Effect of sequencing of complementary feeding in relation to breast-feeding on total intake in infants.

PubMed

Shah, Dheeraj; Singh, Meenakshi; Gupta, Piyush; Faridi, M M A

2014-03-01

The aim of the present study was to evaluate whether the order of complementary feeding in relation to breast-feeding affects breast milk, semisolid, or total energy intake in infants. The present study was designed as a randomized crossover trial. The study was conducted in a tertiary care hospital. The study participants were 25 healthy infants between the ages of 7 and 11 months who were exclusively breast-fed for at least 6 months and were now receiving complementary foods for at least 1 month in addition to breast-feeding. Infants were randomized to follow a sequence of either complementary feeding before breast-feeding (sequence A) or complementary feeding after breast-feeding (sequence B) for the first day (24 hours) of the study period using simple randomization. For the next day, the sequence was reversed for each child. All babies received 3 actively fed complementary food meals per day (morning, afternoon, and evening). A semisolid study diet was prepared in the hospital by cooking rice and pulse with oil using a standard method, ensuring the energy density of at least 0.6 kcal/g. The infants were allowed ad libitum breast-feeding during the observation period. Semisolid intake was directly measured and breast milk intake was quantified by test weighing method. Energy intake from complementary foods was calculated from the product of energy density of the diet served on that day and the total amount consumed. The total energy intake and energy intake from breast milk and complementary foods between the 2 sequences were compared. The mean (standard deviation) energy intake from breast milk during 12 hours of daytime by following sequence A (complementary feeding before breast-feeding) was 132.0 (67.4) kcal in comparison with 135.9 (56.2) kcal in sequence B, which was not statistically different (P = 0.83). The mean (standard deviation) energy consumed from semisolids in sequences A and B was also comparable (88.6 [75.5] kcal vs. 85.5 [89.7] kcal; P = 0.58). The total energy intake during daytime in sequence A was 220.6 (96.2) kcal in comparison with 221.5 (94.0) kcal in sequence B, which was also comparable (P = 0.97). The results related to energy intake through breast milk and total energy intake were not different when insensible losses during feeding were adjusted in both groups. Altering the sequence of complementary feeding in relation to breast-feeding does not affect total energy intake.

The Size of the Internal Loop in DNA Hairpins Influences Their Targeting with Partially Complementary Strands

PubMed Central

2015-01-01

Targeting of noncanonical DNA structures, such as hairpin loops, may have significant diagnostic and therapeutic potential. Oligonucleotides can be used for binding to mRNA, forming a DNA/RNA hybrid duplex that inhibits translation. This kind of modulation of gene expression is called the antisense approach. In order to determine the best strategy to target a common structural motif in mRNA, we have designed a set of stem-loop DNA molecules with sequence: d(GCGCTnGTAAT5GTTACTnGCGC), where n = 1, 3, or 5, “T5” is an end loop of five thymines. We used a combination of calorimetric and spectroscopy techniques to determine the thermodynamics for the reaction of a set of hairpins containing internal loops with their respective partially complementary strands. Our aim was to determine if internal- and end-loops are promising regions for targeting with their corresponding complementary strands. Indeed, all targeting reactions were accompanied by negative changes in free energy, indicating that reactions proceed spontaneously. Further investigation showed that these negative free energy terms result from a net balance of unfavorable entropy and favorable enthalpy contributions. In particular, unfolding of hairpins and duplexes is accompanied by positive changes in heat capacity, which may be a result of exposure of hydrophobic groups to the solvent. This study provides a new method for the targeting of mRNA in order to control gene expression. PMID:25486129

Rational design of micro-RNA-like bifunctional siRNAs targeting HIV and the HIV coreceptor CCR5.

PubMed

Ehsani, Ali; Saetrom, Pål; Zhang, Jane; Alluin, Jessica; Li, Haitang; Snøve, Ola; Aagaard, Lars; Rossi, John J

2010-04-01

Small-interfering RNAs (siRNAs) and micro-RNAs (miRNAs) are distinguished by their modes of action. SiRNAs serve as guides for sequence-specific cleavage of complementary mRNAs and the targets can be in coding or noncoding regions of the target transcripts. MiRNAs inhibit translation via partially complementary base-pairing to 3' untranslated regions (UTRs) and are generally ineffective when targeting coding regions of a transcript. In this study, we deliberately designed siRNAs that simultaneously direct cleavage and translational suppression of HIV RNAs, or cleavage of the mRNA encoding the HIV coreceptor CCR5 and suppression of translation of HIV. These bifunctional siRNAs trigger inhibition of HIV infection and replication in cell culture. The design principles have wide applications throughout the genome, as about 90% of genes harbor sites that make the design of bifunctional siRNAs possible.

Molecular cloning, sequencing, and expression of Eimeria tenella HSP70 partial gene.

PubMed

Bogado, A L G; Martins, G F; Sasse, J P; Guimarães, J da S; Garcia, J L

2017-03-15

Members of the Eimeria genus are protozoan parasites of the subphylum Apicomplexa (Eimeriidae family), and belong to the coccidia group. Eimeria tenella is one of the most pathogenic species owing to its ability to penetrate the mucosa, and cause inflammation and damage. It is an obligate intracellular parasite that causes disease by destroying the host cells during multiplication. Heat shock protein 70 (HSP70) is a molecular chaperone that prevents cellular stress. The objective of this study was to clone, sequence, and express E. tenella HSP70 protein. After selecting the region of highest hydrophilicity in the hsp70 gene, we cloned complementary DNA (cDNA) into a pTrcHis2-TOPO vector and transformed it into TOP10 Escherichia coli cells; after induction, the bacteria expressed a 23-kDa protein with insoluble expression levels of approximately 5 mg/L. In summary, the partial hsp70 gene was successfully expressed in E. coli, producing a 23-kDa protein under insoluble conditions, and the antigen characteristics predicted by hydrophilicity analysis suggest the development of a vaccine for use in avian coccidiosis.

Xenopus laevis ribosomal protein genes: isolation of recombinant cDNA clones and study of the genomic organization.

PubMed Central

Bozzoni, I; Beccari, E; Luo, Z X; Amaldi, F

1981-01-01

Poly-A+ mRNA from Xenopus laevis oocytes, partially enriched for r-protein coding capacity has been used as starting material for preparing a cDNA bank in plasmid pBR322. The clones containing sequences specific for r-proteins have been selected by translation of the complementary mRNAs. Clones for six different r-proteins have been identified and utilized as probes for studying their genomic organization. Two gene copies per haploid genome were found for r-proteins L1, L14, S19, and four-five for protein S1, S8 and L32. Moreover a population polymorphism has been observed for the genomic regions containing sequences for r-protein S1, S8 and L14. Images PMID:6112733

Kit for detecting nucleic acid sequences using competitive hybridization probes

DOEpatents

Lucas, Joe N.; Straume, Tore; Bogen, Kenneth T.

2001-01-01

A kit is provided for detecting a target nucleic acid sequence in a sample, the kit comprising: a first hybridization probe which includes a nucleic acid sequence that is sufficiently complementary to selectively hybridize to a first portion of the target sequence, the first hybridization probe including a first complexing agent for forming a binding pair with a second complexing agent; and a second hybridization probe which includes a nucleic acid sequence that is sufficiently complementary to selectively hybridize to a second portion of the target sequence to which the first hybridization probe does not selectively hybridize, the second hybridization probe including a detectable marker; a third hybridization probe which includes a nucleic acid sequence that is sufficiently complementary to selectively hybridize to a first portion of the target sequence, the third hybridization probe including the same detectable marker as the second hybridization probe; and a fourth hybridization probe which includes a nucleic acid sequence that is sufficiently complementary to selectively hybridize to a second portion of the target sequence to which the third hybridization probe does not selectively hybridize, the fourth hybridization probe including the first complexing agent for forming a binding pair with the second complexing agent; wherein the first and second hybridization probes are capable of simultaneously hybridizing to the target sequence and the third and fourth hybridization probes are capable of simultaneously hybridizing to the target sequence, the detectable marker is not present on the first or fourth hybridization probes and the first, second, third, and fourth hybridization probes each include a competitive nucleic acid sequence which is sufficiently complementary to a third portion of the target sequence that the competitive sequences of the first, second, third, and fourth hybridization probes compete with each other to hybridize to the third portion of the target sequence.

Alterations in the GyrA subunit of DNA gyrase and the ParC subunit of topoisomerase IV in quinolone-resistant clinical isolates of Klebsiella pneumoniae.

PubMed

Deguchi, T; Fukuoka, A; Yasuda, M; Nakano, M; Ozeki, S; Kanematsu, E; Nishino, Y; Ishihara, S; Ban, Y; Kawada, Y

1997-03-01

We determined a partial sequence of the Klebsiella pneumoniae parC gene, including the region analogous to the quinolone resistance-determining region of the Escherichia coli gyrA gene, and examined 26 clinical strains of K. pneumoniae for an association of alterations in GyrA and ParC with susceptibilities to quinolones. The study suggests that in K. pneumoniae DNA gyrase is a primary target of quinolones and that ParC alterations play a complementary role in the development of higher-level fluoroquinolone resistance.

Characterization of rat calcitonin mRNA.

PubMed Central

Amara, S G; David, D N; Rosenfeld, M G; Roos, B A; Evans, R M

1980-01-01

A chimeric plasmic containing cDNA complementary to rat calcitonin mRNA has been constructed. Partial sequence analysis shows that the insert contains a nucleotide sequence encoding the complete amino acid sequence of calcitonin. Two basic amino acids precede and three basic amino acids follow the hormone sequence, suggesting that calcitonin is generated by the proteolytic cleavage of a larger precursor in a manner analogous to that of other small polypeptide hormones. The COOH-terminal proline, known to be amidated in the secreted hormone, is followed by a glycine in the precursor. The cloned calcitonin DNA was used to characterize the expression of calcitonin mRNA. Cytoplasmic mRNAs from calcitonin-producing rat medullary thyroid carcinoma lines and from normal rat thyroid glands contain a single species, 1050 nucleotides long, whch hybridizes to the cloned calcitonin cDNA. The concentration of calcitonin mRNA sequences is greater in those tumors that produce larger amounts of immunoreactive calcitonin. RNAs from other endocrine tissues, including anterior and neurointermediate lobes of rat pituitary, contain no detectable calcitonin mRNA. Images PMID:6933496

Sequence-Selective Formation of Synthetic H-Bonded Duplexes

PubMed Central

2017-01-01

Oligomers equipped with a sequence of phenol and pyridine N-oxide groups form duplexes via H-bonding interactions between these recognition units. Reductive amination chemistry was used to synthesize all possible 3-mer sequences: AAA, AAD, ADA, DAA, ADD, DAD, DDA, and DDD. Pairwise interactions between the oligomers were investigated using NMR titration and dilution experiments in toluene. The measured association constants vary by 3 orders of magnitude (102 to 105 M–1). Antiparallel sequence-complementary oligomers generally form more stable complexes than mismatched duplexes. Mismatched duplexes that have an excess of H-bond donors are stabilized by the interaction of two phenol donors with one pyridine N-oxide acceptor. Oligomers that have a H-bond donor and acceptor on the ends of the chain can fold to form intramolecular H-bonds in the free state. The 1,3-folding equilibrium competes with duplex formation and lowers the stability of duplexes involving these sequences. As a result, some of the mismatch duplexes are more stable than some of the sequence-complementary duplexes. However, the most stable mismatch duplexes contain DDD and compete with the most stable sequence-complementary duplex, AAA·DDD, so in mixtures that contain all eight sequences, sequence-complementary duplexes dominate. Even higher fidelity sequence selectivity can be achieved if alternating donor–acceptor sequences are avoided. PMID:28857551

Allexiviruses may have acquired inserted sequences between the CP and CRP genes to change the translation reinitiation strategy of CRP.

PubMed

Yoshida, Naoto; Shimura, Hanako; Masuta, Chikara

2018-06-01

Allexiviruses are economically important garlic viruses that are involved in garlic mosaic diseases. In this study, we characterized the allexivirus cysteine-rich protein (CRP) gene located just downstream of the coat protein (CP) gene in the viral genome. We determined the nucleotide sequences of the CP and CRP genes from numerous allexivirus isolates and performed a phylogenetic analysis. According to the resulting phylogenetic tree, we found that allexiviruses were clearly divided into two major groups (group I and group II) based on the sequences of the CP and CRP genes. In addition, the allexiviruses in group II had distinct sequences just before the CRP gene, while group I isolates did not. The inserted sequence between the CP and CRP genes was partially complementary to garlic 18S rRNA. Using a potato virus X vector, we showed that the CRPs affected viral accumulation and symptom induction in Nicotiana benthamiana, suggesting that the allexivirus CRP is a pathogenicity determinant. We assume that the inserted sequences before the CRP gene may have been generated during viral evolution to alter the termination-reinitiation mechanism for coupled translation of CP and CRP.

Mapping copy number variation by population-scale genome sequencing.

PubMed

Mills, Ryan E; Walter, Klaudia; Stewart, Chip; Handsaker, Robert E; Chen, Ken; Alkan, Can; Abyzov, Alexej; Yoon, Seungtai Chris; Ye, Kai; Cheetham, R Keira; Chinwalla, Asif; Conrad, Donald F; Fu, Yutao; Grubert, Fabian; Hajirasouliha, Iman; Hormozdiari, Fereydoun; Iakoucheva, Lilia M; Iqbal, Zamin; Kang, Shuli; Kidd, Jeffrey M; Konkel, Miriam K; Korn, Joshua; Khurana, Ekta; Kural, Deniz; Lam, Hugo Y K; Leng, Jing; Li, Ruiqiang; Li, Yingrui; Lin, Chang-Yun; Luo, Ruibang; Mu, Xinmeng Jasmine; Nemesh, James; Peckham, Heather E; Rausch, Tobias; Scally, Aylwyn; Shi, Xinghua; Stromberg, Michael P; Stütz, Adrian M; Urban, Alexander Eckehart; Walker, Jerilyn A; Wu, Jiantao; Zhang, Yujun; Zhang, Zhengdong D; Batzer, Mark A; Ding, Li; Marth, Gabor T; McVean, Gil; Sebat, Jonathan; Snyder, Michael; Wang, Jun; Ye, Kenny; Eichler, Evan E; Gerstein, Mark B; Hurles, Matthew E; Lee, Charles; McCarroll, Steven A; Korbel, Jan O

2011-02-03

Genomic structural variants (SVs) are abundant in humans, differing from other forms of variation in extent, origin and functional impact. Despite progress in SV characterization, the nucleotide resolution architecture of most SVs remains unknown. We constructed a map of unbalanced SVs (that is, copy number variants) based on whole genome DNA sequencing data from 185 human genomes, integrating evidence from complementary SV discovery approaches with extensive experimental validations. Our map encompassed 22,025 deletions and 6,000 additional SVs, including insertions and tandem duplications. Most SVs (53%) were mapped to nucleotide resolution, which facilitated analysing their origin and functional impact. We examined numerous whole and partial gene deletions with a genotyping approach and observed a depletion of gene disruptions amongst high frequency deletions. Furthermore, we observed differences in the size spectra of SVs originating from distinct formation mechanisms, and constructed a map of SV hotspots formed by common mechanisms. Our analytical framework and SV map serves as a resource for sequencing-based association studies.

Chirality- and sequence-selective successive self-sorting via specific homo- and complementary-duplex formations

PubMed Central

Makiguchi, Wataru; Tanabe, Junki; Yamada, Hidekazu; Iida, Hiroki; Taura, Daisuke; Ousaka, Naoki; Yashima, Eiji

2015-01-01

Self-recognition and self-discrimination within complex mixtures are of fundamental importance in biological systems, which entirely rely on the preprogrammed monomer sequences and homochirality of biological macromolecules. Here we report artificial chirality- and sequence-selective successive self-sorting of chiral dimeric strands bearing carboxylic acid or amidine groups joined by chiral amide linkers with different sequences through homo- and complementary-duplex formations. A mixture of carboxylic acid dimers linked by racemic-1,2-cyclohexane bis-amides with different amide sequences (NHCO or CONH) self-associate to form homoduplexes in a completely sequence-selective way, the structures of which are different from each other depending on the linker amide sequences. The further addition of an enantiopure amide-linked amidine dimer to a mixture of the racemic carboxylic acid dimers resulted in the formation of a single optically pure complementary duplex with a 100% diastereoselectivity and complete sequence specificity stabilized by the amidinium–carboxylate salt bridges, leading to the perfect chirality- and sequence-selective duplex formation. PMID:26051291

Arrays of nucleic acid probes on biological chips

DOEpatents

Chee, Mark; Cronin, Maureen T.; Fodor, Stephen P. A.; Huang, Xiaohua X.; Hubbell, Earl A.; Lipshutz, Robert J.; Lobban, Peter E.; Morris, MacDonald S.; Sheldon, Edward L.

1998-11-17

DNA chips containing arrays of oligonucleotide probes can be used to determine whether a target nucleic acid has a nucleotide sequence identical to or different from a specific reference sequence. The array of probes comprises probes exactly complementary to the reference sequence, as well as probes that differ by one or more bases from the exactly complementary probes.

Aptamer based SERS detection of Salmonella typhimurium using DNA-assembled gold nanodimers.

PubMed

Xu, Xumin; Ma, Xiaoyuan; Wang, Haitao; Wang, Zhouping

2018-06-12

The authors describe a surface-enhanced Raman scattering (SERS) based aptasensor for Salmonella typhimurium (S. typhimurium). Gold nanoparticles (AuNPs; 35 nm i.d.) were functionalized with the aptamer (ssDNA 1) and used as the capture probe, while smaller (15 nm) AuNPs were modified with a Cy3-labeled complementary sequence (ssDNA 2) and used as the signalling probe. The asymmetric gold nanodimers (AuNDs) were assemblied with the Raman signal probe and the capture probe via hybridization of the complementary ssDNAs. The gap between two nanoparticles is a "hot spot" in which the Raman reporter Cy3 is localized. It experiences a strong enhancement of the electromagnetic field around the particle. After addition of S. typhimurium, it will be bound by the aptamer which therefore is partially dehybridized from its complementary sequence. Hence, Raman intensity drops. Under the optimal experimental conditions, the SERS signal at 1203 cm -1 increases linearly with the logarithm of the number of colonies in the 10 2 to 10 7  cfu·mL -1 concentration range, and the limit of detection is 35 cfu·mL -1 . The method can be performed within 1 h and was successfully applied to the analysis of spiked milk samples and performed very well and with high specificity. Graphical abstract DNA-assembled asymmetric gold nanodimers (AuNDs) were synthesized and appllied in a SERS-based aptasensor for S. typhimurium. Capture probe was preferentially combined with S. typhimurium and the structure of the AuNDs was destroyed. The "hot spot" vanished partly, this resulting in the decreased Raman intensity of Cy3.

DNA Cloning of Plasmodium falciparum Circumsporozoite Gene: Amino Acid Sequence of Repetitive Epitope

NASA Astrophysics Data System (ADS)

Enea, Vincenzo; Ellis, Joan; Zavala, Fidel; Arnot, David E.; Asavanich, Achara; Masuda, Aoi; Quakyi, Isabella; Nussenzweig, Ruth S.

1984-08-01

A clone of complementary DNA encoding the circumsporozoite (CS) protein of the human malaria parasite Plasmodium falciparum has been isolated by screening an Escherichia coli complementary DNA library with a monoclonal antibody to the CS protein. The DNA sequence of the complementary DNA insert encodes a four-amino acid sequence: proline-asparagine-alanine-asparagine, tandemly repeated 23 times. The CS β -lactamase fusion protein specifically binds monoclonal antibodies to the CS protein and inhibits the binding of these antibodies to native Plasmodium falciparum CS protein. These findings provide a basis for the development of a vaccine against Plasmodium falciparum malaria.

Enzymatic synthesis of long double-stranded DNA labeled with haloderivatives of nucleobases in a precisely pre-determined sequence

PubMed Central

2011-01-01

Background Restriction endonucleases are widely applied in recombinant DNA technology. Among them, enzymes of class IIS, which cleave DNA beyond recognition sites, are especially useful. We use BsaI enzyme for the pinpoint introduction of halogen nucleobases into DNA. This has been done for the purpose of anticancer radio- and phototherapy that is our long-term objective. Results An enzymatic method for synthesizing long double-stranded DNA labeled with the halogen derivatives of nucleobases (Hal-NBs) with 1-bp accuracy has been put forward and successfully tested on three different DNA fragments containing the 5-bromouracil (5-BrU) residue. The protocol assumes enzymatic cleavage of two Polymerase-Chain-Reaction (PCR) fragments containing two recognition sequences for the same or different class IIS restriction endonucleases, where each PCR fragment has a partially complementary cleavage site. These sites are introduced using synthetic DNA primers or are naturally present in the sequence used. The cleavage sites are not compatible, and therefore not susceptible to ligation until they are partially filled with a Hal-NB or original nucleobase, resulting in complementary cohesive end formation. Ligation of these fragments ultimately leads to the required Hal-NB-labeled DNA duplex. With this approach, a synthetic, extremely long DNA fragment can be obtained by means of a multiple assembly reaction (n × maximum PCR product length: n × app. 50 kb). Conclusions The long, precisely labeled DNA duplexes obtained behave in very much the same manner as natural DNA and are beyond the range of chemical synthesis. Moreover, the conditions of synthesis closely resemble the natural ones, and all the artifacts accompanying the chemical synthesis of DNA are thus eliminated. The approach proposed seems to be completely general and could be used to label DNA at multiple pre-determined sites and with halogen derivatives of any nucleobase. Access to DNAs labeled with Hal-NBs at specific position is an indispensable condition for the understanding and optimization of DNA photo- and radio-degradation, which are prerequisites for clinical trials of Hal-NBs in anticancer therapy. PMID:21864341

Enzymatic synthesis of long double-stranded DNA labeled with haloderivatives of nucleobases in a precisely pre-determined sequence.

PubMed

Sobolewski, Ireneusz; Polska, Katarzyna; Zylicz-Stachula, Agnieszka; Jeżewska-Frąckowiak, Joanna; Rak, Janusz; Skowron, Piotr

2011-08-24

Restriction endonucleases are widely applied in recombinant DNA technology. Among them, enzymes of class IIS, which cleave DNA beyond recognition sites, are especially useful. We use BsaI enzyme for the pinpoint introduction of halogen nucleobases into DNA. This has been done for the purpose of anticancer radio- and phototherapy that is our long-term objective. An enzymatic method for synthesizing long double-stranded DNA labeled with the halogen derivatives of nucleobases (Hal-NBs) with 1-bp accuracy has been put forward and successfully tested on three different DNA fragments containing the 5-bromouracil (5-BrU) residue. The protocol assumes enzymatic cleavage of two Polymerase-Chain-Reaction (PCR) fragments containing two recognition sequences for the same or different class IIS restriction endonucleases, where each PCR fragment has a partially complementary cleavage site. These sites are introduced using synthetic DNA primers or are naturally present in the sequence used. The cleavage sites are not compatible, and therefore not susceptible to ligation until they are partially filled with a Hal-NB or original nucleobase, resulting in complementary cohesive end formation. Ligation of these fragments ultimately leads to the required Hal-NB-labeled DNA duplex. With this approach, a synthetic, extremely long DNA fragment can be obtained by means of a multiple assembly reaction (n × maximum PCR product length: n × app. 50 kb). The long, precisely labeled DNA duplexes obtained behave in very much the same manner as natural DNA and are beyond the range of chemical synthesis. Moreover, the conditions of synthesis closely resemble the natural ones, and all the artifacts accompanying the chemical synthesis of DNA are thus eliminated. The approach proposed seems to be completely general and could be used to label DNA at multiple pre-determined sites and with halogen derivatives of any nucleobase. Access to DNAs labeled with Hal-NBs at specific position is an indispensable condition for the understanding and optimization of DNA photo- and radio-degradation, which are prerequisites for clinical trials of Hal-NBs in anticancer therapy.

Preparation of highly multiplexed small RNA sequencing libraries.

PubMed

Persson, Helena; Søkilde, Rolf; Pirona, Anna Chiara; Rovira, Carlos

2017-08-01

MicroRNAs (miRNAs) are ~22-nucleotide-long small non-coding RNAs that regulate the expression of protein-coding genes by base pairing to partially complementary target sites, preferentially located in the 3´ untranslated region (UTR) of target mRNAs. The expression and function of miRNAs have been extensively studied in human disease, as well as the possibility of using these molecules as biomarkers for prognostication and treatment guidance. To identify and validate miRNAs as biomarkers, their expression must be screened in large collections of patient samples. Here, we develop a scalable protocol for the rapid and economical preparation of a large number of small RNA sequencing libraries using dual indexing for multiplexing. Combined with the use of off-the-shelf reagents, more samples can be sequenced simultaneously on large-scale sequencing platforms at a considerably lower cost per sample. Sample preparation is simplified by pooling libraries prior to gel purification, which allows for the selection of a narrow size range while minimizing sample variation. A comparison with publicly available data from benchmarking of miRNA analysis platforms showed that this method captures absolute and differential expression as effectively as commercially available alternatives.

Biosensors based on directed assembly of particles

DOEpatents

Lu, Yi [Champaign, IL; Liu, Juewen [Urbana, IL

2009-02-03

A sensor system for detecting an effector or cofactor comprises (a) a nucleic acid enzyme; (b) a substrate for the nucleic acid enzyme, comprising a first polynucleotide; (c) a first set of particles comprising a second polynucleotide at least partially complementary to the substrate, where the polynucleotide is attached to the particles at its 3' terminus; and (d) a second set of particles comprising a third polynucleotide at least partially complementary to the substrate, where the polynucleotide is attached to the particles at its 5' terminus.

Species-specific identification of Dekkera/Brettanomyces yeasts by fluorescently labeled DNA probes targeting the 26S rRNA.

PubMed

Röder, Christoph; König, Helmut; Fröhlich, Jürgen

2007-09-01

Sequencing of the complete 26S rRNA genes of all Dekkera/Brettanomyces species colonizing different beverages revealed the potential for a specific primer and probe design to support diagnostic PCR approaches and FISH. By analysis of the complete 26S rRNA genes of all five currently known Dekkera/Brettanomyces species (Dekkera bruxellensis, D. anomala, Brettanomyces custersianus, B. nanus and B. naardenensis), several regions with high nucleotide sequence variability yet distinct from the D1/D2 domains were identified. FISH species-specific probes targeting the 26S rRNA gene's most variable regions were designed. Accessibility of probe targets for hybridization was facilitated by the construction of partially complementary 'side'-labeled probes, based on secondary structure models of the rRNA sequences. The specificity and routine applicability of the FISH-based method for yeast identification were tested by analyzing different wine isolates. Investigation of the prevalence of Dekkera/Brettanomyces yeasts in the German viticultural regions Wonnegau, Nierstein and Bingen (Rhinehesse, Rhineland-Palatinate) resulted in the isolation of 37 D. bruxellensis strains from 291 wine samples.

GRIL-seq provides a method for identifying direct targets of bacterial small regulatory RNA by in vivo proximity ligation.

PubMed

Han, Kook; Tjaden, Brian; Lory, Stephen

2016-12-22

The first step in the post-transcriptional regulatory function of most bacterial small non-coding RNAs (sRNAs) is base pairing with partially complementary sequences of targeted transcripts. We present a simple method for identifying sRNA targets in vivo and defining processing sites of the regulated transcripts. The technique, referred to as global small non-coding RNA target identification by ligation and sequencing (GRIL-seq), is based on preferential ligation of sRNAs to the ends of base-paired targets in bacteria co-expressing T4 RNA ligase, followed by sequencing to identify the chimaeras. In addition to the RNA chaperone Hfq, the GRIL-seq method depends on the activity of the pyrophosphorylase RppH. Using PrrF1, an iron-regulated sRNA in Pseudomonas aeruginosa, we demonstrated that direct regulatory targets of this sRNA can readily be identified. Therefore, GRIL-seq represents a powerful tool not only for identifying direct targets of sRNAs in a variety of environments, but also for uncovering novel roles for sRNAs and their targets in complex regulatory networks.

Inferring microRNA regulation of mRNA with partially ordered samples of paired expression data and exogenous prediction algorithms.

PubMed

Godsey, Brian; Heiser, Diane; Civin, Curt

2012-01-01

MicroRNAs (miRs) are known to play an important role in mRNA regulation, often by binding to complementary sequences in "target" mRNAs. Recently, several methods have been developed by which existing sequence-based target predictions can be combined with miR and mRNA expression data to infer true miR-mRNA targeting relationships. It has been shown that the combination of these two approaches gives more reliable results than either by itself. While a few such algorithms give excellent results, none fully addresses expression data sets with a natural ordering of the samples. If the samples in an experiment can be ordered or partially ordered by their expected similarity to one another, such as for time-series or studies of development processes, stages, or types, (e.g. cell type, disease, growth, aging), there are unique opportunities to infer miR-mRNA interactions that may be specific to the underlying processes, and existing methods do not exploit this. We propose an algorithm which specifically addresses [partially] ordered expression data and takes advantage of sample similarities based on the ordering structure. This is done within a Bayesian framework which specifies posterior distributions and therefore statistical significance for each model parameter and latent variable. We apply our model to a previously published expression data set of paired miR and mRNA arrays in five partially ordered conditions, with biological replicates, related to multiple myeloma, and we show how considering potential orderings can improve the inference of miR-mRNA interactions, as measured by existing knowledge about the involved transcripts.

Rapid and specific purification of Argonaute-small RNA complexes from crude cell lysates

PubMed Central

Flores-Jasso, C. Fabián; Salomon, William E.; Zamore, Phillip D.

2013-01-01

Small interfering RNAs (siRNAs) direct Argonaute proteins, the core components of the RNA-induced silencing complex (RISC), to cleave complementary target RNAs. Here, we describe a method to purify active RISC containing a single, unique small RNA guide sequence. We begin by capturing RISC using a complementary 2′-O-methyl oligonucleotide tethered to beads. Unlike other methods that capture RISC but do not allow its recovery, our strategy purifies active, soluble RISC in good yield. The method takes advantage of the finding that RISC partially paired to a target through its siRNA guide dissociates more than 300 times faster than a fully paired siRNA in RISC. We use this strategy to purify fly Ago1- and Ago2-RISC, as well as mouse AGO2-RISC. The method can discriminate among RISCs programmed with different guide strands, making it possible to deplete and recover specific RISC populations. Endogenous microRNA:Argonaute complexes can also be purified from cell lysates. Our method scales readily and takes less than a day to complete. PMID:23249751

Rapid and specific purification of Argonaute-small RNA complexes from crude cell lysates.

PubMed

Flores-Jasso, C Fabián; Salomon, William E; Zamore, Phillip D

2013-02-01

Small interfering RNAs (siRNAs) direct Argonaute proteins, the core components of the RNA-induced silencing complex (RISC), to cleave complementary target RNAs. Here, we describe a method to purify active RISC containing a single, unique small RNA guide sequence. We begin by capturing RISC using a complementary 2'-O-methyl oligonucleotide tethered to beads. Unlike other methods that capture RISC but do not allow its recovery, our strategy purifies active, soluble RISC in good yield. The method takes advantage of the finding that RISC partially paired to a target through its siRNA guide dissociates more than 300 times faster than a fully paired siRNA in RISC. We use this strategy to purify fly Ago1- and Ago2-RISC, as well as mouse AGO2-RISC. The method can discriminate among RISCs programmed with different guide strands, making it possible to deplete and recover specific RISC populations. Endogenous microRNA:Argonaute complexes can also be purified from cell lysates. Our method scales readily and takes less than a day to complete.

Hardware Acceleration Of Multi-Deme Genetic Algorithm for DNA Codeword Searching

DTIC Science & Technology

2008-01-01

C and G are complementary to each other. A Watson - Crick complement of a DNA sequence is another DNA sequence which replaces all the A with T or vise...versa and replaces all the T with A or vise versa, and also switches the 5’ and 3’ ends. A DNA sequence binds most stably with its Watson - Crick ...bind with 5 Watson - Crick pairs. The length of the longest complementary sequence between two flexible DNA strands, A and B, is the same as the

Complementary and alternative medicine used by persons with functional gastrointestinal disorders to alleviate symptom distress.

PubMed

Stake-Nilsson, Kerstin; Hultcrantz, Rolf; Unge, Peter; Wengström, Yvonne

2012-03-01

The aim of this study was to describe the complementary and alternative medicine methods most commonly used to alleviate symptom distress in persons with functional gastrointestinal disorders. People with functional gastrointestinal disorders face many challenges in their everyday lives, and each individual has his/her own way of dealing with this illness. The experience of illness often leads persons with functional gastrointestinal disorders to complementary and alternative medicine as a viable healthcare choice. Quantitative and describing design. A study-specific complementary and alternative medicine questionnaire was used, including questions about complementary and alternative medicine methods used and the perceived effects of each method. Efficacy assessments for each method were preventive effect, partial symptom relief, total symptom relief or no effect. A total of 137 persons with functional gastrointestinal disorders answered the questionnaire, 62% (n = 85) women and 38% (n = 52) men. A total of 28 different complementary and alternative medicine methods were identified and grouped into four categories: nutritional, drug/biological, psychological activity and physical activity. All persons had tried at least one method, and most methods provided partial symptom relief. Persons with functional gastrointestinal disorders commonly use complementary and alternative medicine methods to alleviate symptoms. Nurses have a unique opportunity to expand their roles in this group of patients. Increased knowledge of complementary and alternative medicine practices would enable a more comprehensive patient assessment and a better plan for meaningful interventions that meet the needs of individual patients. © 2011 Blackwell Publishing Ltd.

Increased complexity of circRNA expression during species evolution.

PubMed

Dong, Rui; Ma, Xu-Kai; Chen, Ling-Ling; Yang, Li

2017-08-03

Circular RNAs (circRNAs) are broadly identified from precursor mRNA (pre-mRNA) back-splicing across various species. Recent studies have suggested a cell-/tissue- specific manner of circRNA expression. However, the distinct expression pattern of circRNAs among species and its underlying mechanism still remain to be explored. Here, we systematically compared circRNA expression from human and mouse, and found that only a small portion of human circRNAs could be determined in parallel mouse samples. The conserved circRNA expression between human and mouse is correlated with the existence of orientation-opposite complementary sequences in introns that flank back-spliced exons in both species, but not the circRNA sequences themselves. Quantification of RNA pairing capacity of orientation-opposite complementary sequences across circRNA-flanking introns by Complementary Sequence Index (CSI) identifies that among all types of complementary sequences, SINEs, especially Alu elements in human, contribute the most for circRNA formation and that their diverse distribution across species leads to the increased complexity of circRNA expression during species evolution. Together, our integrated and comparative reference catalog of circRNAs in different species reveals a species-specific pattern of circRNA expression and suggests a previously under-appreciated impact of fast-evolved SINEs on the regulation of (circRNA) gene expression.

Hierarchical assembly of viral nanotemplates with encoded microparticles via nucleic acid hybridization.

PubMed

Tan, Wui Siew; Lewis, Christina L; Horelik, Nicholas E; Pregibon, Daniel C; Doyle, Patrick S; Yi, Hyunmin

2008-11-04

We demonstrate hierarchical assembly of tobacco mosaic virus (TMV)-based nanotemplates with hydrogel-based encoded microparticles via nucleic acid hybridization. TMV nanotemplates possess a highly defined structure and a genetically engineered high density thiol functionality. The encoded microparticles are produced in a high throughput microfluidic device via stop-flow lithography (SFL) and consist of spatially discrete regions containing encoded identity information, an internal control, and capture DNAs. For the hybridization-based assembly, partially disassembled TMVs were programmed with linker DNAs that contain sequences complementary to both the virus 5' end and a selected capture DNA. Fluorescence microscopy, atomic force microscopy (AFM), and confocal microscopy results clearly indicate facile assembly of TMV nanotemplates onto microparticles with high spatial and sequence selectivity. We anticipate that our hybridization-based assembly strategy could be employed to create multifunctional viral-synthetic hybrid materials in a rapid and high-throughput manner. Additionally, we believe that these viral-synthetic hybrid microparticles may find broad applications in high capacity, multiplexed target sensing.

Herpesvirus papio: state and properties of intracellular viral DNA in baboon lymphoblastoid cell lines.

PubMed

Falk, L; Lindahl, T; Bjursell, G; Klein, G

1979-07-15

Herpesvirus papio (HVP) is an indigenous B-lymphotropic virus of baboons (Papio sp.) present in latent form in baboon lymphoblastoid cell lines. It shares cross-reacting viral capsid and early antigens with the Epstein-Barr virus (EBV), and HVP DNA and EBV DNA show partial sequence homology. EBV-specific complementary RNA was employed here as a probe to investigate the physical state of the HVP DNA component in baboon lymphoblastoid cells after fractionation of cellular DNA by density gradient centrifugation. Five virus-producing cultures contained both free and integrated HVP DNA sequences while one non-producing cell line had two or three viral genome equivalents per cell in an apparently integrated form. Further analysis of one virus-producing line showed that the free HVP DNA fraction was composed of both linear and circular viral DNA. Contour length measurements of HVP circular DNA molecules by electron microscopy revealed that they were similar in length to the EBV circular DNA present in human lymphoblastoid cells.

Using complementary DNA from MyoD-transduced fibroblasts to sequence large muscle genes.

PubMed

Waddell, Leigh B; Monnier, Nicole; Cooper, Sandra T; North, Kathryn N; Clarke, Nigel F

2011-08-01

Large muscle genes are often sequenced using complementary DNA (cDNA) made from muscle messenger RNA (mRNA) to reduce the cost and workload associated with sequencing from genomic DNA. Two potential barriers are the availability of a frozen muscle biopsy, and difficulties in detecting nonsense mutations due to nonsense-mediated mRNA decay (NMD). We present patient examples showing that use of MyoD-transduced fibroblasts as a source of muscle-specific mRNA overcomes these potential difficulties in sequencing large muscle-related genes. Copyright © 2011 Wiley Periodicals, Inc.

Zepto-molar electrochemical detection of Brucella genome based on gold nanoribbons covered by gold nanoblooms

NASA Astrophysics Data System (ADS)

Rahi, Amid; Sattarahmady, Naghmeh; Heli, Hossein

2015-12-01

Gold nanoribbons covered by gold nanoblooms were sonoelectrodeposited on a polycrystalline gold surface at -1800 mV (vs. AgCl) with the assistance of ultrasound and co-occurrence of the hydrogen evolution reaction. The nanostructure, as a transducer, was utilized to immobilize a Brucella-specific probe and fabrication of a genosensor, and the process of immobilization and hybridization was detected by electrochemical methods, using methylene blue as a redox marker. The proposed method for detection of the complementary sequence, sequences with base-mismatched (one-, two- and three-base mismatches), and the sequence of non-complementary sequence was assayed. The fabricated genosensor was evaluated for the assay of the bacteria in the cultured and human samples without polymerase chain reactions (PCR). The genosensor could detect the complementary sequence with a calibration sensitivity of 0.40 μA dm3 mol-1, a linear concentration range of 10 zmol dm-3 to 10 pmol dm-3, and a detection limit of 1.71 zmol dm-3.

Nucleotide Sequence Analysis of RNA Synthesized from Rabbit Globin Complementary DNA

PubMed Central

Poon, Raymond; Paddock, Gary V.; Heindell, Howard; Whitcome, Philip; Salser, Winston; Kacian, Dan; Bank, Arthur; Gambino, Roberto; Ramirez, Francesco

1974-01-01

Rabbit globin complementary DNA made with RNA-dependent DNA polymerase (reverse transcriptase) was used as template for in vitro synthesis of 32P-labeled RNA. The sequences of the nucleotides in most of the fragments resulting from combined ribonuclease T1 and alkaline phosphatase digestion have been determined. Several fragments were long enough to fit uniquely with the α or β globin amino-acid sequences. These data demonstrate that the cDNA was copied from globin mRNA and contained no detectable contaminants. Images PMID:4139714

Cadmium sulfide nanocluster-based electrochemical stripping detection of DNA hybridization.

PubMed

Zhu, Ningning; Zhang, Aiping; He, Pingang; Fang, Yuzhi

2003-03-01

A novel, sensitive electrochemical DNA hybridization detection assay, using cadmium sulfide (CdS) nanoclusters as the oligonucleotide labeling tag, is described. The assay relies on the hybridization of the target DNA with the CdS nanocluster oligonucleotide DNA probe, followed by the dissolution of the CdS nanoclusters anchored on the hybrids and the indirect determination of the dissolved cadmium ions by sensitive anodic stripping voltammetry (ASV) at a mercury-coated glassy carbon electrode (GCE). The results showed that only a complementary sequence could form a double-stranded dsDNA-CdS with the DNA probe and give an obvious electrochemical response. A three-base mismatch sequence and non-complementary sequence had negligible response. The combination of the large number of cadmium ions released from each dsDNA hybrid with the remarkable sensitivity of the electrochemical stripping analysis for cadmium at mercury-film GCE allows detection at levels as low as 0.2 pmol L(-1) of the complementary sequence of DNA.

Hairpin Bisulfite Sequencing: Synchronous Methylation Analysis on Complementary DNA Strands of Individual Chromosomes.

PubMed

Giehr, Pascal; Walter, Jörn

2018-01-01

The accurate and quantitative detection of 5-methylcytosine is of great importance in the field of epigenetics. The method of choice is usually bisulfite sequencing because of the high resolution and the possibility to combine it with next generation sequencing. Nevertheless, also this method has its limitations. Following the bisulfite treatment DNA strands are no longer complementary such that in a subsequent PCR amplification the DNA methylation patterns information of only one of the two DNA strand is preserved. Several years ago Hairpin Bisulfite sequencing was developed as a method to obtain the pattern information on complementary DNA strands. The method requires fragmentation (usually by enzymatic cleavage) of genomic DNA followed by a covalent linking of both DNA strands through ligation of a short DNA hairpin oligonucleotide to both strands. The ligated covalently linked dsDNA products are then subjected to a conventional bisulfite treatment during which all unmodified cytosines are converted to uracils. During the treatment the DNA is denatured forming noncomplementary ssDNA circles. These circles serve as a template for a locus specific PCR to amplify chromosomal patterns of the region of interest. As a result one ends up with a linearized product, which contains the methylation information of both complementary DNA strands.

A novel self-powered and sensitive label-free DNA biosensor in microbial fuel cell.

PubMed

Asghary, Maryam; Raoof, Jahan Bakhsh; Rahimnejad, Mostafa; Ojani, Reza

2016-08-15

In this work, a novel self-powered, sensitive, low-cost, and label-free DNA biosensor is reported by applying a two-chambered microbial fuel cell (MFC) as a power supply. A graphite electrode and an Au nanoparticles modified graphite electrode (AuNP/graphite electrode) were used as anode and cathode in the MFC system, respectively. The active biocatalyst in the anodic chamber was a mixed culture of microorganisms. The sensing element of the biosensor was fabricated by the well-known Au-thiol binding the ssDNA probe on the surface of an AuNP/graphite cathode. Electrons produced by microorganisms were transported from the anode to the cathode through an external circuit, which could be detected by the terminal multi-meter detector. The difference between power densities of the ssDNA probe modified cathode in the absence and presence of complementary sequence served as the detection signal of the DNA hybridization with detection limit of 3.1nM. Thereafter, this biosensor was employed for diagnosis and determination of complementary sequence in a human serum sample. The hybridization specificity studies further revealed that the developed DNA biosensor could distinguish fully complementary sequences from one-base mismatched and non-complementary sequences. Copyright © 2016 Elsevier B.V. All rights reserved.

PAPR reduction in CO-OFDM systems using IPTS and modified clipping and filtering

NASA Astrophysics Data System (ADS)

Tong, Zheng-rong; Hu, Ya-nong; Zhang, Wei-hua

2018-05-01

Aiming at the problem of the peak to average power ratio ( PAPR) in coherent optical orthogonal frequency division multiplexing (CO-OFDM), a hybrid PAPR reduction technique of the CO-OFDM system by combining iterative partial transmit sequence (IPTS) scheme with modified clipping and filtering (MCF) is proposed. The simulation results show that at the complementary cumulative distribution function ( CCDF) of 10-4, the PAPR of proposed scheme is optimized by 1.86 dB and 2.13 dB compared with those of IPTS and CF schemes, respectively. Meanwhile, when the bit error rate ( BER) is 10-3, the optical signal to noise ratio ( OSNR) are optimized by 1.57 dB and 0.66 dB compared with those of CF and IPTS-CF schemes, respectively.

Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

PubMed

Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

1988-02-01

Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators.

Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

PubMed Central

Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

1988-01-01

Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators. Images PMID:3257578

Cloning and sequence analysis of complementary DNA encoding an aberrantly rearranged human T-cell gamma chain.

PubMed Central

Dialynas, D P; Murre, C; Quertermous, T; Boss, J M; Leiden, J M; Seidman, J G; Strominger, J L

1986-01-01

Complementary DNA (cDNA) encoding a human T-cell gamma chain has been cloned and sequenced. At the junction of the variable and joining regions, there is an apparent deletion of two nucleotides in the human cDNA sequence relative to the murine gamma-chain cDNA sequence, resulting simultaneously in the generation of an in-frame stop codon and in a translational frameshift. For this reason, the sequence presented here encodes an aberrantly rearranged human T-cell gamma chain. There are several surprising differences between the deduced human and murine gamma-chain amino acid sequences. These include poor homology in the variable region, poor homology in a discrete segment of the constant region precisely bounded by the expected junctions of exon CII, and the presence in the human sequence of five potential sites for N-linked glycosylation. Images PMID:3458221

Nucleotide sequence of a complementary DNA encoding pea cytosolic copper/zinc superoxide dismutase. [Pisum sativum L

DOE Office of Scientific and Technical Information (OSTI.GOV)

White, D.A.; Zilinskas, B.A.

1991-08-01

The authors now report the nucleotide sequence of the cytosolic Cu/Zn SOD cloned from a {lambda}gt11 cDNA library constructed from mRNA extracted from leaves of 7- to 10-d pea seedlings (Pisum sativum L.). The clone was isolated using a 22-base synthetic oligonucleotide complementary to the amino acid sequence CGIIGLQG. This sequence, found at the protein's carboxy terminus, is highly conserved among plant cytosolic Cu/Zn SODs but not chloroplastic Cu/Zn SODs. The 738-base pair sequence contains an open reading frame specifying 152 codons and a predicted M{sub r} of 18,024 D. The deduced amino acid sequence is highly homologous (79-82% identity)more » with the sequences of other known plant cytosolic Cu/Zn SODs but less highly conserved (63-65%) when compared with several chloroplastic Cu/Zn SODs including pea (10).« less

Nature and distribution of feline sarcoma virus nucleotide sequences.

PubMed Central

Frankel, A E; Gilbert, J H; Porzig, K J; Scolnick, E M; Aaronson, S A

1979-01-01

The genomes of three independent isolates of feline sarcoma virus (FeSV) were compared by molecular hybridization techniques. Using complementary DNAs prepared from two strains, SM- and ST-FeSV, common complementary DNA'S were selected by sequential hybridization to FeSV and feline leukemia virus RNAs. These DNAs were shown to be highly related among the three independent sarcoma virus isolates. FeSV-specific complementary DNAs were prepared by selection for hybridization by the homologous FeSV RNA and against hybridization by fline leukemia virus RNA. Sarcoma virus-specific sequences of SM-FeSV were shown to differ from those of either ST- or GA-FeSV strains, whereas ST-FeSV-specific DNA shared extensive sequence homology with GA-FeSV. By molecular hybridization, each set of FeSV-specific sequences was demonstrated to be present in normal cat cellular DNA in approximately one copy per haploid genome and was conserved throughout Felidae. In contrast, FeSV-common sequences were present in multiple DNA copies and were found only in Mediterranean cats. The present results are consistent with the concept that each FeSV strain has arisen by a mechanism involving recombination between feline leukemia virus and cat cellular DNA sequences, the latter represented within the cat genome in a manner analogous to that of a cellular gene. PMID:225544

SSU rDNA divergence in planktonic foraminifera: molecular taxonomy and biogeographic implications.

PubMed

André, Aurore; Quillévéré, Frédéric; Morard, Raphaël; Ujiié, Yurika; Escarguel, Gilles; de Vargas, Colomban; de Garidel-Thoron, Thibault; Douady, Christophe J

2014-01-01

The use of planktonic foraminifera in paleoceanography requires taxonomic consistency and precise assessment of the species biogeography. Yet, ribosomal small subunit (SSUr) DNA analyses have revealed that most of the modern morpho-species of planktonic foraminifera are composed of a complex of several distinct genetic types that may correspond to cryptic or pseudo-cryptic species. These genetic types are usually delimitated using partial sequences located at the 3'end of the SSUrDNA, but typically based on empirical delimitation. Here, we first use patristic genetic distances calculated within and among genetic types of the most common morpho-species to show that intra-type and inter-type genetic distances within morpho-species may significantly overlap, suggesting that genetic types have been sometimes inconsistently defined. We further apply two quantitative and independent methods, ABGD (Automatic Barcode Gap Detection) and GMYC (General Mixed Yule Coalescent) to a dataset of published and newly obtained partial SSU rDNA for a more objective assessment of the species status of these genetic types. Results of these complementary approaches are highly congruent and lead to a molecular taxonomy that ranks 49 genetic types of planktonic foraminifera as genuine (pseudo)cryptic species. Our results advocate for a standardized sequencing procedure allowing homogenous delimitations of (pseudo)cryptic species. On the ground of this revised taxonomic framework, we finally provide an integrative taxonomy synthesizing geographic, ecological and morphological differentiations that can occur among the genuine (pseudo)cryptic species. Due to molecular, environmental or morphological data scarcities, many aspects of our proposed integrative taxonomy are not yet fully resolved. On the other hand, our study opens up the potential for a correct interpretation of environmental sequence datasets.

SSU rDNA Divergence in Planktonic Foraminifera: Molecular Taxonomy and Biogeographic Implications

PubMed Central

André, Aurore; Quillévéré, Frédéric; Morard, Raphaël; Ujiié, Yurika; Escarguel, Gilles; de Vargas, Colomban; de Garidel-Thoron, Thibault; Douady, Christophe J.

2014-01-01

The use of planktonic foraminifera in paleoceanography requires taxonomic consistency and precise assessment of the species biogeography. Yet, ribosomal small subunit (SSUr) DNA analyses have revealed that most of the modern morpho-species of planktonic foraminifera are composed of a complex of several distinct genetic types that may correspond to cryptic or pseudo-cryptic species. These genetic types are usually delimitated using partial sequences located at the 3′end of the SSUrDNA, but typically based on empirical delimitation. Here, we first use patristic genetic distances calculated within and among genetic types of the most common morpho-species to show that intra-type and inter-type genetic distances within morpho-species may significantly overlap, suggesting that genetic types have been sometimes inconsistently defined. We further apply two quantitative and independent methods, ABGD (Automatic Barcode Gap Detection) and GMYC (General Mixed Yule Coalescent) to a dataset of published and newly obtained partial SSU rDNA for a more objective assessment of the species status of these genetic types. Results of these complementary approaches are highly congruent and lead to a molecular taxonomy that ranks 49 genetic types of planktonic foraminifera as genuine (pseudo)cryptic species. Our results advocate for a standardized sequencing procedure allowing homogenous delimitations of (pseudo)cryptic species. On the ground of this revised taxonomic framework, we finally provide an integrative taxonomy synthesizing geographic, ecological and morphological differentiations that can occur among the genuine (pseudo)cryptic species. Due to molecular, environmental or morphological data scarcities, many aspects of our proposed integrative taxonomy are not yet fully resolved. On the other hand, our study opens up the potential for a correct interpretation of environmental sequence datasets. PMID:25119900

Staufen-mediated mRNA decay

PubMed Central

Park, Eonyoung; Maquat, Lynne E.

2013-01-01

Staufen1 (STAU1)-mediated mRNA decay (SMD) is an mRNA degradation process in mammalian cells that is mediated by the binding of STAU1 to a STAU1-binding site (SBS) within the 3'-untranslated region (3'UTR) of target mRNAs. During SMD, STAU1, a double-stranded (ds) RNA-binding protein, recognizes dsRNA structures formed either by intramolecular base-pairing of 3'UTR sequences or by intermolecular base-pairing of 3'UTR sequences with a long noncoding RNA (lncRNA) via partially complementary Alu elements. Recently, STAU2, a paralog of STAU1, has also been reported to mediate SMD. Both STAU1 and STAU2 interact directly with the ATP-dependent RNA helicase UPF1, a key SMD factor, enhancing its helicase activity to promote effective SMD. Moreover, STAU1 and STAU2 form homodimeric and heterodimeric interactions via domain-swapping. Since both SMD and the mechanistically related nonsense-mediated mRNA decay (NMD) employ UPF1, SMD and NMD are competitive pathways. Competition contributes to cellular differentiation processes, such as myogenesis and adipogenesis, placing SMD at the heart of various physiologically important mechanisms. PMID:23681777

GRIL-Seq, a method for identifying direct targets of bacterial small regulatory RNA by in vivo proximity ligation

PubMed Central

Han, Kook; Tjaden, Brian; Lory, Stephen

2017-01-01

The first step in the post-transcriptional regulatory function of most bacterial small non-coding RNAs (sRNAs) is base-pairing with partially complementary sequences of targeted transcripts. We present a simple method for identifying sRNA targets in vivo and defining processing sites of the regulated transcripts. The technique (referred to as GRIL-Seq) is based on preferential ligation of sRNAs to ends of base-paired targets in bacteria co-expressing T4 RNA ligase, followed by sequencing to identify the chimeras. In addition to the RNA chaperone Hfq, the GRIL-Seq method depends on the activity of the pyrophosphorylase RppH. Using PrrF1, an iron-regulated sRNA in Pseudomonas aeruginosa, we demonstrate that direct regulatory targets of this sRNA can be readily identified. Therefore, GRIL-Seq represents a powerful tool not only for identifying direct targets of sRNAs in a variety of environments, but can also result in uncovering novel roles for sRNAs and their targets in complex regulatory networks. PMID:28005055

Identification and Characterization of a Cis-Encoded Antisense RNA Associated with the Replication Process of Salmonella enterica Serovar Typhi

PubMed Central

Dadzie, Isaac; Xu, Shungao; Ni, Bin; Zhang, Xiaolei; Zhang, Haifang; Sheng, Xiumei; Xu, Huaxi; Huang, Xinxiang

2013-01-01

Antisense RNAs that originate from the complementary strand of protein coding genes are involved in the regulation of gene expression in all domains of life. In bacteria, some of these antisense RNAs are transcriptional noise whiles others play a vital role to adapt the cell to changing environmental conditions. By deep sequencing analysis of transcriptome of Salmonella enterica serovar Typhi, a partial RNA sequence encoded in-cis to the dnaA gene was revealed. Northern blot and RACE analysis confirmed the transcription of this antisense RNA which was expressed mostly in the stationary phase of the bacterial growth and also under iron limitation and osmotic stress. Pulse expression analysis showed that overexpression of the antisense RNA resulted in a significant increase in the mRNA levels of dnaA, which will ultimately enhance their translation. Our findings have revealed that antisense RNA of dnaA is indeed transcribed not merely as a by-product of the cell's transcription machinery but plays a vital role as far as stability of dnaA mRNA is concerned. PMID:23637809

Transcriptome analysis by strand-specific sequencing of complementary DNA

PubMed Central

Parkhomchuk, Dmitri; Borodina, Tatiana; Amstislavskiy, Vyacheslav; Banaru, Maria; Hallen, Linda; Krobitsch, Sylvia; Lehrach, Hans; Soldatov, Alexey

2009-01-01

High-throughput complementary DNA sequencing (RNA-Seq) is a powerful tool for whole-transcriptome analysis, supplying information about a transcript's expression level and structure. However, it is difficult to determine the polarity of transcripts, and therefore identify which strand is transcribed. Here, we present a simple cDNA sequencing protocol that preserves information about a transcript's direction. Using Saccharomyces cerevisiae and mouse brain transcriptomes as models, we demonstrate that knowing the transcript's orientation allows more accurate determination of the structure and expression of genes. It also helps to identify new genes and enables studying promoter-associated and antisense transcription. The transcriptional landscapes we obtained are available online. PMID:19620212

Transcriptome analysis by strand-specific sequencing of complementary DNA.

PubMed

Parkhomchuk, Dmitri; Borodina, Tatiana; Amstislavskiy, Vyacheslav; Banaru, Maria; Hallen, Linda; Krobitsch, Sylvia; Lehrach, Hans; Soldatov, Alexey

2009-10-01

High-throughput complementary DNA sequencing (RNA-Seq) is a powerful tool for whole-transcriptome analysis, supplying information about a transcript's expression level and structure. However, it is difficult to determine the polarity of transcripts, and therefore identify which strand is transcribed. Here, we present a simple cDNA sequencing protocol that preserves information about a transcript's direction. Using Saccharomyces cerevisiae and mouse brain transcriptomes as models, we demonstrate that knowing the transcript's orientation allows more accurate determination of the structure and expression of genes. It also helps to identify new genes and enables studying promoter-associated and antisense transcription. The transcriptional landscapes we obtained are available online.

A novel class of small RNAs bind to MILI protein in mouse testes.

PubMed

Aravin, Alexei; Gaidatzis, Dimos; Pfeffer, Sébastien; Lagos-Quintana, Mariana; Landgraf, Pablo; Iovino, Nicola; Morris, Patricia; Brownstein, Michael J; Kuramochi-Miyagawa, Satomi; Nakano, Toru; Chien, Minchen; Russo, James J; Ju, Jingyue; Sheridan, Robert; Sander, Chris; Zavolan, Mihaela; Tuschl, Thomas

2006-07-13

Small RNAs bound to Argonaute proteins recognize partially or fully complementary nucleic acid targets in diverse gene-silencing processes. A subgroup of the Argonaute proteins--known as the 'Piwi family'--is required for germ- and stem-cell development in invertebrates, and two Piwi members--MILI and MIWI--are essential for spermatogenesis in mouse. Here we describe a new class of small RNAs that bind to MILI in mouse male germ cells, where they accumulate at the onset of meiosis. The sequences of the over 1,000 identified unique molecules share a strong preference for a 5' uridine, but otherwise cannot be readily classified into sequence families. Genomic mapping of these small RNAs reveals a limited number of clusters, suggesting that these RNAs are processed from long primary transcripts. The small RNAs are 26-31 nucleotides (nt) in length--clearly distinct from the 21-23 nt of microRNAs (miRNAs) or short interfering RNAs (siRNAs)--and we refer to them as 'Piwi-interacting RNAs' or piRNAs. Orthologous human chromosomal regions also give rise to small RNAs with the characteristics of piRNAs, but the cloned sequences are distinct. The identification of this new class of small RNAs provides an important starting point to determine the molecular function of Piwi proteins in mammalian spermatogenesis.

Simulations Using Random-Generated DNA and RNA Sequences

ERIC Educational Resources Information Center

Bryce, C. F. A.

1977-01-01

Using a very simple computer program written in BASIC, a very large number of random-generated DNA or RNA sequences are obtained. Students use these sequences to predict complementary sequences and translational products, evaluate base compositions, determine frequencies of particular triplet codons, and suggest possible secondary structures.…

Template-switching during DNA synthesis by Thermus aquaticus DNA polymerase I.

PubMed Central

Odelberg, S J; Weiss, R B; Hata, A; White, R

1995-01-01

Recombinant DNA molecules are often generated during the polymerase chain reaction (PCR) when partially homologous templates are available [e.g., see Pääbo et al. (1990) J. Biol. Chem. 265, 4718-4721]. It has been suggested that these recombinant molecules are a consequence of truncated extension products annealing to partially homologous templates on subsequent PCR cycles. However, we demonstrate here that recombinants can be generated during a single round of primer extension in the absence of subsequent heat denaturation, indicating that template-switching produces some of these recombinant molecules. Two types of template-switches were observed: (i) switches to pre-existing templates and (ii) switches to the complementary nascent strand. Recombination is reduced several fold when the complementary template strands are physically separated by attachment to streptavidin magnetic beads. This result supports the hypothesis that either the polymerase or at least one of the two extending strands switches templates during DNA synthesis and that interaction between the complementary template strands is necessary for efficient template-switching. Images PMID:7596836

[Analysis of Conformational Features of Watson-Crick Duplex Fragments by Molecular Mechanics and Quantum Mechanics Methods].

PubMed

Poltev, V I; Anisimov, V M; Sanchez, C; Deriabina, A; Gonzalez, E; Garcia, D; Rivas, F; Polteva, N A

2016-01-01

It is generally accepted that the important characteristic features of the Watson-Crick duplex originate from the molecular structure of its subunits. However, it still remains to elucidate what properties of each subunit are responsible for the significant characteristic features of the DNA structure. The computations of desoxydinucleoside monophosphates complexes with Na-ions using density functional theory revealed a pivotal role of DNA conformational properties of single-chain minimal fragments in the development of unique features of the Watson-Crick duplex. We found that directionality of the sugar-phosphate backbone and the preferable ranges of its torsion angles, combined with the difference between purines and pyrimidines. in ring bases, define the dependence of three-dimensional structure of the Watson-Crick duplex on nucleotide base sequence. In this work, we extended these density functional theory computations to the minimal' fragments of DNA duplex, complementary desoxydinucleoside monophosphates complexes with Na-ions. Using several computational methods and various functionals, we performed a search for energy minima of BI-conformation for complementary desoxydinucleoside monophosphates complexes with different nucleoside sequences. Two sequences are optimized using ab initio method at the MP2/6-31++G** level of theory. The analysis of torsion angles, sugar ring puckering and mutual base positions of optimized structures demonstrates that the conformational characteristic features of complementary desoxydinucleoside monophosphates complexes with Na-ions remain within BI ranges and become closer to the corresponding characteristic features of the Watson-Crick duplex crystals. Qualitatively, the main characteristic features of each studied complementary desoxydinucleoside monophosphates complex remain invariant when different computational methods are used, although the quantitative values of some conformational parameters could vary lying within the limits typical for the corresponding family. We observe that popular functionals in density functional theory calculations lead to the overestimated distances between base pairs, while MP2 computations and the newer complex functionals produce the structures that have too close atom-atom contacts. A detailed study of some complementary desoxydinucleoside monophosphate complexes with Na-ions highlights the existence of several energy minima corresponding to BI-conformations, in other words, the complexity of the relief pattern of the potential energy surface of complementary desoxydinucleoside monophosphate complexes. This accounts for variability of conformational parameters of duplex fragments with the same base sequence. Popular molecular mechanics force fields AMBER and CHARMM reproduce most of the conformational characteristics of desoxydinucleoside monophosphates and their complementary complexes with Na-ions but fail to reproduce some details of the dependence of the Watson-Crick duplex conformation on the nucleotide sequence.

Complete complementary DNA-derived amino acid sequence of canine cardiac phospholamban.

PubMed Central

Fujii, J; Ueno, A; Kitano, K; Tanaka, S; Kadoma, M; Tada, M

1987-01-01

Complementary DNA (cDNA) clones specific for phospholamban of sarcoplasmic reticulum membranes have been isolated from a canine cardiac cDNA library. The amino acid sequence deduced from the cDNA sequence indicates that phospholamban consists of 52 amino acid residues and lacks an amino-terminal signal sequence. The protein has an inferred mol wt 6,080 that is in agreement with its apparent monomeric mol wt 6,000, estimated previously by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Phospholamban contains two distinct domains, a hydrophilic region at the amino terminus (domain I) and a hydrophobic region at the carboxy terminus (domain II). We propose that domain I is localized at the cytoplasmic surface and offers phosphorylatable sites whereas domain II is anchored into the sarcoplasmic reticulum membrane. PMID:3793929

Genome-wide RNA-seq of iPSC-derived motor neurons indicates selective cytoskeletal perturbation in Brown–Vialetto disease that is partially rescued by riboflavin

PubMed Central

Rizzo, Federica; Ramirez, Agnese; Compagnucci, Claudia; Salani, Sabrina; Melzi, Valentina; Bordoni, Andreina; Fortunato, Francesco; Niceforo, Alessia; Bresolin, Nereo; Comi, Giacomo P.; Bertini, Enrico; Nizzardo, Monica; Corti, Stefania

2017-01-01

Riboflavin is essential in numerous cellular oxidation/reduction reactions but is not synthesized by mammalian cells. Riboflavin absorption occurs through the human riboflavin transporters RFVT1 and RFVT3 in the intestine and RFVT2 in the brain. Mutations in these genes are causative for the Brown–Vialetto–Van Laere (BVVL), childhood-onset syndrome characterized by a variety of cranial nerve palsies as well as by spinal cord motor neuron (MN) degeneration. Why mutations in RFVTs result in a neural cell–selective disorder is unclear. As a novel tool to gain insights into the pathomechanisms underlying the disease, we generated MNs from induced pluripotent stem cells (iPSCs) derived from BVVL patients as an in vitro disease model. BVVL-MNs explained a reduction in axon elongation, partially improved by riboflavin supplementation. RNA sequencing profiles and protein studies of the cytoskeletal structures showed a perturbation in the neurofilament composition in BVVL-MNs. Furthermore, exploring the autophagy–lysosome pathway, we observed a reduced autophagic/mitophagic flux in patient MNs. These features represent emerging pathogenetic mechanisms in BVVL-associated neurodegeneration, partially rescued by riboflavin supplementation. Our data showed that this therapeutic strategy could have some limits in rescuing all of the disease features, suggesting the need to develop complementary novel therapeutic strategies. PMID:28382968

Procedure for normalization of cDNA libraries

DOEpatents

Bonaldo, Maria DeFatima; Soares, Marcelo Bento

1997-01-01

This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library.

Genomic regions with a history of divergent selection affect fitness of hybrids between two butterfly species.

PubMed

Gompert, Zachariah; Lucas, Lauren K; Nice, Chris C; Fordyce, James A; Forister, Matthew L; Buerkle, C Alex

2012-07-01

Speciation is the process by which reproductively isolated lineages arise, and is one of the fundamental means by which the diversity of life increases. Whereas numerous studies have documented an association between ecological divergence and reproductive isolation, relatively little is known about the role of natural selection in genome divergence during the process of speciation. Here, we use genome-wide DNA sequences and Bayesian models to test the hypothesis that loci under divergent selection between two butterfly species (Lycaeides idas and L. melissa) also affect fitness in an admixed population. Locus-specific measures of genetic differentiation between L. idas and L. melissa and genomic introgression in hybrids varied across the genome. The most differentiated genetic regions were characterized by elevated L. idas ancestry in the admixed population, which occurs in L. idas-like habitat, consistent with the hypothesis that local adaptation contributes to speciation. Moreover, locus-specific measures of genetic differentiation (a metric of divergent selection) were positively associated with extreme genomic introgression (a metric of hybrid fitness). Interestingly, concordance of differentiation and introgression was only partial. We discuss multiple, complementary explanations for this partial concordance. © 2012 The Author(s).

Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

PubMed Central

Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

2012-01-01

DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

A Programmable DNA Double-Write Material: Synergy of Photolithography and Self-Assembly Nanofabrication.

PubMed

Song, Youngjun; Takahashi, Tsukasa; Kim, Sejung; Heaney, Yvonne C; Warner, John; Chen, Shaochen; Heller, Michael J

2017-01-11

We demonstrate a DNA double-write process that uses UV to pattern a uniquely designed DNA write material, which produces two distinct binding identities for hybridizing two different complementary DNA sequences. The process requires no modification to the DNA by chemical reagents and allows programmed DNA self-assembly and further UV patterning in the UV exposed and nonexposed areas. Multilayered DNA patterning with hybridization of fluorescently labeled complementary DNA sequences, biotin probe/fluorescent streptavidin complexes, and DNA patterns with 500 nm line widths were all demonstrated.

Detection of Ammonia-Oxidizing Bacteria (AOB) Using a Porous Silicon Optical Biosensor Based on a Multilayered Double Bragg Mirror Structure.

PubMed

Zhang, Hongyan; Lv, Jie; Jia, Zhenhong

2018-01-01

We successfully demonstrate a porous silicon (PS) double Bragg mirror by electrochemical etching at room temperature as a deoxyribonucleic acid (DNA) label-free biosensor for detecting ammonia-oxidizing bacteria (AOB). Compared to various other one-dimension photonic crystal configurations of PS, the double Bragg mirror structure is quite easy to prepare and exhibits interesting optical properties. The width of high reflectivity stop band of the PS double Bragg mirror is about 761 nm with a sharp and deep resonance peak at 1328 nm in the reflectance spectrum, which gives a high sensitivity and distinguishability for sensing performance. The detection sensitivity of such a double Bragg mirror structure is illustrated through the investigation of AOB DNA hybridization in the PS pores. The redshifts of the reflectance spectra show a good linear relationship with both complete complementary and partial complementary DNA. The lowest detection limit for complete complementary DNA is 27.1 nM and the detection limit of the biosensor for partial complementary DNA is 35.0 nM, which provides the feasibility and effectiveness for the detection of AOB in a real environment. The PS double Bragg mirror structure is attractive for widespread biosensing applications and provides great potential for the development of optical applications.

Advanced surface-enhanced Raman gene probe systems and methods thereof

DOEpatents

Vo-Dinh, Tuan

2001-01-01

The subject invention is a series of methods and systems for using the Surface-Enhanced Raman (SER)-labeled Gene Probe for hybridization, detection and identification of SER-labeled hybridized target oligonucleotide material comprising the steps of immobilizing SER-labeled hybridized target oligonucleotide material on a support means, wherein the SER-labeled hybridized target oligonucleotide material comprise a SER label attached either to a target oligonucleotide of unknown sequence or to a gene probe of known sequence complementary to the target oligonucleotide sequence, the SER label is unique for the target oligonucleotide strands of a particular sequence wherein the SER-labeled oligonucleotide is hybridized to its complementary oligonucleotide strand, then the support means having the SER-labeled hybridized target oligonucleotide material adsorbed thereon is SERS activated with a SERS activating means, then the support means is analyzed.

Composition for nucleic acid sequencing

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2008-08-26

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Method for sequencing nucleic acid molecules

DOEpatents

Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

2006-06-06

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Method for sequencing nucleic acid molecules

DOEpatents

Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

2006-05-30

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Electrochemical product detection of an asymmetric convective polymerase chain reaction.

PubMed

Duwensee, Heiko; Mix, Maren; Stubbe, Marco; Gimsa, Jan; Adler, Marcel; Flechsig, Gerd-Uwe

2009-10-15

For the first time, we describe the application of heated microwires for an asymmetric convective polymerase chain reaction (PCR) in a modified PCR tube in a small volume. The partly single-stranded product was labeled with the electrochemically active compound osmium tetroxide bipyridine using a partially complementary protective strand with five mismatches compared to the single-stranded product. The labeled product could be successfully detected at a gold electrode modified with a complementary single-stranded capture probe immobilized via a thiol-linker. Our simple thermo-convective PCR yielded electrochemically detectable products after only 5-10 min. A significant discrimination between complementary and non-complementary target was possible using different immobilized capture probes. The total product yield was approx. half the amount of the classical thermocycler PCR. Numerical simulations describing the thermally driven convective PCR explain the received data. Discrimination between complementary capture probes and non-complementary capture probes was performed using square-wave voltammetry. The coupling of asymmetric thermo-convective PCR with electrochemical detection is very promising for future compact DNA sensor devices.

