Sample records for patients alpha-amylase inhibitors

  1. Some aspects of the mechanism of complexation of red kidney bean alpha-amylase inhibitor and alpha-amylase.


    Wilcox, E R; Whitaker, J R


    Bovine pancreatic alpha-amylase binds 1 mol of acarbose (a carbohydrate alpha-amylase inhibitor) per mol at the active site and also binds acarbose nonspecifically. The red kidney bean alpha-amylase inhibitor-bovine pancreatic alpha-amylase complex retained nonspecific binding for acarbose only. Binding of p-nitrophenyl alpha-D-maltoside to the final complex of red kidney bean alpha-amylase inhibitor and bovine pancreatic alpha-amylase has a beta Ks (Ks') value that is 3.4-fold greater than the Ks (16 mM) of alpha-amylase for p-nitrophenyl alpha-D-maltoside alone. The initial complex of alpha-amylase and inhibitor apparently hydrolyzes this substrate as rapidly as alpha-amylase alone. The complex retains affinity for substrates and competitive inhibitors, which, when present in high concentrations, cause dissociation of the complex. Maltose (0.5 M), a competitive inhibitor of alpha-amylase, caused dissociation of the red kidney bean alpha-amylase inhibitor--alpha-amylase complex. Interaction between red kidney bean (Phaseolus vulgaris) alpha-amylase inhibitor and porcine pancreatic alpha-amylase proceeds through two steps. The first step has a Keq of 3.1 X 10(-5) M. The second step (unimolecular; first order) has a forward rate constant of 3.05 min-1 at pH 6.9 and 30 degrees C. alpha-Amylase inhibitor combines with alpha-amylase, in the presence of p-nitrophenyl alpha-D-maltoside, noncompetitively. On the basis of the data presented, it is likely that alpha-amylase is inactivated by the alpha-amylase inhibitor through a conformational change. A kinetic model, in the presence and absence of substrate, is described for noncompetitive, slow, tight-binding inhibitors that proceed through two steps.

  2. Zinc oxide nanoparticles as novel alpha-amylase inhibitors

    NASA Astrophysics Data System (ADS)

    Dhobale, Sandip; Thite, Trupti; Laware, S. L.; Rode, C. V.; Koppikar, Soumya J.; Ghanekar, Ruchika-Kaul; Kale, S. N.


    Amylase inhibitors, also known as starch blockers, contain substances that prevent dietary starches from being absorbed by the body via inhibiting breakdown of complex sugars to simpler ones. In this sense, these materials are projected as having potential applications in diabetes control. In this context, we report on zinc oxide nanoparticles as possible alpha-amylase inhibitors. Zinc oxide nanoparticles have been synthesized using soft-chemistry approach and 1-thioglycerol was used as a surfactant to yield polycrystalline nanoparticles of size ˜18 nm, stabilized in wurtzite structure. Conjugation study and structural characterization have been done using x-ray diffraction technique, Fourier transform infrared spectroscopy, UV-visible spectroscopy, and transmission electron microscopy. Cytotoxicity studies on human fibrosarcoma (HT-1080) and skin carcinoma (A-431) cell lines as well as mouse primary fibroblast cells demonstrate that up to a dose of 20 μg/ml, ZnO nanoparticles are nontoxic to the cells. We report for the first time the alpha-amylase inhibitory activity of ZnO nanoparticles wherein an optimum dose of 20 μg/ml was sufficient to exhibit 49% glucose inhibition at neutral pH and 35 °C temperature. This inhibitory activity was similar to that obtained with acarbose (a standard alpha-amylase inhibitor), thereby projecting ZnO nanoparticles as novel alpha-amylase inhibitors.

  3. A chimera-like alpha-amylase inhibitor suggesting the evolution of Phaseolus vulgaris alpha-amylase inhibitor.


    Wato, S; Kamei, K; Arakawa, T; Philo, J S; Wen, J; Hara, S; Yamaguchi, H


    White kidney bean (Phaseolus vulgaris) contains two kinds of alpha-amylase inhibitors, one heat-stable (alpha AI-s) and one heat-labile (alpha AI-u). alpha AI-s has recently been revealed to be a tetrameric complex, alpha(2)beta(2), with two active sites [Kasahara et al. (1996) J. Biochem. 120, 177-183]. The present study was undertaken to reveal the molecular features of alpha AI-u, which is composed of three kinds of subunits, alpha, beta, and gamma. The gamma-subunit, in contrast to the alpha- and beta-subunits that are indistinguishable from the alpha- and beta-subunits of alpha AI-s, was found to correspond to a subunit of an alpha-amylase inhibitor-like protein, which has been identified as an inactive, evolutionary intermediate between arcelin and the alpha-amylase inhibitor in a P. vulgaris defense protein family. The polypeptide molecular weight of alpha AI-u determined by the light-scattering technique, together with the polypeptide molecular weights of the subunits, suggests that alpha AI-u is a trimeric complex, alpha beta gamma. The inhibition of alpha AI-u by increasing amounts of porcine pancreatic alpha-amylase (PPA) indicates that an inactive 1:1 complex is formed between alpha AI-u and PPA. Molecular weight estimation of the complex by the light-scattering technique confirmed that it is a complex of alpha AI-u with one PPA molecule. Thus it seems probable that alpha AI-u is an evolutionary intermediate of the P. vulgaris alpha-amylase inhibitor.

  4. Identification of alpha amylase inhibitors from Syzygium cumini Linn seeds.


    Karthic, K; Kirthiram, K S; Sadasivam, S; Thayumanavan, B


    The aqueous extract of S. cumini or Eugenia jambolana seeds and Psidium guajava leaves showed higher inhibition against the porcine pancreatic alpha-amylase among the medicinal plants studied. The alpha-amylase inhibitors from S. cumini seeds were separated from the extract by preparative thin layer chromatography into fractions with different Rf values. The fraction with Rf value between 0.285 and 0.43, which showed maximum inhibitory activity, was eluted and analyzed through LC-MS. The compounds identified from the seed extract ofS. cumini were betulinic acid and 3,5,7,4'-tetrahydroxy flavanone, which were reported earlier from S. formosanum and other plants. Dixon plot showed that the inhibition was noncompetitive in nature.

  5. Structural basis for the inhibition of mammalian and insect alpha-amylases by plant protein inhibitors.


    Payan, Françoise


    Alpha-amylases are ubiquitous proteins which play an important role in the carbohydrate metabolism of microorganisms, animals and plants. Living organisms use protein inhibitors as a major tool to regulate the glycolytic activity of alpha-amylases. Most of the inhibitors for which three-dimensional (3-D) structures are available are directed against mammalian and insect alpha-amylases, interacting with the active sites in a substrate-like manner. In this review, we discuss the detailed inhibitory mechanism of these enzymes in light of the recent determination of the 3-D structures of pig pancreatic, human pancreatic, and yellow mealworm alpha-amylases in complex with plant protein inhibitors. In most cases, the mechanism of inhibition occurs through the direct blockage of the active center at several subsites of the enzyme. Inhibitors exhibiting "dual" activity against mammalian and insect alpha-amylases establish contacts of the same type in alternative ways.

  6. Structure activity relationships of flavonoids as potent alpha-amylase inhibitors.


    Yuan, Erdong; Liu, Benguo; Wei, Qingyi; Yang, Jiguo; Chen, Lei; Li, Qiong


    The effects of three flavonoids (quercetin, luteolin, diosmetin) on alpha-amylase were examined by enzymatic kinetics and fluorescence spectroscopy. The three test flavonoids were non-competitive inhibitors of the enzyme. Addition of flavonoids led to fluorescence quenching of alpha-amylase. The quenching was initiated from the formation of a complex between the flavonoids and the enzyme, corresponding to a static quenching process. An alpha-amylase molecule provides a binding site for the test flavonoid. The main binding force was hydrophobic. The decreasing order of inhibition of alpha-amylase by flavonoids and the binding force was luteolin, diosmetin, and quercetin. It is demonstrated that hydroxylation in ring C and methylation of the hydroxyl group in ring B of flavonoids may weaken the binding affinities to alpha-amylase.

  7. Activity of alpha-amylase inhibitors from Phaseolus coccineus on digestive alpha-amylases of the coffee berry borer.


    Valencia-Jiménez, Arnubio; Arboleda Valencia, Jorge W; Grossi-De-Sá, Maria Fátima


    Seeds of scarlet runner bean ( Phaseolus coccineus L.) were analyzed for alpha-amylase inhibitor (alpha-AI) activity. Through the use of polyclonal antibodies raised against pure alpha-AI-1 from common bean ( Phaseolus vulgaris L.), typical alpha-AlphaIota polypeptides (Mr 14-18 kDa) as well as a large polypeptide of Mr 32000 Da, usually referred to as "amylase inhibitor like", were detected. The inhibitor activity present in four accessions of P. coccineus was examined, both in semiquantitative zymograms allowing the separation of different isoforms and in quantitative assays against human salivary amylase, porcine pancreatic amylase, and coffee berry borer, Hypothenemus hampei Ferrari (Coleoptera: Scolytidae) amylase. Differential inhibition curves lead to the suggestion that the gene encoding one of the inhibitors in P. coccineus (in accession G35590) would be a good candidate for genetic engineering of coffee resistance toward the coffee berry borer. An in vitro proteolytic digestion treatment of pure alpha-AlphaIota-1 resulted in a rapid loss of the inhibitory activity, seriously affecting its natural capacity to interact with mammalian alpha-amylases.

  8. Biochemical characterization of the alpha-amylase inhibitor in mungbeans and its application in inhibiting the growth of Callosobruchus maculatus.


    Wisessing, Anussorn; Engkagul, Arunee; Wongpiyasatid, Arunee; Choowongkomon, Kiattawee


    The insect Callosobruchus maculatus causes considerable damage to harvested mungbean seeds every year, which leads to commercial losses. However, recent studies have revealed that mungbean seeds contain alpha-amylase inhibitors that can inhibit the protein C. maculatus, preventing growth and development of the insect larvae in the seed, thus preventing further damage. For this reason, the use of alpha-amylase inhibitors to interfere with the pest's digestion process has become an interesting alternative biocontrolling agent. In this study, we have isolated and purified the alpha-amylase inhibitor from mungbean seeds (KPS1) using ammonium sulfate precipitation, gel filtration chromatography and reversed phase HPLC. We found that the alpha-amylase inhibitor, isolated as a monomer, had a molecular weight of 27 kDa. The alpha-amylase inhibitor was purified 750-fold with a final yield of 0.4 mg of protein per 30 g of mungbean seeds. Its specific activity was determined at 14.5 U (mg of protein)(-1). Interestingly, we found that the isolated alpha-amylase inhibitor inhibits C. maculatus alpha-amylase but not human salivary alpha-amylase. After preincubation of the enzyme with the inhibitor, the mungbean alpha-amylase inhibitor inhibited C. maculatus alpha-amylase activity by decreasing V(max) while increasing the K(m) constant, indicating that the mungbean alpha-amylase is a mix noncompetitive inhibitor. The in vivo effect of alpha-amylase inhibitor on the mortality of C. maculatus shows that the alpha-amylase inhibitor acts on C. maculatus during the development stage, by reducing carbohydrate digestion necessary for growth and development, rather than during the end laying/hatching stage. Our results suggest that mungbean alpha-amylase inhibitor could be a useful future biocontrolling agent.

  9. The bean. alpha. -amylase inhibitor is encoded by a lectin gene

    SciTech Connect

    Moreno, J.; Altabella, T.; Chrispeels, M.J. )


    The common bean, Phaseolus vulgaris, contains an inhibitor of insect and mammalian {alpha}-amylases that does not inhibit plant {alpha}-amylase. This inhibitor functions as an anti-feedant or seed-defense protein. We purified this inhibitor by affinity chromatography and found that it consists of a series of glycoforms of two polypeptides (Mr 14,000-19,000). Partial amino acid sequencing was carried out, and the sequences obtained are identical with portions of the derived amino acid sequence of a lectin-like gene. This lectin gene encodes a polypeptide of MW 28,000, and the primary in vitro translation product identified by antibodies to the {alpha}-amylase inhibitor has the same size. Co- and posttranslational processing of this polypeptide results in glycosylated polypeptides of 14-19 kDa. Our interpretation of these results is that the bean lectins constitute a gene family that encodes diverse plant defense proteins, including phytohemagglutinin, arcelin and {alpha}-amylase inhibitor.

  10. Structural characterization of an alpha-amylase inhibitor from a wild common bean (Phaseolus vulgaris): insight into the common structural features of leguminous alpha-amylase inhibitors.


    Nakaguchi, T; Arakawa, T; Philo, J S; Wen, J; Ishimoto, M; Yamaguchi, H


    The primary structures of two subunits of an alpha-amylase inhibitor (alpha AI-2) from a wild common bean (Phaseolus vulgaris) were revealed by a comparison of the amino acid sequence previously deduced from the nucleotide sequence with the amino- and carboxyl-terminal amino acid sequences determined by conventional methods. The polypeptide molecular weight of alpha AI-2 obtained by the light-scattering technique, considered together with the sequence molecular weights revealed for the subunits, indicated that alpha AI-2 has the subunit stoichiometry of an alpha 2 beta 2 complex. These structural features were closely similar to those recently elucidated for a white kidney bean (P. vulgaris) alpha-amylase inhibitor, which is quite different in the inhibitory specificity from alpha AI-2. The post-translational processing of the precursor glycoproteins to form the tetrameric structure appeared to require an Arg residue close to the processing site. Further, the proper associations of the subunits into the tetrameric structures seemed to be strictly controlled by a few amino acids on the subunit interfaces.

  11. Screening alpha-glucosidase and alpha-amylase inhibitors from natural compounds by molecular docking in silico.


    Jhong, Chien-Hung; Riyaphan, Jirawat; Lin, Shih-Hung; Chia, Yi-Chen; Weng, Ching-Feng


    The alpha-glucosidase inhibitor is a common oral anti-diabetic drug used for controlling carbohydrates normally converted into simple sugars and absorbed by the intestines. However, some adverse clinical effects have been observed. The present study seeks an alternative drug that can regulate the hyperglycemia by down-regulating alpha-glucosidase and alpha-amylase activity by molecular docking approach to screen the hyperglycemia antagonist against alpha-glucosidase and alpha-amylase activities from the 47 natural compounds. The docking data showed that Curcumin, 16-hydroxy-cleroda-3,13-dine-16,15-olide (16-H), Docosanol, Tetracosanol, Antroquinonol, Berberine, Catechin, Quercetin, Actinodaphnine, and Rutin from 47 natural compounds had binding ability towards alpha-amylase and alpha-glucosidase as well. Curcumin had a better biding ability of alpha-amylase than the other natural compounds. Analyzed alpha-glucosidase activity reveals natural compound inhibitors (below 0.5 mM) are Curcumin, Actinodaphnine, 16-H, Quercetin, Berberine, and Catechin when compared to the commercial drug Acarbose (3 mM). A natural compound with alpha-amylase inhibitors (below 0.5 mM) includes Curcumin, Berberine, Docosanol, 16-H, Actinodaphnine/Tetracosanol, Catechin, and Quercetin when compared to Acarbose (1 mM). When taken together, the implication is that molecular docking is a fast and effective way to screen alpha-glucosidase and alpha-amylase inhibitors as lead compounds of natural sources isolated from medicinal plants.

  12. Alpha amylase is a major allergenic component in occupational asthma patients caused by porcine pancreatic extract.


    Park, Hae-Sim; Kim, Hee-Yeon; Suh, You-Jin; Lee, Soo-Jin; Lee, Soo-Keol; Kim, Sun-Sin; Nahm, Dong-Ho


    Porcine pancreatic extracts (PPE) are composed of alpha-amylase and lipase, which are common components of digestive enzymes. They have been known to cause occupational asthma in exposed workers in pharmaceutical and baking industries, as well as in a laboratory technician, but there has been no report of PPE-induced occupational asthma in medical personnel and their IgE binding components to each component. Four asthmatic subjects showing positive results on PPE-bronchoprovocation testing were enrolled. All of them were nurses working in a university hospital. Their job included grinding and mixing PPE powder for admitted patients. Serum-specific IgE antibodies to PPE, alpha-amylase, and lipase were measured by enzyme linked immunosorbent assay (ELISA). To confirm specificity of IgE binding and cross-allergenicity among the three extracts, ELISA inhibition tests were performed. In order to characterize allergenic components within these three extracts, SDS-PAGE and IgE immunoblot analysis were done. Specific IgE antibodies to PPE, alpha-amylase, and lipase were detectable by ELISA in all study subjects. An alpha-amylase ELISA inhibition test showed significant inhibitions by amylase and PPE, and minimal inhibition by lipase. However, a lipase ELISA inhibition test showed significant inhibitions by alpha-amylase and PPE with a lesser degree of inhibition by lipase. Furthermore, IgE immunoblot analysis showed one IgE binding component (55 kDa) within PPE, six components (55 kDa, 43 kDa, 41 kDa, 32 kDa, 31 kDa, 29 kDa) within alpha-amylase and two components (31 kDa, 29 kDa) within lipase extracts. Thesefindings suggest that inhalation of PPE powder can induce IgE-mediated bronchoconstriction in exposed nurses. Alpha-amylase is a major allergenic component within PPE.

  13. Solution structure of the main alpha-amylase inhibitor from amaranth seeds.


    Martins, J C; Enassar, M; Willem, R; Wieruzeski, J M; Lippens, G; Wodak, S J


    The most abundant alpha-amylase inhibitor (AAI) present in the seeds of Amaranthus hypochondriacus, a variety of the Mexican crop plant amaranth, is the smallest polypeptide (32 residues) known to inhibit alpha-amylase activity of insect larvae while leaving that of mammals unaffected. In solution, 1H NMR reveals that AAI isolated from amaranth seeds adopts a major trans (70%) and minor cis (30%) conformation, resulting from slow cis-trans isomerization of the Val15-Pro16 peptide bond. Both solution structures have been determined using 2D 1H-NMR spectroscopy and XPLOR followed by restrained energy refinement in the consistent-valence force field. For the major isomer, a total of 563 distance restraints, including 55 medium-range and 173 long-range ones, were available from the NOESY spectra. This rather large number of constraints from a protein of such a small size results from a compact fold, imposed through three disulfide bridges arranged in a cysteine-knot motif. The structure of the minor cis isomer has also been determined using a smaller constraint set. It reveals a different backbone conformation in the Pro10-Pro20 segment, while preserving the overall global fold. The energy-refined ensemble of the major isomer, consisting of 20 low-energy conformers with an average backbone rmsd of 0.29 +/- 0.19 A and no violations larger than 0.4 A, represents a considerable improvement in precision over a previously reported and independently performed calculation on AAI obtained through solid-phase synthesis, which was determined with only half the number of medium-range and long-range restraints reported here, and featured the trans isomer only. The resulting differences in ensemble precision have been quantified locally and globally, indicating that, for regions of the backbone and a good fraction of the side chains, the conformation is better defined in the new solution structure. Structural comparison of the solution structure with the X-ray structure of the

  14. Protein structures of common bean (Phaseolus vulgaris) alpha-amylase inhibitors.


    Lee, Shih-Chieh; Gepts, Paul L; Whitaker, John R


    Two nucleotide sequences for genes that encode alpha-amylase inhibitor 4 (alphaAI-4) from white kidney bean (WKB) cv. 858, designated gene alphaAI-4 (Accession No. ), and alpha-amylase inhibitor 5 (alphaAI-5) from black bean (BB), designated gene alphaAI-5 (Accession No. ), were determined. Genes alphaAI-4 and alphaAI-5 encode 244 amino acid prepro-alphaAI-4 and prepro-alphaAI-5 polypeptides that are 93 and 95% identical with alpha-amylase inhibitor l (alphaAI-l; Hoffman, L. M.; Ma, Y.; Barker, R. F. Nucleic Acids Res. 1982, 10, 7819-7828), 40 and 43% identical with red kidney bean lectin, and 52 and 55% identical with arcelin l of wild-type bean. The high degree of sequence similarity indicates the evolutionary relationship among these genes. PCR analysis of genomic DNA purified from six genotypes of Phaseolus vulgaris showed very similar band patterns in 2% agarose gel, another indication of the conserved size homology among these genes. Proteolytic processing sites were located between Asn77 and Ser78 for pro-alphaAI-4 and pro-alphaAI-5. A bend next to Asn77 in three-dimensional model structures of alphaAI-4 and alphaAI-5 proinhibitors indicates that the proteolytic cleavage is necessary to remove the conformational constraint for activation to the mature protein. Mature WKB alphaAI-4 was composed of four subunits (2alpha2beta) and had a molecular weight of 50000 determined by multiangle laser light scattering and 56714 determined by laser-assisted time-of-flight mass spectrometry.

  15. Activation of bean (Phaseolus vulgaris) [alpha]-amylase inhibitor requires proteolytic processing of the proprotein

    SciTech Connect

    Pueyo, J.J.; Hunt, D.C.; Chrispeels, M.J. )


    Seeds of the common bean (Phaseolus vulgaris) contain a plant defense protein that inhibits the [alpha]-amylases of mammals and insects. This [alpha]-amylase inhibitor ([alpha]Al) is synthesized as a proprotein on the endoplasmic reticulum and is proteolytically processed after arrival in the protein storage vacuoles to polypeptides of relative molecular weight (M[sub r]) 15,000 to 18,000. The authors report two types of evidence that proteolytic processing is linked to activation of the inhibitory activity. First, by surveying seed extracts of wild accessions of P. vulgaris and other species in the genus Phaseolus, they found that antibodies to [alpha]Al recognize large (M[sub r] 30,000-35,000) polypeptides as well as typical [alpha]Al processing products (M[sub r] 15,000-18,000). [alpha]Al activity was found in all extracts that had the typical [alpha]Al processed polypeptides, but was absent from seed extracts that lacked such polypeptides. Second, they made a mutant [alpha]Al in which asparagine-77 is changed to aspartic acid-77. This mutation slows down the proteolytic processing of pro-[alpha]Al when the gene is expressed in tobacco. When pro-[alpha]Al was separated from mature [alpha]Al by gel filtration, pro-[alpha]Al was found not to have [alpha]-amylase inhibitory activity. The authors interpret these results to mean that formation of the active inhibitor is causally related to proteolytic processing of the proprotein. They suggest that the polypeptide cleavage removes a conformation constraint on the precursor to produce the biochemically active molecule. 43 refs., 5 figs., 1 tab.

  16. Complete sequence, subunit structure, and complexes with pancreatic alpha-amylase of an alpha-amylase inhibitor from Phaseolus vulgaris white kidney beans.


    Kasahara, K; Hayashi, K; Arakawa, T; Philo, J S; Wen, J; Hara, S; Yamaguchi, H


    The complete amino acid sequence of a white kidney bean (Phaseolus vulgaris) alpha-amylase inhibitor (PHA-I), which is composed of two kinds of glycopolypeptide subunits, alpha and beta, was established by conventional methods. The polypeptide molecular weight of PHA-I determined by the light-scattering technique, considered together with the sequence molecular weights revealed for the subunits, indicated that PHA-I has the subunit stoichiometry of (alpha beta)2 complex. Inhibition test of PHA-I with increasing amounts of porcine pancreatic alpha-amylase (PPA) suggested that an inactive 2:1 complex is formed between PPA and PHA-I. In fact, two complexes differing from each other in the molar ratio of PPA to PHA-I were separated by gel filtration, and molecular weight estimation by the light-scattering technique confirmed that they are complexes of PHA-I with one or two PPA molecules. The binding of PPA to PHA-I appeared to follow simple binomial statistics, suggesting that two binding sites on PHA-I are independent and of high affinity for PPA.

  17. Digestive alpha-amylases of the flour moth Ephestia kuehniella--adaptation to alkaline environment and plant inhibitors.


    Pytelková, Jana; Hubert, Jan; Lepsík, Martin; Sobotník, Jan; Sindelka, Radek; Krízková, Iva; Horn, Martin; Mares, Michael


    The digestive tract of lepidopteran insects is extremely alkaline. In the present work, molecular adaptation of amylolytic enzymes to this environment was investigated in the flour moth Ephestia kuehniella, an important stored-product pest. Three digestive alpha-amylases [Ephestia kuehniella alpha-amylase isoenzymes 1-3 (EkAmy1-3)] with an alkaline pH optimum were purified from larvae and biochemically characterized. These isoenzymes differ significantly in their sensitivity to alpha-amylase inhibitors of plant origin that are directed against herbivores as antifeedants. Such functional variability renders the amylolytic system less vulnerable to suppression by plant defensive molecules. Moreover, we found that expression of alpha-amylases is upregulated in larvae feeding on a diet enriched with an alpha-amylase inhibitor. The alpha-amylases are secreted into the larval midgut by an exocytotic mechanism, as revealed by immunogold microscopy. The cDNA sequence of EkAmy3 was determined, and a homology model of EkAmy3 was built in order to analyze the structural features responsible for adaptation to alkaline pH. First, the overall fold was found to be stabilized by remodeling of ion pairs. Second, molecular simulations supported by activity measurements showed that EkAmy3 does not bind a Cl(-), owing to an Arg-to-Gln mutation in a conserved binding site. The Cl(-)-binding residues are in contact with the catalytic residues, and this change might help to fine-tune the catalytic pK(a) values to an alkaline pH optimum. We conclude that lepidopteran alpha-amylases are evolutionarily adapted in terms of structure and expression dynamics for effective functioning in the digestive system.

  18. Selective inhibition of histidine-modified pancreatic alpha-amylase by proteinaceous inhibitor from Phaseolus vulgaris.


    Nakatani, H


    Chemical modification of two histidine residues of porcine pancreatic alpha-amylase (EC by diethyl pyrocarbonate in the presence of a high concentration of maltotriose caused a decrease of amylase activity and an increase of maltosidase activity (hydrolysis of p-nitrophenyl-alpha-maltoside). By binding a proteinaceous inhibitor from Phaseolus vulgaris (white kidney bean) with the modified enzyme, the amylase activity was further decreased but the maltosidase activity was retained to about 100% that of the native enzyme. Both amylase and maltosidase activities of the native enzyme were almost completely inhibited by the proteinaceous inhibitor. The increase of maltosidase activity by histidine modification was due to an increase of kcat, whereas the Km value was not changed; but binding of the proteinous inhibitor affected mainly the Km value of the modified enzyme.

  19. Digestive alpha-amylases from Tecia solanivora larvae (Lepidoptera: Gelechiidae): response to pH, temperature and plant amylase inhibitors.


    Valencia-Jiménez, A; Arboleda, J W; López Avila, A; Grossi-de-Sá, M F


    The biochemical properties of the digestive alpha-amylase from Tecia solanivora larvae, an important and invasive insect pest of potato (Solanum tuberosum), were studied. This insect has three major digestive alpha-amylases with isoelectric points 5.30, 5.70 and 5.98, respectively, which were separated using native and isoelectric focusing gels. The alpha-amylase activity has an optimum pH between 7.0 and 10.0 with a peak at pH 9.0. The enzymes are stable when heated to 50 degrees C and were inhibited by proteinaceous inhibitors from Phaseolus coccineus (70% inhibition) and P. vulgaris cv. Radical (87% inhibition) at pH 6.0. The inhibitors present in an amaranth hybrid inhibited 80% of the activity at pH 9.0. The results show that the alpha-amylase inhibitor from amaranth seeds may be a better candidate to make genetically-modified potatoes resistant to this insect than inhibitors from common bean seeds.

  20. Identification of essential amino acid residues of an alpha-amylase inhibitor from Phaseolus vulgaris white kidney beans.


    Takahashi, T; Hiramoto, S; Wato, S; Nishimoto, T; Wada, Y; Nagai, K; Yamaguchi, H


    Kidney bean (Phaseolus vulgaris) alpha-amylase inhibitors, which are bivalent inhibitors with the subunit stoichiometry of (alphabeta)(2) complex, have been inferred to contain unique arginine, tryptophan, and tyrosine residues essential for the inhibitory activity. To test the validity of this inference, an attempt was made to identify the essential amino acid residues of a white kidney bean (P. vulgaris) alpha-amylase inhibitor (PHA-I) by using the chemical modification technique combined with amino acid sequencing and mass spectrometry. Exhaustive modification of the arginine residues by phenylglyoxal did not lead to a marked loss of activity, suggesting that no arginine residue is directly associated with the inhibitory activity. N-Bromosuccinimide treatment of PHA-I in the presence or absence of a substrate alpha-amylase revealed the involvement of two tryptophan residues in alpha-amylase inhibition, and they were identified as Trp188 of the beta-subunit by amino acid sequencing and mass spectrometry of lysylendopeptidase peptides. Further, two tyrosine residues were preferentially modified either by N-acetylimidazole or by tetranitromethane, resulting in a concomitant loss of most of the PHA-I activity. Amino acid sequencing of the lysylendopeptidase peptides from a tetranitromethane-modified PHA-I identified Tyr186 of the beta-subunit as an essential residue.

  1. Protective mechanism of the Mexican bean weevil against high levels of alpha-amylase inhibitor in the common bean.


    Ishimoto, M; Chrispeels, M J


    Alpha-amylase inhibitor (alpha AI) protects seeds of the common bean (Phaseolus vulgaris) against predation by certain species of bruchids such as the cowpea weevil (Callosobruchus maculatus) and the azuki bean weevil (Callosobruchus chinensis), but not against predation by the bean weevil (Acanthoscelides obtectus) or the Mexican bean weevil (Zabrotes subfasciatus), insects that are common in the Americas. We characterized the interaction of alpha AI-1 present in seeds of the common bean, of a different isoform, alpha AI-2, present in seeds of wild common bean accessions, and of two homologs, alpha AI-Pa present in seeds of the tepary bean (Phaseolus acutifolius) and alpha AI-Pc in seeds of the scarlet runner bean (Phaseolus coccineus), with the midgut extracts of several bruchids. The extract of the Z. subfasciatus larvae rapidly digests and inactivates alpha AI-1 and alpha AI-Pc, but not alpha AI-2 or alpha AI-Pa. The digestion is caused by a serine protease. A single proteolytic cleavage in the beta subunit of alpha AI-1 occurs at the active site of the protein. When degradation is prevented, alpha AI-1 and alpha AI-Pc do not inhibit the alpha-amylase of Z. subfasciatus, although they are effective against the alpha-amylase of C. chinensis. Alpha AI-2 and alpha AI-Pa, on the other hand, do inhibit the alpha-amylase of Z. subfasciatus, suggesting that they are good candidates for genetic engineering to achieve resistance to Z. subfasciatus.

  2. Capillary electrophoresis as a screening tool for alpha amylase inhibitors in plant extracts

    PubMed Central

    Hamdan, Imad I.; Afifi, Fatima U.


    Capillary electrophoresis (CE) method was developed for screening plant extract for potential alpha amylase (AA) inhibitory activity. The method was validated against a well established UV method. Overall, the proposed method was shown able to detect plants with significant alpha amylase inhibitory activity but not those with rather clinically insignificant activities. Fifty plant species were screened using both the proposed CE method and the UV method and seven plant species were found to possess significant AA inhibitory activities. Two plant species were proved to have alpha amylase inhibitory activity for the first time. PMID:24115900

  3. Crystal structure determination and inhibition studies of a novel xylanase and alpha-amylase inhibitor protein (XAIP) from Scadoxus multiflorus.


    Kumar, Sanjit; Singh, Nagendra; Sinha, Mau; Dube, Divya; Singh, S Baskar; Bhushan, Asha; Kaur, Punit; Srinivasan, Alagiri; Sharma, Sujata; Singh, Tej P


    A novel plant protein isolated from the underground bulbs of Scadoxus multiflorus, xylanase and alpha-amylase inhibitor protein (XAIP), inhibits two structurally and functionally unrelated enzymes: xylanase and alpha-amylase. The mature protein contains 272 amino acid residues which show sequence identities of 48% to the plant chitinase hevamine and 36% to xylanase inhibitor protein-I, a double-headed inhibitor of GH10 and GH11 xylanases. However, unlike hevamine, it is enzymatically inactive and, unlike xylanase inhibitor protein-I, it inhibits two functionally different classes of enzyme. The crystal structure of XAIP has been determined at 2.0 A resolution and refined to R(cryst) and R(free) factors of 15.2% and 18.6%, respectively. The polypeptide chain of XAIP adopts a modified triosephosphate isomerase barrel fold with eight beta-strands in the inner circle and nine alpha-helices forming the outer ring. The structure contains three cis peptide bonds: Gly33-Phe34, Tyr159-Pro160 and Trp253-Asp254. Although hevamine has a long accessible carbohydrate-binding channel, in XAIP this channel is almost completely filled with the side-chains of residues Phe13, Pro77, Lys78 and Trp253. Solution studies indicate that XAIP inhibits GH11 family xylanases and GH13 family alpha-amylases through two independent binding sites located on opposite surfaces of the protein. Comparison of the structure of XAIP with that of xylanase inhibitor protein-I, and docking studies, suggest that loops alpha3-beta4 and alpha4-beta5 may be involved in the binding of GH11 xylanase, and that helix alpha7 and loop beta6-alpha6 are suitable for the interaction with alpha-amylase.