Integrative analysis of Arabidopsis thaliana transcriptomics reveals intuitive splicing mechanism for circular RNA.

PubMed

Sun, Xiaoyong; Wang, Lin; Ding, Jiechao; Wang, Yanru; Wang, Jiansheng; Zhang, Xiaoyang; Che, Yulei; Liu, Ziwei; Zhang, Xinran; Ye, Jiazhen; Wang, Jie; Sablok, Gaurav; Deng, Zhiping; Zhao, Hongwei

2016-10-01

A new regulatory class of small endogenous RNAs called circular RNAs (circRNAs) has been described as miRNA sponges in animals. Using 16 Arabidopsis thaliana RNA-Seq data sets, we identified 803 circRNAs in RNase R-/non-RNase R-treated samples. The results revealed the following features: Canonical and noncanonical splicing can generate circRNAs; chloroplasts are a hotspot for circRNA generation; furthermore, limited complementary sequences exist not only in introns, but also in the sequences flanking splice sites. The latter finding suggests that multiple combinations between complementary sequences may facilitate the formation of the circular structure. Our results contribute to a better understanding of this novel class of plant circRNAs. © 2016 Federation of European Biochemical Societies.

Complementary DNA sequences encoding the multimammate rat MHC class II DQ alpha and beta chains and cross-species sequence comparison in rodents.

PubMed

de Bellocq, J Goüy; Leirs, H

2009-09-01

Sequences of the complete open reading frame (ORF) for rodents major histocompatibility complex (MHC) class II genes are rare. Multimammate rat (Mastomys natalensis) complementary DNA (cDNA) encoding the alpha and beta chains of MHC class II DQ gene was cloned from a rapid amplifications of cDNA Emds (RACE) cDNA library. The ORFs consist of 801 and 771 bp encoding 266 and 256 amino acid residues for DQB and DQA, respectively. The genomic structure of Mana-DQ genes is globally analogous to that described for other rodents except for the insertion of a serine residue in the signal peptide of Mana-DQB, which is unique among known rodents.

A cis-antisense RNA acts in trans in Staphylococcus aureus to control translation of a human cytolytic peptide.

PubMed

Sayed, Nour; Jousselin, Ambre; Felden, Brice

2011-12-25

Antisense RNAs (asRNAs) pair to RNAs expressed from the complementary strand, and their functions are thought to depend on nucleotide overlap with genes on the opposite strand. There is little information on the roles and mechanisms of asRNAs. We show that a cis asRNA acts in trans, using a domain outside its target complementary sequence. SprA1 small regulatory RNA (sRNA) and SprA1(AS) asRNA are concomitantly expressed in S. aureus. SprA1(AS) forms a complex with SprA1, preventing translation of the SprA1-encoded open reading frame by occluding translation initiation signals through pairing interactions. The SprA1 peptide sequence is within two RNA pseudoknots. SprA1(AS) represses production of the SprA1-encoded cytolytic peptide in trans, as its overlapping region is dispensable for regulation. These findings demonstrate that sometimes asRNA functional domains are not their gene-target complementary sequences, suggesting there is a need for mechanistic re-evaluation of asRNAs expressed in prokaryotes and eukaryotes.

Staufen-mediated mRNA decay.

PubMed

Park, Eonyoung; Maquat, Lynne E

2013-01-01

Staufen1 (STAU1)-mediated mRNA decay (SMD) is an mRNA degradation process in mammalian cells that is mediated by the binding of STAU1 to a STAU1-binding site (SBS) within the 3'-untranslated region (3'-UTR) of target mRNAs. During SMD, STAU1, a double-stranded (ds) RNA-binding protein, recognizes dsRNA structures formed either by intramolecular base pairing of 3'-UTR sequences or by intermolecular base pairing of 3'-UTR sequences with a long-noncoding RNA (lncRNA) via partially complementary Alu elements. Recently, STAU2, a paralog of STAU1, has also been reported to mediate SMD. Both STAU1 and STAU2 interact directly with the ATP-dependent RNA helicase UPF1, a key SMD factor, enhancing its helicase activity to promote effective SMD. Moreover, STAU1 and STAU2 form homodimeric and heterodimeric interactions via domain-swapping. Because both SMD and the mechanistically related nonsense-mediated mRNA decay (NMD) employ UPF1; SMD and NMD are competitive pathways. Competition contributes to cellular differentiation processes, such as myogenesis and adipogenesis, placing SMD at the heart of various physiologically important mechanisms. Copyright © 2013 John Wiley & Sons, Ltd.

Determining orientation and direction of DNA sequences

DOEpatents

Goodwin, Edwin H.; Meyne, Julianne

2000-01-01

Determining orientation and direction of DNA sequences. A method by which fluorescence in situ hybridization can be made strand specific is described. Cell cultures are grown in a medium containing a halogenated nucleotide. The analog is partially incorporated in one DNA strand of each chromatid. This substitution takes place in opposite strands of the two sister chromatids. After staining with the fluorescent DNA-binding dye Hoechst 33258, cells are exposed to long-wavelength ultraviolet light which results in numerous strand nicks. These nicks enable the substituted strand to be denatured and solubilized by heat, treatment with high or low pH aqueous solutions, or by immersing the strands in 2.times.SSC (0.3M NaCl+0.03M sodium citrate), to name three procedures. It is unnecessary to enzymatically digest the strands using Exo III or another exonuclease in order to excise and solubilize nucleotides starting at the sites of the nicks. The denaturing/solubilizing process removes most of the substituted strand while leaving the prereplication strand largely intact. Hybridization of a single-stranded probe of a tandem repeat arranged in a head-to-tail orientation will result in hybridization only to the chromatid with the complementary strand present.

The Status of Exon Skipping as a Therapeutic Approach to Duchenne Muscular Dystrophy

PubMed Central

Lu, Qi-Long; Yokota, Toshifumi; Takeda, Shin'ichi; Garcia, Luis; Muntoni, Francesco; Partridge, Terence

2011-01-01

Duchenne muscular dystrophy (DMD) is associated with mutations in the dystrophin gene that disrupt the open reading frame whereas the milder Becker's form is associated with mutations which leave an in-frame mRNA transcript that can be translated into a protein that includes the N- and C- terminal functional domains. It has been shown that by excluding specific exons at, or adjacent to, frame-shifting mutations, open reading frame can be restored to an out-of-frame mRNA, leading to the production of a partially functional Becker-like dystrophin protein. Such targeted exclusion can be achieved by administration of oligonucleotides that are complementary to sequences that are crucial to normal splicing of the exon into the transcript. This principle has been validated in mouse and canine models of DMD with a number of variants of oligonucleotide analogue chemistries and by transduction with adeno-associated virus (AAV)-small nuclear RNA (snRNA) reagents encoding the antisense sequence. Two different oligonucleotide agents are now being investigated in human trials for splicing out of exon 51 with some early indications of success at the biochemical level. PMID:20978473

Procedure for normalization of cDNA libraries

DOEpatents

Bonaldo, M.D.; Soares, M.B.

1997-12-30

This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library. 1 fig.

DNA Photo Lithography with Cinnamate-based Photo-Bio-Nano-Glue

NASA Astrophysics Data System (ADS)

Feng, Lang; Li, Minfeng; Romulus, Joy; Sha, Ruojie; Royer, John; Wu, Kun-Ta; Xu, Qin; Seeman, Nadrian; Weck, Marcus; Chaikin, Paul

2013-03-01

We present a technique to make patterned functional surfaces, using a cinnamate photo cross-linker and photolithography. We have designed and modified a complementary set of single DNA strands to incorporate a pair of opposing cinnamate molecules. On exposure to 360nm UV, the cinnamate makes a highly specific covalent bond permanently linking only the complementary strands containing the cinnamates. We have studied this specific and efficient crosslinking with cinnamate-containing DNA in solution and on particles. UV addressability allows us to pattern surfaces functionally. The entire surface is coated with a DNA sequence A incorporating cinnamate. DNA strands A'B with one end containing a complementary cinnamated sequence A' attached to another sequence B, are then hybridized to the surface. UV photolithography is used to bind the A'B strand in a specific pattern. The system is heated and the unbound DNA is washed away. The pattern is then observed by thermo-reversibly hybridizing either fluorescently dyed B' strands complementary to B, or colloids coated with B' strands. Our techniques can be used to reversibly and/or permanently bind, via DNA linkers, an assortment of molecules, proteins and nanostructures. Potential applications range from advanced self-assembly, such as templated self-replication schemes recently reported, to designed physical and chemical patterns, to high-resolution multi-functional DNA surfaces for genetic detection or DNA computing.

Analysis of 16S-23S intergenic spacer regions of the rRNA operons in Edwardsiella ictaluri and Edwardsiella tarda isolates from fish.

PubMed

Panangala, V S; van Santen, V L; Shoemaker, C A; Klesius, P H

2005-01-01

To analyse interspecies and intraspecies differences based on the 16S-23S rRNA intergenic spacer region (ISR) sequences of the fish pathogens Edwardsiella ictaluri and Edwardsiella tarda. The 16S-23S rRNA spacer regions of 19 Edw. ictaluri and four Edw. tarda isolates from four geographical regions were amplified by PCR with primers complementary to conserved sequences within the flanking 16S-23S rRNA coding sequences. Two products were generated from all isolates, without interspecies or intraspecific size polymorphisms. Sequence analysis of the amplified fragments revealed a smaller ISR of 350 bp, which contained a gene for tRNA(Glu), and a larger ISR of 441 bp, which contained genes for tRNA(Ile) and tRNA(Ala). The sequences of the smaller ISR of different Edw. ictaluri isolates were essentially identical to each other. Partial sequences of larger ISR from several Edw. ictaluri isolates also revealed no differences from the one complete Edw. ictaluri large ISR sequence obtained. The sequences of the smaller ISR of Edw. tarda were 97% identical to the Edw. ictaluri smaller ISR and the larger ISR were 96-98% identical to the Edw. ictaluri larger ISR sequence. The Edw. tarda isolates displayed limited ISR sequence heterogeneity, with > or =97% sequence identity among isolates for both small and large ISR. There is a high degree of size and sequence similarity of 16S-23S ISR both among isolates within Edw. ictaluri and Edw. tarda species and between the two species. Our results confirm a close genetic relationship between Edw. ictaluri and Edw. tarda and the relative homogeneity of Edw. ictaluri isolates compared with Edw. tarda isolates. Because no differences were found in ISR sequences among Edw. ictaluri isolates, sequence analysis of the ISR will not be useful to distinguish isolates of Edw. ictaluri. However, we identified restriction sites that differ between ISR sequences of Edw. ictaluri and Edw. tarda, which will be useful in distinguishing the two species.

Labeled nucleotide phosphate (NP) probes

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2009-02-03

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Nucleic acid indexing

DOEpatents

Guilfoyle, Richard A.; Guo, Zhen

2001-01-01

A restriction site indexing method for selectively amplifying any fragment generated by a Class II restriction enzyme includes adaptors specific to fragment ends containing adaptor indexing sequences complementary to fragment indexing sequences near the termini of fragments generated by Class II enzyme cleavage. A method for combinatorial indexing facilitates amplification of restriction fragments whose sequence is not known.

Nucleic acid indexing

DOEpatents

Guilfoyle, Richard A.; Guo, Zhen

1999-01-01

A restriction site indexing method for selectively amplifying any fragment generated by a Class II restriction enzyme includes adaptors specific to fragment ends containing adaptor indexing sequences complementary to fragment indexing sequences near the termini of fragments generated by Class II enzyme cleavage. A method for combinatorial indexing facilitates amplification of restriction fragments whose sequence is not known.

Microchip method for the enrichment of specific DNA sequences

DOEpatents

Mirzabekov, A.D.; Lysov, Y.P.; Shick, V.V.; Dubiley, S.A.

1998-12-22

A method for enriching specific genetic material sequences is provided, whereby oligonucleotide molecules complementary to the desired genetic material is first used to isolate the genetic material from a first source of genomic material. Then the genetic material is used as a label to isolate similar genetic sequences from other sources. 4 figs.

Microchip method for the enrichment of specific DNA sequences

DOEpatents

Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Shick, Valentine Vladimirovich; Dubiley, Svetlana Alekseevna

1998-01-01

A method for enriching specific genetic material sequences is provided, whereby oligonucleotide molecules complementary to the desired genetic material is first used to isolate the genetic material from a first source of genomic material. Then the genetic material is used as a label to isolate similar genetic sequences from other sources.

The convergence of the order sequence and the solution function sequence on fractional partial differential equation

NASA Astrophysics Data System (ADS)

Rusyaman, E.; Parmikanti, K.; Chaerani, D.; Asefan; Irianingsih, I.

2018-03-01

One of the application of fractional ordinary differential equation is related to the viscoelasticity, i.e., a correlation between the viscosity of fluids and the elasticity of solids. If the solution function develops into function with two or more variables, then its differential equation must be changed into fractional partial differential equation. As the preliminary study for two variables viscoelasticity problem, this paper discusses about convergence analysis of function sequence which is the solution of the homogenous fractional partial differential equation. The method used to solve the problem is Homotopy Analysis Method. The results show that if given two real number sequences (αn) and (βn) which converge to α and β respectively, then the solution function sequences of fractional partial differential equation with order (αn, βn) will also converge to the solution function of fractional partial differential equation with order (α, β).

Evaluation of anonymous and expressed sequence tag derived polymorphic microsatellite markers in the tobacco budworm Heliothis virescens (Lepidoptera: noctuidae)

USDA-ARS?s Scientific Manuscript database

Polymorphic genetic markers were identified and characterized using a partial genomic library of Heliothis virescens enriched for simple sequence repeats (SSR) and nucleotide sequences of expressed sequence tags (EST). Nucleotide sequences of 192 clones from the partial genomic library yielded 147 u...

Interfacial Shear Strength and Adhesive Behavior of Silk Ionomer Surfaces.

PubMed

Kim, Sunghan; Geryak, Ren D; Zhang, Shuaidi; Ma, Ruilong; Calabrese, Rossella; Kaplan, David L; Tsukruk, Vladimir V

2017-09-11

The interfacial shear strength between different layers in multilayered structures of layer-by-layer (LbL) microcapsules is a crucial mechanical property to ensure their robustness. In this work, we investigated the interfacial shear strength of modified silk fibroin ionomers utilized in LbL shells, an ionic-cationic pair with complementary ionic pairing, (SF)-poly-l-glutamic acid (Glu) and SF-poly-l-lysine (Lys), and a complementary pair with partially screened Coulombic interactions due to the presence of poly(ethylene glycol) (PEG) segments and SF-Glu/SF-Lys[PEG] pair. Shearing and adhesive behavior between these silk ionomer surfaces in the swollen state were probed at different spatial scales and pressure ranges by using functionalized atomic force microscopy (AFM) tips as well as functionalized colloidal probes. The results show that both approaches were consistent in analyzing the interfacial shear strength of LbL silk ionomers at different spatial scales from a nanoscale to a fraction of a micron. Surprisingly, the interfacial shear strength between SF-Glu and SF-Lys[PEG] pair with partially screened ionic pairing was greater than the interfacial shear strength of the SF-Glu and SF-Lys pair with a high density of complementary ionic groups. The difference in interfacial shear strength and adhesive strength is suggested to be predominantly facilitated by the interlayer hydrogen bonding of complementary amino acids and overlap of highly swollen PEG segments.

SNBRFinder: A Sequence-Based Hybrid Algorithm for Enhanced Prediction of Nucleic Acid-Binding Residues.

PubMed

Yang, Xiaoxia; Wang, Jia; Sun, Jun; Liu, Rong

2015-01-01

Protein-nucleic acid interactions are central to various fundamental biological processes. Automated methods capable of reliably identifying DNA- and RNA-binding residues in protein sequence are assuming ever-increasing importance. The majority of current algorithms rely on feature-based prediction, but their accuracy remains to be further improved. Here we propose a sequence-based hybrid algorithm SNBRFinder (Sequence-based Nucleic acid-Binding Residue Finder) by merging a feature predictor SNBRFinderF and a template predictor SNBRFinderT. SNBRFinderF was established using the support vector machine whose inputs include sequence profile and other complementary sequence descriptors, while SNBRFinderT was implemented with the sequence alignment algorithm based on profile hidden Markov models to capture the weakly homologous template of query sequence. Experimental results show that SNBRFinderF was clearly superior to the commonly used sequence profile-based predictor and SNBRFinderT can achieve comparable performance to the structure-based template methods. Leveraging the complementary relationship between these two predictors, SNBRFinder reasonably improved the performance of both DNA- and RNA-binding residue predictions. More importantly, the sequence-based hybrid prediction reached competitive performance relative to our previous structure-based counterpart. Our extensive and stringent comparisons show that SNBRFinder has obvious advantages over the existing sequence-based prediction algorithms. The value of our algorithm is highlighted by establishing an easy-to-use web server that is freely accessible at http://ibi.hzau.edu.cn/SNBRFinder.

DNA Remodeling by Strict Partial Endoreplication in Orchids, an Original Process in the Plant Kingdom

PubMed Central

Brown, Spencer C.; Bourge, Mickaël; Maunoury, Nicolas; Wong, Maurice; Wolfe Bianchi, Michele; Lepers-Andrzejewski, Sandra; Besse, Pascale; Siljak-Yakovlev, Sonja

2017-01-01

DNA remodeling during endoreplication appears to be a strong developmental characteristic in orchids. In this study, we analyzed DNA content and nuclei in 41 species of orchids to further map the genome evolution in this plant family. We demonstrate that the DNA remodeling observed in 36 out of 41 orchids studied corresponds to strict partial endoreplication. Such process is developmentally regulated in each wild species studied. Cytometry data analyses allowed us to propose a model where nuclear states 2C, 4E, 8E, etc. form a series comprising a fixed proportion, the euploid genome 2C, plus 2–32 additional copies of a complementary part of the genome. The fixed proportion ranged from 89% of the genome in Vanilla mexicana down to 19% in V. pompona, the lowest value for all 148 orchids reported. Insterspecific hybridization did not suppress this phenomenon. Interestingly, this process was not observed in mass-produced epiphytes. Nucleolar volumes grow with the number of endocopies present, coherent with high transcription activity in endoreplicated nuclei. Our analyses suggest species-specific chromatin rearrangement. Towards understanding endoreplication, V. planifolia constitutes a tractable system for isolating the genomic sequences that confer an advantage via endoreplication from those that apparently suffice at diploid level. PMID:28419219

Molecular cloning of a gene encoding translation initiation factor (TIF) from Candida albicans.

PubMed

Mirbod, F; Nakashima, S; Kitajima, Y; Ghannoum, M A; Cannon, R D; Nozawa, Y

1996-01-01

The differential display technique was applied to compare mRNAs from two clinical isolates of Candida albicans with different virulence; high (potent strain, 16240) and low (weak strain, 18084) extracellular phospholipase activities. Complementary DNA fragments corresponding to several apparently differentially expressed mRNAs were recovered and sequenced. A complementary DNA fragment seen distinctly in the potent phospholipase producing strain was highly homologous to the yeast translation initiation factor (TIF). The selected DNA fragment was then used as a probe to isolate its corresponding complementary DNA clone from a library of C. albicans genomic DNA. The sequence of isolated gene revealed an open reading frame of 1194 nucleotides with the potential to encode a protein of 397 amino acids with a predicted molecular weight of 43 kDa. Over its entire length, the amino acid sequence showed strong homology (78-89%) to Saccharomyces cerevisiae TIF and (63-80%) to mouse eIF-4A proteins. Therefore, our C. albicans gene was identified to be TIF (Ca TIF). Northern blot analysis in the two strains of C. albicans revealed that Ca TIF expression is 1.5-fold higher in the potent phospholipase producing strain. The restriction endonuclease digestion of genomic DNA from this potent strain revealed at least two hybridized bands in Southern blot analysis, suggesting two or more closely related sequences in the C. albicans genome.

New redox-active layer create via epoxy-amine reaction - The base of genosensor for the detection of specific DNA and RNA sequences of avian influenza virus H5N1.

PubMed

Malecka, Kamila; Stachyra, Anna; Góra-Sochacka, Anna; Sirko, Agnieszka; Zagórski-Ostoja, Włodzimierz; Dehaen, Wim; Radecka, Hanna; Radecki, Jerzy

2015-03-15

This paper concerns the development of a redox-active monolayer and its application for the construction of an electrochemical genosensor designed for the detection of specific DNA and RNA oligonucleotide sequences related to the avian influenza virus (AIV) type H5N1. This new redox layer was created on a gold electrode surface step by step. Cyclic Voltammetry, Osteryoung Square-Wave Voltammetry and Differential Pulse Voltammetry were used for its characterization. This new redox-active layer was applied for the construction of the DNA biosensor. The NH2-NC3 probe (20-mer) was covalently attached to the gold electrode surface via a "click" reaction between the amine and an epoxide group. The hybridization process was monitored using the Osteryoung Square-Wave Voltammetry. The 20-mer DNA and ca. 280-mer RNA oligonucleotides were used as the targets. The constructed genosensor was capable to determine complementary oligonucleotide sequences with a detection limit in the pM range. It is able to distinguish the different position of the part RNA complementary to the DNA probe. The genosensor was very selective. The 20-mer DNA as well as the 280-mer RNA oligonucleotides without a complementary sequence generated a weak signal. Copyright © 2014 Elsevier B.V. All rights reserved.

Interuser Interference Analysis for Direct-Sequence Spread-Spectrum Systems Part I: Partial-Period Cross-Correlation

NASA Technical Reports Server (NTRS)

Ni, Jianjun (David)

2012-01-01

This presentation discusses an analysis approach to evaluate the interuser interference for Direct-Sequence Spread-Spectrum (DSSS) Systems for Space Network (SN) Users. Part I of this analysis shows that the correlation property of pseudo noise (PN) sequences is the critical factor which determines the interuser interference performance of the DSSS system. For non-standard DSSS systems in which PN sequence s period is much larger than one data symbol duration, it is the partial-period cross-correlation that determines the system performance. This study reveals through an example that a well-designed PN sequence set (e.g. Gold Sequence, in which the cross-correlation for a whole-period is well controlled) may have non-controlled partial-period cross-correlation which could cause severe interuser interference for a DSSS system. Since the analytical derivation of performance metric (bit error rate or signal-to-noise ratio) based on partial-period cross-correlation is prohibitive, the performance degradation due to partial-period cross-correlation will be evaluated using simulation in Part II of this analysis in the future.

Nucleic acid analysis using terminal-phosphate-labeled nucleotides

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2008-04-22

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

A Novel Partial Sequence Alignment Tool for Finding Large Deletions

PubMed Central

Aruk, Taner; Ustek, Duran; Kursun, Olcay

2012-01-01

Finding large deletions in genome sequences has become increasingly more useful in bioinformatics, such as in clinical research and diagnosis. Although there are a number of publically available next generation sequencing mapping and sequence alignment programs, these software packages do not correctly align fragments containing deletions larger than one kb. We present a fast alignment software package, BinaryPartialAlign, that can be used by wet lab scientists to find long structural variations in their experiments. For BinaryPartialAlign, we make use of the Smith-Waterman (SW) algorithm with a binary-search-based approach for alignment with large gaps that we called partial alignment. BinaryPartialAlign implementation is compared with other straight-forward applications of SW. Simulation results on mtDNA fragments demonstrate the effectiveness (runtime and accuracy) of the proposed method. PMID:22566777

Method for performing site-specific affinity fractionation for use in DNA sequencing

DOEpatents

Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.

1999-01-01

A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.

Miniaturized reaction vessel system, method for performing site-specific biochemical reactions and affinity fractionation for use in DNA sequencing

DOEpatents

Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.

2000-01-01

A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.

Method for performing site-specific affinity fractionation for use in DNA sequencing

DOEpatents

Mirzabekov, A.D.; Lysov, Y.P.; Dubley, S.A.

1999-05-18

A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between the cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting the extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to the extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from the array. 14 figs.

Individual sequences in large sets of gene sequences may be distinguished efficiently by combinations of shared sub-sequences

PubMed Central

Gibbs, Mark J; Armstrong, John S; Gibbs, Adrian J

2005-01-01

Background Most current DNA diagnostic tests for identifying organisms use specific oligonucleotide probes that are complementary in sequence to, and hence only hybridise with the DNA of one target species. By contrast, in traditional taxonomy, specimens are usually identified by 'dichotomous keys' that use combinations of characters shared by different members of the target set. Using one specific character for each target is the least efficient strategy for identification. Using combinations of shared bisectionally-distributed characters is much more efficient, and this strategy is most efficient when they separate the targets in a progressively binary way. Results We have developed a practical method for finding minimal sets of sub-sequences that identify individual sequences, and could be targeted by combinations of probes, so that the efficient strategy of traditional taxonomic identification could be used in DNA diagnosis. The sizes of minimal sub-sequence sets depended mostly on sequence diversity and sub-sequence length and interactions between these parameters. We found that 201 distinct cytochrome oxidase subunit-1 (CO1) genes from moths (Lepidoptera) were distinguished using only 15 sub-sequences 20 nucleotides long, whereas only 8–10 sub-sequences 6–10 nucleotides long were required to distinguish the CO1 genes of 92 species from the 9 largest orders of insects. Conclusion The presence/absence of sub-sequences in a set of gene sequences can be used like the questions in a traditional dichotomous taxonomic key; hybridisation probes complementary to such sub-sequences should provide a very efficient means for identifying individual species, subtypes or genotypes. Sequence diversity and sub-sequence length are the major factors that determine the numbers of distinguishing sub-sequences in any set of sequences. PMID:15817134

A compact 5.5 GHz band-rejected UWB antenna using complementary split ring resonators.

PubMed

Islam, M M; Faruque, M R I; Islam, M T

2014-01-01

A band-removal property employing microwave frequencies using complementary split ring resonators (CSRRs) is applied to design a compact UWB antenna wishing for the rejection of some frequency band, which is meanwhile exercised by the existing wireless applications. The reported antenna comprises optimization of a circular radiating patch, in which slotted complementary SRRs are implanted. It is printed on low dielectric FR4 substrate material fed by a partial ground plane and a microstrip line. Validated results exhibit that the reported antenna shows a wide bandwidth covering from 3.45 to more than 12 GHz, with a compact dimension of 22 × 26 mm(2), and VSWR < 2, observing band elimination of 5.5 GHz WLAN band.

Second-generation sequencing of entire mitochondrial coding-regions (∼15.4 kb) holds promise for study of the phylogeny and taxonomy of human body lice and head lice.

PubMed

Xiong, H; Campelo, D; Pollack, R J; Raoult, D; Shao, R; Alem, M; Ali, J; Bilcha, K; Barker, S C

2014-08-01

The Illumina Hiseq platform was used to sequence the entire mitochondrial coding-regions of 20 body lice, Pediculus humanus Linnaeus, and head lice, P. capitis De Geer (Phthiraptera: Pediculidae), from eight towns and cities in five countries: Ethiopia, France, China, Australia and the U.S.A. These data (∼310 kb) were used to see how much more informative entire mitochondrial coding-region sequences were than partial mitochondrial coding-region sequences, and thus to guide the design of future studies of the phylogeny, origin, evolution and taxonomy of body lice and head lice. Phylogenies were compared from entire coding-region sequences (∼15.4 kb), entire cox1 (∼1.5 kb), partial cox1 (∼700 bp) and partial cytb (∼600 bp) sequences. On the one hand, phylogenies from entire mitochondrial coding-region sequences (∼15.4 kb) were much more informative than phylogenies from entire cox1 sequences (∼1.5 kb) and partial gene sequences (∼600 to ∼700 bp). For example, 19 branches had > 95% bootstrap support in our maximum likelihood tree from the entire mitochondrial coding-regions (∼15.4 kb) whereas the tree from 700 bp cox1 had only two branches with bootstrap support > 95%. Yet, by contrast, partial cytb (∼600 bp) and partial cox1 (∼486 bp) sequences were sufficient to genotype lice to Clade A, B or C. The sequences of the mitochondrial genomes of the P. humanus, P. capitis and P. schaeffi Fahrenholz studied are in NCBI GenBank under the accession numbers KC660761-800, KC685631-6330, KC241882-97, EU219988-95, HM241895-8 and JX080388-407. © 2014 The Royal Entomological Society.

Specific DNA duplex formation at an artificial lipid bilayer: towards a new DNA biosensor technology.

PubMed

Werz, Emma; Korneev, Sergei; Montilla-Martinez, Malayko; Wagner, Richard; Hemmler, Roland; Walter, Claudius; Eisfeld, Jörg; Gall, Karsten; Rosemeyer, Helmut

2012-02-01

A novel technique is described which comprises a base-specific DNA duplex formation at a lipid bilayer-H(2) O-phase boundary layer. Two different probes of oligonucleotides both carrying a double-tailed lipid at the 5'-terminus were incorporated into stable artificial lipid bilayers separating two compartments (cis/trans-channel) of an optically transparent microfluidic sample carrier with perfusion capabilities. Both the cis- and trans-channels are filled with saline buffer. Injection of a cyanine-5-labeled target DNA sequence, which is complementary to only one of the oligonucleotide probes, into the cis-channel, followed by a thorough perfusion, leads to an immobilization of the labeled complementary oligonucleotide on the membrane as detected by single-molecule fluorescence spectroscopy and microscopy. In the case of fluorescent but non-complementary DNA sequences, no immobilized fluorescent oligonucleotide duplex could be detected on the membrane. This clearly verifies a specific duplex formation at the membrane interface. Copyright © 2012 Verlag Helvetica Chimica Acta AG, Zürich.

Cryptic splice site in the complementary DNA of glucocerebrosidase causes inefficient expression.

PubMed

Bukovac, Scott W; Bagshaw, Richard D; Rigat, Brigitte A; Callahan, John W; Clarke, Joe T R; Mahuran, Don J

2008-10-15

The low levels of human lysosomal glucocerebrosidase activity expressed in transiently transfected Chinese hamster ovary (CHO) cells were investigated. Reverse transcription PCR (RT-PCR) demonstrated that a significant portion of the transcribed RNA was misspliced owing to the presence of a cryptic splice site in the complementary DNA (cDNA). Missplicing results in the deletion of 179 bp of coding sequence and a premature stop codon. A repaired cDNA was constructed abolishing the splice site without changing the amino acid sequence. The level of glucocerebrosidase expression was increased sixfold. These data demonstrate that for maximum expression of any cDNA construct, the transcription products should be examined.

Dual-excitation upconverting nanoparticle and quantum dot aptasensor for multiplexed food pathogen detection.

PubMed

Kurt, Hasan; Yüce, Meral; Hussain, Babar; Budak, Hikmet

2016-07-15

In this report, a dual-excitation sensing method was developed using aptamer-functionalized quantum dots and upconverting nanoparticles, exhibiting Stokes and anti-Stokes type excitation profiles, respectively. Conjugation of the aptamer-functionalized luminescent nanoparticles with the magnetic beads, comprising short DNA sequences that were partially complementary to the aptamer sequences, enabled facile separation of the analyte-free conjugates for fluorescent measurement. UV-Visible spectroscopy, Circular Dichroism spectroscopy, Dynamic Light Scattering and Polyacrylamide Gel Electrophoresis techniques were used to characterize the aptamer probes developed. The target-specific luminescent conjugates were applied for multiplex detection of model food pathogens, Salmonella typhimurium, and Staphylococcus aureus, in which the fluorescent emission spectra were obtained under UV excitation at 325nm for quantum dots and NIR excitation at 980nm for upconverting nanoparticles, respectively. The dual-excitation strategy was aimed to minimize cross-talk between the luminescent signals for multiplexed detection, and yielded limit of detection values of 16 and 28cfumL(-1) for Staphylococcus aureus, and Salmonella typhimurium, respectively. By employing a greater number of quantum dots and upconverting nanoparticles with non-overlapping fluorescent emissions, the proposed methodology might be exploited further to detect several analytes, simultaneously. Copyright © 2016 Elsevier B.V. All rights reserved.

Mimicking an Enzyme-Based Colorimetric Aptasensor for Antibiotic Residue Detection in Milk Combining Magnetic Loop-DNA Probes and CHA-Assisted Target Recycling Amplification.

PubMed

Luan, Qian; Gan, Ning; Cao, Yuting; Li, Tianhua

2017-07-19

A mimicking-enzyme-based colorimetric aptasensor was developed for the detection of kanamycin (KANA) in milk using magnetic loop-DNA-NMOF-Pt (m-L-DNA) probes and catalytic hairpin assembly (CHA)-assisted target recycling for signal amplification. The m-L-DNA probes were constructed via hybridization of hairpin DNA H1 (containing aptamer sequence) immobilized magnetic beads (m-H1) and signal DNA (sDNA, partial hybridization with H1) labeled nano Fe-MIL-88NH 2 -Pt (NMOF-Pt-sDNA). In the presence of KANA and complementary hairpin DNA H2, the m-L-DNA probes decomposed and formed an m-H1/KANA intermediate, which triggered the CHA reaction to form a stable duplex strand (m-H1-H2) while releasing KANA again for recycling. Consequently, numerous NMOF-Pt-sDNA as mimicking enzymes can synergistically catalyze 3,3',5,5'-tetramethylbenzidine (TMB) for color development. The aptasensor exhibited high selectivity and sensitivity for KANA in milk with a detection limit of 0.2 pg mL -1 within 30 min. The assay can be conveniently extended for on-site screening of other antibiotics in foods by simply changing the base sequence of the probes.

A Highly Sensitive Oligonucleotide Hybridization Assay for Klebsiella pneumoniae Carbapenemase with the Probes on a Gold Nanoparticles Modified Glassy Carbon Electrode.

PubMed

Pan, Hong-zhi; Yu, Hong- Wei; Wang, Na; Zhang, Ze; Wan, Guang-Cai; Liu, Hao; Guan, Xue; Chang, Dong

2015-01-01

To develop a new electrochemical DNA biosensor for determination of Klebsiella pneumoniae carbapenemase, a highly sensitive and selective electrochemical biosensor for DNA detection was constructed based on a glassy carbon electrode (GCE) modified with gold nanoparticles (Au-nano). The Au-nano/GCE was characterized by scanning electromicroscopy, cyclic voltammetry, and electrochemical impedance spectroscopy. The hybridization detection was measured by differential pulse voltammetry using methylene blue as the hybridization indicator. The dynamic range of detection of the sensor for the target DNA sequences was from 1 × 10(-11) to 1 × 10(-8) M, with an LOD of 1 × 10(-12) M. The DNA biosensor had excellent specificity for distinguishing complementary DNA sequence in the presence of non-complementary and mismatched DNA sequence. The Au-nano/GCE showed significant improvement in electrochemical characteristics, and this biosensor was successfully applied for determination of K. pneumoniae.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Venkadesh, S.; Mandal, P.K.; Gautham, N., E-mail: n_gautham@hotmail.com

Highlights: {yields} This is the first crystal structure of a four-way junction with sticky ends. {yields} Four junction structures bind to each other and form a rhombic cavity. {yields} Each rhombus binds to others to form 'infinite' 2D tiles. {yields} This is an example of bottom-up fabrication of a DNA nano-lattice. -- Abstract: We report here the crystal structure of the partially self-complementary decameric sequence d(CGGCGGCCGC), which self assembles to form a four-way junction with sticky ends. Each junction binds to four others through Watson-Crick base pairing at the sticky ends to form a rhombic structure. The rhombuses bind tomore » each other and form two dimensional tiles. The tiles stack to form the crystal. The crystal diffracted in the space group P1 to a resolution of 2.5 A. The junction has the anti-parallel stacked-X conformation like other junction structures, though the formation of the rhombic net noticeably alters the details of the junction geometry.« less

A single splice site mutation in human-specific ARHGAP11B causes basal progenitor amplification

PubMed Central

Florio, Marta; Namba, Takashi; Pääbo, Svante; Hiller, Michael; Huttner, Wieland B.

2016-01-01

The gene ARHGAP11B promotes basal progenitor amplification and is implicated in neocortex expansion. It arose on the human evolutionary lineage by partial duplication of ARHGAP11A, which encodes a Rho guanosine triphosphatase–activating protein (RhoGAP). However, a lack of 55 nucleotides in ARHGAP11B mRNA leads to loss of RhoGAP activity by GAP domain truncation and addition of a human-specific carboxy-terminal amino acid sequence. We show that these 55 nucleotides are deleted by mRNA splicing due to a single C→G substitution that creates a novel splice donor site. We reconstructed an ancestral ARHGAP11B complementary DNA without this substitution. Ancestral ARHGAP11B exhibits RhoGAP activity but has no ability to increase basal progenitors during neocortex development. Hence, a single nucleotide substitution underlies the specific properties of ARHGAP11B that likely contributed to the evolutionary expansion of the human neocortex. PMID:27957544

RECOVIR Software for Identifying Viruses

NASA Technical Reports Server (NTRS)

Chakravarty, Sugoto; Fox, George E.; Zhu, Dianhui

2013-01-01

Most single-stranded RNA (ssRNA) viruses mutate rapidly to generate a large number of strains with highly divergent capsid sequences. Determining the capsid residues or nucleotides that uniquely characterize these strains is critical in understanding the strain diversity of these viruses. RECOVIR (an acronym for "recognize viruses") software predicts the strains of some ssRNA viruses from their limited sequence data. Novel phylogenetic-tree-based databases of protein or nucleic acid residues that uniquely characterize these virus strains are created. Strains of input virus sequences (partial or complete) are predicted through residue-wise comparisons with the databases. RECOVIR uses unique characterizing residues to identify automatically strains of partial or complete capsid sequences of picorna and caliciviruses, two of the most highly diverse ssRNA virus families. Partition-wise comparisons of the database residues with the corresponding residues of more than 300 complete and partial sequences of these viruses resulted in correct strain identification for all of these sequences. This study shows the feasibility of creating databases of hitherto unknown residues uniquely characterizing the capsid sequences of two of the most highly divergent ssRNA virus families. These databases enable automated strain identification from partial or complete capsid sequences of these human and animal pathogens.

Increasing Success Rates in Developmental Math: The Complementary Role of Individual and Institutional Characteristics

ERIC Educational Resources Information Center

Fong, Kristen E.; Melguizo, Tatiana; Prather, George

2015-01-01

This study tracks students' progression through developmental math sequences and defines progression as both attempting and passing each level of the sequence. A model of successful progression in developmental education was built utilizing individual-, institutional-, and developmental math-level factors. Employing step-wise logistic regression…

A Single Molecular Beacon Probe Is Sufficient for the Analysis of Multiple Nucleic Acid Sequences

PubMed Central

Gerasimova, Yulia V.; Hayson, Aaron; Ballantyne, Jack; Kolpashchikov, Dmitry M.

2010-01-01

Molecular beacon (MB) probes are dual-labeled hairpin-shaped oligodeoxyribonucleotides that are extensively used for real-time detection of specific RNA/DNA analytes. In the MB probe, the loop fragment is complementary to the analyte: therefore, a unique probe is required for the analysis of each new analyte sequence. The conjugation of an oligonucleotide with two dyes and subsequent purification procedures add to the cost of MB probes, thus reducing their application in multiplex formats. Here we demonstrate how one MB probe can be used for the analysis of an arbitrary nucleic acid. The approach takes advantage of two oligonucleotide adaptor strands, each of which contains a fragment complementary to the analyte and a fragment complementary to an MB probe. The presence of the analyte leads to association of MB probe and the two DNA strands in quadripartite complex. The MB probe fluorescently reports the formation of this complex. In this design, the MB does not bind the analyte directly; therefore, the MB sequence is independent of the analyte. In this study one universal MB probe was used to genotype three human polymorphic sites. This approach promises to reduce the cost of multiplex real-time assays and improve the accuracy of single-nucleotide polymorphism genotyping. PMID:20665615

Comparison of impedimetric detection of DNA hybridization on the various biosensors based on modified glassy carbon electrodes with PANHS and nanomaterials of RGO and MWCNTs.

PubMed

Benvidi, Ali; Tezerjani, Marzieh Dehghan; Jahanbani, Shahriar; Mazloum Ardakani, Mohammad; Moshtaghioun, Seyed Mohammad

2016-01-15

In this research, we have developed lable free DNA biosensors based on modified glassy carbon electrodes (GCE) with reduced graphene oxide (RGO) and carbon nanotubes (MWCNTs) for detection of DNA sequences. This paper compares the detection of BRCA1 5382insC mutation using independent glassy carbon electrodes (GCE) modified with RGO and MWCNTs. A probe (BRCA1 5382insC mutation detection (ssDNA)) was then immobilized on the modified electrodes for a specific time. The immobilization of the probe and its hybridization with the target DNA (Complementary DNA) were performed under optimum conditions using different electrochemical techniques such as cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). The proposed biosensors were used for determination of complementary DNA sequences. The non-modified DNA biosensor (1-pyrenebutyric acid-N- hydroxysuccinimide ester (PANHS)/GCE), revealed a linear relationship between ∆Rct and logarithm of the complementary target DNA concentration ranging from 1.0×10(-16)molL(-1) to 1.0×10(-10)mol L(-1) with a correlation coefficient of 0.992, for DNA biosensors modified with multi-wall carbon nanotubes (MWCNTs) and reduced graphene oxide (RGO) wider linear range and lower detection limit were obtained. For ssDNA/PANHS/MWCNTs/GCE a linear range 1.0×10(-17)mol L(-1)-1.0×10(-10)mol L(-1) with a correlation coefficient of 0.993 and for ssDNA/PANHS/RGO/GCE a linear range from 1.0×10(-18)mol L(-1) to 1.0×10(-10)mol L(-1) with a correlation coefficient of 0.985 were obtained. In addition, the mentioned biosensors were satisfactorily applied for discriminating of complementary sequences from noncomplementary sequences, so the mentioned biosensors can be used for the detection of BRCA1-associated breast cancer. Copyright © 2015. Published by Elsevier B.V.

Self-complementary circular codes in coding theory.

PubMed

Fimmel, Elena; Michel, Christian J; Starman, Martin; Strüngmann, Lutz

2018-04-01

Self-complementary circular codes are involved in pairing genetic processes. A maximal [Formula: see text] self-complementary circular code X of trinucleotides was identified in genes of bacteria, archaea, eukaryotes, plasmids and viruses (Michel in Life 7(20):1-16 2017, J Theor Biol 380:156-177, 2015; Arquès and Michel in J Theor Biol 182:45-58 1996). In this paper, self-complementary circular codes are investigated using the graph theory approach recently formulated in Fimmel et al. (Philos Trans R Soc A 374:20150058, 2016). A directed graph [Formula: see text] associated with any code X mirrors the properties of the code. In the present paper, we demonstrate a necessary condition for the self-complementarity of an arbitrary code X in terms of the graph theory. The same condition has been proven to be sufficient for codes which are circular and of large size [Formula: see text] trinucleotides, in particular for maximal circular codes ([Formula: see text] trinucleotides). For codes of small-size [Formula: see text] trinucleotides, some very rare counterexamples have been constructed. Furthermore, the length and the structure of the longest paths in the graphs associated with the self-complementary circular codes are investigated. It has been proven that the longest paths in such graphs determine the reading frame for the self-complementary circular codes. By applying this result, the reading frame in any arbitrary sequence of trinucleotides is retrieved after at most 15 nucleotides, i.e., 5 consecutive trinucleotides, from the circular code X identified in genes. Thus, an X motif of a length of at least 15 nucleotides in an arbitrary sequence of trinucleotides (not necessarily all of them belonging to X) uniquely defines the reading (correct) frame, an important criterion for analyzing the X motifs in genes in the future.

Functional base-pairing interaction between highly conserved elements of U3 small nucleolar RNA and the small ribosomal subunit RNA.

PubMed

Hughes, J M

1996-06-21

The U3 nucleolar RNA has a remarkably wide phyletic distribution extending from the Eukarya to the Archaea. It functions in maturation of the small subunit (SSU) rRNA through a mechanism which is as yet unknown but which involves base-pairing with pre-rRNA. The most conserved part of U3 is within 30 nucleotides of the 5' end, but as yet no function for this domain has been proposed. Elements within this domain are complementary to highly conserved sequences in the SSU rRNA which, in the mature form, fold into a universally conserved pseudoknot. The nature of the complementarity suggests a novel mechanism for U3 function whereby U3 facilitates correct folding of the pseudoknot. Wide phylogenetic comparison provides compelling evidence in support of the interaction in that significant complementary changes have taken place, particularly in the archaeon Sulfolobus, which maintain the base-pairing. Base-substitution mutations in yeast U3 designed to disrupt the base-pairing indicate that the interaction is probably essential. These include cold-sensitivity mutations which exhibit phenotypes similar to U3-depletion, but without impairment of the AO processing step, which occurs within the 5' ETS. These phenotypes are consistent with the destabilization of SSU precursors and partial impairment of the processing steps A1, at the 5' ETS/18 S boundary, and A2, within the ITS1.

HYBRIDIZATION PROPERTIES OF DNA SEQUENCES DIRECTING THE SYNTHESIS OF MESSENGER RNA AND HETEROGENEOUS NUCLEAR RNA

PubMed Central

Greenberg, Jay R.; Perry, Robert P.

1971-01-01

The relationship of the DNA sequences from which polyribosomal messenger RNA (mRNA) and heterogeneous nuclear RNA (NRNA) of mouse L cells are transcribed was investigated by means of hybridization kinetics and thermal denaturation of the hybrids. Hybridization was performed in formamide solutions at DNA excess. Under these conditions most of the hybridizing mRNA and NRNA react at values of Dot (DNA concentration multiplied by time) expected for RNA transcribed from the nonrepeated or rarely repeated fraction of the genome. However, a fraction of both mRNA and NRNA hybridize at values of Dot about 10,000 times lower, and therefore must be transcribed from highly redundant DNA sequences. The fraction of NRNA hybridizing to highly repeated sequences is about 1.7 times greater than the corresponding fraction of mRNA. The hybrids formed by the rapidly reacting fractions of both NRNA and mRNA melt over a narrow temperature range with a midpoint about 11°C below that of native L cell DNA. This indicates that these hybrids consist of partially complementary sequences with approximately 11% mismatching of bases. Hybrids formed by the slowly reacting fraction of NRNA melt within 4°–6°C of native DNA, indicating very little, if any, mismatching of bases. Hybrids of the slowly reacting components of mRNA, formed under conditions of sufficiently low RNA input, have a high thermal stability, similar to that observed for hybrids of the slowly reacting NRNA component. However, when higher inputs of mRNA are used, hybrids are formed which have a strikingly lower thermal stability. This observation can be explained by assuming that there is sufficient similarity among the relatively rare DNA sequences coding for mRNA so that under hybridization conditions, in which these DNA sequences are not truly in excess, reversible hybrids exhibiting a considerable amount of mispairing are formed. The fact that a comparable phenomenon has not been observed for NRNA may mean that there is less similarity among the relatively rare DNA sequences coding for NRNA than there is among the rare sequences coding for mRNA. PMID:4999767

Direct Nanoscale Conversion of Biomolecular Signals into Electronic Information

DTIC Science & Technology

2008-09-22

the electrode surface. In this experiment, the single free cysteine group featured in the GOx structure was exploited to demonstrate that orientation...first with GOx-ssDNA conjugates featuring a sequence complementary to the address strand, then with a non-complementary conjugate and finally with...fully-functional for an enzyme that features a free thiol group, or that can be engineered to incorporate a thiol onto its outer shell

A Dual Interaction Between the 5'- and 3'-Ends of the Melon Necrotic Spot Virus (MNSV) RNA Genome Is Required for Efficient Cap-Independent Translation.

PubMed

Miras, Manuel; Rodríguez-Hernández, Ana M; Romero-López, Cristina; Berzal-Herranz, Alfredo; Colchero, Jaime; Aranda, Miguel A; Truniger, Verónica

2018-01-01

In eukaryotes, the formation of a 5'-cap and 3'-poly(A) dependent protein-protein bridge is required for translation of its mRNAs. In contrast, several plant virus RNA genomes lack both of these mRNA features, but instead have a 3'-CITE (for cap-independent translation enhancer), a RNA element present in their 3'-untranslated region that recruits translation initiation factors and is able to control its cap-independent translation. For several 3'-CITEs, direct RNA-RNA long-distance interactions based on sequence complementarity between the 5'- and 3'-ends are required for efficient translation, as they bring the translation initiation factors bound to the 3'-CITE to the 5'-end. For the carmovirus melon necrotic spot virus (MNSV), a 3'-CITE has been identified, and the presence of its 5'-end in cis has been shown to be required for its activity. Here, we analyze the secondary structure of the 5'-end of the MNSV RNA genome and identify two highly conserved nucleotide sequence stretches that are complementary to the apical loop of its 3'-CITE. In in vivo cap-independent translation assays with mutant constructs, by disrupting and restoring sequence complementarity, we show that the interaction between the 3'-CITE and at least one complementary sequence in the 5'-end is essential for virus RNA translation, although efficient virus translation and multiplication requires both connections. The complementary sequence stretches are invariant in all MNSV isolates, suggesting that the dual 5'-3' RNA:RNA interactions are required for optimal MNSV cap-independent translation and multiplication.

Colorimetric molecular diagnosis of the HIV gag gene using DNAzyme and a complementary DNA-extended primer.

PubMed

Kim, Seong U; Batule, Bhagwan S; Mun, Hyoyoung; Byun, Ju-Young; Shim, Won-Bo; Kim, Min-Gon

2018-02-07

We have developed a novel strategy for the colorimetric detection of PCR products by utilizing a target-specific primer modified at the 5'-end with an anti-DNAzyme sequence. A single-stranded DNAzyme sequence folds into a G-quadruplex structure with hemin and shows strong peroxidase activity. When the complementary strand binds to the DNAzyme sequence, it blocks the formation of the G-quadraduplex structure and loses its peroxidase activity. In the presence of the target gene, PCR amplification proceeds, and anti-DNAzyme sequence modified primers present in the reaction mixture form a double strand through primer extension. Therefore, it does not block the DNAzyme sequence. Further, a colorimetric signal is generated by the addition of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (ABTS) and H 2 O 2 at the end of the reaction. We have successfully detected a single copy of the HIV type 1 gag gene in buffer and 10 copies in human serum. The strategy developed could be used to detect DNA and RNA in complex biological samples by simple primer designing that includes DNAzyme and a DNA extended primer.

A Compact 5.5 GHz Band-Rejected UWB Antenna Using Complementary Split Ring Resonators

PubMed Central

Islam, M. M.; Faruque, M. R. I.; Islam, M. T.

2014-01-01

A band-removal property employing microwave frequencies using complementary split ring resonators (CSRRs) is applied to design a compact UWB antenna wishing for the rejection of some frequency band, which is meanwhile exercised by the existing wireless applications. The reported antenna comprises optimization of a circular radiating patch, in which slotted complementary SRRs are implanted. It is printed on low dielectric FR4 substrate material fed by a partial ground plane and a microstrip line. Validated results exhibit that the reported antenna shows a wide bandwidth covering from 3.45 to more than 12 GHz, with a compact dimension of 22 × 26 mm2, and VSWR < 2, observing band elimination of 5.5 GHz WLAN band. PMID:24971379

HIVsirDB: a database of HIV inhibiting siRNAs.

PubMed

Tyagi, Atul; Ahmed, Firoz; Thakur, Nishant; Sharma, Arun; Raghava, Gajendra P S; Kumar, Manoj

2011-01-01

Human immunodeficiency virus (HIV) is responsible for millions of deaths every year. The current treatment involves the use of multiple antiretroviral agents that may harm patients due to their toxic nature. RNA interference (RNAi) is a potent candidate for the future treatment of HIV, uses short interfering RNA (siRNA/shRNA) for silencing HIV genes. In this study, attempts have been made to create a database HIVsirDB of siRNAs responsible for silencing HIV genes. HIVsirDB is a manually curated database of HIV inhibiting siRNAs that provides comprehensive information about each siRNA or shRNA. Information was collected and compiled from literature and public resources. This database contains around 750 siRNAs that includes 75 partially complementary siRNAs differing by one or more bases with the target sites and over 100 escape mutant sequences. HIVsirDB structure contains sixteen fields including siRNA sequence, HIV strain, targeted genome region, efficacy and conservation of target sequences. In order to facilitate user, many tools have been integrated in this database that includes; i) siRNAmap for mapping siRNAs on target sequence, ii) HIVsirblast for BLAST search against database, iii) siRNAalign for aligning siRNAs. HIVsirDB is a freely accessible database of siRNAs which can silence or degrade HIV genes. It covers 26 types of HIV strains and 28 cell types. This database will be very useful for developing models for predicting efficacy of HIV inhibiting siRNAs. In summary this is a useful resource for researchers working in the field of siRNA based HIV therapy. HIVsirDB database is accessible at http://crdd.osdd.net/raghava/hivsir/.

DNA–DNA kissing complexes as a new tool for the assembly of DNA nanostructures

PubMed Central

Barth, Anna; Kobbe, Daniela; Focke, Manfred

2016-01-01

Kissing-loop annealing of nucleic acids occurs in nature in several viruses and in prokaryotic replication, among other circumstances. Nucleobases of two nucleic acid strands (loops) interact with each other, although the two strands cannot wrap around each other completely because of the adjacent double-stranded regions (stems). In this study, we exploited DNA kissing-loop interaction for nanotechnological application. We functionalized the vertices of DNA tetrahedrons with DNA stem-loop sequences. The complementary loop sequence design allowed the hybridization of different tetrahedrons via kissing-loop interaction, which might be further exploited for nanotechnology applications like cargo transport and logical elements. Importantly, we were able to manipulate the stability of those kissing-loop complexes based on the choice and concentration of cations, the temperature and the number of complementary loops per tetrahedron either at the same or at different vertices. Moreover, variations in loop sequences allowed the characterization of necessary sequences within the loop as well as additional stability control of the kissing complexes. Therefore, the properties of the presented nanostructures make them an important tool for DNA nanotechnology. PMID:26773051

Different strategies for the detection of bioagents using electrochemical and photoelectrochemical genosensors

NASA Astrophysics Data System (ADS)

Voccia, Diego; Bettazi, Francesca; Palchetti, Ilaria

2015-10-01

In recent years various kinds of biosensors for the detection of pathogens have been developed. A genosensor consists in the immobilization, onto the surface of a chosen transducer, of an oligonucleotide with a specific base sequence called capture probe. The complementary sequence (the analytical target, i.e. a specific sequence of the DNA/RNA of the pathogen) present in the sample is recognized and captured by the probe through the hybridization reaction. The evaluation of the extent of the hybridization allows one to confirm whether the sample contains the complementary sequence of the probe or not. Electrochemical transducers have received considerable attention in connection with the detection of DNA hybridization. Moreover, recently, with the emergence of novel photoelectrochemically active species and new detection schemes, photoelectrochemistry has resulted in substantial progress in its analytical performance for biosensing applications. In this paper, some examples of electrochemical genosensors for multiplexed pathogen detection are shown. Moreover, the preliminary experiments towards the development of a photoelectrochemical genosensor using a TiO2 - nanocrystal-modified ITO electrode are discussed.

Two RNAs or DNAs May Artificially Fuse Together at a Short Homologous Sequence (SHS) during Reverse Transcription or Polymerase Chain Reactions, and Thus Reporting an SHS-Containing Chimeric RNA Requires Extra Caution

PubMed Central

Xie, Bingkun; Yang, Wei; Ouyang, Yongchang; Chen, Lichan; Jiang, Hesheng; Liao, Yuying; Liao, D. Joshua

2016-01-01

Tens of thousands of chimeric RNAs have been reported. Most of them contain a short homologous sequence (SHS) at the joining site of the two partner genes but are not associated with a fusion gene. We hypothesize that many of these chimeras may be technical artifacts derived from SHS-caused mis-priming in reverse transcription (RT) or polymerase chain reactions (PCR). We cloned six chimeric complementary DNAs (cDNAs) formed by human mitochondrial (mt) 16S rRNA sequences at an SHS, which were similar to several expression sequence tags (ESTs).These chimeras, which could not be detected with cDNA protection assay, were likely formed because some regions of the 16S rRNA are reversely complementary to another region to form an SHS, which allows the downstream sequence to loop back and anneal at the SHS to prime the synthesis of its complementary strand, yielding a palindromic sequence that can form a hairpin-like structure.We identified a 16S rRNA that ended at the 4th nucleotide(nt) of the mt-tRNA-leu was dominant and thus should be the wild type. We also cloned a mouse Bcl2-Nek9 chimeric cDNA that contained a 5-nt unmatchable sequence between the two partners, contained two copies of the reverse primer in the same direction but did not contain the forward primer, making it unclear how this Bcl2-Nek9 was formed and amplified. Moreover, a cDNA was amplified because one primer has 4 nts matched to the template, suggesting that there may be many more artificial cDNAs than we have realized, because the nuclear and mt genomes have many more 4-nt than 5-nt or longer homologues. Altogether, the chimeric cDNAs we cloned are good examples suggesting that many cDNAs may be artifacts due to SHS-caused mis-priming and thus greater caution should be taken when new sequence is obtained from a technique involving DNA polymerization. PMID:27148738

Method for identifying and quantifying nucleic acid sequence aberrations

DOEpatents

Lucas, Joe N.; Straume, Tore; Bogen, Kenneth T.

1998-01-01

A method for detecting nucleic acid sequence aberrations by detecting nucleic acid sequences having both a first and a second nucleic acid sequence type, the presence of the first and second sequence type on the same nucleic acid sequence indicating the presence of a nucleic acid sequence aberration. The method uses a first hybridization probe which includes a nucleic acid sequence that is complementary to a first sequence type and a first complexing agent capable of attaching to a second complexing agent and a second hybridization probe which includes a nucleic acid sequence that selectively hybridizes to the second nucleic acid sequence type over the first sequence type and includes a detectable marker for detecting the second hybridization probe.

Method for identifying and quantifying nucleic acid sequence aberrations

DOEpatents

Lucas, J.N.; Straume, T.; Bogen, K.T.

1998-07-21

A method is disclosed for detecting nucleic acid sequence aberrations by detecting nucleic acid sequences having both a first and a second nucleic acid sequence type, the presence of the first and second sequence type on the same nucleic acid sequence indicating the presence of a nucleic acid sequence aberration. The method uses a first hybridization probe which includes a nucleic acid sequence that is complementary to a first sequence type and a first complexing agent capable of attaching to a second complexing agent and a second hybridization probe which includes a nucleic acid sequence that selectively hybridizes to the second nucleic acid sequence type over the first sequence type and includes a detectable marker for detecting the second hybridization probe. 11 figs.

DNA remodelling by Strict Partial Endoreplication in orchids, an original process in the plant kingdom.

PubMed

Brown, Spencer C; Bourge, Mickaël; Maunoury, Nicolas; Wong, Maurice; Bianchi, Michele Wolfe; Lepers-Andrzejewski, Sandra; Besse, Pascale; Siljak-Yakovlev, Sonja; Dron, Michel; Satiat-Jeunemaître, Béatrice

2017-04-13

DNA remodelling during endoreplication appears to be a strong developmental characteristic in orchids. In this study, we analysed DNA content and nuclei in 41 species of orchids to further map the genome evolution in this plant family. We demonstrate that the DNA remodelling observed in 36 out of 41 orchids studied corresponds to strict partial endoreplication. Such process is developmentally regulated in each wild species studied. Cytometry data analyses allowed us to propose a model where nuclear states 2C, 4E, 8E, etc. form a series comprising a fixed proportion, the euploid genome 2C, plus 2 to 32 additional copies of a complementary part of the genome. The fixed proportion ranged from 89% of the genome in Vanilla mexicana down to 19% in V. pompona, the lowest value for all 148 orchids reported. Insterspecific hybridisation did not suppress this phenomenon. Interestingly, this process was not observed in mass-produced epiphytes. Nucleolar volumes grow with the number of endocopies present, coherent with high transcription activity in endoreplicated nuclei. Our analyses suggest species-specific chromatin rearrangement. Towards understanding endoreplication, V. planifolia constitutes a tractable system for isolating the genomic sequences that confer an advantage via endoreplication from those that apparently suffice at diploid level. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Phylogenetic characterization of Canine Parvovirus VP2 partial sequences from symptomatic dogs samples.

PubMed

Zienius, D; Lelešius, R; Kavaliauskis, H; Stankevičius, A; Šalomskas, A

2016-01-01

The aim of the present study was to detect canine parvovirus (CPV) from faecal samples of clinically ill domestic dogs by polymerase chain reaction (PCR) followed by VP2 gene partial sequencing and molecular characterization of circulating strains in Lithuania. Eleven clinically and antigen-tested positive dog faecal samples, collected during the period of 2014-2015, were investigated by using PCR. The phylogenetic investigations indicated that the Lithuanian CPV VP2 partial sequences (3025-3706 cds) were closely related and showed 99.0-99.9% identity. All Lithuanian sequences were associated with one phylogroup, but grouped in different clusters. Ten of investigated Lithuanian CPV VP2 sequences were closely associated with CPV 2a antigenic variant (99.4% nt identity). Five CPV VP2 sequences from Lithuania were related to CPV-2a, but were rather divergent (6.8 nt differences). Only one CPV VP2 sequence from Lithuania was associated (99.3% nt identity) with CPV-2b VP2 sequences from France, Italy, USA and Korea. The four of eleven investigated Lithuanian dogs with CPV infection symptoms were vaccinated with CPV-2 vaccine, but their VP2 sequences were phylogenetically distantly associated with CPV vaccine strains VP2 sequences (11.5-15.8 nt differences). Ten Lithuanian CPV VP2 sequences had monophyletic relations among the close geographically associated samples, but five of them were rather divergent (1.0% less sequence similarity). The one Lithuanian CPV VP2 sequence was closely related with CPV-2b antigenic variant. All the Lithuanian CPV VP2 partial sequences were conservative and phylogenetically low associated with most commonly used CPV vaccine strains.

Biorecognition by DNA oligonucleotides after Exposure to Photoresists and Resist Removers

PubMed Central

Dean, Stacey L.; Morrow, Thomas J.; Patrick, Sue; Li, Mingwei; Clawson, Gary; Mayer, Theresa S.; Keating, Christine D.

2013-01-01

Combining biological molecules with integrated circuit technology is of considerable interest for next generation sensors and biomedical devices. Current lithographic microfabrication methods, however, were developed for compatibility with silicon technology rather than bioorganic molecules and consequently it cannot be assumed that biomolecules will remain attached and intact during on-chip processing. Here, we evaluate the effects of three common photoresists (Microposit S1800 series, PMGI SF6, and Megaposit SPR 3012) and two photoresist removers (acetone and 1165 remover) on the ability of surface-immobilized DNA oligonucleotides to selectively recognize their reverse-complementary sequence. Two common DNA immobilization methods were compared: adsorption of 5′-thiolated sequences directly to gold nanowires and covalent attachment of 5′-thiolated sequences to surface amines on silica coated nanowires. We found that acetone had deleterious effects on selective hybridization as compared to 1165 remover, presumably due to incomplete resist removal. Use of the PMGI photoresist, which involves a high temperature bake step, was detrimental to the later performance of nanowire-bound DNA in hybridization assays, especially for DNA attached via thiol adsorption. The other three photoresists did not substantially degrade DNA binding capacity or selectivity for complementary DNA sequences. To determine if the lithographic steps caused more subtle damage, we also tested oligonucleotides containing a single base mismatch. Finally, a two-step photolithographic process was developed and used in combination with dielectrophoretic nanowire assembly to produce an array of doubly-contacted, electrically isolated individual nanowire components on a chip. Post-fabrication fluorescence imaging indicated that nanowire-bound DNA was present and able to selectively bind complementary strands. PMID:23952639

Construction Strategy for an Internal Amplification Control for Real-Time Diagnostic Assays Using Nucleic Acid Sequence-Based Amplification: Development and Clinical Application

PubMed Central

Rodríguez-Lázaro, David; D'Agostino, Martin; Pla, Maria; Cook, Nigel

2004-01-01

An important analytical control in molecular amplification-based methods is an internal amplification control (IAC), which should be included in each reaction mixture. An IAC is a nontarget nucleic acid sequence which is coamplified simultaneously with the target sequence. With negative results for the target nucleic acid, the absence of an IAC signal indicates that amplification has failed. A general strategy for the construction of an IAC for inclusion in molecular beacon-based real-time nucleic acid sequence-based amplification (NASBA) assays is presented. Construction proceeds in two phases. In the first phase, a double-stranded DNA molecule that contains nontarget sequences flanked by target sequences complementary to the NASBA primers is produced. At the 5′ end of this DNA molecule is a T7 RNA polymerase binding sequence. In the second phase of construction, RNA transcripts are produced from the DNA by T7 RNA polymerase. This RNA is the IAC; it is amplified by the target NASBA primers and is detected by a molecular beacon probe complementary to the internal nontarget sequences. As a practical example, an IAC for use in an assay for the detection of Mycobacterium avium subsp. paratuberculosis is described, its incorporation and optimization within the assay are detailed, and its application to spiked and natural clinical samples is shown to illustrate the correct interpretation of the diagnostic results. PMID:15583319

Uprobe: a genome-wide universal probe resource for comparative physical mapping in vertebrates.

PubMed

Kellner, Wendy A; Sullivan, Robert T; Carlson, Brian H; Thomas, James W

2005-01-01

Interspecies comparisons are important for deciphering the functional content and evolution of genomes. The expansive array of >70 public vertebrate genomic bacterial artificial chromosome (BAC) libraries can provide a means of comparative mapping, sequencing, and functional analysis of targeted chromosomal segments that is independent and complementary to whole-genome sequencing. However, at the present time, no complementary resource exists for the efficient targeted physical mapping of the majority of these BAC libraries. Universal overgo-hybridization probes, designed from regions of sequenced genomes that are highly conserved between species, have been demonstrated to be an effective resource for the isolation of orthologous regions from multiple BAC libraries in parallel. Here we report the application of the universal probe design principal across entire genomes, and the subsequent creation of a complementary probe resource, Uprobe, for screening vertebrate BAC libraries. Uprobe currently consists of whole-genome sets of universal overgo-hybridization probes designed for screening mammalian or avian/reptilian libraries. Retrospective analysis, experimental validation of the probe design process on a panel of representative BAC libraries, and estimates of probe coverage across the genome indicate that the majority of all eutherian and avian/reptilian genes or regions of interest can be isolated using Uprobe. Future implementation of the universal probe design strategy will be used to create an expanded number of whole-genome probe sets that will encompass all vertebrate genomes.

Electrochemical DNA biosensor for bovine papillomavirus detection using polymeric film on screen-printed electrode.

PubMed

Nascimento, Gustavo A; Souza, Elaine V M; Campos-Ferreira, Danielly S; Arruda, Mariana S; Castelletti, Carlos H M; Wanderley, Marcela S O; Ekert, Marek H F; Bruneska, Danyelly; Lima-Filho, José L

2012-01-01

A new electrochemical DNA biosensor for bovine papillomavirus (BPV) detection that was based on screen-printed electrodes was comprehensively studied by electrochemical methods of cyclic voltammetry (CV) and differential pulse voltammetry (DPV). A BPV probe was immobilised on a working electrode (gold) modified with a polymeric film of poly-L-lysine (PLL) and chitosan. The experimental design was carried out to evaluate the influence of polymers, probe concentration (BPV probe) and immobilisation time on the electrochemical reduction of methylene blue (MB). The polymer poly-L-lysine (PLL), a probe concentration of 1 μM and an immobilisation time of 60 min showed the best result for the BPV probe immobilisation. With the hybridisation of a complementary target sequence (BPV target), the electrochemical signal decreased compared to a BPV probe immobilised on the modified PLL-gold electrode. Viral DNA that was extracted from cattle with papillomatosis also showed a decrease in the MB electrochemical reduction, which suggested that the decreased electrochemical signal corresponded to a bovine papillomavirus infection. The hybridisation specificity experiments further indicated that the biosensor could discriminate the complementary sequence from the non-complementary sequence. Thus, the results showed that the development of analytical devices, such as a biosensor, could assist in the rapid and efficient detection of bovine papillomavirus DNA and help in the prevention and treatment of papillomatosis in cattle. Copyright © 2012 Elsevier B.V. All rights reserved.

Detection of a new bat gammaherpesvirus in the Philippines.

PubMed

Watanabe, Shumpei; Ueda, Naoya; Iha, Koichiro; Masangkay, Joseph S; Fujii, Hikaru; Alviola, Phillip; Mizutani, Tetsuya; Maeda, Ken; Yamane, Daisuke; Walid, Azab; Kato, Kentaro; Kyuwa, Shigeru; Tohya, Yukinobu; Yoshikawa, Yasuhiro; Akashi, Hiroomi

2009-08-01

A new bat herpesvirus was detected in the spleen of an insectivorous bat (Hipposideros diadema, family Hipposideridae) collected on Panay Island, the Philippines. PCR analyses were performed using COnsensus-DEgenerate Hybrid Oligonucleotide Primers (CODEHOPs) targeting the herpesvirus DNA polymerase (DPOL) gene. Although we obtained PCR products with CODEHOPs, direct sequencing using the primers was not possible because of high degree of degeneracy. Direct sequencing technology developed in our rapid determination system of viral RNA sequences (RDV) was applied in this study, and a partial DPOL nucleotide sequence was determined. In addition, a partial gB gene nucleotide sequence was also determined using the same strategy. We connected the partial gB and DPOL sequences with long-distance PCR, and a 3741-bp nucleotide fragment, including the 3' part of the gB gene and the 5' part of the DPOL gene, was finally determined. Phylogenetic analysis showed that the sequence was novel and most similar to those of the subfamily Gammaherpesvirinae.

Teaching Note--Integrating Theory and Research Methods in a First-Year Doctoral Sequence or Program

ERIC Educational Resources Information Center

Pollio, David E.; MacNeil, Gordon; Womack, Bethany; Brazeal, Michelle; Church, Wesley T., II

2016-01-01

This teaching note describes an innovative process in which faculty members worked collaboratively to create an integrated three-course sequence of requisite course content in a PhD program, developed complementary assignments, and coordinated a classroom experience that led to the creation of an individualized area statement and eventual…

Methods for chromosome-specific staining

DOEpatents

Gray, Joe W.; Pinkel, Daniel

1995-01-01

Methods and compositions for chromosome-specific staining are provided. Compositions comprise heterogenous mixtures of labeled nucleic acid fragments having substantially complementary base sequences to unique sequence regions of the chromosomal DNA for which their associated staining reagent is specific. Methods include methods for making the chromosome-specific staining compositions of the invention, and methods for applying the staining compositions to chromosomes.

High-speed optical phase-shifting apparatus

DOEpatents

Zortman, William A.