  4. Transgenic cowpea (Vigna unguiculata) seeds expressing a bean alpha-amylase inhibitor 1 confer resistance to storage pests, bruchid beetles.


    Solleti, Siva Kumar; Bakshi, Souvika; Purkayastha, Jubilee; Panda, Sanjib Kumar; Sahoo, Lingaraj


    Cowpea is one of the important grain legumes. Storage pests, Callosobruchus maculatus and C. chinensis cause severe damage to the cowpea seeds during storage. We employ a highly efficient Agrobacterium-mediated cowpea transformation method for introduction of the bean (Phaseolus vulgaris) alpha-amylase inhibitor-1 (alphaAI-1) gene into a commercially important Indian cowpea cultivar, Pusa Komal and generated fertile transgenic plants. The use of constitutive expression of additional vir genes in resident pSB1 vector in Agrobacterium strain LBA4404, thiol compounds during cocultivation and a geneticin based selection system resulted in twofold increase in stable transformation frequency. Expression of alphaAI-1 gene under bean phytohemagglutinin promoter results in accumulation of alphaAI-1 in transgenic seeds. The transgenic protein was active as an inhibitor of porcine alpha-amylase in vitro. Transgenic cowpeas expressing alphaAI-1 strongly inhibited the development of C. maculatus and C. chinensis in insect bioassays.

  5. Alpha-amylases of the coffee berry borer (Hypothenemus hampei) and their inhibition by two plant amylase inhibitors.


    Valencia, A; Bustillo, A E; Ossa, G E; Chrispeels, M J


    The adult coffee berry borer (Hypothenemus hampei Ferrari [Coleoptera: Scolytidae]), a major insect pest of coffee, has two major digestive alpha-amylases that can be separated by isoelectric focusing. The alpha-amylase activity has a broad pH optimum between 4.0 and 7.0. Using pH indicators, the pH of the midgut was determined to be between 4.5 and 5.2. At pH 5.0, the coffee berry borer alpha-amylase activity is inhibited substantially (80%) by relatively low levels of the amylase inhibitor (alphaAI-1) from the common bean, Phaseolus vulgaris L., and much less so by the amylase inhibitor from Amaranthus. We used an in-gel zymogram assay to demonstrate that seed extracts can be screened to find suitable inhibitors of amylases. The prospect of using the genes that encode these inhibitors to make coffee resistant to the coffee berry borer via genetic engineering is discussed.

  6. Isolation and characterization of the subunits of Phaseolus vulgaris alpha-amylase inhibitor.


    Yamaguchi, H


    An alpha-amylase inhibitor (PHA-I) of the white kidney bean (Phaseolus vulgaris) was found to be composed of two kinds of subunits and they were isolated on a size-exclusion column by HPLC under denaturing conditions. The alpha-subunit was free from tryptophan and cysteine and the beta-subunit contained no methionine or cysteine. There was no marked resemblance in tryptic peptide map between these subunit polypeptides. The alpha-subunit contained 28% by weight of carbohydrate, mainly made up of high mannose-type oligosacharides, whereas the sugar moiety of the beta-subunit amounted to 7% by weight and seemed to be predominantly composed of xylomannose-type oligosaccharides. By SDS-PAGE following deglycosylation, the molecular weights of the polypeptides of alpha- and beta-subunits were shown to be 7,800 and 14,000, respectively. These values were consistent with molecular sizes obtained for alpha- and beta-subunits by gel permeation HPLC in 6 M guanidine hydrochloride. The molecular weight of the native PHA-I, 28,800, obtained by gel permeation HPLC under non-denaturing conditions, suggested a heterodimeric structure for PHA-I.

  7. Alpha-amylase inhibitors selected from a combinatorial library of a cellulose binding domain scaffold.


    Lehtiö, J; Teeri, T T; Nygren, P A


    A disulfide bridge-constrained cellulose binding domain (CBD(WT)) derived from the cellobiohydrolase Cel7A from Trichoderma reesei has been investigated for use in scaffold engineering to obtain novel binding proteins. The gene encoding the wild-type 36 aa CBD(WT) domain was first inserted into a phagemid vector and shown to be functionally displayed on M13 filamentous phage as a protein III fusion protein with retained cellulose binding activity. A combinatorial library comprising 46 million variants of the CBD domain was constructed through randomization of 11 positions located at the domain surface and distributed over three separate beta-sheets of the domain. Using the enzyme porcine alpha-amylase (PPA) as target in biopannings, two CBD variants showing selective binding to the enzyme were characterized. Reduction and iodoacetamide blocking of cysteine residues in selected CBD variants resulted in a loss of binding activity, indicating a conformation dependent binding. Interestingly, further studies showed that the selected CBD variants were capable of competing with the binding of the amylase inhibitor acarbose to the enzyme. In addition, the enzyme activity could be partially inhibited by addition of soluble protein, suggesting that the selected CBD variants bind to the active site of the enzyme.

  8. Purification, crystallization and preliminary X-ray crystallographic analysis of rice bifunctional alpha-amylase/subtilisin inhibitor from Oryza sativa.


    Lin, Yi Hung; Peng, Wen Yan; Huang, Yen Chieh; Guan, Hong Hsiang; Hsieh, Ying Cheng; Liu, Ming Yih; Chang, Tschining; Chen, Chun Jung


    Rice bifunctional alpha-amylase/subtilisin inhibitor (RASI) can inhibit both alpha-amylase from larvae of the red flour beetle (Tribolium castaneum) and subtilisin from Bacillus subtilis. The synthesis of RASI is up-regulated during the late milky stage in developing seeds. The 8.9 kDa molecular-weight RASI from rice has been crystallized using the hanging-drop vapour-diffusion method. According to 1.81 angstroms resolution X-ray diffraction data from rice RASI crystals, the crystal belongs to space group P2(1)2(1)2, with unit-cell parameters a = 79.99, b = 62.95, c = 66.70 angstroms. Preliminary analysis indicates two RASI molecules in an asymmetric unit with a solvent content of 44%.

  9. Characterization of. alpha. -amylase-inhibitor, a lectin-like protein in the seeds of Phaseolus vulgaris

    SciTech Connect

    Moreno, J.; Altabella, T.; Chrispeels, M.J. )


    The common bean, Phaseolus vulgaris, contains a glycoprotein that inhibits the activity of mammalian and insect {alpha}-amylases but not of plant {alpha}-amylases. It is therefore classified as an antifeedant or seed defense protein. In P. vulgaris cv Greensleeves, {alpha}-amylase inhibitor ({alpha}Al) is present in embryonic axes and cotyledons, but not in other organs of the plant. The protein is synthesized during the same time period that phaseolin and phytohemagglutinin are made and also accumulates in the protein storage vacuoles (protein bodies). All the glycoforms have complex glycans that are resistant to removal by endoglycosidase H, indicating transport of the protein through the Golgi apparatus. The two different polypeptides correspond to the N-terminal and C-terminal halves of a lectin-like protein encoded by an already identified gene or a gene closely related to it. The primary translation product of {alpha}Al is a polypeptide of M{sub r} 28,000. Immunologically cross-reacting glycopolypeptides of M{sub r} 30,000 to 35,000 are present in the endoplasmic reticulum, while the smaller polypeptides (M{sub r} 15,000-19,000) accumulate in protein storage vacuoles (protein bodies). Together these data indicate that {alpha}Al is a typical bean lectin-type protein that is synthesized on the rough endoplasmic reticulum, modified in the Golgi, and transported to the protein storage vacuoles.

  10. Tobacco plants transformed with the bean. alpha. ai gene express an inhibitor of insect. alpha. -amylase in their seeds. [Nicotiana tabacum; Tenebrio molitor

    SciTech Connect

    Altabella, T.; Chrispeels, M.J. )


    Bean (Phaseolus vulgaris L.) seeds contain a putative plant defense protein that inhibits insect and mammalian but not plant {alpha}-amylases. We recently presented strong circumstantial evidence that this {alpha}-amylase inhibitor ({alpha}Al) is encoded by an already-identified lectin gene whose product is referred to as lectin-like-protein (LLP). We have now made a chimeric gene consisting of the coding sequence of the lectin gene that encodes LLP and the 5{prime} and 3{prime} flanking sequences of the lectin gene that encodes phytohemagglutinin-L. When this chimeric gene was expressed in transgenic tobacco (Nicotiana tabacum), we observed in the seeds a series of polypeptides (M{sub r} 10,000-18,000) that cross-react with antibodies to the bean {alpha}-amylase inhibitor. Most of these polypeptides bind to a pig pancreas {alpha}-amylase affinity column. An extract of the seeds of the transformed tobacco plants inhibits pig pancreas {alpha}-amylase activity as well as the {alpha}-amylase present in the midgut of Tenebrio molitor. We suggest that introduction of this lectin gene (to be called {alpha}ai) into other leguminous plants may be a strategy to protect the seeds from the seed-eating larvae of Coleoptera.

  11. Molecular structure of a barley alpha-amylase-inhibitor complex: implications for starch binding and catalysis.


    Kadziola, A; Søgaard, M; Svensson, B; Haser, R


    alpha-Amylases are widely occurring, multidomain proteins with a catalytic (beta/alpha)8-barrel. In barley alpha-amylase, insight into the catalytic mechanism is gained from the X-ray crystal structure of its molecular complex with acarbose, a pseudotetrasaccharide that acts like a transition-state analogue and which is shown to bind at two specific regions of the enzyme. The structure of the complex has been refined to an R-factor of 15.1% for all observations with Fo>sigma(Fo) between 10 and 2.8 A resolution. A difference Fourier map produced after refinement of the native structure against the data of the acarbose complex clearly revealed density corresponding to two oligosaccharide-binding sites. One of these is defined as the surface-located starch granule-binding site characteristic of cereal alpha-amylases. It involves stacking of two acarbose rings on Trp276 and Trp277. The other binding region is the active site covering subsites -1, +1 and +2. Here, Glu204 is positioned to act in general acid/base catalysis protonating the glucosidic oxygen atom assisted by Asp289. A water molecule that bridges Glu204 and Asp289 is found at the entrance cavity containing a total of five water molecules. This water molecule is proposed to reprotonate Glu204 and supply the hydroxyl ion for nucleophilic attack on the glucosyl C1 atom. Asp 179 acts as the nucleophile that can bind covalently to the substrate intermediate after bond cleavage. The present complex structure together with the conservation of active-site residues among alpha-amylases and related enzymes, are consistent with a common catalytic mechanism for this class of retaining carbohydrases.

  12. Salivary Alpha-Amylase Enzyme, Psychological Disorders, and Life Quality in Patients with Recurrent Aphthous Stomatitis

    PubMed Central

    Cardoso, Juliana Andrade; dos Santos Junior, André Avelino; Nunes, Maria Lucia Tiellet; de Figueiredo, Maria Antonia Zancanaro; Cherubini, Karen


    Objective. The aim of this study was to evaluate stress, anxiety, and salivary alpha-amylase (SAA) activity in patients with recurrent aphthous stomatitis (RAS). The impact of this disease on the life quality was also evaluated. Design. Twenty-two patients with RAS and controls, matched by sex and age, were selected. Stress and anxiety were assessed using Lipp's Inventory of Stress Symptoms and Beck Anxiety Inventory. Life quality was assessed through the World Health Organization Quality of Life-bref (WHOQOL-BREF) and the Oral Health Impact Profile-14 (OHIP-14). Saliva samples were collected in the morning and afternoon and the SAA activity was analyzed by enzymatic kinetic method. Results. No significant difference was observed between the groups regarding the SAA activity (p = 0.306). Patients with RAS had higher scores of anxiety (p = 0.016). The scores of WHOQOL-BREF were significantly lower in patients with RAS. The values obtained through OHIP-14 were significantly higher in these patients (p = 0.002). Conclusion. RAS negatively affects the life quality. Patients with the disease have higher levels of anxiety, suggesting its association with the etiopathogenesis of RAS.

  13. Interaction of wheat monomeric and dimeric protein inhibitors with alpha-amylase from yellow mealworm (Tenebrio molitor L. larva).


    Buonocore, V; Gramenzi, F; Pace, W; Petrucci, T; Poerio, E; Silano, V


    The highly purified alpha-amylase from Tenebrio molitor L. larva (yellow mealworm) reversibly combines with two closely related homogeneous glycoprotein inhibitors, one dimeric (termed 'inhibitor 0.19') and one monomeric (termed 'inhibitor 0.28'), from wheat flour. As established by means of difference spectroscopy and kinetic studies, molar combining ratios for the amylase--inhibitor-0.19 and amylase-inhibitor-0.28 complexes were 1:1 and 1:2 respectively. Two amylase--inhibitor-0.19 complexes with slightly different retention volumes on Bio-Gel P-300 and only one amylase--inhibitor-0.28 complex were observed. Dissociation constants of the amylase--inhibitor-0.19 and amylase--inhibitor-0.28 complexes were 0.85 nM and 0.13 nM respectively. A strong tendency of both complexes to precipitate under an ultracentrifugal field was observed; the minimum molecular weight calculated for the two complexes under such conditions was approx. 95 000. The two complexes showed difference spectra indicating involvement of structurally related or identical tryptophyl side chains in the binding of inhibitors 0.28 and 0.19 to the amylase. A model summarizing the main features of the inhibition of the insect amylase by the two wheat protein inhibitors is proposed.

  14. An alpha-amylase inhibitor gene from Phaseolus coccineus encodes a protein with potential for control of coffee berry borer (Hypothenemus hampei).


    de Azevedo Pereira, Railene; Nogueira Batista, João Aguiar; da Silva, Maria Cristina Mattar; Brilhante de Oliveira Neto, Osmundo; Zangrando Figueira, Edson Luiz; Valencia Jiménez, Arnubio; Grossi-de-Sa, Maria Fátima


    Plant alpha-amylase inhibitors are proteins found in several plants, and play a key role in natural defenses. In this study, a gene encoding an alpha-amylase inhibitor, named alphaAI-Pc1, was isolated from cotyledons of Phaseolus coccineus. This inhibitor has an enhanced primary structure to P. vulgaris alpha-amylase inhibitors (alpha-AI1 and alpha-AI2). The alphaAI-Pc1 gene, constructed with the PHA-L phytohemaglutinin promoter, was introduced into tobacco plants, with its expression in regenerated (T0) and progeny (T1) transformant plants monitored by PCR amplification, enzyme-linked immunosorbent assay (ELISA) and immunoblot analysis, respectively. Seed protein extracts from selected transformants reacted positively with a polyclonal antibody raised against alphaAI-1, while no reaction was observed with untransformed tobacco plants. Immunological assays showed that the alphaAI-Pc1 gene product represented up to 0.05% of total soluble proteins in T0 plants seeds. Furthermore, recombinant alphaAI-Pc1 expressed in tobacco plants was able to inhibit 65% of digestive H. hampei alpha-amylases. The data herein suggest that the protein encoded by the alphaAI-Pc1 gene has potential to be introduced into coffee plants in order to increase their resistance to the coffee berry borer.

  15. Purification and characterization of the beta-trefoil fold protein barley alpha-amylase/subtilisin inhibitor overexpressed in Escherichia coli.


    Bønsager, Birgit C; Praetorius-Ibba, Mette; Nielsen, Peter K; Svensson, Birte


    Barley alpha-amylase/subtilisin inhibitor (BASI) is a beta-trefoil fold protein related to soybean trypsin inhibitor (Kunitz) and inhibits barley alpha-amylase isozyme 2 (AMY2), which is de novo synthesized in the seed during germination. Recombinant BASI was produced in Escherichia coli in an untagged form (untagged rBASI), in two His(6)-tag forms (His(6)-rBASI and His(6)-Xa-rBASI), and in an intein-CBD-tagged form (rBASI (intein)). The yields per liter culture after purification were (i) 25 mgl(-1) His(6)-rBASI; (ii) 6 mgl(-1) rBASI purified after cleavage of His(6)-Xa-rBASI by Factor Xa; (iii) 3 mgl(-1) untagged rBASI; and (iv) 0.2 mgl(-1) rBASI after a chitin-column and autohydrolysis of the rBASI-intein-CBD. In Pichia pastoris, rBASI was secreted at 0.1 mgl(-1). The recombinant BASI forms and natural seed BASI (sBASI) all had an identical isoelectric point of 7.2 and a mass of 19,879 Da, as determined by mass spectrometry. The fold of rBASI from the different preparations was confirmed by circular dichroism spectroscopy and rBASI (intein), His(6)-rBASI, and sBASI inhibited AMY2 catalyzed starch hydrolysis with K(i) of 0.10, 0.06, and 0.09 nM, respectively. Surface plasmon resonance analysis of the formation of AMY2/rBASI (intein) gave k(on)=1.3x10(5)M(-1)s(-1), k(off)=1.4x10(-4)s(-1), and K(D)=1.1 nM, and of the savinase-His(6)-rBASI complex k(on)=21.0x10(4)M(-1)s(-1), k(off)=53.0x10(-4)s(-1), and K(D)=25.0 nM, in agreement with sBASI values. K(i) was 77 and 65 nM for inhibition of savinase activity by His(6)-rBASI and sBASI, respectively.

  16. Potential of the bean alpha-amylase inhibitor alpha-AI-1 to inhibit alpha-amylase activity in true bugs(Hemiptera)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    True bugs (Hemiptera) are an important pest complex not controlled by Bt crops. An alternative source of resistance includes inhibitors of digestive enzymes. aAI-1, an a-amylase inhibitor from the common bean, has been shown to inhibit a-amylases of bruchid pests of grain legumes. Here we quantify t...

  17. Structures of sugar chains of the subunits of an alpha-amylase inhibitor from Phaseolus vulgaris white kidney beans.


    Yamaguchi, H; Funaoka, H; Iwamoto, H


    The structures of asparagine-linked oligosaccharides in the subunits of an alpha-amylase inhibitor from the white kidney bean (Phaseolus vulgaris) were determined. Glycopeptides obtained from each subunit were treated with hydrazine, then N-acetylated. The oligosaccharides thus liberated were labeled with 2-aminopyridine at their reducing ends and purified by gel-permeation, reverse-phase, and size-fractionation HPLC. The structures of seven oligosaccharides from the alpha-subunit and eight oligosaccharides from the beta-subunit were determined by a combination of composition and molecular size analyses, exo- and endoglycosidase digestions, partial acetolysis, and 1H-NMR spectroscopy. The major glycan chains in the alpha-subunit were Man alpha 1-6(Man alpha 1-3)Man alpha 1-6(Man alpha 1-2Man alpha 1-3)-Man beta 1-4GlcNAc beta 1-4GlcNAc and (Man alpha 1-2)Man alpha 1-6(Man alpha 1-2Man alpha 1-3)Man alpha 1-6 (Man alpha 1-2Man alpha 1-2Man alpha 1-3)Man beta 1-4GlcNAc beta 1-4GlcNAc, while a glycan chain Man alpha 1-6(Man alpha 1-3)(Xyl beta 1-2)Man beta 1-4GlcNAc beta 1-4GlcNAc comprised more than 70% of the sugar moiety of the beta-subunit.

  18. A heterotetrameric alpha-amylase inhibitor from emmer (Triticum dicoccon Schrank) seeds.


    Capocchi, A; Muccilli, V; Cunsolo, V; Saletti, R; Foti, S; Fontanini, D


    Plants have developed a constitutive defense system against pest attacks, which involves the expression of a set of inhibitors acting on heterologous amylases of different origins. Investigating the soluble protein complement of the hulled wheat emmer we have isolated and characterized a heterotetrameric α-amylase inhibitor (ETI). Based on mass spectrometry data, it is an assembly of proteins highly similar to the CM2/CM3/CM16 found in durum wheat. Our data indicate that these proteins can also inhibit exogenous α-amylases in binary assemblies. The calculated dissociation constants (K(i)) for the pancreatic porcine amylase- and human salivary amylase-ETI complexes are similar to those found in durum and soft wheat. Homology modeling of the CM subunits indicate structural similarities with other proteins belonging to the cereal family of trypsin/α-amylase inhibitors; a possible homology modeled structure for a tetrameric assembly of the subunits is proposed.

  19. [Baking ingredients, especially alpha-amylase, as occupational inhalation allergens in the baking industry].


    Wüthrich, B; Baur, X


    Baker's asthma is the most frequent occupational lung disease in Switzerland and West Germany. Cereal flours, and more rarely flour parasites, are implicated as the responsible allergens. Based on an observation of a case of baker's asthma due to monovalent sensitization to alpha-amylase used as additive to flour, 31 bakers with occupational asthma and/or rhinitis were routinely tested by skin tests and serological RAST examinations for allergic sensitivity to flour, alpha-amylase and other bakery additives. 17/31 subjects (55%) reacted positively in scratch tests to a commercial powdered alpha-amylase and 13/20 (65%) to a lecithin preparation. 23/31 (74%) and 19/31 (61%) were RAST positive to wheat and to rye flour respectively. 32% had RAST specific IgE to alpha-amylase (from Aspergillus oryzae), 19.3% to soya bean flour and 16% to malt. 7/12 and 5/12 respectively reacted to trypsin inhibitor and lipoxidase, the main allergens in soya bean. In two patients monosensitization to alpha-amylase was present. In accordance with other reports we recommend that baking additives, especially alpha-amylase, should be tested in allergological diagnosis of occupational diseases in flour processing workers. Full declaration of all additives used in the bakery industry is needed.

  20. Effects of a high-pressure treatment on the wheat alpha-amylase inhibitor and its relationship to elimination of allergenicity

    NASA Astrophysics Data System (ADS)

    Yamamoto, S.; Takanohashi, K.; Hara, T.; Odani, S.; Suzuki, A.; Nishiumi, T.


    In this study, the effects of high-pressure treatment on structure and allergeincity of alpha amylase inhibitor (a-AI) were investigated. The pressure-induced structural changes of α-AI were estimated by fluorescence spectra and by fourth derivative UV-spectroscopy for probed tyrosine residues and by circular dichroism (CD) spectroscopy. The changes in the tertiary structure detected by fluorescence spectra and by fourth derivative UV-spectroscopy under high pressure were indicated at over 300 MPa. Measurements of CD spectroscopy suggested that the effects of a high-pressure treatment on changes in the secondary structure of α-AI were little. From our results, pressure-induced changes of the α-AI structure were not apparent. On the other hands, the IgE-specific binding activities of pressurized α-AI to sera from allergic patients against wheat, which is estimated by observations of dot-blotting, were decreased by high-pressure treatment. It is known that the pressure-induced elimination of allergenicity is related to the tertiary structural changes of allergen molecules. This study are suspected that the epitopes of α-AI do not contain tyrosine residues, and thus the decrease of IgE-specific binding activities is probably caused by the tertiary structural changes of these parts of α-AI.

  1. The starch-bound alpha-amylase/trypsin-inhibitors in Avena.


    Gazza, Laura; Gazzelloni, Gloria; Taddei, Federica; Latini, Arianna; Muccilli, Vera; Alfieri, Michela; Conti, Salvatore; Redaelli, Rita; Pogna, Norberto E


    Oat kernels exhibit an extra-soft texture, a trait recently demonstrated to be largely modulated by starch-bound tryptophan-rich 2S proteins, the vromindolines. In this study, fractionation by two-dimensional electrophoresis of starch-bound proteins in 25 oat (Avena sativa) cultivars and 11 diploid or tetraploid Avena species revealed novel 2S proteins called Avena α-amylase/trypsin-inhibitors (AATI) because of their sequence similarity with wheat α-amylase/trypsin inhibitors. Thirty-seven AATI polypeptides, about 14 kDa in size, were split into three families named AATI-1, AATI-2, and AATI-3 with different primary structures and isoelectric points. AATI-1 and AATI-2 proteins showed 55.5-60.0 % sequence similarity with wheat α-amylase inhibitors CM1, CM2, and CM16, which have been found to cause innate immunity responses in celiac disease and non-celiac gluten sensitivity. Diploid A-genome and tetraploid AC-genome oat species possess three and five genes encoding for the AATI proteins, respectively, whereas hexaploid A. sativa exhibits 12 genes dispersed over the A-, C-, and D-genomes. Some AATI proteins expressed in hexaploid oats were assigned to the A-genome based on similarity to their counterparts in diploid species, contributing to further clarify the genetic origin of hexaploid oats. Moreover, AATI may interact with starch-bound vromindolines in determining the extra-soft texture of oat kernels and, due to their balanced amino acid compositions, may contribute to the biological value of oat proteins in a positive manner.

  2. Bean alpha-amylase inhibitors in transgenic peas inhibit development of pea weevil larvae.


    de Sousa-Majer, Maria José; Hardie, Darryl C; Turner, Neil C; Higgins, Thomas J V


    This glasshouse study used an improved larval measurement procedure to evaluate the impact of transgenic pea, Pisum sativum L., seeds expressing a-amylase inhibitor (AI)-1 or -2 proteins on pea weevil, Bruchus pisorum L. Seeds of transgenic 'Laura' and 'Greenfeast' peas expressing alpha-(AI)-1 reduced pea weevil survival by 93-98%. Larval mortality occurred at an early instar. Conversely, in nontransgenic cultivars, approximately 98-99% of the pea weevils emerged as adults. By measuring the head capsule size, we determined that larvae died at the first to early third instar in alpha-(AI)-1 transgenic peas, indicating that this inhibitor is highly effective in controlling this insect. By contrast, transgenic Laura and 'Dundale' expressing alpha-(AI)-2 did not affect pea weevil survival, but they did delay larval development. After 77 d of development, the head capsule size indicated that the larvae were still at the third instar stage in transgenic alpha-(AI)-2 peas, whereas adult bruchids had developed in the nontransgenic peas.

  3. A proprietary alpha-amylase inhibitor from white bean (Phaseolus vulgaris): a review of clinical studies on weight loss and glycemic control.


    Barrett, Marilyn L; Udani, Jay K


    Obesity, and resultant health hazards which include diabetes, cardiovascular disease and metabolic syndrome, are worldwide medical problems. Control of diet and exercise are cornerstones of the management of excess weight. Foods with a low glycemic index may reduce the risk of diabetes and heart disease as well as their complications. As an alternative to a low glycemic index diet, there is a growing body of research into products that slow the absorption of carbohydrates through the inhibition of enzymes responsible for their digestion. These products include alpha-amylase and glucosidase inhibitors. The common white bean (Phaseolus vulgaris) produces an alpha-amylase inhibitor, which has been characterized and tested in numerous clinical studies. A specific and proprietary product named Phase 2® Carb Controller (Pharmachem Laboratories, Kearny, NJ) has demonstrated the ability to cause weight loss with doses of 500 to 3000 mg per day, in either a single dose or in divided doses. Clinical studies also show that Phase 2 has the ability to reduce the post-prandial spike in blood glucose levels. Experiments conducted incorporating Phase 2 into food and beverage products have found that it can be integrated into various products without losing activity or altering the appearance, texture or taste of the food. There have been no serious side effects reported following consumption of Phase 2. Gastro-intestinal side effects are rare and diminish upon extended use of the product. In summary, Phase 2 has the potential to induce weight loss and reduce spikes in blood sugar caused by carbohydrates through its alpha-amylase inhibiting activity.

  4. A proprietary alpha-amylase inhibitor from white bean (Phaseolus vulgaris): A review of clinical studies on weight loss and glycemic control

    PubMed Central


    Obesity, and resultant health hazards which include diabetes, cardiovascular disease and metabolic syndrome, are worldwide medical problems. Control of diet and exercise are cornerstones of the management of excess weight. Foods with a low glycemic index may reduce the risk of diabetes and heart disease as well as their complications. As an alternative to a low glycemic index diet, there is a growing body of research into products that slow the absorption of carbohydrates through the inhibition of enzymes responsible for their digestion. These products include alpha-amylase and glucosidase inhibitors. The common white bean (Phaseolus vulgaris) produces an alpha-amylase inhibitor, which has been characterized and tested in numerous clinical studies. A specific and proprietary product named Phase 2® Carb Controller (Pharmachem Laboratories, Kearny, NJ) has demonstrated the ability to cause weight loss with doses of 500 to 3000 mg per day, in either a single dose or in divided doses. Clinical studies also show that Phase 2 has the ability to reduce the post-prandial spike in blood glucose levels. Experiments conducted incorporating Phase 2 into food and beverage products have found that it can be integrated into various products without losing activity or altering the appearance, texture or taste of the food. There have been no serious side effects reported following consumption of Phase 2. Gastro-intestinal side effects are rare and diminish upon extended use of the product. In summary, Phase 2 has the potential to induce weight loss and reduce spikes in blood sugar caused by carbohydrates through its alpha-amylase inhibiting activity. PMID:21414227

  5. Association of Tenebrio molitor L. alpha-amylase with two protein inhibitors--one monomeric, one dimeric--from wheat flour. Differential scanning calorimetric comparison of heat stabilities.


    Silano, V; Zahnley, J C


    Thermal stabilization resulting from protein . protein association between two protein inhibitors (coded as 0.19, a dimer, and 0.28, a monomer) from wheat flour and the alpha-amylase from Tenebrio molitor L. (yellow mealworm) larvae was investigated by differential scanning calorimetry (heating rate 10 degrees C/min). Thermograms (plots of heat flow vs. temperature) for the two inhibitors showed broad endothermic peaks with the same extrema (denaturation temperatures) at 93 degrees C, and equal, small enthalpies of denaturation (2 cal/g). The amylase produced a sharp endotherm at 70.5 degrees C, but a larger enthalpy change on denaturation (6 cal/g). The amylase . inhibitor complexes differed in thermal stability, but both showed significant stabilization relative to free enzyme. The complex formed with monomeric inhibitor 0.28 showed a higher denaturation temperature (85.0 degrees C) than that formed with dimeric inhibitor 0.19 (80.5 degrees C). This order of stabilization agrees with the relative affinities of the inhibitors for the amylase. These thermograms are consistent with previous results which indicated that 1 mol of amylase binds 1 mol of inhibitor 0.19.

  6. Isolation and characterization of the subunits of a heat-labile alpha-amylase inhibitor from Phaseolus vulgaris white kidney bean.


    Yamaguchi, H


    The heat-labile one of the two alpha-amylase inhibitors of the white kidney bean (Phaseolus vulgaris) was found to be composed of three kinds of subunits, and they were isolated and characterized. The alpha-subunit was free from tryptophan and cysteine and the beta-subunit contained no methionine or cysteine. There was no marked resemblance in tryptic peptide maps between the alpha- and beta-subunit polypeptides. The alpha-subunit contained 30% by weight of carbohydrate, mainly made up of high mannose-oligosaccharides, and the sugar moiety of the beta-subunit amounted 7% and appeared to be predominantly composed of xylomannose-type oligosaccharides. The largest subunit, gamma, was very similar in molecular features to a postulated alpha beta-dimer and its N-terminal sequence coincided with that of the alpha-subunit. The molecular weights of the polypeptides of alpha, beta-, and gamma-subunits were shown to be 7,800, 14,000, and 22,000, respectively, by SDS-PAGE. It seemed likely that the alpha- and beta-subunits are common to both of the inhibitors and that the heat-lability of this inhibitor arises from the gamma-subunit.

  7. Bakers' asthma caused by alpha amylase.


    Valdivieso, R; Subiza, J; Subiza, J L; Hinojosa, M; de Carlos, E; Subiza, E


    Two bakers with bronchial asthma and two with rhinoconjunctivitis are described. Prick and RAST tests were positive with wheat flour in all of them, but the challenge test (nasal or bronchial) with wheat flour extract was positive only in one asthmatic baker. The prick test, RAST, and nasal or bronchial challenge done with alpha amylase extract (a glycolytic enzyme obtained from Aspergillus oryzae and used as a flour additive) were positive in all four patients. Our results support previous data indicating that alpha amylase used in bakeries is an important antigen that could cause respiratory allergy in bakers. It can function as sole causative allergen or in addition with other allergens used in the baking industry.

  8. Alpha-amylase inhibitor, CS-1036 binds to serum amylase in a concentration-dependent and saturable manner.


    Honda, Tomohiro; Kaneno-Urasaki, Yoko; Ito, Takashi; Kimura, Takako; Matsushima, Nobuko; Okabe, Hiromi; Yamasaki, Atsushi; Izumi, Takashi


    (2R,3R,4R)-4-hydroxy-2-(hydroxymethyl)pyrrolidin-3-yl 4-O-(6-deoxy-β-D-glucopyranosyl)-α-D-glucopyranoside (CS-1036), which is an α-amylase inhibitor, exhibited biphasic and sustained elimination with a long t1/2 (18.4-30.0 hours) in rats and monkeys, but exhibited a short t1/2 (3.7-7.9 hours) in humans. To clarify the species differences in the t1/2, the plasma protein binding of CS-1036 was evaluated by ultrafiltration. A concentration-dependent and saturable plasma protein binding of CS-1036 was observed in rats and monkeys with the dissociation rate constant (KD) of 8.95 and 27.2 nM, and maximal binding capacity (Bmax) of 52.8 and 22.1 nM, respectively. By the assessments of the recombinant amylase and immunoprecipitation, the major binding protein of CS-1036 in rats was identified as salivary amylase (KD 5.64 nM). CS-1036 also showed concentration-dependent and saturable binding to human salivary and pancreatic amylase, with similar binding affinity in rats. However, the protein binding of CS-1036 was constant in human plasma (≤10.2%) due to the lower serum amylase level compared with rats and monkeys. From the calculation of the unbound fraction (fu) in plasma based on in vitro KD and Bmax, the dose-dependent increase in fu after oral administration is speculated to lead to a dose-dependent increase in total body clearance and a high area under the curve/dose at lower doses, such as 0.3 mg/kg in rats.

  9. Novel prediction method of beer foam stability using protein Z, barley dimeric alpha-amylase inhibitor-1 (BDAI-1) and yeast thioredoxin.


    Iimure, Takashi; Takoi, Kiyoshi; Kaneko, Takafumi; Kihara, Makoto; Hayashi, Katsuhiro; Ito, Kazutoshi; Sato, Kazuhiro; Takeda, Kazuyoshi


    Foam stability is an important quality trait of beer. Our previous results of two-dimensional gel electrophoresis (2DE) analyses of beer proteins implied a relationship between barley dimeric alpha-amylase inhibitor-1 (BDAI-1) and beer foam stability as judged by the NIBEM-T analyzer. To develop a novel prediction method of beer foam stability under different conditions of barley cultivar and malt modification, multiple linear regression analysis was applied. The spot intensities of major beer proteins on 2DE gel were quantified and used as explanatory variables. The foam stabilities of 25 beer samples each brewed from malt with different malt modification in one of the three cultivars (cultivars A, B, and C) were explained by the spot intensities of BDAI-1 at the 5% significance level ( r = 0.421). Furthermore, two other major protein spots (b0 and b5) were observed on the 2DE gels of Japanese commercial beer samples with different foam stability. Then, multiple regression for foam stability was calculated using these three spot intensities as explanatory variables. As a result, 72.1% of the beer foam stability in 25 beer samples was explained by a novel multiple regression equation calculated using spot b0 and BDAI-1 as positive explanatory variables and spot b5 as a negative variable. To verify the validity of the multiple regression equation and the explanatory variables, the beer foam stability in practical beer samples was analyzed. As a result, 81.5% of the beer foam stability in 10 Japanese commercial beer samples was also explained by using spot b0 and BDAI-1 as positive explanatory variables and spot b5 as a negative variable. Mass spectrometry analyses followed by database searches revealed that protein spots b0 and b5 were identified as protein Z originated from barley and thioredoxin originated from yeast, respectively. These results confirm that BDAI-1 and protein Z are foam-positive factors and identify yeast thioredoxin as a possible novel foam

  10. On the mechanism of alpha-amylase.


    Oudjeriouat, Naïma; Moreau, Yann; Santimone, Marius; Svensson, Birte; Marchis-Mouren, Guy; Desseaux, Véronique


    Two inhibitors, acarbose and cyclodextrins (CD), were used to investigate the active site structure and function of barley alpha-amylase isozymes, AMY1 and AMY2. The hydrolysis of DP 4900-amylose, reduced (r) DP18-maltodextrin and maltoheptaose (catalysed by AMY1 and AMY2) was followed in the absence and in the presence of inhibitor. Without inhibitor, the highest activity was obtained with amylose, kcat/Km decreased 103-fold using rDP18-maltodextrin and 10(5) to 10(6)-fold using maltoheptaose as substrate. Acarbose is an uncompetitive inhibitor with inhibition constant (L1i) for amylose and maltodextrin in the micromolar range. Acarbose did not bind to the active site of the enzyme, but to a secondary site to give an abortive ESI complex. Only AMY2 has a second secondary binding site corresponding to an ESI2 complex. In contrast, acarbose is a mixed noncompetitive inhibitor of maltoheptaose hydrolysis. Consequently, in the presence of this oligosaccharide substrate, acarbose bound both to the active site and to a secondary binding site. alpha-CD inhibited the AMY1 and AMY2 catalysed hydrolysis of amylose, but was a very weak inhibitor compared to acarbose.beta- and gamma-CD are not inhibitors. These results are different from those obtained previously with PPA. However in AMY1, as already shown for amylases of animal and bacterial origin, in addition to the active site, one secondary carbohydrate binding site (s1) was necessary for activity whereas two secondary sites (s1 and s2) were required for the AMY2 activity. The first secondary site in both AMY1 and AMY2 was only functional when substrate was bound in the active site. This appears to be a general feature of the alpha-amylase family.

  11. Who is stressed? A pilot study of salivary cortisol and alpha-amylase concentrations in agoraphobic patients and their novice therapists undergoing in vivo exposure.


    Schumacher, Sarah; Gaudlitz, Katharina; Plag, Jens; Miller, Robert; Kirschbaum, Clemens; Fehm, Lydia; Fydrich, Thomas; Ströhle, Andreas


    In cognitive behavioural therapy of phobic anxiety, in vivo exposure is considered as an effective treatment strategy. Apparently, it involves the experience of stress and anxiety in patients. Given the therapist's role during exposure sessions, it is conceivable that the performance is also accompanied with the experience of stress in therapists, especially when unversed in conducting psychotherapy. Studies confirmed that cognitive behavioural therapists tend to avoid therapist-guided in vivo exposure. The objective of this study was the simultaneous investigation of therapist's and patient's stress response during in vivo exposure. Therefore, 23 agoraphobic patients and their 23 treating therapists in training provided five saliva samples during an in vivo exposure and five samples during an ordinary therapy session. Before and during exposure session, subjective evaluations of stress and anxiety were assessed. Results suggested that therapists reported similar levels of perceived stress as patients before exposure. Both groups displayed significantly elevated salivary cortisol (sC) levels during exposure compared to the control session and a trend for alterations in salivary alpha-amylase (sAA) activity was found. Therapists reached peak concentrations of sC before start of the intervention followed by a decline during exposure, while patients displayed peak levels of cortisol secretion after 60 min of exposure. In vivo exposure seems to be a demanding intervention not only for the patient, but also for therapists in training. However, it was also demonstrated that physiological and subjective stress rather decrease during the intervention and that both groups rated exposure to be substantially successful. Based on the presented results, another potential factor contributing to the under-usage of exposure treatment is conceivable and needs to be addressed in future research.

  12. The importance of starch and sucrose digestion in nutritive biology of synanthropic acaridid mites: alpha-amylases and alpha-glucosidases are suitable targets for inhibitor-based strategies of mite control.


    Erban, Tomas; Erbanova, Michaela; Nesvorna, Marta; Hubert, Jan


    The adaptation of nine species of mites that infest stored products for starch utilization was tested by (1) enzymatic analysis using feces and whole mite extracts, (2) biotests, and (3) inhibition experiments. Acarus siro, Aleuroglyphus ovatus, and Tyroborus lini were associated with the starch-type substrates and maltose, with higher enzymatic activities observed in whole mite extracts. Lepidoglyphus destructor was associated with the same substrates but had higher activities in feces. Dermatophagoides farinae, Chortoglyphus arcuatus, and Caloglyphus redickorzevi were associated with sucrose. Tyrophagus putrescentiae and Carpoglyphus lactis had low or intermediate enzymatic activity on the tested substrates. Biotests on starch additive diets showed accelerated growth of species associated with the starch-type substrates. The inhibitor acarbose suppressed starch hydrolysis and growth of the mites. We suggest that the species with higher starch hydrolytic activity in feces were more tolerant to acarbose, and alpha-amylase and alpha-glucosidase of synanthropic mites are suitable targets for inhibitor-based strategies of mite control.

  13. Crystal structure of yellow meal worm alpha-amylase at 1.64 A resolution.


    Strobl, S; Maskos, K; Betz, M; Wiegand, G; Huber, R; Gomis-Rüth, F X; Glockshuber, R


    The three-dimensional structure of the alpha-amylase from Tenebrio molitor larvae (TMA) has been determined by molecular replacement techniques using diffraction data of a crystal of space group P212121 (a=51.24 A; b=93.46 A; c=96.95 A). The structure has been refined to a crystallographic R-factor of 17.7% for 58,219 independent reflections in the 7.0 to 1.64 A resolution range, with root-mean-square deviations of 0.008 A for bond lengths and 1.482 degrees for bond angles. The final model comprises all 471 residues of TMA, 261 water molecules, one calcium cation and one chloride anion. The electron density confirms that the N-terminal glutamine residue has undergone a post-transitional modification resulting in a stable 5-oxo-proline residue. The X-ray structure of TMA provides the first three-dimensional model of an insect alpha-amylase. The monomeric enzyme exhibits an elongated shape approximately 75 Ax46 Ax40 A and consists of three distinct domains, in line with models for alpha-amylases from microbial, plant and mammalian origin. However, the structure of TMA reflects in the substrate and inhibitor binding region a remarkable difference from mammalian alpha-amylases: the lack of a highly flexible, glycine-rich loop, which has been proposed to be involved in a "trap-release" mechanism of substrate hydrolysis by mammalian alpha-amylases. The structural differences between alpha-amylases of various origins might explain the specificity of inhibitors directed exclusively against insect alpha-amylases.

  14. The influence of barley malt protein modification on beer foam stability and their relationship to the barley dimeric alpha-amylase inhibitor-I (BDAI-I) as a possible foam-promoting protein.


    Okada, Yoshihiro; Iimure, Takashi; Takoi, Kiyoshi; Kaneko, Takafumi; Kihara, Makoto; Hayashi, Katsuhiro; Ito, Kazutoshi; Sato, Kazuhiro; Takeda, Kazuyoshi


    The foam stability of beer is one of the important key factors in evaluating the quality of beer. The purpose of this study was to investigate the relationship between the level of malt modification (degradation of protein, starch, and so on) and the beer foam stability. This was achieved by examining foam-promoting proteins using two-dimensional gel electrophoresis (2DE). We found that the foam stability of beer samples brewed from the barley malts of cultivars B and C decreased as the level of malt modification increased; however, the foam stability of cultivar A did not change. To identify the property providing the increased foam stability of cultivar A, we analyzed beer proteins using 2DE. We analyzed three fractions that could contain beer foam-promoting proteins, namely, beer whole proteins, salt-precipitated proteins, and the proteins concentrated from beer foam. As a result, we found that in cultivar A, some protein spots did not change in any of these three protein fractions even when the level of malt modification increased, although the corresponding protein spots in cultivars B and C decreased. We analyzed these protein spots by peptide mass finger printing using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. As a result, all of these spots were identified as barley dimeric alpha-amylase inhibitor-I (BDAI-I). These results suggest that BDAI-I is an important contributor to beer foam stability.

  15. [Microbial alpha-amylases: physicochemical properties, substrate specificity and domain structure].


    Avdiiuk, K V; Varbanets', L D


    The current literature data on producers, physico-chemical properties and substrate specificity of a-amylases produced by microbes from different taxonomic groups such as bacteria, fungi and yeasts are discussed in the survey. Synthesis of alpha-amylase majority is an inducible process which is stimulated in the presence of starch or products of its hydrolysis. It is possible to increase enzymes activity level by optimization of cultivation conditions of strains-producers. alpha-Amylases, isolated from different sources are distinguished in their physico-chemical properties, particularly in their molecular weights, pH- and thermooptimums, inhibitors and activators. The enzymes hydrolyse soluble starch, amylose, amylopectin, glycogen, maltodextrins, alpha- and beta3-cyclodextrins and other carbohydrate substrates. It is well known that alpha-amylases belong to GH-13 family of glycosyl-hydrolases, which contain the catalytic domain A as (beta/alpha)8-barrel. In addition to domain A, alpha-amylases contain two other domains: B and C, which are localized approximately on opposite sides of (beta/alpha)8-barrel. Most of the known alpha-amylases contain calcium ion, which is located on the surface between domains A and B and plays an important role in stability and activity of the enzyme.

  16. Response to water deficit and high temperature of transgenic peas (Pisum sativum L.) containing a seed-specific alpha-amylase inhibitor and the subsequent effects on pea weevil (Bruchus pisorum L.) survival.


    Sousa-Majer, Maria José de; Turner, Neil C; Hardie, Darryl C; Morton, Roger L; Lamont, Byron; Higgins, Thomas J V


    The effects of water deficit and high temperature on the production of alpha-amylase inhibitor 1 (alpha-AI-1) were studied in transgenic peas (Pisum sativum L.) that were developed to control the seed-feeding pea weevil (Bruchus pisorum L., Coleoptera: Bruchidae). Transgenic and non-transgenic plants were subjected to water-deficit and high-temperature treatments under controlled conditions in the glasshouse and growth cabinet, beginning 1 week after the first pods were formed. In the water-deficit treatments, the peas were either adequately watered (control) or water was withheld after first pod formation. The high-temperature experiments were performed in two growth cabinets, one maintained at 27/22 degrees C (control) and one at 32/27 degrees C day/night temperatures, with the vapour pressure deficit maintained at 1.3 kPa. The plants exposure to high temperatures and water deficit produced 27% and 79% fewer seeds, respectively, than the controls. In the transgenic peas the level of alpha-AI-1 as a percentage of total protein was not influenced by water stress, but was reduced on average by 36.3% (the range in two experiments was 11-50%) in the high-temperature treatment. Transgenic and non-transgenic pods of plants grown at 27/22 degrees C and 32/27 degrees C were inoculated with pea weevil eggs to evaluate whether the reduction in level of alpha-AI-1 in the transgenic pea seeds affected pea weevil development and survival. At the higher temperatures, 39% of adult pea weevil emerged, compared to 1.2% in the transgenic peas grown at the lower temperatures, indicating that high temperature reduced the protective capacity of the transgenic peas.

  17. Production of alpha-amylase by yeast

    SciTech Connect

    Thomse, K.K.


    The enzyme alpha-amylase confers to an organism the enzymatic activity for the degradation of polyglucosides with alpha-1,4 glycosidic bonds such as starch and glycogen which are among the major storage compounds in plants and animals. Most alpha-amylases are single polypeptides of molecular weights around 50,000 dalton. They are generally found in the digestive tract of animals and in germinating seeds. Among the products released upon enzymatic degradation of polyglucosides maltose, a sugar that can be utilized as carbon source by yeast, is a major constituent. A cDNA segment complementary to mouse salivary amylase messenger RNA has been inserted into the yeast expression vector pMA56 behind the promoter of the gene encoding alcohol dehydrogenase I of yeast. Yeast transformants harboring plasmids with the normal orientation of the promoter and the mouse amylase cDNA gene produce amylase and release the enzyme in free form into the culture medium. Approximately 90% of the amylase activity is found in the medium. Yeast strains carrying MAL allele and transformed with a plasmid which directed the synthesis of mouse alpha-amylase were tested on plates containing starch and in batch fermentations using different high molecular weight sugars and oligosaccharides as carbon source. The results of these experiments will be discussed. (Refs. 21).

  18. New substrate specificity of modified porcine pancreatic alpha-amylase.


    Ishikawa, K; Hirata, H


    Conversion of the substrate specificity of porcine pancreatic alpha-amylase (PPA) was studied using chemical modification of His residues. Diethyl pyrocarbonate modified His residues in PPA and the activity of the modified PPA for the hydrolysis of the alpha-D-(1,4)glucoside bond in starch or oligosaccharides decreased to less than 1% of that of the native enzyme. However, the activity for the hydrolysis of the bond between p-nitrophenol and oligosaccharides in p-nitrophenyl oligosaccharides was increased by chemical modification. When the modified PPA was incubated with a proteinaceous alpha-amylase inhibitor (Mr 60,000) purified from white kidney bean (Phaseolus vulgaris), it bound to the inhibitor. As a result, the remaining less than 1% hydrolytic activity of the modified PPA for starch disappeared completely but that for p-nitrophenyl oligosaccharides remained unaltered. The hydrolytic activity of the native PPA for the alpha-D-(1,4)glucoside bond in oligosaccharides was stronger than that between p-nitrophenyl and oligosaccharides in p-nitrophenyl oligosaccharides. Therefore, when p-nitrophenyl oligosaccharides (three to five glucose residues) were used as substrates for the native PPA, the alpha-D-(1,4)glucoside bonds in the oligosaccharides were hydrolyzed. However, the modified PPA-inhibitor complex hydrolyzed only the bond between p-nitrophenol and oligosaccharides in p-nitrophenyl oligosaccharides. The above results reveal that, by chemical modification with diethyl pyrocarbonate and biochemical modification with an amylase inhibitor, amylase can be converted to a new exo-type enzyme which hydrolyzes only the bond between p-nitrophenol and oligosaccharides in p-nitrophenyl oligosaccharides.

  19. Beta-thiomaltosides as active site probes for alpha-amylase.


    Stankiewicz, P J; Cascio, D; McPherson, A


    A series of substituted 1-thio-beta-D-maltopyranosides was synthesized and confirmed by elemental analysis, optical rotation, NMR, and liquid chromatography. These compounds were shown by several biochemical techniques to bind to the active site of alpha-amylase. Steady-state kinetic studies showed the compounds to be competitive inhibitors, with affinities lying within the range of the natural ligands, maltose and maltotriose. Affinity chromatography employing p-aminophenyl-1-thio-beta-D-maltopyranoside linked to Sepharose provides a relatively simple procedure for alpha-amylase purification. The binding of p-bromphenyl-1-thio-beta-D-maltoside was observed in crystals of alpha-amylase using X-ray crystallography, and through the use of difference Fourier analysis its interaction at 5.0-A resolution with the active site of the enzyme has been visualized. The inhibitor binds in a long, deep cleft that divides the two major domains of the enzyme. These studies are believed to provide a first step toward the rational design of ligands for the physiological regulation of starch breakdown and utilization through modulation of alpha-amylase activity.

  20. Method for using a yeast alpha-amylase promoter


    Gao, Johnway; Skeen, Rodney S.; Hooker, Brian S.; Anderson, Daniel B.


    The present invention provides the promoter clone discovery of an alpha-amylase gene of a starch utilizing yeast strain Schwanniomyces castellii. The isolated alpha-amylase promoter is an inducible promoter, which can regulate strong gene expression in starch culture medium.

  1. The alpha-amylase from the yellow meal worm: complete primary structure, crystallization and preliminary X-ray analysis.


    Strobl, S; Gomis-Rüth, F X; Maskos, K; Frank, G; Huber, R; Glockshuber, R


    The alpha-amylase from Tenebrio molitor larvae (TMA) was purified from a crude larval extract. After removal of the N-terminal pyroglutamate residue and identification of the following 17 residues by Edman sequencing, the cDNA of mature TMA was cloned from larval mRNA. The encoded enzyme consists of 471 amino acid residues and has 57-79% sequence identity to other insect alpha-amylases and also shows high homology to the mammalian enzymes. TMA was crystallized in form of well-ordered orthorhombic crystals of space group P2(1)2(1)2(1) diffracting beyond 1.6 A resolution with unit cell dimensions of a = 51.24 A, b = 93.46 A, c = 96.95 A. TMA may serve as model system for the future analysis of interactions between insect alpha-amylase and proteinaceous plant inhibitors on the molecular level.

  2. Inhibitory effects of tannin on human salivary alpha-amylase.


    Kandra, Lili; Gyémánt, Gyöngyi; Zajácz, Agnes; Batta, Gyula


    Here, we first report on the effectiveness and specificity of tannin inhibition of 2-chloro-4-nitrophenyl-4-O-beta-d-galactopyranosylmaltoside hydrolysis that is catalyzed by human salivary alpha-amylase (HSA). Tannin was gallotannin in which quinic acid was esterified with 2-7 units of gallic acid. A number of studies establish that polyphenols-like tannins-may prevent oral diseases, e.g., dental caries. Kinetic analyses confirmed that the inhibition of hydrolysis is a mixed non-competitive type and only one molecule of tannin binds to the active site or the secondary site of the enzyme. Since Dixon plots were linear, product formation could be excluded from the enzyme-substrate-inhibitor complex (ESI). Kinetic constants calculated from secondary plots and non-linear regression are almost identical, thereby confirming the suggested model. Kinetic constants (K(EI) = 9.03 microgmL(-1), K(ESI) = 47.84 microgmL(-1)) show that tannin is as an effective inhibitor of HSA as acarbose and indicate a higher stability for the enzyme-inhibitor complex than ESI.

  3. Characterization of salivary alpha-amylase binding to Streptococcus sanguis

    SciTech Connect

    Scannapieco, F.A.; Bergey, E.J.; Reddy, M.S.; Levine, M.J. )


    The purpose of this study was to identify the major salivary components which interact with oral bacteria and to determine the mechanism(s) responsible for their binding to the bacterial surface. Strains of Streptococcus sanguis, Streptococcus mitis, Streptococcus mutans, and Actinomyces viscosus were incubated for 2 h in freshly collected human submandibular-sublingual saliva (HSMSL) or parotid saliva (HPS), and bound salivary components were eluted with 2% sodium dodecyl sulfate. By sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western transfer, alpha-amylase was the prominent salivary component eluted from S. sanguis. Studies with {sup 125}I-labeled HSMSL or {sup 125}I-labeled HPS also demonstrated a component with an electrophoretic mobility identical to that of alpha-amylase which bound to S. sanguis. Purified alpha-amylase from human parotid saliva was radiolabeled and found to bind to strains of S. sanguis genotypes 1 and 3 and S. mitis genotype 2, but not to strains of other species of oral bacteria. Binding of ({sup 125}I)alpha-amylase to streptococci was saturable, calcium independent, and inhibitable by excess unlabeled alpha-amylases from a variety of sources, but not by secretory immunoglobulin A and the proline-rich glycoprotein from HPS. Reduced and alkylated alpha-amylase lost enzymatic and bacterial binding activities. Binding was inhibited by incubation with maltotriose, maltooligosaccharides, limit dextrins, and starch.

  4. Expression of liver alpha-amylase in obese mouse hepatocytes

    PubMed Central

    Afsartala, Zohreh; Savabkar, Sanaz; Nazemalhosseini Mojarad, Ehsan; Assadollahi, Vahideh; Tanha, Shima; Bijangi, Khosro; Gholami, Mohammadreza


    Aim: The aim of this study is to demonstrate the relation between the expression of liver alpha-amylase and obesity. Background: Alpha-amylase catalyses the hydrolysis of 1, 4-alpha-glucosidic linkages in polysaccharides and has three main subtypes, including: salivary, pancreatic, and hepatic. Hepatic alpha-amylase is involved in glycogen metabolism, and has a role in obesity and its management. In this study, we aimed to analyze the expression of liver alpha-amylase in overweight and obese mouse. Material and methods: In this study, NMRI male mice were randomly divided into two groups. The sample group (obese) took a high-fat and carbohydrate diet, while the control group (normal) took a laboratory pellet chow for eight weeks. During this period, their weight was measured. After eight weeks, liver hepatocytes were isolated using an enzymatic digestion method. Immunocytochemistry (ICC) and flow cytometry analysis were performed to measure alpha amylase protein expression in mouse liver hepatocyte cells. Results: A significant difference in the body weight was observed between the two groups (p<0.05). The qualitative protein expression of liver alpha-amylase was found to be higher in the obese group in both tests (immunocytochemistry and flow cytometry). Animals from the test group presented higher alpha-amylase expression, which suggests that this hepatic protein may constitute a potential indicator of susceptibility for fat tissue accumulation and obesity. The present data demonstrates an increased expression of liver amylase in obese mice. Conclusion: These results suggest that liver amylase secretion might be useful for predicting susceptibility to obesity induced by consumption of a high-fat and carbohydrate diet. PMID:27895853

  5. Skin-prick tests for hypersensitivity to alpha-amylase preparations.


    Moneo, I; Alday, E; Sanchez-Agudo, L; Curiel, G; Lucena, R; Calatrava, J M


    Twenty-five asthmatic subjects with suspected alpha-amylase hypersensitivity were studied by skin-prick tests, a capture ELISA, immunoblotting and bronchial provocation tests. At the same time, different amylases were analysed by SDS-PAGE and immunoblotting using a polyclonal rabbit antiserum. Eight patients showed a positive bronchial response to amylase. Seven of them had positive skin-prick tests, with this method being the most sensitive approach for diagnosis. However, in four cases, skin tests were also positive although the patients had a negative provocation test, thus demonstrating that skin tests are not specific. ELISA and blotting showed similar results in terms of sensitivity and specificity. The enzymes used by the workers included several antigens besides alpha-amylase. The rabbit antiserum to alpha-amylase detected a protein in a wheat flour extract. In one case, the IgE antibodies were specific only for a contaminant of lower molecular weight than amylase. These facts suggest that proteins from the culture medium could be responsible for some cases of amylase hypersensitivity, making the diagnosis difficult. The presence of amylase in another enzymatic extract, a protease produced by Aspergillus oryzae, was proved by means of skin tests and immunoblotting, thus demonstrating the allergenic properties of this enzymatic preparation.

  6. Host-mediated induction of alpha-amylases by larvae of the Mexican bean weevil Zabrotes subfasciatus (Coleoptera: Chrysomelidae: Bruchinae) is irreversible and observed from the initiation of the feeding period.


    Bifano, Thaís D; Samuels, Richard I; Alexandre, Daniel; Silva, Carlos P


    Larvae of Zabrotes subfasciatus secrete alpha-amylases that are insensitive to the alpha-amylase inhibitor found in seeds of Phaseolus vulgaris. By analyzing amylase activities during larval development on P. vulgaris, we detected activity of the constitutive amylase and the two inducible amylase isoforms at all stages. When larvae were transferred from the non alpha-amylase inhibitor containing seeds of Vigna unguiculata to P. vulgaris, the inducible alpha-amylases were expressed at the same level as in control larvae fed on P. vulgaris. Interestingly, when larvae were transferred from seeds of P. vulgaris to those of V. unguiculata, inducible alpha-amylases continued to be expressed at a level similar to that found in control larvae fed P. vulgaris continuously. When 10-day-old larvae were removed from seeds of V. unguiculata and transferred into capsules containing flour of P. vulgaris cotyledons, and thus maintained until completing 17 days (age when the larvae stopped feeding), we could detect higher activity of the inducible alpha-amylases. However, when larvae of the same age were transferred from P. vulgaris into capsules containing flour of V. unguiculata, the inducible alpha-amylases remained up-regulated. These results suggest that the larvae of Z. subfasciatus have the ability to induce insensitive amylases early in their development. A short period of feeding on P. vulgaris cotyledon flour was sufficient to irreversibly induce the inducible alpha-amylase isoforms. Incubations of brush border membrane vesicles with the alpha-amylase inhibitor 1 from P. vulgaris suggest that the inhibitor is recognized by putative receptors found in the midgut microvillar membranes.

  7. Progress of pancreatitis disease biomarker alpha amylase enzyme by new nano optical sensor.


    Attia, M S; Al-Radadi, Najlaa S


    A new nano optical sensor binuclear Pd-(2-aminothiazole) (urea), Pd(atz,ur) complex was prepared and characterized for the assessment of the activity of alpha amylase enzyme in urine and serum samples for early diagnosis of Pancreatitis disease. The assessment of alpha amylase activity is carried out by the quenching of the luminescence intensity of the nano optical sensor binuclear Pd(atz,ur) complex at 457nm by the 2-chloro-4-nitrophenol (2-CNP) which produced from the reaction of the enzyme with 2-chloro-4-nitrophenyl-α-d-maltotrioside (CNPG3) substrate. The remarkable quenching of the luminescence intensity at 457nm of nano Pd(atz,ur) doped in sol-gel matrix by various concentrations of the 2-CNP was successfully used as an optical sensor for the assessment of α-amylase activity. The calibration plot was achieved over the concentration range 8.5×10(-6) to 1.9×10(-9)molL(-1) 2-CNP with a correlation coefficient of (0.999) and a detection limit of (7.4×10(-10)molL(-1)). The method was used satisfactorily for the assessment of the α-amylase activity over activity range (3-321U/L) in different urine and serum samples of pancreatitis patients. The assessment of the alpha amylase biomarker by the proposed method increases its sensitivity (96.88%) and specificity (94.41%) for early diagnosis of pancreatitis diseases.

  8. Alpha-Amylase Inhibition and Antioxidative Capacity of Some Antidiabetic Plants Used by the Traditional Healers in Southeastern Nigeria

    PubMed Central

    Oyedemi, Blessing O.; Ijeh, Ifeoma I.; Ohanyerem, Princemartins E.; Aiyegoro, Olayinka A.


    Oxidative stress plays a significant role in the pathogenesis of metabolic syndrome including diabetes mellitus (DM). The inhibition of alpha-amylase is an important therapeutic target in the regulation of postprandial increase of blood glucose in diabetic patients. The present study investigated the alpha-amylase inhibitory and antioxidant potential of selected herbal drugs used in the treatment of DM by the traditional healers in Isiala Mbano and Ikwuano regions of southeastern Nigeria. Antioxidant activity was evaluated in terms of free radical scavenging, reducing power, and total phenolic (TPC) and flavonoid content (TFC) in consonance with the TLC profiling. The results showed that methanol crude extracts from Anacardium occidentale (AO) and Ceiba pentandra (CP) recorded higher TPC and TFC, potent free radical scavenging, and efficient reducing power (RP) as compared with other plant samples. All the plant extracts exhibited a relative alpha-amylase inhibition apart from Strophanthus hispidus (SH) extract with a negative effect. We discovered a mild to weak correlation between alpha-amylase inhibition or antioxidative capacity and the total phenol or flavonoid content. At least in part, the results obtained in this work support the traditional use of certain plant species in the treatment of patients with DM. PMID:28367491

  9. Purification and characterization of extracellular alpha-amylase and glucoamylase from the yeast Candida antarctica CBS 6678.


    De Mot, R; Verachtert, H


    An alpha-amylase and a glucoamylase were purified to homogeneity from the culture fluid of beta-cyclodextrin-grown Candida antarctica CBS 6678 by protamine sulfate treatment, ammonium sulfate precipitation, gel filtration (Sephadex G-75 sf, Ultrogel AcA 54), DEAE-Sephacel chromatography, hydroxyapatite chromatography and affinity chromatography on acarbose--AH-Sepharose 4B. Both enzymes were monomeric glycoproteins with fairly different amino acid compositions. Their apparent relative molecular mass, sedimentation coefficient (Szero20,w), isoelectric point, absorption coefficient (280 nm), pH and temperature optima were estimated as 48,500, 4.7 S, 10.1, 1.74 cm2 mg-1, 4.2 and 57 degrees C, respectively, for glucoamylase and as 50,000, 4.9 S, 10.3, 1.53 cm2 mg-1, 4.2 and 62 degrees C, respectively, for alpha-amylase. Kinetic analyses indicated that both enzymes preferentially hydrolyzed high-molecular-mass substrates, including some raw starches. alpha-Amylase was active on cyclodextrins, whereas debranching activity was demonstrated for glucoamylase. Trestatins were potent inhibitors of both alpha-amylase (Ki less than 1 microM) and glucoamylase (Ki less than 0.1 microM), being more effective than Bay e 4609 (Ki less than 10 microM). Glucoamylase was selectivity and strongly inhibited by acarbose (Ki less than 0.1 microM). Activity of the latter enzyme was also affected by 1-deoxynojirimycin (Ki less than 1 mM), maltitol and amino alcohols (Ki less than 10 mM). Unlike alpha-amylase, glucoamylase adsorbed strongly onto raw starch, the adsorption site being non-identical with the active site.

  10. Optimization of alpha-amylase application in raw sugar manufacture

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In recent years there have been warnings by some U.S. refineries that there may be a penalty for high starch concentration sin raw sugar if starch control is not improved. Most commercial alpha-amylases used by the U.S. sugar industry to control starch have intermediate temperature stability (up to...

  11. Domain B protruding at the third beta strand of the alpha/beta barrel in barley alpha-amylase confers distinct isozyme-specific properties.


    Rodenburg, K W; Juge, N; Guo, X J; Søgaard, M; Chaix, J C; Svensson, B


    alpha-Amylases belong to the alpha/beta-barrel protein family in which the active site is created by residues located at the C-terminus of the beta strands and in the helix-connecting loops extending from these ends. In the alpha-amylase family, a small separate domain B protrudes at the C-terminus of the third beta strand of the (beta/alpha)8-barrel framework. The 80% identical barley alpha-amylase isozymes 1 and 2 (AMY1 and AMY2, respectively) differ in substrate affinity and turnover rate, CaCl2 stimulation of activity, sensitivity to the endogenous 21-kDa alpha-amylase/subtilisin inhibitor, and stability at low pH. To identify regions that confer these isozyme-specific variations, AMY1-AMY2 hybrid cDNAs were generated by in vivo homologous recombination in yeast. The hybrids AMY1-(1-90)-AMY2-(90-403) and AMY1-(1-161)-AMY2-(161-403) characterized in this study contain the 90-residue and 161-residue N-terminal sequences, respectively, of AMY1 and complementary C-terminal regions of AMY2. AMY1-(1-90)-AMY2-(90-403) comprises the 60-amino-acid domain B of AMY2 and resembles this isozyme in sensitivity to alpha-amylase/subtilisin inhibitor and its low affinity for the substrates p-nitrophenyl alpha-D-maltoheptaoside, amylose and the inhibitor acarbose. Only AMY1-(1-161)-AMY2-(161-403) and AMY1, which both share domain B, are stable at low pH. However, AMY2 and both hybrid AMY species, but not AMY1, show maximum enzyme activity on insoluble blue starch at approximately 10 mM CaCl2. Domain B thus determines several functional and stability properties that distinguish the barley alpha-amylase isozymes.