2016-11-08

An optical phase shifter includes an optical waveguide, a plurality of partial phase shifting elements arranged sequentially, and control circuitry electrically coupled to the partial phase shifting elements. The control circuitry is adapted to provide an activating signal to each of the N partial phase shifting elements such that the signal is delayed by a clock cycle between adjacent partial phase shifting elements in the sequence. The transit time for a guided optical pulse train between the input edges of consecutive partial phase shifting elements in the sequence is arranged to be equal to a clock cycle, thereby enabling pipelined processing of the optical pulses.

In situ hybridization in paracoccidioidomycosis.

PubMed

De Brito, T; Sandhu, G S; Kline, B C; Aleff, R A; Sandoval, M P; Santos, R T; Brandão, A A; Lacaz, C S

1999-06-01

In situ hybridization (ISH) was performed using oral biopsies from patients with paracoccidioidomycosis and guinea pig testes inoculated with a culture of Paracoccidioides brasiliensis isolated from soil, employing both a 14 base-pair specific oligoprobe (ACT CCC CCG TGG TC) and its complementary sequence. When combining ISH with the Gridley stain which detects fungal cell walls, about 2-3% of the fungal cells present in the tissues were labelled. When the complementary probe was used, labelling was higher, reaching the 3% level.

COMplementary Primer ASymmetric PCR (COMPAS-PCR) Applied to the Identification of Salmo salar, Salmo trutta and Their Hybrids

PubMed Central

2016-01-01

Avoiding complementarity between primers when designing a PCR assay constitutes a central rule strongly anchored in the mind of the molecular scientist. 3’-complementarity will extend the primers during PCR elongation using one another as template, consequently disabling further possible involvement in traditional target amplification. However, a 5’-complementarity will leave the primers unchanged during PCR cycles, albeit sequestered to one another, therefore also suppressing target amplification. We show that 5’-complementarity between primers may be exploited in a new PCR method called COMplementary-Primer-Asymmetric (COMPAS)-PCR, using asymmetric primer concentrations to achieve target PCR amplification. Moreover, such a design may paradoxically reduce spurious non-target amplification by actively sequestering the limiting primer. The general principles were demonstrated using 5S rDNA direct repeats as target sequences to design a species-specific assay for identifying Salmo salar and Salmo trutta using almost fully complementary primers overlapping the same target sequence. Specificity was enhanced by using 3’-penultimate point mutations and the assay was further developed to enable identification of S. salar x S. trutta hybrids by High Resolution Melt analysis in a 35 min one-tube assay. This small paradigm shift, using highly complementary primers for PCR, should help develop robust assays that previously would not be considered. PMID:27783658

An algorithm to compute the sequency ordered Walsh transform

NASA Technical Reports Server (NTRS)

Larsen, H.

1976-01-01

A fast sequency-ordered Walsh transform algorithm is presented; this sequency-ordered fast transform is complementary to the sequency-ordered fast Walsh transform introduced by Manz (1972) and eliminating gray code reordering through a modification of the basic fast Hadamard transform structure. The new algorithm retains the advantages of its complement (it is in place and is its own inverse), while differing in having a decimation-in time structure, accepting data in normal order, and returning the coefficients in bit-reversed sequency order. Applications include estimation of Walsh power spectra for a random process, sequency filtering and computing logical autocorrelations, and selective bit reversing.

Species delimitation in the Central African herbs Haumania (Marantaceae) using georeferenced nuclear and chloroplastic DNA sequences.

PubMed

Ley, A C; Hardy, O J

2010-11-01

Species delimitation is a fundamental biological concept which is frequently discussed and altered to integrate new insights. These revealed that speciation is not a one step phenomenon but an ongoing process and morphological characters alone are not sufficient anymore to properly describe the results of this process. Here we want to assess the degree of speciation in two closely related lianescent taxa from the tropical African genus Haumania which display distinct vegetative traits despite a high similarity in reproductive traits and a partial overlap in distribution area which might facilitate gene flow. To this end, we combined phylogenetic and phylogeographic analyses using nuclear (nr) and chloroplast (cp) DNA sequences in comparison to morphological species descriptions. The nuclear dataset unambiguously supports the morphological species concept in Haumania. However, the main chloroplastic haplotypes are shared between species and, although a geographic analysis of cpDNA diversity confirms that individuals from the same taxon are more related than individuals from distinct taxa, cp-haplotypes display correlated geographic distributions between species. Hybridization is the most plausible reason for this pattern. A scenario involving speciation in geographic isolation followed by range expansion is outlined. The study highlights the gain of information on the speciation process in Haumania by adding georeferenced molecular data to the morphological characteristics. It also shows that nr and cp sequence data might provide different but complementary information, questioning the reliability of the unique use of chloroplast data for species recognition by DNA barcoding. Copyright © 2010 Elsevier Inc. All rights reserved.

Forensically Relevant Blow Flies in Lebanon Survey and Identification Using Molecular Markers (Diptera: Calliphoridae).

PubMed

Shayya, Salman; Debruyne, Régis; Nel, André; Azar, Dany

2018-05-12

Calliphoridae are among the first insects associated to decomposing animal remains. We have collected 1,841 specimens of three calliphorid genera: Calliphora, Lucilia, and Chrysomya, from different Lebanese localities as a first step in implementing a database of insects of forensic relevance for the country. Blow-flies are crucial for the estimation of the postmortem interval. DNA-based identification is a rapid and accurate method, often used for morphologically similar species, especially for immatures or incomplete specimens. In this study, we test the suitability of three genetic markers to identify adults and immature stages of calliphorids, viz., mitochondrial cytochrome c oxidase subunit I (COI) barcode, a region including partial sequences of mitochondrial Cyt-b-tRNAser-ND1, and second internal transcribed spacer (ITS2) region of nuclear ribosomal DNA. Forty Lebanese specimens of various developmental stages (egg, larva, wandering third instar, pupa, newly emerged adult, and mature adult) were identified among the three calliphorid genera: Calliphora, Lucilia, and Chrysomya, and compared with published sequences to confirm their specific assignation. Phylogenetic analyses showed the robustness of ITS2 and COI to identify calliphorids at species level. Nevertheless, ITS2 failed to discriminate Lucilia caesar (Linnaeus) (Diptera, Calliphoridae) from Lucilia illustris (Meigen) (Diptera, Calliphoridae), and COI had a similar issue with Lucilia sericata (Meigen) (Diptera, Calliphoridae) and Lucilia cuprina (Wiedemann) (Diptera, Calliphoridae). Thus, these two markers are complementary. This work contributes new nucleotide sequences for Lebanon. It is a first step in implementing a molecular database of forensic relevant insects for the country.

Genetic characterization of the partial mitochondrial cytochrome oxidase c subunit I (cox 1) gene of the zoonotic parasitic nematode, Ancylostoma ceylanicum from humans, dogs and cats.

PubMed

Ngui, Romano; Mahdy, Mohammed A K; Chua, Kek Heng; Traub, Rebecca; Lim, Yvonne A L

2013-10-01

Ancylostoma ceylanicum is the only zoonotic hookworm species that is able to produce patent infections in humans with the majority of cases reported in South East Asia. Over the past few years, there have been an increasing number of studies investigating the prevalence of this parasitic zoonosis using molecular diagnostic tools and a single genetic locus as marker for species identification. As there can be limitations in using a single genetic locus for epidemiological studies and genetic discrimination, the complementary use of a more variable locus will provide additional evidence to support the zoonotic exchange of hookworm species between humans and animals. In the present study, the cytochrome c oxidase subunit 1 (cox 1) sequence of A. ceylanicum from positive human and animal fecal samples were determined and compared with published reference sequences. Phylogenetic analysis demonstrated that isolates of A. ceylanicum were divided into two clusters, one consisting 3 human isolates and the other comprising 19 isolates of human and animal origin from different geographical locations within Malaysia. The two groups of A. ceylanicum could be distinguished from one another through five fixed nucleotide differences at locations 891, 966, 1008, 1077 and 1083. The detection of genetically distinct groups and considerable level of genetic variation within the cox 1 sequence of A. ceylanicum might suggest potential haplotype-linked differences in zoonotic, epidemiological and pathobiological characteristics, a hypothesis that still needs further investigation. Copyright © 2013 Elsevier B.V. All rights reserved.

The DNA binding site specificity and antiproliferative property of ternary Pt(II) and Zn(II) complexes of phenanthroline and N,N'-ethylenediaminediacetic acid.

PubMed

Nakamura, Yusuke; Taruno, Yoko; Sugimoto, Masashi; Kitamura, Yusuke; Seng, Hoi Ling; Kong, Siew Ming; Ng, Chew Hee; Chikira, Makoto

2013-03-14

The binding site specificity of the ternary complexes, [M(II)(phen)(edda)] (M(II) = Pt(2+) and Zn(2+); phen = 1,10-phenanthroline; edda = N,N'-ethylenediaminediacetic acid), for the self-complementary oligonucleotides (ODNs), ds(C(1)G(2)C(3)G(4)A(5)A(6)T(7)T(8)C(9)G(10)C(11)G(12))(2) (ODN1) and ds(C(1)G(2)C(3)G(4)T(5)A(6)T(7)A(8)C(9)G(10)C(11)G(12))(2) (ODN2), was studied by NMR measurements. The results indicated that [Pt(ii)(phen)(edda)] was partially intercalated between C(3)/G(10) and G(4)/C(9) base pairs of ODN1 and ODN2 in the major grooves, whereas [Zn(II)(phen)(edda)] was bound specifically to the TATA region of ODN2 in the minor groove and to the terminal G(2)/C(11) base pair of ODN1 in the major groove. The preference for the TATA sequence over the AATT sequence in the binding of [Zn(phen)(edda)] was attributed to the wider minor groove width of the TATA sequence. The bindings of the complexes to ct-DNA were also studied by UV, CD, and fluorescence spectroscopy. Additionally, the antiproliferative property of [Pt(II)(phen)(edda)] towards MCF7 breast cancer cells and normal MCF10-A cells was compared with that of [Zn(II)(phen)(edda)].

Characterizing partial AZFc deletions of the Y chromosome with amplicon-specific sequence markers

PubMed Central

Navarro-Costa, Paulo; Pereira, Luísa; Alves, Cíntia; Gusmão, Leonor; Proença, Carmen; Marques-Vidal, Pedro; Rocha, Tiago; Correia, Sónia C; Jorge, Sónia; Neves, António; Soares, Ana P; Nunes, Joaquim; Calhaz-Jorge, Carlos; Amorim, António; Plancha, Carlos E; Gonçalves, João

2007-01-01

Background The AZFc region of the human Y chromosome is a highly recombinogenic locus containing multi-copy male fertility genes located in repeated DNA blocks (amplicons). These AZFc gene families exhibit slight sequence variations between copies which are considered to have functional relevance. Yet, partial AZFc deletions yield phenotypes ranging from normospermia to azoospermia, thwarting definite conclusions on their real impact on fertility. Results The amplicon content of partial AZFc deletion products was characterized with novel amplicon-specific sequence markers. Data indicate that partial AZFc deletions are a male infertility risk [odds ratio: 5.6 (95% CI: 1.6–30.1)] and although high diversity of partial deletion products and sequence conversion profiles were recorded, the AZFc marker profiles detected in fertile men were also observed in infertile men. Additionally, the assessment of rearrangement recurrence by Y-lineage analysis indicated that while partial AZFc deletions occurred in highly diverse samples, haplotype diversity was minimal in fertile men sharing identical marker profiles. Conclusion Although partial AZFc deletion products are highly heterogeneous in terms of amplicon content, this plasticity is not sufficient to account for the observed phenotypical variance. The lack of causative association between the deletion of specific gene copies and infertility suggests that AZFc gene content might be part of a multifactorial network, with Y-lineage evolution emerging as a possible phenotype modulator. PMID:17903263

FMLRC: Hybrid long read error correction using an FM-index.

PubMed

Wang, Jeremy R; Holt, James; McMillan, Leonard; Jones, Corbin D

2018-02-09

Long read sequencing is changing the landscape of genomic research, especially de novo assembly. Despite the high error rate inherent to long read technologies, increased read lengths dramatically improve the continuity and accuracy of genome assemblies. However, the cost and throughput of these technologies limits their application to complex genomes. One solution is to decrease the cost and time to assemble novel genomes by leveraging "hybrid" assemblies that use long reads for scaffolding and short reads for accuracy. We describe a novel method leveraging a multi-string Burrows-Wheeler Transform with auxiliary FM-index to correct errors in long read sequences using a set of complementary short reads. We demonstrate that our method efficiently produces significantly more high quality corrected sequence than existing hybrid error-correction methods. We also show that our method produces more contiguous assemblies, in many cases, than existing state-of-the-art hybrid and long-read only de novo assembly methods. Our method accurately corrects long read sequence data using complementary short reads. We demonstrate higher total throughput of corrected long reads and a corresponding increase in contiguity of the resulting de novo assemblies. Improved throughput and computational efficiency than existing methods will help better economically utilize emerging long read sequencing technologies.

Identification of human microRNA targets from isolated argonaute protein complexes.

PubMed

Beitzinger, Michaela; Peters, Lasse; Zhu, Jia Yun; Kremmer, Elisabeth; Meister, Gunter

2007-06-01

MicroRNAs (miRNAs) constitute a class of small non-coding RNAs that regulate gene expression on the level of translation and/or mRNA stability. Mammalian miRNAs associate with members of the Argonaute (Ago) protein family and bind to partially complementary sequences in the 3' untranslated region (UTR) of specific target mRNAs. Computer algorithms based on factors such as free binding energy or sequence conservation have been used to predict miRNA target mRNAs. Based on such predictions, up to one third of all mammalian mRNAs seem to be under miRNA regulation. However, due to the low degree of complementarity between the miRNA and its target, such computer programs are often imprecise and therefore not very reliable. Here we report the first biochemical identification approach of miRNA targets from human cells. Using highly specific monoclonal antibodies against members of the Ago protein family, we co-immunoprecipitate Ago-bound mRNAs and identify them by cloning. Interestingly, most of the identified targets are also predicted by different computer programs. Moreover, we randomly analyzed six different target candidates and were able to experimentally validate five as miRNA targets. Our data clearly indicate that miRNA targets can be experimentally identified from Ago complexes and therefore provide a new tool to directly analyze miRNA function.

MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species

PubMed Central

Miya, M.; Sato, Y.; Fukunaga, T.; Sado, T.; Poulsen, J. Y.; Sato, K.; Minamoto, T.; Yamamoto, S.; Yamanaka, H.; Araki, H.; Kondoh, M.; Iwasaki, W.

2015-01-01

We developed a set of universal PCR primers (MiFish-U/E) for metabarcoding environmental DNA (eDNA) from fishes. Primers were designed using aligned whole mitochondrial genome (mitogenome) sequences from 880 species, supplemented by partial mitogenome sequences from 160 elasmobranchs (sharks and rays). The primers target a hypervariable region of the 12S rRNA gene (163–185 bp), which contains sufficient information to identify fishes to taxonomic family, genus and species except for some closely related congeners. To test versatility of the primers across a diverse range of fishes, we sampled eDNA from four tanks in the Okinawa Churaumi Aquarium with known species compositions, prepared dual-indexed libraries and performed paired-end sequencing of the region using high-throughput next-generation sequencing technologies. Out of the 180 marine fish species contained in the four tanks with reference sequences in a custom database, we detected 168 species (93.3%) distributed across 59 families and 123 genera. These fishes are not only taxonomically diverse, ranging from sharks and rays to higher teleosts, but are also greatly varied in their ecology, including both pelagic and benthic species living in shallow coastal to deep waters. We also sampled natural seawaters around coral reefs near the aquarium and detected 93 fish species using this approach. Of the 93 species, 64 were not detected in the four aquarium tanks, rendering the total number of species detected to 232 (from 70 families and 152 genera). The metabarcoding approach presented here is non-invasive, more efficient, more cost-effective and more sensitive than the traditional survey methods. It has the potential to serve as an alternative (or complementary) tool for biodiversity monitoring that revolutionizes natural resource management and ecological studies of fish communities on larger spatial and temporal scales. PMID:26587265

MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species.

PubMed

Miya, M; Sato, Y; Fukunaga, T; Sado, T; Poulsen, J Y; Sato, K; Minamoto, T; Yamamoto, S; Yamanaka, H; Araki, H; Kondoh, M; Iwasaki, W

2015-07-01

We developed a set of universal PCR primers (MiFish-U/E) for metabarcoding environmental DNA (eDNA) from fishes. Primers were designed using aligned whole mitochondrial genome (mitogenome) sequences from 880 species, supplemented by partial mitogenome sequences from 160 elasmobranchs (sharks and rays). The primers target a hypervariable region of the 12S rRNA gene (163-185 bp), which contains sufficient information to identify fishes to taxonomic family, genus and species except for some closely related congeners. To test versatility of the primers across a diverse range of fishes, we sampled eDNA from four tanks in the Okinawa Churaumi Aquarium with known species compositions, prepared dual-indexed libraries and performed paired-end sequencing of the region using high-throughput next-generation sequencing technologies. Out of the 180 marine fish species contained in the four tanks with reference sequences in a custom database, we detected 168 species (93.3%) distributed across 59 families and 123 genera. These fishes are not only taxonomically diverse, ranging from sharks and rays to higher teleosts, but are also greatly varied in their ecology, including both pelagic and benthic species living in shallow coastal to deep waters. We also sampled natural seawaters around coral reefs near the aquarium and detected 93 fish species using this approach. Of the 93 species, 64 were not detected in the four aquarium tanks, rendering the total number of species detected to 232 (from 70 families and 152 genera). The metabarcoding approach presented here is non-invasive, more efficient, more cost-effective and more sensitive than the traditional survey methods. It has the potential to serve as an alternative (or complementary) tool for biodiversity monitoring that revolutionizes natural resource management and ecological studies of fish communities on larger spatial and temporal scales.

Phase transition of Boolean networks with partially nested canalizing functions

NASA Astrophysics Data System (ADS)

Jansen, Kayse; Matache, Mihaela Teodora

2013-07-01

We generate the critical condition for the phase transition of a Boolean network governed by partially nested canalizing functions for which a fraction of the inputs are canalizing, while the remaining non-canalizing inputs obey a complementary threshold Boolean function. Past studies have considered the stability of fully or partially nested canalizing functions paired with random choices of the complementary function. In some of those studies conflicting results were found with regard to the presence of chaotic behavior. Moreover, those studies focus mostly on ergodic networks in which initial states are assumed equally likely. We relax that assumption and find the critical condition for the sensitivity of the network under a non-ergodic scenario. We use the proposed mathematical model to determine parameter values for which phase transitions from order to chaos occur. We generate Derrida plots to show that the mathematical model matches the actual network dynamics. The phase transition diagrams indicate that both order and chaos can occur, and that certain parameters induce a larger range of values leading to order versus chaos. The edge-of-chaos curves are identified analytically and numerically. It is shown that the depth of canalization does not cause major dynamical changes once certain thresholds are reached; these thresholds are fairly small in comparison to the connectivity of the nodes.

Genetic Diversity of Crimean Congo Hemorrhagic Fever Virus Strains from Iran

PubMed Central

Chinikar, Sadegh; Bouzari, Saeid; Shokrgozar, Mohammad Ali; Mostafavi, Ehsan; Jalali, Tahmineh; Khakifirouz, Sahar; Nowotny, Norbert; Fooks, Anthony R.; Shah-Hosseini, Nariman

2016-01-01

Background: Crimean Congo hemorrhagic fever virus (CCHFV) is a member of the Bunyaviridae family and Nairovirus genus. It has a negative-sense, single stranded RNA genome approximately 19.2 kb, containing the Small, Medium, and Large segments. CCHFVs are relatively divergent in their genome sequence and grouped in seven distinct clades based on S-segment sequence analysis and six clades based on M-segment sequences. Our aim was to obtain new insights into the molecular epidemiology of CCHFV in Iran. Methods: We analyzed partial and complete nucleotide sequences of the S and M segments derived from 50 Iranian patients. The extracted RNA was amplified using one-step RT-PCR and then sequenced. The sequences were analyzed using Mega5 software. Results: Phylogenetic analysis of partial S segment sequences demonstrated that clade IV-(Asia 1), clade IV-(Asia 2) and clade V-(Europe) accounted for 80 %, 4 % and 14 % of the circulating genomic variants of CCHFV in Iran respectively. However, one of the Iranian strains (Iran-Kerman/22) was associated with none of other sequences and formed a new clade (VII). The phylogenetic analysis of complete S-segment nucleotide sequences from selected Iranian CCHFV strains complemented with representative strains from GenBank revealed similar topology as partial sequences with eight major clusters. A partial M segment phylogeny positioned the Iranian strains in either association with clade III (Asia-Africa) or clade V (Europe). Conclusion: The phylogenetic analysis revealed subtle links between distant geographic locations, which we propose might originate either from international livestock trade or from long-distance carriage of CCHFV by infected ticks via bird migration. PMID:27308271

Automatic detection of pelvic lymph nodes using multiple MR sequences

NASA Astrophysics Data System (ADS)

Yan, Michelle; Lu, Yue; Lu, Renzhi; Requardt, Martin; Moeller, Thomas; Takahashi, Satoru; Barentsz, Jelle

2007-03-01

A system for automatic detection of pelvic lymph nodes is developed by incorporating complementary information extracted from multiple MR sequences. A single MR sequence lacks sufficient diagnostic information for lymph node localization and staging. Correct diagnosis often requires input from multiple complementary sequences which makes manual detection of lymph nodes very labor intensive. Small lymph nodes are often missed even by highly-trained radiologists. The proposed system is aimed at assisting radiologists in finding lymph nodes faster and more accurately. To the best of our knowledge, this is the first such system reported in the literature. A 3-dimensional (3D) MR angiography (MRA) image is employed for extracting blood vessels that serve as a guide in searching for pelvic lymph nodes. Segmentation, shape and location analysis of potential lymph nodes are then performed using a high resolution 3D T1-weighted VIBE (T1-vibe) MR sequence acquired by Siemens 3T scanner. An optional contrast-agent enhanced MR image, such as post ferumoxtran-10 T2*-weighted MEDIC sequence, can also be incorporated to further improve detection accuracy of malignant nodes. The system outputs a list of potential lymph node locations that are overlaid onto the corresponding MR sequences and presents them to users with associated confidence levels as well as their sizes and lengths in each axis. Preliminary studies demonstrates the feasibility of automatic lymph node detection and scenarios in which this system may be used to assist radiologists in diagnosis and reporting.

Molecular confirmation of Hepatozoon canis in Mauritius.

PubMed

Daskalaki, Aikaterini Alexandra; Ionică, Angela Monica; Jeetah, Keshav; Gherman, Călin Mircea; Mihalca, Andrei Daniel

2018-01-01

In this study, Hepatozoon species was molecularly identified and characterized for the first time on the Indian Ocean island of Mauritius. Partial sequences of the 18S rRNA gene of the Hepatozoon isolates were analysed from three naturally infected dogs. The sequences of H. canis were similar to the 18S rRNA partial sequences (JX112783, AB365071 99%) from dog blood samples from West Indies and Nigeria. Our sequences were deposited in the GenBank database. Copyright © 2017 Elsevier B.V. All rights reserved.

RNA-primed complementary-sense DNA synthesis of the geminivirus African cassava mosaic virus.

PubMed Central

Saunders, K; Lucy, A; Stanley, J

1992-01-01

The plant DNA virus African cassava mosaic virus (ACMV) is believed to replicate by a rolling circle mechanism. To investigate complementary-sense DNA (lagging strand) synthesis, we have analysed the heterogenous form of complementary-sense DNA (H3 DNA) from infected Nicotiana benthamiana by two-dimensional agarose gel electrophoresis and blot hybridisation. The presence of an RNA moeity is demonstrated by comparison of results for nucleic acids resolved on neutral/alkaline and neutral/formamide gels, suggesting that complementary-sense DNA synthesis on the virus-sense single-stranded DNA template is preceded by the synthesis of an RNA primer. Hybridisation with probes to specific parts of ACMV DNA A genome indicates that synthesis of the putative RNA primer initiates between nucleotides 2581-221, a region that includes intergenic sequences that have been implicated in geminivirus DNA replication and the control of gene expression. Images PMID:1475192

Differential gene expression in the siphonophore Nanomia bijuga (Cnidaria) assessed with multiple next-generation sequencing workflows.

PubMed

Siebert, Stefan; Robinson, Mark D; Tintori, Sophia C; Goetz, Freya; Helm, Rebecca R; Smith, Stephen A; Shaner, Nathan; Haddock, Steven H D; Dunn, Casey W

2011-01-01

We investigated differential gene expression between functionally specialized feeding polyps and swimming medusae in the siphonophore Nanomia bijuga (Cnidaria) with a hybrid long-read/short-read sequencing strategy. We assembled a set of partial gene reference sequences from long-read data (Roche 454), and generated short-read sequences from replicated tissue samples that were mapped to the references to quantify expression. We collected and compared expression data with three short-read expression workflows that differ in sample preparation, sequencing technology, and mapping tools. These workflows were Illumina mRNA-Seq, which generates sequence reads from random locations along each transcript, and two tag-based approaches, SOLiD SAGE and Helicos DGE, which generate reads from particular tag sites. Differences in expression results across workflows were mostly due to the differential impact of missing data in the partial reference sequences. When all 454-derived gene reference sequences were considered, Illumina mRNA-Seq detected more than twice as many differentially expressed (DE) reference sequences as the tag-based workflows. This discrepancy was largely due to missing tag sites in the partial reference that led to false negatives in the tag-based workflows. When only the subset of reference sequences that unambiguously have tag sites was considered, we found broad congruence across workflows, and they all identified a similar set of DE sequences. Our results are promising in several regards for gene expression studies in non-model organisms. First, we demonstrate that a hybrid long-read/short-read sequencing strategy is an effective way to collect gene expression data when an annotated genome sequence is not available. Second, our replicated sampling indicates that expression profiles are highly consistent across field-collected animals in this case. Third, the impacts of partial reference sequences on the ability to detect DE can be mitigated through workflow choice and deeper reference sequencing.

Differential Gene Expression in the Siphonophore Nanomia bijuga (Cnidaria) Assessed with Multiple Next-Generation Sequencing Workflows

PubMed Central

Siebert, Stefan; Robinson, Mark D.; Tintori, Sophia C.; Goetz, Freya; Helm, Rebecca R.; Smith, Stephen A.; Shaner, Nathan; Haddock, Steven H. D.; Dunn, Casey W.

2011-01-01

We investigated differential gene expression between functionally specialized feeding polyps and swimming medusae in the siphonophore Nanomia bijuga (Cnidaria) with a hybrid long-read/short-read sequencing strategy. We assembled a set of partial gene reference sequences from long-read data (Roche 454), and generated short-read sequences from replicated tissue samples that were mapped to the references to quantify expression. We collected and compared expression data with three short-read expression workflows that differ in sample preparation, sequencing technology, and mapping tools. These workflows were Illumina mRNA-Seq, which generates sequence reads from random locations along each transcript, and two tag-based approaches, SOLiD SAGE and Helicos DGE, which generate reads from particular tag sites. Differences in expression results across workflows were mostly due to the differential impact of missing data in the partial reference sequences. When all 454-derived gene reference sequences were considered, Illumina mRNA-Seq detected more than twice as many differentially expressed (DE) reference sequences as the tag-based workflows. This discrepancy was largely due to missing tag sites in the partial reference that led to false negatives in the tag-based workflows. When only the subset of reference sequences that unambiguously have tag sites was considered, we found broad congruence across workflows, and they all identified a similar set of DE sequences. Our results are promising in several regards for gene expression studies in non-model organisms. First, we demonstrate that a hybrid long-read/short-read sequencing strategy is an effective way to collect gene expression data when an annotated genome sequence is not available. Second, our replicated sampling indicates that expression profiles are highly consistent across field-collected animals in this case. Third, the impacts of partial reference sequences on the ability to detect DE can be mitigated through workflow choice and deeper reference sequencing. PMID:21829563

Methods for chromosome-specific staining

DOEpatents

Gray, J.W.; Pinkel, D.

1995-09-05

Methods and compositions for chromosome-specific staining are provided. Compositions comprise heterogeneous mixtures of labeled nucleic acid fragments having substantially complementary base sequences to unique sequence regions of the chromosomal DNA for which their associated staining reagent is specific. Methods include ways for making the chromosome-specific staining compositions of the invention, and methods for applying the staining compositions to chromosomes. 3 figs.

Methods and compositions for chromosome-specific staining

DOEpatents

Gray, Joe W.; Pinkel, Daniel

2003-07-22

Methods and compositions for chromosome-specific staining are provided. Compositions comprise heterogenous mixtures of labeled nucleic acid fragments having substantially complementary base sequences to unique sequence regions of the chromosomal DNA for which their associated staining reagent is specific. Methods include methods for making the chromosome-specific staining compositions of the invention, and methods for applying the staining compositions to chromosomes.

Through Increasing "Information Literacy" Capital and Habitus (Agency): The Complementary Impact on Composition Skills When Appropriately Sequenced

ERIC Educational Resources Information Center

Karas, Timothy

2017-01-01

Through a case study approach of a cohort of community college students at a single community college, the impact on success rates in composition courses was analyzed based on the sequence of completing an information literacy course. Two student cohorts were sampled based on completing an information literacy course prior to, or concurrently with…

Integrating a DNA barcoding project with an ecological survey: a case study on temperate intertidal polychaete communities in Qingdao, China

NASA Astrophysics Data System (ADS)

Zhou, Hong; Zhang, Zhinan; Chen, Haiyan; Sun, Renhua; Wang, Hui; Guo, Lei; Pan, Haijian

2010-07-01

In this study, we integrated a DNA barcoding project with an ecological survey on intertidal polychaete communities and investigated the utility of CO1 gene sequence as a DNA barcode for the classification of the intertidal polychaetes. Using 16S rDNA as a complementary marker and combining morphological and ecological characterization, some of dominant and common polychaete species from Chinese coasts were assessed for their taxonomic status. We obtained 22 haplotype gene sequences of 13 taxa, including 10 CO1 sequences and 12 16S rDNA sequences. Based on intra- and inter-specific distances, we built phylogenetic trees using the neighbor-joining method. Our study suggested that the mitochondrial CO1 gene was a valid DNA barcoding marker for species identification in polychaetes, but other genes, such as 16S rDNA, could be used as a complementary genetic marker. For more accurate species identification and effective testing of species hypothesis, DNA barcoding should be incorporated with morphological, ecological, biogeographical, and phylogenetic information. The application of DNA barcoding and molecular identification in the ecological survey on the intertidal polychaete communities demonstrated the feasibility of integrating DNA taxonomy and ecology.

A bimetallic nanocomposite modified genosensor for recognition and determination of thalassemia gene.

PubMed

Hamidi-Asl, Ezat; Raoof, Jahan Bakhsh; Naghizadeh, Nahid; Akhavan-Niaki, Haleh; Ojani, Reza; Banihashemi, Ali

2016-10-01

The main roles of DNA in the cells are to maintain and properly express genetic information. It is important to have analytical methods capable of fast and sensitive detection of DNA damage. DNA hybridization sensors are well suited for diagnostics and other purposes, including determination of bacteria and viruses. Beta thalassemias (βth) are due to mutations in the β-globin gene. In this study, an electrochemical biosensor which detects the sequences related to the β-globin gene issued from real samples amplified by polymerase chain reaction (PCR) is described for the first time. The biosensor relies on the immobilization of 20-mer single stranded oligonucleotide (probe) related to βth sequence on the carbon paste electrode (CPE) modified by 15% silver (Ag) and platinum (Pt) nanoparticles to prepare the bimetallic nanocomposite electrode and hybridization of this oligonucleotide with its complementary sequence (target). The extent of hybridization between the probe and target sequences was shown by using linear sweep voltammetry (LSV) with methylene blue (MB) as hybridization indicator. The selectivity of sensor was investigated using PCR samples containing non-complementary oligonucleotides. The detection limit of biosensor was calculated about 470.0pg/μL. Copyright © 2016 Elsevier B.V. All rights reserved.

Array of nucleic acid probes on biological chips for diagnosis of HIV and methods of using the same

DOEpatents

Chee, Mark; Gingeras, Thomas R.; Fodor, Stephen P. A.; Hubble, Earl A.; Morris, MacDonald S.

1999-01-19

The invention provides an array of oligonucleotide probes immobilized on a solid support for analysis of a target sequence from a human immunodeficiency virus. The array comprises at least four sets of oligonucleotide probes 9 to 21 nucleotides in length. A first probe set has a probe corresponding to each nucleotide in a reference sequence from a human immunodeficiency virus. A probe is related to its corresponding nucleotide by being exactly complementary to a subsequence of the reference sequence that includes the corresponding nucleotide. Thus, each probe has a position, designated an interrogation position, that is occupied by a complementary nucleotide to the corresponding nucleotide. The three additional probe sets each have a corresponding probe for each probe in the first probe set. Thus, for each nucleotide in the reference sequence, there are four corresponding probes, one from each of the probe sets. The three corresponding probes in the three additional probe sets are identical to the corresponding probe from the first probe or a subsequence thereof that includes the interrogation position, except that the interrogation position is occupied by a different nucleotide in each of the four corresponding probes.

Evaluation of partial 16S ribosomal DNA sequencing for identification of nocardia species by using the MicroSeq 500 system with an expanded database.

PubMed

Cloud, Joann L; Conville, Patricia S; Croft, Ann; Harmsen, Dag; Witebsky, Frank G; Carroll, Karen C

2004-02-01

Identification of clinically significant nocardiae to the species level is important in patient diagnosis and treatment. A study was performed to evaluate Nocardia species identification obtained by partial 16S ribosomal DNA (rDNA) sequencing by the MicroSeq 500 system with an expanded database. The expanded portion of the database was developed from partial 5' 16S rDNA sequences derived from 28 reference strains (from the American Type Culture Collection and the Japanese Collection of Microorganisms). The expanded MicroSeq 500 system was compared to (i). conventional identification obtained from a combination of growth characteristics with biochemical and drug susceptibility tests; (ii). molecular techniques involving restriction enzyme analysis (REA) of portions of the 16S rRNA and 65-kDa heat shock protein genes; and (iii). when necessary, sequencing of a 999-bp fragment of the 16S rRNA gene. An unknown isolate was identified as a particular species if the sequence obtained by partial 16S rDNA sequencing by the expanded MicroSeq 500 system was 99.0% similar to that of the reference strain. Ninety-four nocardiae representing 10 separate species were isolated from patient specimens and examined by using the three different methods. Sequencing of partial 16S rDNA by the expanded MicroSeq 500 system resulted in only 72% agreement with conventional methods for species identification and 90% agreement with the alternative molecular methods. Molecular methods for identification of Nocardia species provide more accurate and rapid results than the conventional methods using biochemical and susceptibility testing. With an expanded database, the MicroSeq 500 system for partial 16S rDNA was able to correctly identify the human pathogens N. brasiliensis, N. cyriacigeorgica, N. farcinica, N. nova, N. otitidiscaviarum, and N. veterana.

Sphaeridiotrema globulus and Sphaeridiotrema pseudoglobulus (Digenea): Species Differentiation Based On mtDNA (Barcode) and Partial LSU–rDNA Sequences

USGS Publications Warehouse

Bergmame, Laura; Huffman, Jane; Cole, Rebecca; Dayanandan, Selvadurai; Tkach, Vasyl; McLaughlin, J. Daniel

2011-01-01

Flukes belonging to Sphaeridiotrema are important parasites of waterfowl, and 2 morphologically similar species Sphaeridiotrema globulus and Sphaeridiotrema pseudoglobulus, have been implicated in waterfowl mortality in North America. Cytochrome oxidase I (barcode region) and partial LSU-rDNA sequences from specimens of S. globulus and S. pseudoglobulus, obtained from naturally and experimentally infected hosts from New Jersey and Quebec, respectively, confirmed that these species were distinct. Barcode sequences of the 2 species differed at 92 of 590 nucleotide positions (15.6%) and the translated sequences differed by 13 amino acid residues. Partial LSU-rDNA sequences differed at 29 of 1,208 nucleotide positions (2.4%). Additional barcode sequences from specimens collected from waterfowl in Wisconsin and Minnesota and morphometric data obtained from specimens acquired along the north shore of Lake Superior revealed the presence of S. pseudoglobulus in these areas. Although morphometric data suggested the presence of S. globulus in the Lake Superior sample, it was not found among the specimens sequenced from Wisconsin or Minnesota.

Sphaeridiotrema globulus and Sphaeridiotrema pseudoglobulus (Digenea): Species Differentiation Based on mtDNA (Barcode) and Partial LSUrDNA Sequences

USGS Publications Warehouse

Bergmame, L.; Huffman, J.; Cole, R.; Dayanandan, S.; Tkach, V.; McLaughlin, J.D.

2011-01-01

Flukes belonging to Sphaeridiotrema are important parasites of waterfowl, and 2 morphologically similar species Sphaeridiotrema globulus and Sphaeridiotrema pseudoglobulus, have been implicated in waterfowl mortality in North America. Cytochrome oxidase I (barcode region) and partial LSU-rDNA sequences from specimens of S. globulus and S. pseudoglobulus, obtained from naturally and experimentally infected hosts from New Jersey and Quebec, respectively, confirmed that these species were distinct. Barcode sequences of the 2 species differed at 92 of 590 nucleotide positions (15.6%) and the translated sequences differed by 13 amino acid residues. Partial LSU-rDNA sequences differed at 29 of 1,208 nucleotide positions (2.4%). Additional barcode sequences from specimens collected from waterfowl in Wisconsin and Minnesota and morphometric data obtained from specimens acquired along the north shore of Lake Superior revealed the presence of S. pseudoglobulus in these areas. Although morphometric data suggested the presence of S. globulus in the Lake Superior sample, it was not found among the specimens sequenced from Wisconsin or Minnesota. ?? 2011 American Society of Parasitologists.

Cross index for improving cloning selectivity by partially filling in 5'-extensions of DNA produced by type II restriction endonucleases.

PubMed Central

Korch, C

1987-01-01

A cross index is presented for using the improved selectivity offered by the Hung and Wensink (Nucl. Acids Res. 12, 1863-1874, 1984) method of partially filling in 5'-extensions produced by type II restriction endonucleases. After this treatment, DNA fragments which normally cannot be ligated to one another, can be joined providing that complementary cohesive ends have been generated. The uses of this technique, which include the prevention of DNA fragments (both vector and insert) auto-annealing, are discussed. PMID:3033600

Molecular identification and morphological description of Micropogonias megalops, Cynoscion othonopterus, C. reticulatus and Menticirrhus nasus larvae, collected in the upper Gulf of California during Summer 2012.

PubMed

Camacho-Gastélum, Rosabel; Díaz-Viloria, Noé; Sánchez-Velasco, Laura; Jiménez-Rosenberg, Sylvia P A; Perez-Enriquez, Ricardo

2017-05-01

Sciaenidae fish larvae were collected from the upper Gulf of California during September 2012 using a conical net (505 μm) through surface tows. These were pre-classified into four larval morphotypes, based on external characteristics (mainly meristic and pigmentation). Partial sequences of cytochrome c oxidase, subunit 1 and 16S rRNA (16S) genes of mitochondrial DNA, were used in molecular genetic identification from each larval morphotype. Genetic results indicated the identification of four larval morphotypes as Micropogonias megalops, Cynoscion othonopterus, C. reticulatus and Menticirrhus nasus. Pigmentation patterns of larvae described after molecular genetic identification made it possible to distinguish between M. megalops, M. nasus and C. othonopterus (postflexion). However, pigmentation was not reliable for differentiating between preflexion larvae of C. othonopterus and C. reticulatus. From these results, both morphological and genetic approaches were proposed as complementary tools in taxonomic studies of ichthyoplankton, particularly in early fish larvae identification of congeneric species with similar morphological characteristics.

Suitability of partial 16S ribosomal RNA gene sequence analysis for the identification of dangerous bacterial pathogens.

PubMed

Ruppitsch, W; Stöger, A; Indra, A; Grif, K; Schabereiter-Gurtner, C; Hirschl, A; Allerberger, F

2007-03-01

In a bioterrorism event a rapid tool is needed to identify relevant dangerous bacteria. The aim of the study was to assess the usefulness of partial 16S rRNA gene sequence analysis and the suitability of diverse databases for identifying dangerous bacterial pathogens. For rapid identification purposes a 500-bp fragment of the 16S rRNA gene of 28 isolates comprising Bacillus anthracis, Brucella melitensis, Burkholderia mallei, Burkholderia pseudomallei, Francisella tularensis, Yersinia pestis, and eight genus-related and unrelated control strains was amplified and sequenced. The obtained sequence data were submitted to three public and two commercial sequence databases for species identification. The most frequent reason for incorrect identification was the lack of the respective 16S rRNA gene sequences in the database. Sequence analysis of a 500-bp 16S rDNA fragment allows the rapid identification of dangerous bacterial species. However, for discrimination of closely related species sequencing of the entire 16S rRNA gene, additional sequencing of the 23S rRNA gene or sequencing of the 16S-23S rRNA intergenic spacer is essential. This work provides comprehensive information on the suitability of partial 16S rDNA analysis and diverse databases for rapid and accurate identification of dangerous bacterial pathogens.

A codon-usage variant in the (GGN){sub n} trinucleotide polymorphism of the androgen receptor gene as an aid in the prenatal diagnosis of ambiguous genitalia due to partial androgen insensitivity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lumbroso, R.; Vasiliou, M.; Beitel, L.K.

1994-09-01

Exon 1 at the X-linked androgen receptor (AR) locus encodes an N-terminal modulatory domain that contains two large homopolyamino acid tracts: (CAG;glutamine;Gln){sub 11-33} and (GGN;Glycine;Cly){sub 15-27}. Certain AR mutations cause partial androgen insensitivity (PAI) with frank genital ambiguity that may engender appreciable parental anxiety and patient morbidity. If the AR mutation in a PAI family is unknown, the AR`s intragenic trinucleotide repeat polymorphisms may be used for prenatal diagnosis. However, intergenerational instability of repeat-size may be worrisome, particularly when the information alleles differ by only a few repeats. Here, we report the discovery of a codon-usage (silent substitution) variant inmore » the GGN repeat, and describe its use as a source of complementary information for prenatal diagnosis. The standard sense sequence of the (GGN){sub n} tract is (GGT){sub 3} GGG(GGT){sub 2} (GGC){sub 9-21}. On 4 of 27 X chromosomes we noted that the internal GGT sequence was expanded to 3 or 4 repeats. We used an internal (GGT){sub 4} repeat in a total (GGN){sub 24} tract together with a (CAG){sub 20} tract to distinguish an X chromosome with a mutant AR allele from another X chromosome, bearing a normal allele, that had an internal (GGT){sub 2} repeat in a total (GGN){sub 23} tract together with a (CAG){sub 21} tract. Subsequently, we found the base change leading to a pathogenic amino acid substitution (M779I) in codon 6 of the mutant AR gene in an affected maternal aunt and the fetus at risk. This confirmed the prenatal diagnosis based on the intragenic trinucleotide repeat polymorphisms, and it strengthened the prediction of external genital ambiguity using our previous experience with M779I in another family.« less

Rapid method to detect duplex formation in sequencing by hybridization methods

DOEpatents

Mirzabekov, A.D.; Timofeev, E.N.; Florentiev, V.L.; Kirillov, E.V.

1999-01-19

A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided. A plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex. Each duplex facilitates intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface and exposing the light-sensitive fluid to a light pattern. This causes the fluid exposed to the light to coalesce into discrete units and adhere to the surface. This places each of the units in contact with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units. 13 figs.

Impedimetric DNA biosensor based on a nanoporous alumina membrane for the detection of the specific oligonucleotide sequence of dengue virus.

PubMed

Deng, Jiajia; Toh, Chee-Seng

2013-06-17

A novel and integrated membrane sensing platform for DNA detection is developed based on an anodic aluminum oxide (AAO) membrane. Platinum electrodes (~50-100 nm thick) are coated directly on both sides of the alumina membrane to eliminate the solution resistance outside the nanopores. The electrochemical impedance technique is employed to monitor the impedance changes within the nanopores upon DNA binding. Pore resistance (Rp) linearly increases in response towards the increasing concentration of the target DNA in the range of 1 × 10⁻¹² to 1 × 10⁻⁶ M. Moreover, the biosensor selectively differentiates the complementary sequence from single base mismatched (MM-1) strands and non-complementary strands. This study reveals a simple, selective and sensitive method to fabricate a label-free DNA biosensor.

Rapid method to detect duplex formation in sequencing by hybridization methods

DOEpatents

Mirzabekov, Andrei Darievich; Timofeev, Edward Nikolaevich; Florentiev, Vladimer Leonidovich; Kirillov, Eugene Vladislavovich

1999-01-01

A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided whereby a plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex so as to facilitate intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface, exposing said light-sensitive fluid to a light pattern so as to cause the fluid exposed to the light to coalesce into discrete units and adhere to the surface; and contacting each of the units with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units.

A novel aptasensor for the ultra-sensitive detection of adenosine triphosphate via aptamer/quantum dot based resonance energy transfer.

PubMed

Li, Zheng; Wang, Yijing; Liu, Ying; Zeng, Yongyi; Huang, Aimin; Peng, Niancai; Liu, Xiaolong; Liu, Jingfeng

2013-09-07

We designed a novel aptamer based biosensor (aptasensor) for ultrasensitive detection of adenosine triphosphate (ATP) through resonance energy transfer (RET). The ATP aptamer was modified with Cy3 at the 3' end, and a green quantum dot (525) was attached to the 5' end of its complementary sequence respectively. The ATP aptamer and its complementary sequence could assemble into a duplex structure in the absence of target ATP, and then decrease the distance between the quantum dot and Cy3 which could produce significant RET signal. Upon ATP binding, the ATP aptamer could dissociate with its complementary sequence and then increase the distance between the quantum dot and Cy3 which would significantly decrease the RET signal. Therefore, the ATP detection could be easily achieved through detection of the fluorescence intensity ratio between 525 nm and 560 nm. The results show that the emission fluorescence intensity ratio of 525/560 is linearly related to the logarithmic concentration of ATP. The linear range of this aptasensor is from 0.1 nM to 1 μM, and the detection limit is lower down to 0.01 nM. Excellent selectivity of this aptasensor for ATP has been demonstrated through the detection of thymidine triphosphate (TTP), cytidine triphosphate (CTP), guanosine triphosphate (GTP) and adenosine diphosphate (ADP) respectively as control. The method we described here could easily detect ATP with excellent selectivity, linearity and sensitivity down to the nanomolar range, as well as avoid photobleaching.

The field effect transistor DNA biosensor based on ITO nanowires in label-free hepatitis B virus detecting compatible with CMOS technology.

PubMed

Shariati, Mohsen

2018-05-15

In this paper the field-effect transistor DNA biosensor for detecting hepatitis B virus (HBV) based on indium tin oxide nanowires (ITO NWs) in label free approach has been fabricated. Because of ITO nanowires intensive conductance and functional modified surface, the probe immobilization and target hybridization were increased strongly. The high resolution transmission electron microscopy (HRTEM) measurement showed that ITO nanowires were crystalline and less than 50nm in diameter. The single-stranded hepatitis B virus DNA (SS-DNA) was immobilized as probe on the Au-modified nanowires. The DNA targets were measured in a linear concentration range from 1fM to 10µM. The detection limit of the DNA biosensor was about 1fM. The time of the hybridization process for defined single strand was 90min. The switching ratio of the biosensor between "on" and "off" state was ~ 1.1 × 10 5 . For sensing the specificity of the biosensor, non-complementary, mismatch and complementary DNA oligonucleotide sequences were clearly discriminated. The HBV biosensor confirmed the highly satisfied specificity for differentiating complementary sequences from non-complementary and the mismatch oligonucleotides. The response time of the DNA sensor was 37s with a high reproducibility. The stability and repeatability of the DNA biosensor showed that the peak current of the biosensor retained 98% and 96% of its initial response for measurements after three and five weeks, respectively. Copyright © 2018 Elsevier B.V. All rights reserved.

Electrochemical DNA biosensor based on a glassy carbon electrode modified with gold nanoparticles and graphene for sensitive determination of Klebsiella pneumoniae carbapenemase.

PubMed

Pan, Hong-zhi; Yu, Hong-wei; Wang, Na; Zhang, Ze; Wan, Guang-cai; Liu, Hao; Guan, Xue; Chang, Dong

2015-11-20

We describe the fabrication of a sensitive electrochemical DNA biosensor for determination of Klebsiella pneumoniae carbapenemase (KPC). The highly sensitive and selective electrochemical biosensor for DNA detection was constructed based on a glassy carbon electrode (GCE) modified with gold nanoparticles (Au-NPs) and graphene (Gr). Then Au-NPs/Gr/GCE was characterized by scanning electro microscope (SEM), cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). The hybridization detection was measured by diffierential pulse voltammetry (DPV) using methylene blue (MB) as the hybridization indicator. The dynamic range of detection of the sensor for the target DNA sequences was from 1 × 10(-12) to 1 × 10(-7)mol/L, with a detection limit of 2 × 10(-13)mol/L. The DNA biosensor had excellent specificity for distinguishing complementary DNA sequence in the presence of non-complementary and mismatched DNA sequence. The results demonstrated that the Au-NPs/Gr nanocomposite was a promising substrate for the development of high-performance electrocatalysts for determination of KPC. Copyright © 2015 Elsevier B.V. All rights reserved.

CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion.

PubMed

Santillán, Orlando; Ramírez-Romero, Miguel A; Dávila, Guillermo

2017-06-25

Here, we present chimera assembly by plasmid recovery and restriction enzyme site insertion (CAPRRESI). CAPRRESI benefits from many strengths of the original plasmid recovery method and introduces restriction enzyme digestion to ease DNA ligation reactions (required for chimera assembly). For this protocol, users clone wildtype genes into the same plasmid (pUC18 or pUC19). After the in silico selection of amino acid sequence regions where chimeras should be assembled, users obtain all the synonym DNA sequences that encode them. Ad hoc Perl scripts enable users to determine all synonym DNA sequences. After this step, another Perl script searches for restriction enzyme sites on all synonym DNA sequences. This in silico analysis is also performed using the ampicillin resistance gene (ampR) found on pUC18/19 plasmids. Users design oligonucleotides inside synonym regions to disrupt wildtype and ampR genes by PCR. After obtaining and purifying complementary DNA fragments, restriction enzyme digestion is accomplished. Chimera assembly is achieved by ligating appropriate complementary DNA fragments. pUC18/19 vectors are selected for CAPRRESI because they offer technical advantages, such as small size (2,686 base pairs), high copy number, advantageous sequencing reaction features, and commercial availability. The usage of restriction enzymes for chimera assembly eliminates the need for DNA polymerases yielding blunt-ended products. CAPRRESI is a fast and low-cost method for fusing protein-coding genes.

Requirement for XLF/Cernunnos in alignment-based gap filling by DNA polymerases lambda and mu for nonhomologous end joining in human whole-cell extracts.

PubMed

Akopiants, Konstantin; Zhou, Rui-Zhe; Mohapatra, Susovan; Valerie, Kristoffer; Lees-Miller, Susan P; Lee, Kyung-Jong; Chen, David J; Revy, Patrick; de Villartay, Jean-Pierre; Povirk, Lawrence F

2009-07-01

XLF/Cernunnos is a core protein of the nonhomologous end-joining pathway of DNA double-strand break repair. To better define the role of Cernunnos in end joining, whole-cell extracts were prepared from Cernunnos-deficient human cells. These extracts effected little joining of DNA ends with cohesive 5' or 3' overhangs, and no joining at all of partially complementary 3' overhangs that required gap filling prior to ligation. Assays in which gap-filled but unligated intermediates were trapped using dideoxynucleotides revealed that there was no gap filling on aligned DSB ends in the Cernunnos-deficient extracts. Recombinant Cernunnos protein restored gap filling and end joining of partially complementary overhangs, and stimulated joining of cohesive ends more than twentyfold. XLF-dependent gap filling was nearly eliminated by immunodepletion of DNA polymerase lambda, but was restored by addition of either polymerase lambda or polymerase mu. Thus, Cernunnos is essential for gap filling by either polymerase during nonhomologous end joining, suggesting that it plays a major role in aligning the two DNA ends in the repair complex.

Partial Gene Sequencing of CYP1A, Vitellogenin, and Metallothionein in Mosquitofish Gambusia yucatana and Gambusia sexradiata.

PubMed

Vázquez-Euán, Roberto; Escalante-Herrera, Karla S; Rodríguez-Fuentes, Gabriela

2017-01-01

Ground characteristics in the Yucatan Peninsula make recovery and treatment of wastewater very expensive. This situation has contributed to an increase of pollutants in the aquifer. Unfortunately, studies related to the effects of those pollutants in native organisms are scarce. The aim of this work was to obtain partial sequences of widely known genes used as biomarkers of pollutant effect in Gambusia yucatana and Gambusia sexradiata. The studied genes were: cytochrome P450 1A (CYP1A); vitellogenin (VTG); metallothionein (MT), and two housekeeping genes, 18S and β-actin. From reported sequences of Gambusia affinis, primers were designed and amplification was done in the local Gambusia species exposed for 48 h to gasoline (100 µL/L, stirred for 24 h pre-exposure). Preliminary results revealed partial sequences of all genes with an approximate average length of 200 bp. BLAST analysis of found sequences indicated a minimum of 97% identity with reported sequences for G. affinis or Gambusia holbrooki showing great similarity.

Integrating multiple molecular sources into a clinical risk prediction signature by extracting complementary information.

PubMed

Hieke, Stefanie; Benner, Axel; Schlenl, Richard F; Schumacher, Martin; Bullinger, Lars; Binder, Harald

2016-08-30

High-throughput technology allows for genome-wide measurements at different molecular levels for the same patient, e.g. single nucleotide polymorphisms (SNPs) and gene expression. Correspondingly, it might be beneficial to also integrate complementary information from different molecular levels when building multivariable risk prediction models for a clinical endpoint, such as treatment response or survival. Unfortunately, such a high-dimensional modeling task will often be complicated by a limited overlap of molecular measurements at different levels between patients, i.e. measurements from all molecular levels are available only for a smaller proportion of patients. We propose a sequential strategy for building clinical risk prediction models that integrate genome-wide measurements from two molecular levels in a complementary way. To deal with partial overlap, we develop an imputation approach that allows us to use all available data. This approach is investigated in two acute myeloid leukemia applications combining gene expression with either SNP or DNA methylation data. After obtaining a sparse risk prediction signature e.g. from SNP data, an automatically selected set of prognostic SNPs, by componentwise likelihood-based boosting, imputation is performed for the corresponding linear predictor by a linking model that incorporates e.g. gene expression measurements. The imputed linear predictor is then used for adjustment when building a prognostic signature from the gene expression data. For evaluation, we consider stability, as quantified by inclusion frequencies across resampling data sets. Despite an extremely small overlap in the application example with gene expression and SNPs, several genes are seen to be more stably identified when taking the (imputed) linear predictor from the SNP data into account. In the application with gene expression and DNA methylation, prediction performance with respect to survival also indicates that the proposed approach might work well. We consider imputation of linear predictor values to be a feasible and sensible approach for dealing with partial overlap in complementary integrative analysis of molecular measurements at different levels. More generally, these results indicate that a complementary strategy for integrating different molecular levels can result in more stable risk prediction signatures, potentially providing a more reliable insight into the underlying biology.

Phylogenetic relationships in Demodex mites (Acari: Demodicidae) based on mitochondrial 16S rDNA partial sequences.

PubMed

Zhao, Ya-E; Wu, Li-Ping

2012-09-01

To confirm phylogenetic relationships in Demodex mites based on mitochondrial 16S rDNA partial sequences, mtDNA 16S partial sequences of ten isolates of three Demodex species from China were amplified, recombined, and sequenced and then analyzed with two Demodex folliculorum isolates from Spain. Lastly, genetic distance was computed, and phylogenetic tree was reconstructed. MEGA 4.0 analysis showed high sequence identity among 16S rDNA partial sequences of three Demodex species, which were 95.85 % in D. folliculorum, 98.53 % in Demodex canis, and 99.71 % in Demodex brevis. The divergence, genetic distance, and transition/transversions of the three Demodex species reached interspecies level, whereas there was no significant difference of the divergence (1.1 %), genetic distance (0.011), and transition/transversions (3/1) of the two geographic D. folliculorum isolates (Spain and China). Phylogenetic trees reveal that the three Demodex species formed three separate branches of one clade, where D. folliculorum and D. canis gathered first, and then gathered with D. brevis. The two Spain and five China D. folliculorum isolates did not form sister clades. In conclusion, 16S mtDNA are suitable for phylogenetic relationship analysis in low taxa (genus or species), but not for intraspecies determination of Demodex. The differentiation among the three Demodex species has reached interspecies level.

Robust analysis of semiparametric renewal process models

PubMed Central

Lin, Feng-Chang; Truong, Young K.; Fine, Jason P.

2013-01-01

Summary A rate model is proposed for a modulated renewal process comprising a single long sequence, where the covariate process may not capture the dependencies in the sequence as in standard intensity models. We consider partial likelihood-based inferences under a semiparametric multiplicative rate model, which has been widely studied in the context of independent and identical data. Under an intensity model, gap times in a single long sequence may be used naively in the partial likelihood with variance estimation utilizing the observed information matrix. Under a rate model, the gap times cannot be treated as independent and studying the partial likelihood is much more challenging. We employ a mixing condition in the application of limit theory for stationary sequences to obtain consistency and asymptotic normality. The estimator's variance is quite complicated owing to the unknown gap times dependence structure. We adapt block bootstrapping and cluster variance estimators to the partial likelihood. Simulation studies and an analysis of a semiparametric extension of a popular model for neural spike train data demonstrate the practical utility of the rate approach in comparison with the intensity approach. PMID:24550568

Comparative Genomics of the Dual-Obligate Symbionts from the Treehopper, Entylia carinata (Hemiptera: Membracidae), Provide Insight into the Origins and Evolution of an Ancient Symbiosis.

PubMed

Mao, Meng; Yang, Xiushuai; Poff, Kirsten; Bennett, Gordon

2017-06-01

Insect species in the Auchenorrhyncha suborder (Hemiptera) maintain ancient obligate symbioses with bacteria that provide essential amino acids (EAAs) deficient in their plant-sap diets. Molecular studies have revealed that two complementary symbiont lineages, "Candidatus Sulcia muelleri" and a betaproteobacterium ("Ca. Zinderia insecticola" in spittlebugs [Cercopoidea] and "Ca. Nasuia deltocephalinicola" in leafhoppers [Cicadellidae]) may have persisted in the suborder since its origin ∼300 Ma. However, investigation of how this pair has co-evolved on a genomic level is limited to only a few host lineages. We sequenced the complete genomes of Sulcia and a betaproteobacterium from the treehopper, Entylia carinata (Membracidae: ENCA), as the first representative from this species-rich group. It also offers the opportunity to compare symbiont evolution across a major insect group, the Membracoidea (leafhoppers + treehoppers). Genomic analyses show that the betaproteobacteria in ENCA is a member of the Nasuia lineage. Both symbionts have larger genomes (Sulcia = 218 kb and Nasuia = 144 kb) than related lineages in Deltocephalinae leafhoppers, retaining genes involved in basic cellular functions and information processing. Nasuia-ENCA further exhibits few unique gene losses, suggesting that its parent lineage in the common ancestor to the Membracoidea was already highly reduced. Sulcia-ENCA has lost the abilities to synthesize menaquinone cofactor and to complete the synthesis of the branched-chain EAAs. Both capabilities are conserved in other Sulcia lineages sequenced from across the Auchenorrhyncha. Finally, metagenomic sequencing recovered the partial genome of an Arsenophonus symbiont, although it infects only 20% of individuals indicating a facultative role. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Comparative Genomics of the Dual-Obligate Symbionts from the Treehopper, Entylia carinata (Hemiptera: Membracidae), Provide Insight into the Origins and Evolution of an Ancient Symbiosis

PubMed Central

Yang, Xiushuai; Poff, Kirsten; Bennett, Gordon

2017-01-01

Abstract Insect species in the Auchenorrhyncha suborder (Hemiptera) maintain ancient obligate symbioses with bacteria that provide essential amino acids (EAAs) deficient in their plant-sap diets. Molecular studies have revealed that two complementary symbiont lineages, “Candidatus Sulcia muelleri” and a betaproteobacterium (“Ca. Zinderia insecticola” in spittlebugs [Cercopoidea] and “Ca. Nasuia deltocephalinicola” in leafhoppers [Cicadellidae]) may have persisted in the suborder since its origin ∼300 Ma. However, investigation of how this pair has co-evolved on a genomic level is limited to only a few host lineages. We sequenced the complete genomes of Sulcia and a betaproteobacterium from the treehopper, Entylia carinata (Membracidae: ENCA), as the first representative from this species-rich group. It also offers the opportunity to compare symbiont evolution across a major insect group, the Membracoidea (leafhoppers + treehoppers). Genomic analyses show that the betaproteobacteria in ENCA is a member of the Nasuia lineage. Both symbionts have larger genomes (Sulcia = 218 kb and Nasuia = 144 kb) than related lineages in Deltocephalinae leafhoppers, retaining genes involved in basic cellular functions and information processing. Nasuia-ENCA further exhibits few unique gene losses, suggesting that its parent lineage in the common ancestor to the Membracoidea was already highly reduced. Sulcia-ENCA has lost the abilities to synthesize menaquinone cofactor and to complete the synthesis of the branched-chain EAAs. Both capabilities are conserved in other Sulcia lineages sequenced from across the Auchenorrhyncha. Finally, metagenomic sequencing recovered the partial genome of an Arsenophonus symbiont, although it infects only 20% of individuals indicating a facultative role. PMID:28854637

Enantiospecific recognition of DNA sequences by a proflavine Tröger base.

PubMed

Bailly, C; Laine, W; Demeunynck, M; Lhomme, J

2000-07-05

The DNA interaction of a chiral Tröger base derived from proflavine was investigated by DNA melting temperature measurements and complementary biochemical assays. DNase I footprinting experiments demonstrate that the binding of the proflavine-based Tröger base is both enantio- and sequence-specific. The (+)-isomer poorly interacts with DNA in a non-sequence-selective fashion. In sharp contrast, the corresponding (-)-isomer recognizes preferentially certain DNA sequences containing both A. T and G. C base pairs, such as the motifs 5'-GTT. AAC and 5'-ATGA. TCAT. This is the first experimental demonstration that acridine-type Tröger bases can be used for enantiospecific recognition of DNA sequences. Copyright 2000 Academic Press.

High Awareness but Low Coverage of a Locally Produced Fortified Complementary Food in Abidjan, Côte d'Ivoire: Findings from a Cross-Sectional Survey.

PubMed

Leyvraz, Magali; Rohner, Fabian; Konan, Amoin G; Esso, Lasme J C E; Woodruff, Bradley A; Norte, Augusto; Adiko, Adiko F; Bonfoh, Bassirou; Aaron, Grant J

2016-01-01

Poor complementary feeding practices among infants and young children in Côte d'Ivoire are major contributing factors to the country's high burden of malnutrition. As part of a broad effort to address this issue, an affordable, nutritious, and locally produced fortified complementary food product was launched in the Côte d'Ivoire in 2011. The objective of the current research was to assess various levels of coverage of the program and to identify coverage barriers. A cross-sectional household survey was conducted among caregivers of children less than 2-years of age living in Abidjan, Côte d'Ivoire. Four measures of coverage were assessed: "message coverage" (i.e., has the caregiver ever heard of the product?), "contact coverage" (i.e., has the caregiver ever fed the child the product?), "partial coverage" (i.e., has the caregiver fed the child the product in the previous month?), and "effective coverage" (i.e., has the caregiver fed the child the product in the previous 7 days?). A total of 1,113 caregivers with children between 0 and 23 months of age were interviewed. Results showed high message coverage (85.0%), moderate contact coverage (37.8%), and poor partial and effective coverages (8.8% and 4.6%, respectively). Product awareness was lower among caregivers from poorer households, but partial and effective coverages were comparable in both poor and non-poor groups. Infant and young child feeding (IYCF) practices were generally poor and did not appear to have improved since previous assessments. In conclusion, the results from the present study indicate that availability on the market and high awareness among the target population is not sufficient to achieve high and effective coverage. With market-based delivery models, significant efforts are needed to improve demand. Moreover, given the high prevalence of malnutrition and poor IYCF practices, additional modes of delivering IYCF interventions and improving IYCF practices should be considered.

Small nuclear RNA U2 is base-paired to heterogeneous nuclear RNA.

PubMed

Calvet, J P; Meyer, L M; Pederson, T

1982-07-30

Eukaryotic cells contain a set of low molecular weight nuclear RNA's. One of the more abundant of these is termed U2 RNA. The possibility that U2 RNA is hydrogen-bonded to complementary sequences in other nuclear RNA's was investigated. Cultured human (HeLa) cells were treated with a psoralen derivative that cross-links RNA chains that are base-paired with one another. High molecular weight heterogeneous nuclear RNA was isolated under denaturing conditions, and the psoralen cross-links were reversed. Electrophoresis of the released RNA and hybridization with a human cloned U2 DNA probe revealed that U2 is hydrogen-bonded to complementary sequences in heterogeneous nuclear RNA in vivo. In contrast, U2 RNA is not base-paired with nucleolar RNA, which contains the precursors of ribosomal RNA. The results suggest that U2 RNA participates in messenger RNA processing in the nucleus.

RNA-programmed genome editing in human cells

PubMed Central

Jinek, Martin; East, Alexandra; Cheng, Aaron; Lin, Steven; Ma, Enbo; Doudna, Jennifer

2013-01-01

Type II CRISPR immune systems in bacteria use a dual RNA-guided DNA endonuclease, Cas9, to cleave foreign DNA at specific sites. We show here that Cas9 assembles with hybrid guide RNAs in human cells and can induce the formation of double-strand DNA breaks (DSBs) at a site complementary to the guide RNA sequence in genomic DNA. This cleavage activity requires both Cas9 and the complementary binding of the guide RNA. Experiments using extracts from transfected cells show that RNA expression and/or assembly into Cas9 is the limiting factor for Cas9-mediated DNA cleavage. In addition, we find that extension of the RNA sequence at the 3′ end enhances DNA targeting activity in vivo. These results show that RNA-programmed genome editing is a facile strategy for introducing site-specific genetic changes in human cells. DOI: http://dx.doi.org/10.7554/eLife.00471.001 PMID:23386978

Rapid method to detect duplex formation in sequencing by hybridization methods, a method for constructing containment structures for reagent interaction

DOEpatents

Mirzabekov, Andrei Darievich; Yershov, Gennadiy Moiseyevich; Guschin, Dmitry Yuryevich; Gemmell, Margaret Anne; Shick, Valentine V.; Proudnikov, Dmitri Y.; Timofeev, Edward N.

2002-01-01

A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided whereby a plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex so as to facilitate intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface, exposing said light-sensitive fluid to a light pattern so as to cause the fluid exposed to the light to polymerize into discrete units and adhere to the surface; and contacting each of the units with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units.

Mesomorphic phase transitions of 3F7HPhF studied by complementary methods

NASA Astrophysics Data System (ADS)

Deptuch, Aleksandra; Jaworska-Gołąb, Teresa; Marzec, Monika; Pociecha, Damian; Fitas, Jakub; Żurowska, Magdalena; Tykarska, Marzena; Hooper, James

2018-02-01

Physical properties and the phase sequence of (S)-4‧-(1-methylheptyloxycarbonyl)biphenyl-4-yl 4-[7-(2,2,3,3,4,4,4-heptafluorobutoxy) heptyl-1-oxy]-2-fluorobenzoate exhibiting the liquid crystalline paraelectric smectic A*, ferroelectric smectic C* and antiferroelectric smectic CA* phases were studied by complementary methods in the temperature range from -125 to 120 °C. Differential scanning calorimetry measurements together with polarizing optical microscopy provided the phase sequence, including the glass transition and a cold crystallization. X-ray diffraction was used to obtain the unit-cell parameters of the crystal phase, as well as the layer thickness and correlation length in the liquid crystalline smectic phases. The tilt angle was found to reach 45°, as determined from the measurements of the layer thickness and molecular modeling. Relaxation processes in the smectic phases and the fragility parameter were studied using frequency-domain dielectric spectroscopy.

Kits for Characterization of Chromosomal Inversions Using Probes

NASA Technical Reports Server (NTRS)

Ray, F. Andrew (Inventor)

2017-01-01

A kit for the characterization of chromosomal inversions using single-stranded probes that are either all identical or all complementary to a single-stranded chromatid is described. Reporter species are attached to oligonucleotide strands designed such that they may hybridize to portions of only one of a pair of single-stranded sister chromatids which may be prepared by the CO-FISH procedure. If an inversion has occurred, these marker probes will be detected on the second sister chromatid at the same location as the inversion on the first chromatid. The kit includes non-repetitive probes that are either all identical or all complementary to at least a portion of a target DNA sequence of only one DNA strand of only one chromatid and may in some embodiments include reagents suitable for performing CO-FISH and/or reagents for hybridizing the probes to the target DNA sequence.

Design and characterization of a nanopore-coupled polymerase for single-molecule DNA sequencing by synthesis on an electrode array

PubMed Central

Stranges, P. Benjamin; Palla, Mirkó; Kalachikov, Sergey; Nivala, Jeff; Dorwart, Michael; Trans, Andrew; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Tao, Chuanjuan; Morozova, Irina; Li, Zengmin; Shi, Shundi; Aberra, Aman; Arnold, Cleoma; Yang, Alexander; Aguirre, Anne; Harada, Eric T.; Korenblum, Daniel; Pollard, James; Bhat, Ashwini; Gremyachinskiy, Dmitriy; Bibillo, Arek; Chen, Roger; Davis, Randy; Russo, James J.; Fuller, Carl W.; Roever, Stefan; Ju, Jingyue; Church, George M.

2016-01-01

Scalable, high-throughput DNA sequencing is a prerequisite for precision medicine and biomedical research. Recently, we presented a nanopore-based sequencing-by-synthesis (Nanopore-SBS) approach, which used a set of nucleotides with polymer tags that allow discrimination of the nucleotides in a biological nanopore. Here, we designed and covalently coupled a DNA polymerase to an α-hemolysin (αHL) heptamer using the SpyCatcher/SpyTag conjugation approach. These porin–polymerase conjugates were inserted into lipid bilayers on a complementary metal oxide semiconductor (CMOS)-based electrode array for high-throughput electrical recording of DNA synthesis. The designed nanopore construct successfully detected the capture of tagged nucleotides complementary to a DNA base on a provided template. We measured over 200 tagged-nucleotide signals for each of the four bases and developed a classification method to uniquely distinguish them from each other and background signals. The probability of falsely identifying a background event as a true capture event was less than 1.2%. In the presence of all four tagged nucleotides, we observed sequential additions in real time during polymerase-catalyzed DNA synthesis. Single-polymerase coupling to a nanopore, in combination with the Nanopore-SBS approach, can provide the foundation for a low-cost, single-molecule, electronic DNA-sequencing platform. PMID:27729524

First description of Grapevine leafroll-associated virus 5 in Argentina and partial genome sequence.