  12. Neohesperidin dihydrochalcone: presentation of a small molecule activator of mammalian alpha-amylase as an allosteric effector.


    Kashani-Amin, Elaheh; Larijani, Bagher; Ebrahim-Habibi, Azadeh


    Flavonoids and their precursor trans-chalcone have been reported as inhibitors of mammalian alpha-amylase. With regard to this background, neohesperidin dihydrochalcone (NHDC) effect was investigated toward porcine pancreatic alpha-amylase (PPA), and found to be an activator of the enzyme. The maximal activation (up to threefold) was found to occur at 4.8mM of NHDC, which could be considered to have a high activation profile, with regard to the alpha and beta parameters (alpha<1

  13. Alpha-amylase from the Hyperthermophilic Archaeon Thermococcus thioreducens

    NASA Technical Reports Server (NTRS)

    Bernhardsdotter, E. C. M. J.; Pusey, M. L.; Ng, M. L.; Garriott, O. K.


    Extremophiles are microorganisms that thrive in, from an anthropocentric view, extreme environments such as hot springs. The ability of survival at extreme conditions has rendered enzymes from extremophiles to be of interest in industrial applications. One approach to producing these extremozymes entails the expression of the enzyme-encoding gene in a mesophilic host such as E.coli. This method has been employed in the effort to produce an alpha-amylase from a hyperthermophile (an organism that displays optimal growth above 80 C) isolated from a hydrothermal vent at the Rainbow vent site in the Atlantic Ocean. alpha-amylases catalyze the hydrolysis of starch to produce smaller sugars and constitute a class of industrial enzymes having approximately 25% of the enzyme market. One application for thermostable alpha-amylases is the starch liquefaction process in which starch is converted into fructose and glucose syrups. The a-amylase encoding gene from the hyperthermophile Thermococcus thioreducens was cloned and sequenced, revealing high similarity with other archaeal hyperthermophilic a-amylases. The gene encoding the mature protein was expressed in E.coli. Initial characterization of this enzyme has revealed an optimal amylolytic activity between 85-90 C and around pH 5.3-6.0.

  14. Clinical and immunological responses to occupational exposure to alpha-amylase in the baking industry.


    Brisman, J; Belin, L


    alpha-Amylase is a starch cleaving enzyme often used in the baking industry as a flour additive. It is usually of fungal origin, produced by Aspergillus oryzae. One previous report has shown IgE antibodies and positive skin prick test against alpha-amylase in asthmatic bakers. This paper describes four alpha-amylase sensitised index cases with occupational asthma or rhinitis and the results of a cross sectional study of 20 workers from the same factory who were also exposed to alpha-amylase powder. Air sampling detected airborne alpha-amylase at a concentration of 0.03 mg/m3. Significantly more work related symptoms such as rhinitis and dermatitis were found among the alpha-amylase exposed workers compared with referents. A skin prick test to alpha-amylase was positive in 30% (6/20) of the exposed workers. Most of the persons showing a positive skin prick test had work related symptoms and were also skin prick test positive to common allergens. Nasal challenge tests with amylase were performed in selected cases and validated three cases of alpha-amylase induced rhinitis. Two non-symptomatic workers had precipitins to alpha-amylase. Specific IgG antibodies were shown by two further serological techniques. The nature and relevance of these antibodies are currently being studied. It is concluded that alpha-amylase powder is a potent occupational sensitiser. Precautions should be taken when handling this allergenic enzyme.

  15. Purification, characterization, and synergistic action of phytate-resistant alpha-amylase and alpha-glucosidase from Geobacillus thermodenitrificans HRO10.


    Ezeji, Thaddeus C; Bahl, Hubert


    The alpha-amylase (1, 4-alpha-d-glucanohydrolase; EC and alpha-glucosidase (alpha-d-glucoside glucohydrolase; EC secreted by Geobacillus thermodenitrificans HRO10 were purified to homogeneity (13.6-fold; 11.5% yield and 25.4-fold; 32.0% yield, respectively) through a series of steps. The molecular weight of alpha-amylase was 58kDa, as estimated by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE). The alpha-amylase activity on potato starch was optimal at pH 5.5 and 80 degrees Celsius. In the presence of Ca(2+), the alpha-amylase had residual activity of more than 92% after 1h of incubation at 70 degrees Celsius. The alpha-amylase did not lose any activity in the presence of phytate (a selective alpha-amylase inhibitor) at concentrations as high as 10mM, rather it retained 90% maximal activity after 1h of incubation at 70 degrees Celsius. EGTA and EDTA were strong inhibitory substances of the enzyme. The alpha-amylase hydrolyzed soluble starch at 80 degrees Celsius, with a K(m) of 3.05mgml(-1) and a V(max) of 7.35Uml(-1). The molecular weight of alpha-glucosidase was approximately 45kDa, as determined by SDS-PAGE. The enzyme activity was optimal at pH 6.5-7.5 and 55 degrees Celsius. Phytate did not inhibit G. thermodenitrificans HRO10 alpha-glucosidase activity, whereas pCMB was a potent inhibitor of the enzyme. The alpha-glucosidase exhibited Michaelis-Menten kinetics with maltose at 55 degrees Celsius (K(m): 17mM; V(max): 23micromolmin(-1)mg(-1)). Thin-layer chromatography studies with G. thermodenitrificans HRO10 alpha-amylase and alpha-glucosidase showed an excellent synergistic action and did not reveal any transglycosylation catalyzed reaction by the alpha-glucosidase.

  16. X-ray crystallographic analyses of pig pancreatic alpha-amylase with limit dextrin, oligosaccharide, and alpha-cyclodextrin.


    Larson, Steven B; Day, John S; McPherson, Alexander


    Further refinement of the model using maximum likelihood procedures and reevaluation of the native electron density map has shown that crystals of pig pancreatic alpha-amylase, whose structure we reported more than 15 years ago, in fact contain a substantial amount of carbohydrate. The carbohydrate fragments are the products of glycogen digestion carried out as an essential step of the protein's purification procedure. In particular, the substrate-binding cleft contains a limit dextrin of six glucose residues, one of which contains both alpha-(1,4) and alpha-(1,6) linkages to contiguous residues. The disaccharide in the original model, shared between two amylase molecules in the crystal lattice, but also occupying a portion of the substrate-binding cleft, is now seen to be a tetrasaccharide. There are, in addition, several other probable monosaccharide binding sites. Furthermore, we have further reviewed our X-ray diffraction analysis of alpha-amylase complexed with alpha-cyclodextrin. alpha-Amylase binds three cyclodextrin molecules. Glucose residues of two of the rings superimpose upon the limit dextrin and the tetrasaccharide. The limit dextrin superimposes in large part upon linear oligosaccharide inhibitors visualized by other investigators. By comprehensive integration of these complexes we have constructed a model for the binding of polysaccharides having the helical character known to be present in natural substrates such as starch and glycogen.

  17. A comparison of ghrelin, glucose, alpha-amylase and protein levels in saliva from diabetics.


    Aydin, Suleyman


    During the past decade, many salivary parameters have been used to characterize disease states. Ghrelin (GAH) is recently-discovered peptide hormone secreted mainly from the stomach but also produced in a number of other tissues including salivary glands. The aim of this work was to examine the relationship between active (aGAH) and inactive (dGAH) ghrelin in the saliva and other salivary parameters in type II diabetic patients and healthy controls. Salivary parameters were assessed in a single measurement of unstimulated whole saliva from 20 obese and 20 non-obese type II diabetes patients, and in 22 healthy controls. Total protein and alpha-amylase were determined by colorimetric methods, and glucose by the glucose-oxidase method. Saliva aGAH and dGAH levels were measured using a commercial radioimmunoassay (RIA) kit. Salivary concentrations of aGAH and dGAH ghrelin were more markedly decreased in obese diabetic subjects than in the two other groups. Glucose and alpha-amylase levels were higher in diabetic subjects than in controls. Furthermore, there were correlations between GAH levels and BMI, and between GAH and blood pressure. However, there was no marked variability in saliva flow rates among the groups. These results indicate that measurement of salivary GAH and its relationship to other salivary parameters might help to provide insight into the role of ghrelin in diabetes.

  18. Evening salivary alpha-amylase, major depressive disorder, and antidepressant use in the Netherlands Study of Depression and Anxiety (NESDA).


    Veen, Gerthe; Giltay, Erik J; Licht, Carmilla M M; Vreeburg, Sophie A; Cobbaert, Christa M; Penninx, Brenda W J H; Zitman, Frans G


    Salivary alpha-amylase (sAA) may be a suitable index for sympathetic activity and dysregulation of the autonomic nervous system. The relationship between antidepressants and depression with sAA levels was studied, since antidepressants were previously shown to have a profound impact on heart rate variability as an ANS indicator. Data are from 1692 participants of the Netherlands Study of Depression and Anxiety (NESDA) who were recruited from the community, general practice, and specialized mental health care. Differences in evening sAA levels were examined between patient groups (i.e., 752 current major depressive disorder [MDD], 611 remitted MDD, and 329 healthy controls) and between 46 tricyclic antidepressant (TCA) users, 307 selective serotonin reuptake inhibitor (SSRI) users, 97 users of another antidepressant, and 1242 non-users. Each participant sampled twice at 22.00h and 23.00h. In multivariable analysis, there was a trend over the three groups with increasing sAA levels from controls to remitted MDD to current MDD that approached significance. Furthermore, in comparison to non-users of antidepressants, TCA rather than SSRI users showed higher sAA levels, that persisted after multivariable adjustment. The present study shows that higher evening sAA levels in depressed patients, indicative of an increased sympathetic activity, may be induced by TCAs.

  19. alpha-Amylase: an ideal representative of thermostable enzymes.


    Prakash, Om; Jaiswal, Nivedita


    The conditions prevailing in the industrial applications in which enzymes are used are rather extreme, especially with respect to temperature and pH. Therefore, there is a continuing demand to improve the stability of enzymes and to meet the requirements set by specific applications. In this respect, thermostable enzymes have been proposed to be industrially relevant. In this review, alpha-amylase, a well-established representative of thermostable enzymes, providing an attractive model for the investigation of the structural basis of thermostability of proteins, has been discussed.

  20. Biochemical properties of alpha-amylase from peel of Citrus sinensis cv. Abosora.


    Mohamed, Saleh Ahmed; Drees, Ehab A; El-Badry, Mohamed O; Fahmy, Afaf S


    alpha-Amylase activity was screened in the peel, as waste fruit, of 13 species and cultivars of Egyptian citrus. The species Citrus sinensis cv. Abosora had the highest activity. alpha-Amylase AI from Abosora peel was purified to homogeneity using anion and cation-exchange, and gel filtration chromatographies. Molecular weight of alpha-amylase AI was found to be 42 kDa. The hydrolysis properties of alpha-amylase AI toward different substrates indicated that corn starch is the best substrate. The alpha-amylase had the highest activity toward glycogen compared with amylopectin and dextrin. Potato starch had low affinity toward alpha-amylase AI but it did not hydrolyze beta-cyclodextrin and dextran. Apparent Km for alpha-amylase AI was 5 mg (0.5%) starch/ml. alpha-Amylase AI showed optimum activity at pH 5.6 and 40 degrees C. The enzyme was thermally stable up to 40 degrees C and inactivated at 70 degrees C. The effect of mono and divalent metal ions were tested for the alpha-amylase AI. Ba2+ was found to have activating effect, where as Li+ had negligible effect on activity. The other metals caused inhibition effect. Activity of the alpha-amylase AI was increased one and half in the presence of 4 mM Ca2+ and was found to be partially inactivated at 10 mM Ca2+. The reduction of starch viscosity indicated that the enzyme is endoamylase. The results suggested that, in addition to citrus peel is a rich source of pectins and flavanoids, alpha-amylase AI from orange peel could be involved in the development and ripening of citrus fruit and may be used for juice processing.

  1. Structural analysis of a chimeric bacterial alpha-amylase. High-resolution analysis of native and ligand complexes.


    Brzozowski, A M; Lawson, D M; Turkenburg, J P; Bisgaard-Frantzen, H; Svendsen, A; Borchert, T V; Dauter, Z; Wilson, K S; Davies, G J


    Several chimeric alpha-amylases genes were constructed by an in vivo recombination technique from the Bacillus amyloliquefaciens and Bacillus licheniformis genes. One of the fusion amylases (hereafter BA2), consisting of residues 1-300 from B. amyloliquefaciens and 301-483 from B. licheniformis, has been extensively studied by X-ray crystallography at resolutions between 2.2 and 1.7 A. The 3-dimensional structure of the native enzyme was solved by multiple isomorphous replacement, and refined at a resolution of 1.7 A. It consists of 483 amino acids, organized similarly to the known B. lichiniformis alpha-amylase structure [Machius et al. (1995) J. Mol. Biol. 246, 545-559], but features 4 bound calcium ions. Two of these form part of a linear cluster of three ions, the central ion being attributed to sodium. This cluster lies at the junction of the A and B domains with one calcium of the cluster structurally equivalent to the major Ca(2+) binding site of fungal alpha-amylases. The third calcium ion is found at the interface of the A and C domains. BA2 contains a fourth calcium site, not observed in the B. licheniformis alpha-amylase structure. It is found on the C domain where it bridges the two beta-sheets. Three acid residues (Glu261, Asp328, and Asp231) form an active site similar to that seen in other amylases. In the presence of TRIS buffer, a single molecule of TRIS occupies the -1 subsite of the enzyme where it is coordinated by the three active-center carboxylates. Kinetic data reveal that BA2 displays properties intermediate to those of its parents. Data for crystals soaked in maltooligosaccharides reveal the presence of a maltotriose binding site on the N-terminal face of the (beta/alpha)(8) barrel of the molecule, not previously described for any alpha-amylase structure, the biological function of which is unclear. Data for a complex soaked with the tetrasaccharide inhibitor acarbose, at 1.9 A, reveal a decasaccharide moiety, spanning the -7 to +3

  2. Salivary Alpha-Amylase Reactivity in Breast Cancer Survivors

    PubMed Central

    Wan, Cynthia; Couture-Lalande, Marie-Ève; Narain, Tasha A.; Lebel, Sophie; Bielajew, Catherine


    The two main components of the stress system are the hypothalamic-pituitary-adrenal (HPA) and sympathetic-adrenal-medullary (SAM) axes. While cortisol has been commonly used as a biomarker of HPA functioning, much less attention has been paid to the role of the SAM in this context. Studies have shown that long-term breast cancer survivors display abnormal reactive cortisol patterns, suggesting a dysregulation of their HPA axis. To fully understand the integrity of the stress response in this population, this paper explored the diurnal and acute alpha-amylase profiles of 22 breast cancer survivors and 26 women with no history of cancer. Results revealed that breast cancer survivors displayed identical but elevated patterns of alpha-amylase concentrations in both diurnal and acute profiles relative to that of healthy women, F (1, 39) = 17.95, p < 0.001 and F (1, 37) = 7.29, p = 0.010, respectively. The average area under the curve for the diurnal and reactive profiles was 631.54 ± 66.94 SEM and 1238.78 ± 111.84 SEM, respectively. This is in sharp contrast to their cortisol results, which showed normal diurnal and blunted acute patterns. The complexity of the stress system necessitates further investigation to understand the synergistic relationship of the HPA and SAM axes. PMID:27023572

  3. An approach to remove alpha amylase for proteomic analysis of low abundance biomarkers in human saliva.


    Deutsch, Omer; Fleissig, Yoram; Zaks, Batia; Krief, Guy; Aframian, Doron J; Palmon, Aaron


    Proteomic characterization of human whole saliva for the identification of disease-specific biomarkers is guaranteed to be an easy-to-use and powerful diagnostic tool for defining the onset, progression and prognosis of human systemic diseases and, in particular, oral diseases. The high abundance of proteins, mainly alpha amylase, hampers the detection of low abundant proteins appearing in the disease state and therefore should be removed. In the present study a 2-DE was used to analyze human whole saliva following the removal of alpha amylase by affinity adsorption to potato starch. After alpha amylase removal whole saliva was analyzed by SDS-PAGE showing at least sixfold removal efficiency and by an alpha amylase activity assay showing 97% reduced activity. MS identification of the captured alpha amylase after elution demonstrated specific removal; 2-DE analysis showed the selective removal of alpha amylase and consequently increased gel resolution. MS identification of protein spots in the 60 kDa area revealed 15 proteins, which were masked before alpha amylase removal. In conclusion, treatment of human whole saliva with an alpha amylase removal device increases gel resolution and enables a higher protein sample for analysis.

  4. Cloning of a yeast alpha-amylase promoter and its regulated heterologous expression


    Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR; Hooker, Brian S [Kennewick, WA; Anderson, Daniel B [Pasco, WA


    The present invention provides the promoter clone discovery of an alpha-amylase gene of a starch utilizing yeast strain Schwanniomyces castellii. The isolated alpha-amylase promoter is an inducible promoter, which can regulate strong gene expression in starch culture medium.

  5. Inhibition of human salivary alpha-amylase by glucopyranosylidene-spiro-thiohydantoin.


    Gyémánt, Gyöngyi; Kandra, Lili; Nagy, Veronika; Somsák, László


    This study is the first report on the effectiveness and specificity of glucopyranosylidene-spiro-thiohydantoin (G-TH) inhibitor on the 2-chloro-4-nitrophenyl-4-O-beta-D-galactopyranosyl-maltoside (GalG(2)CNP) hydrolysis catalysed by human salivary alpha-amylase (HSA). The inhibition of hydrolysis is a mixed-noncompetitive type. In any case, only one molecule of inhibitor binds to HSA. Since our substrate and inhibitor are small molecules the long enough active site facilitates accommodating both of them simultaneously. However, the product formation can be excluded from enzyme-substrate-inhibitor complex (ESI) since Dixon plots are linear. Kinetic constants calculated from secondary plots and nonlinear regression are almost entirely equal, confirming the fidelity of the suggested model. Kinetic constants (K(1i)=7.3mM, L(1i)=2.84 mM) show that G-TH is not such a potent inhibitor of HSA as acarbose and indicate higher stability for ESI than for enzyme-inhibitor complex.

  6. Crystal and molecular structure of barley alpha-amylase.


    Kadziola, A; Abe, J; Svensson, B; Haser, R


    The three-dimensional structure of barley malt alpha-amylase (isoform AMY2-2) was determined by multiple isomorphous replacement using three heavy-atom derivatives and solvent flattening. The model was refined using a combination of simulated annealing and conventional restrained least-squares crystallographic refinement to an R-factor of 0.153 based on 18,303 independent reflections with F(o) > sigma(F(o)) between 10 and 2.8 A resolution, with root-mean-square deviations of 0.016 A and 3.3 degrees from ideal bond lengths and bond angles, respectively. The final model consists of 403 amino acid residues, three calcium ions and 153 water molecules. The polypeptide chain folds into three domains: a central domain forming a (beta alpha)8-barrel of 286 residues, with a protruding irregular structured loop domain of 64 residues (domain B) connecting strand beta 3 and helix alpha 3 of the barrel, and a C-terminal domain of 53 residues forming a five stranded anti-parallel beta-sheet. Unlike the previously known alpha-amylase structures, AMY2-2 contains three Ca2+ binding sites co-ordinated by seven or eight oxygen atoms from carboxylate groups, main-chain carbonyl atoms and water molecules, all calcium ions being bound to domain B and therefore essential for the structural integrity of that domain. Two of the Ca2+ sites are located only 7.0 A apart with one Asp residue serving as ligand for both. One Ca2+ site located at about 20 A from the other two was found to be exchangeable with Eu3+. By homology with other alpha-amylases, some important active site residues are identified as Asp179, Glu204 and Asp289, and are situated at the C-terminal end of the central beta-barrel. A starch granule binding site, previously identified as Trp276 and Trp277, is situated on alpha-helix 6 in the central (beta alpha)8-barrel, at the surface of the enzyme. This binding site region is associated with a considerable disruption of the (beta alpha)8-barrel 8-fold symmetry.

  7. Ca-binding to Bacillus licheniformis alpha-amylase (BLA).


    Nazmi, Ali Reza; Reinisch, Timm; Hinz, Hans-Jürgen


    Ca-induced renaturation of Bacillus licheniformis alpha-amylase in the presence of urea has been employed to determine the binding constants of the ion. The native enzyme is folded at 3M urea while the Ca-depleted protein is largely unfolded at this denaturant concentration. Refolding of the protein has been monitored by circular dichroism and the titration curves have been analyzed assuming a model of three independent binding sites. The stoichiometry has been taken from X-ray studies. The refolded protein exhibits a secondary structure that is similar but not identical to that of the native protein. The binding constants have been used to construct a phase diagram that illustrates the contribution of Ca-binding to the resistance against urea unfolding.

  8. Protein engineering in the alpha-amylase family: catalytic mechanism, substrate specificity, and stability.


    Svensson, B


    Most starch hydrolases and related enzymes belong to the alpha-amylase family which contains a characteristic catalytic (beta/alpha)8-barrel domain. Currently known primary structures that have sequence similarities represent 18 different specificities, including starch branching enzyme. Crystal structures have been reported in three of these enzyme classes: the alpha-amylases, the cyclodextrin glucanotransferases, and the oligo-1,6-glucosidases. Throughout the alpha-amylase family, only eight amino acid residues are invariant, seven at the active site and a glycine in a short turn. However, comparison of three-dimensional models with a multiple sequence alignment suggests that the diversity in specificity arises by variation in substrate binding at the beta-->alpha loops. Designed mutations thus have enhanced transferase activity and altered the oligosaccharide product patterns of alpha-amylases, changed the distribution of alpha-, beta- and gamma-cyclodextrin production by cyclodextrin glucanotransferases, and shifted the relative alpha-1,4:alpha-1,6 dual-bond specificity of neopullulanase. Barley alpha-amylase isozyme hybrids and Bacillus alpha-amylases demonstrate the impact of a small domain B protruding from the (beta/alpha)8-scaffold on the function and stability. Prospects for rational engineering in this family include important members of plant origin, such as alpha-amylase, starch branching and debranching enzymes, and amylomaltase.

  9. Study of serum lipase, alpha-amylase and pancreatic amylose in gall-stone diseases.


    Bera, Swati; Bhattacharyya, Swati; Ghose, Bikash C; Bera, Tapas; Mukhopadhyay, Surajit K; Saha, Mita


    Silent gall-stone causes significant morbidity and mortality and its incidence in India as well as in whole world is on the rise. It has positive correlation with development of carcinoma gall bladder. So far no predictive study has been done to show its correlation with biochemical markers. The present study has been aimed to establish whether simple enzymatic markers can predict association with cholelithiasis. Study group has been selected from the patients attending general surgery OPD of a tertiary healthcare centre with complaints of vague abdominal pain, flatulence and dyspepsia. A total of 61 cases (male = 18, female = 43) were studied and data matched with age and sex matched control. The biochemical markers studied are serum alkaline phosphatase, serum lipase, serum alpha-amylase and serum pancreatic amylase. Patients with obstructive cholelithiasis, duct stones, pancreatic insufficiency and malignancy are excluded from the study. The results were analysed by Student's t-test. Alkaline phosphatase in all the above mentioned cases was not significantly different from the control group (40 female, 21 male healthy individuals). A significant association was found out with serum alpha-amylase (p < 0.05) and a highly significant association was found out with pancreatic amylase (p < 0.001). Results of serum lipase however were inconclusive (p = 0.1). Pancreatic amylase can be estimated at a reasonable cost and costwise may prove to be a marker of gall-stone diseases which are in many cases silent preventing further complications and chances of Malignancy especially where alkaline phosphatase isinconclusive.

  10. Alpha-amylase production is induced by sulfuric acid in rice aleurone cells.


    Mitsunaga, Shin-ichiro; Kobayashi, Midori; Fukui, Satoe; Fukuoka, Kayoko; Kawakami, Osamu; Yamaguchi, Junji; Ohshima, Masahiro; Mitsui, Toshiaki


    The hydrolytic enzyme alpha-amylase (EC is produced mainly in aleurone cells of germinating cereals, and the phytohormone gibberellin (GA) is essential for its induction. However, in rice (Oryza sativa L.), sulfuric acid (H(2)SO(4)) induces alpha-amylase production in aleurone tissue even in the absence of GA. Here, the pre-treatment of rice aleurone cells with H(2)SO(4) and incubation in water induced alpha-amylase activity, as if the cells had been incubated in GA solution.

  11. [Study of the effect of Pb2+ on alpha-amylase activity by spectroscopy].


    Hong, Fa-shui


    The activity of alpha-amylase from porcine pancreas was enhanced under the treatment by Pb2+ at low concentration (0.5-4 mumol.L-1), but was inhibited by Pb2+ at high concentration (above 4 mumol.L-1). Pb2+ at high concentration could competitively displace Ca2+ from alpha-amylase. The EXAFS demonstrated that Pb2+ was bound to the active site of alpha-amylase, the coordination atom was oxygen, the coordination number was 2, and the Pb-O bond length was 0.234 nm. Circular dichroism spectra showed that the secondary structure of trypsin was greatly changed by Pb2+ at high concentration, as alpha-helix, beta-turn and random coil contents decreased, while beta-sheet, aromatic and disulfide bond contents increased. It was suggested that Pb2+ was bound to result in an alpha-amylase conformational change, and the enzyme activity decreased.

  12. Synergistic action of. alpha. -amylase and glucoamylase on hydrolysis of starch

    SciTech Connect

    Fujii, M.; Kawamura, Y.


    Synergistic action of ..alpha..-amylase and glucoamylase on hydrolysis of starch is modeled by the kinetic equations presented in this paper. At the early stage of the reaction ..alpha..-amylase acts as a contributor of newly formed non-reducing ends of starch molecules to glucoamylase by splitting the original starch molecules. This is expressed by the simultaneous differential equations which consist of each rate equation for ..alpha.. amylase and glucoamylase. After the molecular weight of the substrate decreases to the value of about 5000, which is obtained experimentally in this work, the action of ..alpha.. amylase can be neglected and the rate of formation of glucose obeys only the rate equation for glucoamylase. 5 references.

  13. alpha. -Amylase of Clostridium thermosulfurogenes EM1: Nucleotide sequence of the gene, processing of the enzyme, and comparison to other. alpha. -amylases

    SciTech Connect

    Bahl, H.; Burchhardt, G.; Spreinat, A.; Haeckel, K.; Wienecke, A.; Antranikian, G.; Schmidt, B. )


    The nucleotide sequence of the {alpha}-amylase gene (amyA) from Clostridium thermosulfurogenes EM1 cloned in Escherichia coli was determined. The reading frame of the gene consisted of 2,121 bp. Comparison of the DNA sequence data with the amino acid sequence of the N terminus of the purified secreted protein of C. thermosulfurogenes Em1 suggested that the {alpha}-amylase is translated form mRNA as a secretory precursor with a signal peptide of 27 amino acid residues. The deduced amino acid sequence of the mature {alpha}-amylase contained 679 residues, resulting in a protein with a molecular mass of 75,112 Da. In E. coli the enzyme was transported to the periplasmic space and the signal peptide was cleaved at exactly the same site between two alanine residues. Comparison of the amino acid sequence of the C. thermosulfurogenes EM1 {alpha}-amylase with those from other bacterial and eukaryotic {alpha}-amylases showed several homologous regions, probably in the enzymatically functioning regions. The tentative Ca{sup 2+}-binding site (consensus region I) of this Ca{sub 2+}-independent enzyme showed only limited homology. The deduced amino acid sequence of a second obviously truncated open reading frame showed significant homology to the malG gene product of E. coli. Comparison of the {alpha}-amylase gene region of C. thermosulfurogenes EM1 (DSM3896) with the {beta}-amylase gene region of C. thermosulfurogenes (ATCC 33743) indicated that both genes have been exchanged with each other at identical sites in the chromosomes of these strains.

  14. alpha-Amylase of Clostridium thermosulfurogenes EM1: nucleotide sequence of the gene, processing of the enzyme, and comparison of other alpha-amylases.

    PubMed Central

    Bahl, H; Burchhardt, G; Spreinat, A; Haeckel, K; Wienecke, A; Schmidt, B; Antranikian, G


    The nucleotide sequence of the alpha-amylase gene (amyA) from Clostridium thermosulfurogenes EM1 cloned in Escherichia coli was determined. The reading frame of the gene consisted of 2,121 bp. Comparison of the DNA sequence data with the amino acid sequence of the N terminus of the purified secreted protein of C. thermosulfurogenes EM1 suggested that the alpha-amylase is translated from mRNA as a secretory precursor with a signal peptide of 27 amino acid residues. The deduced amino acid sequence of the mature alpha-amylase contained 679 residues, resulting in a protein with a molecular mass of 75,112 Da. In E. coli the enzyme was transported to the periplasmic space and the signal peptide was cleaved at exactly the same site between two alanine residues. Comparison of the amino acid sequence of the C. thermosulfurogenes EM1 alpha-amylase with those from other bacterial and eucaryotic alpha-amylases showed several homologous regions, probably in the enzymatically functioning regions. The tentative Ca(2+)-binding site (consensus region I) of this Ca(2+)-independent enzyme showed only limited homology. The deduced amino acid sequence of a second obviously truncated open reading frame showed significant homology to the malG gene product of E. coli. Comparison of the alpha-amylase gene region of C. thermosulfurogenes EM1 (DSM3896) with the beta-amylase gene region of C. thermosulfurogenes (ATCC 33743) indicated that both genes have been exchanged with each other at identical sites in the chromosomes of these strains. PMID:1854207

  15. Exposure-sensitization relationship for alpha-amylase allergens in the baking industry.


    Houba, R; Heederik, D J; Doekes, G; van Run, P E


    Fungal alpha-amylase is an important occupational allergen in the bakery industry. Epidemiologic studies focusing on the relationship between alpha-amylase allergen exposure and work-related respiratory allergy, however, have not been reported yet. In this cross-sectional study, sensitization to occupational allergens and work-related symptoms were studied in 178 bakery workers and related to allergen exposure. Alpha-amylase allergen concentrations were measured in personal dust samples, using a sandwich enzyme immunoassay. All workers were categorized into groups on the basis of their job histories and the alpha-amylase exposure levels of their job titles. Of all workers 25% had one or more work-related symptoms. As much as 9% of the bakery workers showed a positive skin prick test reaction to fungal amylase, and in 8% amylase-specific IgE was demonstrated. Alpha-amylase exposure and atopy appeared to be the most important determinants of skin sensitization, with prevalence ratios for atopy of 20.8 (95% CI, 2.74 to 158) and for medium and high alpha-amylase exposure groups of 8.6 (95% CI, 1.01 to 74) and 15.9 (95% CI, 1.95 to 129), respectively. Furthermore, a positive association was found between positive skin prick tests to alpha-amylase and work-related respiratory symptoms. In conclusion, this study has shown that there is a strong and positive relationship between alpha-amylase allergen exposure levels in bakeries and specific sensitization in bakery workers.

  16. [Studies on determination of alpha-amylase with p-nitrophenyl-alpha-D-maltotetraoside].


    Kruse-Jarres, J D; Schott, F J; Klein, B; Rastetter, N; Wallenfels, K


    Nitrophenylmaltodextrins are alpha-amylase substrates which allow a continuous determination with a zero order kinetics over a period of at least 10 min, without deviations from linearity. Only one auxiliary enzyme is necessary. Practicability and clinical evidence of alpha-amylase determinations by means of p-nitrophenyl-alpha-D-maltotetraoside are demonstrated. The interserial precision of 0.84% cannot conceal an only moderate correlation with previous methods. This fact, however, does not negate the advantages.

  17. MS characterization of multiple forms of alpha-amylase in human saliva.


    Hirtz, Christophe; Chevalier, François; Centeno, Delphine; Rofidal, Valerie; Egea, Jean-Christophe; Rossignol, Michel; Sommerer, Nicolas; Deville de Périère, Dominique


    Alpha-amylase is a major and well-characterized component of human saliva. Recent proteomic studies suggested that this protein could be observed in more than twenty spots on 2-D gels of salivary proteins. The aim of this work was to investigate this unexpected redundancy. 2-D gel electrophoresis was combined with systematic MALDI-TOF MS analysis. More than 140 protein spots identifying the alpha-amylase were shown to constitute a stable but very complex pattern. Careful analysis of mass spectra and simultaneous hierarchical clustering of the observed peptides and of the electrophoretic features of spots allowed one to define three major groups. A main class grouping 90 spots was shown to correspond to full length alpha-amylases that can be assumed to include isoforms and post-translationally modified forms, a subset of this class being demonstrated to be N-glycosylated. A second group included short alpha-amylases that are differently truncated in a non-random manner, very likely in the oral cavity. The last class grouped alpha-amylase forms showing both the N- and C-terminal sequences of the enzyme but displaying a molecular weight that was up to 50% lower than that of the native protein. It is speculated that the last group of alpha-amylase spots could correspond to proteins submitted to internal deletions prior to the secretion.

  18. Where do animal alpha-amylases come from? An interkingdom trip.


    Da Lage, Jean-Luc; Danchin, Etienne G J; Casane, Didier


    Alpha-amylases are widely found in eukaryotes and prokaryotes. Few amino acids are conserved among these organisms, but at an intra-kingdom level, conserved protein domains exist. In animals, numerous conserved stretches are considered as typical of animal alpha-amylases. Searching databases, we found no animal-type alpha-amylases outside the Bilateria. Instead, we found in the sponge Reniera sp. and in the sea anemone Nematostella vectensis, alpha-amylases whose most similar cognate was that of the amoeba Dictyostelium discoideum. We found that this "Dictyo-type" alpha-amylase was shared not only by these non-Bilaterian animals, but also by other Amoebozoa, Choanoflagellates, and Fungi. This suggested that the Dictyo-type alpha-amylase was present in the last common ancestor of Unikonts. The additional presence of the Dictyo-type in some Ciliates and Excavates, suggests that horizontal gene transfers may have occurred among Eukaryotes. We have also detected putative interkingdom transfers of amylase genes, which obscured the historical reconstitution. Several alternative scenarii are discussed.

  19. Salivary alpha-amylase: role in dental plaque and caries formation.


    Scannapieco, F A; Torres, G; Levine, M J


    Salivary alpha-amylase, one of the most plentiful components in human saliva, has at least three distinct biological functions. The enzymatic activity of alpha-amylase undoubtedly plays a role in carbohydrate digestion. Amylase in solution binds with high affinity to a selected group of oral streptococci, a function that may contribute to bacterial clearance and nutrition. The fact that alpha-amylase is also found in acquired enamel pellicle suggests a role in the adhesion of alpha-amylase-binding bacteria. All of these biological activities seem to depend on an intact enzyme conformation. Binding of alpha-amylase to bacteria and teeth may have important implications for dental plaque and caries formation. alpha-Amylase bound to bacteria in plaque may facilitate dietary starch hydrolysis to provide additional glucose for metabolism by plaque microorganisms in close proximity to the tooth surface. The resulting lactic acid produced may be added to the pool of acid in plaque to contribute to tooth demineralization.

  20. Regulation of the synthesis of barley aleurone. cap alpha. -amylase by gibberellic acid and calcium ions

    SciTech Connect

    Jones, R.L.; Carbonell, J.


    The effects of gibberellic acid (GA/sub 3/) and calcium ions on the production of ..cap alpha..-amylase and acid phosphatase by isolated aleurone layers of barley (Hordeum vulgare L. cv Himalaya) were studied. Aleurone layers not previously exposed to GA/sub 3/ or CA/sup 2 +/ show qualitative and quantitative changes in hydrolase production following incubation in either GA/sub 3/ or CA/sup 2 +/ or both. In cubation in H/sub 2/O or CA/sup 2 +/ results in the production of low levels of ..cap alpha..-amylase or acid phosphatase. The addition of GA/sub 3/ to the incubation medium causes 10- to 20-fold increase in the amounts of these enzymes released from the tissue, and addition of CA/sup 2 +/ at 10 millimolar causes a further 8- to 9-fold increase in ..cap alpha..-amylase release and a 75% increase in phosphatase release. Production of ..cap alpha..-amylase isoenzymes is also modified by the levels of GA/sub 3/ and CA/sup 2 +/ in the incubation medium. ..cap alpha..-amylase 2 is produced under all conditions of incubation, while ..cap alpha..-amylase 1 appears only when layers are incubated in GA/sub 3/ or GA/sub 3/ plus CA/sup 2 +/. The synthesis of ..cap alpha..-amylases 3 and 4 requires the presence of both GA/sub 3/ and CA/sup 2 +/ in the incubation medium. Laurell rocket immunoelectrophoresis shows that two distinct groups of ..cap alpha..-amylase antigens are present in incubation media of aleurone layers incubated with both GA/sub 3/ and CA/sup 2 +/, while only one group of antigens is found in media of layers incubated in GA/sub 3/ alone. Strontium ions can be substituted for CA/sup 2 +/ in increasing hydrolase production, although higher concentrations of Sr/sup 2 +/ are requried for maximal response. We conclude that GA/sub 3/ is required for the production of ..cap alpha..-amylase 1 and that both GA/sub 3/ and either CA/sup 2 +/ or Sr/sup 2 +/ are required for the production of isoenzymes 3 and 4 of barley aleurone ..cap alpha..-amylase. 22 references, 8

  1. One-step production of immobilized alpha-amylase in recombinant Escherichia coli.


    Rasiah, Indira A; Rehm, Bernd H A


    Industrial enzymes are often immobilized via chemical cross-linking onto solid supports to enhance stability and facilitate repeated use in bioreactors. For starch-degrading enzymes, immobilization usually places constraints on enzymatic conversion due to the limited diffusion of the macromolecular substrate through available supports. This study describes the one-step immobilization of a highly thermostable alpha-amylase (BLA) from Bacillus licheniformis and its functional display on the surface of polyester beads inside engineered Escherichia coli. An optimized BLA variant (Termamyl) was N-terminally fused to the polyester granule-forming enzyme PhaC of Cupriavidus necator. The fusion protein lacking the signal sequence mediated formation of stable polyester beads exhibiting alpha-amylase activity. The alpha-amylase beads were assessed with respect to alpha-amylase activity, which was demonstrated qualitatively and quantitatively. The immobilized alpha-amylase showed Michaelis-Menten enzyme kinetics exerting a V(max) of about 506 mU/mg of bead protein with a K(m) of about 5 microM, consistent with that of free alpha-amylase. The stability of the enzyme at 85 degrees C and the capacity for repeated usage in a starch liquefaction process were also demonstrated. In addition, structural integrity and functionality of the beads at extremes of pH and temperature, demonstrating their suitability for industrial use, were confirmed by electron microscopy and protein/enzyme analysis. This study proposes a novel, cost-effective method for the production of immobilized alpha-amylase in a single step by using the polyester granules forming protein PhaC as a fusion partner in engineered E. coli.

  2. Phylogenetic and Comparative Sequence Analysis of Thermostable Alpha Amylases of kingdom Archea, Prokaryotes and Eukaryotes.


    Huma, Tayyaba; Maryam, Arooma; Rehman, Shahid Ur; Qamar, Muhammad Tahir Ul; Shaheen, Tayyaba; Haque, Asma; Shaheen, Bushra


    Alpha amylase family is generally defined as a group of enzymes that can hydrolyse and transglycosylase α-(1, 4) or α-(1, 6) glycosidic bonds along with the preservation of anomeric configuration. For the comparative analysis of alpha amylase family, nucleotide sequences of seven thermo stable organisms of Kingdom Archea i.e. Pyrococcus furiosus (100-105°C), Kingdom Prokaryotes i.e. Bacillus licheniformis (90-95°C), Geobacillus stearothermophilus (75°C), Bacillus amyloliquefaciens (72°C), Bacillus subtilis (70°C) and Bacillus KSM K38 (55°C) and Eukaryotes i.e. Aspergillus oryzae (60°C) were selected from NCBI. Primary structure composition analysis and Conserved sequence analysis were conducted through Bio Edit tools. Results from BioEdit shown only three conserved regions of base pairs and least similarity in MSA of the above mentioned alpha amylases. In Mega 5.1 Phylogeny of thermo stable alpha amylases of Kingdom Archea, Prokaryotes and Eukaryote was handled by Neighbor-Joining (NJ) algorithm. Mega 5.1 phylogenetic results suggested that alpha amylases of thermo stable organisms i.e. Pyrococcus furiosus (100-105°C), Bacillus licheniformis (90-95°C), Geobacillus stearothermophilus (75°C) and Bacillus amyloliquefaciens (72°C) are more distantly related as compared to less thermo stable organisms. By keeping in mind the characteristics of most thermo stable alpha amylases novel and improved features can be introduced in less thermo stable alpha amylases so that they become more thermo tolerant and productive for industry.

  3. Characterization of alpha-Amylase from Shoots and Cotyledons of Pea (Pisum sativum L.) Seedlings.


    Beers, E P; Duke, S H


    The most abundant alpha-amylase (EC in shoots and cotyledons from pea (Pisum sativum L.) seedlings was purified 6700-and 850-fold, respectively, utilizing affinity (amylose and cycloheptaamylose) and gel filtration chromatography and ultrafiltration. This alpha-amylase contributed at least 79 and 15% of the total amylolytic activity in seedling cotyledons and shoots, respectively. The enzyme was identified as an alpha-amylase by polarimetry, substrate specificity, and end product analyses. The purified alpha-amylases from shoots and cotyledons appear identical. Both are 43.5 kilodalton monomers with pls of 4.5, broad pH activity optima from 5.5 to 6.5, and nearly identical substrate specificities. They produce identical one-dimensional peptide fingerprints following partial proteolysis in the presence of SDS. Calcium is required for activity and thermal stability of this amylase. The enzyme cannot attack maltodextrins with degrees of polymerization below that of maltotetraose, and hydrolysis of intact starch granules was detected only after prolonged incubation. It best utilizes soluble starch as substrate. Glucose and maltose are the major end products of the enzyme with amylose as substrate. This alpha-amylase appears to be secreted, in that it is at least partially localized in the apoplast of shoots. The native enzyme exhibits a high degree of resistance to degradation by proteinase K, trypsin/chymostrypsin, thermolysin, and Staphylococcus aureus V8 protease. It does not appear to be a high-mannose-type glycoprotein. Common cell wall constituents (e.g. beta-glucan) are not substrates of the enzyme. A very low amount of this alpha-amylase appears to be associated with chloroplasts; however, it is unclear whether this activity is contamination or alpha-amylase which is integrally associated with the chloroplast.

  4. Purification and characterization of the extracellular. alpha. -amylase from Clostridium acetobutylicum ATCC 824

    SciTech Connect

    Paquet, V.; Croux, C.; Goma, G.; Soucaille, P. )


    The extracellular {alpha}-amylase (1,4-{alpha}-D-glucanglucanohydrolase; EC from Clostridium acetobutylicum ATCC 824 was purified to homogeneity by anion-exchange chromatography (Mono Q) and gel filtration (Superose 12). The enzyme had an isoelectric point of 4.7 and a molecular weight of 84,000, as estimated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. It was a monomeric protein, the 19-amino-acid N terminus of which displayed 42% homology with the Bacillus subtilis saccharifying {alpha}-amylase. The amino acid composition of the enzyme showed a high number of acidic and hydrophobic residues and only one cysteine residue per mole. The activity of the {alpha}-amylase was not stimulated by calcium ions (or other metal ions) or inhibited by EDTA, although the enzyme contained seven calcium atoms per molecule. {alpha}-Amylase activity on soluble starch was optimal at pH 5.6 and 45{degree}C. The {alpha}-amylase was stable at an acidic pH but very sensitive to thermal inactivation. It hydrolyzed soluble starch, with a K{sub m} of 3.6 g {center dot} liter{sup {minus}1} and a K{sub cat} of 122 mol of reducing sugars {center dot} s{sup {minus}1} {center dot} mol{sup {minus}1}. The {alpha}-amylase showed greater activity with high-molecular-weight substrates than with low-molecular-weight maltooligosaccharides, hydrolyzed glycogen and pullulan slowly, but did not hydrolyze dextran or cyclodextrins. The major end products of maltohexaose degradation were glucose, maltose, and maltotriose; maltotetraose and maltopentaose were formed as intermediate products. Twenty seven percent of the glucoamylase activity generally detected in the culture supernatant of C. acetobutylicum can be attributed to the {alpha}-amylase.

  5. alpha-Amylase is not required for breakdown of transitory starch in Arabidopsis leaves.


    Yu, Tien-Shin; Zeeman, Samuel C; Thorneycroft, David; Fulton, Daniel C; Dunstan, Hannah; Lue, Wei-Ling; Hegemann, Björn; Tung, Shu-Yun; Umemoto, Takayuki; Chapple, Andrew; Tsai, Der-Long; Wang, Shue-Mei; Smith, Alison M; Chen, Jychian; Smith, Steven M


    The Arabidopsis thaliana genome encodes three alpha-amylase-like proteins (AtAMY1, AtAMY2, and AtAMY3). Only AtAMY3 has a predicted N-terminal transit peptide for plastidial localization. AtAMY3 is an unusually large alpha-amylase (93.5 kDa) with the C-terminal half showing similarity to other known alpha-amylases. When expressed in Escherichia coli, both the whole AtAMY3 protein and the C-terminal half alone show alpha-amylase activity. We show that AtAMY3 is localized in chloroplasts. The starch-excess mutant of Arabidopsis sex4, previously shown to have reduced plastidial alpha-amylase activity, is deficient in AtAMY3 protein. Unexpectedly, T-DNA knock-out mutants of AtAMY3 have the same diurnal pattern of transitory starch metabolism as the wild type. These results show that AtAMY3 is not required for transitory starch breakdown and that the starch-excess phenotype of the sex4 mutant is not caused simply by deficiency of AtAMY3 protein. Knock-out mutants in the predicted non-plastidial alpha-amylases AtAMY1 and AtAMY2 were also isolated, and these displayed normal starch breakdown in the dark as expected for extraplastidial amylases. Furthermore, all three AtAMY double knock-out mutant combinations and the triple knock-out degraded their leaf starch normally. We conclude that alpha-amylase is not necessary for transitory starch breakdown in Arabidopsis leaves.

  6. Alpha-Amylase Activity in Blood Increases after Pharmacological, But Not Psychological, Activation of the Adrenergic System

    PubMed Central

    Nater, Urs M.; La Marca, Roberto; Erni, Katja; Ehlert, Ulrike


    Background & Aim Alpha-amylase in both blood and saliva has been used as a diagnostic parameter. While studies examining alpha-amylase activity in saliva have shown that it is sensitive to physiological and psychological challenge of the adrenergic system, no challenge studies have attempted to elucidate the role of the adrenergic system in alpha-amylase activity in blood. We set out to examine the impact of psychological and pharmacological challenge on alpha-amylase in blood in two separate studies. Methods In study 1, healthy subjects were examined in a placebo-controlled, double-blind paradigm using yohimbine, an alpha2-adrenergic antagonist. In study 2, subjects were examined in a standardized rest-controlled psychosocial stress protocol. Alpha-amylase activity in blood was repeatedly measured in both studies. Results Results of study 1 showed that alpha-amylase in blood is subject to stronger increases after injection of yohimbine compared to placebo. In study 2, results showed that there was no significant effect of psychological stress compared to rest. Conclusions Alpha-amylase in blood increases after pharmacological activation of the adrenergic pathways suggesting that sympathetic receptors are responsible for these changes. Psychological stress, however, does not seem to have an impact on alpha-amylase in blood. Our findings provide insight into the mechanisms underlying activity changes in alpha-amylase in blood in healthy individuals. PMID:26110636

  7. Alpha-amylase genes (amyR2 and amyE+) from an alpha-amylase-hyperproducing Bacillus subtilis strain: molecular cloning and nucleotide sequences.

    PubMed Central

    Yamazaki, H; Ohmura, K; Nakayama, A; Takeichi, Y; Otozai, K; Yamasaki, M; Tamura, G; Yamane, K


    amyR2, amyE+, and aroI+ alleles from an alpha-amylase-hyperproducing strain, Bacillus subtilis NA64, were cloned in temperate B. subtilis phage p11, and the amyR2 and amyE+ genes were then recloned in plasmid pUB110, which was designated pTUB4. The order of the restriction sites, ClaI-EcoRI-PstI-SalI-SmaI, found in the DNA fragment carrying amyR2 and amyE+ from the phage genome was also found in the 2.3-kilobase insert of pTUB4. Approximately 2,600 base pairs of the DNA nucleotide sequence of the amyR2 and amyE+ gene region in pTUB4 were determined. Starting from an ATG initiator codon, an open reading frame was composed of a total 1,776 base pairs (592 amino acids). Among the 1,776 base pairs, 1,674 (558 amino acids) were found in the cloned DNA fragment, and 102 base pairs (34 amino acids) were in the vector pUB110 DNA. The COOH terminal region of the alpha-amylase of pTUB4 was encoded in pUB110. The electrophoretic mobility in a 7.5% polyacrylamide gel of the alpha-amylase was slightly faster than that of the parental alpha-amylases. The NH2 termination portion of the gene encoded a 41-amino acid-long signal sequence (Ohmura et al., Biochem. Biophys. Res. Commun. 112:687-683, 1983). The DNA sequence of the mature extracellular alpha-amylase, a potential RNA polymerase recognition site and Pribnow box (TTGATAGAGTGATTGTGATAATTTAAAAT), and an AT-rich inverted repeat structure which has free energy of -8.2 kcal/mol (-34.3 kJ/mol) were identified. The AT-rich inverted repeat structure seemed to correspond to the hyperproducing character. The nucleotide sequence around the region was quite different from the promoter region of the B. subtilis 168 alpha-amylase gene which was cloned in the Escherichia coli vector systems. Images PMID:6413492

  8. Action of Bacillus subtilis alpha-amylase on native wheat starch.


    Colonna, P; Buléon, A; Lemarié, F


    Native starch granules from wheat have been subjected to enzymatic depolymerization with an alpha-amylase from Bacillus subtilis. Crystallites made from short-chain amylose and residues from mild acid hydrolysis have been also tested. Electron microscopy, particle size analysis, DSC, and x-ray diffractometry reveal that enzymatic degradation occurs granule by granule. Gel permeation chromatography shows off the macromolecular nature of the remaining material. In contrast, acid erodes simultaneously all the granules, leading to a splitting into small particles. Crystalline fractions are completely degraded by alpha-amylase. These results support evidence for an active disentanglement of chains, carried out by the different subsites of alpha-amylase molecules. A simple mathematical treatment is proposed to explain the results of the kinetics.

  9. General Subject 1. Report to ICUMSA on the determination of commercial alpha-amylase activity by a spectrophotometric method

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A report is given on a new industrial method for the determination of the activity or strength of commercial alpha-amylase at a sugarcane factory or refinery, as well as a recommendation. At the present time, the activities or strengths of commercial alpha-amylases cannot be directly compared becau...

  10. Validation of an assay for quantification of alpha-amylase in saliva of sheep

    PubMed Central

    Fuentes-Rubio, Maria; Fuentes, Francisco; Otal, Julio; Quiles, Alberto; Hevia, María Luisa


    The objective of this study was to develop a time-resolved immunofluorometric assay (TR-IFMA) for quantification of salivary alpha-amylase in sheep. For that purpose, after the design of the assay, an analytical and a clinical validation were carried out. The analytical validation of the assay showed intra- and inter-assay coefficients of variation (CVs) of 6.1% and 10.57%, respectively and an analytical limit of detection of 0.09 ng/mL. The assay also demonstrated a high level of accuracy, as determined by linearity under dilution. For clinical validation, a model of acute stress testing was conducted to determine whether expected significant changes in alpha-amylase were picked up in the newly developed assay. In that model, 11 sheep were immobilized and confronted with a sheepdog to induce stress. Saliva samples were obtained before stress induction and 15, 30, and 60 min afterwards. Salivary cortisol was measured as a reference of stress level. The results of TR-IFMA showed a significant increase (P < 0.01) in the concentration of alpha-amylase in saliva after stress induction. The assay developed in this study could be used to measure salivary alpha-amylase in the saliva of sheep and this enzyme could be a possible noninvasive biomarker of stress in sheep. PMID:27408332

  11. Validation of an assay for quantification of alpha-amylase in saliva of sheep.


    Fuentes-Rubio, Maria; Fuentes, Francisco; Otal, Julio; Quiles, Alberto; Hevia, María Luisa


    The objective of this study was to develop a time-resolved immunofluorometric assay (TR-IFMA) for quantification of salivary alpha-amylase in sheep. For that purpose, after the design of the assay, an analytical and a clinical validation were carried out. The analytical validation of the assay showed intra- and inter-assay coefficients of variation (CVs) of 6.1% and 10.57%, respectively and an analytical limit of detection of 0.09 ng/mL. The assay also demonstrated a high level of accuracy, as determined by linearity under dilution. For clinical validation, a model of acute stress testing was conducted to determine whether expected significant changes in alpha-amylase were picked up in the newly developed assay. In that model, 11 sheep were immobilized and confronted with a sheepdog to induce stress. Saliva samples were obtained before stress induction and 15, 30, and 60 min afterwards. Salivary cortisol was measured as a reference of stress level. The results of TR-IFMA showed a significant increase (P < 0.01) in the concentration of alpha-amylase in saliva after stress induction. The assay developed in this study could be used to measure salivary alpha-amylase in the saliva of sheep and this enzyme could be a possible noninvasive biomarker of stress in sheep.

  12. Production and Partial Purification of Alpha Amylase from Bacillus subtilis (MTCC 121) Using Solid State Fermentation

    PubMed Central

    Raul, Dibyangana; Mukhopadhyay, Suchita; Kumar Das, Shrayan; Gupta, Suvroma


    Amylase is an enzyme that catalyzes the breakdown of starch into sugars and plays a pivotal role in a variety of areas like use as digestives, for the production of ethanol and high fructose corn syrup, detergents, desiring of textiles, modified starches, hydrolysis of oil-field drilling fluids, and paper recycling. In the present work, solid state fermentation (SSF) for α-amylase production has been used in lieu of submerged fermentation (SmF) due to its simple technique, low capital investment, lower levels of catabolite repression, and better product recovery. Bacillus subtilis has been well known as producer of alpha amylase and was tested using solid state fermentation for 48 hours at 37°C with wheat bran as substrate. Comparison between different fermentation hours demonstrated high yield of alpha amylase after 48 hours. This alpha amylase has optimum pH and temperature at 7.1 and 40°C, respectively. With the goal to purify alpha amylase, 30–70% (NH4)2SO4 cut concentrated the amylase activity threefold with respect to crude fermented extract. This was verified in quantitative DNS assay method as well as in zymogram gel profile. The exact molecular weight of the amylase is yet to be determined with the aid of other protein purification techniques. PMID:24672727

  13. Human Parotid Gland Alpha-Amylase Secretion as a Function of Chronic Hyperbaric Exposure

    DTIC Science & Technology


    parotid ...Pullman, WA 99163 Gilman, S. C, G. J. Fischer, R. J. Biersner, R. D. Thornton, and D. A. Miller. 1979. Human parotid gland alpha-amylase a function of chronic hyperbaric exposure. Undersea Biomed. Res. 6(3):303-307.—Secretion of a-amylase by the human parotid gland increased

  14. Production, purification and characterization of an extracellular alpha-amylase enzyme isolated from Aspergillus flavus.


    Abou-Zeid, A M


    Filamentous fungi isolated from cereals were screened for their ability to produce alpha-amylase (1,4-alpha-glucan glucanohydrolase, EC A selected strain identified as Aspergillus flavus showed high enzymatic activity. A single extracellular alpha-amylase was purified to homogeneity by a starch adsorption method. The molecular weight (M(r)) of the A. flavus alpha-amylase was approximately 75,000 +/- 3,000 by polyacrylamide gel electrophoresis (PAGE) and that of the subunit was approximately 75,000 +/- 3000 SDS-PAGE. The optimal activity of the purified enzyme was achieved at pH 7.0 and 30 degrees C. K+ ions increased the alpha-amylase activity, but Mg2+ did not greatly affect enzyme activity. Mn2+, Zn2+, Cu2+ and Fe3+ ions strongly inhibited the enzyme activity. The products of hydrolysis of native starch by the A. flavus enzyme were mainly glucose as well as unidentified oligosaccharides.

  15. Optimization of Alpha-Amylase Application in U.S. Factories

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In recent years there have been warnings by some U.S. refineries that there may be a penalty for high starch concentrations in raw sugar if starch control is not improved. Most commercial alpha-amylases used by the U.S. sugar industry to control starch have intermediate temperature stability (up to...

  16. The noncatalytic triad of alpha-amylases: a novel structural motif involved in conformational stability.


    Marx, Jean-Claude; Poncin, Johan; Simorre, Jean-Pierre; Ramteke, Pramod W; Feller, Georges


    Chloride-activated alpha-amylases contain a noncatalytic triad, independent of the glycosidic active site, perfectly mimicking the catalytic triad of serine-proteases and of other active serine hydrolytic enzymes. Mutagenesis of Glu, His, and Ser residues in various alpha-amylases shows that this pattern is a structural determinant of the enzyme conformation that cannot be altered without losing the intrinsic stability of the protein. (1)H-(15)N NMR spectra of a bacterial alpha-amylase reveal proton signals that are identical with the NMR signature of catalytic triads and especially a deshielded proton involving a protonated histidine and displaying properties similar to that of a low barrier hydrogen bond. It is proposed that the H-bond between His and Glu of the noncatalytic triad is an unusually strong interaction, responsible for the observed NMR signal and for the weak stability of the triad mutants. Furthermore, a stringent template-based search of the Protein Data Bank demonstrated that this motif is not restricted to alpha-amylases, but is also found in 80 structures from 33 different proteins, amongst which SH2 domain-containing proteins are the best representatives.

  17. The effect of oral stimulation on human parotid salivary flow rate and alpha-amylase secretion.


    Froehlich, D A; Pangborn, R M; Whitaker, J R


    Unilateral parotid saliva was collected from ten subjects following oral stimulation with water as baseline, and aqueous solutions of starch (2.5, 5.0, and 10%), sucrose (0.1, 0.2, and 0.4 M) sodium chloride (0.075, 0.15, and 0.30 M), and citric acid (0.005, 0.01, and 0.02 M). Salivary flow rate increased with increasing levels of each taste stimulus. At concentrations of equal taste intensity, citric acid evoked the highest flow rate, followed by sodium chloride and sucrose, while starch, in solution, had a minimal effect. Secretion rate patterns for total protein and alpha-amylase mirrored those of flow rate. The total protein and alpha-amylase concentrations of the saliva, and specific activity of alpha-amylase, were influenced by the type but not the concentration of stimulus, with citric acid stimulation resulting in the lowest concentrations and highest specific activity. Sodium ion (Na+) concentration generally increased with increasing stimulated flow rate, while K+, Ca++, and Mg++ concentrations remained relatively constant. Subjects with lower flow rates had a more concentrated saliva than those with high flow, except for Na+ concentration. Oral stimulation resulted in similar changes in protein and alpha-amylase secretion rates for the two groups.

  18. Integrable alpha-amylase plasmid for generating random transcriptional fusions in Bacillus subtilis.

    PubMed Central

    O'Kane, C; Stephens, M A; McConnell, D


    An integrable plasmid, pOK4, which replicated independently in Escherichia coli was constructed for generating transcriptional fusions in vivo in Bacillus DNA. It did not replicate independently in Bacillus subtilis, but it could be made to integrate into the chromosome of B. subtilis if sequences homologous to chromosomal sequences were inserted into it. It had a selectable marker for chloramphenicol resistance and carried unique sites for EcoRI and SmaI just to the 5' side of a promoterless alpha-amylase gene from Bacillus licheniformis. When B. subtilis DNA fragments were ligated into one of these sites and the ligation mixture was used to transform an alpha-amylase-negative B. subtilis strain, chloramphenicol-resistant transformants could be isolated conveniently. Many of these were alpha-amylase positive, owing to the fusion of the plasmid amylase gene to chromosomal operons. In principle, because integration need not be mutagenic, it is possible to obtain fusions to any chromosomal operon. The site of each integration can be mapped, and the flanking sequences can be cloned into E. coli. The alpha-amylase gene can be used to detect regulated genes. We used it as an indicator to detect operons which are DNA-damage-inducible (din), and we identified insertions in both SP beta and PBSX prophages. Images PMID:3096966

  19. Peer Victimization and Aggression: Moderation by Individual Differences in Salivary Cortisol and Alpha-Amylase

    ERIC Educational Resources Information Center

    Rudolph, Karen D.; Troop-Gordon, Wendy; Granger, Douglas A.


    This research examined whether variations in salivary measures of the hypothalamic-pituitary-adrenal axis (cortisol) and autonomic nervous system (alpha amylase [sAA]) contribute to individual differences in the association between peer victimization and aggression. Children (N = 132; M age = 9.46 years, SD = 0.33) completed a measure of peer…

  20. Isolation and characterization of a novel thermostable alpha-amylase from Korean pine seeds.


    Azad, Md Abul Kalam; Bae, Jae-Han; Kim, Jong-Sang; Lim, Jin-Kyu; Song, Kyung-Sik; Shin, Beom-Soo; Kim, Hak-Ryul


    Amylases have significant importance in broad industrial application including bio-ethanol production. Although amylases are widely distributed in microbes, plants and animals, it has been sought for new amylases from various sources with special industrial potential. In this study we firstly isolated and characterized a novel thermostable alpha-amylase from Korean pine seed. Enzyme was purified to homogeneity level with purification fold of 1286.1 using several techniques such as self-precipitation, (NH(4))(2)SO(4) fractionation, DEAE anion exchange and starch affinity chromatography. The purified alpha-amylase showed two bands in SDS-PAGE with molecular weight of 44 and 45 kDa. The apparent molecular weight of native enzyme was calculated to be 46.7 kDa. Internal peptide sequencing confirmed that the purified alpha-amylase was a novel enzyme. The optimum pH and temperature for enzyme activity were pH 4.5 and 65 degrees C, respectively. This enzyme was fully stable for 48h at 50 degrees C and retained 80% activity up to 96h. The K(m) and V(max) were 0.84 mg/ml and 3.71 micromol/min, respectively. On the basis of high thermal stability and a broad range of pH stability, the pine seed alpha-amylase showed a good prospect of industrial application.

  1. Production and Partial Purification of Alpha Amylase from Bacillus subtilis (MTCC 121) Using Solid State Fermentation.


    Raul, Dibyangana; Biswas, Tania; Mukhopadhyay, Suchita; Kumar Das, Shrayan; Gupta, Suvroma


    Amylase is an enzyme that catalyzes the breakdown of starch into sugars and plays a pivotal role in a variety of areas like use as digestives, for the production of ethanol and high fructose corn syrup, detergents, desiring of textiles, modified starches, hydrolysis of oil-field drilling fluids, and paper recycling. In the present work, solid state fermentation (SSF) for α -amylase production has been used in lieu of submerged fermentation (SmF) due to its simple technique, low capital investment, lower levels of catabolite repression, and better product recovery. Bacillus subtilis has been well known as producer of alpha amylase and was tested using solid state fermentation for 48 hours at 37°C with wheat bran as substrate. Comparison between different fermentation hours demonstrated high yield of alpha amylase after 48 hours. This alpha amylase has optimum pH and temperature at 7.1 and 40°C, respectively. With the goal to purify alpha amylase, 30-70% (NH4)2SO4 cut concentrated the amylase activity threefold with respect to crude fermented extract. This was verified in quantitative DNS assay method as well as in zymogram gel profile. The exact molecular weight of the amylase is yet to be determined with the aid of other protein purification techniques.

  2. Production of alpha-amylase from Aspergillus oryzae for several industrial applications in a single step.


    Porfirif, María C; Milatich, Esteban J; Farruggia, Beatriz M; Romanini, Diana


    A one-step method as a strategy of alpha-amylase concentration and purification was developed in this work. This methodology requires the use of a very low concentration of biodegradable polyelectrolyte (Eudragit(®) E-PO) and represents a low cost, fast, easy to scale up and non-polluting technology. Besides, this methodology allows recycling the polymer after precipitation. The formation of reversible soluble/insoluble complexes between alpha-amylase and the polymer Eudragit(®) E-PO was studied, and their precipitation in selected conditions was applied with bioseparation purposes. Turbidimetric assays allowed to determine the pH range where the complexes are insoluble (4.50-7.00); pH 5.50 yielded the highest turbidity of the system. The presence of NaCl (0.05M) in the medium totally dissociates the protein-polymer complexes. When the adequate concentration of polymer was added under these conditions to a liquid culture of Aspergillus oryzae, purification factors of alpha-amylase up to 7.43 and recoveries of 88% were obtained in a simple step without previous clarification. These results demonstrate that this methodology is suitable for the concentration and production of alpha-amylase from this source and could be applied at the beginning of downstream processing.