PubMed

Gómez Talquenca, Sebastián; Muñoz, Claudio; Grau, Oscar; Gracia, Olga

2009-02-01

An accession of Vitis vinifera cv. Red Globe from Argentina, was found to be infected with Grapevine leafroll-associated virus-5 by ELISA. It was partially sequenced, and three ORFs, corresponding to HSP70h, HSP90h, and CP, were found. This isolate shares a high aminoacid identity with the previously reported sequence of the virus, and identities between 80% and 90% with previously reported GLRaV-9 and GLRaV-4 isolates. The analysis of the sequence supports the clustering together with GLRaV-4 and GLRV-9 inside the Ampelovirus genus.

Yeast Pif1 Accelerates Annealing of Complementary DNA Strands

PubMed Central

2015-01-01

Pif1 is a helicase involved in the maintenance of nuclear and mitochondrial genomes in eukaryotes. Here we report a new activity of Saccharomyces cerevisiae Pif1, annealing of complementary DNA strands. We identified preferred substrates for annealing as those that generate a duplex product with a single-stranded overhang relative to a blunt end duplex. Importantly, we show that Pif1 can anneal DNA in the presence of ATP and Mg2+. Pif1-mediated annealing also occurs in the presence of single-stranded DNA binding proteins. Additionally, we show that partial duplex substrates with 3′-single-stranded overhangs such as those generated during double-strand break repair can be annealed by Pif1. PMID:25393406

Yeast Pif1 accelerates annealing of complementary DNA strands.

PubMed

Ramanagoudr-Bhojappa, Ramanagouda; Byrd, Alicia K; Dahl, Christopher; Raney, Kevin D

2014-12-09

Pif1 is a helicase involved in the maintenance of nuclear and mitochondrial genomes in eukaryotes. Here we report a new activity of Saccharomyces cerevisiae Pif1, annealing of complementary DNA strands. We identified preferred substrates for annealing as those that generate a duplex product with a single-stranded overhang relative to a blunt end duplex. Importantly, we show that Pif1 can anneal DNA in the presence of ATP and Mg(2+). Pif1-mediated annealing also occurs in the presence of single-stranded DNA binding proteins. Additionally, we show that partial duplex substrates with 3'-single-stranded overhangs such as those generated during double-strand break repair can be annealed by Pif1.

A PRESTO-SENSE sequence with alternating partial-Fourier encoding for rapid susceptibility-weighted 3D MRI time series.

PubMed

Klarhöfer, Markus; Dilharreguy, Bixente; van Gelderen, Peter; Moonen, Chrit T W

2003-10-01

A 3D sequence for dynamic susceptibility imaging is proposed which combines echo-shifting principles (such as PRESTO), sensitivity encoding (SENSE), and partial-Fourier acquisition. The method uses a moderate SENSE factor of 2 and takes advantage of an alternating partial k-space acquisition in the "slow" phase encode direction allowing an iterative reconstruction using high-resolution phase estimates. Offering an isotropic spatial resolution of 4 x 4 x 4 mm(3), the novel sequence covers the whole brain including parts of the cerebellum in 0.5 sec. Its temporal signal stability is comparable to that of a full-Fourier, full-FOV EPI sequence having the same dynamic scan time but much less brain coverage. Initial functional MRI experiments showed consistent activation in the motor cortex with an average signal change slightly less than that of EPI. Copyright 2003 Wiley-Liss, Inc.

Imported dengue virus serotype 1 from Madeira to Finland 2012.

PubMed

Huhtamo, E; Korhonen, Em; Vapalahti, O

2013-02-21

Imported dengue cases originating from the Madeiran outbreak are increasingly reported. In 2012 five Finnish travellers returning from Madeira were diagnosed with dengue fever. Viral sequence data was obtained from two patients. The partial C-preM sequences (399 and 396 bp respectively) were found similar to that of an autochthonous case from Madeira. The partial E-gene sequence (933 bp) which was identical among the two patients grouped phylogenetically with South American strains of dengue virus serotype 1.

Site Redistribution, Partial Frozen-in Defect Chemistry, and Electrical Properties of Ba1-x(Zr,Pr)O3-δ.

PubMed

Antunes, Isabel; Mikhalev, Sergey; Mather, Glenn Christopher; Kharton, Vladislav Vadimovich; Figueiras, Fábio Gabriel; Alves, Adriana; Rodrigues, Joana; Correia, Maria Rosário; Frade, Jorge Ribeiro; Fagg, Duncan Paul

2016-09-06

Changes in nominal composition of the perovskite (ABO3) solid solution Ba1-x(Zr,Pr)O3-δ and adjusted firing conditions at very high temperatures were used to induce structural changes involving site redistribution and frozen-in point defects, as revealed by Raman and photoluminescence spectroscopies. Complementary magnetic measurements allowed quantification of the reduced content of Pr. Weak dependence of oxygen stoichiometry with temperature was obtained by coulometric titration at temperatures below 1000 °C, consistent with a somewhat complex partial frozen-in defect chemistry. Electrical conductivity measurements combined with transport number and Seebeck coefficient measurements showed prevailing electronic transport and also indicated trends expected for partial frozen-in conditions. Nominal Ba deficiency and controlled firing at very high temperatures allows adjustment of structure and partial frozen-in defect chemistry, opening the way to engineer relevant properties for high-temperature electrochemical applications.

Distinguishing between direct and indirect directional couplings in large oscillator networks: Partial or non-partial phase analyses?

NASA Astrophysics Data System (ADS)

Rings, Thorsten; Lehnertz, Klaus

2016-09-01

We investigate the relative merit of phase-based methods for inferring directional couplings in complex networks of weakly interacting dynamical systems from multivariate time-series data. We compare the evolution map approach and its partialized extension to each other with respect to their ability to correctly infer the network topology in the presence of indirect directional couplings for various simulated experimental situations using coupled model systems. In addition, we investigate whether the partialized approach allows for additional or complementary indications of directional interactions in evolving epileptic brain networks using intracranial electroencephalographic recordings from an epilepsy patient. For such networks, both direct and indirect directional couplings can be expected, given the brain's connection structure and effects that may arise from limitations inherent to the recording technique. Our findings indicate that particularly in larger networks (number of nodes ≫10 ), the partialized approach does not provide information about directional couplings extending the information gained with the evolution map approach.

Hiding message into DNA sequence through DNA coding and chaotic maps.

PubMed

Liu, Guoyan; Liu, Hongjun; Kadir, Abdurahman

2014-09-01

The paper proposes an improved reversible substitution method to hide data into deoxyribonucleic acid (DNA) sequence, and four measures have been taken to enhance the robustness and enlarge the hiding capacity, such as encode the secret message by DNA coding, encrypt it by pseudo-random sequence, generate the relative hiding locations by piecewise linear chaotic map, and embed the encoded and encrypted message into a randomly selected DNA sequence using the complementary rule. The key space and the hiding capacity are analyzed. Experimental results indicate that the proposed method has a better performance compared with the competing methods with respect to robustness and capacity.

Leuconostoc pseudomesenteroides WCFur3 partial 16S rRNA gene

USDA-ARS?s Scientific Manuscript database

This study used a partial 535 base pair 16S rRNA gene sequence to identify a bacterial isolate. Fatty acid profiles are consistent with the 16S rRNA gene sequence identification of this bacterium. The isolate was obtained from a compost bin in Fort Collins, Colorado, USA. The 16S rRNA gene sequen...

Genome-wide comparisons of phylogenetic similarities between partial genomic regions and the full-length genome in Hepatitis E virus genotyping.

PubMed

Wang, Shuai; Wei, Wei; Luo, Xuenong; Cai, Xuepeng

2014-01-01

Besides the complete genome, different partial genomic sequences of Hepatitis E virus (HEV) have been used in genotyping studies, making it difficult to compare the results based on them. No commonly agreed partial region for HEV genotyping has been determined. In this study, we used a statistical method to evaluate the phylogenetic performance of each partial genomic sequence from a genome wide, by comparisons of evolutionary distances between genomic regions and the full-length genomes of 101 HEV isolates to identify short genomic regions that can reproduce HEV genotype assignments based on full-length genomes. Several genomic regions, especially one genomic region at the 3'-terminal of the papain-like cysteine protease domain, were detected to have relatively high phylogenetic correlations with the full-length genome. Phylogenetic analyses confirmed the identical performances between these regions and the full-length genome in genotyping, in which the HEV isolates involved could be divided into reasonable genotypes. This analysis may be of value in developing a partial sequence-based consensus classification of HEV species.

Shrimp miRNAs regulate innate immune response against white spot syndrome virus infection.

PubMed

Kaewkascholkul, Napol; Somboonviwat, Kulwadee; Asakawa, Shuichi; Hirono, Ikuo; Tassanakajon, Anchalee; Somboonwiwat, Kunlaya

2016-07-01

MicroRNAs are short noncoding RNAs of RNA interference pathways that regulate gene expression through partial complementary base-pairing to target mRNAs. In this study, miRNAs that are expressed in white spot syndrome virus (WSSV)-infected Penaeus monodon, were identified using next generation sequencing. Forty-six miRNA homologs were identified from WSSV-infected shrimp hemocyte. Stem-loop real-time RT-PCR analysis showed that 11 out of 16 selected miRNAs were differentially expressed upon WSSV infection. Of those, pmo-miR-315 and pmo-miR-750 were highly responsive miRNAs. miRNA target prediction revealed that the miRNAs were targeted at 5'UTR, ORF, and 3'UTR of several immune-related genes such as genes encoding antimicrobial peptides, signaling transduction proteins, heat shock proteins, oxidative stress proteins, proteinases or proteinase inhibitors, proteins in blood clotting system, apoptosis-related proteins, proteins in prophenoloxidase system, pattern recognition proteins and other immune molecules. The highly conserved miRNA homolog, pmo-bantam, was characterized for its function in shrimp. The pmo-bantam was predicted to target the 3'UTR of Kunitz-type serine protease inhibitor (KuSPI). Binding of pmo-bantam to the target sequence of KuSPI gene was analyzed by luciferase reporter assay. Correlation of pmo-bantam and KuSPI expression was observed in lymphoid organ of WSSV-infected shrimp. These results implied that miRNAs might play roles as immune gene regulators in shrimp antiviral response. Copyright © 2016. Published by Elsevier Ltd.

Natural antisense transcript-targeted regulation of inducible nitric oxide synthase mRNA levels.

PubMed

Yoshigai, Emi; Hara, Takafumi; Araki, Yoshiro; Tanaka, Yoshito; Oishi, Masaharu; Tokuhara, Katsuji; Kaibori, Masaki; Okumura, Tadayoshi; Kwon, A-Hon; Nishizawa, Mikio

2013-04-01

Natural antisense transcripts (asRNAs) are frequently transcribed from mammalian genes. Recently, we found that non-coding asRNAs are transcribed from the 3' untranslated region (3'UTR) of the rat and mouse genes encoding inducible nitric oxide synthase (iNOS), which catalyzes the production of the inflammatory mediator nitric oxide. The iNOS asRNA stabilizes iNOS mRNA by interacting with the mRNA 3'UTR. Furthermore, single-stranded 'sense' oligonucleotides corresponding to the iNOS mRNA sequence were found to reduce iNOS mRNA levels by interfering with mRNA-asRNA interactions in rat hepatocytes. This method was named natural antisense transcript-targeted regulation (NATRE) technology. In this study, we detected human iNOS asRNA expressed in hepatocarcinoma and colon carcinoma tissues. The human iNOS asRNA harbored a sequence complementary to an evolutionarily conserved region of the iNOS mRNA 3'UTR. When introduced into hepatocytes, iNOS sense oligonucleotides that were modified by substitution with partial phosphorothioate bonds and locked nucleic acids or 2'-O-methyl nucleic acids greatly reduced levels of iNOS mRNA and iNOS protein. Moreover, sense oligonucleotides and short interfering RNAs decreased iNOS mRNA to comparable levels. These results suggest that NATRE technology using iNOS sense oligonucleotides could potentially be used to treat human inflammatory diseases and cancers by reducing iNOS mRNA levels. Copyright © 2013 Elsevier Inc. All rights reserved.

COMPUTER SIMULATION STUDY OF AMYLOID FIBRIL FORMATION BY PALINDROMIC SEQUENCES IN PRION PEPTIDES

PubMed Central

Wagoner, Victoria; Cheon, Mookyung; Chang, Iksoo; Hall, Carol

2011-01-01

We simulate the aggregation of large systems containing palindromic peptides from the Syrian hamster prion protein SHaPrP 113–120 (AGAAAAGA) and the mouse prion protein MoPrP 111–120 (VAGAAAAGAV) and eight sequence variations: GAAAAAAG, (AG)4, A8, GAAAGAAA, A10, V10, GAVAAAAVAG, and VAVAAAAVAV The first two peptides are thought to act as the Velcro that holds the parent prion proteins together in amyloid structures and can form fibrils themselves. Kinetic events along the fibrillization pathway influence the types of structures that occur and variations in the sequence affect aggregation kinetics and fibrillar structure. Discontinuous molecular dynamics simulations using the PRIME20 force field are performed on systems containing 48 peptides starting from a random coil configuration. Depending on the sequence, fibrillar structures form spontaneously over a range of temperatures, below which amorphous aggregates form and above which no aggregation occurs. AGAAAAGA forms well organized fibrillar structures whereas VAGAAAAGAV forms less well organized structures that are partially fibrillar and partially amorphous. The degree of order in the fibrillar structure stems in part from the types of kinetic events leading up to its formation, with AGAAAAGA forming less amorphous structures early in the simulation than VAGAAAAGAV. The ability to form fibrils increases as the chain length and the length of the stretch of hydrophobic residues increase. However as the hydrophobicity of the sequence increases, the ability to form well-ordered structures decreases. Thus, longer hydrophobic sequences form slightly disordered aggregates that are partially fibrillar and partially amorphous. Subtle changes in sequence result in slightly different fibril structures. PMID:21557317

Blastocystis phylogeny among various isolates from humans to insects.

PubMed

Yoshikawa, Hisao; Koyama, Yukiko; Tsuchiya, Erika; Takami, Kazutoshi

2016-12-01

Blastocystis is a common unicellular eukaryotic parasite found not only in humans, but also in various kinds of animal species worldwide. Since Blastocystis isolates are morphologically indistinguishable, many molecular biological approaches have been applied to classify these isolates. The complete or partial sequences of the small subunit rRNA gene (SSU rDNA) are mainly used for comparisons and phylogenetic analyses among Blastocystis isolates. However, various lengths of the partial SSU rDNA sequence have been used for phylogenetic inference among genetically different isolates. Based on the complete SSU rDNA sequences, consensus terminology of nine subtypes (STs) of Blastocystis sp. that were supported by phylogenetically monophyletic nine clades was proposed in 2007. Thereafter, eight additional kinds of STs comprising non-human mammalian Blastocystis isolates have been reported based on the phylogeny of SSU rDNA sequences, while STs 11 and 12 were only proposed on the base of partial sequences. Although many sequence data from mammalian and avian Blastocystis are registered in GenBank, only limited data on SSU rDNA are available for poikilotherm-derived Blastocystis isolates. Therefore, the phylogenetic positions of the reptilian/amphibian Blastocystis clades are unstable. The phylogenetic inference of various STs comprising mammalian and/or avian Blastocystis isolates was verified herein based on comparisons between partial and complete SSU rDNA sequences, and the phylogenetic positions of reptilian and amphibian Blastocystis isolates were also investigated using 14 new Blastocystis isolates from reptiles with all known isolates from other reptilians, amphibians, and insects registered in GenBank. Copyright © 2016. Published by Elsevier Ireland Ltd.

Definite existence of subphases with eight- and ten-layer unit cells as studied by complementary methods, electric-field-induced birefringence and microbeam resonant x-ray scattering.

PubMed

Feng, Zhengyu; Chandani Perera, A D L; Fukuda, Atsuo; Vij, Jagdish K; Ishikawa, Ken; Iida, Atsuo; Takanishi, Yoichi

2017-07-01

A mixture of two selenium-containing compounds, 80 wt. % AS657 and 20 wt. % AS620, are studied with two complementary methods, electric-field-induced birefringence (EFIB) and microbeam resonant x-ray scattering (μRXS). The mixture shows the typical phase sequence of Sm-C_{A}^{*}-1/3-1/2-Sm-C^{*}-Sm-C_{α}^{*}-Sm-A, where 1/3 and 1/2 are two prototypal ferrielectric and antiferroelectric subphases with three- and four-layer unit cells, respectively. Here we designate the subphase as its q_{T} number defined by the ratio of [F]/([F]+[A]), where [F] and [A] are the numbers of synclinic ferroelectric and anticlinic antiferroelectric orderings in the unit cell, respectively. The electric field vs temperature phase diagram with EFIB contours indicates the emergence of three additional subphases, an antiferroelectric one between Sm-C_{A}^{*} and 1/3 and antiferroelectric and apparently ferrielectric ones between 1/3 and 1/2. The simplest probable q_{T}'s for these additional subphases are 1/4, 2/5, and 3/7, respectively, in the order of increasing temperature. The μRXS profiles indicate that antiferroelectric 1/4 and 2/5 approximately have the eight-layer (FAAAFAAA) and ten-layer (FAFAAFAFAA) Ising unit cells, respectively. The remaining subphase may be ferrielectric 3/7 with a seven-layer unit cell, although the evidence is partial. These experimental results are compared with the phenomenological Landau model [P. V. Dolganov and E. I. Kats, Liq. Cryst. Rev. 1, 127 (2014)2168-039610.1080/21680396.2013.869667] and the quasimolecular model [A. V. Emelyanenko and M. A. Osipov, Phys. Rev. E 68, 051703 (2003)1063-651X10.1103/PhysRevE.68.051703].

[Guidelines for complementary feeding in healthy infants].

PubMed

Romero-Velarde, Enrique; Villalpando-Carrión, Salvador; Pérez-Lizaur, Ana Berta; Iracheta-Gerez, Ma de la Luz; Alonso-Rivera, Carlos Gilberto; López-Navarrete, Gloria Elena; García-Contreras, Andrea; Ochoa-Ortiz, Erika; Zarate-Mondragón, Flora; López-Pérez, Gerardo Tiburcio; Chávez-Palencia, Clío; Guajardo-Jáquez, Manuel; Vázquez-Ortiz, Salvador; Pinzón-Navarro, Beatriz Adriana; Torres-Duarte, Karely Noemy; Vidal-Guzmán, José Domingo; Michel-Gómez, Pedro Luis; López-Contreras, Iris Nallely; Arroyo-Cruz, Liliana Verenice; Almada-Velasco, Pamela; Saltigeral-Simental, Patricia; Ríos-Aguirre, Alejandro; Domínguez-Pineda, Lorena; Rodríguez-González, Perla; Crabtree-Ramírez, Úrsula; Hernández-Rosiles, Vanessa; Pinacho-Velázquez, José Luis

A proper nutrition during the first two years of life is critical to reach the full potential of every human being; now, this period is recognized as a critical window for promoting optimal growth, development, and good health. Therefore, adequate feeding at this stage of life has an impact on health, nutritional status, growth and development of children; not only in the short term, but in the medium and long term. This paper provides recommendations on complementary feeding (CF) presented as questions or statements that are important for those who take care for children during this stage of life. For example: When to start complementary feedings: 4 or 6 months of age?; Exposure to potentially allergenic foods; Introduction of sweetened beverages; Use of artificial sweeteners and light products; Food introduction sequence; Food consistency changes according to neurological maturation; Number of days to test acceptance and tolerance to new foods; Amounts for each meal; Inadequate complementary feeding practices; Myths and realities of complementary feeding; Developmental milestones; Practice of "Baby Led Weaning" and practice of vegetarianism. Copyright © 2016 Hospital Infantil de México Federico Gómez. Publicado por Masson Doyma México S.A. All rights reserved.

Evaluation of full S1 gene sequencing of classical and variant infectious bronchitis viruses extracted from allantoic fluid and FTA cards.

PubMed

Manswr, Basim; Ball, Christopher; Forrester, Anne; Chantrey, Julian; Ganapathy, Kannan

2018-08-01

Sequence variability in the S1 gene determines the genotype of infectious bronchitis virus (IBV) strains. A single RT-PCR assay was developed to amplify and sequence the full S1 gene for six classical and variant IBVs (M41, D274, 793B, IS/885/00, IS/1494/06 and Q1) enriched in allantoic fluid (AF) or the same AF inoculated onto Flinders Technology Association (FTA) cards. Representative strains from each genotype were grown in specific-pathogen-free eggs and RNA was extracted from AF. Full S1 gene amplification was achieved using primer A and primer 22.51. Products were sequenced using primers A, 1050+, 1380+ and SX3+ to obtain short sequences covering the full gene. Following serial dilutions of AF, detection limits of the partial assay were higher than those of the full S1 gene. Partial S1 sequences exhibited higher-than-average nucleotide similarity percentages (79%; 352 bp) compared to full S1 sequences (77%; 1756 bp), suggesting that full S1 analysis allows greater strain differentiation. For IBV detection from AF-inoculated FTA cards, four serotypes were incubated for up to 21 days at three temperatures, 4°C, room temperature (approximately 24°C) and 40°C. RNA was extracted and tested with partial and full S1 protocols. Through partial sequencing, all IBVs were successfully detected at all sampling points and storage temperatures. In contrast, using full S1 sequencing it was not possible to amplify the gene beyond 14 days or when stored at 40°C. Data presented show that for full S1 sequencing, a substantial amount of RNA is needed. Field samples collected onto FTA cards are unlikely to yield such quantity or quality. AF: allantoic fluid; CD50: ciliostatic dose 50; FTA: Flinders Technology Association; IB: infectious bronchitis; IBV: infectious bronchitis virus.

A Rapid, High-Quality, Cost-Effective, Comprehensive and Expandable Targeted Next-Generation Sequencing Assay for Inherited Heart Diseases.

PubMed

Wilson, Kitchener D; Shen, Peidong; Fung, Eula; Karakikes, Ioannis; Zhang, Angela; InanlooRahatloo, Kolsoum; Odegaard, Justin; Sallam, Karim; Davis, Ronald W; Lui, George K; Ashley, Euan A; Scharfe, Curt; Wu, Joseph C

2015-09-11

Thousands of mutations across >50 genes have been implicated in inherited cardiomyopathies. However, options for sequencing this rapidly evolving gene set are limited because many sequencing services and off-the-shelf kits suffer from slow turnaround, inefficient capture of genomic DNA, and high cost. Furthermore, customization of these assays to cover emerging targets that suit individual needs is often expensive and time consuming. We sought to develop a custom high throughput, clinical-grade next-generation sequencing assay for detecting cardiac disease gene mutations with improved accuracy, flexibility, turnaround, and cost. We used double-stranded probes (complementary long padlock probes), an inexpensive and customizable capture technology, to efficiently capture and amplify the entire coding region and flanking intronic and regulatory sequences of 88 genes and 40 microRNAs associated with inherited cardiomyopathies, congenital heart disease, and cardiac development. Multiplexing 11 samples per sequencing run resulted in a mean base pair coverage of 420, of which 97% had >20× coverage and >99% were concordant with known heterozygous single nucleotide polymorphisms. The assay correctly detected germline variants in 24 individuals and revealed several polymorphic regions in miR-499. Total run time was 3 days at an approximate cost of $100 per sample. Accurate, high-throughput detection of mutations across numerous cardiac genes is achievable with complementary long padlock probe technology. Moreover, this format allows facile insertion of additional probes as more cardiomyopathy and congenital heart disease genes are discovered, giving researchers a powerful new tool for DNA mutation detection and discovery. © 2015 American Heart Association, Inc.

A search for pre-main sequence stars in the high-latitude molecular clouds. II - A survey of the Einstein database

NASA Technical Reports Server (NTRS)

Caillault, Jean-Pierre; Magnani, Loris

1990-01-01

The preliminary results are reported of a survey of every EINSTEIN image which overlaps any high-latitude molecular cloud in a search for X-ray emitting pre-main sequence stars. This survey, together with complementary KPNO and IRAS data, will allow the determination of how prevalent low mass star formation is in these clouds in general and, particularly, in the translucent molecular clouds.

Post-main-sequence planetary system evolution.

PubMed

Veras, Dimitri

2016-02-01

The fates of planetary systems provide unassailable insights into their formation and represent rich cross-disciplinary dynamical laboratories. Mounting observations of post-main-sequence planetary systems necessitate a complementary level of theoretical scrutiny. Here, I review the diverse dynamical processes which affect planets, asteroids, comets and pebbles as their parent stars evolve into giant branch, white dwarf and neutron stars. This reference provides a foundation for the interpretation and modelling of currently known systems and upcoming discoveries.

Fastidious Gram-Negatives: Identification by the Vitek 2 Neisseria-Haemophilus Card and by Partial 16S rRNA Gene Sequencing Analysis.

PubMed

Sönksen, Ute Wolff; Christensen, Jens Jørgen; Nielsen, Lisbeth; Hesselbjerg, Annemarie; Hansen, Dennis Schrøder; Bruun, Brita

2010-12-31

Taxonomy and identification of fastidious Gram negatives are evolving and challenging. We compared identifications achieved with the Vitek 2 Neisseria-Haemophilus (NH) card and partial 16S rRNA gene sequence (526 bp stretch) analysis with identifications obtained with extensive phenotypic characterization using 100 fastidious Gram negative bacteria. Seventy-five strains represented 21 of the 26 taxa included in the Vitek 2 NH database and 25 strains represented related species not included in the database. Of the 100 strains, 31 were the type strains of the species. Vitek 2 NH identification results: 48 of 75 database strains were correctly identified, 11 strains gave `low discrimination´, seven strains were unidentified, and nine strains were misidentified. Identification of 25 non-database strains resulted in 14 strains incorrectly identified as belonging to species in the database. Partial 16S rRNA gene sequence analysis results: For 76 strains phenotypic and sequencing identifications were identical, for 23 strains the sequencing identifications were either probable or possible, and for one strain only the genus was confirmed. Thus, the Vitek 2 NH system identifies most of the commonly occurring species included in the database. Some strains of rarely occurring species and strains of non-database species closely related to database species cause problems. Partial 16S rRNA gene sequence analysis performs well, but does not always suffice, additional phenotypical characterization being useful for final identification.

Fastidious Gram-Negatives: Identification by the Vitek 2 Neisseria-Haemophilus Card and by Partial 16S rRNA Gene Sequencing Analysis

PubMed Central

Sönksen, Ute Wolff; Christensen, Jens Jørgen; Nielsen, Lisbeth; Hesselbjerg, Annemarie; Hansen, Dennis Schrøder; Bruun, Brita

2010-01-01

Taxonomy and identification of fastidious Gram negatives are evolving and challenging. We compared identifications achieved with the Vitek 2 Neisseria-Haemophilus (NH) card and partial 16S rRNA gene sequence (526 bp stretch) analysis with identifications obtained with extensive phenotypic characterization using 100 fastidious Gram negative bacteria. Seventy-five strains represented 21 of the 26 taxa included in the Vitek 2 NH database and 25 strains represented related species not included in the database. Of the 100 strains, 31 were the type strains of the species. Vitek 2 NH identification results: 48 of 75 database strains were correctly identified, 11 strains gave `low discrimination´, seven strains were unidentified, and nine strains were misidentified. Identification of 25 non-database strains resulted in 14 strains incorrectly identified as belonging to species in the database. Partial 16S rRNA gene sequence analysis results: For 76 strains phenotypic and sequencing identifications were identical, for 23 strains the sequencing identifications were either probable or possible, and for one strain only the genus was confirmed. Thus, the Vitek 2 NH system identifies most of the commonly occurring species included in the database. Some strains of rarely occurring species and strains of non-database species closely related to database species cause problems. Partial 16S rRNA gene sequence analysis performs well, but does not always suffice, additional phenotypical characterization being useful for final identification. PMID:21347215

Some New Sets of Sequences of Fuzzy Numbers with Respect to the Partial Metric

PubMed Central

Ozluk, Muharrem

2015-01-01

In this paper, we essentially deal with Köthe-Toeplitz duals of fuzzy level sets defined using a partial metric. Since the utilization of Zadeh's extension principle is quite difficult in practice, we prefer the idea of level sets in order to construct some classical notions. In this paper, we present the sets of bounded, convergent, and null series and the set of sequences of bounded variation of fuzzy level sets, based on the partial metric. We examine the relationships between these sets and their classical forms and give some properties including definitions, propositions, and various kinds of partial metric spaces of fuzzy level sets. Furthermore, we study some of their properties like completeness and duality. Finally, we obtain the Köthe-Toeplitz duals of fuzzy level sets with respect to the partial metric based on a partial ordering. PMID:25695102

[A method for the implementation and promotion of access to comprehensive and complementary primary healthcare practices].

PubMed

Santos, Melissa Costa; Tesser, Charles Dalcanale

2012-11-01

The rendering of integrated and complementary practices in the Brazilian Unified Health System is fostered to increase the comprehensiveness of care and access to same, though it is a challenge to incorporate them into the services. Our objective is to provide a simple method of implementation of such practices in Primary Healthcare, derived from analysis of experiences in municipalities, using partial results of a master's thesis that employed research-action methodology. The method involves four stages: 1 - defininition of a nucleus responsible for implementation and consolidation thereof; 2 - situational analysis, with definition of the existing competent professionals; 3 - regulation, organization of access and legitimation; and 4 - implementation cycle: local plans, mentoring and ongoing education in health. The phases are described, justified and briefly discussed. The method encourages the development of rational and sustainable actions, sponsors participatory management, the creation of comprehensivenessand the broadening of care provided in Primary Healthcare by offering progressive and sustainable comprehensive and complementary practices.

Geranyl diphosphate synthase from mint

DOEpatents

Croteau, Rodney Bruce; Wildung, Mark Raymond; Burke, Charles Cullen; Gershenzon, Jonathan

1999-01-01

A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate.

Geranyl diphosphate synthase from mint

DOEpatents

Croteau, R.B.; Wildung, M.R.; Burke, C.C.; Gershenzon, J.

1999-03-02

A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate. 5 figs.

Sequence specificity of mutagen-nucleic acid complexes in solution: intercalation and mutagen-base pair overlap geometries for proflavine binding to dC-dC-dG-dG and dG-dG-dC-dC self-complementary duplexes.

PubMed

Patel, D J; Canuel, L L

1977-07-01

The complex formed between the mutagen proflavine and the dC-dC-dG-dG and dG-dG-dC-dC self-complementary tetranucleotide duplexes has been monitored by proton high resolution nuclear magnetic resonance spectroscopy in 0.1 M phosphate solution at high nucleotide/drug ratios. The large upfield shifts (0.5 to 0.85 ppm) observed at all the proflavine ring nonexchangeable protons on complex formation are consistent with intercalation of the mutagen between base pairs of the tetranucleotide duplex. We have proposed an approximate overlap geometry between the proflavine ring and nearest neighbor base pairs at the intercalation site from a comparison between experimental shifts and those calculated for various stacking orientations. We have compared the binding of actinomycin D, propidium diiodide, and proflavine to self-complementary tetranucleotide sequences dC-dC-dG-dG and dG-dG-dC-dC by UV absorbance changes in the drug bands between 400 and 500 nm. Actinomycin D exhibits a pronounced specificity for sequences with dG-dC sites (dG-dG-dC-dC), while propidium diiodide and proflavine exhibit a specificity for sequences with dC-dG sites (dC-dC-dG-dG). Actinomycin D binds more strongly than propidium diiodide and proflavine to dC-dG-dC-dG (contains dC-dG and dG-dC binding sites), indicative of the additional stabilization from hydrogen bonding and hydrophobic interactions between the pentapeptide lactone rings of actinomycin D and the base pair edges and sugar-phosphate backbone of the tetranucleotide duplex.

Sequence specificity of mutagen-nucleic acid complexes in solution: Intercalation and mutagen-base pair overlap geometries for proflavine binding to dC-dC-dG-dG and dG-dG-dC-dC self-complementary duplexes

PubMed Central

Patel, Dinshaw J.; Canuel, Lita L.

1977-01-01

The complex formed between the mutagen proflavine and the dC-dC-dG-dG and dG-dG-dC-dC self-complementary tetranucleotide duplexes has been monitored by proton high resolution nuclear magnetic resonance spectroscopy in 0.1 M phosphate solution at high nucleotide/drug ratios. The large upfield shifts (0.5 to 0.85 ppm) observed at all the proflavine ring nonexchangeable protons on complex formation are consistent with intercalation of the mutagen between base pairs of the tetranucleotide duplex. We have proposed an approximate overlap geometry between the proflavine ring and nearest neighbor base pairs at the intercalation site from a comparison between experimental shifts and those calculated for various stacking orientations. We have compared the binding of actinomycin D, propidium diiodide, and proflavine to self-complementary tetranucleotide sequences dC-dC-dG-dG and dG-dG-dC-dC by UV absorbance changes in the drug bands between 400 and 500 nm. Actinomycin D exhibits a pronounced specificity for sequences with dG-dC sites (dG-dG-dC-dC), while propidium diiodide and proflavine exhibit a specificity for sequences with dC-dG sites (dC-dC-dG-dG). Actinomycin D binds more strongly than propidium diiodide and proflavine to dC-dG-dC-dG (contains dC-dG and dG-dC binding sites), indicative of the additional stabilization from hydrogen bonding and hydrophobic interactions between the pentapeptide lactone rings of actinomycin D and the base pair edges and sugar-phosphate backbone of the tetranucleotide duplex. PMID:268613

Solid phase sequencing of biopolymers

DOEpatents

Cantor, Charles; Koster, Hubert

2010-09-28

This invention relates to methods for detecting and sequencing target nucleic acid sequences, to mass modified nucleic acid probes and arrays of probes useful in these methods, and to kits and systems which contain these probes. Useful methods involve hybridizing the nucleic acids or nucleic acids which represent complementary or homologous sequences of the target to an array of nucleic acid probes. These probes comprise a single-stranded portion, an optional double-stranded portion and a variable sequence within the single-stranded portion. The molecular weights of the hybridized nucleic acids of the set can be determined by mass spectroscopy, and the sequence of the target determined from the molecular weights of the fragments. Nucleic acids whose sequences can be determined include DNA or RNA in biological samples such as patient biopsies and environmental samples. Probes may be fixed to a solid support such as a hybridization chip to facilitate automated molecular weight analysis and identification of the target sequence.

Primary structure of prostaglandin G/H synthase from sheep vesicular gland determined from the complementary DNA sequence.

PubMed Central

DeWitt, D L; Smith, W L

1988-01-01

Prostaglandin G/H synthase (8,11,14-icosatrienoate, hydrogen-donor:oxygen oxidoreductase, EC 1.14.99.1) catalyzes the first step in the formation of prostaglandins and thromboxanes, the conversion of arachidonic acid to prostaglandin endoperoxides G and H. This enzyme is the site of action of nonsteroidal anti-inflammatory drugs. We have isolated a 2.7-kilobase complementary DNA (cDNA) encompassing the entire coding region of prostaglandin G/H synthase from sheep vesicular glands. This cDNA, cloned from a lambda gt 10 library prepared from poly(A)+ RNA of vesicular glands, hybridizes with a single 2.75-kilobase mRNA species. The cDNA clone was selected using oligonucleotide probes modeled from amino acid sequences of tryptic peptides prepared from the purified enzyme. The full-length cDNA encodes a protein of 600 amino acids, including a signal sequence of 24 amino acids. Identification of the cDNA as coding for prostaglandin G/H synthase is based on comparison of amino acid sequences of seven peptides comprising 103 amino acids with the amino acid sequence deduced from the nucleotide sequence of the cDNA. The molecular weight of the unglycosylated enzyme lacking the signal peptide is 65,621. The synthase is a glycoprotein, and there are three potential sites for N-glycosylation, two of them in the amino-terminal half of the molecule. The serine reported to be acetylated by aspirin is at position 530, near the carboxyl terminus. There is no significant similarity between the sequence of the synthase and that of any other protein in amino acid or nucleotide sequence libraries, and a heme binding site(s) is not apparent from the amino acid sequence. The availability of a full-length cDNA clone coding for prostaglandin G/H synthase should facilitate studies of the regulation of expression of this enzyme and the structural features important for catalysis and for interaction with anti-inflammatory drugs. Images PMID:3125548

Ultrahigh-resolution Fourier transform ion cyclotron resonance mass spectrometry and tandem mass spectrometry for peptide de novo amino acid sequencing for a seven-protein mixture by paired single-residue transposed Lys-N and Lys-C digestion.

PubMed

Guan, Xiaoyan; Brownstein, Naomi C; Young, Nicolas L; Marshall, Alan G

2017-01-30

Bottom-up tandem mass spectrometry (MS/MS) is regularly used in proteomics to identify proteins from a sequence database. De novo sequencing is also available for sequencing peptides with relatively short sequence lengths. We recently showed that paired Lys-C and Lys-N proteases produce peptides of identical mass and similar retention time, but different tandem mass spectra. Such parallel experiments provide complementary information, and allow for up to 100% MS/MS sequence coverage. Here, we report digestion by paired Lys-C and Lys-N proteases of a seven-protein mixture: human hemoglobin alpha, bovine carbonic anhydrase 2, horse skeletal muscle myoglobin, hen egg white lysozyme, bovine pancreatic ribonuclease, bovine rhodanese, and bovine serum albumin, followed by reversed-phase nanoflow liquid chromatography, collision-induced dissociation, and 14.5 T Fourier transform ion cyclotron resonance mass spectrometry. Matched pairs of product peptide ions of equal precursor mass and similar retention times from each digestion are compared, leveraging single-residue transposed information with independent interferences to confidently identify fragment ion types, residues, and peptides. Selected pairs of product ion mass spectra for de novo sequenced protein segments from each member of the mixture are presented. Pairs of the transposed product ions as well as complementary information from the parallel experiments allow for both high MS/MS coverage for long peptide sequences and high confidence in the amino acid identification. Moreover, the parallel experiments in the de novo sequencing reduce false-positive matches of product ions from the single-residue transposed peptides from the same segment, and thereby further improve the confidence in protein identification. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

Weaning Time in Preterm Infants: An Audit of Italian Primary Care Paediatricians.

PubMed

Baldassarre, Maria Elisabetta; Di Mauro, Antonio; Pedico, Annarita; Rizzo, Valentina; Capozza, Manuela; Meneghin, Fabio; Lista, Gianluca; Laforgia, Nicola

2018-05-15

According to the 2016 Italian National Institute of Statistics (Istat) data in Italy, about 6.7% of all newborns are born prematurely. Due to the lack of data on current complementary feeding in preterm infants in Italy, the aim of the survey was to evaluate individual attitudes of primary care paediatricians, concerning the introduction of complementary foods in preterm infants. An internet-based survey was conducted among primary care paediatricians, working in Italy, regarding (1) timing of the introduction of complementary foods to preterm newborns; (2) type of complementary foods introduced; (3) vitamin D and iron supplementations. A total of 347 primary care Italian paediatricians answered the questionnaire; 44% of responders based the timing of the introduction of solid food exclusively on an infant's age, 18% on an infant's neurodevelopmental status and 4% on the body weight; the remaining 34% based the timing on two or more of these aspects. The type of complementary foods did not comply with an evidence-based sequence; 98% of participants promoted vitamin D supplementation and 89% promoted iron supplementation with great diversity in timing and doses. Due to limited evidence, there is a great heterogeneity in the attitudes of primary care paediatricians concerning the introduction of complementary foods to preterm newborns. Further research is needed to provide evidence-based guidelines regarding weaning preterm newborns.

Inducible Alkylation of DNA by a Quinone Methide-Peptide Nucleic Acid Conjugate†

PubMed Central

Liu, Yang; Rokita, Steven E.

2012-01-01

The reversibility of alkylation by a quinone methide intermediate (QM) avoids the irreversible consumption that plagues most reagents based on covalent chemistry and allows for site specific reaction that is controlled by the thermodynamics rather than kinetics of target association. This characteristic was originally examined with an oligonucleotide QM conjugate but broad application depends on alternative derivatives that are compatible with a cellular environment. Now, a peptide nucleic acid (PNA) derivative has been constructed and shown to exhibit an equivalent ability to delivery the reactive QM in a controlled manner. This new conjugate demonstrates high selectivity for a complementary sequence of DNA even when challenged with an alternative sequence containing a single T/T mismatch. Alkylation of non-complementary sequences is only possible when a template strand is present to co-localize the conjugate and its target. For efficient alkylation in this example, a single-stranded region of the target is required adjacent to the QM conjugate. Most importantly, the intrastrand self adducts formed between the PNA and its attached QM remained active and reversible over more than eight days in aqueous solution prior to reaction with a chosen target added subsequently. PMID:22243337

Isothermal folding of a light-up bio-orthogonal RNA origami nanoribbon.

PubMed

Torelli, Emanuela; Kozyra, Jerzy Wieslaw; Gu, Jing-Ying; Stimming, Ulrich; Piantanida, Luca; Voïtchovsky, Kislon; Krasnogor, Natalio

2018-05-03

RNA presents intringuing roles in many cellular processes and its versatility underpins many different applications in synthetic biology. Nonetheless, RNA origami as a method for nanofabrication is not yet fully explored and the majority of RNA nanostructures are based on natural pre-folded RNA. Here we describe a biologically inert and uniquely addressable RNA origami scaffold that self-assembles into a nanoribbon by seven staple strands. An algorithm is applied to generate a synthetic De Bruijn scaffold sequence that is characterized by the lack of biologically active sites and repetitions larger than a predetermined design parameter. This RNA scaffold and the complementary staples fold in a physiologically compatible isothermal condition. In order to monitor the folding, we designed a new split Broccoli aptamer system. The aptamer is divided into two nonfunctional sequences each of which is integrated into the 5' or 3' end of two staple strands complementary to the RNA scaffold. Using fluorescence measurements and in-gel imaging, we demonstrate that once RNA origami assembly occurs, the split aptamer sequences are brought into close proximity forming the aptamer and turning on the fluorescence. This light-up 'bio-orthogonal' RNA origami provides a prototype that can have potential for in vivo origami applications.

On Asymptotically Good Ramp Secret Sharing Schemes

NASA Astrophysics Data System (ADS)

Geil, Olav; Martin, Stefano; Martínez-Peñas, Umberto; Matsumoto, Ryutaroh; Ruano, Diego

Asymptotically good sequences of linear ramp secret sharing schemes have been intensively studied by Cramer et al. in terms of sequences of pairs of nested algebraic geometric codes. In those works the focus is on full privacy and full reconstruction. In this paper we analyze additional parameters describing the asymptotic behavior of partial information leakage and possibly also partial reconstruction giving a more complete picture of the access structure for sequences of linear ramp secret sharing schemes. Our study involves a detailed treatment of the (relative) generalized Hamming weights of the considered codes.

Bellerophon: A program to detect chimeric sequences in multiple sequence alignments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huber, Thomas; Faulkner, Geoffrey; Hugenholtz, Philip

2003-12-23

Bellerophon is a program for detecting chimeric sequences in multiple sequence datasets by an adaption of partial treeing analysis. Bellerophon was specifically developed to detect 16S rRNA gene chimeras in PCR-clone libraries of environmental samples but can be applied to other nucleotide sequence alignments.

16S rRNA partial gene sequencing for the differentiation and molecular subtyping of Listeria species.

PubMed

Hellberg, Rosalee S; Martin, Keely G; Keys, Ashley L; Haney, Christopher J; Shen, Yuelian; Smiley, R Derike

2013-12-01

Use of 16S rRNA partial gene sequencing within the regulatory workflow could greatly reduce the time and labor needed for confirmation and subtyping of Listeria monocytogenes. The goal of this study was to build a 16S rRNA partial gene reference library for Listeria spp. and investigate the potential for 16S rRNA molecular subtyping. A total of 86 isolates of Listeria representing L. innocua, L. seeligeri, L. welshimeri, and L. monocytogenes were obtained for use in building the custom library. Seven non-Listeria species and three additional strains of Listeria were obtained for use in exclusivity and food spiking tests. Isolates were sequenced for the partial 16S rRNA gene using the MicroSeq ID 500 Bacterial Identification Kit (Applied Biosystems). High-quality sequences were obtained for 84 of the custom library isolates and 23 unique 16S sequence types were discovered for use in molecular subtyping. All of the exclusivity strains were negative for Listeria and the three Listeria strains used in food spiking were consistently recovered and correctly identified at the species level. The spiking results also allowed for differentiation beyond the species level, as 87% of replicates for one strain and 100% of replicates for the other two strains consistently matched the same 16S type. Copyright © 2013 Elsevier Ltd. All rights reserved.

Genetic Characterization of a Panel of Diverse HIV-1 Isolates at Seven International Sites

PubMed Central

Chen, Yue; Sanchez, Ana M.; Sabino, Ester; Hunt, Gillian; Ledwaba, Johanna; Hackett, John; Swanson, Priscilla; Hewlett, Indira; Ragupathy, Viswanath; Vikram Vemula, Sai; Zeng, Peibin; Tee, Kok-Keng; Chow, Wei Zhen; Ji, Hezhao; Sandstrom, Paul; Denny, Thomas N.; Busch, Michael P.; Gao, Feng

2016-01-01

HIV-1 subtypes and drug resistance are routinely tested by many international surveillance groups. However, results from different sites often vary. A systematic comparison of results from multiple sites is needed to determine whether a standardized protocol is required for consistent and accurate data analysis. A panel of well-characterized HIV-1 isolates (N = 50) from the External Quality Assurance Program Oversight Laboratory (EQAPOL) was assembled for evaluation at seven international sites. This virus panel included seven subtypes, six circulating recombinant forms (CRFs), nine unique recombinant forms (URFs) and three group O viruses. Seven viruses contained 10 major drug resistance mutations (DRMs). HIV-1 isolates were prepared at a concentration of 107 copies/ml and compiled into blinded panels. Subtypes and DRMs were determined with partial or full pol gene sequences by conventional Sanger sequencing and/or Next Generation Sequencing (NGS). Subtype and DRM results were reported and decoded for comparison with full-length genome sequences generated by EQAPOL. The partial pol gene was amplified by RT-PCR and sequenced for 89.4%-100% of group M viruses at six sites. Subtyping results of majority of the viruses (83%-97.9%) were correctly determined for the partial pol sequences. All 10 major DRMs in seven isolates were detected at these six sites. The complete pol gene sequence was also obtained by NGS at one site. However, this method missed six group M viruses and sequences contained host chromosome fragments. Three group O viruses were only characterized with additional group O-specific RT-PCR primers employed by one site. These results indicate that PCR protocols and subtyping tools should be standardized to efficiently amplify diverse viruses and more consistently assign virus genotypes, which is critical for accurate global subtype and drug resistance surveillance. Targeted NGS analysis of partial pol sequences can serve as an alternative approach, especially for detection of low-abundance DRMs. PMID:27314585

Genetic Characterization of a Panel of Diverse HIV-1 Isolates at Seven International Sites.

PubMed

Hora, Bhavna; Keating, Sheila M; Chen, Yue; Sanchez, Ana M; Sabino, Ester; Hunt, Gillian; Ledwaba, Johanna; Hackett, John; Swanson, Priscilla; Hewlett, Indira; Ragupathy, Viswanath; Vikram Vemula, Sai; Zeng, Peibin; Tee, Kok-Keng; Chow, Wei Zhen; Ji, Hezhao; Sandstrom, Paul; Denny, Thomas N; Busch, Michael P; Gao, Feng

2016-01-01

HIV-1 subtypes and drug resistance are routinely tested by many international surveillance groups. However, results from different sites often vary. A systematic comparison of results from multiple sites is needed to determine whether a standardized protocol is required for consistent and accurate data analysis. A panel of well-characterized HIV-1 isolates (N = 50) from the External Quality Assurance Program Oversight Laboratory (EQAPOL) was assembled for evaluation at seven international sites. This virus panel included seven subtypes, six circulating recombinant forms (CRFs), nine unique recombinant forms (URFs) and three group O viruses. Seven viruses contained 10 major drug resistance mutations (DRMs). HIV-1 isolates were prepared at a concentration of 107 copies/ml and compiled into blinded panels. Subtypes and DRMs were determined with partial or full pol gene sequences by conventional Sanger sequencing and/or Next Generation Sequencing (NGS). Subtype and DRM results were reported and decoded for comparison with full-length genome sequences generated by EQAPOL. The partial pol gene was amplified by RT-PCR and sequenced for 89.4%-100% of group M viruses at six sites. Subtyping results of majority of the viruses (83%-97.9%) were correctly determined for the partial pol sequences. All 10 major DRMs in seven isolates were detected at these six sites. The complete pol gene sequence was also obtained by NGS at one site. However, this method missed six group M viruses and sequences contained host chromosome fragments. Three group O viruses were only characterized with additional group O-specific RT-PCR primers employed by one site. These results indicate that PCR protocols and subtyping tools should be standardized to efficiently amplify diverse viruses and more consistently assign virus genotypes, which is critical for accurate global subtype and drug resistance surveillance. Targeted NGS analysis of partial pol sequences can serve as an alternative approach, especially for detection of low-abundance DRMs.

Analysis of sequences from field samples reveals the presence of the recently described pepper vein yellows virus (genus Polerovirus) in six additional countries.

PubMed

Knierim, Dennis; Tsai, Wen-Shi; Kenyon, Lawrence

2013-06-01

Polerovirus infection was detected by reverse transcription polymerase chain reaction (RT-PCR) in 29 pepper plants (Capsicum spp.) and one black nightshade plant (Solanum nigrum) sample collected from fields in India, Indonesia, Mali, Philippines, Thailand and Taiwan. At least two representative samples for each country were selected to generate a general polerovirus RT-PCR product of 1.4 kb length for sequencing. Sequence analysis of the partial genome sequences revealed the presence of pepper vein yellows virus (PeVYV) in all 13 samples. A 1990 Australian herbarium sample of pepper described by serological means as infected with capsicum yellows virus (CYV) was identified by sequence analysis of a partial CP sequence as probably infected with a potato leaf roll virus (PLRV) isolate.

Large scale DNA microsequencing device

DOEpatents

Foote, Robert S.

1997-01-01

A microminiature sequencing apparatus and method provide means for simultaneously obtaining sequences of plural polynucleotide strands. The apparatus comprises a microchip into which plural channels have been etched using standard lithographic procedures and chemical wet etching. The channels include a reaction well and a separating section. Enclosing the channels is accomplished by bonding a transparent cover plate over the apparatus. A first oligonucleotide strand is chemically affixed to the apparatus through an alkyl chain. Subsequent nucleotides are selected by complementary base pair bonding. A target nucleotide strand is used to produce a family of labelled sequencing strands in each channel which are separated in the separating section. During or following separation the sequences are determined using appropriate detection means.

Large scale DNA microsequencing device

DOEpatents

Foote, Robert S.

1999-01-01

A microminiature sequencing apparatus and method provide means for simultaneously obtaining sequences of plural polynucleotide strands. The apparatus comprises a microchip into which plural channels have been etched using standard lithographic procedures and chemical wet etching. The channels include a reaction well and a separating section. Enclosing the channels is accomplished by bonding a transparent cover plate over the apparatus. A first oligonucleotide strand is chemically affixed to the apparatus through an alkyl chain. Subsequent nucleotides are selected by complementary base pair bonding. A target nucleotide strand is used to produce a family of labelled sequencing strands in each channel which are separated in the separating section. During or following separation the sequences are determined using appropriate detection means.

Large scale DNA microsequencing device

DOEpatents

Foote, R.S.

1999-08-31

A microminiature sequencing apparatus and method provide means for simultaneously obtaining sequences of plural polynucleotide strands. The apparatus comprises a microchip into which plural channels have been etched using standard lithographic procedures and chemical wet etching. The channels include a reaction well and a separating section. Enclosing the channels is accomplished by bonding a transparent cover plate over the apparatus. A first oligonucleotide strand is chemically affixed to the apparatus through an alkyl chain. Subsequent nucleotides are selected by complementary base pair bonding. A target nucleotide strand is used to produce a family of labelled sequencing strands in each channel which are separated in the separating section. During or following separation the sequences are determined using appropriate detection means. 11 figs.

DETECTION OF DNA DAMAGE USING A FIBEROPTIC BIOSENSOR

EPA Science Inventory

A rapid and sensitive fiber optic biosensor assay for radiation-induced DNA damage is reported. For this assay, a biotin-labeled capture oligonucleotide (38 mer) was immobilized to an avidin-coated quartz fiber. Hybridization of a dye-labeled complementary sequence was observed...

Phylogenetic Analysis of Marine Picoplankton Using Tau RNA Sequences.

DTIC Science & Technology

1991-02-01

Pacific Ocean (Aloha Station). DNA prepared from both populations was analyzed by hybridization using kingdom -specific probes complementary to 16S rRNA...euba:-teria. Few eukaryotes, no archaebacteria detected (at low resolution). "* Fluorescendly labeled phylogenetir group-specific oligon ucleotfides

Structure, sequence and expression of the hepatitis delta (δ) viral genome

NASA Astrophysics Data System (ADS)

Wang, Kang-Sheng; Choo, Qui-Lim; Weiner, Amy J.; Ou, Jing-Hsiung; Najarian, Richard C.; Thayer, Richard M.; Mullenbach, Guy T.; Denniston, Katherine J.; Gerin, John L.; Houghton, Michael

1986-10-01

Biochemical and electron microscopic data indicate that the human hepatitis δ viral agent contains a covalently closed circular and single-stranded RNA genome that has certain similarities with viroid-like agents from plants. The sequence of the viral genome (1,678 nucleotides) has been determined and an open reading frame within the complementary strand has been shown to encode an antigen that binds specifically to antisera from patients with chronic hepatitis δ viral infections.

Post-main-sequence planetary system evolution

PubMed Central

Veras, Dimitri

2016-01-01

The fates of planetary systems provide unassailable insights into their formation and represent rich cross-disciplinary dynamical laboratories. Mounting observations of post-main-sequence planetary systems necessitate a complementary level of theoretical scrutiny. Here, I review the diverse dynamical processes which affect planets, asteroids, comets and pebbles as their parent stars evolve into giant branch, white dwarf and neutron stars. This reference provides a foundation for the interpretation and modelling of currently known systems and upcoming discoveries. PMID:26998326

Circular codes revisited: a statistical approach.

PubMed

Gonzalez, D L; Giannerini, S; Rosa, R

2011-04-21

In 1996 Arquès and Michel [1996. A complementary circular code in the protein coding genes. J. Theor. Biol. 182, 45-58] discovered the existence of a common circular code in eukaryote and prokaryote genomes. Since then, circular code theory has provoked great interest and underwent a rapid development. In this paper we discuss some theoretical issues related to the synchronization properties of coding sequences and circular codes with particular emphasis on the problem of retrieval and maintenance of the reading frame. Motivated by the theoretical discussion, we adopt a rigorous statistical approach in order to try to answer different questions. First, we investigate the covering capability of the whole class of 216 self-complementary, C(3) maximal codes with respect to a large set of coding sequences. The results indicate that, on average, the code proposed by Arquès and Michel has the best covering capability but, still, there exists a great variability among sequences. Second, we focus on such code and explore the role played by the proportion of the bases by means of a hierarchy of permutation tests. The results show the existence of a sort of optimization mechanism such that coding sequences are tailored as to maximize or minimize the coverage of circular codes on specific reading frames. Such optimization clearly relates the function of circular codes with reading frame synchronization. Copyright © 2011 Elsevier Ltd. All rights reserved.

An Entertaining Method of Teaching Concepts of Linear Light Propagation, Reflection and Refraction Using a Simple Optical Mechanism

ERIC Educational Resources Information Center

Yurumezoglu, K.

2009-01-01

An activity has been designed for the purpose of teaching how light is dispersed in a straight line and about the interaction between matter and light as well as the related concepts of shadows, partial shadows, reflection, refraction, primary colours and complementary (secondary) colours, and differentiating the relationship between colours, all…

Analysis of the endogenous peptide profile of milk: identification of 248 mainly casein-derived peptides.

PubMed

Baum, Florian; Fedorova, Maria; Ebner, Jennifer; Hoffmann, Ralf; Pischetsrieder, Monika

2013-12-06

Milk is an excellent source of bioactive peptides. However, the composition of the native milk peptidome has only been partially elucidated. The present study applied matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) directly or after prefractionation of the milk peptides by reverse-phase high-performance liquid chromatography (RP-HPLC) or OFFGEL fractionation for the comprehensive analysis of the peptide profile of raw milk. The peptide sequences were determined by MALDI-TOF/TOF or nano-ultra-performance liquid chromatography-nanoelectrospray ionization-LTQ-Orbitrap-MS. Direct MALDI-TOF-MS analysis led to the assignment of 57 peptides. Prefractionation by both complementary methods led to the assignment of another 191 peptides. Most peptides originate from α(S1)-casein, followed by β-casein, and α(S2)-casein. κ-Casein and whey proteins seem to play only a minor role as peptide precursors. The formation of many, but not all, peptides could be explained by the activity of the endogenous peptidases, plasmin or cathepsin D, B, and G. Database searches revealed the presence of 22 peptides with established physiological function, including those with angiotensin-converting-enzyme (ACE) inhibitory, immunomodulating, or antimicrobial activity.

Titanium Dioxide Nanoparticle-Based Interdigitated Electrodes: A Novel Current to Voltage DNA Biosensor Recognizes E. coli O157:H7.

PubMed

Nadzirah, Sh; Azizah, N; Hashim, Uda; Gopinath, Subash C B; Kashif, Mohd

2015-01-01

Nanoparticle-mediated bio-sensing promoted the development of novel sensors in the front of medical diagnosis. In the present study, we have generated and examined the potential of titanium dioxide (TiO2) crystalline nanoparticles with aluminium interdigitated electrode biosensor to specifically detect single-stranded E.coli O157:H7 DNA. The performance of this novel DNA biosensor was measured the electrical current response using a picoammeter. The sensor surface was chemically functionalized with (3-aminopropyl) triethoxysilane (APTES) to provide contact between the organic and inorganic surfaces of a single-stranded DNA probe and TiO2 nanoparticles while maintaining the sensing system's physical characteristics. The complement of the target DNA of E. coli O157:H7 to the carboxylate-probe DNA could be translated into electrical signals and confirmed by the increased conductivity in the current-to-voltage curves. The specificity experiments indicate that the biosensor can discriminate between the complementary sequences from the base-mismatched and the non-complementary sequences. After duplex formation, the complementary target sequence can be quantified over a wide range with a detection limit of 1.0 x 10(-13)M. With target DNA from the lysed E. coli O157:H7, we could attain similar sensitivity. Stability of DNA immobilized surface was calculated with the relative standard deviation (4.6%), displayed the retaining with 99% of its original response current until 6 months. This high-performance interdigitated DNA biosensor with high sensitivity, stability and non-fouling on a novel sensing platform is suitable for a wide range of biomolecular interactive analyses.

Titanium Dioxide Nanoparticle-Based Interdigitated Electrodes: A Novel Current to Voltage DNA Biosensor Recognizes E. coli O157:H7

PubMed Central

Nadzirah, Sh.; Azizah, N.; Hashim, Uda; Gopinath, Subash C. B.; Kashif, Mohd

2015-01-01

Nanoparticle-mediated bio-sensing promoted the development of novel sensors in the front of medical diagnosis. In the present study, we have generated and examined the potential of titanium dioxide (TiO2) crystalline nanoparticles with aluminium interdigitated electrode biosensor to specifically detect single-stranded E.coli O157:H7 DNA. The performance of this novel DNA biosensor was measured the electrical current response using a picoammeter. The sensor surface was chemically functionalized with (3-aminopropyl) triethoxysilane (APTES) to provide contact between the organic and inorganic surfaces of a single-stranded DNA probe and TiO2 nanoparticles while maintaining the sensing system’s physical characteristics. The complement of the target DNA of E. coli O157:H7 to the carboxylate-probe DNA could be translated into electrical signals and confirmed by the increased conductivity in the current-to-voltage curves. The specificity experiments indicate that the biosensor can discriminate between the complementary sequences from the base-mismatched and the non-complementary sequences. After duplex formation, the complementary target sequence can be quantified over a wide range with a detection limit of 1.0 x 10-13M. With target DNA from the lysed E. coli O157:H7, we could attain similar sensitivity. Stability of DNA immobilized surface was calculated with the relative standard deviation (4.6%), displayed the retaining with 99% of its original response current until 6 months. This high-performance interdigitated DNA biosensor with high sensitivity, stability and non-fouling on a novel sensing platform is suitable for a wide range of biomolecular interactive analyses. PMID:26445455

A New Zamilon-like Virophage Partial Genome Assembled from a Bioreactor Metagenome

PubMed Central

Bekliz, Meriem; Verneau, Jonathan; Benamar, Samia; Raoult, Didier; La Scola, Bernard; Colson, Philippe

2015-01-01

Virophages replicate within viral factories inside the Acanthamoeba cytoplasm, and decrease the infectivity and replication of their associated giant viruses. Culture isolation and metagenome analyses have suggested that they are common in our environment. By screening metagenomic databases in search of amoebal viruses, we detected virophage-related sequences among sequences generated from the same non-aerated bioreactor metagenome as recently screened by another team for virophage capsid-encoding genes. We describe here the assembled partial genome of a virophage closely related to Zamilon, which infects Acanthamoeba with mimiviruses of lineages B and C but not A. Searches for sequences related to amoebal giant viruses, other Megavirales representatives and virophages were conducted using BLAST against this bioreactor metagenome (PRJNA73603). Comparative genomic and phylogenetic analyses were performed using sequences from previously identified virophages. A total of 72 metagenome contigs generated from the bioreactor were identified as best matching with sequences from Megavirales representatives, mostly Pithovirus sibericum, pandoraviruses and amoebal mimiviruses from three lineages A–C, as well as from virophages. In addition, a partial genome from a Zamilon-like virophage, we named Zamilon 2, was assembled. This genome has a size of 6716 base pairs, corresponding to 39% of the Zamilon genome, and comprises partial or full-length homologs for 15 Zamilon predicted open reading frames (ORFs). Mean nucleotide and amino acid identities for these 15 Zamilon 2 ORFs with their Zamilon counterparts were 89% (range, 81–96%) and 91% (range, 78–99%), respectively. Notably, these ORFs included two encoding a capsid protein and a packaging ATPase. Comparative genomics and phylogenetic analyses indicated that the partial genome was that of a new Zamilon-like virophage. Further studies are needed to gain better knowledge of the tropism and prevalence of virophages in our biosphere and in humans. PMID:26640459

High-Resolution Sequence-Function Mapping of Full-Length Proteins

PubMed Central

Kowalsky, Caitlin A.; Klesmith, Justin R.; Stapleton, James A.; Kelly, Vince; Reichkitzer, Nolan; Whitehead, Timothy A.

2015-01-01

Comprehensive sequence-function mapping involves detailing the fitness contribution of every possible single mutation to a gene by comparing the abundance of each library variant before and after selection for the phenotype of interest. Deep sequencing of library DNA allows frequency reconstruction for tens of thousands of variants in a single experiment, yet short read lengths of current sequencers makes it challenging to probe genes encoding full-length proteins. Here we extend the scope of sequence-function maps to entire protein sequences with a modular, universal sequence tiling method. We demonstrate the approach with both growth-based selections and FACS screening, offer parameters and best practices that simplify design of experiments, and present analytical solutions to normalize data across independent selections. Using this protocol, sequence-function maps covering full sequences can be obtained in four to six weeks. Best practices introduced in this manuscript are fully compatible with, and complementary to, other recently published sequence-function mapping protocols. PMID:25790064

Aptamer-based electrochemical sensors with aptamer-complementary DNA oligonucleotides as probe.

PubMed

Lu, Ying; Li, Xianchan; Zhang, Limin; Yu, Ping; Su, Lei; Mao, Lanqun

2008-03-15

This study describes a facile and general strategy for the development of aptamer-based electrochemical sensors with a high specificity toward the targets and a ready regeneration feature. Very different from the existing strategies for the development of electrochemical aptasensors with the aptamers as the probes, the strategy proposed here is essentially based on the utilization of the aptamer-complementary DNA (cDNA) oligonucleotides as the probes for electrochemical sensing. In this context, the sequences at both ends of the cDNA are tailor-made to be complementary and both the redox moiety (i.e., ferrocene in this study) and thiol group are labeled onto the cDNA. The labeled cDNA are hybridized with their respective aptamers (i.e., ATP- and thrombin-binding aptamers in this study) to form double-stranded DNA (ds-DNA) and the electrochemical aptasensors are prepared by self-assembling the labeled ds-DNA onto Au electrodes. Upon target binding, the aptamers confined onto electrode surface dissociate from their respective cDNA oligonucleotides into the solution and the single-stranded cDNA could thus tend to form a hairpin structure through the hybridization of the complementary sequences at both its ends. Such a conformational change of the cDNA resulting from the target binding-induced dissociation of the aptamers essentially leads to the change in the voltammetric signal of the redox moiety labeled onto the cDNA and thus constitutes the mechanism for the electrochemical aptasensors for specific target sensing. The aptasensors demonstrated here with the cDNA as the probe are readily regenerated and show good responses toward the targets. This study may offer a new and relatively general approach to electrochemical aptasensors with good analytical properties and potential applications.

Partial sequencing analysis of the NS5B region confirmed the predominance of hepatitis C virus genotype 1 infection in Jeddah, Saudi Arabia.

PubMed

El Hadad, Sahar; Al-Hamdan, Hesa; Linjawi, Sabah

2017-01-01

Chronic hepatitis C virus (HCV) infection and its progression are major health problems that many countries including Saudi Arabia are facing. Determination of HCV genotypes and subgenotypes is critical for epidemiological and clinical analysis and aids in the determination of the ideal treatment strategy that needs to be followed and the expected therapy response. Although HCV infection has been identified as the second most predominant type of hepatitis in Saudi Arabia, little is known about the molecular epidemiology and genetic variability of HCV circulating in the Jeddah province of Saudi Arabia. The aim of this study was to determine the dominance of various HCV genotypes and subgenotypes circulating in Jeddah using partial sequencing of the NS5B region. To the best of our knowledge, this is the first study of its kind in Saudi Arabia. To characterize HCV genotypes and subgenotypes, serum samples from 56 patients with chronic HCV infection were collected and subjected to partial NS5B gene amplification and sequence analysis. Phylogenetic analysis of the NS5B partial sequences revealed that HCV/1 was the predominant genotype (73%), followed by HCV/4 (24.49%) and HCV/3 (2.04%). Moreover, pairwise analysis also confirmed these results based on the average specific nucleotide distance identity: ±0.112, ±0.112, and ±0.179 for HCV/1, HCV/4, and HCV/3, respectively, without any interference between genotypes. Notably, the phylogenetic tree of the HCV/1 subgenotypes revealed that all the isolates (100%) from the present study belonged to the HCV/1a subgenotype. Our findings also revealed similarities in the nucleotide sequences between HCV circulating in Saudi Arabia and those circulating in countries such as Morocco, Egypt, Canada, India, Pakistan, and France. These results indicated that determination of HCV genotypes and subgenotypes based on partial sequence analysis of the NS5B region is accurate and reliable for HCV subtype determination.

Electrochemical detection of sequence-specific DNA based on formation of G-quadruplex-hemin through continuous hybridization chain reaction.

PubMed

Sun, Xiaofan; Chen, Haohan; Wang, Shuling; Zhang, Yiping; Tian, Yaping; Zhou, Nandi

2018-08-27

A high-sensitive detection of sequence-specific DNA was established based on the formation of G-quadruplex-hemin complex through continuous hybridization chain reaction (HCR). Taking HIV DNA sequence as an example, a capture probe complementary to part of HIV DNA was firstly self-assembled onto the surface of Au electrode. Then a specially designed assistant probe with both terminals complementary to the target DNA and a G-quadruplex-forming sequence in the center was introduced into the detection solution. In the presence of both the target DNA and the assistant probe, the target DNA can be captured on the electrode surface and then a continuous HCR can be conducted due to the mutual recognition of the target DNA and the assistant probe, leading to the formation of a large number of G-quadruplex on the electrode surface. With the help of hemin, a pronounced electrochemical signal can be observed in differential pulse voltammetry (DPV), due to the formation of G-quadruplex-hemin complex. The peak current is linearly related with the logarithm of the concentration of the target DNA in the range from 10 fM to 10 pM. The electrochemical sensor has high selectivity to clearly discriminate single-base mismatched and three-base mismatched sequences from the original HIV DNA sequence. Moreover, the established DNA sensor was challenged by detection of HIV DNA in human serum samples, which showed the low detection limit of 6.3 fM. Thus it has great application prospect in the field of clinical diagnosis and environmental monitoring. Copyright © 2018 Elsevier B.V. All rights reserved.

A label-free fluorescent direct detection of live Salmonella typhimurium using cascade triple trigger sequences-regenerated strand displacement amplification and hairpin template-generated-scaffolded silver nanoclusters.

PubMed

Zhang, Peng; Liu, Hui; Li, Xiaocheng; Ma, Suzhen; Men, Shuai; Wei, Heng; Cui, Jingjing; Wang, Hongning

2017-01-15

The harm of Salmonella typhimurium (S. typhimurium) to public health mainly by the consumption of contaminated agricultural products or water stresses an urgent need for rapid detection methods to help control the spread of S. typhimurium. In this work, an intelligently designed sensor system took creative advantage of triple trigger sequences-regenerated strand displacement amplification and self-protective hairpin template-generated-scaffolded silver nanoclusters (AgNCs) for the first time. In the presence of live S. typhimurium, single-stranded trigger sequences were released from aptamer-trigger sequences complex, initiating a branch migration to open the hairpin template I containing complementary scaffolds of AgNCs. Then the first strand displacement amplification was induced to produce numerous scaffolds of AgNCs and reporter strands which initiated a branch migration to open the hairpin template II containing complementary scaffolds of AgNCs. Then the second strand displacement amplification was induced to generate numerous scaffolds of AgNCs and trigger sequences which initiated the third branch migration and strand displacement amplification to produce numerous scaffolds of AgNCs and reporter strands in succession. Cyclically, the reproduction of the trigger sequences and cascade successive production of scaffolds were achieved successfully, forming highly fluorescent AgNCs, thus providing significantly enhanced fluorescent signals to achieve ultrasensitive detection of live S. typhimurium down to 50 CFU/mL with a linear range from 10 2 to 10 7 CFU/mL. It is the first report on a fluorescent biosensor for detecting viable S. typhimurium directly, which can distinguish from heat denatured S. typhimurium. And it develops a new strategy to generate the DNA-scaffolds for forming AgNCs. Copyright © 2016 Elsevier B.V. All rights reserved.

Circular RNAs: Unexpected outputs of many protein-coding genes

PubMed Central

Wilusz, Jeremy E.

2017-01-01

ABSTRACT Pre-mRNAs from thousands of eukaryotic genes can be non-canonically spliced to generate circular RNAs, some of which accumulate to higher levels than their associated linear mRNA. Recent work has revealed widespread mechanisms that dictate whether the spliceosome generates a linear or circular RNA. For most genes, circular RNA biogenesis via backsplicing is far less efficient than canonical splicing, but circular RNAs can accumulate due to their long half-lives. Backsplicing is often initiated when complementary sequences from different introns base pair and bring the intervening splice sites close together. This process is further regulated by the combinatorial action of RNA binding proteins, which allow circular RNAs to be expressed in unique patterns. Some genes do not require complementary sequences to generate RNA circles and instead take advantage of exon skipping events. It is still unclear what most mature circular RNAs do, but future investigations into their functions will be facilitated by recently described methods to modulate circular RNA levels. PMID:27571848

Identification of antisense nucleic acid hybridization sites in mRNA molecules with self-quenching fluorescent reporter molecules

PubMed Central

Gifford, Lida K.; Opalinska, Joanna B.; Jordan, David; Pattanayak, Vikram; Greenham, Paul; Kalota, Anna; Robbins, Michelle; Vernovsky, Kathy; Rodriguez, Lesbeth C.; Do, Bao T.; Lu, Ponzy; Gewirtz, Alan M.

2005-01-01

We describe a physical mRNA mapping strategy employing fluorescent self-quenching reporter molecules (SQRMs) that facilitates the identification of mRNA sequence accessible for hybridization with antisense nucleic acids in vitro and in vivo, real time. SQRMs are 20–30 base oligodeoxynucleotides with 5–6 bp complementary ends to which a 5′ fluorophore and 3′ quenching group are attached. Alone, the SQRM complementary ends form a stem that holds the fluorophore and quencher in contact. When the SQRM forms base pairs with its target, the structure separates the fluorophore from the quencher. This event can be reported by fluorescence emission when the fluorophore is excited. The stem–loop of the SQRM suggests that SQRM be made to target natural stem–loop structures formed during mRNA synthesis. The general utility of this method is demonstrated by SQRM identification of targetable sequence within c-myb and bcl-6 mRNA. Corresponding antisense oligonucleotides reduce these gene products in cells. PMID:15718294

Programmable hydrogels for controlled cell catch and release using hybridized aptamers and complementary sequences.

PubMed

Zhang, Zhaoyang; Chen, Niancao; Li, Shihui; Battig, Mark R; Wang, Yong

2012-09-26

The ability to regulate cell-material interactions is important in various applications such as regenerative medicine and cell separation. This study successfully demonstrates that the binding states of cells on a hydrogel surface can be programmed by using hybridized aptamers and triggering complementary sequences (CSs). In the absence of the triggering CSs, the aptamers exhibit a stable, hybridized state in the hydrogel for cell-type-specific catch. In the presence of the triggering CSs, the aptamers are transformed into a new hybridized state that leads to the rapid dissociation of the aptamers from the hydrogel. As a result, the cells are released from the hydrogel. The entire procedure of cell catch and release during the transformation of the aptamers is biocompatible and does not involve any factor destructive to either the cells or the hydrogel. Thus, the programmable hydrogel is regenerable and can be applied to a new round of cell catch and release when needed.

Dynamic covalent chemistry enables formation of antimicrobial peptide quaternary assemblies in a completely abiotic manner

NASA Astrophysics Data System (ADS)

Reuther, James F.; Dees, Justine L.; Kolesnichenko, Igor V.; Hernandez, Erik T.; Ukraintsev, Dmitri V.; Guduru, Rusheel; Whiteley, Marvin; Anslyn, Eric V.

2018-01-01

Naturally occurring peptides and proteins often use dynamic disulfide bonds to impart defined tertiary/quaternary structures for the formation of binding pockets with uniform size and function. Although peptide synthesis and modification are well established, controlling quaternary structure formation remains a significant challenge. Here, we report the facile incorporation of aryl aldehyde and acyl hydrazide functionalities into peptide oligomers via solid-phase copper-catalysed azide-alkyne cycloaddition (SP-CuAAC) click reactions. When mixed, these complementary functional groups rapidly react in aqueous media at neutral pH to form peptide-peptide intermolecular macrocycles with highly tunable ring sizes. Moreover, sequence-specific figure-of-eight, dumbbell-shaped, zipper-like and multi-loop quaternary structures were formed selectively. Controlling the proportions of reacting peptides with mismatched numbers of complementary reactive groups results in the formation of higher-molecular-weight sequence-defined ladder polymers. This also amplified antimicrobial effectiveness in select cases. This strategy represents a general approach to the creation of complex abiotic peptide quaternary structures.

Antisense phosphorothioate oligonucleotides: selective killing of the intracellular parasite Leishmania amazonensis.

PubMed

Ramazeilles, C; Mishra, R K; Moreau, S; Pascolo, E; Toulmé, J J

1994-08-16

We targeted the mini-exon sequence, present at the 5' end of every mRNA of the protozoan parasite Leishmania amazonensis, by phosphorothioate oligonucleotides. A complementary 16-mer (16PS) was able to kill amastigotes--the intracellular stage of the parasite--in murine macrophages in culture. After 24 hr of incubation with 10 microM 16PS, about 30% infected macrophages were cured. The oligomer 16PS acted through antisense hybridization in a sequence-dependent way; no effect on parasites was observed with noncomplementary phosphorothioate oligonucleotides. The antisense oligonucleotide 16PS was a selective killer of the protozoans without any detrimental effect to the host macrophage. Using 16PS linked to a palmitate chain, which enabled it to complex with low density lipoproteins, improved the leishmanicidal efficiency on intracellular amastigotes, probably due to increased endocytosis. Phosphorothioate oligonucleotides complementary to the intron part of the mini-exon pre-RNA were also effective, suggesting that antisense oligomers could prevent trans-splicing in these parasites.

Aggregating and Predicting Sequence Labels from Crowd Annotations

PubMed Central

Nguyen, An T.; Wallace, Byron C.; Li, Junyi Jessy; Nenkova, Ani; Lease, Matthew

2017-01-01

Despite sequences being core to NLP, scant work has considered how to handle noisy sequence labels from multiple annotators for the same text. Given such annotations, we consider two complementary tasks: (1) aggregating sequential crowd labels to infer a best single set of consensus annotations; and (2) using crowd annotations as training data for a model that can predict sequences in unannotated text. For aggregation, we propose a novel Hidden Markov Model variant. To predict sequences in unannotated text, we propose a neural approach using Long Short Term Memory. We evaluate a suite of methods across two different applications and text genres: Named-Entity Recognition in news articles and Information Extraction from biomedical abstracts. Results show improvement over strong baselines. Our source code and data are available online1. PMID:29093611

Molecular characterization of human T-cell lymphotropic virus type 1 full and partial genomes by Illumina massively parallel sequencing technology.

PubMed

Pessôa, Rodrigo; Watanabe, Jaqueline Tomoko; Nukui, Youko; Pereira, Juliana; Casseb, Jorge; Kasseb, Jorge; de Oliveira, Augusto César Penalva; Segurado, Aluisio Cotrim; Sanabani, Sabri Saeed

2014-01-01

Here, we report on the partial and full-length genomic (FLG) variability of HTLV-1 sequences from 90 well-characterized subjects, including 48 HTLV-1 asymptomatic carriers (ACs), 35 HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP) and 7 adult T-cell leukemia/lymphoma (ATLL) patients, using an Illumina paired-end protocol. Blood samples were collected from 90 individuals, and DNA was extracted from the PBMCs to measure the proviral load and to amplify the HTLV-1 FLG from two overlapping fragments. The amplified PCR products were subjected to deep sequencing. The sequencing data were assembled, aligned, and mapped against the HTLV-1 genome with sufficient genetic resemblance and utilized for further phylogenetic analysis. A high-throughput sequencing-by-synthesis instrument was used to obtain an average of 3210- and 5200-fold coverage of the partial (n = 14) and FLG (n = 76) data from the HTLV-1 strains, respectively. The results based on the phylogenetic trees of consensus sequences from partial and FLGs revealed that 86 (95.5%) individuals were infected with the transcontinental sub-subtypes of the cosmopolitan subtype (aA) and that 4 individuals (4.5%) were infected with the Japanese sub-subtypes (aB). A comparison of the nucleotide and amino acids of the FLG between the three clinical settings yielded no correlation between the sequenced genotype and clinical outcomes. The evolutionary relationships among the HTLV sequences were inferred from nucleotide sequence, and the results are consistent with the hypothesis that there were multiple introductions of the transcontinental subtype in Brazil. This study has increased the number of subtype aA full-length genomes from 8 to 81 and HTLV-1 aB from 2 to 5 sequences. The overall data confirmed that the cosmopolitan transcontinental sub-subtypes were the most prevalent in the Brazilian population. It is hoped that this valuable genomic data will add to our current understanding of the evolutionary history of this medically important virus.

Comparative evaluation of the identification of rapidly growing non-tuberculous mycobacteria by mass spectrometry (MALDI-TOF MS), GenoType Mycobacterium CM/AS assay and partial sequencing of the rpoβ gene with phylogenetic analysis as a reference method.

PubMed

Costa-Alcalde, José Javier; Barbeito-Castiñeiras, Gema; González-Alba, José María; Aguilera, Antonio; Galán, Juan Carlos; Pérez-Del-Molino, María Luisa

2018-06-02

The American Thoracic Society and the Infectious Diseases Society of America recommend that clinically significant non-tuberculous mycobacteria (NTM) should be identified to the species level in order to determine their clinical significance. The aim of this study was to evaluate identification of rapidly growing NTM (RGM) isolated from clinical samples by using MALDI-TOF MS and a commercial molecular system. The results were compared with identification using a reference method. We included 46 clinical isolates of RGM and identified them using the commercial molecular system GenoType ® CM/AS (Hain, Lifescience, Germany), MALDI-TOF MS (Bruker) and, as reference method, partial rpoβ gene sequencing followed by BLAST and phylogenetic analysis with the 1093 sequences available in the GeneBank. The degree of agreement between GenoType ® and MALDI-TOF MS and the reference method, partial rpoβ sequencing, was 27/43 (62.8%) and 38/43 cases (88.3%) respectively. For all the samples correctly classified by GenoType ® , we obtained the same result with MALDI-TOF MS (27/27). However, MALDI-TOF MS also correctly identified 68.75% (11/16) of the samples that GenoType ® had misclassified (p=0.005). MALDI-TOF MS classified significantly better than GenoType ® . When a MALDI-TOF MS score >1.85 was achieved, MALDI-TOF MS and partial rpoβ gene sequencing were equivalent. GenoType ® was not able to distinguish between species belonging to the M. fortuitum complex. MALDI-TOF MS methodology is simple, rapid and associated with lower consumable costs than GenoType ® . The partial rpoβ sequencing methods with BLAST and phylogenetic analysis were not able to identify some RGM unequivocally. Therefore, sequencing of additional regions would be indicated in these cases. Copyright © 2018 Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

[Correlation of codon biases and potential secondary structures with mRNA translation efficiency in unicellular organisms].

PubMed

Vladimirov, N V; Likhoshvaĭ, V A; Matushkin, Iu G

2007-01-01

Gene expression is known to correlate with degree of codon bias in many unicellular organisms. However, such correlation is absent in some organisms. Recently we demonstrated that inverted complementary repeats within coding DNA sequence must be considered for proper estimation of translation efficiency, since they may form secondary structures that obstruct ribosome movement. We have developed a program for estimation of potential coding DNA sequence expression in defined unicellular organism using its genome sequence. The program computes elongation efficiency index. Computation is based on estimation of coding DNA sequence elongation efficiency, taking into account three key factors: codon bias, average number of inverted complementary repeats, and free energy of potential stem-loop structures formed by the repeats. The influence of these factors on translation is numerically estimated. An optimal proportion of these factors is computed for each organism individually. Quantitative translational characteristics of 384 unicellular organisms (351 bacteria, 28 archaea, 5 eukaryota) have been computed using their annotated genomes from NCBI GenBank. Five potential evolutionary strategies of translational optimization have been determined among studied organisms. A considerable difference of preferred translational strategies between Bacteria and Archaea has been revealed. Significant correlations between elongation efficiency index and gene expression levels have been shown for two organisms (S. cerevisiae and H. pylori) using available microarray data. The proposed method allows to estimate numerically the coding DNA sequence translation efficiency and to optimize nucleotide composition of heterologous genes in unicellular organisms. http://www.mgs.bionet.nsc.ru/mgs/programs/eei-calculator/.

Genome organisation and sequence comparison suggest intraspecies incongruence in M RNA of Watermelon bud necrosis virus.

PubMed

Kumar, Rakesh; Mandal, B; Geetanjali, A S; Jain, R K; Jaiwal, P K

2010-08-01

Watermelon bud necrosis virus (WBNV), a member of the genus Tospovirus, family Bunyaviridae is an important viral pathogen in watermelon cultivation in India. The complete genome sequence properties of WBNV are not available. In the present study, the complete M RNA sequence and the genome organisation of a WBNV isolate infecting watermelon in Delhi (WBNV-wDel) were determined. The M RNA was 4,794 nucleotides (nt) long and potentially coded for a movement protein (NSm) of 34.22 kDa (307 amino acids) on the viral sense strand and a Gn/Gc glycoprotein precursor of 127.15 kDa (1,121 amino acids) on the complementary strand. The two open reading frames were separated by an intergenic region of 402 nt. The 5' and 3' untranslated regions were 55 and 47 nt long, respectively, containing complementary termini typical of tospoviruses. WBNV-wDel was most closely related (79.1% identity) to Groundnut bud necrosis virus, an important tospovirus that occurs in several crops in India, and was different (63.3-75.2% identity) from the other cucurbit-infecting tospoviruses known to occur in Taiwan and Japan. Sequence analysis of NSm and Gn/Gc revealed phylogenetic incongruence between WBNV-wDel and another isolate originating from central India (WBNV-Wm-Som isolate). The Wm-Som isolate showed evolutionary divergence from the wDel isolate in the Gn/Gc protein (74.6% identity) potentially due to recombination with the other tospoviruses that are known to occur in India. This is the first report of a comparison of complete sequences of M RNA of WBNV.

Glutamate cysteine ligase (GCL) in the freshwater bivalve Unio tumidus: impact of storage conditions and seasons on activity and identification of partial coding sequence of the catalytic subunit.

PubMed

Coffinet, Stéphanie; Cossu-Leguille, Carole; Rodius, François; Vasseur, Paule

2008-09-01

Glutamate cysteine ligase (GCL; EC 6.3.2.2) is the first enzyme involved in the synthesis of glutathione. A HPLC method with fluorimetric detection was used to measure GCL activity in the gills and the digestive gland of the freshwater bivalve, Unio tumidus. Storage conditions were optimized in order to prevent decrease of GCL activity and consisted in freezing the cytosolic fraction in the presence of protease (1 mM phenylmethylsulfonic fluoric acid) and gamma-glutamyltranspeptidase (1 mM L-serine borate mixture and 0.5 mM acivicin) inhibitors. Seasonal variations of activity in the digestive gland and to a lesser extent in the gills were found with activity increasing in spring compared to winter. No sex differences were revealed. The GCL coding sequence was identified using degenerated primers designed in the highly conserved regions of the catalytic subunit of GCL. The partial sequence identified encoded for 121 amino acids. The comparison of the identified partial coding sequence of U. tumidus with those available from vertebrates and invertebrates indicated that GCL sequence was highly conserved.

Infrared Spectroscopy and Born-Oppenheimer Molecular Dynamics Simulation Study on Deuterium Substitution in the Crystalline Benzoic Acid.

PubMed

Gług, Maciej; Brela, Mateusz Z; Boczar, Marek; Turek, Andrzej M; Boda, Łukasz; Wójcik, Marek J; Nakajima, Takahito; Ozaki, Yukihiro

2017-01-26

In this study we present complementary computational and experimental studies of hydrogen bond interaction in crystalline benzoic acid and its deuterated and partially deuterated derivatives. The experimental part of the presented work includes preparation of partially deuterated samples and measurement of attenuated total reflection (ATR)-FTIR spectra. Analysis of the geometrical parameters and time course of dipole moment of crystalline benzoic acid and its deuterated and partially deuterated derivatives by Born-Oppenheimer molecular dynamics (BOMD) enabled us to deeply analyze the IR spectra. Presented simulations based on BOMD gave us opportunity to investigate individual motion and its contribution to the IR spectra. The band contours calculated using Fourier transform of autocorrelation function are in quantitative agreement with the experimental spectra. Characterization of single bands was carried out by "normal coordinate analysis". The salient point of our study is a comparison of the spectra of the deuterated and partially deuterated crystalline benzoic acid with that of the nondeuterated one. Furthermore, we have applied the principal component analysis for analysis of the number of components in partially deuterated systems. In this study, we reveal that the arrangements of hydrogen and deuterium atoms in partially deuterated samples are random.

Anti-inflammatory activity of Bromelia hieronymi: comparison with bromelain.

PubMed

Errasti, María E; Caffini, Néstor O; Pelzer, Lilian E; Rotelli, Alejandra E

2013-03-01

Some plant proteases (e. g., papain, bromelain, ficin) have been used as anti-inflammatory agents for some years, and especially bromelain is still being used as alternative and/or complementary therapy to glucocorticoids, nonsteroidal antirheumatics, and immunomodulators. Bromelain is an extract rich in cysteine endopeptidases obtained from Ananas comosus. In this study the anti-inflammatory action of a partially purified extract of Bromelia hieronymi fruits, whose main components are cysteine endopeptidases, is presented. Different doses of a partially purified extract of B. hieronymi were assayed on carrageenan-induced and serotonine-induced rat paw edema, as well as in cotton pellet granuloma model. Doses with equal proteolytic activity of the partially purified extract and bromelain showed significantly similar anti-inflammatory responses. Treatment of the partially purified extract and bromelain with E-64 provoked loss of anti-inflammatory activity on carrageenan-induced paw edema, a fact which is consistent with the hypothesis that the proteolytic activity would be responsible for the anti-inflammatory action. Georg Thieme Verlag KG Stuttgart · New York.

Genome sequencing of the redbanded stink bug (Piezodorus guildinii)

USDA-ARS?s Scientific Manuscript database

We assembled a partial genome sequence from the redbanded stink bug, Piezodorus guildinii from Illumina MiSeq sequencing runs. The sequence has been submitted and published under NCBI GenBank Accession Number JTEQ01000000. The BioProject and BioSample Accession numbers are PRJNA263369 and SAMN030997...

Problem-Solving Test: Conditional Gene Targeting Using the Cre/loxP Recombination System

ERIC Educational Resources Information Center

Szeberényi, József

2013-01-01

Terms to be familiar with before you start to solve the test: gene targeting, knock-out mutation, bacteriophage, complementary base-pairing, homologous recombination, deletion, transgenic organisms, promoter, polyadenylation element, transgene, DNA replication, RNA polymerase, Shine-Dalgarno sequence, restriction endonuclease, polymerase chain…

A nanophosphor-based method for selective DNA recovery in Synthosomes.

PubMed

Nallani, Madhavan; Onaca, Ozana; Gera, Nimish; Hildenbrand, Karlheinz; Hoheisel, Werner; Schwaneberg, Ulrich

2006-01-01

A nanocompartment system composed of an ABA triblock copolymer, where A is poly(dimethylsiloxane) and B is poly(2-methyloxazoline), has been developed for selective recovery and detection of DNA. Translocation of TAMRA-labeled complementary primers into the nanocompartment system has been achieved through two deletion mutants (FhuA Delta1-129; FhuA Delta1-160) of the channel protein FhuA. Translocation was monitored by fluorescence resonance energy transfer through hybridization of the TAMRA-labeled primer to the complementary sequence of a nanophosphor-DNA-conjugate, which reduces its half-life (FhuA Delta1-129, 16.0% reduced; FhuA Delta1-160, 39.0% reduced).

ddClone: joint statistical inference of clonal populations from single cell and bulk tumour sequencing data.

PubMed

Salehi, Sohrab; Steif, Adi; Roth, Andrew; Aparicio, Samuel; Bouchard-Côté, Alexandre; Shah, Sohrab P

2017-03-01

Next-generation sequencing (NGS) of bulk tumour tissue can identify constituent cell populations in cancers and measure their abundance. This requires computational deconvolution of allelic counts from somatic mutations, which may be incapable of fully resolving the underlying population structure. Single cell sequencing (SCS) is a more direct method, although its replacement of NGS is impeded by technical noise and sampling limitations. We propose ddClone, which analytically integrates NGS and SCS data, leveraging their complementary attributes through joint statistical inference. We show on real and simulated datasets that ddClone produces more accurate results than can be achieved by either method alone.

Large scale DNA microsequencing device

DOEpatents

Foote, R.S.

1997-08-26

A microminiature sequencing apparatus and method provide a means for simultaneously obtaining sequences of plural polynucleotide strands. The apparatus cosists of a microchip into which plural channels have been etched using standard lithographic procedures and chemical wet etching. The channels include a reaction well and a separating section. Enclosing the channels is accomplished by bonding a transparent cover plate over the apparatus. A first oligonucleotide strand is chemically affixed to the apparatus through an alkyl chain. Subsequent nucleotides are selected by complementary base pair bonding. A target nucleotide strand is used to produce a family of labelled sequencing strands in each channel which are separated in the separating section. During or following separation the sequences are determined using appropriate detection means. 17 figs.

Isolates of viral hemorrhagic septicemia virus from North America and Europe can be detected and distinguished by DNA probes

USGS Publications Warehouse

Batts, W.N.; Arakawa, C.K.; Bernard, J.; Winton, J.R.

1993-01-01

Biotinylated DNA probes were constructed to hybndize with speclfic sequences within the messenger RNA (mRNA) of the nucleoprotein (N) gene of vlral hemorrhagic septicemia virus (VHSV) reference strains from Europe (07-71) and North Arnenca (Makah) Probes were synthesized that were complementary to (1) a 29-nucleotide sequence near the center of the N gene conlmon to both the 07-71 and Makah reference strains of the virus (2) a unique 28- nucleotide sequence that followed the open readng frame of the Makah N gene mRNA most of which was absent In the 07-71 strain, and (3) a 22-nucleobde sequence wthin the 07-71 N gene that had 6 nllsmatches \

Molecular analysis of partial VP-2 gene amplified from rectal swab samples of diarrheic dogs in Pakistan confirms the circulation of canine parvovirus genetic variant CPV-2a and detects sequences of feline panleukopenia virus (FPV).

PubMed

Ahmed, Nisar; Riaz, Adeel; Zubair, Zahra; Saqib, Muhammad; Ijaz, Sehrish; Nawaz-Ul-Rehman, Muhammad Shah; Al-Qahtani, Ahmed; Mubin, Muhammad

2018-03-15

The infection in dogs due to canine parvovirus (CPV), is a highly contagious one with high mortality rate. The present study was undertaken for a detailed genetic analysis of partial VP2 gene i.e., 630 bp isolated from rectal swab samples of infected domestic and stray dogs from all areas of district Faisalabad. Monitoring of viruses is important, as continuous prevalence of viral infection might be associated with emergence of new virulent strains. In the present study, 40 rectal swab samples were collected from diarrheic dogs from different areas of district Faisalabad, Pakistan, in 2014-15 and screened for the presence of CPV by immunochromatography. Most of these dogs were stray dogs showing symptoms of diarrhea. Viral DNA was isolated and partial VP2 gene was amplified using gene specific primer pair Hfor/Hrev through PCR. Amplified fragments were cloned in pTZ57R/T (Fermentas) and completely sequenced. Sequences were analyzed and assembled by the Lasergene DNA analysis package (v8; DNAStar Inc., Madison, WI, USA). The results with immunochromatography showed that 33/40 (82%) of dogs were positive for CPV. We were able to amplify a fragment of 630 bp from 25 samples. In 25 samples the sequences of CPV-2a were detected showing the amino acid substitution Ser297Ala and presence of amino acid (426-Asn) in partial VP2 protein. Interestingly the BLAST analysis showed the of feline panleukopenia virus (FPV) sequences in 3 samples which were already positive for new CPV-2a, with 99% sequence homology to other FPV sequences present in GenBank. Phylogenetic analysis showed clustering of partial CPV-VP-2 gene with viruses from China, India, Japan and Uruguay identifying a new variant, whereas the 3 FPV sequences showed immediate ancestral relationship with viruses from Portugal, South Africa and USA. Interesting observation was that CPV are clustering away from the commercial vaccine strains. In this work we provide a better understanding of CPV prevailing in Pakistan at molecular level. The detection of FPV could be a case of real co-infection or a case of dual presence, due to ingestion of contaminated food.

Probing chromatin structure with nuclease sensitivity assays.

PubMed

Gregory, R I; Khosla, S; Feil, R

2001-01-01

To further our understanding of genomic imprinting it will be essential to identify key control elements, and to investigate their regulation by both epigenetic modifications (such as DNA methylation) and trans-acting factors. So far, sequence elements that regulate parental allele-specific gene expression have been identified in a number of imprinted loci, either because of their differential DNA methylation or through functional studies in transgenic mice (1,2). A systematic search for allele-specific chromatin features constitutes an alternative strategy to identify elements that regulate imprinting. The validity of such an in vivo chromatin approach derives from the fact that in several known imprinting control-elements, a specialized organization of chromatin characterized by nuclease hypersensitivity is present on only one of the two parental chromosome (3). For example, the differentially methylated 5 -portion of the human SNRPN gene-a sequence element that controls imprinting in the Prader-Willi and Angelman syndromes' domain on chromosome 15q11- q13-has strong DNase-I hypersensitive sites on the unmethylated paternal chromosome (4). A differentially methylated region that regulates the imprinting of H19 and that of the neighboring insulin-like growth factor-2 gene on mouse chromosome 7 was also found to have parental chromosome-specific hypersensitive sites (5,6). The precise nature of the allelic nuclease hypersensitivity in these and other imprinted loci remains to be determined in more detail, for example, by applying complementary chromatin methodologies (7,8). However, it is commonly observed that a nuclease hypersensitive site corresponds to a small region where nucleosomes are absent or partially disrupted.

Identification of Skin Electrical Injury Using Infrared Imaging: A Possible Complementary Tool for Histological Examination

PubMed Central

Lin, Hancheng; Wang, Zhenyuan; Dong, Hongmei

2017-01-01

In forensic practice, determination of electrocution as a cause of death usually depends on the conventional histological examination of electrical mark in the body skin, but the limitation of this method includes subjective bias by different forensic pathologists, especially for identifying suspicious electrical mark. The aim of our work is to introduce Fourier transform infrared (FTIR) spectroscopy in combination with chemometrics as a complementary tool for providing an relatively objective diagnosis. The results of principle component analysis (PCA) showed that there were significant differences of protein structural profile between electrical mark and normal skin in terms of α-helix, antiparallel β-sheet and β-sheet content. Then a partial least square (PLS) model was established based on this spectral dataset and used to discriminate electrical mark from normal skin areas in independent tissue sections as revealed by color-coded digital maps, making the visualization of electrical injury more intuitively. Our pilot study demonstrates the potential of FTIR spectroscopy as a complementary tool for diagnosis of electrical mark. PMID:28118398

Multiview three-dimensional display with continuous motion parallax through planar aligned OLED microdisplays.

PubMed

Teng, Dongdong; Xiong, Yi; Liu, Lilin; Wang, Biao

2015-03-09

Existing multiview three-dimensional (3D) display technologies encounter discontinuous motion parallax problem, due to a limited number of stereo-images which are presented to corresponding sub-viewing zones (SVZs). This paper proposes a novel multiview 3D display system to obtain continuous motion parallax by using a group of planar aligned OLED microdisplays. Through blocking partial light-rays by baffles inserted between adjacent OLED microdisplays, transitional stereo-image assembled by two spatially complementary segments from adjacent stereo-images is presented to a complementary fusing zone (CFZ) which locates between two adjacent SVZs. For a moving observation point, the spatial ratio of the two complementary segments evolves gradually, resulting in continuously changing transitional stereo-images and thus overcoming the problem of discontinuous motion parallax. The proposed display system employs projection-type architecture, taking the merit of full display resolution, but at the same time having a thin optical structure, offering great potentials for portable or mobile 3D display applications. Experimentally, a prototype display system is demonstrated by 9 OLED microdisplays.

A direct detection of Escherichia coli genomic DNA using gold nanoprobes

PubMed Central

2012-01-01

Background In situation like diagnosis of clinical and forensic samples there exists a need for highly sensitive, rapid and specific DNA detection methods. Though conventional DNA amplification using PCR can provide fast results, it is not widely practised in diagnostic laboratories partially because it requires skilled personnel and expensive equipment. To overcome these limitations nanoparticles have been explored as signalling probes for ultrasensitive DNA detection that can be used in field applications. Among the nanomaterials, gold nanoparticles (AuNPs) have been extensively used mainly because of its optical property and ability to get functionalized with a variety of biomolecules. Results We report a protocol for the use of gold nanoparticles functionalized with single stranded oligonucleotide (AuNP- oligo probe) as visual detection probes for rapid and specific detection of Escherichia coli. The AuNP- oligo probe on hybridization with target DNA containing complementary sequences remains red whereas test samples without complementary DNA sequences to the probe turns purple due to acid induced aggregation of AuNP- oligo probes. The color change of the solution is observed visually by naked eye demonstrating direct and rapid detection of the pathogenic Escherichia coli from its genomic DNA without the need for PCR amplification. The limit of detection was ~54 ng for unamplified genomic DNA. The method requires less than 30 minutes to complete after genomic DNA extraction. However, by using unamplified enzymatic digested genomic DNA, the detection limit of 11.4 ng was attained. Results of UV-Vis spectroscopic measurement and AFM imaging further support the hypothesis of aggregation based visual discrimination. To elucidate its utility in medical diagnostic, the assay was validated on clinical strains of pathogenic Escherichia coli obtained from local hospitals and spiked urine samples. It was found to be 100% sensitive and proves to be highly specific without any cross reaction with non-Escherichia coli strains. Conclusion This work gives entry into a new class of DNA/gold nanoparticles hybrid materials which might have optical property that can be controlled for application in diagnostics. We note that it should be possible to extend this strategy easily for developing new types of DNA biosensor for point of care detection. The salient feature of this approach includes low-cost, robust reagents and simple colorimetric detection of pathogen. PMID:22309695

Rapid detection of microbial DNA by a novel isothermal genome exponential amplification reaction (GEAR) assay.

PubMed

Prithiviraj, Jothikumar; Hill, Vincent; Jothikumar, Narayanan

2012-04-20

In this study we report the development of a simple target-specific isothermal nucleic acid amplification technique, termed genome exponential amplification reaction (GEAR). Escherichia coli was selected as the microbial target to demonstrate the GEAR technique as a proof of concept. The GEAR technique uses a set of four primers; in the present study these primers targeted 5 regions on the 16S rRNA gene of E. coli. The outer forward and reverse Tab primer sequences are complementary to each other at their 5' end, whereas their 3' end sequences are complementary to their respective target nucleic acid sequences. The GEAR assay was performed at a constant temperature 60 °C and monitored continuously in a real-time PCR instrument in the presence of an intercalating dye (SYTO 9). The GEAR assay enabled amplification of as few as one colony forming units of E. coli per reaction within 30 min. We also evaluated the GEAR assay for rapid identification of bacterial colonies cultured on agar media directly in the reaction without DNA extraction. Cells from E. coli colonies were picked and added directly to GEAR assay mastermix without prior DNA extraction. DNA in the cells could be amplified, yielding positive results within 15 min. Published by Elsevier Inc.

Molecular analysis of RAPD DNA based markers: their potential use for the detection of genetic variability in jojoba (Simmondsia chinensis L Schneider).

PubMed

Amarger, V; Mercier, L

1995-01-01

We have applied the recently developed technique of random amplified polymorphic DNA (RAPD) for the discrimination between two jojoba clones at the genomic level. Among a set of 30 primers tested, a simple reproducible pattern with three distinct fragments for clone D and two distinct fragments for clone E was obtained with primer OPB08. Since RAPD products are the results of arbitrarily priming events and because a given primer can amplify a number of non-homologous sequences, we wondered whether or not RAPD bands, even those of similar size, were derived from different loci in the two clones. To answer this question, two complementary approaches were used: i) cloning and sequencing of the amplification products from clone E; and ii) complementary Southern analysis of RAPD gels using cloned or amplified fragments (directly recovered from agarose gels) as RFLP probes. The data reported here show that the RAPD reaction generates multiple amplified fragments. Some fragments, although resolved as a single band on agarose gels, contain different DNA species of the same size. Furthermore, it appears that the cloned RAPD products of known sequence that do not target repetitive DNA can be used as hybridization probes in RFLP to detect a polymorphism among individuals.

Development of a Fluorescence Resonance Energy Transfer (FRET)-Based DNA Biosensor for Detection of Synthetic Oligonucleotide of Ganoderma boninense.

PubMed

Bakhori, Noremylia Mohd; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir

2013-12-12

An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10-9 M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense.

Development of a Fluorescence Resonance Energy Transfer (FRET)-Based DNA Biosensor for Detection of Synthetic Oligonucleotide of Ganoderma boninense.

PubMed

Mohd Bakhori, Noremylia; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir

2013-12-01

An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10(-9) M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense.

Single-Molecule Counting of Point Mutations by Transient DNA Binding

NASA Astrophysics Data System (ADS)

Su, Xin; Li, Lidan; Wang, Shanshan; Hao, Dandan; Wang, Lei; Yu, Changyuan

2017-03-01

High-confidence detection of point mutations is important for disease diagnosis and clinical practice. Hybridization probes are extensively used, but are hindered by their poor single-nucleotide selectivity. Shortening the length of DNA hybridization probes weakens the stability of the probe-target duplex, leading to transient binding between complementary sequences. The kinetics of probe-target binding events are highly dependent on the number of complementary base pairs. Here, we present a single-molecule assay for point mutation detection based on transient DNA binding and use of total internal reflection fluorescence microscopy. Statistical analysis of single-molecule kinetics enabled us to effectively discriminate between wild type DNA sequences and single-nucleotide variants at the single-molecule level. A higher single-nucleotide discrimination is achieved than in our previous work by optimizing the assay conditions, which is guided by statistical modeling of kinetics with a gamma distribution. The KRAS c.34 A mutation can be clearly differentiated from the wild type sequence (KRAS c.34 G) at a relative abundance as low as 0.01% mutant to WT. To demonstrate the feasibility of this method for analysis of clinically relevant biological samples, we used this technology to detect mutations in single-stranded DNA generated from asymmetric RT-PCR of mRNA from two cancer cell lines.

DNA microdevice for electrochemical detection of Escherichia coli 0157:H7 molecular markers.

PubMed

Berganza, J; Olabarria, G; García, R; Verdoy, D; Rebollo, A; Arana, S

2007-04-15

An electrochemical DNA sensor based on the hybridization recognition of a single-stranded DNA (ssDNA) probe immobilized onto a gold electrode to its complementary ssDNA is presented. The DNA probe is bound on gold surface electrode by using self-assembled monolayer (SAM) technology. An optimized mixed SAM with a blocking molecule preventing the nonspecific adsorption on the electrode surface has been prepared. In this paper, a DNA biosensor is designed by means of the immobilization of a single stranded DNA probe on an electrochemical transducer surface to recognize specifically Escherichia coli (E. coli) 0157:H7 complementary target DNA sequence via cyclic voltammetry experiments. The 21 mer DNA probe including a C6 alkanethiol group at the 5' phosphate end has been synthesized to form the SAM onto the gold surface through the gold sulfur bond. The goal of this paper has been to design, characterise and optimise an electrochemical DNA sensor. In order to investigate the oligonucleotide probe immobilization and the hybridization detection, experiments with different concentration of DNA and mismatch sequences have been performed. This microdevice has demonstrated the suitability of oligonucleotide Self-assembled monolayers (SAMs) on gold as immobilization method. The DNA probes deposited on gold surface have been functional and able to detect changes in bases sequence in a 21-mer oligonucleotide.

Solid phase sequencing of double-stranded nucleic acids

DOEpatents

Fu, Dong-Jing; Cantor, Charles R.; Koster, Hubert; Smith, Cassandra L.

2002-01-01

This invention relates to methods for detecting and sequencing of target double-stranded nucleic acid sequences, to nucleic acid probes and arrays of probes useful in these methods, and to kits and systems which contain these probes. Useful methods involve hybridizing the nucleic acids or nucleic acids which represent complementary or homologous sequences of the target to an array of nucleic acid probes. These probe comprise a single-stranded portion, an optional double-stranded portion and a variable sequence within the single-stranded portion. The molecular weights of the hybridized nucleic acids of the set can be determined by mass spectroscopy, and the sequence of the target determined from the molecular weights of the fragments. Nucleic acids whose sequences can be determined include nucleic acids in biological samples such as patient biopsies and environmental samples. Probes may be fixed to a solid support such as a hybridization chip to facilitate automated determination of molecular weights and identification of the target sequence.

FATHEAD MINNOW VITELLOGENIN: COMPLEMENTARY DNA SEQUENCE AND MESSENGER RNA AND PROTEIN EXPRESSION AFTER 17B-ESTRADIOL TREATMENT

EPA Science Inventory

Induction of vitellogenin (VTG) in oviparous animals has been proposed as a sensitive indicator of invironmental contaminants that activate the estrogen receptor. In the present study, a sensitive ribonuclease protection assay (RPA) for VTG messenger RNA (mRNA) was developed for ...

Comparative study of switchgrass cultivars using RNA sequencing technology

USDA-ARS?s Scientific Manuscript database

Switchgrass (Panicum virgatum L.) is a C4 perennial grass, identified as a promising bioenergy crop. Switchgrass exists in two ecotypes, upland and lowland, which are heterotic, or genetically complementary to each other. The objectives of this study are to assess the potential of SNP markers as a b...

Construction of high-quality recombination maps with low-coverage genomic sequencing for joint linkage analysis in maize

USDA-ARS?s Scientific Manuscript database

A genome-wide association study (GWAS) is the foremost strategy used for finding genes that control human diseases and agriculturally important traits, but it often reports false positives. In contrast, its complementary method, linkage analysis, provides direct genetic confirmation, but with limite...

Zn2+ blocks annealing of complementary single-stranded DNA in a sequence-selective manner

USDA-ARS?s Scientific Manuscript database

A simple low-temperature EDTA-free agarose gel electrophoresis procedure (LTEAGE) coupled with UV-Vis spectrum and fluorescence quenching analyses was developed and the Zn2+-single-stranded (ss) DNA interaction was investigated under near-physiological conditions. It was found that Zn2+ blocked the...

Image Reconstruction from Highly Undersampled (k, t)-Space Data with Joint Partial Separability and Sparsity Constraints

PubMed Central

Zhao, Bo; Haldar, Justin P.; Christodoulou, Anthony G.; Liang, Zhi-Pei

2012-01-01

Partial separability (PS) and sparsity have been previously used to enable reconstruction of dynamic images from undersampled (k, t)-space data. This paper presents a new method to use PS and sparsity constraints jointly for enhanced performance in this context. The proposed method combines the complementary advantages of PS and sparsity constraints using a unified formulation, achieving significantly better reconstruction performance than using either of these constraints individually. A globally convergent computational algorithm is described to efficiently solve the underlying optimization problem. Reconstruction results from simulated and in vivo cardiac MRI data are also shown to illustrate the performance of the proposed method. PMID:22695345

Signatures of selection among sex-determining alleles of the honey bee.

PubMed

Hasselmann, Martin; Beye, Martin

2004-04-06

Patterns of DNA polymorphisms are a primary tool for dissecting signatures of selection; however, the underlying selective forces are poorly understood for most genes. A classical example of diversifying selection is the complementary sex-determining locus that is found in the very large insect order Hymenoptera (bees, wasps, ants, and sawflies). The gene responsible for sex determination, the complementary sex determiner (csd), has been most recently identified in the honey bee. Females are heterozygous at this locus. Males result when there is only one functional allele present, as a result of either homozygosity (fertilized eggs) or, more commonly, hemizygosity (unfertilized eggs). The homozygotes, diploid males, do not reproduce and have zero fitness, which implies positive selection in favor of rare alleles. Large differences in csd cDNA sequences within and between four populations were found that fall into two major groups, types I and II. Type I consists of several allelic lineages that were maintained over an extended period, an indication of balancing selection. Diversifying selection has operated on several confined parts of the protein, as shown by an excess of nonsynonymous differences. Elevated sequence differences indicate another selected part near a repeat region. These findings have general implications about the understanding of both the function of the multiallelic mechanism and the adaptive processes on the level of nucleotide sequences. Moreover, the first csd sequence data are a notable basis for the avoidance of diploid males in bee selection programs by allele-assisted breeding.

The Mechanism of Synchronous Precise Regulation of Two Shrimp White Spot Syndrome Virus Targets by a Viral MicroRNA

PubMed Central

He, Yaodong; Ma, Tiantian; Zhang, Xiaobo

2017-01-01

MicroRNAs (miRNAs), important factors in animal innate immunity, suppress the expressions of their target genes by binding to target mRNA’s 3′ untranslated regions (3′UTRs). However, the mechanism of synchronous regulation of multiple targets by a single miRNA remains unclear. In this study, the interaction between a white spot syndrome virus (WSSV) miRNA (WSSV-miR-N32) and its two viral targets (wsv459 and wsv322) was characterized in WSSV-infected shrimp. The outcomes indicated that WSSV-encoded miRNA (WSSV-miR-N32) significantly inhibited virus infection by simultaneously targeting wsv459 and wsv322. The silencing of wsv459 or wsv322 by siRNA led to significant decrease of WSSV copies in shrimp, showing that the two viral genes were required for WSSV infection. WSSV-miR-N32 could mediate 5′–3′ exonucleolytic digestion of its target mRNAs, which stopped at the sites of target mRNA 3′UTRs close to the sequence complementary to the miRNA seed sequence. The complementary bases (to the target mRNA sequence) of a miRNA 9th–18th non-seed sequence were essential for the miRNA targeting. Therefore, our findings presented novel insights into the mechanism of miRNA-mediated suppression of target gene expressions, which would be helpful for understanding the roles of miRNAs in innate immunity of invertebrate. PMID:29230209

The first genome sequences of human bocaviruses from Vietnam

PubMed Central

Thanh, Tran Tan; Van, Hoang Minh Tu; Hong, Nguyen Thi Thu; Nhu, Le Nguyen Truc; Anh, Nguyen To; Tuan, Ha Manh; Hien, Ho Van; Tuong, Nguyen Manh; Kien, Trinh Trung; Khanh, Truong Huu; Nhan, Le Nguyen Thanh; Hung, Nguyen Thanh; Chau, Nguyen Van Vinh; Thwaites, Guy; van Doorn, H. Rogier; Tan, Le Van

2017-01-01

As part of an ongoing effort to generate complete genome sequences of hand, foot and mouth disease-causing enteroviruses directly from clinical specimens, two complete coding sequences and two partial genomic sequences of human bocavirus 1 (n=3) and 2 (n=1) were co-amplified and sequenced, representing the first genome sequences of human bocaviruses from Vietnam. The sequences may aid future study aiming at understanding the evolution of the virus. PMID:28090592

Computational sequence analysis of predicted long dsRNA transcriptomes of major crops reveals sequence complementarity with human genes.

PubMed

Jensen, Peter D; Zhang, Yuanji; Wiggins, B Elizabeth; Petrick, Jay S; Zhu, Jin; Kerstetter, Randall A; Heck, Gregory R; Ivashuta, Sergey I

2013-01-01

Long double-stranded RNAs (long dsRNAs) are precursors for the effector molecules of sequence-specific RNA-based gene silencing in eukaryotes. Plant cells can contain numerous endogenous long dsRNAs. This study demonstrates that such endogenous long dsRNAs in plants have sequence complementarity to human genes. Many of these complementary long dsRNAs have perfect sequence complementarity of at least 21 nucleotides to human genes; enough complementarity to potentially trigger gene silencing in targeted human cells if delivered in functional form. However, the number and diversity of long dsRNA molecules in plant tissue from crops such as lettuce, tomato, corn, soy and rice with complementarity to human genes that have a long history of safe consumption supports a conclusion that long dsRNAs do not present a significant dietary risk.

Comparison of growth on mannitol salt agar, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry, VITEK® 2 with partial sequencing of 16S rRNA gene for identification of coagulase-negative staphylococci.

PubMed

Ayeni, Funmilola A; Andersen, Camilla; Nørskov-Lauritsen, Niels

2017-04-01

Mannitol salt agar (MSA) is often used in resources' limited laboratories for identification of S. aureus however, coagulase-negative staphylococci (CoNS) grows and ferments mannitol on MSA. 171 strains of CoNS which have been previously misidentified as S. aureus due to growth on MSA were collected from different locations in Nigeria and two methods for identification of CoNS were compared i.e. ViTEK 2 and MALDI-TOF MS with partial 16S rRNA gene sequencing as gold standard. Partial tuf gene sequencing was used for contradicting identification. All 171 strains (13 species) grew on MSA and ferments mannitol. All tested strains of S. epidermidis, S. haemolyticus, S. nepalensis, S. pasteuri, S. sciuri,, S. warneri, S. xylosus, S. capitis were correctly identified by MALDI-TOF while variable identification were observed in S. saprophyticus and S. cohnii (90%, 81%). There was low identification of S. arlettae (14%) while all strains of S. kloosii and S. gallinarum were misidentified. There is absence of S. gallinarum in the MALDI-TOF database at the period of this study. All tested strains of S. epidermidis, S. gallinarum, S. haemolyticus, S. sciuri,, S. warneri, S. xylosus and S. capitis were correctly identified by ViTEK while variable identification were observed in S. saprophyticus, S. arlettae, S. cohnii, S. kloosii, (84%, 86%, 75%, 60%) and misidentification of S. nepalensis, S. pasteuri. Partial sequencing of 16S rRNA gene was used as gold standard for most strains except S. capitis and S. xylosus where the two species were misidentified by partial sequencing of 16S rRNA contrary to MALDI-TOF and ViTEK identification. Tuf gene sequencing was used for correct identification. Characteristic growth on MSA for CoNS is also identical to S. aureus growth on the media and therefore, MSA could not differentiate between S. aureus and CoNS. The percentage accuracy of ViTEK was better than MALDI-TOF in identification of CoNS. Although partial sequencing of 16S rRNA gene was used as gold standard in this study, it could not correctly identify S. capitis and S. xylosus. Copyright © 2017 Elsevier Ltd. All rights reserved.

Characterization of rabies virus from a human case in Nepal.

PubMed

Pant, G R; Horton, D L; Dahal, M; Rai, J N; Ide, S; Leech, S; Marston, D A; McElhinney, L M; Fooks, A R

2011-04-01

Rabies is endemic throughout most of Asia, with the majority of human cases transmitted by domestic dogs (Canis familiaris). Here, we report a case of rabies in a 12-year-old girl in the Lalitpur district of Nepal that might have been prevented by better public awareness and timely post-exposure prophylaxis. Molecular characterization of the virus showed 100% identity over a partial nucleoprotein gene sequence to previous isolates from Nepal belonging to the 'arctic-like' lineage of rabies virus. Sequence analysis of both partial nucleoprotein and glycoprotein genes showed differences in consensus sequence after passage in vitro but not after passage in vivo.

A multilevel ant colony optimization algorithm for classical and isothermic DNA sequencing by hybridization with multiplicity information available.

PubMed

Kwarciak, Kamil; Radom, Marcin; Formanowicz, Piotr

2016-04-01

The classical sequencing by hybridization takes into account a binary information about sequence composition. A given element from an oligonucleotide library is or is not a part of the target sequence. However, the DNA chip technology has been developed and it enables to receive a partial information about multiplicity of each oligonucleotide the analyzed sequence consist of. Currently, it is not possible to assess the exact data of such type but even partial information should be very useful. Two realistic multiplicity information models are taken into consideration in this paper. The first one, called "one and many" assumes that it is possible to obtain information if a given oligonucleotide occurs in a reconstructed sequence once or more than once. According to the second model, called "one, two and many", one is able to receive from biochemical experiment information if a given oligonucleotide is present in an analyzed sequence once, twice or at least three times. An ant colony optimization algorithm has been implemented to verify the above models and to compare with existing algorithms for sequencing by hybridization which utilize the additional information. The proposed algorithm solves the problem with any kind of hybridization errors. Computational experiment results confirm that using even the partial information about multiplicity leads to increased quality of reconstructed sequences. Moreover, they also show that the more precise model enables to obtain better solutions and the ant colony optimization algorithm outperforms the existing ones. Test data sets and the proposed ant colony optimization algorithm are available on: http://bioserver.cs.put.poznan.pl/download/ACO4mSBH.zip. Copyright © 2016 Elsevier Ltd. All rights reserved.

Sequence analysis of a few species of termites (Order: Isoptera) on the basis of partial characterization of COII gene.

PubMed

Sobti, Ranbir Chander; Kumari, Mamtesh; Sharma, Vijay Lakshmi; Sodhi, Monika; Mukesh, Manishi; Shouche, Yogesh

2009-11-01

The present study was aimed to get the nucleotide sequences of a part of COII mitochondrial gene amplified from individuals of five species of Termites (Isoptera: Termitidae: Macrotermitinae). Four of them belonged to the genus Odontotermes (O. obesus, O. horni, O. bhagwatii and Odontotermes sp.) and one to Microtermes (M. obesi). Partial COII gene fragments were amplified by using specific primers. The sequences so obtained were characterized to calculate the frequencies of each nucleotide bases and a high A + T content was observed. The interspecific pairwise sequence divergence in Odontotermes species ranged from 6.5% to 17.1% across COII fragment. M. obesi sequence diversity ranged from 2.5 with Odontotermes sp. to 19.0% with O. bhagwatii. Phylogenetic trees drawn on the basis of distance neighbour-joining method revealed three main clades clustering all the individuals according to their genera and families.

Detection of Hepatozoon felis in Ticks Collected from Free-Ranging Amur Tigers ( Panthera tigris altaica), Russian Far East, 2002-12.

PubMed

Thomas, Lindsay H; Seryodkin, Ivan V; Goodrich, John M; Miquelle, Dale G; Birtles, Richard J; Lewis, John C M

2016-07-01

We collected 69 ticks from nine, free-ranging Amur tigers ( Panthera tigris altaica) between 2002 and 2011 and investigated them for tick-borne pathogens. DNA was extracted using alkaline digestion and PCR was performed to detect apicomplexan organisms. Partial 18S rDNA amplification products were obtained from 14 ticks from four tigers, of which 13 yielded unambiguous nucleotide sequence data. Comparative sequence analysis revealed all 13 partial 18S rDNA sequences were most similar to those belonging to strains of Hepatozoon felis (>564/572 base-pair identity, >99% sequence similarity). Although this tick-borne protozoon pathogen has been detected in wild felids from many parts of the world, this is the first record from the Russian Far East.

Analysis of the solar/wind resources in Southern Spain for optimal sizing of hybrid solar-wind power generation systems

NASA Astrophysics Data System (ADS)

Quesada-Ruiz, S.; Pozo-Vazquez, D.; Santos-Alamillos, F. J.; Lara-Fanego, V.; Ruiz-Arias, J. A.; Tovar-Pescador, J.

2010-09-01

A drawback common to the solar and wind energy systems is their unpredictable nature and dependence on weather and climate on a wide range of time scales. In addition, the variation of the energy output may not match with the time distribution of the load demand. This can partially be solved by the use of batteries for energy storage in stand-alone systems. The problem caused by the variable nature of the solar and wind resources can be partially overcome by the use of energy systems that uses both renewable resources in a combined manner, that is, hybrid wind-solar systems. Since both resources can show complementary characteristics in certain location, the independent use of solar or wind systems results in considerable over sizing of the batteries system compared to the use of hybrid solar-wind systems. Nevertheless, to the day, there is no single recognized method for properly sizing these hybrid wind-solar systems. In this work, we present a method for sizing wind-solar hybrid systems in southern Spain. The method is based on the analysis of the wind and solar resources on daily scale, particularly, its temporal complementary characteristics. The method aims to minimize the size of the energy storage systems, trying to provide the most reliable supply.

Chemical-free n-type and p-type multilayer-graphene transistors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dissanayake, D. M. N. M., E-mail: nandithad@voxtel-inc.com; Eisaman, M. D.; Department of Electrical and Computer Engineering, Stony Brook University, Stony Brook, New York 11794

A single-step doping method to fabricate n- and p-type multilayer graphene (MG) top-gate field effect transistors (GFETs) is demonstrated. The transistors are fabricated on soda-lime glass substrates, with the n-type doping of MG caused by the sodium in the substrate without the addition of external chemicals. Placing a hydrogen silsesquioxane (HSQ) barrier layer between the MG and the substrate blocks the n-doping, resulting in p-type doping of the MG above regions patterned with HSQ. The HSQ is deposited in a single fabrication step using electron beam lithography, allowing the patterning of arbitrary sub-micron spatial patterns of n- and p-type doping.more » When a MG channel is deposited partially on the barrier and partially on the glass substrate, a p-type and n-type doping profile is created, which is used for fabricating complementary transistors pairs. Unlike chemically doped GFETs in which the external dopants are typically introduced from the top, these substrate doped GFETs allow for a top gate which gives a stronger electrostatic coupling to the channel, reducing the operating gate bias. Overall, this method enables scalable fabrication of n- and p-type complementary top-gated GFETs with high spatial resolution for graphene microelectronic applications.« less

Partial DNA sequencing of Douglas-fir cDNAs used in RFLP mapping

Treesearch

K.D. Jermstad; D.L. Bassoni; C.S. Kinlaw; D.B. Neale

1998-01-01

DNA sequences from 87 Douglas-fir (Pseudotsuga menziesii [Mirb.] Franco) cDNA RFLP probes were determined. Sequences were submitted to the GenBank dbEST database and searched for similarity against nucleotide and protein databases using the BLASTn and BLASTx programs. Twenty-one sequences (24%) were assigned putative functions; 18 of which...

3' Untranslated regions mediate transcriptional interference between convergent genes both locally and ectopically in Saccharomyces cerevisiae.

PubMed

Wang, Luwen; Jiang, Ning; Wang, Lin; Fang, Ou; Leach, Lindsey J; Hu, Xiaohua; Luo, Zewei

2014-01-01

Paired sense and antisense (S/AS) genes located in cis represent a structural feature common to the genomes of both prokaryotes and eukaryotes, and produce partially complementary transcripts. We used published genome and transcriptome sequence data and found that over 20% of genes (645 pairs) in the budding yeast Saccharomyces cerevisiae genome are arranged in convergent pairs with overlapping 3'-UTRs. Using published microarray transcriptome data from the standard laboratory strain of S. cerevisiae, our analysis revealed that expression levels of convergent pairs are significantly negatively correlated across a broad range of environments. This implies an important role for convergent genes in the regulation of gene expression, which may compensate for the absence of RNA-dependent mechanisms such as micro RNAs in budding yeast. We selected four representative convergent gene pairs and used expression assays in wild type yeast and its genetically modified strains to explore the underlying patterns of gene expression. Results showed that convergent genes are reciprocally regulated in yeast populations and in single cells, whereby an increase in expression of one gene produces a decrease in the expression of the other, and vice-versa. Time course analysis of the cell cycle illustrated the functional significance of this relationship for the three pairs with relevant functional roles. Furthermore, a series of genetic modifications revealed that the 3'-UTR sequence plays an essential causal role in mediating transcriptional interference, which requires neither the sequence of the open reading frame nor the translation of fully functional proteins. More importantly, transcriptional interference persisted even when one of the convergent genes was expressed ectopically (in trans) and therefore does not depend on the cis arrangement of convergent genes; we conclude that the mechanism of transcriptional interference cannot be explained by the transcriptional collision model, which postulates a clash between simultaneous transcriptional processes occurring on opposite DNA strands.

3′ Untranslated Regions Mediate Transcriptional Interference between Convergent Genes Both Locally and Ectopically in Saccharomyces cerevisiae

PubMed Central

Wang, Luwen; Jiang, Ning; Wang, Lin; Fang, Ou; Leach, Lindsey J.; Hu, Xiaohua; Luo, Zewei

2014-01-01

Paired sense and antisense (S/AS) genes located in cis represent a structural feature common to the genomes of both prokaryotes and eukaryotes, and produce partially complementary transcripts. We used published genome and transcriptome sequence data and found that over 20% of genes (645 pairs) in the budding yeast Saccharomyces cerevisiae genome are arranged in convergent pairs with overlapping 3′-UTRs. Using published microarray transcriptome data from the standard laboratory strain of S. cerevisiae, our analysis revealed that expression levels of convergent pairs are significantly negatively correlated across a broad range of environments. This implies an important role for convergent genes in the regulation of gene expression, which may compensate for the absence of RNA-dependent mechanisms such as micro RNAs in budding yeast. We selected four representative convergent gene pairs and used expression assays in wild type yeast and its genetically modified strains to explore the underlying patterns of gene expression. Results showed that convergent genes are reciprocally regulated in yeast populations and in single cells, whereby an increase in expression of one gene produces a decrease in the expression of the other, and vice-versa. Time course analysis of the cell cycle illustrated the functional significance of this relationship for the three pairs with relevant functional roles. Furthermore, a series of genetic modifications revealed that the 3′-UTR sequence plays an essential causal role in mediating transcriptional interference, which requires neither the sequence of the open reading frame nor the translation of fully functional proteins. More importantly, transcriptional interference persisted even when one of the convergent genes was expressed ectopically (in trans) and therefore does not depend on the cis arrangement of convergent genes; we conclude that the mechanism of transcriptional interference cannot be explained by the transcriptional collision model, which postulates a clash between simultaneous transcriptional processes occurring on opposite DNA strands. PMID:24465217

DNA nanomapping using CRISPR-Cas9 as a programmable nanoparticle.

PubMed

Mikheikin, Andrey; Olsen, Anita; Leslie, Kevin; Russell-Pavier, Freddie; Yacoot, Andrew; Picco, Loren; Payton, Oliver; Toor, Amir; Chesney, Alden; Gimzewski, James K; Mishra, Bud; Reed, Jason

2017-11-21

Progress in whole-genome sequencing using short-read (e.g., <150 bp), next-generation sequencing technologies has reinvigorated interest in high-resolution physical mapping to fill technical gaps that are not well addressed by sequencing. Here, we report two technical advances in DNA nanotechnology and single-molecule genomics: (1) we describe a labeling technique (CRISPR-Cas9 nanoparticles) for high-speed AFM-based physical mapping of DNA and (2) the first successful demonstration of using DVD optics to image DNA molecules with high-speed AFM. As a proof of principle, we used this new "nanomapping" method to detect and map precisely BCL2-IGH translocations present in lymph node biopsies of follicular lymphoma patents. This HS-AFM "nanomapping" technique can be complementary to both sequencing and other physical mapping approaches.

Phenotypic and genotypic analysis of Borrelia burgdorferi isolates from various sources.

PubMed Central

Adam, T; Gassmann, G S; Rasiah, C; Göbel, U B

1991-01-01

A total of 17 B. burgdorferi isolates from various sources were characterized by sodium dodecyl sulfate-polyacrylamide gel electrophoresis of whole-cell proteins, restriction enzyme analysis, Southern hybridization with probes complementary to unique regions of evolutionarily conserved genes (16S rRNA and fla), and direct sequencing of in vitro polymerase chain reaction-amplified fragments of the 16S rRNA gene. Three groups were distinguished on the basis of phenotypic and genotypic traits, the latter traced to the nucleotide sequence level. Images PMID:1649797

Piscine reovirus: Genomic and molecular phylogenetic analysis from farmed and wild salmonids collected on the Canada/US Pacific Coast

USGS Publications Warehouse

Siah, Ahmed; Morrison, Diane B.; Fringuelli, Elena; Savage, Paul S.; Richmond, Zina; Purcell, Maureen K.; Johns, Robert; Johnson, Stewart C.; Sakasida, Sonja M.

2015-01-01

Piscine reovirus (PRV) is a double stranded non-enveloped RNA virus detected in farmed and wild salmonids. This study examined the phylogenetic relationships among different PRV sequence types present in samples from salmonids in Western Canada and the US, including Alaska (US), British Columbia (Canada) and Washington State (US). Tissues testing positive for PRV were partially sequenced for segment S1, producing 71 sequences that grouped into 10 unique sequence types. Sequence analysis revealed no identifiable geographical or temporal variation among the sequence types. Identical sequence types were found in fish sampled in 2001, 2005 and 2014. In addition, PRV positive samples from fish derived from Alaska, British Columbia and Washington State share identical sequence types. Comparative analysis of the phylogenetic tree indicated that Canada/US Pacific Northwest sequences formed a subgroup with some Norwegian sequence types (group II), distinct from other Norwegian and Chilean sequences (groups I, III and IV). Representative PRV positive samples from farmed and wild fish in British Columbia and Washington State were subjected to genome sequencing using next generation sequencing methods. Individual analysis of each of the 10 partial segments indicated that the Canadian and US PRV sequence types clustered separately from available whole genome sequences of some Norwegian and Chilean sequences for all segments except the segment S4. In summary, PRV was genetically homogenous over a large geographic distance (Alaska to Washington State), and the sequence types were relatively stable over a 13 year period.

Piscine Reovirus: Genomic and Molecular Phylogenetic Analysis from Farmed and Wild Salmonids Collected on the Canada/US Pacific Coast

PubMed Central

Siah, Ahmed; Morrison, Diane B.; Fringuelli, Elena; Savage, Paul; Richmond, Zina; Johns, Robert; Purcell, Maureen K.; Johnson, Stewart C.; Saksida, Sonja M.

2015-01-01

Piscine reovirus (PRV) is a double stranded non-enveloped RNA virus detected in farmed and wild salmonids. This study examined the phylogenetic relationships among different PRV sequence types present in samples from salmonids in Western Canada and the US, including Alaska (US), British Columbia (Canada) and Washington State (US). Tissues testing positive for PRV were partially sequenced for segment S1, producing 71 sequences that grouped into 10 unique sequence types. Sequence analysis revealed no identifiable geographical or temporal variation among the sequence types. Identical sequence types were found in fish sampled in 2001, 2005 and 2014. In addition, PRV positive samples from fish derived from Alaska, British Columbia and Washington State share identical sequence types. Comparative analysis of the phylogenetic tree indicated that Canada/US Pacific Northwest sequences formed a subgroup with some Norwegian sequence types (group II), distinct from other Norwegian and Chilean sequences (groups I, III and IV). Representative PRV positive samples from farmed and wild fish in British Columbia and Washington State were subjected to genome sequencing using next generation sequencing methods. Individual analysis of each of the 10 partial segments indicated that the Canadian and US PRV sequence types clustered separately from available whole genome sequences of some Norwegian and Chilean sequences for all segments except the segment S4. In summary, PRV was genetically homogenous over a large geographic distance (Alaska to Washington State), and the sequence types were relatively stable over a 13 year period. PMID:26536673

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yeo, Hyun Koo; Lee, Jae Young

2012-04-18

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

Analysis of bacterial populations in the environment using two-dimensional gel electrophoresis of genomic DNA and complementary DNA.

PubMed

Liu, Guo-Hua; Nakamura, Tatsuo; Amemiya, Takashi; Rajendran, Narasimmalu; Itoh, Kiminori

2011-01-01

Two-dimensional gel electrophoresis (2-DGE) mapping of genomic DNA and complementary DNA (cDNA) amplicons was attempted to analyze total and active bacterial populations within soil and activated sludge samples. Distinct differences in the number and species of bacterial populations and those that were metabolically active at the time of sampling were visually observed especially for the soil community. Statistical analyses and sequencing based on the 2-DGE data further revealed the relationships between total and active bacterial populations within each community. This high-resolution technique would be useful for obtaining a better understanding of bacterial population structures in the environment.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

PubMed

Yeo, Hyun Koo; Lee, Jae Young

2010-05-01

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

Sequences downstream of AAUAAA signals affect pre-mRNA cleavage and polyadenylation in vitro both directly and indirectly.

PubMed Central

Ryner, L C; Takagaki, Y; Manley, J L

1989-01-01

To investigate the role of sequences lying downstream of the conserved AAUAAA hexanucleotide in pre-mRNA cleavage and polyadenylation, deletions or substitutions were constructed in polyadenylation signals from simian virus 40 and adenovirus, and their effects were assayed in both crude and fractionated HeLa cell nuclear extracts. As expected, these sequences influenced the efficiency of both cleavage and polyadenylation as well as the accuracy of the cleavage reaction. Sequences near or upstream of the actual site of poly(A) addition appeared to specify a unique cleavage site, since their deletion resulted, in some cases, in heterogeneous cleavage. Furthermore, the sequences that allowed the simian virus 40 late pre-RNA to be cleaved preferentially by partially purified cleavage activity were also those at the cleavage site itself. Interestingly, sequences downstream of the cleavage site interacted with factors not directly involved in catalyzing cleavage and polyadenylation, since the effects of deletions were substantially diminished when partially purified components were used in assays. In addition, these sequences contained elements that could affect 3'-end formation both positively and negatively. Images PMID:2566911

A Partial Least Squares Based Procedure for Upstream Sequence Classification in Prokaryotes.

PubMed

Mehmood, Tahir; Bohlin, Jon; Snipen, Lars

2015-01-01

The upstream region of coding genes is important for several reasons, for instance locating transcription factor, binding sites, and start site initiation in genomic DNA. Motivated by a recently conducted study, where multivariate approach was successfully applied to coding sequence modeling, we have introduced a partial least squares (PLS) based procedure for the classification of true upstream prokaryotic sequence from background upstream sequence. The upstream sequences of conserved coding genes over genomes were considered in analysis, where conserved coding genes were found by using pan-genomics concept for each considered prokaryotic species. PLS uses position specific scoring matrix (PSSM) to study the characteristics of upstream region. Results obtained by PLS based method were compared with Gini importance of random forest (RF) and support vector machine (SVM), which is much used method for sequence classification. The upstream sequence classification performance was evaluated by using cross validation, and suggested approach identifies prokaryotic upstream region significantly better to RF (p-value < 0.01) and SVM (p-value < 0.01). Further, the proposed method also produced results that concurred with known biological characteristics of the upstream region.

Cloning of a CACTA transposon-like insertion in intron I of tomato invertase Lin5 gene and identification of transposase-like sequences of Solanaceae species.

PubMed

Proels, Reinhard K; Roitsch, Thomas

2006-03-01

Very few CACTA transposon-like sequences have been described in Solanaceae species. Sequence information has been restricted to partial transposase (TPase)-like fragments, and no target gene of CACTA-like transposon insertion has been described in tomato to date. In this manuscript, we report on a CACTA transposon-like insertion in intron I of tomato (Lycopersicon esculentum) invertase gene Lin5 and TPase-like sequences of several Solanaceae species. Consensus primers deduced from the TPase region of the tomato CACTA transposon-like element allowed the amplification of similar sequences from various Solanaceae species of different subfamilies including Solaneae (Solanum tuberosum), Cestreae (Nicotiana tabacum) and Datureae (Datura stramonium). This demonstrates the ubiquitous presence of CACTA-like elements in Solanaceae genomes. The obtained partial sequences are highly conserved, and allow further detection and detailed analysis of CACTA-like transposons throughout Solanaceae species. CACTA-like transposon sequences make possible the evaluation of their use for genome analysis, functional studies of genes and the evolutionary relationships between plant species.

Triple helix purification and sequencing

DOEpatents

Wang, Renfeng; Smith, Lloyd M.; Tong, Xinchun E.

1995-01-01

Disclosed herein are methods, kits, and equipment for purifying single stranded circular DNA and then using the DNA for DNA sequencing purposes. Templates are provided with an insert having a hybridization region. An elongated oligonucleotide has two regions that are complementary to the insert and the oligo is bound to a magnetic anchor. The oligo hybridizes to the insert on two sides to form a stable triple helix complex. The anchor can then be used to drag the template out of solution using a magnet. The system can purify sequencing templates, and if desired the triple helix complex can be opened up to a double helix so that the oligonucleotide will act as a primer for further DNA synthesis.

Triple helix purification and sequencing

DOEpatents

Wang, R.; Smith, L.M.; Tong, X.E.

1995-03-28

Disclosed herein are methods, kits, and equipment for purifying single stranded circular DNA and then using the DNA for DNA sequencing purposes. Templates are provided with an insert having a hybridization region. An elongated oligonucleotide has two regions that are complementary to the insert and the oligo is bound to a magnetic anchor. The oligo hybridizes to the insert on two sides to form a stable triple helix complex. The anchor can then be used to drag the template out of solution using a magnet. The system can purify sequencing templates, and if desired the triple helix complex can be opened up to a double helix so that the oligonucleotide will act as a primer for further DNA synthesis. 4 figures.

A Guide to the PLAZA 3.0 Plant Comparative Genomic Database.

PubMed

Vandepoele, Klaas

2017-01-01

PLAZA 3.0 is an online resource for comparative genomics and offers a versatile platform to study gene functions and gene families or to analyze genome organization and evolution in the green plant lineage. Starting from genome sequence information for over 35 plant species, precomputed comparative genomic data sets cover homologous gene families, multiple sequence alignments, phylogenetic trees, and genomic colinearity information within and between species. Complementary functional data sets, a Workbench, and interactive visualization tools are available through a user-friendly web interface, making PLAZA an excellent starting point to translate sequence or omics data sets into biological knowledge. PLAZA is available at http://bioinformatics.psb.ugent.be/plaza/ .

Probability of coding of a DNA sequence: an algorithm to predict translated reading frames from their thermodynamic characteristics.

PubMed Central

Tramontano, A; Macchiato, M F

1986-01-01

An algorithm to determine the probability that a reading frame codifies for a protein is presented. It is based on the results of our previous studies on the thermodynamic characteristics of a translated reading frame. We also develop a prediction procedure to distinguish between coding and non-coding reading frames. The procedure is based on the characteristics of the putative product of the DNA sequence and not on periodicity characteristics of the sequence, so the prediction is not biased by the presence of overlapping translated reading frames or by the presence of translated reading frames on the complementary DNA strand. PMID:3753761

The mitochondrial genome of the Arizona Snowfly Mesocapnia arizonensis (Plecoptera, Capniidae).

PubMed

Elbrecht, Vasco; Leese, Florian

2016-09-01

We assembled the mitochondrial genome of the capniid stonefly Mesocapnia arizonensis (Baumann & Gaufin, 1969) using Illumina HiSeq sequence data. The recovered mitogenome is 14,921 bp in length and includes 13 protein-coding genes, 2 ribosomal RNA genes and 22 transfer RNA genes. The control region could only be assembled partially. Gene order resembles that of basal arthropods. This is the first partial mitogenome sequence for the stonefly superfamily group Euholognatha and will be useful in future phylogenetic analyses.

Evidence-Based Evaluation of Complementary Health Approaches for Pain Management in the United States.