  3. Structure of Bacillus amyloliquefaciens alpha-amylase at high resolution: implications for thermal stability.


    Alikhajeh, Jahan; Khajeh, Khosro; Ranjbar, Bijan; Naderi-Manesh, Hossein; Lin, Yi Hung; Liu, Enhung; Guan, Hong Hsiang; Hsieh, Yin Cheng; Chuankhayan, Phimonphan; Huang, Yen Chieh; Jeyaraman, Jeyakanthan; Liu, Ming Yih; Chen, Chun Jung


    The crystal structure of Bacillus amyloliquefaciens alpha-amylase (BAA) at 1.4 A resolution revealed ambiguities in the thermal adaptation of homologous proteins in this family. The final model of BAA is composed of two molecules in a back-to-back orientation, which is likely to be a consequence of crystal packing. Despite a high degree of identity, comparison of the structure of BAA with those of other liquefying-type alpha-amylases indicated moderate discrepancies at the secondary-structural level. Moreover, a domain-displacement survey using anisotropic B-factor and domain-motion analyses implied a significant contribution of domain B to the total flexibility of BAA, while visual inspection of the structure superimposed with that of B. licheniformis alpha-amylase (BLA) indicated higher flexibility of the latter in the central domain A. Therefore, it is suggested that domain B may play an important role in liquefying alpha-amylases, as its rigidity offers a substantial improvement in thermostability in BLA compared with BAA.

  4. [Characteristics of alpha-amylase isozymes in cytologenetically different wheat cultivars].


    Netsvetaev, V P; Badaeva, E D


    The isoenzyme composition of alpha-amylase is studied by polyacrylamide gel electrophoresis in Tris-glycine (pH 8.3) system in wheat cultivars with different genome composition. We show that durum wheat (Triticum durum, 2n=4x=28, BBAA) lacks the isoenzymes encoded by 6D and 7D chromosomes that are present in common wheat zymograms (Triticum aestivum, 2n=6x=42, BBAADD). A similar pattern is observed in a synthetic allohexaploid carrying the BBAA genomes of wheat and the HchHch genome of barley (Hordeum chilense). Our method of electrophoresis fails to reveal additional variants of alpha-amylase encoded by the barley genome, although C-banding analysis confirms the genomic structure BBAAHChHCh of this allopolyploid. The electrophoretic spectrum of the spring common wheat cultivar Dobrynya with the wheat-Agropyron translocation 7DL-7AiL contains all of the alpha-amylase isoenzymes typical for common wheat (2n=6x=42, BBAADD) except for the zymotype encoded by the long arm of chromosome 7D. This observation confirms the results of cytogenetic analysis that identified a 7DL-7AiL translocation in this cultivar. No additional alpha-amylase isoenzymes encoded by Agropyron chromosome have been observed. Our data indicate that analysis of wheat-alien hybrids or introgressive forms should be carried out using a complex of different methods.

  5. Increased production of alpha-amylase by Bacillus amyloliquefaciens in the presence of glycine

    SciTech Connect

    Zhang, Q.; Tsukagoshi, N.; Miyashiro, S.; Udaka, S.


    The production of alpha-amylase by Bacillus amyloliquefaciens increased by a factor of 300 when glycine was added to a chemically defined simple medium at the early-logarithmic phase of growth. Glycine was not metabolized to a significant extent under the conditions used, but it considerably prevented the lowering of the pH of the culture. (Refs. 10).


    Technology Transfer Automated Retrieval System (TEKTRAN)

    Starch is an extremely abundant, economical and versatile industrial commodity. Many industrial uses of starch depend on hydrolyzing the polymer for the conversion of glucose and maltodextrins. Starch hydrolysis is frequently achieved by utilizing alpha-amylase, which is an endo-acting enzyme that...

  7. Thermodynamic stability of a cold-active alpha-amylase from the Antarctic bacterium Alteromonas haloplanctis.


    Feller, G; d'Amico, D; Gerday, C


    The thermal stability of the cold-active alpha-amylase (AHA) secreted by the Antarctic bacterium Alteromonas haloplanctis has been investigated by intrinsic fluorescence, circular dichroism, and differential scanning calorimetry. It was found that this heat-labile enzyme is the largest known multidomain protein exhibiting a reversible two-state unfolding, as demonstrated by the recovery of DeltaHcal values after consecutive calorimetric transitions, a DeltaHcal/DeltaHeff ratio close to unity, and the independence of unfolding thermodynamic parameters of scan rates. By contrast, the mesophilic alpha-amylases investigated here (from porcine pancreas, human salivary glands, yellow meal beetle, Bacillus amyloliquefaciens, and Bacillus licheniformis) unfold irreversibly according to a non-two-state mechanism. Unlike mesophilic alpha-amylases, the melting point of AHA is independent of calcium and chloride binding while the allosteric and structural functions of these ions are conserved. The thermostability of AHA at optimal conditions is characterized by a Tm of 43.7 degrees C, a DeltaHcal of 238 kcal mol-1, and a DeltaCp of 8.47 kcal mol-1 K-1. These values were used to calculate the Gibbs free energy of unfolding over a wide range of temperatures. This stability curve shows that (a) the specific DeltaGmax of AHA [22 cal (mol of residue)-1] is 4 times lower than that of mesophilic alpha-amylases, (b) group hydration plays a crucial role in the enzyme flexibility at low temperatures, (c) the temperature of cold unfolding closely corresponds to the lower limit of bacterial growth, and (d) the recombinant heat-labile enzyme can be expressed in mesophilic hosts at moderate temperatures. It is also argued that the cold-active alpha-amylase has evolved toward the lowest possible conformational stability of its native state.

  8. Two Strategies for Microbial Production of an Industrial Enzyme-Alpha-Amylase

    NASA Technical Reports Server (NTRS)

    Bernhardsdotter, Eva C. M. J.; Garriott, Owen; Pusey, Marc L.; Ng, Joseph D.


    Extremophiles are microorganisms that thrive in, from an anthropocentric view, extreme environments including hot springs, soda lakes and arctic water. This ability of survival at extreme conditions has rendered extremophiles to be of interest in astrobiology, evolutionary biology as well as in industrial applications. Of particular interest to the biotechnology industry are the biological catalysts of the extremophiles, the extremozymes, whose unique stabilities at extreme conditions make them potential sources of novel enzymes in industrial applications. There are two major approaches to microbial enzyme production. This entails enzyme isolation directly from the natural host or creating a recombinant expression system whereby the targeted enzyme can be overexpressed in a mesophilic host. We are employing both methods in the effort to produce alpha-amylases from a hyperthermophilic archaeon (Thermococcus) isolated from a hydrothermal vent in the Atlantic Ocean, as well as from alkaliphilic bacteria (Bacillus) isolated from a soda lake in Tanzania. Alpha-amylases catalyze the hydrolysis of internal alpha-1,4-glycosidic linkages in starch to produce smaller sugars. Thermostable alpha-amylases are used in the liquefaction of starch for production of fructose and glucose syrups, whereas alpha-amylases stable at high pH have potential as detergent additives. The alpha-amylase encoding gene from Thermococcus was PCR amplified using carefully designed primers and analyzed using bioinformatics tools such as BLAST and Multiple Sequence Alignment for cloning and expression in E.coli. Four strains of Bacillus were grown in alkaline starch-enriched medium of which the culture supernatant was used as enzyme source. Amylolytic activity was detected using the starch-iodine method.

  9. Concurrent attenuated reactivity of alpha-amylase and cortisol is related to disruptive behavior in male adolescents.


    de Vries-Bouw, Marjan; Jansen, Lucres; Vermeiren, Robert; Doreleijers, Theo; van de Ven, Peter; Popma, Arne


    Attenuated reactivity of salivary alpha-amylase has been proposed as a specific sympathetic marker of disruptive behavior in juveniles and may have additional value to studying other autonomic parameters and hypothalamic-pituitary-adrenal axis activity. Investigating the interrelationships between neurobiological parameters in relation to juvenile disruptive behavior may enhance insight into the complex mechanisms at play. We investigated salivary alpha-amylase, cortisol, heart rate (HR), and heart rate variability (HRV) in response to a standardized public speaking task, and examined interactions between these parameters in relation to disruptive behavior. Participants were 48 delinquent male adolescents (mean age 18.4 years, SD 0.9), with and without a disruptive behavior disorder (resp. DP+, DP-) and 16 matched normal controls (NC). A structured psychiatric interview as well as the Youth Self Report and Child Behavior Checklist were administered to assess disruptive behavior. Alpha-amylase and cortisol reactivity, but not HR or HRV, showed significant inverse associations with dimensional measures of disruptive behavior. Moreover, both cortisol and alpha-amylase reactivity were significantly lower in the DP+ group as compared to the NC group. The mentioned relationships remained present when nicotine use was entered as a covariate. Combining alpha-amylase and cortisol in one model explained a larger part of the variance of disruptive behavior than either single parameter. There were no interactions between alpha-amylase and cortisol or HRV in relation to disruptive behavior. Attenuated alpha-amylase responsivity to stress is a correlate of disruptive behavior in late-adolescent males. Although nicotine use explains a considerable part of the variance of disruptive behavior, both alpha-amylase and cortisol are related to disruptive behavior, over and above the effect of nicotine use. Combining alpha-amylase and cortisol improved insight into neurobiological

  10. Diurnal profiles of salivary cortisol and alpha-amylase change across the adult lifespan: evidence from repeated daily life assessments.


    Nater, Urs M; Hoppmann, Christiane A; Scott, Stacey B


    Salivary cortisol and alpha-amylase are known to have distinctive diurnal profiles. However, little is known about systematic changes in these biomarkers across the adult lifespan. In a study of 185 participants (aged 20-81 years), time-stamped salivary cortisol and alpha-amylase were collected 7 times/day over 10 days. Samples were taken upon waking, 30 min later, and then approximately every 3 h until 9 pm. Multilevel models showed that older age was associated with increased daily cortisol secretion as indicated by greater area under the curve, attenuated wake-evening slopes, and more pronounced cortisol awakening responses. Further, older age was related to greater daily alpha-amylase output and attenuated wake-evening slopes. No age differences were observed regarding the alpha-amylase awakening response. Our findings may contribute to a better understanding of age-related differences in functioning of stress-related systems.

  11. A circularly permuted alpha-amylase-type alpha/beta-barrel structure in glucan-synthesizing glucosyltransferases.


    MacGregor, E A; Jespersen, H M; Svensson, B


    A motif of amino acid residues, located at the active site and specific beta-strands in alpha-amylases, is recognized in alpha-1,3- and alpha-1,6-glucan-synthesizing glucosyltransferases, leading to the conclusion that these enzymes contain an alpha/beta-barrel closely related to the (beta/alpha)8-fold of the alpha-amylase superfamily. The secondary structure elements of the transferase barrel, however, are circularly permuted to start with an alpha-helix equivalent to helix 3 in the alpha-amylases. Thus, the transferase counterpart of the long third beta-->alpha connection--constituting a domain in the alpha-amylases--is divided to precede and succeed the barrel. This architectural arrangement may be coupled to sucrose scission and glucosyl transfer. The involvement in the mechanism in glucosyltransferases of active site residues recurring in amylolytic enzymes is discussed.

  12. Production and characterization of a thermostable alpha-amylase from Nocardiopsis sp. endophyte of yam bean.


    Stamford, T L; Stamford, N P; Coelho, L C; Araújo, J M


    Thermostable amylolytic enzymes have been currently investigated to improve industrial processes of starch degradation. Studies on production of alpha-amylase by Nocardiopsis sp., an endophytic actinomycete isolated from yam bean (Pachyrhizus erosus L. Urban), showed that higher enzyme levels were obtained at the end of the logarithmic growth phase after incubation for 72 h at pH 8.6. Maximum activity of alpha-amylase was obtained at pH 5.0 and 70 degrees C. The isolated enzyme exhibited thermostable properties as indicated by retention of 100% of residual activity at 70 degrees C, and 50% of residual activity at 90 degrees C for 10 min. Extracellular enzyme from Nocardiopsis sp. was purified by fractional precipitation with ammonium sulphate. After 60% saturation produced 1130 U mg-1 protein and yield was 28% with purification 2.7-fold. The enzyme produced by Nocardiopsis sp. has potential for industrial applications.

  13. Measuring Stress and Ability to Recover from Stress with Salivary Alpha-Amylase Levels

    DTIC Science & Technology


    Ability to Recover from Stress with Salivary α- Amylase Levels Authors Brandon L. Mulrine Michael F. Sheehan Lolita M. Burrell Michael...TITLE AND SUBTITLE Measuring Stress and Ability to Recover from Stress with Salivary Alpha Amylase Levels 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c...stress-related conditions. The findings suggest that measuring salivary α- amylase levels may help to determine a Soldier’s resilience or risk of

  14. Alpha-amylase from mung beans (Vigna radiata)--correlation of biochemical properties and tertiary structure by homology modelling.


    Tripathi, Pallavi; Lo Leggio, Leila; Mansfeld, Johanna; Ulbrich-Hofmann, Renate; Kayastha, Arvind M


    Alpha-amylase from germinated mung beans (Vigna radiata) has been purified 600-fold to electrophoretic homogeneity and a final specific activity of 437 U/mg. SDS-PAGE of the final preparation revealed a single protein band of 46 kDa. The optimum pH was 5.6. The energy of activation was determined to be 7.03 kcal/mol in the temperature range 15-55 degrees C. Km for starch was 1.6 mg/mL in 50 mM sodium acetate buffer, pH 5.5. Thermal inactivation studies at 70 degrees C showed first-order kinetics with rate constant (k) equal to 0.005 min(-1). Mung bean alpha-amylase showed high specificity for its primary substrate starch. Addition of EDTA (10 mM) caused irreversible loss of activity. Mung bean alpha-amylase is inhibited in a non-competitive manner by heavy metal ions, for example, mercury with a Ki of 110 microM. Homology modelling studies with mung bean alpha-amylase using barley alpha-amylases Amy 1 and Amy 2 as templates showed a very similar structure as expected from the high sequence identity. The model showed that alpha-amylase from mung beans has no sugar-binding site, instead it has a methionine. Furthermore, instead of two tryptophans, it has Val(277) and Lys(278), which are the conserved residues, important for proper folding and conformational stability.

  15. Control of. cap alpha. -amylase mRNA accumulation by gibberellic acid and calcium in barley aleurone layers

    SciTech Connect

    Deikman, J.; Jones, R.L.


    Pulse-labeling of barley (Hordeum vulgare L. cv Himalaya) aleurone layers incubated for 13 hours in 2.5 micromolar gibberellic acid (GA/sub 3/) with or without 5 millimolar CaCl/sub 2/ shows that ..cap alpha..-amylase isozymes 3 and 4 are not synthesized in vivo in the absence of Ca/sup 2 +/. No difference was observed in ..cap alpha..-amylase mRNA levels between layers incubated for 12 hours in 2.5 micromolar GA/sub 3/ with 5 millimolar CaCl/sub 2/ and layers incubated in GA/sub 3/ alone. RNA isolated from layers incubated for 12 hours in GA/sub 3/ with and without CA/sup 2 +/. A cDNA clone for ..cap alpha..-amylase was isolated and used to measure ..cap alpha..-amylase mRNA levels in aleurone layers incubated in the presence and absence of Ca/sup 2 +/ was translated in vitro and was found to produce the same complement of translation products regardless of the presence of Ca/sup 2 +/ in the incubation medium. Immunoprecipitation of translation products showed that the RNA for ..cap alpha..-amylase synthesized in Ca/sup 2 +/-deprived aleurone layers was translatable. Ca/sup 2 +/ is required for the synthesis of ..cap alpha..-amylase isozymes 3 and 4 at a step after mRNA accumulation and processing.

  16. Starch-binding domain affects catalysis in two Lactobacillus alpha-amylases.


    Rodríguez-Sanoja, R; Ruiz, B; Guyot, J P; Sanchez, S


    A new starch-binding domain (SBD) was recently described in alpha-amylases from three lactobacilli (Lactobacillus amylovorus, Lactobacillus plantarum, and Lactobacillus manihotivorans). Usually, the SBD is formed by 100 amino acids, but the SBD sequences of the mentioned lactobacillus alpha-amylases consist of almost 500 amino acids that are organized in tandem repeats. The three lactobacillus amylase genes share more than 98% sequence identity. In spite of this identity, the SBD structures seem to be quite different. To investigate whether the observed differences in the SBDs have an effect on the hydrolytic capability of the enzymes, a kinetic study of L. amylovorus and L. plantarum amylases was developed, with both enzymes acting on several starch sources in granular and gelatinized forms. Results showed that the amylolytic capacities of these enzymes are quite different; the L. amylovorus alpha-amylase is, on average, 10 times more efficient than the L. plantarum enzyme in hydrolyzing all the tested polymeric starches, with only a minor difference in the adsorption capacities.

  17. Artificial chaperone-assisted refolding of chemically denatured alpha-amylase.


    Yazdanparast, Razieh; Khodagholi, Fariba; Khodarahmi, Reza


    It is now well established that alpha-cyclodextrin (alpha-CD) is a valuable folding agent in refolding processes of several denatured enzyme solutions. The refolding of Gu-HCl denatured alpha-amylase in the dilution-additive mode revealed that alpha-CD enhanced the refolding yield by 20-30% depending upon alpha-CD concentration. However, the refolding efficiency of the Gu-HCl denatured alpha-amylase through the artificial chaperone-assisted method indicated that alpha-CD enhanced the activity recovery of denatured alpha-amylase by almost 50% and also increased the reactivation rate constant relative to the unassisted control sample. The higher refolding efficiency should be due to different mechanism played by alpha-CD in this technique. In addition, our data indicated that higher refolding yields are obtained when the residual Gu-HCl concentration is low in the refolding environment and when the capture agent is removed not in a stepwise manner from the protein-detergent complexes in the stripping step of the whole process. Collectively, the results of this investigation expand the range of procedural variations used to refold different denatured proteins through artificial chaperone-assisted method.

  18. Isolation and characterisation of a novel alpha-amylase from the extreme haloarchaeon Haloterrigena turkmenica.


    Santorelli, Marco; Maurelli, Luisa; Pocsfalvi, Gabriella; Fiume, Immacolata; Squillaci, Giuseppe; La Cara, Francesco; Del Monaco, Giovanni; Morana, Alessandra


    An extracellular halophilic alpha-amylase (AmyA) was produced by the haloarchaeon Haloterrigena turkmenica grown in medium enriched with 0.2% (w/v) starch. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and size exclusion chromatography (SEC) analyses showed a major band at 66.0kDa and a peak of 54.0kDa, respectively. Analysis of tryptic fragments of the protein present in the major SDS-PAGE band by nano-LC-ESI-MS/MS led to identification of the alpha-amylase catalytic region, encoded by the htur2110 gene, as the protein possessing the described activity. Optimal values for activity were 55°C, pH 8.5 and 2M NaCl, and high thermostability was showed at 55°C and 3M NaCl. AmyA activity was enhanced by Triton X-100 and was not influenced by n-hexane and chloroform. Starch hydrolysis produced different oligomers with maltose as the smallest end-product. The efficiency of AmyA in degrading starch contained in agronomic residues was tested in grape cane chosen as model substrate. Preliminary results showed that starch was degraded making the enzyme a potential candidate for utilization of agro-industrial waste in fuel and chemicals production. AmyA is one of the few investigated amylases produced by haloarchaea, and the first alpha-amylase described among microorganisms belonging to the genus Haloterrigena.

  19. Production and properties of alpha-amylase from Penicillium chrysogenum and its application in starch hydrolysis.


    Balkan, Bilal; Ertan, Figen


    Fungi were screened for their ability to produce alpha-amylase by a plate culture method. Penicillium chrysogenum showed high enzymatic activity. Alpha-amylase production by P. chrysogenum cultivated in liquid media containing maltose (2%) reached its maximum at 6-8 days, at 30 degrees C, with a level of 155 U ml(-1). Some general properties of the enzyme were investigated. The optimum reaction pH and temperature were 5.0 and 30-40 degrees C, respectively. The enzyme was stable at a pH range from 5.0-6.0 and at 30 degrees C for 20 min and the enzyme's 92.1% activity's was retained at 40 degrees C for 20 min without substrate. Hydrolysis products of the enzyme were maltose, unidefined oligosaccharides, and a trace amount of glucose. Alpha-amylase of P. chrysogenum hydrolysed starches from different sources. The best hydrolysis was determined (98.69%) in soluble starch for 15 minute at 30 degrees C.

  20. [Influence of amaranth on the production of alpha-amylase using Aspergillus niger NRRL 3112].


    Mariani, D D; Lorda, G; Balatti, A P


    In this paper the influence of the amaranth seed meal and the aeration conditions on the alpha-amylase production by Aspergillus niger NRRL 3112 were studied. The assays of selection of culture medium were carried out in a rotary shaker at 250 rpm and 2.5 cm stroke. The aeration conditions were studied in a mechanically stirred fermentor New Brunswick type. A concentration of alpha-amylase of 2750 U.Dun/ml was achieved at 120 h with a dry weight of 8.0 g/l, using a base medium with 5.0 g/l Amaranthus cruentus seed meal. In the experiment performed in a New Brunswick fermentor, the highest value was 2806 U.Dun/ml. This result was obtained after 120 h, operating at 300 rpm and an airflow of 1 l/l. min. in a limited dissolved oxygen concentration. It was determined that the increase in the agitation rate was not favorable to the enzyme production, despite that an increase was verified in the dissolved oxygen. The morphology of the microorganism, in long and ramified hyphae, was the critical factor to obtain higher levels of alpha-amylase.

  1. Transformation of Bacillus subtilis in alpha-amylase productivity by deoxyribonucleic acid from B. subtilis var. amylosacchariticus.


    Yoneda, Y; Yamane, K; Yamaguchi, K; Nagata, Y; Maruo, B


    Deoxyribonucleic acid (DNA) of Bacillus subtilis var. amylosacchariticus showed almost the same ability as B. subtilis Marburg to induce transfer of several genetic markers in DNA-mediated transformation. DNA-DNA hybridization data also showed an intimate relationship between the two strains. Genetic elements involved in the production of extracellular alpha-amylase (EC in B. subtilis var. amylosacchariticus were studied by using DNA-mediated transformation. Two Marburg derivatives, NA20(amyR2) and NA20-22(amyR1), produced about 50 and 10 U of alpha-amylase per mg of cells, respectively, whereas B. subtilis var. amylosacchariticus produced as much as 150 U of the enzyme per mg of cells. When B. subtilis var. amylosacchariticus was crossed with strain NA20-22 as recipient, transformants that acquired high alpha-amylase productivity (about 50 U/mg of cells) were obtained. Genetic analysis revealed that a regulator gene (amyR) for alpha-amylase synthesis was found in B. subtilis var. amylosacchariticus, as in the case of B. natto 1212 (amyR2) and B. subtilis Marburg (amyR1). The allele was designated amyR3; it is phenotypically indistinguishable from amyR2, but is readily distinguishable from amyR1. The presence of amyR3 was not sufficient for an organism to render production of an exceptional amount of alpha-amylase. Extra-high alpha-amylase producers could be obtained by crossing B. subtilis var. amylosacchariticus as donor with strain NA20 as recipient. The transformants produced the same or even greater amounts of the enzyme than the donor strain. Results suggest the presence of another gene that is involved in the production of the exceptional amount of alpha-amylase.

  2. Development and validation of a monoclonal based immunoassay for the measurement of fungal alpha-amylase: focus on peak exposures.


    Elms, J; Denniss, S; Smith, M; Evans, P G; Wiley, K; Griffin, P; Curran, A D


    The inhalation of flour dust has been implicated in the induction of sensitisation and elicitation of respiratory symptoms, such as asthma in bakers. In addition to the cereal allergens present in wheat flour, enzymes in flour improvers, in particular fungal alpha-amylase, are now known to be a significant cause of respiratory allergy in the baking industry.A monoclonal antibody based enzyme-linked immunoassay (ELISA) was developed using two monoclonal antibodies that recognised two distinct epitopes of the fungal alpha-amylase enzyme. The ELISA had an inter-assay variation of 12.0% at 1360 pg/ml and 12.8% at 564 pg/ml and intra-assay variation of 4.9% at 1340 pg/ml and 6.1% at 504 pg/ml. The assay had a sensitivity of 200 pg/ml. Competitive inhibition assays confirmed that the monoclonal antibodies had no cross reactivity with other enzymes used in the baking industry and could distinguish added fungal alpha-amylase from cereal amylase. We assessed the levels of exposure to dust, total protein and fungal alpha-amylase in four UK bakeries ranging in size and technical capabilities. Within the bakeries we surveyed, workers were exposed to variable levels of inhalable dust (0.8-39.8 mg/m3), total protein (0-5.7 mg/m3) and fungal alpha-amylase (0-29.8 ng/m3). Consecutive 15 min personal samples taken over a 1 h period demonstrated that the ELISA could measure fungal alpha-amylase exposure in such a 15 min period. Short term peak exposures to fungal alpha-amylase could be identified which may contribute to the sensitisation in individuals who appear to have low exposure levels if measured over a full shift period.

  3. In vitro and in vivo inhibition of alpha-amylases of stored-product mite Acarus siro.


    Hubert, Jan; Dolecková-Maresová, Lucie; Hýblová, Jana; Kudlíková, Iva; Stejskal, Václav; Mares, Michael


    The stored-product mites are the most abundant and frequent group of pests living on the stored food products in Europe. They endanger public health since they produce allergens and transmit mycotoxin-producing fungi. Novel acaricidal compounds with inhibitory effects on the digestive enzymes of arthropods are a safe alternative to the traditional neurotoxic pesticides used for control of the stored-product pests. In this work, we explored the properties of acarbose, the low molecular weight inhibitor of alpha-amylases (AI), as a novel acaricide candidate for protection of the stored products from infestation by Acarus siro (Acari: Acaridae). In vitro analysis revealed that AI blocked efficiently the enzymatic activity of digestive amylases of A. siro, and decreased the physiological capacity of mite's gut in utilizing a starch component of grain flour. In vivo experiments showed that AI suppressed the population growth of A. siro. The mites were kept for three weeks on experimental diet enriched by AI in concentration range of 0.005 to 0.25%. Population growth of A. siro was negatively correlated with the content of AI in the treated diet with a half-population dose of 0.125%. The suppressive effect of AIs on stored-product mites is discussed in the context of their potential application in GMO crops.

  4. A Proposed Mechanism for the Thermal Denaturation of a Recombinant Bacillus Halmapalus Alpha-amylase - the Effect of Calcium Ions

    NASA Technical Reports Server (NTRS)

    Nielsen, Anders D.; Pusey, Marc L.; Fuglsang, Claus C.; Westh, Peter


    The thermal stability of a recombinant alpha-amylase from Bacillus halmapalus alpha-amylase (BHA) has been investigated using circular dichroism spectroscopy (CD) and differential scanning calorimetry (DSC). This alpha-amylase is homologous to other Bacillus alpha-amylases where previous crystallographic studies have identified the existence of 3 calcium binding sites in the structure. Denaturation of BHA is irreversible with a Tm of approximately 89 C, and DSC thermograms can be described using a one-step irreversible model. A 5 C increase in T(sub m) in the presence of 10 fold excess CaCl2 was observed. However, a concomitant increase in the tendency to aggregate was also observed. The presence of 30-40 fold excess calcium chelator (EDTA or EGTA) results in a large destabilization of BHA corresponding to about 40 C lower T(sub m), as determined by both CD and DSC. Ten fold excess EGTA reveals complex DSC thermograms corresponding to both reversible and irreversible transitions, which possibly originate from different populations of BHA:calcium complexes. The observations in the present study have, in combination with structural information of homologous alpha-amylases, provided the basis for the proposal of a simple denaturation mechanism of BHA. The proposed mechanism describes the irreversible thermal denaturation of different BHA:calcium complexes and the calcium binding equilibrium involved. Furthermore, the model accounts for a temperature induced reversible structural change associated with calcium binding.

  5. Two tandemly located promoters, artificially constructed, are active in a Bacillus subtilis alpha-amylase secretion vector.


    Furusato, T; Takano, J; Jigami, Y; Tanaka, H; Yamane, K


    An 85 bp DNA fragment, the nucleotide sequence of which had 84% homology with the sequence for the promoter, ribosome binding site and NH2-terminal five amino acids of the Bacillus amyloliquefaciens alpha-amylase gene, was chemically synthesized. In order to analyze the promoter activity of a Bacillus subtilis alpha-amylase secretion vector, the fragment was inserted between the promoter and signal peptide-coding region of Bacillus subtilis alpha-amylase gene. Both promoters, tandemly repeated, functioned in transcribing the B. subtilis alpha-amylase signal peptide-coding region followed by the Escherichia coli beta-lactamase structural gene. The transcription initiation sites were determined by the primer extension method. The extracellular production of beta-lactamase was stimulated by two promoters as compared with that by the plasmids containing either promoter region alone. The change of two amino acids in the NH2-terminal region of the B. subtilis alpha-amylase signal peptide had no effect on the secretion of beta-lactamase from B. subtilis cells.

  6. Chewing bread: impact on alpha-amylase secretion and oral digestion.


    Joubert, Marianne; Septier, Chantal; Brignot, Hélène; Salles, Christian; Panouillé, Maud; Feron, Gilles; Tournier, Carole


    During chewing, saliva helps in preparing the food bolus by agglomerating the formed particles, and it initiates enzymatic food breakdown. However, limited information is actually available on the adaptation of saliva composition during the oral processing of complex foods, especially for foods that are sensitive to salivary enzymes. We addressed this question in the context of starch-based products and salivary alpha-amylase. The objectives were two-fold: (1) to determine if salivary alpha-amylase secretion can be modulated by the bread type and (2) to evaluate the contribution of the oral phase in bread enzymatic breakdown. Mouthfuls of three different wheat breads (industrial, artisan and whole-meal breads) were chewed by twelve subjects. Saliva samples were collected at rest and at different times corresponding to 33, 66 and 100% of the individual's chewing sequence. Alpha-amylase activity and total protein content were determined for all saliva samples that were collected. Additionally, the salivary maltose concentration was measured as a marker of bread enzymatic digestion. Boluses were collected at the swallowing time to evaluate the saliva uptake. Chewing industrial bread induced higher saliva uptake than the other breads despite a similar chewing duration. The evolution of salivary amylase activity tended to depend on the type of bread and was highly influenced by a large degree of inter- and intra-subject variability. The protein and maltose concentration steadily increased during chewing as a result of bread breakdown. The salivary protein concentration was mainly affected by the release of the water-soluble proteins of the bread. The salivary maltose concentration was found to be significantly lower for the whole-meal bread. When considering the weight of the mouthful, enzymatic breakdown was found to be most efficient for the breads ranking from industrial > artisan > whole-meal.

  7. Properties and applications of starch-converting enzymes of the alpha-amylase family.


    van der Maarel, Marc J E C; van der Veen, Bart; Uitdehaag, Joost C M; Leemhuis, Hans; Dijkhuizen, L


    Starch is a major storage product of many economically important crops such as wheat, rice, maize, tapioca, and potato. A large-scale starch processing industry has emerged in the last century. In the past decades, we have seen a shift from the acid hydrolysis of starch to the use of starch-converting enzymes in the production of maltodextrin, modified starches, or glucose and fructose syrups. Currently, these enzymes comprise about 30% of the world's enzyme production. Besides the use in starch hydrolysis, starch-converting enzymes are also used in a number of other industrial applications, such as laundry and porcelain detergents or as anti-staling agents in baking. A number of these starch-converting enzymes belong to a single family: the alpha-amylase family or family13 glycosyl hydrolases. This group of enzymes share a number of common characteristics such as a (beta/alpha)(8) barrel structure, the hydrolysis or formation of glycosidic bonds in the alpha conformation, and a number of conserved amino acid residues in the active site. As many as 21 different reaction and product specificities are found in this family. Currently, 25 three-dimensional (3D) structures of a few members of the alpha-amylase family have been determined using protein crystallization and X-ray crystallography. These data in combination with site-directed mutagenesis studies have helped to better understand the interactions between the substrate or product molecule and the different amino acids found in and around the active site. This review illustrates the reaction and product diversity found within the alpha-amylase family, the mechanistic principles deduced from structure-function relationship structures, and the use of the enzymes of this family in industrial applications.