PubMed

Nahin, Richard L; Boineau, Robin; Khalsa, Partap S; Stussman, Barbara J; Weber, Wendy J

2016-09-01

Although most pain is acute and resolves within a few days or weeks, millions of Americans have persistent or recurring pain that may become chronic and debilitating. Medications may provide only partial relief from this chronic pain and can be associated with unwanted effects. As a result, many individuals turn to complementary health approaches as part of their pain management strategy. This article examines the clinical trial evidence for the efficacy and safety of several specific approaches-acupuncture, manipulation, massage therapy, relaxation techniques including meditation, selected natural product supplements (chondroitin, glucosamine, methylsulfonylmethane, S-adenosylmethionine), tai chi, and yoga-as used to manage chronic pain and related disability associated with back pain, fibromyalgia, osteoarthritis, neck pain, and severe headaches or migraines. Copyright © 2016 Mayo Foundation for Medical Education and Research. Published by Elsevier Inc. All rights reserved.

Performance trade-off in an adaptive IEEE 802.11ad waveform design for a joint automotive radar and communication system.

DOT National Transportation Integrated Search

2017-05-01

The IEEE 802.11ad waveform can be used for automotive radar by exploiting the Golay complementary sequences in the preamble of a frame. The performance of radar, however, is limited by the preamble structure. In this paper, we propose an adaptive pre...

Oligonucleoside alkyl or arylphosphonate derivatives capable of crosslinking with or cleaving nucleic acids

DOEpatents

Miller, Paul S.; Ts'o, Paul O.P.

1999-06-15

A composition for inactivating a target nucleic acid which comprises an oligonucleoside alkyl or arylphosphonate analogue which is complementary to the sequence of the target nucleic acid and includes a functional group which reacts with the target nucleic acid to render the target nucleic acid inactive or nonfunctional.

Topological Interaction by Entanglement of DNA

NASA Astrophysics Data System (ADS)

Feng, Lang; Sha, Ruojie; Seeman, Nadrian; Chaikin, Paul

2012-02-01

We find and study a new type of interaction between colloids, Topological Interaction by Entanglement of DNA (TIED), due to concatenation of loops formed by palindromic DNA. Consider a particle coated with palindromic DNA of sequence ``P1.'' Below the DNA hybridization temperature (Tm), loops of the self-complementary DNA form on the particle surface. Direct hybridization with similar particle covered with a different sequence P2 do not occur. However when particles are held together at T > Tm, then cooled to T < Tm, some of the loops entangle and link, similar to a Olympic Gel. We quantitatively observe and measure this topological interaction between colloids in a ˜5^o C temperature window, ˜6^o C lower than direct binding of complementary DNA with similar strength and introduce the concept of entanglement binding free energy. To prove our interaction to be topological, we unknot the purely entangled binding sites between colloids by adding Topoisomerase I which unconcatenates our loops. This research suggests novel history dependent ways of binding particles and serves as a new design tool in colloidal self-assembly.

Identification and Characterization of a Cis Antisense RNA of the rpoH Gene of Salmonella enterica Serovar Typhi.

PubMed

Xiong, Changyan; Li, Xuejiao; Liu, Juanli; Zhao, Xin; Xu, Shungao; Huang, Xinxiang

2018-01-01

Antisense RNAs from complementary strands of protein coding genes regulate the expression of genes involved in many cellular processes. Using deep sequencing analysis of the Salmonella enterica serovar Typhi ( S. Typhi) transcriptome, a novel antisense RNA encoded on the strand complementary to the rpoH gene was revealed. In this study, the molecular features of this antisense RNA were assessed using northern blotting and rapid amplification of cDNA ends. The 3,508 nt sequence of RNA was identified as the antisense RNA of the rpoH gene and was named ArpH. ArpH was found to attenuate the invasion of HeLa cells by S. Typhi by regulating the expression of SPI-1 genes. In an rpoH mutant strain, the invasive capacity of S. Typhi was increased, whereas overexpression of ArpH positively regulates rpoH mRNA levels. Results of this study suggest that the cis -encoded antisense RNA ArpH is likely to affect the invasive capacity of S. Typhi by regulating the expression of rpoH .

Multiple primary cancers of breast and cervix uteri: An epidemiological approach to analysis

PubMed Central

Prior, P.; Waterhouse, J. A. H.

1981-01-01

Index sites of breast and cervix uteri were selected from populationbased data held at the West Midlands and Birmingham Regional Cancer Registry, and the expected numbers of second primary cancers in cervix and breast were computed (sequence analyses). In the breast series (17,756 patients) a small deficit of cervical tumours was observed (O = 16, E = 2·119, O/E = 0·76, P > 0·05), while in the cervix series (4817 patients) a small excess of breast tumours was found (O = 29, E = 23·38, O/E = 1·24, P > 0·05) over a period of 15 years. A theoretical statement of the combined risk of the 2 tumours occurring in the same individual of a general population was developed and was compared with the practical approach of summing the sequence analyses (complementary analysis). Complementary analysis indicated that there was no excess of women with the 2 primary tumours (O = 45, E = 44·57, O/E = 1·01) and that cancers of the breast and cervix uteri are not aetiologically related. PMID:7248147

Formation of template-switching artifacts by linear amplification.

PubMed

Chakravarti, Dhrubajyoti; Mailander, Paula C

2008-07-01

Linear amplification is a method of synthesizing single-stranded DNA from either a single-stranded DNA or one strand of a double-stranded DNA. In this protocol, molecules of a single primer DNA are extended by multiple rounds of DNA synthesis at high temperature using thermostable DNA polymerases. Although linear amplification generates the intended full-length single-stranded product, it is more efficient over single-stranded templates than double-stranded templates. We analyzed linear amplification over single- or double-stranded mouse H-ras DNA (exon 1-2 region). The single-stranded H-ras template yielded only the intended product. However, when the double-stranded template was used, additional artifact products were observed. Increasing the concentration of the double-stranded template produced relatively higher amounts of these artifact products. One of the artifact DNA bands could be mapped and analyzed by sequencing. It contained three template-switching products. These DNAs were formed by incomplete DNA strand extension over the template strand, followed by switching to the complementary strand at a specific Ade nucleotide within a putative hairpin sequence, from which DNA synthesis continued over the complementary strand.

Mapping of aldose reductase gene sequences to human chromosomes 1, 3, 7, 9, 11, and 13

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bateman, J.B.; Kojis, T.; Heinzmann, C.

1993-09-01

Aldose reductase (alditol:NAD(P)+ 1-oxidoreductase; EC 1.1.1.21) (AR) catalyzes the reduction of several aldehydes, including that of glucose, to the corresponding sugar alcohol. Using a complementary DNA clone encoding human AR, the authors mapped the gene sequences to human chromosomes 1, 3, 7, 9, 11, 13, 14, and 18 by somatic cell hybridization. By in situ hybridization analysis, sequences were localized to human chromosomes 1q32-q43, 3p12, 7q31-q35, 9q22, 11p14-p15, and 13q14-q21. As a putative functional AR gene has been mapped to chromosome 7 and a putative pseudogene to chromosome 3, the sequences on the other seven chromosomes may represent other activemore » genes, non-aldose reductase homologous sequences, or pseudogenes. 24 refs., 3 figs., 2 tabs.« less

Highly Complementary Target RNAs Promote Release of Guide RNAs from Human Argonaute2

PubMed Central

De, Nabanita; Young, Lisa; Lau, Pick-Wei; Meisner, Nicole-Claudia; Morrissey, David V.; MacRae, Ian J.

2013-01-01

SUMMARY Argonaute proteins use small RNAs to guide the silencing of complementary target RNAs in many eukaryotes. Although small RNA biogenesis pathways are well studied, mechanisms for removal of guide RNAs from Argonaute are poorly understood. Here we show that the Argonaute2 (Ago2) guide RNA complex is extremely stable, with a half-life on the order of days. However, highly complementary target RNAs destabilize the complex and significantly accelerate release of the guide RNA from Ago2. This “unloading” activity can be enhanced by mismatches between the target and the guide 5′ end and attenuated by mismatches to the guide 3′ end. The introduction of 3′ mismatches leads to more potent silencing of abundant mRNAs in mammalian cells. These findings help to explain why the 3′ ends of mammalian microRNAs (miRNAs) rarely match their targets, suggest a mechanism for sequence-specific small RNA turnover, and offer insights for controlling small RNAs in mammalian cells. PMID:23664376

Conformational Heterogeneity in a Fully Complementary DNA Three-Way Junction with a GC-Rich Branchpoint.

PubMed

Toulmin, Anita; Baltierra-Jasso, Laura E; Morten, Michael J; Sabir, Tara; McGlynn, Peter; Schröder, Gunnar F; Smith, Brian O; Magennis, Steven W

2017-09-19

DNA three-way junctions (3WJs) are branched structures that serve as important biological intermediates and as components in DNA nanostructures. We recently derived the global structure of a fully complementary 3WJ and found that it contained unpaired bases at the branchpoint, which is consistent with previous observations of branch flexibility and branchpoint reactivity. By combining high-resolution single-molecule Förster resonance energy transfer, molecular modeling, time-resolved ensemble fluorescence spectroscopy, and the first 19 F nuclear magnetic resonance observations of fully complementary 3WJs, we now show that the 3WJ structure can adopt multiple distinct conformations depending upon the sequence at the branchpoint. A 3WJ with a GC-rich branchpoint adopts an open conformation with unpaired bases at the branch and at least one additional conformation with an increased number of base interactions at the branchpoint. This structural diversity has implications for branch interactions and processing in vivo and for technological applications.

A Golay complementary TS-based symbol synchronization scheme in variable rate LDPC-coded MB-OFDM UWBoF system

NASA Astrophysics Data System (ADS)

He, Jing; Wen, Xuejie; Chen, Ming; Chen, Lin

2015-09-01

In this paper, a Golay complementary training sequence (TS)-based symbol synchronization scheme is proposed and experimentally demonstrated in multiband orthogonal frequency division multiplexing (MB-OFDM) ultra-wideband over fiber (UWBoF) system with a variable rate low-density parity-check (LDPC) code. Meanwhile, the coding gain and spectral efficiency in the variable rate LDPC-coded MB-OFDM UWBoF system are investigated. By utilizing the non-periodic auto-correlation property of the Golay complementary pair, the start point of LDPC-coded MB-OFDM UWB signal can be estimated accurately. After 100 km standard single-mode fiber (SSMF) transmission, at the bit error rate of 1×10-3, the experimental results show that the short block length 64QAM-LDPC coding provides a coding gain of 4.5 dB, 3.8 dB and 2.9 dB for a code rate of 62.5%, 75% and 87.5%, respectively.

Bellerophon: a program to detect chimeric sequences in multiple sequence alignments.

PubMed

Huber, Thomas; Faulkner, Geoffrey; Hugenholtz, Philip

2004-09-22

Bellerophon is a program for detecting chimeric sequences in multiple sequence datasets by an adaption of partial treeing analysis. Bellerophon was specifically developed to detect 16S rRNA gene chimeras in PCR-clone libraries of environmental samples but can be applied to other nucleotide sequence alignments. Bellerophon is available as an interactive web server at http://foo.maths.uq.edu.au/~huber/bellerophon.pl

Detection of somatic, subclonal and mosaic CNVs from sequencing | Division of Cancer Prevention

Cancer.gov

Progress in technology has made individual genome sequencing a clinical reality, with partial genome sequencing already in use in clinical care. In fact, it is expected that within a few years whole genome sequencing will be a standard procedure that will allow discovering personal genomic variants of all types and thus greatly facilitate individualized medicine. However, fast

Confirmation of a novel siadenovirus species detected in raptors: partial sequence and phylogenetic analysis.

PubMed

Kovács, Endre R; Benko, Mária

2009-03-01

Partial genome characterisation of a novel adenovirus, found recently in organ samples of multiple species of dead birds of prey, was carried out by sequence analysis of PCR-amplified DNA fragments. The virus, named as raptor adenovirus 1 (RAdV-1), has originally been detected by a nested PCR method with consensus primers targeting the adenoviral DNA polymerase gene. Phylogenetic analysis with the deduced amino acid sequence of the small PCR product has implied a new siadenovirus type present in the samples. Since virus isolation attempts remained unsuccessful, further characterisation of this putative novel siadenovirus was carried out with the use of PCR on the infected organ samples. The DNA sequence of the central genome part of RAdV-1, encompassing nine full (pTP, 52K, pIIIa, III, pVII, pX, pVI, hexon, protease) and two partial (DNA polymerase and DBP) genes and exceeding 12 kb pairs in size, was determined. Phylogenetic tree reconstructions, based on several genes, unambiguously confirmed the preliminary classification of RAdV-1 as a new species within the genus Siadenovirus. Further study of RAdV-1 is of interest since it represents a rare adenovirus genus of yet undetermined host origin.

Molecular characterization of Calocedrus rupestris Aver., H.T. Nguyen & L.K. Phan, 2008 (Cupressaceae) based on ITS1 partial sequence.

PubMed

Long, P K; Trang, N T P; Averyanov, L V; Loc, P K

2011-11-21

Calocedrus rupestris Aver., H.T. Nguyen & L.K. Phan was described in 2008 based on some morphological characters that were not sufficiently significant to discriminate it as a species distinct from C. macrolepis Kurz. We applied a new approach to resolve these conflicting views by using sequence data from DNA (ITS) to elucidate phylogenetic relationships between the two species. Analyses of a partial ITS1 sequence in 5 individuals of 2 subpopulations of C. macrolepis and 18 individuals of 8 subpopulations of C. rupestris collected in Vietnam were done. Molecular characterization of the two species showed its low divergence with the lack of autapomorphic characters. In addition, the ITS1 partial sequences of some C. rupestris individuals were identical with C. macrolepis. Due to the less distinctive morphology between C. rupestris and C. macrolepis, the divergence between them does not exceed the interspecific levels, and therefore, C. rupestris could not be regarded as an independent species in relation to C. macrolepis but only as one of its varieties, C. macrolepis var. rupestris (Aver., H.T. Nguyen & L.K. Phan) L.K. Phan, Long K. Phan & Aver.

Species-specific identification of commercial probiotic strains.

PubMed

Yeung, P S M; Sanders, M E; Kitts, C L; Cano, R; Tong, P S

2002-05-01

Products containing probiotic bacteria are gaining popularity, increasing the importance of their accurate speciation. Unfortunately, studies have suggested that improper labeling of probiotic species is common in commercial products. Species identification of a bank of commercial probiotic strains was attempted using partial 16S rDNA sequencing, carbohydrate fermentation analysis, and cellular fatty acid methyl ester analysis. Results from partial 16S rDNA sequencing indicated discrepancies between species designations for 26 out of 58 strains tested, including two ATCC Lactobacillus strains. When considering only the commercial strains obtained directly from the manufacturers, 14 of 29 strains carried species designations different from those obtained by partial 16S rDNA sequencing. Strains from six commercial products were species not listed on the label. The discrepancies mainly occurred in Lactobacillus acidophilus and Lactobacillus casei groups. Carbohydrate fermentation analysis was not sensitive enough to identify species within the L. acidophilus group. Fatty acid methyl ester analysis was found to be variable and inaccurate and is not recommended to identify probiotic lactobacilli.

Positively selected amino acid replacements within the RuBisCO enzyme of oak trees are associated with ecological adaptations.

PubMed

Hermida-Carrera, Carmen; Fares, Mario A; Fernández, Ángel; Gil-Pelegrín, Eustaquio; Kapralov, Maxim V; Mir, Arnau; Molins, Arántzazu; Peguero-Pina, José Javier; Rocha, Jairo; Sancho-Knapik, Domingo; Galmés, Jeroni

2017-01-01

Phylogenetic analysis by maximum likelihood (PAML) has become the standard approach to study positive selection at the molecular level, but other methods may provide complementary ways to identify amino acid replacements associated with particular conditions. Here, we compare results of the decision tree (DT) model method with ones of PAML using the key photosynthetic enzyme RuBisCO as a model system to study molecular adaptation to particular ecological conditions in oaks (Quercus). We sequenced the chloroplast rbcL gene encoding RuBisCO large subunit in 158 Quercus species, covering about a third of the global genus diversity. It has been hypothesized that RuBisCO has evolved differentially depending on the environmental conditions and leaf traits governing internal gas diffusion patterns. Here, we show, using PAML, that amino acid replacements at the residue positions 95, 145, 251, 262 and 328 of the RuBisCO large subunit have been the subject of positive selection along particular Quercus lineages associated with the leaf traits and climate characteristics. In parallel, the DT model identified amino acid replacements at sites 95, 219, 262 and 328 being associated with the leaf traits and climate characteristics, exhibiting partial overlap with the results obtained using PAML.

High frame rate imaging systems developed in Northwest Institute of Nuclear Technology

NASA Astrophysics Data System (ADS)

Li, Binkang; Wang, Kuilu; Guo, Mingan; Ruan, Linbo; Zhang, Haibing; Yang, Shaohua; Feng, Bing; Sun, Fengrong; Chen, Yanli

2007-01-01

This paper presents high frame rate imaging systems developed in Northwest Institute of Nuclear Technology in recent years. Three types of imaging systems are included. The first type of system utilizes EG&G RETICON Photodiode Array (PDA) RA100A as the image sensor, which can work at up to 1000 frame per second (fps). Besides working continuously, the PDA system is also designed to switch to capture flash light event working mode. A specific time sequence is designed to satisfy this request. The camera image data can be transmitted to remote area by coaxial or optic fiber cable and then be stored. The second type of imaging system utilizes PHOTOBIT Complementary Metal Oxygen Semiconductor (CMOS) PB-MV13 as the image sensor, which has a high resolution of 1280 (H) ×1024 (V) pixels per frame. The CMOS system can operate at up to 500fps in full frame and 4000fps partially. The prototype scheme of the system is presented. The third type of imaging systems adopts charge coupled device (CCD) as the imagers. MINTRON MTV-1881EX, DALSA CA-D1 and CA-D6 camera head are used in the systems development. The features comparison of the RA100A, PB-MV13, and CA-D6 based systems are given in the end.

Positively selected amino acid replacements within the RuBisCO enzyme of oak trees are associated with ecological adaptations

PubMed Central

Hermida-Carrera, Carmen; Fares, Mario A.; Fernández, Ángel; Gil-Pelegrín, Eustaquio; Kapralov, Maxim V.; Mir, Arnau; Molins, Arántzazu; Peguero-Pina, José Javier; Rocha, Jairo; Sancho-Knapik, Domingo

2017-01-01

Phylogenetic analysis by maximum likelihood (PAML) has become the standard approach to study positive selection at the molecular level, but other methods may provide complementary ways to identify amino acid replacements associated with particular conditions. Here, we compare results of the decision tree (DT) model method with ones of PAML using the key photosynthetic enzyme RuBisCO as a model system to study molecular adaptation to particular ecological conditions in oaks (Quercus). We sequenced the chloroplast rbcL gene encoding RuBisCO large subunit in 158 Quercus species, covering about a third of the global genus diversity. It has been hypothesized that RuBisCO has evolved differentially depending on the environmental conditions and leaf traits governing internal gas diffusion patterns. Here, we show, using PAML, that amino acid replacements at the residue positions 95, 145, 251, 262 and 328 of the RuBisCO large subunit have been the subject of positive selection along particular Quercus lineages associated with the leaf traits and climate characteristics. In parallel, the DT model identified amino acid replacements at sites 95, 219, 262 and 328 being associated with the leaf traits and climate characteristics, exhibiting partial overlap with the results obtained using PAML. PMID:28859145

Open and closed conformations of two SpoIIAA-like proteins (YP_749275.1 and YP_001095227.1) provide insights into membrane association and ligand binding

PubMed Central

Kumar, Abhinav; Lomize, Andrei; Jin, Kevin K.; Carlton, Dennis; Miller, Mitchell D.; Jaroszewski, Lukasz; Abdubek, Polat; Astakhova, Tamara; Axelrod, Herbert L.; Chiu, Hsiu-Ju; Clayton, Thomas; Das, Debanu; Deller, Marc C.; Duan, Lian; Feuerhelm, Julie; Grant, Joanna C.; Grzechnik, Anna; Han, Gye Won; Klock, Heath E.; Knuth, Mark W.; Kozbial, Piotr; Krishna, S. Sri; Marciano, David; McMullan, Daniel; Morse, Andrew T.; Nigoghossian, Edward; Okach, Linda; Reyes, Ron; Rife, Christopher L.; Sefcovic, Natasha; Tien, Henry J.; Trame, Christine B.; van den Bedem, Henry; Weekes, Dana; Xu, Qingping; Hodgson, Keith O.; Wooley, John; Elsliger, Marc-André; Deacon, Ashley M.; Godzik, Adam; Lesley, Scott A.; Wilson, Ian A.

2010-01-01

The crystal structures of the proteins encoded by the YP_749275.1 and YP_001095227.1 genes from Shewanella frigidimarina and S. loihica, respectively, have been determined at 1.8 and 2.25 Å resolution, respectively. These proteins are members of a novel family of bacterial proteins that adopt the α/β SpoIIAA-like fold found in STAS and CRAL-TRIO domains. Despite sharing 54% sequence identity, these two proteins adopt distinct conformations arising from different dispositions of their α2 and α3 helices. In the ‘open’ conformation (YP_001095227.1), these helices are 15 Å apart, leading to the creation of a deep nonpolar cavity. In the ‘closed’ structure (YP_749275.1), the helices partially unfold and rearrange, occluding the cavity and decreasing the solvent-exposed hydrophobic surface. These two complementary structures are reminiscent of the conformational switch in CRAL-TRIO carriers of hydrophobic compounds. It is suggested that both proteins may associate with the lipid bilayer in their ‘open’ monomeric state by inserting their amphiphilic helices, α2 and α3, into the lipid bilayer. These bacterial proteins may function as carriers of nonpolar substances or as interfacially activated enzymes. PMID:20944218

A rapid and reliable PCR method for genotyping the ABO blood group.

PubMed

O'Keefe, D S; Dobrovic, A

1993-01-01

The ABO blood group has been used extensively as a marker in population studies, epidemiology, and forensic work. However, until the cloning of the gene, it was not possible to determine the genotype of group A and B individuals without recourse to family studies. We have developed a method to determine the ABO genotype directly from human DNA using multiplex PCR and restriction enzyme analysis. Two PCR fragments spanning positions 258 and 700 of the cDNA sequence are amplified. The site at position 258 allows us to differentiate the O allele from the A and B alleles. The site at position 700 allows us to distinguish the B allele from the A and O alleles. Analysis at the two sites thus allows us to distinguish the three alleles. The multiplex PCR product is digested separately with four enzymes, two for each of the sites. The pair of enzymes for each site cut in a reciprocal fashion. Whereas one enzyme for each site is theoretically sufficient for genotyping, the use of complementary pairs of enzymes prevents the assignment of a false genotype as a result of false negative or partial digestion. This method is fast and reliable, does not rely on probing of blots, and should be widely applicable.

Hydroelastic vibration analysis of partially liquid-filled shells using a series representation of the liquid

NASA Technical Reports Server (NTRS)

Housner, J. M.; Herr, R. W.; Sewall, J. L.

1980-01-01

A series representation of the oscillatory behavior of incompressible nonviscous liquids contained in partially filled elastic tanks is presented. Each term is selected on the basis of hydroelastic vibrations in circular cylindrical tanks. Using a complementary energy principle, the superposition of terms is made to approximately satisfy the liquid-tank interface compatibility. This analysis is applied to the gravity sloshing and hydroelastic vibrations of liquids in hemispherical tanks and in a typical elastic aerospace propellant tank. With only a few series terms retained, the results correlate very well with existing analytical results, NASTRAN-generated analytical results, and experimental test results. Hence, although each term is based on a cylindrical tank geometry, the superposition can be successfully applied to noncylindrical tanks.

On new classes of solutions of nonlinear partial differential equations in the form of convergent special series

NASA Astrophysics Data System (ADS)

Filimonov, M. Yu.

2017-12-01

The method of special series with recursively calculated coefficients is used to solve nonlinear partial differential equations. The recurrence of finding the coefficients of the series is achieved due to a special choice of functions, in powers of which the solution is expanded in a series. We obtain a sequence of linear partial differential equations to find the coefficients of the series constructed. In many cases, one can deal with a sequence of linear ordinary differential equations. We construct classes of solutions in the form of convergent series for a certain class of nonlinear evolution equations. A new class of solutions of generalized Boussinesque equation with an arbitrary function in the form of a convergent series is constructed.

Toward a General Approach for RNA-Templated Hierarchical Assembly of Split-Proteins

PubMed Central

Furman, Jennifer L.; Badran, Ahmed H.; Ajulo, Oluyomi; Porter, Jason R.; Stains, Cliff I.; Segal, David J.; Ghosh, Indraneel

2010-01-01

The ability to conditionally turn on a signal or induce a function in the presence of a user-defined RNA target has potential applications in medicine and synthetic biology. Although sequence-specific pumilio repeat proteins can target a limited set of ssRNA sequences, there are no general methods for targeting ssRNA with designed proteins. As a first step toward RNA recognition, we utilized the RNA binding domain of argonaute, implicated in RNA interference, for specifically targeting generic 2-nucleotide, 3' overhangs of any dsRNA. We tested the reassembly of a split-luciferase enzyme guided by argonaute-mediated recognition of newly generated nucleotide overhangs when ssRNA is targeted by a designed complementary guide sequence. This approach was successful when argonaute was utilized in conjunction with a pumilio repeat and expanded the scope of potential ssRNA targets. However, targeting any desired ssRNA remained elusive as two argonaute domains provided minimal reassembled split-luciferase. We next designed and tested a second hierarchical assembly, wherein ssDNA guides are appended to DNA hairpins that serve as a scaffold for high affinity zinc fingers attached to split-luciferase. In the presence of a ssRNA target containing adjacent sequences complementary to the guides, the hairpins are brought into proximity, allowing for zinc finger binding and concomitant reassembly of the fragmented luciferase. The scope of this new approach was validated by specifically targeting RNA encoding VEGF, hDM2, and HER2. These approaches provide potentially general design paradigms for the conditional reassembly of fragmented proteins in the presence of any desired ssRNA target. PMID:20681585

Analysis of aberrant pre-messenger RNA splicing resulting from mutations in ATP8B1 and efficient in vitro rescue by adapted U1 small nuclear RNA.

PubMed

van der Woerd, Wendy L; Mulder, Johanna; Pagani, Franco; Beuers, Ulrich; Houwen, Roderick H J; van de Graaf, Stan F J

2015-04-01

ATP8B1 deficiency is a severe autosomal recessive liver disease resulting from mutations in the ATP8B1 gene characterized by a continuous phenotypical spectrum from intermittent (benign recurrent intrahepatic cholestasis; BRIC) to progressive familial intrahepatic cholestasis (PFIC). Current therapeutic options are insufficient, and elucidating the molecular consequences of mutations could lead to personalized mutation-specific therapies. We investigated the effect on pre-messenger RNA splicing of 14 ATP8B1 mutations at exon-intron boundaries using an in vitro minigene system. Eleven mutations, mostly associated with a PFIC phenotype, resulted in aberrant splicing and a complete absence of correctly spliced product. In contrast, three mutations led to partially correct splicing and were associated with a BRIC phenotype. These findings indicate an inverse correlation between the level of correctly spliced product and disease severity. Expression of modified U1 small nuclear RNAs (snRNA) complementary to the splice donor sites strongly improved or completely rescued splicing for several ATP8B1 mutations located at donor, as well as acceptor, splice sites. In one case, we also evaluated exon-specific U1 snRNAs that, by targeting nonconserved intronic sequences, might reduce possible off-target events. Although very effective in correcting exon skipping, they also induced retention of the short downstream intron. We systematically characterized the molecular consequences of 14 ATP8B1 mutations at exon-intron boundaries associated with ATP8B1 deficiency and found that the majority resulted in total exon skipping. The amount of correctly spliced product inversely correlated with disease severity. Compensatory modified U1 snRNAs, complementary to mutated donor splice sites, were able to improve exon definition very efficiently and could be a novel therapeutic strategy in ATP8B1 deficiency as well as other genetic diseases. © 2014 by the American Association for the Study of Liver Diseases.

Formation of rings from segments of HeLa-cell nuclear deoxyribonucleic acid

PubMed Central

Hardman, Norman

1974-01-01

Duplex segments of HeLa-cell nuclear DNA were generated by cleavage with DNA restriction endonuclease from Haemophilus influenzae. About 20–25% of the DNA segments produced, when partly degraded with exonuclease III and annealed, were found to form rings visible in the electron microscope. A further 5% of the DNA segments formed structures that were branched in configuration. Similar structures were generated from HeLa-cell DNA, without prior treatment with restriction endonuclease, when the complementary polynucleotide chains were exposed by exonuclease III action at single-chain nicks. After exposure of an average single-chain length of 1400 nucleotides per terminus at nicks in HeLa-cell DNA by exonuclease III, followed by annealing, the physical length of ring closures was estimated and found to be 0.02–0.1μm, or 50–300 base pairs. An almost identical distribution of lengths was recorded for the regions of complementary base sequence responsible for branch formation. It is proposed that most of the rings and branches are formed from classes of reiterated base sequence with an average length of 180 base pairs arranged intermittenly in HeLa-cell DNA. From the rate of formation of branched structures when HeLa-cell DNA segments were heat-denatured and annealed, it is estimated that the reiterated sequences are in families containing approximately 2400–24000 copies. ImagesPLATE 2PLATE 1 PMID:4462738

Development of a Fluorescence Resonance Energy Transfer (FRET)-Based DNA Biosensor for Detection of Synthetic Oligonucleotide of Ganoderma boninense

PubMed Central

Mohd Bakhori, Noremylia; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir

2013-01-01

An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10−9 M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense. PMID:25587406

Isolation of a complementary DNA clone for thyroid microsomal antigen. Homology with the gene for thyroid peroxidase.

PubMed Central

Seto, P; Hirayu, H; Magnusson, R P; Gestautas, J; Portmann, L; DeGroot, L J; Rapoport, B

1987-01-01

The thyroid microsomal antigen (MSA) in autoimmune thyroid disease is a protein of approximately 107 kD. We screened a human thyroid cDNA library constructed in the expression vector lambda gt11 with anti-107-kD monoclonal antibodies. Of five clones obtained, the recombinant beta-galactosidase fusion protein from one clone (PM-5) was confirmed to react with the monoclonal antiserum. The complementary DNA (cDNA) insert from PM-5 (0.8 kb) was used as a probe on Northern blot analysis to estimate the size of the mRNA coding for the MSA. The 2.9-kb messenger RNA (mRNA) species observed was the same size as that coding for human thyroid peroxidase (TPO). The probe did not bind to human liver mRNA, indicating the thyroid-specific nature of the PM-5-related mRNA. The nucleotide sequence of PM-5 (842 bp) was determined and consisted of a single open reading frame. Comparison of the nucleotide sequence of PM-5 with that presently available for pig TPO indicates 84% homology. In conclusion, a cDNA clone representing part of the microsomal antigen has been isolated. Sequence homology with porcine TPO, as well as identity in the size of the mRNA species for both the microsomal antigen and TPO, indicate that the microsomal antigen is, at least in part, TPO. Images PMID:3654979

Synthesis and fluorescence studies of multiple labeled oligonucleotides containing dansyl fluorophore covalently attached at 2'-terminus of cytidine via carbamate linkage.

PubMed

Misra, Arvind; Mishra, Satyendra; Misra, Krishna

2004-01-01

Synthesis of modified oligonucleotides in which the specific cytidine nucleoside analogues linked at 2'-OH position via a carbamate bond with an amino ethyl derivative of dansyl fluorophore is reported. For the multiple labeling of oligonucleotides, a strategy involving prelabeling at the monomeric level followed by solid phase assembly of oligonucleotides to obtain regiospecifically labeled probes has been described. The labeled monomer was phosphitylated using 2-cyanoethyl-N,N,N',N'-tetraisopropyl-phosphoramidite (Bis-reagent) and pyridiniumtrifluoro acetate (Py.TFA) as an activator. To ascertain the minimal number of labeled monomers required for a specific length of oligonucleotide for detection and also to assess the effect of carbamate linkage on hybridization, hexamer and 20-mer sequences were selected. Both were labeled with 1, 2, and 3 monomers at the 5'-end and hybridized with normal (unmodified) complementary sequences. As compared to midsequence or 3'-terminal labeling reported earlier, the 5'-terminal labeling has been found to have minimal contact-mediated quenching on duplex formation. This may be due to complementary deoxyguanosine (dG) rich oligonucleotide sequences or CG base pairs at a terminus that is known to yield stronger binding. This is one reason for selecting cytidine for labeling. The results may aid rational design of multiple fluorescent DNA probes for nonradioactive detection of nucleic acids.

An integrated semiconductor device enabling non-optical genome sequencing.

PubMed

Rothberg, Jonathan M; Hinz, Wolfgang; Rearick, Todd M; Schultz, Jonathan; Mileski, William; Davey, Mel; Leamon, John H; Johnson, Kim; Milgrew, Mark J; Edwards, Matthew; Hoon, Jeremy; Simons, Jan F; Marran, David; Myers, Jason W; Davidson, John F; Branting, Annika; Nobile, John R; Puc, Bernard P; Light, David; Clark, Travis A; Huber, Martin; Branciforte, Jeffrey T; Stoner, Isaac B; Cawley, Simon E; Lyons, Michael; Fu, Yutao; Homer, Nils; Sedova, Marina; Miao, Xin; Reed, Brian; Sabina, Jeffrey; Feierstein, Erika; Schorn, Michelle; Alanjary, Mohammad; Dimalanta, Eileen; Dressman, Devin; Kasinskas, Rachel; Sokolsky, Tanya; Fidanza, Jacqueline A; Namsaraev, Eugeni; McKernan, Kevin J; Williams, Alan; Roth, G Thomas; Bustillo, James

2011-07-20

The seminal importance of DNA sequencing to the life sciences, biotechnology and medicine has driven the search for more scalable and lower-cost solutions. Here we describe a DNA sequencing technology in which scalable, low-cost semiconductor manufacturing techniques are used to make an integrated circuit able to directly perform non-optical DNA sequencing of genomes. Sequence data are obtained by directly sensing the ions produced by template-directed DNA polymerase synthesis using all-natural nucleotides on this massively parallel semiconductor-sensing device or ion chip. The ion chip contains ion-sensitive, field-effect transistor-based sensors in perfect register with 1.2 million wells, which provide confinement and allow parallel, simultaneous detection of independent sequencing reactions. Use of the most widely used technology for constructing integrated circuits, the complementary metal-oxide semiconductor (CMOS) process, allows for low-cost, large-scale production and scaling of the device to higher densities and larger array sizes. We show the performance of the system by sequencing three bacterial genomes, its robustness and scalability by producing ion chips with up to 10 times as many sensors and sequencing a human genome.

Novel molecular approach to define pest species status and tritrophic interactions from historical Bemisia specimens.

PubMed

Tay, W T; Elfekih, S; Polaszek, A; Court, L N; Evans, G A; Gordon, K H J; De Barro, P J

2017-03-27

Museum specimens represent valuable genomic resources for understanding host-endosymbiont/parasitoid evolutionary relationships, resolving species complexes and nomenclatural problems. However, museum collections suffer DNA degradation, making them challenging for molecular-based studies. Here, the mitogenomes of a single 1912 Sri Lankan Bemisia emiliae cotype puparium, and of a 1942 Japanese Bemisia puparium are characterised using a Next-Generation Sequencing approach. Whiteflies are small sap-sucking insects including B. tabaci pest species complex. Bemisia emiliae's draft mitogenome showed a high degree of homology with published B. tabaci mitogenomes, and exhibited 98-100% partial mitochondrial DNA Cytochrome Oxidase I (mtCOI) gene identity with the B. tabaci species known as Asia II-7. The partial mtCOI gene of the Japanese specimen shared 99% sequence identity with the Bemisia 'JpL' genetic group. Metagenomic analysis identified bacterial sequences in both Bemisia specimens, while hymenopteran sequences were also identified in the Japanese Bemisia puparium, including complete mtCOI and rRNA genes, and various partial mtDNA genes. At 88-90% mtCOI sequence identity to Aphelinidae wasps, we concluded that the 1942 Bemisia nymph was parasitized by an Eretmocerus parasitoid wasp. Our approach enables the characterisation of genomes and associated metagenomic communities of museum specimens using 1.5 ng gDNA, and to infer historical tritrophic relationships in Bemisia whiteflies.

Event-related potential correlates of declarative and non-declarative sequence knowledge.

PubMed

Ferdinand, Nicola K; Rünger, Dennis; Frensch, Peter A; Mecklinger, Axel

2010-07-01

The goal of the present study was to demonstrate that declarative and non-declarative knowledge acquired in an incidental sequence learning task contributes differentially to memory retrieval and leads to dissociable ERP signatures in a recognition memory task. For this purpose, participants performed a sequence learning task and were classified as verbalizers, partial verbalizers, or nonverbalizers according to their ability to verbally report the systematic response sequence. Thereafter, ERPs were recorded in a recognition memory task time-locked to sequence triplets that were either part of the previously learned sequence or not. Although all three groups executed old sequence triplets faster than new triplets in the recognition memory task, qualitatively distinct ERP patterns were found for participants with and without reportable knowledge. Verbalizers and, to a lesser extent, partial verbalizers showed an ERP correlate of recollection for parts of the incidentally learned sequence. In contrast, nonverbalizers showed a different ERP effect with a reverse polarity that might reflect priming. This indicates that an ensemble of qualitatively different processes is at work when declarative and non-declarative sequence knowledge is retrieved. By this, our findings favor a multiple-systems view postulating that explicit and implicit learning are supported by different and functionally independent systems. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

Using Partial Genomic Fosmid Libraries for Sequencing CompleteOrganellar Genomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

McNeal, Joel R.; Leebens-Mack, James H.; Arumuganathan, K.

2005-08-26

Organellar genome sequences provide numerous phylogenetic markers and yield insight into organellar function and molecular evolution. These genomes are much smaller in size than their nuclear counterparts; thus, their complete sequencing is much less expensive than total nuclear genome sequencing, making broader phylogenetic sampling feasible. However, for some organisms it is challenging to isolate plastid DNA for sequencing using standard methods. To overcome these difficulties, we constructed partial genomic libraries from total DNA preparations of two heterotrophic and two autotrophic angiosperm species using fosmid vectors. We then used macroarray screening to isolate clones containing large fragments of plastid DNA. Amore » minimum tiling path of clones comprising the entire genome sequence of each plastid was selected, and these clones were shotgun-sequenced and assembled into complete genomes. Although this method worked well for both heterotrophic and autotrophic plants, nuclear genome size had a dramatic effect on the proportion of screened clones containing plastid DNA and, consequently, the overall number of clones that must be screened to ensure full plastid genome coverage. This technique makes it possible to determine complete plastid genome sequences for organisms that defy other available organellar genome sequencing methods, especially those for which limited amounts of tissue are available.« less

Comparison of traditional phenotypic identification methods with partial 5' 16S rRNA gene sequencing for species-level identification of nonfermenting Gram-negative bacilli.

PubMed

Cloud, Joann L; Harmsen, Dag; Iwen, Peter C; Dunn, James J; Hall, Gerri; Lasala, Paul Rocco; Hoggan, Karen; Wilson, Deborah; Woods, Gail L; Mellmann, Alexander

2010-04-01

Correct identification of nonfermenting Gram-negative bacilli (NFB) is crucial for patient management. We compared phenotypic identifications of 96 clinical NFB isolates with identifications obtained by 5' 16S rRNA gene sequencing. Sequencing identified 88 isolates (91.7%) with >99% similarity to a sequence from the assigned species; 61.5% of sequencing results were concordant with phenotypic results, indicating the usability of sequencing to identify NFB.

Capturing the Temporal Sequence of Interaction in Young Siblings

PubMed Central

Steele, Fiona; Jenkins, Jennifer

2015-01-01

We explored whether young children exhibit subtypes of behavioral sequences during sibling interaction. Ten-minute, free-play observations of over 300 sibling dyads were coded for positivity, negativity and disengagement. The data were analyzed using growth mixture modeling (GMM). Younger (18-month-old) children’s temporal behavioral sequences showed a harmonious (53%) and a casual (47%) class. Older (approximately four-year-old) children’s behavior was more differentiated revealing a harmonious (25%), a deteriorating (31%), a recovery (22%) and a casual (22%) class. A more positive maternal affective climate was associated with more positive patterns. Siblings’ sequential behavioral patterns tended to be complementary rather than reciprocal in nature. The study illustrates a novel use of GMM and makes a theoretical contribution by showing that young children exhibit distinct types of temporal behavioral sequences that are related to parenting processes. PMID:25996957

Identification of the Bovine Arachnomelia Mutation by Massively Parallel Sequencing Implicates Sulfite Oxidase (SUOX) in Bone Development

PubMed Central

Drögemüller, Cord; Tetens, Jens; Sigurdsson, Snaevar; Gentile, Arcangelo; Testoni, Stefania; Lindblad-Toh, Kerstin; Leeb, Tosso

2010-01-01

Arachnomelia is a monogenic recessive defect of skeletal development in cattle. The causative mutation was previously mapped to a ∼7 Mb interval on chromosome 5. Here we show that array-based sequence capture and massively parallel sequencing technology, combined with the typical family structure in livestock populations, facilitates the identification of the causative mutation. We re-sequenced the entire critical interval in a healthy partially inbred cow carrying one copy of the critical chromosome segment in its ancestral state and one copy of the same segment with the arachnomelia mutation, and we detected a single heterozygous position. The genetic makeup of several partially inbred cattle provides extremely strong support for the causality of this mutation. The mutation represents a single base insertion leading to a premature stop codon in the coding sequence of the SUOX gene and is perfectly associated with the arachnomelia phenotype. Our findings suggest an important role for sulfite oxidase in bone development. PMID:20865119

New partial sequences of phosphoenolpyruvate carboxylase as molecular phylogenetic markers.

PubMed

Gehrig, H; Heute, V; Kluge, M

2001-08-01

To better understand the evolution of the enzyme phosphoenolpyruvate carboxylase (PEPC) and to test its versatility as a molecular character in phylogenetic and taxonomic studies, we have characterized and compared 70 new partial PEPC nucleotide and amino acid sequences (about 1100 bp of the 3' side of the gene) from 50 plant species (24 species of Bryophyta, 1 of Pteridophyta, and 25 of Spermatophyta). Together with previously published data, the new set of sequences allowed us to construct the up to now most complete phylogenetic tree of PEPC, where the PEPC sequences cluster according to both the taxonomic positions of the donor plants and the assumed specific function of the PEPC isoforms. Altogether, the study further strengthens the view that PEPC sequences can provide interesting information for the reconstruction of phylogenetic relations between organisms and metabolic pathways. To avoid confusion in future discussion, we propose a new nomenclature for the denotation of PEPC isoforms. Copyright 2001 Academic Press.

Intragenome Diversity of Gene Families Encoding Toxin-like Proteins in Venomous Animals.

PubMed

Rodríguez de la Vega, Ricardo C; Giraud, Tatiana

2016-11-01

The evolution of venoms is the story of how toxins arise and of the processes that generate and maintain their diversity. For animal venoms these processes include recruitment for expression in the venom gland, neofunctionalization, paralogous expansions, and functional divergence. The systematic study of these processes requires the reliable identification of the venom components involved in antagonistic interactions. High-throughput sequencing has the potential of uncovering the entire set of toxins in a given organism, yet the existence of non-venom toxin paralogs and the misleading effects of partial census of the molecular diversity of toxins make necessary to collect complementary evidence to distinguish true toxins from their non-venom paralogs. Here, we analyzed the whole genomes of two scorpions, one spider and one snake, aiming at the identification of the full repertoires of genes encoding toxin-like proteins. We classified the entire set of protein-coding genes into paralogous groups and monotypic genes, identified genes encoding toxin-like proteins based on known toxin families, and quantified their expression in both venom-glands and pooled tissues. Our results confirm that genes encoding toxin-like proteins are part of multigene families, and that these families arise by recruitment events from non-toxin genes followed by limited expansions of the toxin-like protein coding genes. We also show that failing to account for sequence similarity with non-toxin proteins has a considerable misleading effect that can be greatly reduced by comparative transcriptomics. Our study overall contributes to the understanding of the evolutionary dynamics of proteins involved in antagonistic interactions. © The Author 2016. Published by Oxford University Press on behalf of the Society for Integrative and Comparative Biology. All rights reserved. For permissions please email: journals.permissions@oup.com.

Rapid DNA Sequencing by Direct Nanoscale Reading of Nucleotide Bases on Individual DNA Chains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, James Weifu; Meller, Amit

2007-01-01

Since the independent invention of DNA sequencing by Sanger and by Gilbert 30 years ago, it has grown from a small scale technique capable of reading several kilobase-pair of sequence per day into today's multibillion dollar industry. This growth has spurred the development of new sequencing technologies that do not involve either electrophoresis or Sanger sequencing chemistries. Sequencing by Synthesis (SBS) involves multiple parallel micro-sequencing addition events occurring on a surface, where data from each round is detected by imaging. New High Throughput Technologies for DNA Sequencing and Genomics is the second volume in the Perspectives in Bioanalysis series, whichmore » looks at the electroanalytical chemistry of nucleic acids and proteins, development of electrochemical sensors and their application in biomedicine and in the new fields of genomics and proteomics. The authors have expertly formatted the information for a wide variety of readers, including new developments that will inspire students and young scientists to create new tools for science and medicine in the 21st century. Reviews of complementary developments in Sanger and SBS sequencing chemistries, capillary electrophoresis and microdevice integration, MS sequencing and applications set the framework for the book.« less

Oligonucleoside alkyl or arylphosphonate derivatives capable of crosslinking with or cleaving nucleic acids

DOEpatents

Miller, P.S.; Ts'o, P.O.P.

1999-06-15

A composition for inactivating a target nucleic acid which comprises an oligonucleoside alkyl or arylphosphonate analogue which is complementary to the sequence of the target nucleic acid is provided. It includes a functional group which reacts with the target nucleic acid to render the target nucleic acid inactive or nonfunctional. 16 figs.

Surface-enhanced Raman scattering detection of DNA derived from the West Nile virus genome using magnetic capture of Raman-active gold nanoparticles

USDA-ARS?s Scientific Manuscript database

A model paramagnetic nanoparticle (MNP) assay is demonstrated for surface-enhanced Raman scattering (SERS) detection of DNA oligonucleotides derived from the West Nile virus (WNV) genome. Detection is based on the capture of WNV target sequences by hybridization with complementary oligonucleotide pr...

Partial DNA-guided Cas9 enables genome editing with reduced off-target activity

PubMed Central

Yin, Hao; Song, Chun-Qing; Suresh, Sneha; Kwan, Suet-Yan; Wu, Qiongqiong; Walsh, Stephen; Ding, Junmei; Bogorad, Roman L; Zhu, Lihua Julie; Wolfe, Scot A; Koteliansky, Victor; Xue, Wen; Langer, Robert; Anderson, Daniel G

2018-01-01

CRISPR–Cas9 is a versatile RNA-guided genome editing tool. Here we demonstrate that partial replacement of RNA nucleotides with DNA nucleotides in CRISPR RNA (crRNA) enables efficient gene editing in human cells. This strategy of partial DNA replacement retains on-target activity when used with both crRNA and sgRNA, as well as with multiple guide sequences. Partial DNA replacement also works for crRNA of Cpf1, another CRISPR system. We find that partial DNA replacement in the guide sequence significantly reduces off-target genome editing through focused analysis of off-target cleavage, measurement of mismatch tolerance and genome-wide profiling of off-target sites. Using the structure of the Cas9–sgRNA complex as a guide, the majority of the 3′ end of crRNA can be replaced with DNA nucleotide, and the 5 - and 3′-DNA-replaced crRNA enables efficient genome editing. Cas9 guided by a DNA–RNA chimera may provide a generalized strategy to reduce both the cost and the off-target genome editing in human cells. PMID:29377001

Deep sequencing methods for protein engineering and design.

PubMed

Wrenbeck, Emily E; Faber, Matthew S; Whitehead, Timothy A

2017-08-01

The advent of next-generation sequencing (NGS) has revolutionized protein science, and the development of complementary methods enabling NGS-driven protein engineering have followed. In general, these experiments address the functional consequences of thousands of protein variants in a massively parallel manner using genotype-phenotype linked high-throughput functional screens followed by DNA counting via deep sequencing. We highlight the use of information rich datasets to engineer protein molecular recognition. Examples include the creation of multiple dual-affinity Fabs targeting structurally dissimilar epitopes and engineering of a broad germline-targeted anti-HIV-1 immunogen. Additionally, we highlight the generation of enzyme fitness landscapes for conducting fundamental studies of protein behavior and evolution. We conclude with discussion of technological advances. Copyright © 2016 Elsevier Ltd. All rights reserved.

Characterizing genomic alterations in cancer by complementary functional associations.

PubMed

Kim, Jong Wook; Botvinnik, Olga B; Abudayyeh, Omar; Birger, Chet; Rosenbluh, Joseph; Shrestha, Yashaswi; Abazeed, Mohamed E; Hammerman, Peter S; DiCara, Daniel; Konieczkowski, David J; Johannessen, Cory M; Liberzon, Arthur; Alizad-Rahvar, Amir Reza; Alexe, Gabriela; Aguirre, Andrew; Ghandi, Mahmoud; Greulich, Heidi; Vazquez, Francisca; Weir, Barbara A; Van Allen, Eliezer M; Tsherniak, Aviad; Shao, Diane D; Zack, Travis I; Noble, Michael; Getz, Gad; Beroukhim, Rameen; Garraway, Levi A; Ardakani, Masoud; Romualdi, Chiara; Sales, Gabriele; Barbie, David A; Boehm, Jesse S; Hahn, William C; Mesirov, Jill P; Tamayo, Pablo

2016-05-01

Systematic efforts to sequence the cancer genome have identified large numbers of mutations and copy number alterations in human cancers. However, elucidating the functional consequences of these variants, and their interactions to drive or maintain oncogenic states, remains a challenge in cancer research. We developed REVEALER, a computational method that identifies combinations of mutually exclusive genomic alterations correlated with functional phenotypes, such as the activation or gene dependency of oncogenic pathways or sensitivity to a drug treatment. We used REVEALER to uncover complementary genomic alterations associated with the transcriptional activation of β-catenin and NRF2, MEK-inhibitor sensitivity, and KRAS dependency. REVEALER successfully identified both known and new associations, demonstrating the power of combining functional profiles with extensive characterization of genomic alterations in cancer genomes.

In vitro isolation and molecular characterization of an Ehrlichia canis strain from São Paulo, Brazil

PubMed Central

Aguiar, Daniel M.; Hagiwara, Mitika K.; Labruna, Marcelo B.

2008-01-01

An Ehrlichia canis isolate was obtained from an naturally infected dog exhibiting clinical signs of ehrlichiosis in São Paulo Municipality, state of São Paulo, Brazil. The isolate was characterized by PCR and DNA sequencing of portions of the ehrlichial genes dsb, 16SrRNA, and p28. Partial dsb and 16S rRNA sequences were identical to three and five other E. canis strains, respectively, from different countries and continents (including North America, Africa, Asia and Europe). Conversely, the p28 partial sequence for this E. canis (São Paulo) differed by 1, 2, and 2 nucleotides from the corresponding sequences of the E. canis strains Jake (from USA), Oklahoma (USA), and VHE (Venezuela), respectively. The results in this study indicate that E. canis is the only recognized Ehrlichia species infecting dogs in Brazil. PMID:24031251

rpoB-Based Identification of Nonpigmented and Late-Pigmenting Rapidly Growing Mycobacteria

PubMed Central

Adékambi, Toïdi; Colson, Philippe; Drancourt, Michel

2003-01-01

Nonpigmented and late-pigmenting rapidly growing mycobacteria (RGM) are increasingly isolated in clinical microbiology laboratories. Their accurate identification remains problematic because classification is labor intensive work and because new taxa are not often incorporated into classification databases. Also, 16S rRNA gene sequence analysis underestimates RGM diversity and does not distinguish between all taxa. We determined the complete nucleotide sequence of the rpoB gene, which encodes the bacterial β subunit of the RNA polymerase, for 20 RGM type strains. After using in-house software which analyzes and graphically represents variability stretches of 60 bp along the nucleotide sequence, our analysis focused on a 723-bp variable region exhibiting 83.9 to 97% interspecies similarity and 0 to 1.7% intraspecific divergence. Primer pair Myco-F-Myco-R was designed as a tool for both PCR amplification and sequencing of this region for molecular identification of RGM. This tool was used for identification of 63 RGM clinical isolates previously identified at the species level on the basis of phenotypic characteristics and by 16S rRNA gene sequence analysis. Of 63 clinical isolates, 59 (94%) exhibited <2% partial rpoB gene sequence divergence from 1 of 20 species under study and were regarded as correctly identified at the species level. Mycobacterium abscessus and Mycobacterium mucogenicum isolates were clearly distinguished from Mycobacterium chelonae; Mycobacterium mageritense isolates were clearly distinguished from “Mycobacterium houstonense.” Four isolates were not identified at the species level because they exhibited >3% partial rpoB gene sequence divergence from the corresponding type strain; they belonged to three taxa related to M. mucogenicum, Mycobacterium smegmatis, and Mycobacterium porcinum. For M. abscessus and M. mucogenicum, this partial sequence yielded a high genetic heterogeneity within the clinical isolates. We conclude that molecular identification by analysis of the 723-bp rpoB sequence is a rapid and accurate tool for identification of RGM. PMID:14662964

Complete Genomic Sequence and Comparative Analysis of the Genome Segments of Sweet Potato Chlorotic Stunt Virus in China

PubMed Central

Qin, Yanhong; Wang, Li; Zhang, Zhenchen; Qiao, Qi; Zhang, Desheng; Tian, Yuting; Wang, Shuang; Wang, Yongjiang; Yan, Zhaoling

2014-01-01

Background Sweet potato chlorotic stunt virus (family Closteroviridae, genus Crinivirus) features a large bipartite, single-stranded, positive-sense RNA genome. To date, only three complete genomic sequences of SPCSV can be accessed through GenBank. SPCSV was first detected from China in 2011, only partial genomic sequences have been determined in the country. No report on the complete genomic sequence and genome structure of Chinese SPCSV isolates or the genetic relation between isolates from China and other countries is available. Methodology/Principal Findings The complete genomic sequences of five isolates from different areas in China were characterized. This study is the first to report the complete genome sequences of SPCSV from whitefly vectors. Genome structure analysis showed that isolates of WA and EA strains from China have the same coding protein as isolates Can181-9 and m2-47, respectively. Twenty cp genes and four RNA1 partial segments were sequenced and analyzed, and the nucleotide identities of complete genomic, cp, and RNA1 partial sequences were determined. Results indicated high conservation among strains and significant differences between WA and EA strains. Genetic analysis demonstrated that, except for isolates from Guangdong Province, SPCSVs from other areas belong to the WA strain. Genome organization analysis showed that the isolates in this study lack the p22 gene. Conclusions/Significance We presented the complete genome sequences of SPCSV in China. Comparison of nucleotide identities and genome structures between these isolates and previously reported isolates showed slight differences. The nucleotide identities of different SPCSV isolates showed high conservation among strains and significant differences between strains. All nine isolates in this study lacked p22 gene. WA strains were more extensively distributed than EA strains in China. These data provide important insights into the molecular variation and genomic structure of SPCSV in China as well as genetic relationships among isolates from China and other countries. PMID:25170926

Somatic association of telocentric chromosomes carrying homologous centromeres in common wheat.

PubMed

Mello-Sampayo, T

1973-01-01

Measurements of distances between telocentric chromosomes, either homologous or representing the opposite arms of a metacentric chromosome (complementary telocentrics), were made at metaphase in root tip cells of common wheat carrying two homologous pairs of complementary telocentrics of chromosome 1 B or 6 B (double ditelosomic 1 B or 6 B). The aim was to elucidate the relative locations of the telocentric chromosomes within the cell. The data obtained strongly suggest that all four telocentrics of chromosome 1 B or 6 B are spacially and simultaneously co-associated. In plants carrying two complementary (6 B (S) and 6 B (L)) and a non-related (5 B (L)) telocentric, only the complementary chromosomes were found to be somatically associated. It is thought, therefore, that the somatic association of chromosomes may involve more than two chromosomes in the same association and, since complementary telocentrics are as much associated as homologous, that the homology between centromeres (probably the only homologous region that exists between complementary telocentrics) is a very important condition for somatic association of chromosomes. The spacial arrangement of chromosomes was studied at anaphase and prophase and the polar orientation of chromosomes at prophase was found to resemble anaphase orientation. This was taken as good evidence for the maintenance of the chromosome arrangement - the Rabl orientation - and of the peripheral location of the centromere and its association with the nuclear membrane. Within this general arrangement homologous telocentric chromosomes were frequently seen to have their centromeres associated or directed towards each other. The role of the centromere in somatic association as a spindle fibre attachment and chromosome binder is discussed. It is suggested that for non-homologous chromosomes to become associated in root tips, the only requirement needed should be the homology of centromeres such as exists between complementary telocentrics, or, as a possible alternative, common repeated sequences of DNA molecules around the centromere region.

Generation of RNA in abiotic conditions.

NASA Astrophysics Data System (ADS)

di Mauro, Ernesto

Generation of RNA in abiotic conditions. Ernesto Di Mauro Dipartimento di Genetica Bi-ologia Molecolare, Universit` "Sapienza" Roma, Italy. a At least four conditions must be satisfied for the spontaneous generation of (pre)-genetic poly-mers: 1) availability of precursors that are activated enough to spontaneously polymerize. Preliminary studies showed that (a) nucleic bases and acyclonucleosides can be synthesized from formamide H2NCOH by simply heating with prebiotically available mineral catalysts [last reviewed in (1)], and that b) nucleic bases can be phosphorylated in every possible posi-tion [2'; 3'; 5'; cyclic 2',3'; cyclic 3',5' (2)]. The higher stability of the cyclic forms allows their accumulation. 2) A polymerization mechanism. A reaction showing the formation of RNA polymers starting from prebiotically plausible precursors (3',5' cyclic GMP and 3', 5'cyclic AMP) was recently reported (3). Polymerization in these conditions is thermodynamically up-hill and an equilibrium is attained that limits the maximum length of the polymer produced to about 40 nucleotides for polyG and 100 nucleotides for polyA. 3) Ligation of the synthesized oligomers. If this type of reaction could occur according to a terminal-joining mechanism and could generate canonical 3',5' phosphodiester bonds, exponential growth would be obtained of the generated oligomers. This type of reaction has been reported (4) , limited to homogeneous polyA sequences and leading to the production of polyA dimers and tetramers. What is still missing are: 4) mechanisms that provide the proof of principle for the generation of sequence complexity. We will show evidence for two mechanisms providing this proof of principle for simple complementary sequences. Namely: abiotic sequence complementary-driven terminal ligation and sequence-complementary terminal growth. In conclusion: all the steps leading to the generation of RNA in abiotic conditions are satisfied. (1) R Saladino, C Crestini, F. Ciciriello, S. Pino, G. Costanzo, E. Di Mauro. From formamide to RNA: the roles of formamide and water in the evolution of chemical information. Research In Microbiology, Special Issue on The Origin of life and Microbiology (2009) 160:441-448. (2) Costanzo, G., Saladino, R., Crestini, C., Ciciriello, F., and Di Mauro, E. Nucleoside phos-phorylation by phosphate minerals. J. Biol. Chem. (2007) 282: 16729-16735. (3) Samanta Pino, Fabiana Ciciriello, Giovanna Costanzo and E. Di Mauro, Nonenzymatic RNA Ligation in Water J. Biol. Chem. (2008), 283: 36494-36503 (4) Costanzo, G., Pino, S., Ciciriello, F., and Di Mauro, E. Generation of long RNA chains in water. J Biol Chem. (2009) 284:33206-33216.

Algebraic Methods to Design Signals

DTIC Science & Technology

2015-08-27

sequence pairs with optimal correlation values. 5. K.T. Arasu, Pradeep Bansal , Cody Watson, Partially balanced incomplete block designs with two...IEEE Transactions Information Theory, Volume: 58, Issue: 11, Nov 2012, Page(s): 6968 – 6978 5. K.T. Arasu, Pradeep Bansal , Cody Watson, Partially

In vivo, Argonaute-bound microRNAs exist predominantly in a reservoir of low molecular weight complexes not associated with mRNA

PubMed Central

La Rocca, Gaspare; Olejniczak, Scott H.; González, Alvaro J.; Briskin, Daniel; Vidigal, Joana A.; Spraggon, Lee; DeMatteo, Raymond G.; Radler, Megan R.; Lindsten, Tullia; Ventura, Andrea; Tuschl, Thomas; Leslie, Christina S.; Thompson, Craig B.

2015-01-01

MicroRNAs repress mRNA translation by guiding Argonaute proteins to partially complementary binding sites, primarily within the 3′ untranslated region (UTR) of target mRNAs. In cell lines, Argonaute-bound microRNAs exist mainly in high molecular weight RNA-induced silencing complexes (HMW-RISC) associated with target mRNA. Here we demonstrate that most adult tissues contain reservoirs of microRNAs in low molecular weight RISC (LMW-RISC) not bound to mRNA, suggesting that these microRNAs are not actively engaged in target repression. Consistent with this observation, the majority of individual microRNAs in primary T cells were enriched in LMW-RISC. During T-cell activation, signal transduction through the phosphoinositide-3 kinase–RAC-alpha serine/threonine-protein kinase–mechanistic target of rapamycin pathway increased the assembly of microRNAs into HMW-RISC, enhanced expression of the glycine-tryptophan protein of 182 kDa, an essential component of HMW-RISC, and improved the ability of microRNAs to repress partially complementary reporters, even when expression of targeting microRNAs did not increase. Overall, data presented here demonstrate that microRNA-mediated target repression in nontransformed cells depends not only on abundance of specific microRNAs, but also on regulation of RISC assembly by intracellular signaling. PMID:25568082

Temporal lobe dual pathology in malignant migrating partial seizures in infancy.

PubMed

Coppola, Giangennaro; Operto, Francesca Felicia; Auricchio, Gianfranca; D'Amico, Alessandra; Fortunato, Delia; Pascotto, Antonio

2007-06-01

A child had the characteristic clinical and EEG pattern of migrating partial seizures in infancy with left temporal lobe atrophy, hippocampal sclerosis and cortical-subcortical blurring. Seizures were drug-resistant, with recurring episodes of status epilepticus. The child developed microcephaly with arrest of psychomotor development. Focal brain lesions, in the context of migrating partial seizures, have not been previously reported.[Published with video sequences].

A Systematic Bayesian Integration of Epidemiological and Genetic Data

PubMed Central

Lau, Max S. Y.; Marion, Glenn; Streftaris, George; Gibson, Gavin

2015-01-01

Genetic sequence data on pathogens have great potential to inform inference of their transmission dynamics ultimately leading to better disease control. Where genetic change and disease transmission occur on comparable timescales additional information can be inferred via the joint analysis of such genetic sequence data and epidemiological observations based on clinical symptoms and diagnostic tests. Although recently introduced approaches represent substantial progress, for computational reasons they approximate genuine joint inference of disease dynamics and genetic change in the pathogen population, capturing partially the joint epidemiological-evolutionary dynamics. Improved methods are needed to fully integrate such genetic data with epidemiological observations, for achieving a more robust inference of the transmission tree and other key epidemiological parameters such as latent periods. Here, building on current literature, a novel Bayesian framework is proposed that infers simultaneously and explicitly the transmission tree and unobserved transmitted pathogen sequences. Our framework facilitates the use of realistic likelihood functions and enables systematic and genuine joint inference of the epidemiological-evolutionary process from partially observed outbreaks. Using simulated data it is shown that this approach is able to infer accurately joint epidemiological-evolutionary dynamics, even when pathogen sequences and epidemiological data are incomplete, and when sequences are available for only a fraction of exposures. These results also characterise and quantify the value of incomplete and partial sequence data, which has important implications for sampling design, and demonstrate the abilities of the introduced method to identify multiple clusters within an outbreak. The framework is used to analyse an outbreak of foot-and-mouth disease in the UK, enhancing current understanding of its transmission dynamics and evolutionary process. PMID:26599399

FA-SAT Is an Old Satellite DNA Frozen in Several Bilateria Genomes

PubMed Central

Chaves, Raquel; Ferreira, Daniela; Mendes-da-Silva, Ana; Meles, Susana; Adega, Filomena

2017-01-01

Abstract In recent years, a growing body of evidence has recognized the tandem repeat sequences, and specifically satellite DNA, as a functional class of sequences in the genomic “dark matter.” Using an original, complementary, and thus an eclectic experimental design, we show that the cat archetypal satellite DNA sequence, FA-SAT, is “frozen” conservatively in several Bilateria genomes. We found different genomic FA-SAT architectures, and the interspersion pattern was conserved. In Carnivora genomes, the FA-SAT-related sequences are also amplified, with the predominance of a specific FA-SAT variant, at the heterochromatic regions. We inspected the cat genome project to locate FA-SAT array flanking regions and revealed an intensive intermingling with transposable elements. Our results also show that FA-SAT-related sequences are transcribed and that the most abundant FA-SAT variant is not always the most transcribed. We thus conclude that the DNA sequences of FA-SAT and their transcripts are “frozen” in these genomes. Future work is needed to disclose any putative function that these sequences may play in these genomes. PMID:29608678

Using nearly full-genome HIV sequence data improves phylogeny reconstruction in a simulated epidemic

PubMed Central

Yebra, Gonzalo; Hodcroft, Emma B.; Ragonnet-Cronin, Manon L.; Pillay, Deenan; Brown, Andrew J. Leigh; Fraser, Christophe; Kellam, Paul; de Oliveira, Tulio; Dennis, Ann; Hoppe, Anne; Kityo, Cissy; Frampton, Dan; Ssemwanga, Deogratius; Tanser, Frank; Keshani, Jagoda; Lingappa, Jairam; Herbeck, Joshua; Wawer, Maria; Essex, Max; Cohen, Myron S.; Paton, Nicholas; Ratmann, Oliver; Kaleebu, Pontiano; Hayes, Richard; Fidler, Sarah; Quinn, Thomas; Novitsky, Vladimir; Haywards, Andrew; Nastouli, Eleni; Morris, Steven; Clark, Duncan; Kozlakidis, Zisis

2016-01-01

HIV molecular epidemiology studies analyse viral pol gene sequences due to their availability, but whole genome sequencing allows to use other genes. We aimed to determine what gene(s) provide(s) the best approximation to the real phylogeny by analysing a simulated epidemic (created as part of the PANGEA_HIV project) with a known transmission tree. We sub-sampled a simulated dataset of 4662 sequences into different combinations of genes (gag-pol-env, gag-pol, gag, pol, env and partial pol) and sampling depths (100%, 60%, 20% and 5%), generating 100 replicates for each case. We built maximum-likelihood trees for each combination using RAxML (GTR + Γ), and compared their topologies to the corresponding true tree’s using CompareTree. The accuracy of the trees was significantly proportional to the length of the sequences used, with the gag-pol-env datasets showing the best performance and gag and partial pol sequences showing the worst. The lowest sampling depths (20% and 5%) greatly reduced the accuracy of tree reconstruction and showed high variability among replicates, especially when using the shortest gene datasets. In conclusion, using longer sequences derived from nearly whole genomes will improve the reliability of phylogenetic reconstruction. With low sample coverage, results can be highly variable, particularly when based on short sequences. PMID:28008945

Using nearly full-genome HIV sequence data improves phylogeny reconstruction in a simulated epidemic.

PubMed

Yebra, Gonzalo; Hodcroft, Emma B; Ragonnet-Cronin, Manon L; Pillay, Deenan; Brown, Andrew J Leigh

2016-12-23

HIV molecular epidemiology studies analyse viral pol gene sequences due to their availability, but whole genome sequencing allows to use other genes. We aimed to determine what gene(s) provide(s) the best approximation to the real phylogeny by analysing a simulated epidemic (created as part of the PANGEA_HIV project) with a known transmission tree. We sub-sampled a simulated dataset of 4662 sequences into different combinations of genes (gag-pol-env, gag-pol, gag, pol, env and partial pol) and sampling depths (100%, 60%, 20% and 5%), generating 100 replicates for each case. We built maximum-likelihood trees for each combination using RAxML (GTR + Γ), and compared their topologies to the corresponding true tree's using CompareTree. The accuracy of the trees was significantly proportional to the length of the sequences used, with the gag-pol-env datasets showing the best performance and gag and partial pol sequences showing the worst. The lowest sampling depths (20% and 5%) greatly reduced the accuracy of tree reconstruction and showed high variability among replicates, especially when using the shortest gene datasets. In conclusion, using longer sequences derived from nearly whole genomes will improve the reliability of phylogenetic reconstruction. With low sample coverage, results can be highly variable, particularly when based on short sequences.

Quantiprot - a Python package for quantitative analysis of protein sequences.

PubMed

Konopka, Bogumił M; Marciniak, Marta; Dyrka, Witold

2017-07-17

The field of protein sequence analysis is dominated by tools rooted in substitution matrices and alignments. A complementary approach is provided by methods of quantitative characterization. A major advantage of the approach is that quantitative properties defines a multidimensional solution space, where sequences can be related to each other and differences can be meaningfully interpreted. Quantiprot is a software package in Python, which provides a simple and consistent interface to multiple methods for quantitative characterization of protein sequences. The package can be used to calculate dozens of characteristics directly from sequences or using physico-chemical properties of amino acids. Besides basic measures, Quantiprot performs quantitative analysis of recurrence and determinism in the sequence, calculates distribution of n-grams and computes the Zipf's law coefficient. We propose three main fields of application of the Quantiprot package. First, quantitative characteristics can be used in alignment-free similarity searches, and in clustering of large and/or divergent sequence sets. Second, a feature space defined by quantitative properties can be used in comparative studies of protein families and organisms. Third, the feature space can be used for evaluating generative models, where large number of sequences generated by the model can be compared to actually observed sequences.

Progress in ion torrent semiconductor chip based sequencing.

PubMed

Merriman, Barry; Rothberg, Jonathan M

2012-12-01

In order for next-generation sequencing to become widely used as a diagnostic in the healthcare industry, sequencing instrumentation will need to be mass produced with a high degree of quality and economy. One way to achieve this is to recast DNA sequencing in a format that fully leverages the manufacturing base created for computer chips, complementary metal-oxide semiconductor chip fabrication, which is the current pinnacle of large scale, high quality, low-cost manufacturing of high technology. To achieve this, ideally the entire sensory apparatus of the sequencer would be embodied in a standard semiconductor chip, manufactured in the same fab facilities used for logic and memory chips. Recently, such a sequencing chip, and the associated sequencing platform, has been developed and commercialized by Ion Torrent, a division of Life Technologies, Inc. Here we provide an overview of this semiconductor chip based sequencing technology, and summarize the progress made since its commercial introduction. We described in detail the progress in chip scaling, sequencing throughput, read length, and accuracy. We also summarize the enhancements in the associated platform, including sample preparation, data processing, and engagement of the broader development community through open source and crowdsourcing initiatives. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

"Maxillary lateral incisor partial anodontia sequence": a clinical entity with epigenetic origin.

PubMed

Consolaro, Alberto; Cardoso, Maurício Almeida; Consolaro, Renata Bianco

2017-01-01

The relationship between maxillary lateral incisor anodontia and the palatal displacement of unerupted maxillary canines cannot be considered as a multiple tooth abnormality with defined genetic etiology in order to be regarded as a "syndrome". Neither were the involved genes identified and located in the human genome, nor was it presumed on which chromosome the responsible gene would be located. The palatal maxillary canine displacement in cases of partial anodontia of the maxillary lateral incisor is potentially associated with environmental changes caused by its absence in its place of formation and eruption, which would characterize an epigenetic etiology. The lack of the maxillary lateral incisor in the canine region means removing one of the reference guides for the eruptive trajectory of the maxillary canine, which would therefore, not erupt and /or impact on the palate. Consequently, and in sequence, it would lead to malocclusion, maxillary atresia, transposition, prolonged retention of the deciduous canine and resorption in the neighboring teeth. Thus, we can say that we are dealing with a set of anomalies and multiple sequential changes known as sequential development anomalies or, simply, sequence. Once the epigenetics and sequential condition is accepted for this clinical picture, it could be called "Maxillary Lateral Incisor Partial Anodontia Sequence."

Tagging partially reconstructed objects with jet substructure

DOE PAGES

Freytsis, Marat; Volansky, Tomer; Walsh, Jonathan R.

2016-08-24

Here, we present a new tagger which aims at identifying partially reconstructed objects, in which only some of the constituents are collected in a single jet. As an example, we also focus on top decays in which either part of the hadronically decaying W or the b jet is soft or falls outside of the top jet cone. Furthermore, we construct an observable to identify remnant substructure from the decay and employ aggressive jet grooming to reject QCD backgrounds. The tagger is complementary to existing ones and works well in the intermediate boost regime where jet substructure techniques usually fail.more » It is anticipated that a similar tagger can be used to identify non-QCD hadronic jets, such as those expected from hidden valleys.« less

Complementary Constrains on Component based Multiphase Flow Problems, Should It Be Implemented Locally or Globally?

NASA Astrophysics Data System (ADS)

Shao, H.; Huang, Y.; Kolditz, O.

2015-12-01

Multiphase flow problems are numerically difficult to solve, as it often contains nonlinear Phase transition phenomena A conventional technique is to introduce the complementarity constraints where fluid properties such as liquid saturations are confined within a physically reasonable range. Based on such constraints, the mathematical model can be reformulated into a system of nonlinear partial differential equations coupled with variational inequalities. They can be then numerically handled by optimization algorithms. In this work, two different approaches utilizing the complementarity constraints based on persistent primary variables formulation[4] are implemented and investigated. The first approach proposed by Marchand et.al[1] is using "local complementary constraints", i.e. coupling the constraints with the local constitutive equations. The second approach[2],[3] , namely the "global complementary constrains", applies the constraints globally with the mass conservation equation. We will discuss how these two approaches are applied to solve non-isothermal componential multiphase flow problem with the phase change phenomenon. Several benchmarks will be presented for investigating the overall numerical performance of different approaches. The advantages and disadvantages of different models will also be concluded. References[1] E.Marchand, T.Mueller and P.Knabner. Fully coupled generalized hybrid-mixed finite element approximation of two-phase two-component flow in porous media. Part I: formulation and properties of the mathematical model, Computational Geosciences 17(2): 431-442, (2013). [2] A. Lauser, C. Hager, R. Helmig, B. Wohlmuth. A new approach for phase transitions in miscible multi-phase flow in porous media. Water Resour., 34,(2011), 957-966. [3] J. Jaffré, and A. Sboui. Henry's Law and Gas Phase Disappearance. Transp. Porous Media. 82, (2010), 521-526. [4] A. Bourgeat, M. Jurak and F. Smaï. Two-phase partially miscible flow and transport modeling in porous media : application to gas migration in a nuclear waste repository, Comp.Geosciences. (2009), Volume 13, Number 1, 29-42.

Peak-to-average power ratio reduction in orthogonal frequency division multiplexing-based visible light communication systems using a modified partial transmit sequence technique

NASA Astrophysics Data System (ADS)

Liu, Yan; Deng, Honggui; Ren, Shuang; Tang, Chengying; Qian, Xuewen

2018-01-01

We propose an efficient partial transmit sequence technique based on genetic algorithm and peak-value optimization algorithm (GAPOA) to reduce high peak-to-average power ratio (PAPR) in visible light communication systems based on orthogonal frequency division multiplexing (VLC-OFDM). By analysis of hill-climbing algorithm's pros and cons, we propose the POA with excellent local search ability to further process the signals whose PAPR is still over the threshold after processed by genetic algorithm (GA). To verify the effectiveness of the proposed technique and algorithm, we evaluate the PAPR performance and the bit error rate (BER) performance and compare them with partial transmit sequence (PTS) technique based on GA (GA-PTS), PTS technique based on genetic and hill-climbing algorithm (GH-PTS), and PTS based on shuffled frog leaping algorithm and hill-climbing algorithm (SFLAHC-PTS). The results show that our technique and algorithm have not only better PAPR performance but also lower computational complexity and BER than GA-PTS, GH-PTS, and SFLAHC-PTS technique.

Guiding principles for peptide nanotechnology through directed discovery.

PubMed

Lampel, A; Ulijn, R V; Tuttle, T

2018-05-21

Life's diverse molecular functions are largely based on only a small number of highly conserved building blocks - the twenty canonical amino acids. These building blocks are chemically simple, but when they are organized in three-dimensional structures of tremendous complexity, new properties emerge. This review explores recent efforts in the directed discovery of functional nanoscale systems and materials based on these same amino acids, but that are not guided by copying or editing biological systems. The review summarises insights obtained using three complementary approaches of searching the sequence space to explore sequence-structure relationships for assembly, reactivity and complexation, namely: (i) strategic editing of short peptide sequences; (ii) computational approaches to predicting and comparing assembly behaviours; (iii) dynamic peptide libraries that explore the free energy landscape. These approaches give rise to guiding principles on controlling order/disorder, complexation and reactivity by peptide sequence design.

SxtA gene sequence analysis of dinoflagellate Alexandrium minutum

NASA Astrophysics Data System (ADS)

Norshaha, Safida Anira; Latib, Norhidayu Abdul; Usup, Gires; Yusof, Nurul Yuziana Mohd

2015-09-01

The dinoflagellate Alexandrium minutum is typically known for the production of potent neurotoxins such as saxitoxin, affecting the health of human seafood consumers via paralytic shellfish poisoning (PSP). These phenomena is related to the harmful algal blooms (HABs) that is believed to be influenced by environmental and nutritional factors. Previous study has revealed that SxtA gene is a starting gene that involved in the saxitoxin production pathway. The aim of this study was to analyse the sequence of the sxtA gene in A. minutum. The dinoflagellates culture was cultured at temperature 26°C with 16:8-hour light:dark photocycle. After the samples were harvested, RNA was extracted, complementary DNA (cDNA) was synthesised and amplified by polymerase chain reaction (PCR). The PCR products were then purified and cloned before sequenced. The SxtA sequence obtained was then analyzed in order to identify the presence of SxtA gene in Alexandrium minutum.

Studying Epigenetic DNA Modifications in Undergraduate Laboratories Using Complementary Bioinformatic and Molecular Approaches

ERIC Educational Resources Information Center

Militello, Kevin T.

2013-01-01

Epigenetic inheritance is the inheritance of genetic information that is not based on DNA sequence alone. One type of epigenetic information that has come to the forefront in the last few years is modified DNA bases. The most common modified DNA base in nature is 5-methylcytosine. Herein, we describe a laboratory experiment that combines…

Blue light photoreceptors and methods of using the same

DOEpatents

Cashmore, Anthony Robert; Ahmad, Margaret; Lin, Chentao

1998-01-01

The invention features a substantially pure preparation of a nucleic acid encoding a HY4 or a HY4-related gene. The invention further features transgenic plants encoding a HY4 gene having a shorter stem than substantially homozygous wild type nontransgenic plants; and, transgenic plants comprising complementary HY4 sequences having a longer stem than substantially homozygous wild type nontransgenic plants.

Amplification of Chloroplast DNA Using the Polymerase Chain Reaction (PCR): A Practical Activity for Secondary School Students

ERIC Educational Resources Information Center

Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary

2006-01-01

We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…

Top-Down Hydrogen-Deuterium Exchange Analysis of Protein Structures Using Ultraviolet Photodissociation.

PubMed

Brodie, Nicholas I; Huguet, Romain; Zhang, Terry; Viner, Rosa; Zabrouskov, Vlad; Pan, Jingxi; Petrotchenko, Evgeniy V; Borchers, Christoph H

2018-03-06

Top-down hydrogen-deuterium exchange (HDX) analysis using electron capture or transfer dissociation Fourier transform mass spectrometry (FTMS) is a powerful method for the analysis of secondary structure of proteins in solution. The resolution of the method is a function of the degree of fragmentation of backbone bonds in the proteins. While fragmentation is usually extensive near the N- and C-termini, electron capture (ECD) or electron transfer dissociation (ETD) fragmentation methods sometimes lack good coverage of certain regions of the protein, most often in the middle of the sequence. Ultraviolet photodissociation (UVPD) is a recently developed fast-fragmentation technique, which provides extensive backbone fragmentation that can be complementary in sequence coverage to the aforementioned electron-based fragmentation techniques. Here, we explore the application of electrospray ionization (ESI)-UVPD FTMS on an Orbitrap Fusion Lumos Tribrid mass spectrometer to top-down HDX analysis of proteins. We have incorporated UVPD-specific fragment-ion types and fragment-ion mixtures into our isotopic envelope fitting software (HDX Match) for the top-down HDX analysis. We have shown that UVPD data is complementary to ETD, thus improving the overall resolution when used as a combined approach.

The Role of CRISPR-Cas Systems in Virulence of Pathogenic Bacteria

PubMed Central

Staals, Raymond H. J.; Endtz, Hubert P.; van Baarlen, Peter; van der Oost, John

2014-01-01

SUMMARY Clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) genes are present in many bacterial and archaeal genomes. Since the discovery of the typical CRISPR loci in the 1980s, well before their physiological role was revealed, their variable sequences have been used as a complementary typing tool in diagnostic, epidemiologic, and evolutionary analyses of prokaryotic strains. The discovery that CRISPR spacers are often identical to sequence fragments of mobile genetic elements was a major breakthrough that eventually led to the elucidation of CRISPR-Cas as an adaptive immunity system. Key elements of this unique prokaryotic defense system are small CRISPR RNAs that guide nucleases to complementary target nucleic acids of invading viruses and plasmids, generally followed by the degradation of the invader. In addition, several recent studies have pointed at direct links of CRISPR-Cas to regulation of a range of stress-related phenomena. An interesting example concerns a pathogenic bacterium that possesses a CRISPR-associated ribonucleoprotein complex that may play a dual role in defense and/or virulence. In this review, we describe recently reported cases of potential involvement of CRISPR-Cas systems in bacterial stress responses in general and bacterial virulence in particular. PMID:24600041

Isolation of complementary DNA clones encoding pathogenesis-related proteins P and Q, two acidic chitinases from tobacco.

PubMed Central

Payne, G; Ahl, P; Moyer, M; Harper, A; Beck, J; Meins, F; Ryals, J

1990-01-01

Complementary DNA clones encoding two isoforms of the acidic endochitinase (chitinase, EC 3.2.1.14) from tobacco were isolated. Comparison of amino acid sequences deduced from the cDNA clones and the sequence of peptides derived from purified proteins show that these clones encode the pathogenesis-related proteins PR-P and PR-Q. The cDNA inserts were not homologous to either the bacterial form of chitinase or the form from cucumber but shared significant homology to the basic form of chitinase from tobacco and bean. The acidic isoforms of tobacco chitinase did not contain the amino-terminal, cysteine-rich "hevein" domain found in the basic isoforms, indicating that this domain, which binds chitin, is not essential for chitinolytic activity. The accumulation of mRNA for the pathogenesis-related proteins PR-1, PR-R, PR-P, and PR-Q in Xanthi.nc tobacco leaves following infection with tobacco mosaic virus was measured by primer extension. The results indicate that the induction of these proteins during the local necrotic lesion response to the virus is coordinated at the mRNA level. Images PMID:2296608

The role of CRISPR-Cas systems in virulence of pathogenic bacteria.

PubMed

Louwen, Rogier; Staals, Raymond H J; Endtz, Hubert P; van Baarlen, Peter; van der Oost, John

2014-03-01

Clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) genes are present in many bacterial and archaeal genomes. Since the discovery of the typical CRISPR loci in the 1980s, well before their physiological role was revealed, their variable sequences have been used as a complementary typing tool in diagnostic, epidemiologic, and evolutionary analyses of prokaryotic strains. The discovery that CRISPR spacers are often identical to sequence fragments of mobile genetic elements was a major breakthrough that eventually led to the elucidation of CRISPR-Cas as an adaptive immunity system. Key elements of this unique prokaryotic defense system are small CRISPR RNAs that guide nucleases to complementary target nucleic acids of invading viruses and plasmids, generally followed by the degradation of the invader. In addition, several recent studies have pointed at direct links of CRISPR-Cas to regulation of a range of stress-related phenomena. An interesting example concerns a pathogenic bacterium that possesses a CRISPR-associated ribonucleoprotein complex that may play a dual role in defense and/or virulence. In this review, we describe recently reported cases of potential involvement of CRISPR-Cas systems in bacterial stress responses in general and bacterial virulence in particular.

Design of a sensitive aptasensor based on magnetic microbeads-assisted strand displacement amplification and target recycling.

PubMed

Li, Ying; Ji, Xiaoting; Song, Weiling; Guo, Yingshu

2013-04-03

A cross-circular amplification system for sensitive detection of adenosine triphosphate (ATP) in cancer cells was developed based on aptamer-target interaction, magnetic microbeads (MBs)-assisted strand displacement amplification and target recycling. Here we described a new recognition probe possessing two parts, the ATP aptamer and the extension part. The recognition probe was firstly immobilized on the surface of MBs and hybridized with its complementary sequence to form a duplex. When combined with ATP, the probe changed its conformation, revealing the extension part in single-strand form, which further served as a toehold for subsequent target recycling. The released complementary sequence of the probe acted as the catalyst of the MB-assisted strand displacement reaction. Incorporated with target recycling, a large amount of biotin-tagged MB complexes were formed to stimulate the generation of chemiluminescence (CL) signal in the presence of luminol and H2O2 by incorporating with streptavidin-HRP, reaching a detection limit of ATP as low as 6.1×10(-10)M. Moreover, sample assays of ATP in Ramos Burkitt's lymphoma B cells were performed, which confirmed the reliability and practicality of the protocol. Copyright © 2013 Elsevier B.V. All rights reserved.

Modeling the Behavior of an Underwater Acoustic Relative Positioning System Based on Complementary Set of Sequences

PubMed Central

Aparicio, Joaquín; Jiménez, Ana; Álvarez, Fernando J.; Ureña, Jesús; De Marziani, Carlos; Diego, Cristina

2011-01-01

The great variability usually found in underwater media makes modeling a challenging task, but helpful for better understanding or predicting the performance of future deployed systems. In this work, an underwater acoustic propagation model is presented. This model obtains the multipath structure by means of the ray tracing technique. Using this model, the behavior of a relative positioning system is presented. One of the main advantages of relative positioning systems is that only the distances between all the buoys are needed to obtain their positions. In order to obtain the distances, the propagation times of acoustic signals coded by Complementary Set of Sequences (CSS) are used. In this case, the arrival instants are obtained by means of correlation processes. The distances are then used to obtain the position of the buoys by means of the Multidimensional Scaling Technique (MDS). As an early example of an application using this relative positioning system, a tracking of the position of the buoys at different times is performed. With this tracking, the surface current of a particular region could be studied. The performance of the system is evaluated in terms of the distance from the real position to the estimated one. PMID:22247661

A label-free, PCR-free and signal-on electrochemical DNA biosensor for Leishmania major based on gold nanoleaves.

PubMed

Moradi, M; Sattarahmady, N; Rahi, A; Hatam, G R; Sorkhabadi, S M Rezayat; Heli, H

2016-12-01

Detection of leishmaniasis is important in clinical diagnoses. In the present study, identification of Leishmania parasites was performed by a label-free, PCR-free and signal-on ultrasensitive electrochemical DNA biosensor. Gold nanoleaves were firstly electrodeposited by an electrodeposition method using spermidine as a shape directing agent. The biosensor was fabricated by immobilization of a Leishmania major specific DNA probe onto gold nanoleaves, and methylene blue was employed as a marker. Hybridization of the complementary single stranded DNA sequence with the biosensor under the selected conditions was then investigated. The biosensor could detect a synthetic DNA target in a range of 1.0×10 -10 to 1.0×10 -19 molL -1 with a limit of detection of 1.8×10 -20 molL -1 , and genomic DNA in a range of 0.5-20ngμL -1 with a limit of detection of 0.07ngμL -1 . The biosensor could distinguish Leishmania major from a non-complementary-sequence oligonucleotide and the tropica species with a high selectivity. The biosensor was applicable to detect Leishmania major in patient samples. Copyright © 2016 Elsevier B.V. All rights reserved.

Biomimetic nanochannels based biosensor for ultrasensitive and label-free detection of nucleic acids.

PubMed

Sun, Zhongyue; Liao, Tangbin; Zhang, Yulin; Shu, Jing; Zhang, Hong; Zhang, Guo-Jun

2016-12-15

A very simple sensing device based on biomimetic nanochannels has been developed for label-free, ultrasensitive and highly sequence-specific detection of DNA. Probe DNA was modified on the inner wall of the nanochannel surface by layer-by-layer (LBL) assembly. After probe DNA immobilization, DNA detection was realized by monitoring the rectified ion current when hybridization occurred. Due to three dimensional (3D) nanoscale environment of the nanochannel, this special geometry dramatically increased the surface area of the nanochannel for immobilization of probe molecules on the inner-surface and enlarged contact area between probes and target-molecules. Thus, the unique sensor reached a reliable detection limit of 10 fM for target DNA. In addition, this DNA sensor could discriminate complementary DNA (c-DNA) from non-complementary DNA (nc-DNA), two-base mismatched DNA (2bm-DNA) and one-base mismatched DNA (1bm-DNA) with high specificity. Moreover, the nanochannel-based biosensor was also able to detect target DNA even in an interfering environment and serum samples. This approach will provide a novel biosensing platform for detection and discrimination of disease-related molecular targets and unknown sequence DNA. Copyright © 2016 Elsevier B.V. All rights reserved.

Citrus psorosis virus RNA 1 is of negative polarity and potentially encodes in its complementary strand a 24K protein of unknown function and 280K putative RNA dependent RNA polymerase.

PubMed

Naum-Onganía, Gabriela; Gago-Zachert, Selma; Peña, Eduardo; Grau, Oscar; Garcia, Maria Laura

2003-10-01

Citrus psorosis virus (CPsV), the type member of genus Ophiovirus, has three genomic RNAs. Complete sequencing of CPsV RNA 1 revealed a size of 8184 nucleotides and Northern blot hybridization with chain specific probes showed that its non-coding strand is preferentially encapsidated. The complementary strand of RNA 1 contains two open reading frames (ORFs) separated by a 109-nt intergenic region, one located near the 5'-end potentially encoding a 24K protein of unknown function, and another of 280K containing the core polymerase motifs characteristic of viral RNA-dependent RNA polymerases (RdRp). Comparison of the core RdRp motifs of negative-stranded RNA viruses, supports grouping CPsV, Ranunculus white mottle virus (RWMV) and Mirafiori lettuce virus (MiLV) within the same genus (Ophiovirus), constituting a monophyletic group separated from all other negative-stranded RNA viruses. Furthermore, RNAs 1 of MiLV, CPsV and RWMV are similar in size and those of MiLV and CPsV also in genomic organization and sequence.

Degradation of Serotonin N-Acetyltransferase, a Circadian Regulator, by the N-end Rule Pathway.

PubMed

Wadas, Brandon; Borjigin, Jimo; Huang, Zheping; Oh, Jang-Hyun; Hwang, Cheol-Sang; Varshavsky, Alexander

2016-08-12

Serotonin N-acetyltransferase (AANAT) converts serotonin to N-acetylserotonin (NAS), a distinct biological regulator and the immediate precursor of melatonin, a circulating hormone that influences circadian processes, including sleep. N-terminal sequences of AANAT enzymes vary among vertebrates. Mechanisms that regulate the levels of AANAT are incompletely understood. Previous findings were consistent with the possibility that AANAT may be controlled through its degradation by the N-end rule pathway. By expressing the rat and human AANATs and their mutants not only in mammalian cells but also in the yeast Saccharomyces cerevisiae, and by taking advantage of yeast genetics, we show here that two "complementary" forms of rat AANAT are targeted for degradation by two "complementary" branches of the N-end rule pathway. Specifically, the N(α)-terminally acetylated (Nt-acetylated) Ac-AANAT is destroyed through the recognition of its Nt-acetylated N-terminal Met residue by the Ac/N-end rule pathway, whereas the non-Nt-acetylated AANAT is targeted by the Arg/N-end rule pathway, which recognizes the unacetylated N-terminal Met-Leu sequence of rat AANAT. We also show, by constructing lysine-to-arginine mutants of rat AANAT, that its degradation is mediated by polyubiquitylation of its Lys residue(s). Human AANAT, whose N-terminal sequence differs from that of rodent AANATs, is longer-lived than its rat counterpart and appears to be refractory to degradation by the N-end rule pathway. Together, these and related results indicate both a major involvement of the N-end rule pathway in the control of rodent AANATs and substantial differences in the regulation of rodent and human AANATs that stem from differences in their N-terminal sequences. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Correction for Eddy Current-Induced Echo-Shifting Effect in Partial-Fourier Diffusion Tensor Imaging.

PubMed

Truong, Trong-Kha; Song, Allen W; Chen, Nan-Kuei

2015-01-01

In most diffusion tensor imaging (DTI) studies, images are acquired with either a partial-Fourier or a parallel partial-Fourier echo-planar imaging (EPI) sequence, in order to shorten the echo time and increase the signal-to-noise ratio (SNR). However, eddy currents induced by the diffusion-sensitizing gradients can often lead to a shift of the echo in k-space, resulting in three distinct types of artifacts in partial-Fourier DTI. Here, we present an improved DTI acquisition and reconstruction scheme, capable of generating high-quality and high-SNR DTI data without eddy current-induced artifacts. This new scheme consists of three components, respectively, addressing the three distinct types of artifacts. First, a k-space energy-anchored DTI sequence is designed to recover eddy current-induced signal loss (i.e., Type 1 artifact). Second, a multischeme partial-Fourier reconstruction is used to eliminate artificial signal elevation (i.e., Type 2 artifact) associated with the conventional partial-Fourier reconstruction. Third, a signal intensity correction is applied to remove artificial signal modulations due to eddy current-induced erroneous T2(∗) -weighting (i.e., Type 3 artifact). These systematic improvements will greatly increase the consistency and accuracy of DTI measurements, expanding the utility of DTI in translational applications where quantitative robustness is much needed.

Correction for Eddy Current-Induced Echo-Shifting Effect in Partial-Fourier Diffusion Tensor Imaging

PubMed Central

Truong, Trong-Kha; Song, Allen W.; Chen, Nan-kuei

2015-01-01

In most diffusion tensor imaging (DTI) studies, images are acquired with either a partial-Fourier or a parallel partial-Fourier echo-planar imaging (EPI) sequence, in order to shorten the echo time and increase the signal-to-noise ratio (SNR). However, eddy currents induced by the diffusion-sensitizing gradients can often lead to a shift of the echo in k-space, resulting in three distinct types of artifacts in partial-Fourier DTI. Here, we present an improved DTI acquisition and reconstruction scheme, capable of generating high-quality and high-SNR DTI data without eddy current-induced artifacts. This new scheme consists of three components, respectively, addressing the three distinct types of artifacts. First, a k-space energy-anchored DTI sequence is designed to recover eddy current-induced signal loss (i.e., Type 1 artifact). Second, a multischeme partial-Fourier reconstruction is used to eliminate artificial signal elevation (i.e., Type 2 artifact) associated with the conventional partial-Fourier reconstruction. Third, a signal intensity correction is applied to remove artificial signal modulations due to eddy current-induced erroneous T 2 ∗-weighting (i.e., Type 3 artifact). These systematic improvements will greatly increase the consistency and accuracy of DTI measurements, expanding the utility of DTI in translational applications where quantitative robustness is much needed. PMID:26413505

Enterocin T, a novel class IIa bacteriocin produced by Enterococcus sp. 812.

PubMed

Chen, Yi-Sheng; Yu, Chi-Rong; Ji, Si-Hua; Liou, Min-Shiuan; Leong, Kun-Hon; Pan, Shwu-Fen; Wu, Hui-Chung; Lin, Yu-Hsuan; Yu, Bi; Yanagida, Fujitoshi

2013-09-01

Enterococcus sp. 812, isolated from fresh broccoli, was previously found to produce a bacteriocin active against a number of Gram-positive bacteria, including Listeria monocytogenes. Bacteriocin activity decreased slightly after autoclaving (121 °C for 15 min), but was inactivated by protease K. Mass spectrometry analysis revealed the bacteriocin mass to be approximately 4,521.34 Da. N-terminal amino acid sequencing yielded a partial sequence, NH2-ATYYGNGVYXDKKKXWVEWGQA, by Edman degradation, which contained the consensus class IIa bacteriocin motif YGNGV in the N-terminal region. The obtained partial sequence showed high homology with some enterococcal bacteriocins; however, no identical peptide or protein was found. This peptide was therefore considered to be a novel bacteriocin produced by Enterococcus sp. 812 and was termed enterocin T.

Pantoea hericii sp. nov., Isolated from the Fruiting Bodies of Hericium erinaceus.

PubMed

Rong, Chengbo; Ma, Yuanwei; Wang, Shouxian; Liu, Yu; Chen, Sanfeng; Huang, Bin; Wang, Jing; Xu, Feng

2016-06-01

Three Gram-negative, facultatively anaerobic bacterial isolates were obtained from the fruiting bodies of the edible mushroom Hericium erinaceus showing symptoms of soft rot disease in Beijing, China. Sequences of partial 16S rRNA gene placed these isolates in the genus Pantoea. Multilocus sequence analysis based on the partial sequences of atpD, gyrB, infB and rpoB revealed P. eucalypti and P. anthophila as their closest phylogenetic relatives and indicated that these isolates constituted a possible novel species. DNA-DNA hybridization studies confirmed the classification of these isolates as a novel species and phenotypic tests allowed for differentiation from the closest phylogenetic neighbours. The name Pantoea hericii sp. nov. [Type strain LMG 28847(T) = CGMCC 1.15224(T) = JZB 2120024(T)] is proposed.

Lactobacillus strain diversity based on partial hsp60 gene sequences and design of PCR-restriction fragment length polymorphism assays for species identification and differentiation.

PubMed

Blaiotta, Giuseppe; Fusco, Vincenzina; Ercolini, Danilo; Aponte, Maria; Pepe, Olimpia; Villani, Francesco

2008-01-01

A phylogenetic tree showing diversities among 116 partial (499-bp) Lactobacillus hsp60 (groEL, encoding a 60-kDa heat shock protein) nucleotide sequences was obtained and compared to those previously described for 16S rRNA and tuf gene sequences. The topology of the tree produced in this study showed a Lactobacillus species distribution similar, but not identical, to those previously reported. However, according to the most recent systematic studies, a clear differentiation of 43 single-species clusters was detected/identified among the sequences analyzed. The slightly higher variability of the hsp60 nucleotide sequences than of the 16S rRNA sequences offers better opportunities to design or develop molecular assays allowing identification and differentiation of either distant or very closely related Lactobacillus species. Therefore, our results suggest that hsp60 can be considered an excellent molecular marker for inferring the taxonomy and phylogeny of members of the genus Lactobacillus and that the chosen primers can be used in a simple PCR procedure allowing the direct sequencing of the hsp60 fragments. Moreover, in this study we performed a computer-aided restriction endonuclease analysis of all 499-bp hsp60 partial sequences and we showed that the PCR-restriction fragment length polymorphism (RFLP) patterns obtainable by using both endonucleases AluI and TacI (in separate reactions) can allow identification and differentiation of all 43 Lactobacillus species considered, with the exception of the pair L. plantarum/L. pentosus. However, the latter species can be differentiated by further analysis with Sau3AI or MseI. The hsp60 PCR-RFLP approach was efficiently applied to identify and to differentiate a total of 110 wild Lactobacillus strains (including closely related species, such as L. casei and L. rhamnosus or L. plantarum and L. pentosus) isolated from cheese and dry-fermented sausages.

Lactobacillus Strain Diversity Based on Partial hsp60 Gene Sequences and Design of PCR-Restriction Fragment Length Polymorphism Assays for Species Identification and Differentiation▿ †

PubMed Central

Blaiotta, Giuseppe; Fusco, Vincenzina; Ercolini, Danilo; Aponte, Maria; Pepe, Olimpia; Villani, Francesco

2008-01-01

A phylogenetic tree showing diversities among 116 partial (499-bp) Lactobacillus hsp60 (groEL, encoding a 60-kDa heat shock protein) nucleotide sequences was obtained and compared to those previously described for 16S rRNA and tuf gene sequences. The topology of the tree produced in this study showed a Lactobacillus species distribution similar, but not identical, to those previously reported. However, according to the most recent systematic studies, a clear differentiation of 43 single-species clusters was detected/identified among the sequences analyzed. The slightly higher variability of the hsp60 nucleotide sequences than of the 16S rRNA sequences offers better opportunities to design or develop molecular assays allowing identification and differentiation of either distant or very closely related Lactobacillus species. Therefore, our results suggest that hsp60 can be considered an excellent molecular marker for inferring the taxonomy and phylogeny of members of the genus Lactobacillus and that the chosen primers can be used in a simple PCR procedure allowing the direct sequencing of the hsp60 fragments. Moreover, in this study we performed a computer-aided restriction endonuclease analysis of all 499-bp hsp60 partial sequences and we showed that the PCR-restriction fragment length polymorphism (RFLP) patterns obtainable by using both endonucleases AluI and TacI (in separate reactions) can allow identification and differentiation of all 43 Lactobacillus species considered, with the exception of the pair L. plantarum/L. pentosus. However, the latter species can be differentiated by further analysis with Sau3AI or MseI. The hsp60 PCR-RFLP approach was efficiently applied to identify and to differentiate a total of 110 wild Lactobacillus strains (including closely related species, such as L. casei and L. rhamnosus or L. plantarum and L. pentosus) isolated from cheese and dry-fermented sausages. PMID:17993558

Capillary electrophoresis, a method for the determination of nucleic acid ligands covalently attached to quantum dots representing a donor of Förster resonance energy transfer.

PubMed

Datinská, Vladimíra; Klepárník, Karel; Belšánová, Barbora; Minárik, Marek; Foret, František

2018-05-09

The synthesis and determination of the structure of a Förster resonance energy transfer probe intended for the detection of specific nucleic acid sequences are described here. The probe is based on the hybridization of oligonucleotide modified quantum dots with a fluorescently labeled nucleic acid sample resulting in changes of the fluorescence emission due to the energy transfer effect. The stoichiometry distribution of oligonucleotides conjugated to quantum dots was determined by capillary electrophoresis separation. The results indicate that one to four molecules of oligonucleotide are conjugated to the surface of a single nanoparticle. This conclusion is confirmed by the course of the dependence of Förster resonance energy transfer efficiency on the concentration of fluorescently labeled complementary single-stranded nucleic acid, showing saturation. While the energy transfer efficiency of the probe hybridized with complementary nucleic acid strands was 30%, negligible efficiency was observed with a non-complementary strands. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Nucleotide sequence analysis of the gene encoding the Deinococcus radiodurans surface protein, derived amino acid sequence, and complementary protein chemical studies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Peters, J.; Peters, M.; Lottspeich, F.

1987-11-01

The complete nucleotide sequence of the gene encoding the surface (hexagonally packed intermediate (HPI))-layer polypeptide of Deinococcus radiodurans Sark was determined and found to encode a polypeptide of 1036 amino acids. Amino acid sequence analysis of about 30% of the residues revealed that the mature polypeptide consists of at least 978 amino acids. The N terminus was blocked to Edman degradation. The results of proteolytic modification of the HPI layer in situ and M/sub r/ estimations of the HPI polypeptide expressed in Escherichia coli indicated that there is a leader sequence. The N-terminal region contained a very high percentage (29%)more » of threonine and serine, including a cluster of nine consecutive serine or threonine residues, whereas a stretch near the C terminus was extremely rich in aromatic amino acids (29%). The protein contained at least two disulfide bridges, as well as tightly bound reducing sugars and fatty acids.« less

Detection and isolation of nucleic acid sequences using competitive hybridization probes

DOEpatents

Lucas, Joe N.; Straume, Tore; Bogen, Kenneth T.

1997-01-01

A method for detecting a target nucleic acid sequence in a sample is provided using hybridization probes which competitively hybridize to a target nucleic acid. According to the method, a target nucleic acid sequence is hybridized to first and second hybridization probes which are complementary to overlapping portions of the target nucleic acid sequence, the first hybridization probe including a first complexing agent capable of forming a binding pair with a second complexing agent and the second hybridization probe including a detectable marker. The first complexing agent attached to the first hybridization probe is contacted with a second complexing agent, the second complexing agent being attached to a solid support such that when the first and second complexing agents are attached, target nucleic acid sequences hybridized to the first hybridization probe become immobilized on to the solid support. The immobilized target nucleic acids are then separated and detected by detecting the detectable marker attached to the second hybridization probe. A kit for performing the method is also provided.

Detection and isolation of nucleic acid sequences using competitive hybridization probes

DOEpatents

Lucas, J.N.; Straume, T.; Bogen, K.T.

1997-04-01

A method for detecting a target nucleic acid sequence in a sample is provided using hybridization probes which competitively hybridize to a target nucleic acid. According to the method, a target nucleic acid sequence is hybridized to first and second hybridization probes which are complementary to overlapping portions of the target nucleic acid sequence, the first hybridization probe including a first complexing agent capable of forming a binding pair with a second complexing agent and the second hybridization probe including a detectable marker. The first complexing agent attached to the first hybridization probe is contacted with a second complexing agent, the second complexing agent being attached to a solid support such that when the first and second complexing agents are attached, target nucleic acid sequences hybridized to the first hybridization probe become immobilized on to the solid support. The immobilized target nucleic acids are then separated and detected by detecting the detectable marker attached to the second hybridization probe. A kit for performing the method is also provided. 7 figs.

Repeat sequence chromosome specific nucleic acid probes and methods of preparing and using

DOEpatents

Weier, H.U.G.; Gray, J.W.

1995-06-27

A primer directed DNA amplification method to isolate efficiently chromosome-specific repeated DNA wherein degenerate oligonucleotide primers are used is disclosed. The probes produced are a heterogeneous mixture that can be used with blocking DNA as a chromosome-specific staining reagent, and/or the elements of the mixture can be screened for high specificity, size and/or high degree of repetition among other parameters. The degenerate primers are sets of primers that vary in sequence but are substantially complementary to highly repeated nucleic acid sequences, preferably clustered within the template DNA, for example, pericentromeric alpha satellite repeat sequences. The template DNA is preferably chromosome-specific. Exemplary primers and probes are disclosed. The probes of this invention can be used to determine the number of chromosomes of a specific type in metaphase spreads, in germ line and/or somatic cell interphase nuclei, micronuclei and/or in tissue sections. Also provided is a method to select arbitrarily repeat sequence probes that can be screened for chromosome-specificity. 18 figs.

Repeat sequence chromosome specific nucleic acid probes and methods of preparing and using

DOEpatents

Weier, Heinz-Ulrich G.; Gray, Joe W.

1995-01-01

A primer directed DNA amplification method to isolate efficiently chromosome-specific repeated DNA wherein degenerate oligonucleotide primers are used is disclosed. The probes produced are a heterogeneous mixture that can be used with blocking DNA as a chromosome-specific staining reagent, and/or the elements of the mixture can be screened for high specificity, size and/or high degree of repetition among other parameters. The degenerate primers are sets of primers that vary in sequence but are substantially complementary to highly repeated nucleic acid sequences, preferably clustered within the template DNA, for example, pericentromeric alpha satellite repeat sequences. The template DNA is preferably chromosome-specific. Exemplary primers ard probes are disclosed. The probes of this invention can be used to determine the number of chromosomes of a specific type in metaphase spreads, in germ line and/or somatic cell interphase nuclei, micronuclei and/or in tissue sections. Also provided is a method to select arbitrarily repeat sequence probes that can be screened for chromosome-specificity.

Partial gene sequences for the A subunit of methyl-coenzyme M reductase (mcrI) as a phylogenetic tool for the family Methanosarcinaceae

NASA Technical Reports Server (NTRS)

Springer, E.; Sachs, M. S.; Woese, C. R.; Boone, D. R.

1995-01-01

Representatives of the family Methanosarcinaceae were analyzed phylogenetically by comparing partial sequences of their methyl-coenzyme M reductase (mcrI) genes. A 490-bp fragment from the A subunit of the gene was selected, amplified by the PCR, cloned, and sequenced for each of 25 strains belonging to the Methanosarcinaceae. The sequences obtained were aligned with the corresponding portions of five previously published sequences, and all of the sequences were compared to determine phylogenetic distances by Fitch distance matrix methods. We prepared analogous trees based on 16S rRNA sequences; these trees corresponded closely to the mcrI trees, although the mcrI sequences of pairs of organisms had 3.01 +/- 0.541 times more changes than the respective pairs of 16S rRNA sequences, suggesting that the mcrI fragment evolved about three times more rapidly than the 16S rRNA gene. The qualitative similarity of the mcrI and 16S rRNA trees suggests that transfer of genetic information between dissimilar organisms has not significantly affected these sequences, although we found inconsistencies between some mcrI distances that we measured and and previously published DNA reassociation data. It is unlikely that multiple mcrI isogenes were present in the organisms that we examined, because we found no major discrepancies in multiple determinations of mcrI sequences from the same organism. Our primers for the PCR also match analogous sites in the previously published mcrII sequences, but all of the sequences that we obtained from members of the Methanosarcinaceae were more closely related to mcrI sequences than to mcrII sequences, suggesting that members of the Methanosarcinaceae do not have distinct mcrII genes.

Development of SCAR (sequence-characterized amplified region) markers as a complementary tool for identification of ginger (Zingiber officinale Roscoe) from crude drugs and multicomponent formulations.

PubMed

Chavan, Preeti; Warude, Dnyaneshwar; Joshi, Kalpana; Patwardhan, Bhushan

2008-05-01

Zingiber officinale Roscoe (common or culinary ginger) is an official drug in Ayurvedic, Indian herbal, Chinese, Japanese, African and British Pharmacopoeias. The objective of the present study was to develop DNA-based markers that can be applied for the identification and differentiation of the commercially important plant Z. officinale Roscoe from the closely related species Zingiber zerumbet (pinecone, bitter or 'shampoo' ginger) and Zingiber cassumunar [cassumunar or plai (Thai) ginger]. The rhizomes of the other two Zingiber species used in the present study are morphologically similar to that of Z. officinale Roscoe and can be used as its adulterants or contaminants. Various methods, including macroscopy, microscopy and chemoprofiling, have been reported for the quality control of crude ginger and its products. These methods are reported to have limitations in distinguishing Z. officinale from closely related species. Hence, newer complementary methods for correct identification of ginger are useful. In the present study, RAPD (random amplification of polymorphic DNA) analysis was used to identify putative species-specific amplicons for Z. officinale. These were further cloned and sequenced to develop SCAR (sequence-characterized amplified region) markers. The developed SCAR markers were tested in several non-Zingiber species commonly used in ginger-containing formulations. One of the markers, P3, was found to be specific for Z. officinale and was successfully applied for detection of Z. officinale from Trikatu, a multicomponent formulation.

Integrative approaches to childhood constipation and encopresis.

PubMed

Culbert, Timothy P; Banez, Gerard A

2007-12-01

Constipation and encopresis (fecal soiling) are common childhood disorders that may lead to significant functional impairment. The etiology and course of constipation and encopresis are increasingly conceptualized from a broad biopsychosocial perspective, and therefore a holistic approach to assessment and treatment is indicated. Many children experience symptoms of chronic constipation and/or encopresis that are only partially responsive to conventional medical therapy. Complementary/alternative therapies can often help in the treatment of constipation/encopresis and are well accepted by patients and families.

Palindromic Sequence Artifacts Generated during Next Generation Sequencing Library Preparation from Historic and Ancient DNA

PubMed Central

Star, Bastiaan; Nederbragt, Alexander J.; Hansen, Marianne H. S.; Skage, Morten; Gilfillan, Gregor D.; Bradbury, Ian R.; Pampoulie, Christophe; Stenseth, Nils Chr; Jakobsen, Kjetill S.; Jentoft, Sissel

2014-01-01

Degradation-specific processes and variation in laboratory protocols can bias the DNA sequence composition from samples of ancient or historic origin. Here, we identify a novel artifact in sequences from historic samples of Atlantic cod (Gadus morhua), which forms interrupted palindromes consisting of reverse complementary sequence at the 5′ and 3′-ends of sequencing reads. The palindromic sequences themselves have specific properties – the bases at the 5′-end align well to the reference genome, whereas extensive misalignments exists among the bases at the terminal 3′-end. The terminal 3′ bases are artificial extensions likely caused by the occurrence of hairpin loops in single stranded DNA (ssDNA), which can be ligated and amplified in particular library creation protocols. We propose that such hairpin loops allow the inclusion of erroneous nucleotides, specifically at the 3′-end of DNA strands, with the 5′-end of the same strand providing the template. We also find these palindromes in previously published ancient DNA (aDNA) datasets, albeit at varying and substantially lower frequencies. This artifact can negatively affect the yield of endogenous DNA in these types of samples and introduces sequence bias. PMID:24608104

Two Complete Genome Sequences of Phasey Bean Mild Yellows Virus, a Novel Member of the Luteoviridae from Australia

PubMed Central

Kehoe, Monica; Coutts, Brenda; van Leur, Joop; Filardo, Fiona; Thomas, John

2016-01-01

We present here the complete genome sequences of a novel polerovirus from Trifolium subterraneum (subterranean clover) and Cicer arietinum (chickpea) and compare these to a partial viral genome sequence obtained from Macroptilium lathyroides (phasey bean). We propose the name phasey bean mild yellows virus for this novel polerovirus. PMID:26847905

Molecular phylogeny of some avian species using Cytochrome b gene sequence analysis

PubMed Central

Awad, A; Khalil, S. R; Abd-Elhakim, Y. M

2015-01-01

Veritable identification and differentiation of avian species is a vital step in conservative, taxonomic, forensic, legal and other ornithological interventions. Therefore, this study involved the application of molecular approach to identify some avian species i.e. Chicken (Gallus gallus), Muskovy duck (Cairina moschata), Japanese quail (Coturnix japonica), Laughing dove (Streptopelia senegalensis), and Rock pigeon (Columba livia). Genomic DNA was extracted from blood samples and partial sequence of the mitochondrial cytochrome b gene (358 bp) was amplified and sequenced using universal primers. Sequences alignment and phylogenetic analyses were performed by CLC main workbench program. The obtained five sequences were deposited in GenBank and compared with those previously registered in GenBank. The similarity percentage was 88.60% between Gallus gallus and Coturnix japonica and 80.46% between Gallus gallus and Columba livia. The percentage of identity between the studied species and GenBank species ranged from 77.20% (Columba oenas and Anas platyrhynchos) to 100% (Gallus gallus and Gallus sonneratii, Coturnix coturnix and Coturnix japonica, Meleagris gallopavo and Columba livia). Amplification of the partial sequence of mitochondrial cytochrome b gene proved to be practical for identification of an avian species unambiguously. PMID:27175180

Analysis for complete genomic sequence of HLA-B and HLA-C alleles in the Chinese Han population.

PubMed

Zhu, F; He, Y; Zhang, W; He, J; He, J; Xu, X; Lv, H; Yan, L

2011-08-01

In the present study, we have determined the complete genomic sequence and analysed the intron polymorphism of partial HLA-B and HLA-C alleles in the Chinese Han population. Over 3.0 kb DNA fragments of HLA-B and HLA-C loci were amplified by polymerase chain reaction from partial 5' untranslated region to 3' noncoding region respectively, and then the amplified products were sequenced. Full-length nucleotide sequences of 14 HLA-B alleles and 10 HLA-C alleles were obtained and have been submitted to GenBank and IMGT/HLA database. Two novel alleles of HLA-B*52:01:01:02 and HLA-B*59:01:01:02 were identified, and the complete genomic sequence of HLA-B*52:01:01:01 was firstly reported. Totally 157 and 167 polymorphism positions were found in the full-length genomic sequence of HLA-B and HLA-C loci respectively. Our results suggested that many single nucleotide polymorphisms existed in the exon and intron regions, and the data can provide useful information for understanding the evolution of HLA-B and HLA-C alleles. © 2011 Blackwell Publishing Ltd.

Strategies for optimizing BioNano and Dovetail explored through a second reference quality assembly for the legume model, Medicago truncatula.

PubMed

Moll, Karen M; Zhou, Peng; Ramaraj, Thiruvarangan; Fajardo, Diego; Devitt, Nicholas P; Sadowsky, Michael J; Stupar, Robert M; Tiffin, Peter; Miller, Jason R; Young, Nevin D; Silverstein, Kevin A T; Mudge, Joann

2017-08-04

Third generation sequencing technologies, with sequencing reads in the tens- of kilo-bases, facilitate genome assembly by spanning ambiguous regions and improving continuity. This has been critical for plant genomes, which are difficult to assemble due to high repeat content, gene family expansions, segmental and tandem duplications, and polyploidy. Recently, high-throughput mapping and scaffolding strategies have further improved continuity. Together, these long-range technologies enable quality draft assemblies of complex genomes in a cost-effective and timely manner. Here, we present high quality genome assemblies of the model legume plant, Medicago truncatula (R108) using PacBio, Dovetail Chicago (hereafter, Dovetail) and BioNano technologies. To test these technologies for plant genome assembly, we generated five assemblies using all possible combinations and ordering of these three technologies in the R108 assembly. While the BioNano and Dovetail joins overlapped, they also showed complementary gains in continuity and join numbers. Both technologies spanned repetitive regions that PacBio alone was unable to bridge. Combining technologies, particularly Dovetail followed by BioNano, resulted in notable improvements compared to Dovetail or BioNano alone. A combination of PacBio, Dovetail, and BioNano was used to generate a high quality draft assembly of R108, a M. truncatula accession widely used in studies of functional genomics. As a test for the usefulness of the resulting genome sequence, the new R108 assembly was used to pinpoint breakpoints and characterize flanking sequence of a previously identified translocation between chromosomes 4 and 8, identifying more than 22.7 Mb of novel sequence not present in the earlier A17 reference assembly. Adding Dovetail followed by BioNano data yielded complementary improvements in continuity over the original PacBio assembly. This strategy proved efficient and cost-effective for developing a quality draft assembly compared to traditional reference assemblies.

Multihormonal induction of hepatic α2u-globulin mRNA as measured by hybridization to complementary DNA

PubMed Central

Kurtz, David T.; Feigelson, Philip

1977-01-01

A procedure is presented for the preparation of a 3H-labeled complementary DNA (cDNA) specific for the mRNA coding for α2u-globulin, a male rat liver protein under multihormonal control that represents approximately 1% of hepatic protein synthesis. Rat liver polysomes are incubated with monospecific rabbit antiserum to α2u-globulin, which binds to the nascent α2u-globulin chains on the polysomes. These antibody-polysome complexes are then adsorbed to goat antiserum to rabbit IgG that is covalently linked to p-aminobenzylcellulose. mRNA preparations are thus obtained that contain 30-40% α2u-globulin mRNA. A labeled cDNA is made to this α2u-globulin-enriched mRNA preparation by using RNA-dependent DNA polymerase (reverse transcriptase). To remove the non-α2u-globulin sequences, this cDNA preparation is hybridized to an RNA concentration × incubation time (R0t) of 1000 mol of ribonucleotide per liter × sec with female rat liver mRNA, which, though it shares the vast majority of mRNA sequences with male liver, contains no α2u-globulin mRNA sequences. The cDNA remaining single-stranded is isolated by hydroxylapatite chromatography and is shown to be specific for α2u-globulin mRNA by several criteria. Good correlation was found in all endocrine states studied between the hepatic level of α2u-globulin, the level of functional α2u-globulin mRNA as assayed in a wheat germ cell-free translational system, and the level of α2u-globulin mRNA sequences as measured by hybridization to the α2u-globulin cDNA. Thus, the hormonal control of hepatic α2u-globulin synthesis by sex steroids and thyroid hormone occurs through modulation of the cellular level of α2u-globulin mRNA sequences, presumably by hormonal control of transcriptive synthesis. PMID:73184

Complementary DNA cloning and constitutive expression of cytochrome P450 1C1 in the gills of carp (Cyprinus carpio).

PubMed

Itakura, Takao; El-Kady, Mohamed; Mitsuo, Ryoichi; Kaminishi, Yoshio

2005-01-01

Cytochrome P450 (CYP) enzymes constitute a multigene family of many endogenous and xenobiotic substances. The CYP1 family is of particular interest in environmental toxicology because its members are dominant in the metabolism of polycyclic aromatic hydrocarbons (PAHs), polychlorinated biphenyls (PCBs), and aryl amines. A new complementary DNA of the CYP1C subfamily encoding CYP1C1 was isolated from carp liver after intraperitoneal injection of beta-napthoflavone (BNF). The full-length cDNA obtained contained a 5' noncoding region of 244 bp, an open reading frame of 1572 bp coding for 524 amino acids, a stop codon, and a 3' noncoding region of 965 bp. The predicted molecular weight of the protein was approximately 59.3 kDa. The deduced amino acid sequence of this cDNA was 82.1% and 80.2% similar to Japanese eel and scup CYP1C1 sequences, respectively, while it exhibited a similarity of 74.9% with the scup CYP1C2 sequence. The deduced amino acid sequence of carp CYP1C1 showed similarities with those of the reported CYP1B1s of teleosts and mammals of 48.4, 48.8, 48.2, 48.6, 45.3, and 45.5% for carp CYP1B1, carp CYP1B2, plaice CYP1B1, and human, rat, and mouse CYP1B1, respectively. The phylogenetic tree constructed using fish and mammalian CYP1 sequences suggested a closer relationship of the CYP1C subfamily to CYP1B than to CYP1A. The tree showed the possibility of the existence of CYP1C subfamily genes in mammalian species. Northern blot analysis for the liver, intestine, gills, and kidney showed no detectable induced expression but constitutive expression in the gill organs.

Co-operation between Polymerases and Nucleotide Synthetases in the RNA World.

PubMed

Kim, Ye Eun; Higgs, Paul G

2016-11-01

It is believed that life passed through an RNA World stage in which replication was sustained by catalytic RNAs (ribozymes). The two most obvious types of ribozymes are a polymerase, which uses a neighbouring strand as a template to make a complementary sequence to the template, and a nucleotide synthetase, which synthesizes monomers for use by the polymerase. When a chemical source of monomers is available, the polymerase can survive on its own. When the chemical supply of monomers is too low, nucleotide production by the synthetase is essential and the two ribozymes can only survive when they are together. Here we consider a computational model to investigate conditions under which coexistence and cooperation of these two types of ribozymes is possible. The model considers six types of strands: the two functional sequences, the complementary strands to these sequences (which are required as templates), and non-functional mutants of the two sequences (which act as parasites). Strands are distributed on a two-dimensional lattice. Polymerases replicate strands on neighbouring sites and synthetases produce monomers that diffuse in the local neighbourhood. We show that coexistence of unlinked polymerases and synthetases is possible in this spatial model under conditions in which neither sequence could survive alone; hence, there is a selective force for increasing complexity. Coexistence is dependent on the relative lengths of the two functional strands, the strand diffusion rate, the monomer diffusion rate, and the rate of deleterious mutations. The sensitivity of this two-ribozyme system suggests that evolution of a system of many types of ribozymes would be difficult in a purely spatial model with unlinked genes. We therefore speculate that linkage of genes onto mini-chromosomes and encapsulation of strands in protocells would have been important fairly early in the history of life as a means of enabling more complex systems to evolve.

Identification and characterization of circular RNAs in zebrafish.

PubMed

Shen, Yudong; Guo, Xianwu; Wang, Weimin

2017-01-01

Circular RNA (circRNA), a class of RNAs with circular structure, has received little attention until recently, when some new features and functions were discovered. In the present study, we sequenced circRNAs in zebrafish (Danio rerio) and identified 3868 circRNAs using three algorithms (find_circ, CIRI, segemehl). The analysis of microRNA target sites on circRNAs shows that some circRNAs may function as miRNA sponges. Furthermore, we identified the existence of reverse complementary sequences in the flanking regions of only 25 (2.64%) exonic circRNAs, indicating that the mechanism of zebrafish exonic circRNA biogenesis might be different from that in mammals. Moreover, 1122 (29%) zebrafish circRNA sequences showed homology with human, mouse and coelacanth circRNAs. © 2016 Federation of European Biochemical Societies.

A statistical physics perspective on alignment-independent protein sequence comparison.

PubMed

Chattopadhyay, Amit K; Nasiev, Diar; Flower, Darren R

2015-08-01

Within bioinformatics, the textual alignment of amino acid sequences has long dominated the determination of similarity between proteins, with all that implies for shared structure, function and evolutionary descent. Despite the relative success of modern-day sequence alignment algorithms, so-called alignment-free approaches offer a complementary means of determining and expressing similarity, with potential benefits in certain key applications, such as regression analysis of protein structure-function studies, where alignment-base similarity has performed poorly. Here, we offer a fresh, statistical physics-based perspective focusing on the question of alignment-free comparison, in the process adapting results from 'first passage probability distribution' to summarize statistics of ensemble averaged amino acid propensity values. In this article, we introduce and elaborate this approach. © The Author 2015. Published by Oxford University Press.

[Molecular identification and detection of moon jellyfish (Aurelia sp.) based on partial sequencing of mitochondrial 16S rDNA and COI].

PubMed

Wang, Jian-Yan; Zhen, Yu; Wang, Guo-shan; Mi, Tie-Zhu; Yu, Zhi-gang

2013-03-01

Taking the moon jellyfish Aurelia sp. commonly found in our coastal sea areas as test object, its genome DNA was extracted, the partial sequences of mt-16S rDNA (650 bp) and mt-COI (709 bp) were PCR-amplified, and, after purification, cloning, and sequencing, the sequences obtained were BLASTn-analyzed. The sequences of greater difference with those of the other jellyfish were chosen, and eight specific primers for the mt-16S rDNA and mt-COI of Aurelia sp. were designed, respectively. The specificity test indicated that the primer AS3 for the mt-16S rDNA and the primer AC3 for the mt-COI were excellent in rapidly detecting the target jellyfish from Rhopilema esculentum, Nemopilema nomurai, Cyanea nozakii, Acromitus sp., and Aurelia sp., and thus, the techniques for the molecular identification and detection of moon jellyfish were preliminarily established, which could get rid of the limitations in classical morphological identification of Aurelia sp. , being able to find the Aurelia sp. in the samples more quickly and accurately.

Materials and fabrication sequences for water soluble silicon integrated circuits at the 90 nm node

NASA Astrophysics Data System (ADS)

Yin, Lan; Bozler, Carl; Harburg, Daniel V.; Omenetto, Fiorenzo; Rogers, John A.

2015-01-01

Tungsten interconnects in silicon integrated circuits built at the 90 nm node with releasable configurations on silicon on insulator wafers serve as the basis for advanced forms of water-soluble electronics. These physically transient systems have potential uses in applications that range from temporary biomedical implants to zero-waste environmental sensors. Systematic experimental studies and modeling efforts reveal essential aspects of electrical performance in field effect transistors and complementary ring oscillators with as many as 499 stages. Accelerated tests reveal timescales for dissolution of the various constituent materials, including tungsten, silicon, and silicon dioxide. The results demonstrate that silicon complementary metal-oxide-semiconductor circuits formed with tungsten interconnects in foundry-compatible fabrication processes can serve as a path to high performance, mass-produced transient electronic systems.

Directional, seamless, and restriction enzyme-free construction of random-primed complementary DNA libraries using phosphorothioate-modified primers.

PubMed

Howland, Shanshan W; Poh, Chek-Meng; Rénia, Laurent

2011-09-01

Directional cloning of complementary DNA (cDNA) primed by oligo(dT) is commonly achieved by appending a restriction site to the primer, whereas the second strand is synthesized through the combined action of RNase H and Escherichia coli DNA polymerase I (PolI). Although random primers provide more uniform and complete coverage, directional cloning with the same strategy is highly inefficient. We report that phosphorothioate linkages protect the tail sequence appended to random primers from the 5'→3' exonuclease activity of PolI. We present a simple strategy for constructing a random-primed cDNA library using the efficient, size-independent, and seamless In-Fusion cloning method instead of restriction enzymes. Copyright © 2011 Elsevier Inc. All rights reserved.

Using ClinicalTrials.gov to supplement information in ophthalmology conference abstracts about trial outcomes: a comparison study.

PubMed

Scherer, Roberta W; Huynh, Lynn; Ervin, Ann-Margret; Dickersin, Kay

2015-01-01

Including results from unpublished randomized controlled trials (RCTs) in a systematic review may ameliorate the effect of publication bias in systematic review results. Unpublished RCTs are sometimes described in abstracts presented at conferences, included in trials registers, or both. Trial results may not be available in a trials register and abstracts describing RCT results often lack study design information. Complementary information from a trials register record may be sufficient to allow reliable inclusion of an unpublished RCT only available as an abstract in a systematic review. We identified 496 abstracts describing RCTs presented at the 2007 to 2009 Association for Research in Vision and Ophthalmology (ARVO) meetings; 154 RCTs were registered in ClinicalTrials.gov. Two persons extracted verbatim primary and non-primary outcomes reported in the abstract and ClinicalTrials.gov record. We compared each abstract outcome with all ClinicalTrials.gov outcomes and coded matches as complete, partial, or no match. We identified 800 outcomes in 152 abstracts (95 primary [51 abstracts] and 705 [141 abstracts] non-primary outcomes). No outcomes were reported in 2 abstracts. Of 95 primary outcomes, 17 (18%) agreed completely, 53 (56%) partially, and 25 (26%) had no match with a ClinicalTrials.gov primary or non-primary outcome. Among 705 non-primary outcomes, 56 (8%) agreed completely, 205 (29%) agreed partially, and 444 (63%) had no match with a ClinicalTrials.gov primary or non-primary outcome. Among the 258 outcomes partially agreeing, we found additional information on the time when the outcome was measured more often in ClinicalTrials.gov than in the abstract (141/258 (55%) versus 55/258 (21%)). We found no association between the presence of non-matching "new" outcomes and year of registration, time to registry update, industry sponsorship, or multi-center status. Conference abstracts may be a valuable source of information about results for outcomes of unpublished RCTs that have been registered in ClinicalTrials.gov. Complementary additional descriptive information may be present for outcomes reported in both sources. However, ARVO abstract authors also present outcomes not reported in ClinicalTrials.gov and these may represent analyses not originally planned.

High Degree of Interlaboratory Reproducibility of Human Immunodeficiency Virus Type 1 Protease and Reverse Transcriptase Sequencing of Plasma Samples from Heavily Treated Patients

PubMed Central

Shafer, Robert W.; Hertogs, Kurt; Zolopa, Andrew R.; Warford, Ann; Bloor, Stuart; Betts, Bradley J.; Merigan, Thomas C.; Harrigan, Richard; Larder, Brendon A.

2001-01-01

We assessed the reproducibility of human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) and protease sequencing using cryopreserved plasma aliquots obtained from 46 heavily treated HIV-1-infected individuals in two laboratories using dideoxynucleotide sequencing. The rates of complete sequence concordance between the two laboratories were 99.1% for the protease sequence and 99.0% for the RT sequence. Approximately 90% of the discordances were partial, defined as one laboratory detecting a mixture and the second laboratory detecting only one of the mixture's components. Only 0.1% of the nucleotides were completely discordant between the two laboratories, and these were significantly more likely to occur in plasma samples with lower plasma HIV-1 RNA levels. Nucleotide mixtures were detected at approximately 1% of the nucleotide positions, and in every case in which one laboratory detected a mixture, the second laboratory either detected the same mixture or detected one of the mixture's components. The high rate of concordance in detecting mixtures and the fact that most discordances between the two laboratories were partial suggest that most discordances were caused by variation in sampling of the HIV-1 quasispecies by PCR rather than by technical errors in the sequencing process itself. PMID:11283081

Using the Developmental Gene Bicoid to Identify Species of Forensically Important Blowflies (Diptera: Calliphoridae)

PubMed Central

Park, Seong Hwan; Park, Chung Hyun; Zhang, Yong; Piao, Huguo; Chung, Ukhee; Kim, Seong Yoon; Ko, Kwang Soo; Yi, Cheong-Ho; Jo, Tae-Ho; Hwang, Juck-Joon

2013-01-01

Identifying species of insects used to estimate postmortem interval (PMI) is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd) genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera) were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae) and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science. PMID:23586044

ContEst16S: an algorithm that identifies contaminated prokaryotic genomes using 16S RNA gene sequences.

PubMed

Lee, Imchang; Chalita, Mauricio; Ha, Sung-Min; Na, Seong-In; Yoon, Seok-Hwan; Chun, Jongsik

2017-06-01

Thanks to the recent advancement of DNA sequencing technology, the cost and time of prokaryotic genome sequencing have been dramatically decreased. It has repeatedly been reported that genome sequencing using high-throughput next-generation sequencing is prone to contaminations due to its high depth of sequencing coverage. Although a few bioinformatics tools are available to detect potential contaminations, these have inherited limitations as they only use protein-coding genes. Here we introduce a new algorithm, called ContEst16S, to detect potential contaminations using 16S rRNA genes from genome assemblies. We screened 69 745 prokaryotic genomes from the NCBI Assembly Database using ContEst16S and found that 594 were contaminated by bacteria, human and plants. Of the predicted contaminated genomes, 8 % were not predicted by the existing protein-coding gene-based tool, implying that both methods can be complementary in the detection of contaminations. A web-based service of the algorithm is available at www.ezbiocloud.net/tools/contest16s.

Hyperspectral Analysis of Soil Total Nitrogen in Subsided Land Using the Local Correlation Maximization-Complementary Superiority (LCMCS) Method.

PubMed

Lin, Lixin; Wang, Yunjia; Teng, Jiyao; Xi, Xiuxiu

2015-07-23

The measurement of soil total nitrogen (TN) by hyperspectral remote sensing provides an important tool for soil restoration programs in areas with subsided land caused by the extraction of natural resources. This study used the local correlation maximization-complementary superiority method (LCMCS) to establish TN prediction models by considering the relationship between spectral reflectance (measured by an ASD FieldSpec 3 spectroradiometer) and TN based on spectral reflectance curves of soil samples collected from subsided land which is determined by synthetic aperture radar interferometry (InSAR) technology. Based on the 1655 selected effective bands of the optimal spectrum (OSP) of the first derivate differential of reciprocal logarithm ([log{1/R}]'), (correlation coefficients, p < 0.01), the optimal model of LCMCS method was obtained to determine the final model, which produced lower prediction errors (root mean square error of validation [RMSEV] = 0.89, mean relative error of validation [MREV] = 5.93%) when compared with models built by the local correlation maximization (LCM), complementary superiority (CS) and partial least squares regression (PLS) methods. The predictive effect of LCMCS model was optional in Cangzhou, Renqiu and Fengfeng District. Results indicate that the LCMCS method has great potential to monitor TN in subsided lands caused by the extraction of natural resources including groundwater, oil and coal.

The promises and pitfalls of RNA-interference-based therapeutics

PubMed Central

Castanotto, Daniela; Rossi, John J.

2009-01-01

The discovery that gene expression can be controlled by the Watson–Crick base-pairing of small RNAs with messenger RNAs containing complementary sequence — a process known as RNA interference — has markedly advanced our understanding of eukaryotic gene regulation and function. The ability of short RNA sequences to modulate gene expression has provided a powerful tool with which to study gene function and is set to revolutionize the treatment of disease. Remarkably, despite being just one decade from its discovery, the phenomenon is already being used therapeutically in human clinical trials, and biotechnology companies that focus on RNA-interference-based therapeutics are already publicly traded. PMID:19158789

Structure and Function of Lipopolysaccharide Binding Protein

NASA Astrophysics Data System (ADS)

Schumann, Ralf R.; Leong, Steven R.; Flaggs, Gail W.; Gray, Patrick W.; Wright, Samuel D.; Mathison, John C.; Tobias, Peter S.; Ulevitch, Richard J.

1990-09-01

The primary structure of lipopolysaccharide binding protein (LBP), a trace plasma protein that binds to the lipid A moiety of bacterial lipopolysaccharides (LPSs), was deduced by sequencing cloned complementary DNA. LBP shares sequence identity with another LPS binding protein found in granulocytes, bactericidal/permeability-increasing protein, and with cholesterol ester transport protein of the plasma. LBP may control the response to LPS under physiologic conditions by forming high-affinity complexes with LPS that bind to monocytes and macrophages, which then secrete tumor necrosis factor. The identification of this pathway for LPS-induced monocyte stimulation may aid in the development of treatments for diseases in which Gram-negative sepsis or endotoxemia are involved.

Programmable release of multiple protein drugs from aptamer-functionalized hydrogels via nucleic acid hybridization.

PubMed

Battig, Mark R; Soontornworajit, Boonchoy; Wang, Yong

2012-08-01

Polymeric delivery systems have been extensively studied to achieve localized and controlled release of protein drugs. However, it is still challenging to control the release of multiple protein drugs in distinct stages according to the progress of disease or treatment. This study successfully demonstrates that multiple protein drugs can be released from aptamer-functionalized hydrogels with adjustable release rates at predetermined time points using complementary sequences (CSs) as biomolecular triggers. Because both aptamer-protein interactions and aptamer-CS hybridization are sequence-specific, aptamer-functionalized hydrogels constitute a promising polymeric delivery system for the programmable release of multiple protein drugs to treat complex human diseases.

Periodic Assembly of Nanospecies on Repetitive DNA Sequences Generated on Gold Nanoparticles by Rolling Circle Amplification

NASA Astrophysics Data System (ADS)

Zhao, Weian; Brook, Michael A.; Li, Yingfu

Periodical assembly of nanospecies is desirable for the construction of nanodevices. We provide a protocol for the preparation of a gold nanoparticle (AuNP)/DNA scaffold on which nanospecies can be assembled in a periodical manner. AuNP/DNA scaffold is prepared by growing long single-stranded DNA (ssDNA) molecules (typically hundreds of nanometers to a few microns in length) on AuNPs via rolling circle amplification (RCA). Since these long ssDNA molecules contain many repetitive sequence units, complementary DNA-attached nanospecies can be assembled through specific hybridization in a controllable and periodical manner.

Molecular analysis of 16S rRNA genes identifies potentially periodontal pathogenic bacteria and archaea in the plaque of partially erupted third molars.

PubMed

Mansfield, J M; Campbell, J H; Bhandari, A R; Jesionowski, A M; Vickerman, M M

2012-07-01

Small subunit rRNA sequencing and phylogenetic analysis were used to identify cultivable and uncultivable microorganisms present in the dental plaque of symptomatic and asymptomatic partially erupted third molars to determine the prevalence of putative periodontal pathogens in pericoronal sites. Template DNA prepared from subgingival plaque collected from partially erupted symptomatic and asymptomatic mandibular third molars and healthy incisors was used in polymerase chain reaction with broad-range oligonucleotide primers to amplify 16S rRNA bacterial and archaeal genes. Amplicons were cloned, sequenced, and compared with known nucleotide sequences in online databases to identify the microorganisms present. Two thousand three hundred two clones from the plaque of 12 patients carried bacterial sequences from 63 genera belonging to 11 phyla, including members of the uncultivable TM7, SR1, and Chloroflexi, and difficult-to-cultivate Synergistetes and Spirochaetes. Dialister invisus, Filifactor alocis, Fusobacterium nucleatum, Porphyromonas endodontalis, Prevotella denticola, Tannerella forsythia, and Treponema denticola, which have been associated with periodontal disease, were found in significantly greater abundance in pericoronal compared with incisor sites. Dialister invisus and F nucleatum were found in greater abundance in sites exhibiting clinical symptoms. The archaeal species, Methanobrevibacter oralis, which has been associated with severe periodontitis, was found in 3 symptomatic patients. These findings have provided new insights into the complex microbiota of pericoronitis. Several bacterial and archaeal species implicated in periodontal disease were recovered in greater incidence and abundance from the plaque of partially erupted third molars compared with incisors, supporting the hypothesis that the pericoronal region may provide a favored niche for periodontal pathogens in otherwise healthy mouths. Copyright © 2012 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.

Molecular cloning and sequencing analysis of the interferon receptor (IFNAR-1) from Columba livia.

PubMed

Li, Chao; Chang, Wei Shan

2014-01-01

Partial sequence cloning of interferon receptor (IFNAR-1) of Columba livia. In order to obtain a certain length (630 bp) of gene, a pair of primers was designed according to the conserved nucleotide sequence of Gallus (EU477527.1) and Taeniopygia guttata (XM_002189232.1) IFNAR-1 gene fragment that was published by GenBank. Special primers were designed by the Race method to amplify the 3'terminal cDNA. The Columba livia IFNAR-1 displayed 88.5%, 80.5% and 73.8% nucleotide identity to Falco peregrinus, Gallus and Taeniopygia guttata, respectively. Phylogenetic analysis of the IFNAR1 gene showed that the relationship of Columba livia, Falco peregrinus and chicken had high homology. We successfully obtained a Columba livia IFNAR-1 gene partial sequence. Analysis of the genetic tree showed that the relationship of Columba livia and Falco peregrinus IFNAR-1 had high homology. This result can be used as reference for further research and practical application.

Molecular cloning and sequencing analysis of the interferon receptor (IFNAR-1) from Columba livia

PubMed Central

Chang, Wei Shan

2014-01-01

Objective Partial sequence cloning of interferon receptor (IFNAR-1) of Columba livia. Material and methods In order to obtain a certain length (630 bp) of gene, a pair of primers was designed according to the conserved nucleotide sequence of Gallus (EU477527.1) and Taeniopygia guttata (XM_002189232.1) IFNAR-1 gene fragment that was published by GenBank. Special primers were designed by the Race method to amplify the 3'terminal cDNA. Results The Columba livia IFNAR-1 displayed 88.5%, 80.5% and 73.8% nucleotide identity to Falco peregrinus, Gallus and Taeniopygia guttata, respectively. Phylogenetic analysis of the IFNAR1 gene showed that the relationship of Columba livia, Falco peregrinus and chicken had high homology. Conclusions We successfully obtained a Columba livia IFNAR-1 gene partial sequence. Analysis of the genetic tree showed that the relationship of Columba livia and Falco peregrinus IFNAR-1 had high homology. This result can be used as reference for further research and practical application. PMID:26155117

Sequence and phylogenetic analysis of chicken anaemia virus obtained from backyard and commercial chickens in Nigeria.