  8. Structure, specificity and function of cyclomaltodextrinase, a multispecific enzyme of the alpha-amylase family.


    Park, K H; Kim, T J; Cheong, T K; Kim, J W; Oh, B H; Svensson, B


    Cyclomaltodextrinase (CDase, EC, maltogenic amylase (EC 3. 2.1.133), and neopullulanase (EC are reported to be capable of hydrolyzing all or two of the following three types of substrates: cyclomaltodextrins (CDs); pullulan; and starch. These enzymes hydrolyze CDs and starch to maltose and pullulan to panose by cleavage of alpha-1,4 glycosidic bonds whereas alpha-amylases essentially lack activity on CDs and pullulan. They also catalyze transglycosylation of oligosaccharides to the C3-, C4- or C6-hydroxyl groups of various acceptor sugar molecules. The present review surveys the biochemical, enzymatic, and structural properties of three types of such enzymes as defined based on the substrate specificity toward the CDs: type I, cyclomaltodextrinase and maltogenic amylase that hydrolyze CDs much faster than pullulan and starch; type II, Thermoactinomyces vulgaris amylase II (TVA II) that hydrolyzes CDs much less efficiently than pullulan; and type III, neopullulanase that hydrolyzes pullulan efficiently, but remains to be reported to hydrolyze CDs. These three types of enzymes exhibit 40-60% amino acid sequence identity. They occur in the cytoplasm of bacteria and have molecular masses from 62 to 90 kDa which are slightly larger than those of most alpha-amylases. Multiple amino acid sequence alignment and crystal structures of maltogenic amylase and TVA II reveal the presence of an N-terminal extension of approximately 130 residues not found in alpha-amylases. This unique N-terminal domain as seen in the crystal structures apparently contributes to the active site structure leading to the distinct substrate specificity through a dimer formation. In aqueous solution, most of these enzymes show a monomer-dimer equilibrium. The present review discusses the multiple specificity in the light of the oligomerization and the molecular structures arriving at a clarified enzyme classification. Finally, a physiological role of the enzymes is proposed.

  9. [Effect of dental alloys on salivary alkaline and acid phosphatase, alpha amylase K+, Na+, and Cl-].


    Todorov, I; Saprjanova, M


    Comparative studied were performed in healthy subjects without metals in their oral cavities and in individuals having different metal alloys (gold, steel, amalgam) in their mouths and presenting with various complaints such as xerostomia, burning mucosa, etc. It was found that the contents of alkaline and acid phosphatases, alpha-amylase, K+, Na+ and Cl- in saliva increased significantly with the increase in total corrosion potential when non-precious metal alloys, especially different types of alloys, were present. Parallel to this, the frequency and the intensity of the complaints increased.

  10. The effect of calcium binding on the unfolding barrier: A kinetic study on homologous alpha-amylases.


    Kumari, Arpana; Rosenkranz, Tobias; Kayastha, Arvind M; Fitter, Jörg


    Extreme thermostabilities of proteins can be achieved by binding co-factors to the protein structures. For various alpha-amylases protein stabilization upon calcium binding is a well-known phenomenon. In the present study the mechanism of stabilization of three homologous alpha-amylases was investigated by measuring the unfolding kinetics with CD spectroscopy. For this purpose thermal unfolding kinetics of calcium saturated and calcium depleted enzymes were analyzed by means of Eyring-plots. The free energy change between the native and the transition state which characterized the unfolding barrier height was found to be proportional to the number of calcium ions bound to the protein structures. For the most thermostable alpha-amylases calcium binding caused a significant increase in the enthalpy change, which was partly compensated by increased entropy changes.

  11. Purification by expanded bed adsorption and characterization of an alpha-amylases FORILASE NTL from A. niger.


    Toledo, A L; Severo, J B; Souza, R R; Campos, E S; Santana, J C C; Tambourgi, E B


    In this work the purification and biochemistry characterization of alpha-amylases from Aspergillus niger (FORILASE NTL) were studied. The effects of expansion degree of resin bed on enzyme purification by expanded bed adsorption (EBA) have also been studied. Residence time distributions (RTD) studies were done to achieve the optimal conditions of the amylases recovery on ion-exchange resin, and glucose solution was used as a new tracer. Results showed that height equivalent of the theoretical plates (HETP), axial dispersion and the Prandt number increased with bed height, bed voidage and linear velocity. The adsorption capacity of alpha-amylases, on the resin, increased with bed height and the best condition was at four-expansion degree. alpha-Amylase characterization showed that this enzyme has high affinity with soluble starch, good hydrolysis potential and molecular weight of 116 kDa.

  12. Alpha amylase assisted synthesis of TiO₂ nanoparticles: structural characterization and application as antibacterial agents.


    Ahmad, Razi; Mohsin, Mohd; Ahmad, Tokeer; Sardar, Meryam


    The enzyme alpha amylase was used as the sole reducing and capping agent for the synthesis of TiO2 nanoparticles. The biosynthesized nanoparticles were characterized by X-ray diffraction (XRD) and transmission electron microscopic (TEM) methods. The XRD data confirms the monophasic crystalline nature of the nanoparticles formed. TEM data shows that the morphology of nanoparticles depends upon the enzyme concentration used at the time of synthesis. The presence of alpha amylase on TiO2 nanoparticles was confirmed by FTIR. The nanoparticles were investigated for their antibacterial effect on Staphylococcus aureus and Escherichia coli. The minimum inhibitory concentration value of the TiO2 nanoparticles was found to be 62.50 μg/ml for both the bacterial strains. The inhibition was further confirmed using disc diffusion assay. It is evident from the zone of inhibition that TiO2 nanoparticles possess potent bactericidal activity. Further, growth curve study shows effect of inhibitory concentration of TiO2 nanoparticles against S. aureus and E. coli. Confocal microscopy and TEM investigation confirm that nanoparticles were disrupting the bacterial cell wall.

  13. Structural relationship between the enzymatic and streptococcal binding sites of human salivary alpha-amylase.


    Scannapieco, F A; Bhandary, K; Ramasubbu, N; Levine, M J


    Previous studies have demonstrated that human salivary alpha-amylase specifically binds to the oral bacterium Streptococcus gordonii. This interaction is inhibited by substrates such as starch and maltotriose suggesting that bacterial binding may involve the enzymatic site of amylase. Experiments were performed to determine if amylase bound to the bacterial surface possessed enzymatic activity. It was found that over one-half of the bound amylase was enzymatically active. In addition, bacterial-bound amylase hydrolyzed starch to glucose which was then metabolized to lactic acid by the bacteria. In further studies, the role of amylase's histidine residues in streptococcal binding and enzymatic function was assessed after their selective modification with diethyl pyrocarbonate. DEP-modified amylase showed a marked reduction in both enzymatic and streptococcal binding activities. These effects were diminished when DEP modification occurred in the presence of maltotriose. DEP-modified amylase had a significantly altered secondary structure when compared with native enzyme or amylase modified in the presence of maltotriose. Collectively, these results suggest that human salivary alpha-amylase may possess multiple sites for bacterial binding and enzymatic activity which share structural similarities.

  14. Physical and catalytic properties of alpha-amylase from Tenebrio molitor L. larvae.


    Buonocore, V; Poerio, E; Silano, V; Tomasi, M


    The amylase from Tenebrio molitor L. larvae (yellow mealworm) was characterized according to a number of its molecular and catalytic properties. The insect amylase is a single polypeptide chain with mol.wt. 68000, an isoelectric point of 4.0 and a very low content of sulphur-containing amino acids. The enzyme is a Ca2+-protein and behaves as an alpha-amylase. Removal of Ca2+ by exhaustive dialysis against water causes the irreversible inactivation of the enzyme. Moreover, the enzyme is activated by the presence in the assay mixture of Cl-, or some other inorganic anions that are less effective than Cl-, and is inhibited by F-. Optimal conditions of pH and temperature for the enzymic activity are 5.8 and 37 degrees C. The insect amylase exhibits an identical kinetic behaviour toward starch, amylose and amylopectin; the enzyme hydrolyses glycogen with a higher affinity constant. Compared with the non-insect alpha-amylases described in the literature, Tenebrio molitor amylase has a lower affinity for starch.

  15. Cortisol, salivary alpha-amylase and children's perceptions of their social networks.


    Ponzi, Davide; Muehlenbein, Michael P; Geary, David C; Flinn, Mark V


    In recent years there has been a growing interest in the use of social network analysis in biobehavioral research. Despite the well-established importance of social relationships in influencing human behavior and health, little is known about how children's perception of their immediate social relationships correlates with biological parameters of stress. In this study we explore the association between two measures of children's personal social networks, perceived network size and perceived network density, with two biomarkers of stress, cortisol and salivary alpha-amylase. Forty children (mean age = 8.30, min age = 5, and max age = 12) were interviewed to collect information about their friendships and three samples of saliva were collected. Our results show that children characterized by a lower pre-interview cortisol concentration and a lower salivary alpha-amylase reactivity to the interview reported the highest density of friendships. We discuss this result in light of the multisystem approach to the study of children's behavioral outcomes, emphasizing that future work of this kind is needed in order to understand the cognitive and biological mechanisms underlying children's and adolescents' social perceptual biases.

  16. Purification and characterization of alpha-amylase from safflower (Carthamus tinctorius L.) germinating seeds.


    Ben Elarbi, Mosbah; Khemiri, Halima; Jridi, Taoufik; Ben Hamida, Jeannette


    alpha-Amylase (alpha-1-4 D-glucan glucanohydrolase EC crude extract was obtained from safflower (Carthamus tinctorius L.) cotyledons excised from 5-day-old dark grown seedlings. The enzyme was purified by precipitating the crude extract with ammonium sulphate at 20-60% saturation, and then by subjecting this fraction to affinity chromatography on a beta-cyclodextrin-Sepharose 6B column. The active fraction was dialysed and concentrated. An overall purification of about 131 folds with an activity yield of 81.25% was achieved. The molecular mass of purified enzyme determined by SDS-PAGE was 35 kD. When the purified alpha-amylase was subjected to gel electrophoresis followed by negative staining, only one band of active protein was detected. Its maximal activity was in the pH 6.0 and at a temperature of 55 degrees C. This enzyme was activated by Ca(2+) and inhibited by Fe(2+).

  17. Dual feeding strategy for the production of alpha-amylase by Bacillus caldolyticus using complex media.


    Schwab, Karima; Bader, Johannes; Brokamp, Christian; Popović, Milan K; Bajpai, Rakesh; Berovic, Marin


    In this study, the objective was to investigate an exponential feeding strategy for fed-batch production of thermostable alpha-amylase (E.C. from the Bacillus caldolyticus (DSM405). The parameters for establishing compositions of feed media and feeding rate were obtained by statistical analysis of batch and continuous shake flask experiments. These parameters were casitone to starch ratio of 2.67g(casitone)g(starch)(-1), maintenance coefficient 0.174g(casitone)g(DW)(-1)h(-1), cell yield 0.62g(DW)g(casitone)(-1) and mu(opt)=0.2h(-1). The exponentially fed fermentation resulted in yield of 120Uml(-1) alpha-amylase that was thermostable up to 105 degrees C. Results of the exponentially fed fermentation have been discussed in the light of a feed-back controlled fed-batch fermentation reported earlier by the authors. A comparison of the temperature and pH effects on amylase produced by B. caldolyticus and on several other commercially available amylases has also been presented.

  18. The effects of autonomy support on salivary alpha-amylase: The role of individual differences.


    Sieber, Vanda; Schüler, Julia; Wegner, Mirko


    The empirical evidence for the relationship between autonomy-supportive environments and physiological stress is inconsistent. Whereas some studies report a decrease in stress in autonomy-supportive environments, other studies show a negative effect of autonomy on physiological stress. As previous research has not considered individual differences within this relationship, the present research aims to close this empirical gap by proposing that an implicit autonomy disposition, which is defined as a dispositional preference for self-determination, serves as a moderator. In an experiment, we tested whether the autonomy disposition moderates the effect of different teaching styles (controlling, autonomy-supportive, and neutral) on the acute physiological stress response (salivary alpha-amylase) in adolescents (N=69). The study revealed that participants with a high implicit autonomy disposition displayed lower salivary alpha-amylase responses when exposed to autonomy-supportive vignettes compared to when they were exposed to controlling or neutral teaching styles. The opposite pattern was found in students with a low implicit autonomy disposition. The results illustrate that experimentally induced variations in autonomy support lead to different physiological stress responses, depending on individual differences in the implicit autonomy disposition.

  19. Construction of an amylolytic industrial strain of Saccharomyces cerevisiae containing the Schwanniomyces occidentalis alpha-amylase gene.


    Kang, Na-Young; Park, Jeong-Nam; Chin, Jong-Eon; Lee, Hwanghee Blaise; Im, Suhn-Young; Bai, Suk


    The gene encoding Schwanniomyces occidentalis alpha-amylase (AMY) was introduced into the chromosomal delta sequences of an industrial strain of Saccharomyces cerevisiae. To obtain a strain suitable for commercial use, an delta-integrative cassette devoid of bacterial DNA sequences was constructed that contains the AMY gene and aureobasidin A resistance gene (AUR1-C) as the selection marker. The AMY gene was expressed under the control of the alcohol dehydrogenase gene promoter (ADC1p). The alpha-amylase activity of Sacc. cerevisiae transformed with this integrative cassette was 6 times higher than that of Sch. occidentalis. The transformants (integrants) were mitotically stable after 100 generations in nonselective medium.

  20. Stable yeast transformants that secrete functional. cap alpha. -amylase encoded by cloned mouse pancreatic cDNA

    SciTech Connect

    Filho, S.A.; Galembeck, E.V.; Faria, J.B.; Frascino, A.C.S.


    Mouse pancreatic ..cap alpha..-amylase complementary DNA was inserted into a yeast shuttle vector after the Saccharomyces cerevisiae MF..cap alpha..1 promoter and secretion signals coding sequences. When transformed with the recombinant plasmid, S. cerevisiae cells were able to synthesize and secrete functional ..cap alpha..-amylase, efficiently hydrolyzing starch present in the culture medium. Stable amylolytic cells were obtained from different yeast strains. This work represents a significant step towards producing yeast that can convert starchy materials directly to ethanol.

  1. Quantitative digital image analysis of chromogenic assays for high throughput screening of alpha-amylase mutant libraries.


    Shankar, Manoharan; Priyadharshini, Ramachandran; Gunasekaran, Paramasamy


    An image analysis-based method for high throughput screening of an alpha-amylase mutant library using chromogenic assays was developed. Assays were performed in microplates and high resolution images of the assay plates were read using the Virtual Microplate Reader (VMR) script to quantify the concentration of the chromogen. This method is fast and sensitive in quantifying 0.025-0.3 mg starch/ml as well as 0.05-0.75 mg glucose/ml. It was also an effective screening method for improved alpha-amylase activity with a coefficient of variance of 18%.

  2. Effect of neohesperidin dihydrochalcone on the activity and stability of alpha-amylase: a comparative study on bacterial, fungal, and mammalian enzymes.


    Kashani-Amin, Elaheh; Ebrahim-Habibi, Azadeh; Larijani, Bagher; Moosavi-Movahedi, Ali Akbar


    Neohesperidin dihydrochalcone (NHDC) was recently introduced as an activator of mammalian alpha-amylase. In the current study, the effect of NHDC has been investigated on bacterial and fungal alpha-amylases. Enzyme assays and kinetic analysis demonstrated the capability of NHDC to significantly activate both tested alpha-amylases. The ligand activation pattern was found to be more similar between the fungal and mammalian enzyme in comparison with the bacterial one. Further, thermostability experiments indicated a stability increase in the presence of NHDC for the bacterial enzyme. In silico (docking) test locates a putative binding site for NHDC on alpha-amylase surface in domain B. This domain shows differences in various alpha-amylase types, and the different behavior of the ligand toward the studied enzymes may be attributed to this fact.

  3. Purification and characterization of alpha-amylase from Bacillus licheniformis CUMC305

    SciTech Connect

    Krishnan, T.; Chandra, A.K.


    Alpha-amylase produced by Bacillus licheniformis CUMC305 was purified 212-fold with a 42% yield through a series of four steps. The purified enzyme was homogeneous as shown by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and discontinuous gel electrophoresis. The purified enzyme showed maximal activity at 90 degrees C and pH 9.0, and 91% of this activity remained at 100 degrees C. In the presence of substrate (soluble starch), the alpha-amylase enzyme was fully stable after a 4-hour incubation at 100 degrees C. The enzyme showed 100% stability in the pH range 7 to 9; 95% stability at pH 10; and 84, 74, 68, and 50% stability at pH values of 6, 5, 4, and 3, respectively, after 18 hours of treatment. The activation energy for this enzyme was calculated as 5.1 x 10 to the power of 5 J/mol. The molecular weight was estimated to be 28,000 by sodium dodecyl sulfate-gel electrophoresis. The relative rates of hydrolysis of soluble starch, amylose, amylopectin, and glycogen were 1.27, 1.8, 1.94, and 2.28 mg/ml, respectively. Vmax values for hydrolysis of these substrates were calculated as 0.738, 1.08, 0.8, and 0.5 mg of maltose/ml per min, respectively. Of the cations, Na+, Ca(2+), and Mg(2+), showed stimulatory effect, wheras Hg(2+), Cu(2+), Ni(2+), Zn(2+), Ag+, Fe(2+), Co(2+), Cd(2+), Al(3+), and Mn(2+) were inhibitory. Of the anions, azide, F-, SO/sub 3/(2-), SO/sub 4/(3-), S/sub 2/O/sub 3/(2-), MoO/sub 4/(2-), and Wo/sub 4/(2-) showed an excitant effect. p-Chloromercuribenzoic acid and sodium iodoacetate were inhibitory, whereas cysteine, reduced glutathione, thiourea, beta-mercaptoethanol, and sodium glycerophosphate afforded protection to enzyme activity. Alpha-amylase was fairly resistant to EDTA treatment at 30 degrees C, but heating at 90 degrees C in presence of EDTA resulted in the complete loss of enzyme activity. (Refs. 32).

  4. Maltose effects on barley malt diastatic power enzyme activity and thermostability at high isothermal mashing temperature: II. Alpha-amylase

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Maltose, the primary product of starch degradation during mashing, has the potential as a compatible solute to affect the activity of and increase the thermostability of barley malt alpha-amylase activity at high temperatures used in mashing and temperatures above those normally used in mashing. To ...

  5. Effects of metals on {alpha}-amylase activity in the digestive gland of the green mussel, Perna viridis L.

    SciTech Connect

    Yan, T.; Teo, L.H.; Sin, Y.M.


    A number of digestive enzymes in the green mussel, Perna viridis L., have been reported, and {alpha}-amylase is believed to have a higher activity than the others. Small plankton, on which the green mussel feeds, may supply plenty of starch and glycogen. They may be an important source of nutrients for the green mussel and the ability of the latter to make good use of them depends mainly on the activities of amylase. The effect of heavy metals on amylase activity is also important as the ability of the mussel`s digestive gland to accumulate these metals is well known. High concentrations of heavy metals, especially lead, have been observed in the water around Singapore. The in vitro inhibition of some metals on the activities of digestive enzymes from the green mussel has been observed, but kinetic properties of the inhibition and the in vivo inhibition of the heavy metals on digestive enzymes are little understood. In the present study, in vitro inhibition of four metals (Pb, Cd, Zn and Hg) on the activity of {alpha}-amylase from the digestive gland of the green mussel will be compared. Their effects on the K{sub M} and V{sub max} values of {alpha}-amylase will also be compared. Finally, lead is either added to the food or water, to see how it affects the activity of {alpha}-amylase and how this effect acts in combination with starvation. 12 refs., 3 figs., 3 tabs.

  6. Relationship Between Meditation Depth and Waking Salivary Alpha-Amylase Secretion Among Long-Term MBSR Instructors.


    Haslam, Alyson; Wirth, Michael D; Robb, Sara Wagner


    The purpose of this study was to characterize sympathetic activity by using waking salivary alpha-amylase (sAA) concentrations in a group of long-term meditation instructors and to examine the association between meditation (depth, dose and duration) and the waking alpha-amylase response. Salivary alpha-amylase samples were collected (immediately upon waking and at 15-min, 30-min and 45-min intervals after waking) from mindfulness-based stress reduction instructors to determine both the area under the curve and the awakening slope (difference in alpha-amylase concentrations between waking and 30-min post-waking). It was determined through general linear models that neither years of meditation nor meditation dose were associated with the awakening sAA slope, but higher scores for meditation depth (greater depth) was associated with a more negative (or steeper) awakening slope [Quartile (Q)1: -7 versus Q4: -21 U/mL; p = 0.06], in fully adjusted models. Older age (p = 0.04) and a later time of waking (p < 0.01) also were associated with less negative awakening slope values. Smoking was associated with lower area under the curve values (smokers: 1716 U/mL versus nonsmokers: 2107 U/mL; p = 0.05) in fully adjusted models. The results suggest a 'healthy' sAA waking slope among individuals who meditate more deeply. Copyright © 2016 John Wiley & Sons, Ltd.

  7. Daytime Secretion of Salivary Cortisol and Alpha-Amylase in Preschool-Aged Children with Autism and Typically Developing Children

    ERIC Educational Resources Information Center

    Kidd, Sharon A.; Corbett, Blythe A.; Granger, Douglas A.; Boyce, W. Thomas; Anders, Thomas F.; Tager, Ira B.


    We examined daytime salivary cortisol and salivary alpha-amylase (sAA) secretion levels and variability in preschool-aged children with autism (AUT) and typically developing children (TYP). Fifty-two subjects (26 AUT and 26 TYP) were enrolled. Salivary samples were obtained at waking, midday, and bedtime on two consecutive days at three phases…

  8. The green tea polyphenol (-)-epigallocatechin gallate precipitates salivary proteins including alpha-amylase: biochemical implications for oral health.


    Hara, Kumiko; Ohara, Masaru; Hayashi, Ikue; Hino, Takamune; Nishimura, Rumi; Iwasaki, Yoriko; Ogawa, Tetsuji; Ohyama, Yoshihiko; Sugiyama, Masaru; Amano, Hideaki


    Green tea is a popular drink throughout the world, and it contains various components, including the green tea polyphenol (-)-epigallocatechin gallate (EGCG). Tea interacts with saliva upon entering the mouth, so the interaction between saliva and EGCG interested us, especially with respect to EGCG-protein binding. SDS-PAGE revealed that several salivary proteins were precipitated after adding EGCG to saliva. Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) peptide mass fingerprinting indicated that the major proteins precipitated by EGCG were alpha-amylase, S100, and cystatins. Surface plasmon resonance revealed that EGCG bound to alpha-amylase at dissociation constant (K(d)) = 2.74 × 10(-6) M, suggesting that EGCG interacts with salivary proteins with a relatively strong affinity. In addition, EGCG inhibited the activity of alpha-amylase by non-competitive inhibition, indicating that EGCG is effective at inhibiting the formation of fermentable carbohydrates involved in caries formation. Interestingly, alpha-amylase reduced the antimicrobial activity of EGCG against the periodontal bacterium Aggregatibacter actinomycetemcomitans. Therefore, we considered that EGCG-salivary protein interactions might have both protective and detrimental effects with respect to oral health.

  9. Permissive role of the acidification caused by wheat aleurone layers upon. alpha. -amylase induction by GA sub 3

    SciTech Connect

    Rodriguez-Campos, E.; Bernal-Lugo, I.; Hamabata, A. )


    Wheat aleurone has the capacity of acidifying the incubation medium in 1 to 2 pH units. The {alpha}-amylase induction by GA{sub 3} in isolated wheat aleurone layers is strongly dependent on acidic pH of the medium (pH < 5). To examine possible mechanisms {sup 35}-Met incorporation into proteins and {alpha}-amylase, in the presence of GA{sub 3} and Ca{sup 2+} at pH, 4, 5 and 6 was studied. Although {sup 35}-Met uptake decreased markedly ({approx} 90%) at pH 4 in thepresence of GA{sub 3}, incorporation into total protein did not change significantly from other conditions. Auto-radiography of SDS-PAGE showed that most of the amino acid was in the {alpha}-amylase band, meaning that the effect of acidic pH is specific for GA{sub 3} actions on aleurone tissue. On the other hand, an increase of protonated GA{sub 3} diffusion could be ruled out. Also, there was not {alpha}-amylase inactivation at pH 6. These findings point out to the important physiological role of the acidification caused by the aleurone.

  10. Effects of alpha-amylases from different sources on the firming of concentrated wheat starch gels: relationship to bread staling.


    Palacios, Hernan R; Schwarz, Paul B; D'Appolonia, Bert L


    The firming and carbohydrate fractions of concentrated starch gels supplemented with four alpha-amylases from different sources were evaluated. Correlations were found between the firmness data and results for the carbohydrate fractions extracted from the gels. The thermostable (TBA) and intermediate temperature stability (ISBA) bacterial alpha-amylases were most effective in decreasing the rate of firming. The cereal alpha-amylase at the high level (CAH) was also effective. The CAH produced the largest quantity of dextrins at storage time zero and the thermostable bacterial alpha-amylase at the high level (TBAH) after storage for 5 days. None of the maltooligosaccharides appeared to be responsible for the decreased rate of firming of the gels. The results indicated that the TBA and ISBA most effectively inhibited firming because they degraded the external branches and the intercluster regions of amylopectin during storage. Consideration of previously reported differential scanning calorimetry and X-ray crystallography results leads to the conclusion that the antifirming action of the TBA and ISBA is due to their ability to degrade the amylopectin and amorphous regions of the gels during storage, which inhibits the formation of double helices and decreases the strength of the starch gel matrix. Gels supplemented with the TBA and ISBA were most crystalline but firmed to a lesser extent. These results are similar to those previously reported by other researchers for bread and strongly suggest that starch retrogradation plays a primary role in bread staling.

  11. The structure of human pancreatic alpha-amylase at 1.8 A resolution and comparisons with related enzymes.


    Brayer, G D; Luo, Y; Withers, S G


    The structure of human pancreatic alpha-amylase has been determined to 1.8 A resolution using X-ray diffraction techniques. This enzyme is found to be composed of three structural domains. The largest is Domain A (residues 1-99, 169-404), which forms a central eight-stranded parallel beta-barrel, to one end of which are located the active site residues Asp 197, Glu 233, and Asp 300. Also found in this vicinity is a bound chloride ion that forms ligand interactions to Arg 195, Asn 298, and Arg 337. Domain B is the smallest (residues 100-168) and serves to form a calcium binding site against the wall of the beta-barrel of Domain A. Protein groups making ligand interactions to this calcium include Asn 100, Arg 158, Asp 167, and His 201. Domain C (residues 405-496) is made up of anti-parallel beta-structure and is only loosely associated with Domains A and B. It is notable that the N-terminal glutamine residue of human pancreatic alpha-amylase undergoes a posttranslational modification to form a stable pyrrolidone derivative that may provide protection against other digestive enzymes. Structure-based comparisons of human pancreatic alpha-amylase with functionally related enzymes serve to emphasize three points. Firstly, despite this approach facilitating primary sequence alignments with respect to the numerous insertions and deletions present, overall there is only approximately 15% sequence homology between the mammalian and fungal alpha-amylases. Secondly, in contrast, these same studies indicate that significant structural homology is present and of the order of approximately 70%. Thirdly, the positioning of Domain C can vary considerably between alpha-amylases. In terms of the more closely related porcine enzyme, there are four regions of polypeptide chain (residues 237-250, 304-310, 346-354, and 458-461) with significantly different conformations from those in human pancreatic alpha-amylase. At least two of these could play a role in observed differential

  12. Crystal structure of thermostable alpha-amylase from Bacillus licheniformis refined at 1.7 A resolution.


    Hwang, K Y; Song, H K; Chang, C; Lee, J; Lee, S Y; Kim, K K; Choe, S; Sweet, R M; Suh, S W


    alpha-Amylases (alpha-1,4-glucan-4-glucanohydrolase, E.C. catalyze the cleavage of alpha-1, 4-glucosidic linkages of starch components, glycogen, and various oligosaccharides. Thermostable alpha-amylases from Bacillus species are of great industrial importance in the production of corn syrup or dextrose. Thermostable alpha-amylase from Bacillus licheniformis, a monomeric enzyme with molecular mass of 55,200 Da (483 amino acid residues), shows a remarkable heat stability. This enzyme provides an attractive model for investigating the structural basis for thermostability of proteins. The three-dimensional structure of thermostable alpha-amylase from Bacillus licheniformis has been determined by the multiple isomorphous replacement method of X-ray crystallography. The structure has been refined to a crystallographic R-factor of 19.9% for 58,601 independent reflections with F0 > 2 sigma F0 between 8.0 and 1.7 A resolution, with root mean square deviations of 0.013 A from ideal bond lengths and 1.72 degrees from ideal bond angles. The final model consists of 469 amino acid residues and 294 water molecules. Missing from the model are the N- and C-termini and the segment between Trp182 and Asn192. Like other alpha-amylases, the polypeptide chain folds into three distinct domains. The first domain (domain A), consisting of 291 residues (from residue 3 to 103 and 207 to 396), forms a (beta/alpha)8-barrel structure. The second domain (domain B), consisting of residues 104 to 206, is inserted between the third beta-strand and the third alpha-helix of domain A. The third C-terminal domain (domain C), consisting of residues 397 to 482, folds into an eight-stranded antiparallel beta-barrel. Neither calcium ion nor chloride ion is located near the active site. This study reveals the architecture of the thermostable alpha-amylase from Bacillus licheniformis. By homology with other alpha-amylases, important active site residues can be identified as Asp231, Glu261, and Asp

  13. Improved activity and modulated action pattern obtained by random mutagenesis at the fourth beta-alpha loop involved in substrate binding to the catalytic (beta/alpha)8-barrel domain of barley alpha-amylase 1.


    Matsui, I; Svensson, B


    The functionality of the sequence Arg183-Gly184-Tyr185 of the substrate binding fourth beta-alpha loop in the (beta/alpha)8-barrel of barley alpha-amylase isozyme 1 (AMY1) was studied by random mutagenesis. A motif of polar Gly184 hydrophobic residues was present in active mutants, selected by starch plate screening of yeast transformants. Gly184 was important, probably due to the carbonyl group binding to Ca2+ and the spatial proximity of Phe181. Mutation of both flanking residues as in Ser183-Gly184-Met185 (SGM-) and TGL-AMY1 decreased the Ca2+ affinity. SGM-AMY1 has 2-fold increased activity for amylose but reduced activity on maltooligosaccharides, whereas KGY-AMY1 has up to 3-fold elevated activity toward the oligosaccharides. TGL-AMY1 has modest activity on all substrates. Shifted action pattern on maltooligosaccharides for NGY-, SGM-, and TGL-AMY1 support that Arg183 in wild type is located at subsites +1 and +2, accommodating two sugar rings toward the reducing end from the site of cleavage. In the crystal structure of barley alpha-amylase 2 (AMY2), Lys182 (equivalent to AMY1 Arg183) is hydrogen-bonded with sugar OH-3 in subsite +2. Higher Ki app for acarbose inhibition of KGY-AMY1 and parent AMY1 compared with the other mutants suggests favorable substrate interactions for Arg/Lys183. KGY-AMY1 was not inhibited by the AMY2-specific proteinaceous barley alpha-amylase/subtilisin inhibitor, although Lys182 of AMY2 is salt-linked to the inhibitor.

  14. Electron microscopic investigation of the diffusion of Bacillus licheniformis alpha-amylase into corn starch granules.


    Helbert, W; Schülein, M; Henrissat, B


    A method for the direct electron microscopic observation of amylases in interaction with starch granules is presented. The technique involves immuno-gold labeling of the enzymes and cross-sectioning of hydrated starch granules. This approach allows the analysis of the internal degradation of starch with a concomitant visualization of enzymes at the sites of hydrolysis. The visualization of enzymes at the surface, inside the channel and inside the core of the degraded granules shows that the alpha-amylase molecules first proceed from the surface toward the center (centripetal hydrolysis). Then the core is completely degraded from within by erosion of its periphery (centrifugal hydrolysis). In the first case (centripetal hydrolysis), the enzymes act by progressing along the polysaccharide chains. By contrast, the centrifugal hydrolysis leads to even erosion, indicative of a more diffusive motion of the enzymes.

  15. Self-compassionate young adults show lower salivary alpha-amylase responses to repeated psychosocial stress

    PubMed Central

    Breines, Juliana G.; McInnis, Christine M.; Kuras, Yuliya I.; Thoma, Myriam V.; Gianferante, Danielle; Hanlin, Luke; Chen, Xuejie; Rohleder, Nicolas


    In this study we tested the hypothesis that participants higher in dispositional self-compassion would show lower stress-induced reactivity of salivary alpha-amylase (sAA), a marker of sympathetic nervous system activation. Thirty-three healthy participants (18–34 years old) were exposed to a standardized laboratory stressor on two consecutive days. Self-compassion, self-esteem, and demographic factors were assessed by questionnaire and sAA was assessed at baseline and at 1, 10, 30, and 60 minutes following each stressor. Self-compassion was a significant negative predictor of sAA responses on both days. This relationship remained significant when controlling for self-esteem, subjective distress, age, gender, ethnicity, and Body Mass Index (BMI). These results suggest that self-compassion may serve as a protective factor against stress-induced physiological changes that have implications for health. PMID:26005394

  16. Multi-site substrate binding and interplay in barley alpha-amylase 1.


    Nielsen, Morten Munch; Seo, Eun-Seong; Bozonnet, Sophie; Aghajari, Nushin; Robert, Xavier; Haser, Richard; Svensson, Birte


    Certain starch hydrolases possess secondary carbohydrate binding sites outside of the active site, suggesting that multi-site substrate interactions are functionally significant. In barley alpha-amylase both Tyr380, situated on a remote non-catalytic domain, and Tyr105 in subsite -6 of the active site cleft are principal carbohydrate binding residues. The dual active site/secondary site mutants Y105A/Y380A and Y105A/Y380M show that each of Tyr380 and Tyr105 is important, albeit not essential for binding, degradation, and multiple attack on polysaccharides, while Tyr105 predominates in oligosaccharide hydrolysis. Additional delicate structure/function relationships of the secondary site are uncovered using Y380A/H395A, Y380A, and H395A AMY1 mutants.