PubMed

Oluwayelu, D O; Todd, D; Olaleye, O D

2008-12-01

This work reports the first molecular analysis study of chicken anaemia virus (CAV) in backyard chickens in Africa using molecular cloning and sequence analysis to characterize CAV strains obtained from commercial chickens and Nigerian backyard chickens. Partial VP1 gene sequences were determined for three CAVs from commercial chickens and for six CAV variants present in samples from a backyard chicken. Multiple alignment analysis revealed that the 6% and 4% nucleotide diversity obtained respectively for the commercial and backyard chicken strains translated to only 2% amino acid diversity for each breed. Overall, the amino acid composition of Nigerian CAVs was found to be highly conserved. Since the partial VP1 gene sequence of two backyard chicken cloned CAV strains (NGR/CI-8 and NGR/CI-9) were almost identical and evolutionarily closely related to the commercial chicken strains NGR-1, and NGR-4 and NGR-5, respectively, we concluded that CAV infections had crossed the farm boundary.

Effects of varied energy density of complementary foods on breast-milk intakes and total energy consumption by healthy, breastfed Bangladeshi children.

PubMed

Islam, M Munirul; Peerson, Janet M; Ahmed, Tahmeed; Dewey, Kathryn G; Brown, Kenneth H

2006-04-01

Information is needed to design studies of the effects of complementary feeding regimens on children's intakes of complementary foods (CFs) and breast milk. We evaluated the effects of varied energy density of CFs on the time until stabilization of dietary intakes and on total daily energy intakes (EIs) and breast-milk intakes. CFs with low [0.4 kcal/g (LD)] and high [1.5 kcal/g (HD)] energy density were fed 3 times/d to 10 children (aged 9-18 mo) during 2 randomly assigned sequences of three 8-d diet periods (HD-LD-HD or LD-HD-LD) along with ad libitum breastfeeding. CF and breast-milk intakes were measured. Intakes of the HD diet and breast milk did not vary by day of period, but intake of the LD diet increased progressively. During days 5-7 of the last 2 diet periods in each sequence, more of the LD than of the HD diet was consumed (752 +/- 252 and 439 +/- 111 g/d, respectively; P < 0.001), but EIs from CFs were greater with the HD diet. Breast-milk consumption was slightly less (192 +/- 115 and 234 +/- 121 g/d, respectively; P = 0.03) but total daily EI was greater (774 +/- 175 and 441 +/- 85 kcal/d, respectively; P < 0.001) during the HD than during the LD diet period. New information on the effects of newly introduced diets on daily intakes of these diets and of breast milk can be used to design future studies. Total daily EIs were greater with the HD diet despite its negative effects on breast-milk intakes.

Changes in miRNAs Signal High-Risk HPV Infections | Center for Cancer Research

Cancer.gov

microRNAs (miRNAs) are approximately 21 nucleotide long, non-coding RNAs that regulate the expression of certain proteins. As part of the RNA-induced silencing complex or RISC, miRNAs bind to complementary sequences in the 3’ untranslated regions of target messenger RNAs, blocking protein synthesis and sometimes leading to the destruction of the target RNA. Numerous studies

Biology of Symbioses between Marine Invertebrates and Intracellular Bacteria

DTIC Science & Technology

1990-01-30

bisphosphate carboxylase We designed from published sequence information oligonucleotide primers which are complementary to conserved regions on RubisCO ...large and small subunit genes. These primers were used successfully to amplify using polymerase chain reaction (PCR) specific regions of RubisCO ...for the large subunit of ribulose bisphosphate carboxylase/oxygenase ( RubisCO ) to symbiont DNA shows that the symbionts from both deep-sea and shallow

Oligonucleotides Containing Aminated 2'-Amino-LNA Nucleotides: Synthesis and Strong Binding to Complementary DNA and RNA.

PubMed

Lou, Chenguang; Samuelsen, Simone V; Christensen, Niels Johan; Vester, Birte; Wengel, Jesper

2017-04-19

Mono- and diaminated 2'-amino-LNA monomers were synthesized and introduced into oligonucleotides. Each modification imparts significant stabilization of nucleic acid duplexes and triplexes, excellent sequence selectivity, and significant nuclease resistance. Molecular modeling suggested that structural stabilization occurs via intrastrand electrostatic attraction between the protonated amino groups of the aminated 2'-amino-LNA monomers and the host oligonucleotide backbone.

The Ties That Bind: Mapping the Dynamic Enhancer-Promoter Interactome

DOE PAGES

Spurrell, Cailyn H.; Dickel, Diane E.; Visel, Axel

2016-11-17

Coupling chromosome conformation capture to molecular enrichment for promoter-containing DNA fragments enables the systematic mapping of interactions between individual distal regulatory sequences and their target genes. Here in this Minireview, we describe recent progress in the application of this technique and related complementary approaches to gain insight into the lineage- and cell-type-specific dynamics of interactions between regulators and gene promoters.

Two Complete Genome Sequences of Phasey Bean Mild Yellows Virus, a Novel Member of the Luteoviridae from Australia.

PubMed

Sharman, Murray; Kehoe, Monica; Coutts, Brenda; van Leur, Joop; Filardo, Fiona; Thomas, John

2016-02-04

We present here the complete genome sequences of a novel polerovirus from Trifolium subterraneum (subterranean clover) and Cicer arietinum (chickpea) and compare these to a partial viral genome sequence obtained from Macroptilium lathyroides (phasey bean). We propose the name phasey bean mild yellows virus for this novel polerovirus. Copyright © 2016 Sharman et al.

Genetic diversity of Clostridium perfringens type A isolates from animals, food poisoning outbreaks and sludge

PubMed Central

Johansson, Anders; Aspan, Anna; Bagge, Elisabeth; Båverud, Viveca; Engström, Björn E; Johansson, Karl-Erik

2006-01-01

Background Clostridium perfringens, a serious pathogen, causes enteric diseases in domestic animals and food poisoning in humans. The epidemiological relationship between C. perfringens isolates from the same source has previously been investigated chiefly by pulsed-field gel electrophoresis (PFGE). In this study the genetic diversity of C. perfringens isolated from various animals, from food poisoning outbreaks and from sludge was investigated. Results We used PFGE to examine the genetic diversity of 95 C. perfringens type A isolates from eight different sources. The isolates were also examined for the presence of the beta2 toxin gene (cpb2) and the enterotoxin gene (cpe). The cpb2 gene from the 28 cpb2-positive isolates was also partially sequenced (519 bp, corresponding to positions 188 to 706 in the consensus cpb2 sequence). The results of PFGE revealed a wide genetic diversity among the C. perfringens type A isolates. The genetic relatedness of the isolates ranged from 58 to 100% and 56 distinct PFGE types were identified. Almost all clusters with similar patterns comprised isolates with a known epidemiological correlation. Most of the isolates from pig, horse and sheep carried the cpb2 gene. All isolates originating from food poisoning outbreaks carried the cpe gene and three of these also carried cpb2. Two evolutionary different populations were identified by sequence analysis of the partially sequenced cpb2 genes from our study and cpb2 sequences previously deposited in GenBank. Conclusion As revealed by PFGE, there was a wide genetic diversity among C. perfringens isolates from different sources. Epidemiologically related isolates showed a high genetic similarity, as expected, while isolates with no obvious epidemiological relationship expressed a lesser degree of genetic similarity. The wide diversity revealed by PFGE was not reflected in the 16S rRNA sequences, which had a considerable degree of sequence similarity. Sequence comparison of the partially sequenced cpb2 gene revealed two genetically different populations. This is to our knowledge the first study in which the genetic diversity of C. perfringens isolates both from different animals species, from food poisoning outbreaks and from sludge has been investigated. PMID:16737528

The LRRK2 G2385R variant is a partial loss-of-function mutation that affects synaptic vesicle trafficking through altered protein interactions.

PubMed

Carrion, Maria Dolores Perez; Marsicano, Silvia; Daniele, Federica; Marte, Antonella; Pischedda, Francesca; Di Cairano, Eliana; Piovesana, Ester; von Zweydorf, Felix; Kremmer, Elisabeth; Gloeckner, Christian Johannes; Onofri, Franco; Perego, Carla; Piccoli, Giovanni

2017-07-14

Mutations in the Leucine-rich repeat kinase 2 gene (LRRK2) are associated with familial Parkinson's disease (PD). LRRK2 protein contains several functional domains, including protein-protein interaction domains at its N- and C-termini. In this study, we analyzed the functional features attributed to LRRK2 by its N- and C-terminal domains. We combined TIRF microscopy and synaptopHluorin assay to visualize synaptic vesicle trafficking. We found that N- and C-terminal domains have opposite impact on synaptic vesicle dynamics. Biochemical analysis demonstrated that different proteins are bound at the two extremities, namely β3-Cav2.1 at N-terminus part and β-Actin and Synapsin I at C-terminus domain. A sequence variant (G2385R) harboured within the C-terminal WD40 domain increases the risk for PD. Complementary biochemical and imaging approaches revealed that the G2385R variant alters strength and quality of LRRK2 interactions and increases fusion of synaptic vesicles. Our data suggest that the G2385R variant behaves like a loss-of-function mutation that mimics activity-driven events. Impaired scaffolding capabilities of mutant LRRK2 resulting in perturbed vesicular trafficking may arise as a common pathophysiological denominator through which different LRRK2 pathological mutations cause disease.

MicroRNAs in islet immunobiology and transplantation.

PubMed

Pileggi, Antonello; Klein, Dagmar; Fotino, Carmen; Bravo-Egaña, Valia; Rosero, Samuel; Doni, Marco; Podetta, Michele; Ricordi, Camillo; Molano, R Damaris; Pastori, Ricardo L

2013-12-01

The ultimate goal of diabetes therapy is the restoration of physiologic metabolic control. For type 1 diabetes, research efforts are focused on the prevention or early intervention to halt the autoimmune process and preserve β cell function. Replacement of pancreatic β cells via islet transplantation reestablishes physiologic β cell function in patients with diabetes. Emerging research shows that microRNAs (miRNAs), noncoding small RNA molecules produced by a newly discovered class of genes, negatively regulate gene expression. MiRNAs recognize and bind to partially complementary sequences of target messenger RNA (mRNA), regulating mRNA translation and affecting gene expression. Correlation between miRNA signatures and genome-wide RNA expression allows identification of multiple miRNA-mRNA pairs in biological processes. Because miRNAs target functionally related genes, they represent an exciting and indispensable approach for biomarkers and drug discovery. We are studying the role of miRNA in the context of islet immunobiology. Our research aims at understanding the mechanisms underlying pancreatic β cell loss and developing clinically relevant approaches for preservation and restoration of β cell function to treat insulin-dependent diabetes. Herein, we discuss some of our recent efforts related to the study of miRNA in islet inflammation and islet engraftment. Our working hypothesis is that modulation of the expression of specific microRNAs in the transplant microenvironment will be of assistance in enhancing islet engraftment and promoting long-term function.

Roles of the amino group of purine bases in the thermodynamic stability of DNA base pairing.

PubMed

Nakano, Shu-ichi; Sugimoto, Naoki

2014-08-05

The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I) and 2'-deoxyribo-2,6-diaminopurine (D) as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G • C > D • T ≈ I • C > A • T > G • T > I • T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.

Partial characterisation of citrus leaf blotch virus, a new virus from Nagami kumquat.

PubMed

Galipienso, L; Vives, M C; Moreno, P; Milne, R G; Navarro, L; Guerri, J

2001-01-01

Citrus leaf blotch virus (CLBV) was purified from leaves of Nagami kumquat SRA-153 that showed bud union crease when propagated on Troyer citrange. Virions were filamentous particles (960 x 14 nm) containing a 42 kDa protein and a single-stranded RNA (ssRNA) of about 9,000 nt (Mr 3 x 10(6)). Infected tissue contained three species of double-stranded RNA (dsRNA) of Mr 6, 4.5 and 3.4 x 10(6). The nucleotide sequence of several complementary DNA (cDNA) clones showed significant similarities with replication-related proteins from plant filamentous viruses in several genera. A digoxigenin-labelled probe from one of these cDNA clones hybridised in Northern blots with ssRNA from virions and with the three dsRNA species, suggesting that the ssRNA is the genomic RNA of the virus, the largest dsRNA is its replicative form, and the two smaller dsRNAs probably replicative forms of 5' co-terminal subgenomic RNAs. CLBV was also detected in several citrus cultivars from Spain and Japan including Navelina sweet orange field trees propagated on Troyer citrange showing bud union crease; however, no virus could be detected in other citrus trees with similar symptoms. This indicates that CLBV is not restricted to kumquat SRA-153, but its involvement in causing the bud union disorder remains unclear.

Partially coherent lensfree tomographic microscopy⋄

PubMed Central

Isikman, Serhan O.; Bishara, Waheb; Ozcan, Aydogan

2012-01-01

Optical sectioning of biological specimens provides detailed volumetric information regarding their internal structure. To provide a complementary approach to existing three-dimensional (3D) microscopy modalities, we have recently demonstrated lensfree optical tomography that offers high-throughput imaging within a compact and simple platform. In this approach, in-line holograms of objects at different angles of partially coherent illumination are recorded using a digital sensor-array, which enables computing pixel super-resolved tomographic images of the specimen. This imaging modality, which forms the focus of this review, offers micrometer-scale 3D resolution over large imaging volumes of, for example, 10–15 mm3, and can be assembled in light weight and compact architectures. Therefore, lensfree optical tomography might be particularly useful for lab-on-a-chip applications as well as for microscopy needs in resource-limited settings. PMID:22193016

Programmable removal of bacterial strains by use of genome-targeting CRISPR-Cas systems.

PubMed

Gomaa, Ahmed A; Klumpe, Heidi E; Luo, Michelle L; Selle, Kurt; Barrangou, Rodolphe; Beisel, Chase L

2014-01-28

CRISPR (clustered regularly interspaced short palindromic repeats)-Cas (CRISPR-associated) systems in bacteria and archaea employ CRISPR RNAs to specifically recognize the complementary DNA of foreign invaders, leading to sequence-specific cleavage or degradation of the target DNA. Recent work has shown that the accidental or intentional targeting of the bacterial genome is cytotoxic and can lead to cell death. Here, we have demonstrated that genome targeting with CRISPR-Cas systems can be employed for the sequence-specific and titratable removal of individual bacterial strains and species. Using the type I-E CRISPR-Cas system in Escherichia coli as a model, we found that this effect could be elicited using native or imported systems and was similarly potent regardless of the genomic location, strand, or transcriptional activity of the target sequence. Furthermore, the specificity of targeting with CRISPR RNAs could readily distinguish between even highly similar strains in pure or mixed cultures. Finally, varying the collection of delivered CRISPR RNAs could quantitatively control the relative number of individual strains within a mixed culture. Critically, the observed selectivity and programmability of bacterial removal would be virtually impossible with traditional antibiotics, bacteriophages, selectable markers, or tailored growth conditions. Once delivery challenges are addressed, we envision that this approach could offer a novel means to quantitatively control the composition of environmental and industrial microbial consortia and may open new avenues for the development of "smart" antibiotics that circumvent multidrug resistance and differentiate between pathogenic and beneficial microorganisms. Controlling the composition of microbial populations is a critical aspect in medicine, biotechnology, and environmental cycles. While different antimicrobial strategies, such as antibiotics, antimicrobial peptides, and lytic bacteriophages, offer partial solutions, what remains elusive is a generalized and programmable strategy that can distinguish between even closely related microorganisms and that allows for fine control over the composition of a microbial population. This study demonstrates that RNA-directed immune systems in bacteria and archaea called CRISPR-Cas systems can provide such a strategy. These systems can be employed to selectively and quantitatively remove individual bacterial strains based purely on sequence information, creating opportunities in the treatment of multidrug-resistant infections, the control of industrial fermentations, and the study of microbial consortia.

Isolation, cloning, and characterization of a partial novel aro A gene in common reed (Phragmites australis).

PubMed

Taravat, Elham; Zebarjadi, Alireza; Kahrizi, Danial; Yari, Kheirollah

2015-05-01

Among the essential amino acids, phenylalanine, tryptophan, and tyrosine are aromatic amino acids which are synthesized by the shikimate pathway in plants and bacteria. Herbicide glyphosate can inhibit the biosynthesis of these amino acids. So, identification of the gene tolerant to glyphosate is very important. It has been shown that the common reed or Phragmites australis Cav. (Poaceae) is relatively tolerant to glyphosate. The aim of the current research is identification, cloning, sequencing, and registering of partial aro A gene of the common reed P. australis. The partial aro A gene of common reed (P. australis) was cloned in Escherichia coli and the amino acid sequence was identified/determined for the first time. This is the first report for isolation, cloning, and sequencing of a part of aro A gene from the common reed. A 670 bp fragment including two introns (86 bp and 289 bp) was obtained. The open reading frame (ORF) region in part of gene was encoded for 98 amino acids. Alignment showed high similarity among this region with Zea mays (L.) (Poaceae) (94.6%), Eleusine indica L. Gaertn (Poaceae) (94.2%), and Zoysia japonica Steud. (Poaceae) (94.2%). The alignment of amino acid sequence of the investigated part of the gene showed a homology with aro A from several other plants. This conserved region forms the enzyme active site. The alignment results of nucleotide and amino acid residues with related sequences showed that there are some differences among them. The relative glyphosate tolerance in the common reed may be related to these differences.

probeBase—an online resource for rRNA-targeted oligonucleotide probes and primers: new features 2016

PubMed Central

Greuter, Daniel; Loy, Alexander; Horn, Matthias; Rattei, Thomas

2016-01-01

probeBase http://www.probebase.net is a manually maintained and curated database of rRNA-targeted oligonucleotide probes and primers. Contextual information and multiple options for evaluating in silico hybridization performance against the most recent rRNA sequence databases are provided for each oligonucleotide entry, which makes probeBase an important and frequently used resource for microbiology research and diagnostics. Here we present a major update of probeBase, which was last featured in the NAR Database Issue 2007. This update describes a complete remodeling of the database architecture and environment to accommodate computationally efficient access. Improved search functions, sequence match tools and data output now extend the opportunities for finding suitable hierarchical probe sets that target an organism or taxon at different taxonomic levels. To facilitate the identification of complementary probe sets for organisms represented by short rRNA sequence reads generated by amplicon sequencing or metagenomic analysis with next generation sequencing technologies such as Illumina and IonTorrent, we introduce a novel tool that recovers surrogate near full-length rRNA sequences for short query sequences and finds matching oligonucleotides in probeBase. PMID:26586809

Screening for Hepatozoon parasites in gerbils and potential predators in South Africa.

PubMed

Harris, D James; Pereira, Ana; Halajian, Ali; Luus-Powell, Wilmien J; Kunutu, Katlego D

2017-02-08

Samples of gerbils and their potential predators were screened for the presence of Hepatozoon parasites (Apicomplexa: Adeleorina) using both microscopic examination and sequencing of partial 18S rRNA sequences. Positive samples were compared to published sequences in a phylogenetic framework. The results indicate that genets can be infected with Hepatozoon felis. A Cape fox was infected with Hepatozoon canis, whereas the sequence from an infected rodent fell within a group of parasites primarily recovered from other rodents and snakes.

Penicillium excelsum sp. nov from the Brazil Nut Tree Ecosystem in the Amazon Basin'.

PubMed

Taniwaki, Marta Hiromi; Pitt, John I; Iamanaka, Beatriz T; Massi, Fernanda P; Fungaro, Maria Helena P; Frisvad, Jens C

2015-01-01

A new Penicillium species, P. excelsum, is described here using morphological characters, extrolite and partial sequence data from the ITS, β-tubulin and calmodulin genes. It was isolated repeatedly using samples of nut shells and flowers from the brazil nut tree, Bertolletia excelsa, as well as bees and ants from the tree ecosystem in the Amazon rainforest. The species produces andrastin A, curvulic acid, penicillic acid and xanthoepocin, and has unique partial β-tubulin and calmodulin gene sequences. The holotype of P. excelsum is CCT 7772, while ITAL 7572 and IBT 31516 are cultures derived from the holotype.

Penicillium excelsum sp. nov from the Brazil Nut Tree Ecosystem in the Amazon Basin’

PubMed Central

Taniwaki, Marta Hiromi; Pitt, John I.; Iamanaka, Beatriz T.; Massi, Fernanda P.; Fungaro, Maria Helena P.; Frisvad, Jens C.

2015-01-01

A new Penicillium species, P. excelsum, is described here using morphological characters, extrolite and partial sequence data from the ITS, β-tubulin and calmodulin genes. It was isolated repeatedly using samples of nut shells and flowers from the brazil nut tree, Bertolletia excelsa, as well as bees and ants from the tree ecosystem in the Amazon rainforest. The species produces andrastin A, curvulic acid, penicillic acid and xanthoepocin, and has unique partial β-tubulin and calmodulin gene sequences. The holotype of P. excelsum is CCT 7772, while ITAL 7572 and IBT 31516 are cultures derived from the holotype. PMID:26717519

Effect of structure variation of the aptamer-DNA duplex probe on the performance of displacement-based electrochemical aptamer sensors.

PubMed

Pang, Jie; Zhang, Ziping; Jin, Haizhu

2016-03-15

Electrochemical aptamer-based (E-AB) sensors employing electrode-immobilized, redox-tagged aptamer probes have emerged as a promising platform for the sensitive and quick detection of target analytes ranging from small molecules to proteins. Signal generation in this class of sensor is linked to change in electron transfer efficiency upon binding-induced change in flexibility/conformation of the aptamer probe. Because of this signaling mechanism, signal gains of these sensors can be improved by employing a displacement-based recognition system, which links target binding with a large-scale flexibility/conformation shift from the aptamer-DNA duplex to the single-stranded DNA or the native aptamer. Despite the relatively large number of displacement-based E-AB sensor samples, little attention has been paid to the structure variation of the aptamer-DNA duplex probe. Here we detail the effects of complementary length and position of the aptamer-DNA duplex probe on the performance of a model displacement-based E-AB sensor for ATP. We find that, greater background suppression and signal gain are observed with longer complementary length of the aptamer-DNA duplex probe. However, sensor equilibration time slows monotonically with increasing complementary length; and with too many target binding sites in aptamer sequence being occupied by the complementary DNA, the aptamer-target binding does not occur and no signal gain observed. We also demonstrate that signal gain of the displacement-based E-AB sensor is strongly dependent on the complementary position of the aptamer-DNA duplex probe, with complementary position located at the electrode-attached or redox-tagged end of the duplex probe, larger background suppression and signal increase than that of the middle position are observed. These results highlight the importance of rational structure design of the aptamer-DNA duplex probe and provide new insights into the optimization of displacement-based E-AB sensors. Copyright © 2015 Elsevier B.V. All rights reserved.

Molecular cloning and expression of two heat-shock protein genes (HSC70/HSP70) from Prenant's schizothoracin (Schizothorax prenanti).

PubMed

Li, Jiuxuan; Zhang, Haibin; Zhang, Xiuyue; Yang, Shiyong; Yan, Taiming; Song, Zhaobin

2015-04-01

Through the RT-PCR and rapid amplification of cDNA ends, two complementary deoxyribonucleic acid (cDNA) clones encoding heat-shock cognate 70 (HSC70, designated Sp-HSC70) and inducible heat-shock protein 70 (HSP70, designated Sp-HSP70) were isolated from the liver of Prenant's schizothoracin (Schizothorax prenanti). The cDNAs were 2344- and 2292-bp in length and contained 1950- and 1932-bp open reading frames, encoded proteins of 649 and 643 amino acids, respectively. Amino acid sequence analysis indicated that both Sp-HSC70 and Sp-HSP70 contained three signature sequences of HSP70 family, two partial overlapping bipartite nuclear localization signal sequences (an ATP-binding site motif, a bipartite nuclear targeting signal), and a cytoplasmic characteristic motif EEVD. Homology analysis revealed that Sp-HSC70 and Sp-HSP70 shared 77.5% identity and Sp-HSC70 shared more than 81.1% identity with the known HSC70s of other vertebrates, while Sp-HSP70 shared more than 77.5 % identity with the known HSP70s of other vertebrates. Fluorescent real-time quantitative RT-PCR showed that Sp-HSC70 and Sp-HSP70 mRNAs were found in all tested tissues, including blood, brain, heart, liver, spleen, head kidney, white muscle, skin, gonad, hypophysis, red muscle, and gill. The Sp-HSC70 and Sp-HSP70 mRNA expression level in blood and head kidney displayed a significant increase in vibrio-challenged group with the bacterium Aeromonas hydrophila at 24 h post-infection compared to a control group. Temporally, there was a clear time-dependent expression pattern of Sp-HSC70 or Sp-HSP70 gene after bacterial challenge, and the expression of Sp-HSC70 and Sp-HSP70 mRNAs reached a maximum level at 12 and 6 h post-challenge, respectively. Both returned to control level after 7 × 24 h. The results suggest that Sp-HSC70 and Sp-HSP70 genes may play important roles in mediating the immune responses of A. hydrophila-related diseases in the Prenant's schizothoracin.

"De-novo" amino acid sequence elucidation of protein G'e by combined "top-down" and "bottom-up" mass spectrometry.

PubMed

Yefremova, Yelena; Al-Majdoub, Mahmoud; Opuni, Kwabena F M; Koy, Cornelia; Cui, Weidong; Yan, Yuetian; Gross, Michael L; Glocker, Michael O

2015-03-01

Mass spectrometric de-novo sequencing was applied to review the amino acid sequence of a commercially available recombinant protein G´ with great scientific and economic importance. Substantial deviations to the published amino acid sequence (Uniprot Q54181) were found by the presence of 46 additional amino acids at the N-terminus, including a so-called "His-tag" as well as an N-terminal partial α-N-gluconoylation and α-N-phosphogluconoylation, respectively. The unexpected amino acid sequence of the commercial protein G' comprised 241 amino acids and resulted in a molecular mass of 25,998.9 ± 0.2 Da for the unmodified protein. Due to the higher mass that is caused by its extended amino acid sequence compared with the original protein G' (185 amino acids), we named this protein "protein G'e." By means of mass spectrometric peptide mapping, the suggested amino acid sequence, as well as the N-terminal partial α-N-gluconoylations, was confirmed with 100% sequence coverage. After the protein G'e sequence was determined, we were able to determine the expression vector pET-28b from Novagen with the Xho I restriction enzyme cleavage site as the best option that was used for cloning and expressing the recombinant protein G'e in E. coli. A dissociation constant (K(d)) value of 9.4 nM for protein G'e was determined thermophoretically, showing that the N-terminal flanking sequence extension did not cause significant changes in the binding affinity to immunoglobulins.

Molecular evolution of the HoxA cluster in the three major gnathostome lineages

PubMed Central

Chiu, Chi-hua; Amemiya, Chris; Dewar, Ken; Kim, Chang-Bae; Ruddle, Frank H.; Wagner, Günter P.

2002-01-01

The duplication of Hox clusters and their maintenance in a lineage has a prominent but little understood role in chordate evolution. Here we examined how Hox cluster duplication may influence changes in cluster architecture and patterns of noncoding sequence evolution. We sequenced the entire duplicated HoxAa and HoxAb clusters of zebrafish (Danio rerio) and extended the 5′ (posterior) part of the HoxM (HoxA-like) cluster of horn shark (Heterodontus francisci) containing the hoxa11 and hoxa13 orthologs as well as intergenic and flanking noncoding sequences. The duplicated HoxA clusters in zebrafish each house considerably fewer genes and are dramatically shorter than the single HoxA clusters of human and horn shark. We compared the intergenic sequences of the HoxA clusters of human, horn shark, zebrafish (Aa, Ab), and striped bass and found extensive conservation of noncoding sequence motifs, i.e., phylogenetic footprints, between the human and horn shark, representing two of the three gnathostome lineages. These are putative cis-regulatory elements that may play a role in the regulation of the ancestral HoxA cluster. In contrast, homologous regions of the duplicated HoxAa and HoxAb clusters of zebrafish and the HoxA cluster of striped bass revealed a striking loss of conservation of these putative cis-regulatory sequences in the 3′ (anterior) segment of the cluster, where zebrafish only retains single representatives of group 1, 3, 4, and 5 (HoxAa) and group 2 (HoxAb) genes and in the 5′ part of the clusters, where zebrafish retains two copies of the group 13, 11, and 9 genes, i.e., AbdB-like genes. In analyzing patterns of cis-sequence evolution in the 5′ part of the clusters, we explicitly looked for evidence of complementary loss of conserved noncoding sequences, as predicted by the duplication-degeneration-complementation model in which genetic redundancy after gene duplication is resolved because of the fixation of complementary degenerative mutations. Our data did not yield evidence supporting this prediction. We conclude that changes in the pattern of cis-sequence conservation after Hox cluster duplication are more consistent with being the outcome of adaptive modification rather than passive mechanisms that erode redundancy created by the duplication event. These results support the view that genome duplications may provide a mechanism whereby master control genes undergo radical modifications conducive to major alterations in body plan. Such genomic revolutions may contribute significantly to the evolutionary process. PMID:11943847

Recombinant pinoresinol/lariciresinol reductase, recombinant dirigent protein, and methods of use

DOEpatents

Lewis, Norman G.; Davin, Laurence B.; Dinkova-Kostova, Albena T.; Fujita, Masayuki; Gang, David R.; Sarkanen, Simo; Ford, Joshua D.

2001-04-03

Dirigent proteins and pinoresinol/lariciresinol reductases have been isolated, together with cDNAs encoding dirigent proteins and pinoresinol/lariciresinol reductases. Accordingly, isolated DNA sequences are provided which code for the expression of dirigent proteins and pinoresinol/lariciresinol reductases. In other aspects, replicable recombinant cloning vehicles are provided which code for dirigent proteins or pinoresinol/lariciresinol reductases or for a base sequence sufficiently complementary to at least a portion of dirigent protein or pinoresinol/lariciresinol reductase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding dirigent protein or pinoresinol/lariciresinol reductase. Thus, systems and methods are provided for the recombinant expression of dirigent proteins and/or pinoresinol/lariciresinol reductases.

Digital Marine Bioprospecting: Mining New Neurotoxin Drug Candidates from the Transcriptomes of Cold-Water Sea Anemones

PubMed Central

Urbarova, Ilona; Karlsen, Bård Ove; Okkenhaug, Siri; Seternes, Ole Morten; Johansen, Steinar D.; Emblem, Åse

2012-01-01

Marine bioprospecting is the search for new marine bioactive compounds and large-scale screening in extracts represents the traditional approach. Here, we report an alternative complementary protocol, called digital marine bioprospecting, based on deep sequencing of transcriptomes. We sequenced the transcriptomes from the adult polyp stage of two cold-water sea anemones, Bolocera tuediae and Hormathia digitata. We generated approximately 1.1 million quality-filtered sequencing reads by 454 pyrosequencing, which were assembled into approximately 120,000 contigs and 220,000 single reads. Based on annotation and gene ontology analysis we profiled the expressed mRNA transcripts according to known biological processes. As a proof-of-concept we identified polypeptide toxins with a potential blocking activity on sodium and potassium voltage-gated channels from digital transcriptome libraries. PMID:23170083

Genome sequences of Phytophthora enable translational plant disease management and accelerate research

Treesearch

Niklaus J. Grünwald

2012-01-01

Whole and partial genome sequences are becoming available at an ever-increasing pace. For many plant pathogen systems, we are moving into the era of genome resequencing. The first Phytophthora genomes, P. ramorum and P. sojae, became available in 2004, followed shortly by P. infestans...

Aspergillus section Versicolores: nine new species and multilocus DNA sequence based phylogeny

USDA-ARS?s Scientific Manuscript database

ß-tubulin, calmodulin, internal transcribed spacer and partial lsu-rDNA, RNA polymerase, DNA replication licensing factor Mcm7, and pre-rRNA processing protein Tsr1 were amplified and sequenced from 62 A. versicolor clade isolates and analyzed phylogenetically using the concordance model to establis...

Aspergillus section Versicolores, nine new species and multilocus DNA sequence based phylogeny

USDA-ARS?s Scientific Manuscript database

ß-tubulin, calmodulin, internal transcribed spacer and partial lsu-rDNA, RNA polymerase, DNA replication licensing factor Mcm7, and pre-rRNA processing protein Tsr1 were amplified and sequenced from 62 A. versicolor clade isolates and analyzed phylogenetically using the concordance model to establis...

Three-dimensional instabilities of natural convection between two differentially heated vertical plates: Linear and nonlinear complementary approaches

NASA Astrophysics Data System (ADS)

Gao, Zhenlan; Podvin, Berengere; Sergent, Anne; Xin, Shihe; Chergui, Jalel

2018-05-01

The transition to the chaos of the air flow between two vertical plates maintained at different temperatures is studied in the Boussinesq approximation. After the first bifurcation at critical Rayleigh number Rac, the flow consists of two-dimensional (2D) corotating rolls. The stability of the 2D rolls is examined, confronting linear predictions with nonlinear integration. In all cases the 2D rolls are destabilized in the spanwise direction. Efficient linear stability analysis based on an Arnoldi method shows competition between two eigenmodes, corresponding to different spanwise wavelengths and different types of roll distortion. Nonlinear integration shows that the lower-wave-number mode is always dominant. A partial route to chaos is established through the nonlinear simulations. The flow becomes temporally chaotic for Ra =1.05 Rac , but remains characterized by the spatial patterns identified by linear stability analysis. This highlights the complementary role of linear stability analysis and nonlinear simulation.

On understanding the very different science premises meaningful to CAM versus orthodox medicine: Part II--applications of Part I fundamentals to five different space-time examples.

PubMed

Tiller, William A

2010-04-01

In Part I of this pair of articles, the fundamental experimental observations and theoretical perspectives were provided for one to understand the key differences between our normal, uncoupled state of physical reality and the human consciousness-induced coupled state of physical reality. Here in Part II, the thermodynamics of complementary and alternative medicine, which deals with the partially coupled state of physical reality, is explored via the use of five different foci of relevance to today's science and medicine: (1) homeopathy; (2) the placebo effect; (3) long-range, room temperature, macroscopic size-scale, information entanglement; (4) an explanation for dark matter/energy plus human levitation possibility; and (5) electrodermal diagnostic devices. The purpose of this pair of articles is to clearly differentiate the use and limitations of uncoupled state physics in both nature and today's orthodox medicine from coupled state physics in tomorrow's complementary and alternative medicine.

Consolidation of glycosyl hydrolase family 30 : a dual domain 4/7 hydrolase family consisting of two structurally distinct groups

Treesearch

Franz J. St John; Javier M. Gonzalez; Edwin Pozharski

2010-01-01

In this work glycosyl hydrolase (GH) family 30 (GH30) is analyzed and shown to consist of its currently classified member sequences as well as several homologous sequence groups currently assigned within family GH5. A large scale amino acid sequence alignment and a phylogenetic tree were generated and GH30 groups and subgroups were designated. A partial rearrangement...

Comparative sequence analyses of sixteen reptilian paramyxoviruses

USGS Publications Warehouse

Ahne, W.; Batts, W.N.; Kurath, G.; Winton, J.R.

1999-01-01

Viral genomic RNA of Fer-de-Lance virus (FDLV), a paramyxovirus highly pathogenic for reptiles, was reverse transcribed and cloned. Plasmids with significant sequence similarities to the hemagglutinin-neuraminidase (HN) and polymerase (L) genes of mammalian paramyxoviruses were identified by BLAST search. Partial sequences of the FDLV genes were used to design primers for amplification by nested polymerase chain reaction (PCR) and sequencing of 518-bp L gene and 352-bp HN gene fragments from a collection of 15 previously uncharacterized reptilian paramyxoviruses. Phylogenetic analyses of the partial L and HN sequences produced similar trees in which there were two distinct subgroups of isolates that were supported with maximum bootstrap values, and several intermediate isolates. Within each subgroup the nucleotide divergence values were less than 2.5%, while the divergence between the two subgroups was 20-22%. This indicated that the two subgroups represent distinct virus species containing multiple virus strains. The five intermediate isolates had nucleotide divergence values of 11-20% and may represent additional distinct species. In addition to establishing diversity among reptilian paramyxoviruses, the phylogenetic groupings showed some correlation with geographic location, and clearly demonstrated a low level of host species-specificity within these viruses. Copyright (C) 1999 Elsevier Science B.V.

The Role of 16S rRNA Gene Sequencing in Identification of Microorganisms Misidentified by Conventional Methods

PubMed Central

Petti, C. A.; Polage, C. R.; Schreckenberger, P.

2005-01-01

Traditional methods for microbial identification require the recognition of differences in morphology, growth, enzymatic activity, and metabolism to define genera and species. Full and partial 16S rRNA gene sequencing methods have emerged as useful tools for identifying phenotypically aberrant microorganisms. We report on three bacterial blood isolates from three different College of American Pathologists-certified laboratories that were referred to ARUP Laboratories for definitive identification. Because phenotypic identification suggested unusual organisms not typically associated with the submitted clinical diagnosis, consultation with the Medical Director was sought and further testing was performed including partial 16S rRNA gene sequencing. All three patients had endocarditis, and conventional methods identified isolates from patients A, B, and C as a Facklamia sp., Eubacterium tenue, and a Bifidobacterium sp. 16S rRNA gene sequencing identified the isolates as Enterococcus faecalis, Cardiobacterium valvarum, and Streptococcus mutans, respectively. We conclude that the initial identifications of these three isolates were erroneous, may have misled clinicians, and potentially impacted patient care. 16S rRNA gene sequencing is a more objective identification tool, unaffected by phenotypic variation or technologist bias, and has the potential to reduce laboratory errors. PMID:16333109

High-Throughput Block Optical DNA Sequence Identification.

PubMed

Sagar, Dodderi Manjunatha; Korshoj, Lee Erik; Hanson, Katrina Bethany; Chowdhury, Partha Pratim; Otoupal, Peter Britton; Chatterjee, Anushree; Nagpal, Prashant

2018-01-01

Optical techniques for molecular diagnostics or DNA sequencing generally rely on small molecule fluorescent labels, which utilize light with a wavelength of several hundred nanometers for detection. Developing a label-free optical DNA sequencing technique will require nanoscale focusing of light, a high-throughput and multiplexed identification method, and a data compression technique to rapidly identify sequences and analyze genomic heterogeneity for big datasets. Such a method should identify characteristic molecular vibrations using optical spectroscopy, especially in the "fingerprinting region" from ≈400-1400 cm -1 . Here, surface-enhanced Raman spectroscopy is used to demonstrate label-free identification of DNA nucleobases with multiplexed 3D plasmonic nanofocusing. While nanometer-scale mode volumes prevent identification of single nucleobases within a DNA sequence, the block optical technique can identify A, T, G, and C content in DNA k-mers. The content of each nucleotide in a DNA block can be a unique and high-throughput method for identifying sequences, genes, and other biomarkers as an alternative to single-letter sequencing. Additionally, coupling two complementary vibrational spectroscopy techniques (infrared and Raman) can improve block characterization. These results pave the way for developing a novel, high-throughput block optical sequencing method with lossy genomic data compression using k-mer identification from multiplexed optical data acquisition. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

On site DNA barcoding by nanopore sequencing

PubMed Central

Menegon, Michele; Cantaloni, Chiara; Rodriguez-Prieto, Ana; Centomo, Cesare; Abdelfattah, Ahmed; Rossato, Marzia; Bernardi, Massimo; Xumerle, Luciano; Loader, Simon; Delledonne, Massimo

2017-01-01

Biodiversity research is becoming increasingly dependent on genomics, which allows the unprecedented digitization and understanding of the planet’s biological heritage. The use of genetic markers i.e. DNA barcoding, has proved to be a powerful tool in species identification. However, full exploitation of this approach is hampered by the high sequencing costs and the absence of equipped facilities in biodiversity-rich countries. In the present work, we developed a portable sequencing laboratory based on the portable DNA sequencer from Oxford Nanopore Technologies, the MinION. Complementary laboratory equipment and reagents were selected to be used in remote and tough environmental conditions. The performance of the MinION sequencer and the portable laboratory was tested for DNA barcoding in a mimicking tropical environment, as well as in a remote rainforest of Tanzania lacking electricity. Despite the relatively high sequencing error-rate of the MinION, the development of a suitable pipeline for data analysis allowed the accurate identification of different species of vertebrates including amphibians, reptiles and mammals. In situ sequencing of a wild frog allowed us to rapidly identify the species captured, thus confirming that effective DNA barcoding in the field is possible. These results open new perspectives for real-time-on-site DNA sequencing thus potentially increasing opportunities for the understanding of biodiversity in areas lacking conventional laboratory facilities. PMID:28977016

Polymerase cross-linking spiral reaction (PCLSR) for detection of African swine fever virus (ASFV) in pigs and wild boars

PubMed Central

Woźniakowski, Grzegorz; Frączyk, Magdalena; Kowalczyk, Andrzej; Pomorska-Mól, Małgorzata; Niemczuk, Krzysztof; Pejsak, Zygmunt

2017-01-01

The study reports the development of a polymerase cross-linking spiral reaction (PCLSR) for the detection of African swine fever virus (ASFV) DNA in blood collected from infected pigs and wild boars. The method uses 3 specifically designed primers. Two outer-spiral primers comprising of 3′ sequences complementary to ASFV p72 gene sequence and 5′end sequences complementary to exogenous gene of black widow alpha-latrotoxin as well as additional ASFV specific cross-linking primer. The method is specific exclusively to ASFV DNA without cross-reactions with cDNA of classical swine fever virus (CSFV), porcine reproductive respiratory syndrome (PRRSV) or porcine epidemic diarrhea virus (PEDV). The sensitivity of this technique reached 7.2 × 102 copies per μl−1 of plasmid containing p72 gene. The PCLSR was conducted at 65 °C creating cross-linked complex structures. The results of PCLSR were visualized using SYBR Green I dye, gel electrophoresis while the reaction progress was traced using real-time PCR system that resulted in registration of fluorescent curves and melting peaks at 85.3 °C. The developed PCLSR was examined using blood or tissue samples collected from selected 17 ASF cases from infected wild boars and 3 outbreaks in pigs. Further tests have been also conducted using 55 tissue samples from 23 outbreaks and 22 cases. These results showed that PCLSR might be further used for preliminary and cost-effective detection and surveillance of ASFV. PMID:28198455

Polymerase cross-linking spiral reaction (PCLSR) for detection of African swine fever virus (ASFV) in pigs and wild boars.

PubMed

Woźniakowski, Grzegorz; Frączyk, Magdalena; Kowalczyk, Andrzej; Pomorska-Mól, Małgorzata; Niemczuk, Krzysztof; Pejsak, Zygmunt

2017-02-15

The study reports the development of a polymerase cross-linking spiral reaction (PCLSR) for the detection of African swine fever virus (ASFV) DNA in blood collected from infected pigs and wild boars. The method uses 3 specifically designed primers. Two outer-spiral primers comprising of 3' sequences complementary to ASFV p72 gene sequence and 5'end sequences complementary to exogenous gene of black widow alpha-latrotoxin as well as additional ASFV specific cross-linking primer. The method is specific exclusively to ASFV DNA without cross-reactions with cDNA of classical swine fever virus (CSFV), porcine reproductive respiratory syndrome (PRRSV) or porcine epidemic diarrhea virus (PEDV). The sensitivity of this technique reached 7.2 × 10 2 copies per μl -1 of plasmid containing p72 gene. The PCLSR was conducted at 65 °C creating cross-linked complex structures. The results of PCLSR were visualized using SYBR Green I dye, gel electrophoresis while the reaction progress was traced using real-time PCR system that resulted in registration of fluorescent curves and melting peaks at 85.3 °C. The developed PCLSR was examined using blood or tissue samples collected from selected 17 ASF cases from infected wild boars and 3 outbreaks in pigs. Further tests have been also conducted using 55 tissue samples from 23 outbreaks and 22 cases. These results showed that PCLSR might be further used for preliminary and cost-effective detection and surveillance of ASFV.

ACVP-05: Virus Genetic Analysis from Cell-Free Plasma, Virally Infected Cells or Tissues and Cultured Supernatant Via Single Genome Amplification and Direct Sequencing | Frederick National Laboratory for Cancer Research

Cancer.gov

The Viral Evolution Core within the AIDS and Cancer Virus Program will extract viral RNA/DNA from cell-free or cell-associated samples. Complementary (cDNA) will be generated as needed, and cDNA or DNA will be diluted to a single copy prior to nested

Simulations Meet Experiment to Reveal New Insights into DNA Intrinsic Mechanics

PubMed Central

Ben Imeddourene, Akli; Elbahnsi, Ahmad; Guéroult, Marc; Oguey, Christophe; Foloppe, Nicolas; Hartmann, Brigitte

2015-01-01

The accurate prediction of the structure and dynamics of DNA remains a major challenge in computational biology due to the dearth of precise experimental information on DNA free in solution and limitations in the DNA force-fields underpinning the simulations. A new generation of force-fields has been developed to better represent the sequence-dependent B-DNA intrinsic mechanics, in particular with respect to the BI ↔ BII backbone equilibrium, which is essential to understand the B-DNA properties. Here, the performance of MD simulations with the newly updated force-fields Parmbsc0εζOLI and CHARMM36 was tested against a large ensemble of recent NMR data collected on four DNA dodecamers involved in nucleosome positioning. We find impressive progress towards a coherent, realistic representation of B-DNA in solution, despite residual shortcomings. This improved representation allows new and deeper interpretation of the experimental observables, including regarding the behavior of facing phosphate groups in complementary dinucleotides, and their modulation by the sequence. It also provides the opportunity to extensively revisit and refine the coupling between backbone states and inter base pair parameters, which emerges as a common theme across all the complementary dinucleotides. In sum, the global agreement between simulations and experiment reveals new aspects of intrinsic DNA mechanics, a key component of DNA-protein recognition. PMID:26657165

Inferring the Brassica rapa Interactome Using Protein–Protein Interaction Data from Arabidopsis thaliana

PubMed Central

Yang, Jianhua; Osman, Kim; Iqbal, Mudassar; Stekel, Dov J.; Luo, Zewei; Armstrong, Susan J.; Franklin, F. Chris H.

2013-01-01

Following successful completion of the Brassica rapa sequencing project, the next step is to investigate functions of individual genes/proteins. For Arabidopsis thaliana, large amounts of protein–protein interaction (PPI) data are available from the major PPI databases (DBs). It is known that Brassica crop species are closely related to A. thaliana. This provides an opportunity to infer the B. rapa interactome using PPI data available from A. thaliana. In this paper, we present an inferred B. rapa interactome that is based on the A. thaliana PPI data from two resources: (i) A. thaliana PPI data from three major DBs, BioGRID, IntAct, and TAIR. (ii) ortholog-based A. thaliana PPI predictions. Linking between B. rapa and A. thaliana was accomplished in three complementary ways: (i) ortholog predictions, (ii) identification of gene duplication based on synteny and collinearity, and (iii) BLAST sequence similarity search. A complementary approach was also applied, which used known/predicted domain–domain interaction data. Specifically, since the two species are closely related, we used PPI data from A. thaliana to predict interacting domains that might be conserved between the two species. The predicted interactome was investigated for the component that contains known A. thaliana meiotic proteins to demonstrate its usability. PMID:23293649

Complementary fMRI and EEG evidence for more efficient neural processing of rhythmic vs. unpredictably timed sounds

PubMed Central

van Atteveldt, Nienke; Musacchia, Gabriella; Zion-Golumbic, Elana; Sehatpour, Pejman; Javitt, Daniel C.; Schroeder, Charles

2015-01-01

The brain’s fascinating ability to adapt its internal neural dynamics to the temporal structure of the sensory environment is becoming increasingly clear. It is thought to be metabolically beneficial to align ongoing oscillatory activity to the relevant inputs in a predictable stream, so that they will enter at optimal processing phases of the spontaneously occurring rhythmic excitability fluctuations. However, some contexts have a more predictable temporal structure than others. Here, we tested the hypothesis that the processing of rhythmic sounds is more efficient than the processing of irregularly timed sounds. To do this, we simultaneously measured functional magnetic resonance imaging (fMRI) and electro-encephalograms (EEG) while participants detected oddball target sounds in alternating blocks of rhythmic (e.g., with equal inter-stimulus intervals) or random (e.g., with randomly varied inter-stimulus intervals) tone sequences. Behaviorally, participants detected target sounds faster and more accurately when embedded in rhythmic streams. The fMRI response in the auditory cortex was stronger during random compared to random tone sequence processing. Simultaneously recorded N1 responses showed larger peak amplitudes and longer latencies for tones in the random (vs. the rhythmic) streams. These results reveal complementary evidence for more efficient neural and perceptual processing during temporally predictable sensory contexts. PMID:26579044

Partial structure of the phylloxin gene from the giant monkey frog, Phyllomedusa bicolor: parallel cloning of precursor cDNA and genomic DNA from lyophilized skin secretion.

PubMed

Chen, Tianbao; Gagliardo, Ron; Walker, Brian; Zhou, Mei; Shaw, Chris

2005-12-01

Phylloxin is a novel prototype antimicrobial peptide from the skin of Phyllomedusa bicolor. Here, we describe parallel identification and sequencing of phylloxin precursor transcript (mRNA) and partial gene structure (genomic DNA) from the same sample of lyophilized skin secretion using our recently-described cloning technique. The open-reading frame of the phylloxin precursor was identical in nucleotide sequence to that previously reported and alignment with the nucleotide sequence derived from genomic DNA indicated the presence of a 175 bp intron located in a near identical position to that found in the dermaseptins. The highly-conserved structural organization of skin secretion peptide genes in P. bicolor can thus be extended to include that encoding phylloxin (plx). These data further reinforce our assertion that application of the described methodology can provide robust genomic/transcriptomic/peptidomic data without the need for specimen sacrifice.

Tziminema unachi n. gen., n. sp. (Nematoda: Strongylidae: Strongylinae) parasite of Baird's tapir Tapirus bairdii from Mexico.

PubMed

Güiris-Andrade, D M; Oceguera-Figueroa, A; Osorio-Sarabia, D; Pérez-Escobar, M E; Nieto-López, M G; Rojas-Hernández, N M; García-Prieto, L

2017-11-20

A new genus and species of nematode, Tziminema unachi n. gen., n. sp. is described from the caecum and colon of Baird's tapir Tapirus bairdii (Gill, 1865), found dead in the Reserva de la Biósfera El Triunfo, Chiapas State, in the Neotropical realm of Mexico. Tziminema n. gen. differs from the other nine genera included in the Strongylinae by two main characteristics: having 7-9 posteriorly directed tooth-like structures at the anterior end of the buccal capsule, and the external surface of the buccal capsule being heavily striated. Phylogenetic analyses of the DNA sequences of the mitochondrial cytochrome c oxidase and nuclear DNA, including a partial sequence of the internal transcribed spacer 1, 5.8S and a partial sequence of the internal transcribed spacer 2 of the new taxon, confirmed its inclusion in Strongylinae and its rank as a new genus.

A double-labeling procedure for sequence analysis of picomole amounts of nonradioactive RNA fragments.

PubMed Central

Gupta, R C; Randerath, E; Randerath, K

1976-01-01

A double-labeling procedure for sequence analysis of nonradioactive polyribonucleotides is detailed, which is based on controlled endonucleolytic degradation of 3'-terminally (3H)-labeled oligonucleotide-(3') dialcohols and 5"-terminal analysis of the partial (3H)-labeled fragments following their separation according to chain length by polyethyleneimine- (PEI-)cellulose TLC and detection by fluorography. Undesired nonradioactive partial digestion products are eliminated by periodate oxidation. The 5'-termini are assayed by enzymic incorporation of (32p)-label into the isolated fragments, enzymic release of (32p)-labeled nucleoside-(5') monophosphates, two-dimensional PEI-cellulose chromatography, and autoradiography. Using this procedure, as little as 0.1 - 0.3 A260 unit of tRNA is needed to sequence all fragments in complete ribonuclease T1 and A digests, whereas radioactive derivative methods previously described by us1-4 required 4 - 6 A260 units. Images PMID:826884

Initial Detection and Molecular Characterization of Namaycush Herpesvirus (Salmonid Herpesvirus 5) in Lake Trout.

PubMed

Glenney, Gavin W; Barbash, Patricia A; Coll, John A

2016-03-01

A novel herpesvirus was found by molecular methods in samples of Lake Trout Salvelinus namaycush from Lake Erie, Pennsylvania, and Lake Ontario, Keuka Lake, and Lake Otsego, New York. Based on PCR amplification and partial sequencing of polymerase, terminase, and glycoprotein genes, a number of isolates were identified as a novel virus, which we have named Namaycush herpesvirus (NamHV) salmonid herpesvirus 5 (SalHV5). Phylogenetic analyses of three NamHV genes indicated strong clustering with other members of the genus Salmonivirus, placing these isolates into family Alloherpesviridae. The NamHV isolates were identical in the three partially sequenced genes; however, they varied from other salmonid herpesviruses in nucleotide sequence identity. In all three of the genes sequenced, NamHV shared the highest sequence identity with Atlantic Salmon papillomatosis virus (ASPV; SalHV4) isolated from Atlantic Salmon Salmo salar in northern Europe, including northwestern Russia. These results lead one to believe that NamHV and ASPV have a common ancestor that may have made a relatively recent host jump from Atlantic Salmon to Lake Trout or vice versa. Partial nucleotide sequence comparisons between NamHV and ASPV for the polymerase and glycoprotein genes differ by >5% and >10%, respectively. Additional nucleotide sequence comparisons between NamHV and epizootic epitheliotropic disease virus (EEDV/SalHV3) in the terminase, glycoprotein, and polymerase genes differ by >5%, >20%, and >10%, respectively. Thus, NamHV and EEDV may be occupying discrete ecological niches in Lake Trout. Even though NamHV shared the highest genetic identity with ASPV, each of these viruses has a separate host species, which also implies speciation. Additionally, NamHV has been detected over the last 4 years in four separate water bodies across two states, which suggests that NamHV is a distinct, naturally replicating lineage. This, in combination with a divergence in nucleotide sequence from EEDV, indicates that NamHV is a new species in the genus Salmonivirus. Received April 20, 2015; accepted October 11, 2015.

Biomimetic DNA emulsions: specific, thermo-reversible and adjustable binding from a liquid-like DNA layer

NASA Astrophysics Data System (ADS)

Pontani, Lea-Laetitia; Feng, Lang; Dreyfus, Remi; Seeman, Nadrian; Chaikin, Paul; Brujic, Jasna

2013-03-01

We develop micron-sized emulsions coated with specific DNA sequences and complementary sticky ends. The emulsions are stabilized with phospholipids on which the DNA strands are grafted through biotin-streptavidin interactions, which allows the DNA to diffuse freely on the surface. We produce two complementary emulsions: one is functionalized with S sticky ends and dyed with red streptavidin, the other displays the complementary S' sticky ends and green streptavidin. Mixing those emulsions reveals specific adhesion between them due to the short-range S-S' hybridization. As expected this interaction is thermo-reversible: the red-green adhesive droplets dissociate upon heating and reassemble after cooling. Here the fluid phospholipids layer also leads to diffusive adhesion patches, which allows the bound droplets to rearrange throughout the packing structure. We quantify the adhesion strength between two droplets and build a theoretical framework that captures the observed trends through parameters such as the size of the droplets, the DNA surface density, the various DNA constructs or the temperature. This colloidal-scale, specific, thermo-reversible biomimetic emulsion offers a new versatile and powerful tool for the development of complex self-assembled materials.

Vertically stacked multi-heterostructures of layered materials for logic transistors and complementary inverters

PubMed Central

Yu, Woo Jong; Li, Zheng; Zhou, Hailong; Chen, Yu; Wang, Yang; Huang, Yu; Duan, Xiangfeng

2014-01-01

The layered materials such as graphene have attracted considerable interest for future electronics. Here we report the vertical integration of multi-heterostructures of layered materials to enable high current density vertical field-effect transistors (VFETs). An n-channel VFET is created by sandwiching few-layer molybdenum disulfide (MoS2) as the semiconducting channel between a monolayer graphene and a metal thin film. The VFETs exhibit a room temperature on-off ratio >103, while at same time deliver a high current density up to 5,000 A/cm2, sufficient for high performance logic applications. This study offers a general strategy for the vertical integration of various layered materials to obtain both p- and n-channel transistors for complementary logic functions. A complementary inverter with larger than unit voltage gain is demonstrated by vertically stacking the layered materials of graphene, Bi2Sr2Co2O8 (p-channel), graphene, MoS2 (n-channel), and metal thin film in sequence. The ability to simultaneously achieve high on-off ratio, high current density, and logic integration in the vertically stacked multi-heterostructures can open up a new dimension for future electronics to enable three-dimensional integration. PMID:23241535

Leptospira species molecular epidemiology in the genomic era.

PubMed

Caimi, K; Repetto, S A; Varni, V; Ruybal, P

2017-10-01

Leptospirosis is a zoonotic disease which global burden is increasing often related to climatic change. Hundreds of whole genome sequences from worldwide isolates of Leptospira spp. are available nowadays, together with online tools that permit to assign MLST sequence types (STs) directly from raw sequence data. In this work we have applied R7L-MLST to near 500 genomes and strains collection globally distributed. All 10 pathogenic species as well as intermediate were typed using this MLST scheme. The correlation observed between STs and serogroups in our previous work, is still satisfied with this higher dataset sustaining the implementation of MLST to assist serological classification as a complementary approach. Bayesian phylogenetic analysis of concatenated sequences from R7-MLST loci allowed us to resolve taxonomic inconsistencies but also showed that events such as recombination, gene conversion or lateral gene transfer played an important role in the evolution of Leptospira genus. Whole genome sequencing allows us to contribute with suitable epidemiologic information useful to apply in the design of control strategies and also in diagnostic methods for this illness. Copyright © 2017 Elsevier B.V. All rights reserved.

Sequencing the oligosaccharide pool in the low molecular weight heparin dalteparin with offline HPLC and ESI-MS/MS.

PubMed

Wang, Zhangjie; Zhang, Tianji; Xie, Shaoshuai; Liu, Xinyue; Li, Hongmei; Linhardt, Robert J; Chi, Lianli

2018-03-01

Low molecular weight heparins (LMWHs) are widely used anticoagulant drugs. The composition and sequence of LMWH oligosaccharides determine their safety and efficacy. The short oligosaccharide pool in LMWHs undergoes more depolymerization reactions than the longer chains and is the most sensitive indicator of the manufacturing process. Electrospray ionization tandem mass spectrometry (ESI-MS/MS) has been demonstrated as a powerful tool to sequence synthetic heparin oligosaccharide but never been applied to analyze complicated mixture like LMWHs. We established an offline strong anion exchange (SAX)-high performance liquid chromatography (HPLC) and ESI-MS/MS approach to sequence the short oligosaccharides of dalteparin sodium. With the help of in-house developed MS/MS interpretation software, the sequences of 18 representative species ranging from tetrasaccharide to octasaccharide were obtained. Interestingly, we found a novel 2,3-disulfated hexauronic acid structure and reconfirmed it by complementary heparinase digestion and LC-MS/MS analysis. This approach provides straightforward and in-depth insight to the structure of LMWHs and the reaction mechanism of heparin depolymerization. Copyright © 2017 Elsevier Ltd. All rights reserved.

A simple procedure for parallel sequence analysis of both strands of 5'-labeled DNA.

PubMed

Razvi, F; Gargiulo, G; Worcel, A

1983-08-01

Ligation of a 5'-labeled DNA restriction fragment results in a circular DNA molecule carrying the two 32Ps at the reformed restriction site. Double digestions of the circular DNA with the original enzyme and a second restriction enzyme cleavage near the labeled site allows direct chemical sequencing of one 5'-labeled DNA strand. Similar double digestions, using an isoschizomer that cleaves differently at the 32P-labeled site, allows direct sequencing of the now 3'-labeled complementary DNA strand. It is possible to directly sequence both strands of cloned DNA inserts by using the above protocol and a multiple cloning site vector that provides the necessary restriction sites. The simultaneous and parallel visualization of both DNA strands eliminates sequence ambiguities. In addition, the labeled circular molecules are particularly useful for single-hit DNA cleavage studies and DNA footprint analysis. As an example, we show here an analysis of the micrococcal nuclease-induced breaks on the two strands of the somatic 5S RNA gene of Xenopus borealis, which suggests that the enzyme may recognize and cleave small AT-containing palindromes along the DNA helix.

SELEX and SHAPE reveal that sequence motifs and an extended hairpin in the 5' portion of Turnip crinkle virus satellite RNA C mediate fitness in plants.

PubMed

Bayne, Charlie F; Widawski, Max E; Gao, Feng; Masab, Mohammed H; Chattopadhyay, Maitreyi; Murawski, Allison M; Sansevere, Robert M; Lerner, Bryan D; Castillo, Rinaldys J; Griesman, Trevor; Fu, Jiantao; Hibben, Jennifer K; Garcia-Perez, Alma D; Simon, Anne E; Kushner, David B

2018-07-01

Noncoding RNAs use their sequence and/or structure to mediate function(s). The 5' portion (166 nt) of the 356-nt noncoding satellite RNA C (satC) of Turnip crinkle virus (TCV) was previously modeled to contain a central region with two stem-loops (H6 and H7) and a large connecting hairpin (H2). We now report that in vivo functional selection (SELEX) experiments assessing sequence/structure requirements in H2, H6, and H7 reveal that H6 loop sequence motifs were recovered at nonrandom rates and only some residues are proposed to base-pair with accessible complementary sequences within the 5' central region. In vitro SHAPE of SELEX winners indicates that the central region is heavily base-paired, such that along with the lower stem and H2 region, one extensive hairpin exists composing the entire 5' region. As these SELEX winners are highly fit, these characteristics facilitate satRNA amplification in association with TCV in plants. Copyright © 2018 Elsevier Inc. All rights reserved.

Survey of local and global biological network alignment: the need to reconcile the two sides of the same coin.

PubMed

Guzzi, Pietro Hiram; Milenkovic, Tijana

2018-05-01

Analogous to genomic sequence alignment that allows for across-species transfer of biological knowledge between conserved sequence regions, biological network alignment can be used to guide the knowledge transfer between conserved regions of molecular networks of different species. Hence, biological network alignment can be used to redefine the traditional notion of a sequence-based homology to a new notion of network-based homology. Analogous to genomic sequence alignment, there exist local and global biological network alignments. Here, we survey prominent and recent computational approaches of each network alignment type and discuss their (dis)advantages. Then, as it was recently shown that the two approach types are complementary, in the sense that they capture different slices of cellular functioning, we discuss the need to reconcile the two network alignment types and present a recent first step in this direction. We conclude with some open research problems on this topic and comment on the usefulness of network alignment in other domains besides computational biology.

RNA Editing in Plant Mitochondria

NASA Astrophysics Data System (ADS)

Hiesel, Rudolf; Wissinger, Bernd; Schuster, Wolfgang; Brennicke, Axel

1989-12-01

Comparative sequence analysis of genomic and complementary DNA clones from several mitochondrial genes in the higher plant Oenothera revealed nucleotide sequence divergences between the genomic and the messenger RNA-derived sequences. These sequence alterations could be most easily explained by specific post-transcriptional nucleotide modifications. Most of the nucleotide exchanges in coding regions lead to altered codons in the mRNA that specify amino acids better conserved in evolution than those encoded by the genomic DNA. Several instances show that the genomic arginine codon CGG is edited in the mRNA to the tryptophan codon TGG in amino acid positions that are highly conserved as tryptophan in the homologous proteins of other species. This editing suggests that the standard genetic code is used in plant mitochondria and resolves the frequent coincidence of CGG codons and tryptophan in different plant species. The apparently frequent and non-species-specific equivalency of CGG and TGG codons in particular suggests that RNA editing is a common feature of all higher plant mitochondria.

Endophytic bacterial diversity in grapevine (Vitis vinifera L.) leaves described by 16S rRNA gene sequence analysis and length heterogeneity-PCR.

PubMed

Bulgari, Daniela; Casati, Paola; Brusetti, Lorenzo; Quaglino, Fabio; Brasca, Milena; Daffonchio, Daniele; Bianco, Piero Attilio

2009-08-01

Diversity of bacterial endophytes associated with grapevine leaf tissues was analyzed by cultivation and cultivation-independent methods. In order to identify bacterial endophytes directly from metagenome, a protocol for bacteria enrichment and DNA extraction was optimized. Sequence analysis of 16S rRNA gene libraries underscored five diverse Operational Taxonomic Units (OTUs), showing best sequence matches with gamma-Proteobacteria, family Enterobacteriaceae, with a dominance of the genus Pantoea. Bacteria isolation through cultivation revealed the presence of six OTUs, showing best sequence matches with Actinobacteria, genus Curtobacterium, and with Firmicutes genera Bacillus and Enterococcus. Length Heterogeneity-PCR (LH-PCR) electrophoretic peaks from single bacterial clones were used to setup a database representing the bacterial endophytes identified in association with grapevine tissues. Analysis of healthy and phytoplasma-infected grapevine plants showed that LH-PCR could be a useful complementary tool for examining the diversity of bacterial endophytes especially for diversity survey on a large number of samples.

Comparison of sequencing-based methods to profile DNA methylation and identification of monoallelic epigenetic modifications

PubMed Central

Harris, R. Alan; Wang, Ting; Coarfa, Cristian; Nagarajan, Raman P.; Hong, Chibo; Downey, Sara L.; Johnson, Brett E.; Fouse, Shaun D.; Delaney, Allen; Zhao, Yongjun; Olshen, Adam; Ballinger, Tracy; Zhou, Xin; Forsberg, Kevin J.; Gu, Junchen; Echipare, Lorigail; O’Geen, Henriette; Lister, Ryan; Pelizzola, Mattia; Xi, Yuanxin; Epstein, Charles B.; Bernstein, Bradley E.; Hawkins, R. David; Ren, Bing; Chung, Wen-Yu; Gu, Hongcang; Bock, Christoph; Gnirke, Andreas; Zhang, Michael Q.; Haussler, David; Ecker, Joseph; Li, Wei; Farnham, Peggy J.; Waterland, Robert A.; Meissner, Alexander; Marra, Marco A.; Hirst, Martin; Milosavljevic, Aleksandar; Costello, Joseph F.

2010-01-01

Sequencing-based DNA methylation profiling methods are comprehensive and, as accuracy and affordability improve, will increasingly supplant microarrays for genome-scale analyses. Here, four sequencing-based methodologies were applied to biological replicates of human embryonic stem cells to compare their CpG coverage genome-wide and in transposons, resolution, cost, concordance and its relationship with CpG density and genomic context. The two bisulfite methods reached concordance of 82% for CpG methylation levels and 99% for non-CpG cytosine methylation levels. Using binary methylation calls, two enrichment methods were 99% concordant, while regions assessed by all four methods were 97% concordant. To achieve comprehensive methylome coverage while reducing cost, an approach integrating two complementary methods was examined. The integrative methylome profile along with histone methylation, RNA, and SNP profiles derived from the sequence reads allowed genome-wide assessment of allele-specific epigenetic states, identifying most known imprinted regions and new loci with monoallelic epigenetic marks and monoallelic expression. PMID:20852635

Between Two Fern Genomes

PubMed Central

2014-01-01

Ferns are the only major lineage of vascular plants not represented by a sequenced nuclear genome. This lack of genome sequence information significantly impedes our ability to understand and reconstruct genome evolution not only in ferns, but across all land plants. Azolla and Ceratopteris are ideal and complementary candidates to be the first ferns to have their nuclear genomes sequenced. They differ dramatically in genome size, life history, and habit, and thus represent the immense diversity of extant ferns. Together, this pair of genomes will facilitate myriad large-scale comparative analyses across ferns and all land plants. Here we review the unique biological characteristics of ferns and describe a number of outstanding questions in plant biology that will benefit from the addition of ferns to the set of taxa with sequenced nuclear genomes. We explain why the fern clade is pivotal for understanding genome evolution across land plants, and we provide a rationale for how knowledge of fern genomes will enable progress in research beyond the ferns themselves. PMID:25324969

Added Value of Next-Generation Sequencing for Multilocus Sequence Typing Analysis of a Pneumocystis jirovecii Pneumonia Outbreak1.

PubMed

Charpentier, Elena; Garnaud, Cécile; Wintenberger, Claire; Bailly, Sébastien; Murat, Jean-Benjamin; Rendu, John; Pavese, Patricia; Drouet, Thibault; Augier, Caroline; Malvezzi, Paolo; Thiébaut-Bertrand, Anne; Mallaret, Marie-Reine; Epaulard, Olivier; Cornet, Muriel; Larrat, Sylvie; Maubon, Danièle

2017-08-01

Pneumocystis jirovecii is a major threat for immunocompromised patients, and clusters of pneumocystis pneumonia (PCP) have been increasingly described in transplant units during the past decade. Exploring an outbreak transmission network requires complementary spatiotemporal and strain-typing approaches. We analyzed a PCP outbreak and demonstrated the added value of next-generation sequencing (NGS) for the multilocus sequence typing (MLST) study of P. jirovecii strains. Thirty-two PCP patients were included. Among the 12 solid organ transplant patients, 5 shared a major and unique genotype that was also found as a minor strain in a sixth patient. A transmission map analysis strengthened the suspicion of nosocomial acquisition of this strain for the 6 patients. NGS-MLST enables accurate determination of subpopulation, which allowed excluding other patients from the transmission network. NGS-MLST genotyping approach was essential to deciphering this outbreak. This innovative approach brings new insights for future epidemiologic studies on this uncultivable opportunistic fungus.

Added Value of Next-Generation Sequencing for Multilocus Sequence Typing Analysis of a Pneumocystis jirovecii Pneumonia Outbreak1

PubMed Central

Charpentier, Elena; Garnaud, Cécile; Wintenberger, Claire; Bailly, Sébastien; Murat, Jean-Benjamin; Rendu, John; Pavese, Patricia; Drouet, Thibault; Augier, Caroline; Malvezzi, Paolo; Thiébaut-Bertrand, Anne; Mallaret, Marie-Reine; Epaulard, Olivier; Cornet, Muriel; Larrat, Sylvie

2017-01-01

Pneumocystis jirovecii is a major threat for immunocompromised patients, and clusters of pneumocystis pneumonia (PCP) have been increasingly described in transplant units during the past decade. Exploring an outbreak transmission network requires complementary spatiotemporal and strain-typing approaches. We analyzed a PCP outbreak and demonstrated the added value of next-generation sequencing (NGS) for the multilocus sequence typing (MLST) study of P. jirovecii strains. Thirty-two PCP patients were included. Among the 12 solid organ transplant patients, 5 shared a major and unique genotype that was also found as a minor strain in a sixth patient. A transmission map analysis strengthened the suspicion of nosocomial acquisition of this strain for the 6 patients. NGS-MLST enables accurate determination of subpopulation, which allowed excluding other patients from the transmission network. NGS-MLST genotyping approach was essential to deciphering this outbreak. This innovative approach brings new insights for future epidemiologic studies on this uncultivable opportunistic fungus. PMID:28726611