  17. Refined molecular structure of pig pancreatic alpha-amylase at 2.1 A resolution.


    Larson, S B; Greenwood, A; Cascio, D; Day, J; McPherson, A


    The structure of pig pancreatic alpha-amylase has been determined by X-ray diffraction analysis using multiple isomorphous replacement in a crystal of space group P2(1)2(1)2(1) (a = 70.6 A, b = 114.8 A, c = 118.8 A) containing nearly 75% solvent. The structure was refined by simulated annealing and Powell minimization, as monitored by 2Fo-Fc difference Fourier syntheses, to a conventional R of 0.168 at 2.1 A resolution. The final model consists of all 496 amino acid residues, a chloride and a calcium ion, 145 water molecules and an endogenous disaccharide molecule that contiguously links protein molecules related by the 2(1) crystallographic operator along x. The protein is composed of a large domain (amino acid residues 1 to 403) featuring a central alpha ta-barrel of eight parallel strands and connecting helices with a prominent excursion between strand beta 3 and helix alpha 3 (amino acid residues 100 to 168). The final 93 amino acid residues at the carboxyl terminus form a second small domain consisting of a compact Greek key beta-barrel. The domains are tightly associated through hydrophobic interfaces. The beta 3/alpha 3 excursion and portions of the central alpha/beta-barrel provide four protein ligands to the tightly bound Ca ion; three water molecules complete the coordination. The Cl- ion is bound within one end of the alpha/beta-barrel by two arginine residues in a manner suggesting a plausible mechanism for its allosteric activation of the enzyme. A crystalline complex of the pancreatic alpha-amylase with alpha-cyclodextrin, a cyclic substrate analog of six glucose residues, reveals, in difference Fourier maps, three unique binding sites. One of the alpha-cyclodextrin sites is near the center of the long polysaccharide binding cleft that traverses one end of the alpha/beta-barrel, another is at the extreme of this cleft. By symmetry this can also be considered as two half sites located at the extremes of the active site cleft. This latter alpha

  18. A functional raw starch-binding domain of barley alpha-amylase expressed in Escherichia coli.


    Tibbot, B K; Wong, D W; Robertson, G H


    The mature form of barley seed low-pI alpha-amylase (BAA1) possesses a raw starch-binding site in addition to the catalytic site. A truncated cDNA encoding the C-terminal region (aa 281-414) and containing the proposed raw starch-binding domain (SBD) but lacking Trp278/Trp279, a previously proposed starch granule-binding site, was synthesized via PCR and expressed in Escherichia coli as an N-terminal His-Tag fusion protein. SBD was produced in the form of insoluble inclusion bodies that were extracted with urea and successfully refolded into a soluble form via dialysis. To determine binding, SBD was purified by affinity chromatography with cycloheptaamylose as ligand cross-linked to Sepharose. This work demonstrates that a SBD is located in the C-terminal region and retains sufficient function in the absence of the N-terminal, catalytic, and Trp278/279 regions.

  19. Structural investigation and homology modeling studies of native and truncated forms of alpha-amylases from Sclerotinia sclerotiorum.


    Ben Abdelmalek, Imen; Urdaci, Maria Camino; Ben Ali, Mamdouh; Denayrolles, Muriel; Chaignepain, Stephane; Limam, Ferid; Bejar, Samir; Marzouki, Mohamed Nejib


    The filamentous ascomycete Sclerotinia sclerotiorum is well known for its ability to produce a large variety of hydrolytic enzymes for the degradation of plant polysaccharide material. Two alpha-amylases designated as ScAmy54 and ScAmy43 were biochemically characterized and predicted to play an important role in starch degradation. Those enzymes produce specific oligosaccharides, essentially maltotriose, that have a considerable commercial interest. The primary structures of the two enzymes were analyzed by N-terminal sequencing, MALDI-TOF mass spectrometry, and cDNA cloning, and implied that the two proteins have the same N-terminal catalytic domain and ScAmy43 was produced from ScAmy54 by truncation of 96 amino acids at the carboxyl-terminal region. The result of genomic analysis suggested that the two enzymes originated from the same alpha-amylase gene and that truncation of ScAmy54 to ScAmy43 occurred probably during the S. sclerotiorum cultivation. The structural gene of ScAmy54 consisted of 9 exons and 8 introns, containing a single 1,500-bp open reading frame encoding 499 amino acids including a signal peptide of 21 amino acids. ScAmy54 exhibited high amino acid identity to other liquefying fungal alpha-amylases, essentially in the four conserved regions and in the putative catalytic triad. A 3D structure model of ScAmy54 and ScAmy43 was built using the 3D structure of 2guy from A. niger as template. ScAmy54 with three domains A, B, and C, including the well-known (beta/alpha)8-barrel motif in domain A, has a typical structure of the alpha-amylase family. ScAmy43 composed only of domains A and B constitutes a smallest fungal alpha-amylase with only a catalytic domain.

  20. Multiple time courses of salivary alpha-amylase and dimensions of affect in adolescence.


    Doane, Leah D; Van Lenten, Scott A


    Previous research has illustrated associations among daily experiences, emotions and stress-responding physiological systems. Recently, investigators have examined salivary alpha-amylase (sAA), a surrogate marker of the autonomic nervous system, and its associations with affect. The current study examined associations among affective valence, arousal and sAA across three different time courses at the momentary, daily and inter-individual level to understand varying influences of adolescents' daily emotional experiences on sAA reactivity and diurnal sAA activity. Adolescents (N=82) provided salivary samples and diary reports of affect and experiences five times a day for three consecutive days. They also completed self-report questionnaires on trait affect. Findings from multilevel growth curves demonstrated that adolescents in our sample displayed typical sAA diurnal rhythms with levels dropping 30 min after waking and then increasing across the day to a peak in the late afternoon. Within person momentary experiences of high arousal positive affect were associated with momentary sAA reactivity. Prior day experiences of high arousal negative affect were associated with a greater amylase awakening response (i.e., greater decrease) and flatter slopes the next day. Trait positive affect was also associated with flatter sAA slopes. Our findings suggest that both affective arousal and valence should be accounted for when examining differences in sAA reactivity and diurnal patterns. Further, our results indicated that emotion-physiology transactions among adolescents occur over varying time scales for salivary alpha-amylase as well as cortisol.

  1. [Alpha-amylase as an occupational allergen in baking industry employees].


    De Zotti, R; Larese, F; Molinari, S


    In a group of 226 bakers and pastry makers and in 88 students of a training school for bakers, we evaluated skin sensitization to the common allergens, wheat and alpha amylase. Skin prick tests were positive to the enzyme in 17 exposed subjects (7.5%) and in one student with previous occupational exposure as a baker; 27 exposed subjects (11.9%) and 2 students were sensitized to wheat. Among the 42 exposed workers who complained of work-related symptoms, 12 (28.6%) cases were skin positive to amylase and 17 (42.9%) to wheat. Among the 17 workers who were positive to amylase, 16 were also sensitized to wheat and/or common allergens, 12 complained of symptoms at work but since in many cases there was a positive response to wheat, too, it is impossible to speculate on the role of each allergen in inducing symptoms. One case, with work-related rhinoconjunctivitis, had skin sensitization only to alpha amylase but no specific IgE in the serum. These findings confirm that bakers are at risk of sensitization not only to wheat allergen but also to amylase from Aspergillus oryzae. The enzyme should be included in the list of substances to be tested among bakers in whom an occupational allergy is suspected, but particular care should be taken in evaluating the cutaneous response, especially if compared to wheat wheals. Further investigations are also needed to identify the source of risk and to better define the characteristics of the enzyme and the relationship between skin reaction to amylase, sensitization to wheat and atopy.(ABSTRACT TRUNCATED AT 250 WORDS)

  2. Effects of a dietary Aspergillus oryzae extract containing alpha-amylase activity on performance and carcass characteristics of finishing beef cattle.


    Tricarico, J M; Abney, M D; Galyean, M L; Rivera, J D; Hanson, K C; McLeod, K R; Harmon, D L


    Three experiments were conducted to examine the effects of an Aspergillus oryzae extract containing alpha-amylase activity on performance and carcass characteristics of finishing beef cattle. In Exp. 1, 120 crossbred steers were used in a randomized complete block design to evaluate the effects of roughage source (alfalfa hay vs. cottonseed hulls) and supplemental alpha-amylase at 950 dextrinizing units (DU)/kg of DM. Significant roughage source x alpha-amylase interactions (P < 0.05) were observed for performance. In steers fed cottonseed hulls, supplemental alpha-amylase increased ADG through d 28 and 112 and tended (P < 0.15) to increase ADG in all other periods. The increases in ADG were related to increased DMI and efficiency of gain during the initial 28-d period but were primarily related to increased DMI as the feeding period progressed. Supplemental alpha-amylase increased (P = 0.02) the LM area across both roughage sources. In Exp. 2, 96 crossbred heifers were used in a randomized complete block design with a 2 x 3 factorial arrangement of treatments to evaluate the effects of corn processing (dry cracked vs. high moisture) and supplemental alpha-amylase concentration (0, 580, or 1,160 DU/kg of DM). Alpha-amylase supplementation increased DMI (P = 0.05) and ADG (P = 0.03) during the initial 28 d on feed and carcass-adjusted ADG (P = 0.04) across corn processing methods. Longissimus muscle area was greatest (quadratic effect, P = 0.04), and yield grade was least (quadratic effect, P = 0.02) in heifers fed 580 DU of alpha-amylase/kg of DM across corn processing methods. In Exp. 3, 56 crossbred steers were used in a randomized complete block design to evaluate the effects of supplemental alpha-amylase (930 DU/kg of DM) on performance when DMI was restricted to yield a programmed ADG. Alpha-amylase supplementation did not affect performance when DMI was restricted. We conclude that dietary alpha-amylase supplementation of finishing beef diets may result in

  3. Adolescents' increasing stress response to social evaluation: pubertal effects on cortisol and alpha-amylase during public speaking.


    van den Bos, Esther; de Rooij, Mark; Miers, Anne C; Bokhorst, Caroline L; Westenberg, P Michiel


    Stress responses to social evaluation are thought to increase during adolescence, which may be due to pubertal maturation. However, empirical evidence is scarce. This study is the first to investigate the relation between pubertal development and biological responses to a social-evaluative stressor longitudinally. Participants performed the Leiden Public Speaking Task twice, with a 2-year interval (N = 217; age at Time 1: 8-17 years). The results support an increase in sensitivity to social evaluation during adolescence. The overall cortisol and alpha-amylase responses increased-both between and within participants-and were more strongly related to self-reported pubertal development than to age. The cortisol response shifted from speech delivery toward anticipation. The alpha-amylase response increased in both phases.

  4. Rubusuaviins A-F, monomeric and oligomeric ellagitannins from Chinese sweet tea and their alpha-amylase inhibitory activity.


    Li, Haizhou; Tanaka, Takashi; Zhang, Ying-Jun; Yang, Chong-Ren; Kouno, Isao


    Six new ellagitannins herein, rubusuaviins A-F, were isolated from the aqueous acetone extract of Chinese sweet tea (Tien-cha, dried leaves of Rubus suavissimus S. LEE) together with seven known tannins. Rubusuaviin A was characterized as 1-O-galloyl-2,3-O-(S)-HHDP-4,6-O-(S)-sanguisorboyl-beta-D-glucopyranose. Rubusuaviins B, C, and E are dimeric, trimeric, and tetrameric ellagitannins, respectively, in which the sanguisorboyl groups were connected ellagitannin units. Rubusuaviins D and F were desgalloyl derivatives of rubusuaviins C and E, respectively. The inhibition of alpha-amylase activity by rubusuaviins and related ellagitannins was compared. Ellagitannins with beta-galloyl groups at the glucose C-1 positions showed stronger inhibition compared with the alpha-galloyl and desgalloyl compounds. The molecular weight of these compounds was not important for the inhibition of alpha-amylase activity.

  5. Acyclic peptide inhibitors of amylases.


    Pohl, Nicola


    In this issue of Chemistry and Biology, a library screening approach reveals a linear octapeptide inhibitor of alpha-amylases reached by de novo design . The selected molecule shares characteristics with naturally occurring protein inhibitors -- a result that suggests general rules for the design of peptide-based amylase inhibitors may be achievable.

  6. Alpha-amylase from germinating soybean (Glycine max) seeds--purification, characterization and sequential similarity of conserved and catalytic amino acid residues.


    Kumari, Arpana; Singh, Vinay Kumar; Fitter, Jörg; Polen, Tino; Kayastha, Arvind M


    Starch hydrolyzing amylase from germinated soybeans seeds (Glycine max) has been purified 400-fold to electrophoretic homogeneity with a final specific activity of 384 units/mg. SDS-PAGE of the final preparation revealed a single protein band of 100 kDa, whereas molecular mass was determined to be 84 kDa by MALDI-TOF and gel filtration on Superdex-200 (FPLC). The enzyme exhibited maximum activity at pH 5.5 and a pI value of 4.85. The energy of activation was determined to be 6.09 kcal/mol in the temperature range 25-85 degrees C. Apparent Michaelis constant (K(m)((app))) for starch was 0.71 mg/mL and turnover number (k(cat)) was 280 s(-1) in 50 mM sodium acetate buffer, pH 5.5. Thermal inactivation studies at 85 degrees C showed first-order kinetics with rate constant (k) equal to 0.0063 min(-1). Soybean alpha-amylase showed high specificity for its primary substrate starch. High similarity of soybean alpha-amylase with known amylases suggests that this alpha-amylase belongs to glycosyl hydrolase family 13. Cereal alpha-amylases have gained importance due to their compatibility for biotechnological applications. Wide availability and easy purification protocol make soybean as an attractive alternative for plant alpha-amylase. Soybean can be used as commercially viable source of alpha-amylase for various industrial applications.

  7. Hyperthermostable, Ca(2+)-independent, and high maltose-forming alpha-amylase production by an extreme thermophile Geobacillus thermoleovorans: whole cell immobilization.


    Rao, J L Uma Maheswar; Satyanarayana, T


    The synthesis of extracellular alpha-amylase in Geobacillus thermoleovorans was constitutive. The enzyme was secreted in metabolizable carbon sources as well as non-metabolizable synthetic analogues of glucose, but the titers were higher in the former than that in the latter. G. thermoleovorans is a fast-growing facultatively anaerobic bacterium that grows under both aerobic and anaerobic conditions and produces an extracellular amylolytic enzyme alpha-amylase with the by-product of lactic acid. G. thermoleovorans is a rich source of various novel thermostable biocatalysts for different industrial applications. alpha-Amylase synthesis was subject to catabolite repression in the presence of high concentrations of glucose. The addition of cAMP to the medium containing glucose did not result in the repression of alpha-amylase synthesis. The addition of maltose (1%) to the starch arginine medium resulted in a twofold enhancement in enzyme titers. Polyurethane foam (PUF)-immobilized cells secreted alpha-amylase, which was higher than that with the free cells. PUF appeared to be a better matrix for immobilization of the thermophilic bacterium than the other commonly used matrices. The repeated use of PUF-immobilized cells was possible over 15 cycles with a sustained alpha-amylase secretion. The use of this enzyme in starch saccharification eliminates the addition of Ca(2+) in starch liquefaction and its subsequent removal by ion exchangers from the product streams.

  8. Sociodemographic Risk, Parenting, and Effortful Control: Relations to Salivary Alpha-amylase and Cortisol in Early Childhood

    PubMed Central

    Taylor, Zoe E.; Spinrad, Tracy L.; VanSchyndel, Sarah K.; Eisenberg, Nancy; Huynh, Jacqueline; Sulik, Michael J.; Granger, Douglas A.


    Early sociodemographic risk, parenting, and temperament were examined as predictors of the activity of children’s (N = 148; 81 boys, 67 girls) hypothalamic-pituitary-adrenal axis and autonomic nervous system. Demographic risk was assessed at 18 months (T1), intrusive-overcontrolling parenting and effortful control were assessed at 30 months (T2), and salivary cortisol and alpha-amylase were collected at 72 (T3) months of age. Demographic risk at T1 predicted lower levels of children’s effortful control and higher levels of mothers’ intrusive-overcontrolling parenting at T2. Intrusive-overcontrolling parenting at T2 predicted higher levels of children’s cortisol and alpha-amylase at T3, but effortful control did not uniquely predict children’s cortisol or alpha-amylase. Findings support the open nature of stress responsive physiological systems to influence by features of the early caregiving environment and underscore the utility of including measures of these systems in prevention trials designed to influence child outcomes by modifying parenting behavior. PMID:22949301

  9. Plant cell calcium-rich environment enhances thermostability of recombinantly produced alpha-amylase from the hyperthermophilic bacterium Thermotoga maritime.


    Santa-Maria, Monica C; Chou, Chung-Jung; Yencho, G Craig; Haigler, Candace H; Thompson, William F; Kelly, Robert M; Sosinski, Bryon


    In the industrial processing of starch for sugar syrup and ethanol production, a liquefaction step is involved where starch is initially solubilized at high temperature and partially hydrolyzed with a thermostable and thermoactive alpha-amylase. Most amylases require calcium as a cofactor for their activity and stability, therefore calcium, along with the thermostable enzyme, are typically added to the starch mixture during enzymatic liquefaction, thereby increasing process costs. An attractive alternative would be to produce the enzyme directly in the tissue to be treated. In a proof of concept study, tobacco cell cultures were used as model system to test in planta production of a hyperthermophilic alpha-amylase from Thermotoga maritima. While comparable biochemical properties to recombinant production in Escherichia coli were observed, thermostability of the plant-produced alpha-amylase benefited significantly from high intrinsic calcium levels in the tobacco cells. The plant-made enzyme retained 85% of its initial activity after 3 h incubation at 100 degrees C, whereas the E. coli-produced enzyme was completely inactivated after 30 min under the same conditions. The addition of Ca(2+) or plant cell extracts from tobacco and sweetpotato to the E. coli-produced enzyme resulted in a similar stabilization, demonstrating the importance of a calcium-rich environment for thermostability, as well as the advantage of producing this enzyme directly in plant cells where calcium is readily available.

  10. A single residue mutation abolishes attachment of the CBM26 starch-binding domain from Lactobacillus amylovorus alpha-amylase.


    Rodríguez-Sanoja, Romina; Oviedo, N; Escalante, L; Ruiz, B; Sánchez, S


    Starch is degraded by amylases that frequently have a modular structure composed of a catalytic domain and at least one non-catalytic domain that is involved in polysaccharide binding. The C-terminal domain from the Lactobacillus amylovorus alpha-amylase has an unusual architecture composed of five tandem starch-binding domains (SBDs). These domains belong to family 26 in the carbohydrate-binding modules (CBM) classification. It has been reported that members of this family have only one site for starch binding, where aromatic amino acids perform the binding function. In SBDs, fold similarities are better conserved than sequences; nevertheless, it is possible to identify in CBM26 members at least two aromatic residues highly conserved. We attempt to explain polysaccharide recognition for the L. amylovorus alpha-amylase SBD through site-directed mutagenesis of aromatic amino acids. Three amino acids were identified as essential for binding, two tyrosines and one tryptophan. Y18L and Y20L mutations were found to decrease the SBD binding capacity, but unexpectedly, the mutation at W32L led to a total loss of affinity, either with linear or ramified substrates. The critical role of Trp 32 in substrate binding confirms the presence of just one binding site in each alpha-amylase SBD.

  11. Fed-batch optimization of alpha-amylase and protease-producing Bacillus subtilis using Markov chain methods.


    Skolpap, Wanwisa; Scharer, J M; Douglas, P L; Moo-Young, M


    A stoichiometry-based model for the fed-batch culture of the recombinant bacterium Bacillus subtilis ATCC 6051a, producing extracellular alpha-amylase as a desirable product and proteases as undesirable products, was developed and verified. The model was then used for optimizing the feeding schedule in fed-batch culture. To handle higher-order model equations (14 state variables), an optimization methodology for the dual-enzyme system is proposed by integrating Pontryagin's optimum principle with fermentation measurements. Markov chain Monte Carlo (MCMC) procedures were appropriate for model parameter and decision variable estimation by using a priori parameter distributions reflecting the experimental results. Using a simplified Metropolis-Hastings algorithm, the specific productivity of alpha-amylase was maximized and the optimum path was confirmed by experimentation. The optimization process predicted a further 14% improvement of alpha-amylase productivity that could not be realized because of the onset of sporulation. Among the decision variables, the switching time from batch to fed-batch operation (t(s)) was the most sensitive decision variable.

  12. Salivary Alpha-Amylase Activity and Salivary Flow Rate in Young Adults

    PubMed Central

    Arhakis, Aristidis; Karagiannis, Vasilis; Kalfas, Sotirios


    The secretion of salivary alpha-amylase (sAA) is more associated with psychoneuroendocrinological response to stress than with the flow rate and age. The aim of this cross sectional study is to build an explanatory model based on patterns of relationship between age 20-39 in resting and stimulated saliva under no stressful condition in healthy volunteers. Both resting and stimulated saliva were collected from 40 subjects. The sAA values were log-transformed, the normality assumption was verified with the Shapiro-Wilk test and the reliability of the measurements was estimated by the Pearsons’ r correlation coefficient. The estimated model was based on the theory of the Linear Mixed Models. Significant mean changes were observed in flow rate and sAA activity between resting and stimulated saliva. The final model consists of two components, the first revealed a positive correlation between age and sAA while the second one revealed a negative correlation between the interaction of age × flow rate in its condition (resting or stimulated saliva), with sAA. Both flow rate and age influence sAA activity. PMID:23524385

  13. Harsh discipline and behavior problems: the moderating effects of cortisol and alpha-amylase.


    Chen, Frances R; Raine, Adrian; Rudo-Hutt, Anna S; Glenn, Andrea L; Soyfer, Liana; Granger, Douglas A


    Numerous studies link harsh discipline to adjustment problems in youth, yet not all individuals exposed to harsh discipline develop behavior problems. Contemporary theory suggests that this relationship could be moderated by individual differences in environmentally sensitive biological systems. This study investigated whether the interaction between hypothalamic-pituitary-adrenal (HPA) activity and autonomic nervous system (ANS) arousal moderated the link between harsh discipline and behavior problems. Three saliva samples were collected on a single day from 425 inner city youth (50% male, age 11-12 years, 80% African American) and were later assayed for cortisol (HPA) and alpha-amylase (ANS). Problem behavior was assessed by self- and parent-report using the Child Behavior Checklist. Youth also reported the level of harsh discipline that they experienced. Harsh discipline was positively associated with externalizing and internalizing problems only when there were asymmetrical profiles of HPA activity and ANS arousal. This pattern was evident for boys but not girls. Findings are discussed in relation to prevailing theories suggesting that biological susceptibility translates adversity into risk for behavior problems.

  14. Salivary Alpha-amylase and Cortisol in Toddlers: Differential Relations to Affective Behavior

    PubMed Central

    Fortunato, Christine K.; Dribin, Amy E.; Granger, Douglas A.; Buss, Kristin A.


    This study applies a non-invasive and multi-system measurement approach (using salivary analytes) to examine associations between the psychobiology of the stress response and affective behavior in toddlers. Eighty-seven two-year-olds (48 females) participated in laboratory tasks designed to elicit emotions and behavior ranging from pleasure/approach to fear/withdrawal. Saliva samples were collected pre-task and immediately post-task, and assayed for markers of sympathetic nervous system (alpha-amylase or sAA) and hypothalamic-pituitary-adrenal axis (cortisol) activity. Individual differences in sAA were positively associated with approach behavior and positive affect; whereas, cortisol was positively associated with negative affect and withdrawal behavior. The findings suggest that individual differences in sAA may covary specifically with positive affect and approach behaviors or the predominant emotional state across a series of tasks. The results are discussed with respect to advancing biosocial models of the concomitants and correlates of young children’s affective behaviors. PMID:18688807

  15. Salivary nitric oxide and alpha-amylase as indexes of training intensity and load.


    Diaz, M M; Bocanegra, O L; Teixeira, R R; Soares, S S; Espindola, F S


    This study examined the variation in salivary nitric oxide (NO), alpha-amylase (sAA) and serum markers of muscle injury during 21 weeks of training in elite swimmers. Samples of saliva and blood were collected once a month during 5 months from 11 male professional athletes during their regular training season. The variation in each marker throughout the 21 weeks was compared with the dynamics of training volume, intensity and load. Unstimulated whole saliva was assessed for NO and sAA whereas venous blood was assessed for lactate dehydrogenase, creatine kinase, and γ-glutamyltransferase. Nitric oxide and sAA showed a proportional response to the intensity of training. However, whereas the concentration of NO increased across the 21 weeks, the activity of sAA decreased. Similar variations in the concentration of NO and the markers of muscle injury were also observed. The higher concentration of NO might be attributed to changes in haemodynamics and muscle regenerative processes. On the other hand, autonomic regulation towards parasympathetic predominance might have been responsible for the decrease in sAA activity. These findings provide appealing evidence for the utilization of salivary constituents in sports medicine to monitor training programmes.

  16. Directed evolution of a maltogenic alpha-amylase from Bacillus sp. TS-25.


    Jones, Aubrey; Lamsa, Michael; Frandsen, Torben P; Spendler, Tina; Harris, Paul; Sloma, Alan; Xu, Feng; Nielsen, Jack Bech; Cherry, Joel R


    Directed evolution coupled with a high-throughput robotic screen was employed to broaden the industrial use of the maltogenic alpha-amylase Novamyl from Bacillus sp. TS-25. Wild-type Novamyl is currently used in the baking industry as an anti-staling agent in breads baked at neutral or near neutral pH. However, the enzyme is rapidly inactivated during the baking process of bread made with low pH recipes and Novamyl thus has very limited beneficial effect for this particular application. In an effort to improve the performance of Novamyl for low pH bread applications such as sourdough and rye, two error-prone PCR libraries were generated, expressed in Bacillus subtilis and screened for variants with improved thermal stability and activity under low pH conditions. Variants exhibiting improved performance were iteratively recombined using DNA shuffling to create two generations of libraries. Relative to wild-type Novamyl, a number of the resulting variants exhibited more than 10 degrees C increase in thermal stability at pH 4.5, one of which demonstrated substantial anti-staling properties in low pH breads.

  17. Autonomic markers associated with generalized social phobia symptoms: heart rate variability and salivary alpha-amylase.


    García-Rubio, María J; Espín, Laura; Hidalgo, Vanesa; Salvador, Alicia; Gómez-Amor, Jesús


    The study of autonomic nervous system changes associated with generalized social phobia (GSP) disorder has increased in recent years, showing contradictory results. The present study aimed to evaluate how young people with GSP reacted before, during, and after exposure to the Trier Stress Social Test (TSST), focusing on their autonomic changes (heart rate variability (HRV) and salivary alpha-amylase (sAA)) compared to a control group (non-GSP). Some psychological variables were also considered. Sex was specifically studied as a possible modulator of autonomic fluctuations and psychological state. Eighty young people were randomly distributed into two counterbalanced situations: stress condition (N = 18 and 21 for GSP and non-GSP, respectively) and control condition (N = 21 and 20 for GSP and non-GSP, respectively), where cardiovascular variables were continuously recorded. Psychological questionnaires about mood and perceived stress were filled out, and five saliva samples were collected to analyze sAA. GSP participants showed higher values on low- and high-frequency ratios (HR domains), compared to non-GSP people, during exposure to the TSST, but no differences were observed after the stressor. Furthermore, the two groups did not differ in sAA. Importantly, positive affect in GSP participants was modulated by sex. The present study suggests that the balance between high- and low-frequency domains of HRV is a key cardiovascular marker reflecting the stress response of GSP people, as well the importance of sex in positive affect when facing a stressful situation.

  18. Diurnal alpha amylase patterns in adolescents: associations with puberty and momentary mood states.


    Adam, Emma K; Till Hoyt, Lindsay; Granger, Douglas A


    Salivary alpha amylase (sAA) has been proposed as a marker of autonomic nervous system activity. Few studies have examined sAA basal activity and reactivity in naturalistic settings, or developmental changes in sAA. In 50 adolescents, diary-reported moods and sAA levels were gathered across two typical weekdays. As in adults, basal sAA levels were low at waking and increased across the day. More advanced pubertal development was associated with higher waking sAA levels; males had smaller sAA increases across the day. High arousal positive emotions (feeling strong, active, excited) were associated with acute sAA increases; high arousal negative emotions (angry, stressed, nervous, worried) predicted sAA increases among youth with high average levels of these emotions. Findings suggest that basal sAA levels increase with puberty, and that acute sAA increases may reflect levels of emotional arousal, including high arousal positive emotions, rather than being specific to stress or emotions of negative valence.

  19. Effect of temperature on subsite map of Bacillus licheniformis alpha-amylase.


    Kandra, Lili; Remenyik, Judit; Gyémánt, Gyöngyi; Lipták, A


    To elucidate how temperature effects subsite mapping of a thermostable alpha-amylase from Bacillus licheniformis (BLA), a comparative study was performed by using 2-chloro-4-nitrophenyl (CNP) beta-maltooligosides with degree of polymerisation (DP) 4-10 as model substrates. Action patterns, cleavage frequencies and subsite binding energies were determined at 50 degrees C, 80 degrees C and 100 degrees C. Subsite map at 80 degrees C indicates more favourable bindings compared to the hydrolysis at 50 degrees C. Hydrolysis at 100 degrees C resulted in a clear shift in the product pattern and suggests significant differences in the active site architecture. Two preferred cleavage modes were seen for all substrates in which subsite (+2) and (+3) were dominant, but CNP-G1 was never formed. In the preferred binding mode of shorter oligomers, CNP-G2 serves as the leaving group (79%, 50%, 59% and 62% from CNP-G4, CNP-G5, CNP-G6 and CNP-G7, respectively), while CNP-G3 is the dominant hydrolysis product from CNP-G8, CNP-G9, and CNP-Gl0 (62%, 68% and 64%, respectively). The high binding energy value (-17.5 kJ/mol) found at subsite (+2) is consistent with the significant formation of CNP-G2. Subsite mapping at 80 degrees C and 100 degrees C confirms that there are no further binding sites despite the presence of longer products.

  20. Structures of Thermoactinomyces vulgaris R-47 alpha-amylase II complexed with substrate analogues.


    Yokota, T; Tonozuka, T; Shimura, Y; Ichikawa, K; Kamitori, S; Sakano, Y


    The structures of Thermoactinomyces vulgaris R-47 alpha-amylase II mutant (d325nTVA II) complexed with substrate analogues, methyl beta-cyclodextrin (m beta-CD) and maltohexaose (G6), were solved by X-ray diffraction at 3.2 A and 3.3 A resolution, respectively. In d325nTVA II-m beta-CD complex, the orientation and binding-position of beta-CD in TVA II were identical to those in cyclodextin glucanotransferase (CGTase). The active site residues were essentialy conserved, while there are no residues corresponding to Tyr89, Phe183, and His233 of CGTase in TVA II. In d325nTVA II-G6 complex, the electron density maps of two glucosyl units at the non-reducing end were disordered and invisible. The four glucosyl units of G6 were bound to TVA II as in CGTase, while the others were not stacked and were probably flexible. The residues of TVA II corresponding to Tyr89, Lys232, and His233 of CGTase were completely lacking. These results suggest that the lack of the residues related to alpha-glucan and CD-stacking causes the functional distinctions between CGTase and TVA II.

  1. Conversion of the maltogenic alpha-amylase Novamyl into a CGTase.


    Beier, L; Svendsen, A; Andersen, C; Frandsen, T P; Borchert, T V; Cherry, J R


    Novamyl is a thermostable five-domain maltogenic alpha-amylase that shows sequence and structural homology with the cyclodextrin glycosyltransferases (CGTases). Comparing X-ray crystal structures of Novamyl and CGTases, two major differences in the active site cleft were observed: Novamyl contains a loop insertion consisting of five residues (residues 191-195) and the location of an aromatic residue known to be essential to obtain an efficient cyclization reaction. To convert Novamyl into a cyclodextrin (CD)-producing enzyme, the loop was deleted and two substitutions, F188L and T189Y, were introduced. Unlike the parent Novamyl, the obtained variant is able to produce beta-CD and showed an overall conversion of starch to CD of 9%, compared with CGTases which are able to convert up to 40%. The lower conversion compared with the CGTase is probably due to additional differences in the active site cleft and in the starch-binding E domain. A variant with only the five-residue loop deleted was not able to form beta-CD.

  2. Relationship of sequence and structure to specificity in the alpha-amylase family of enzymes.


    MacGregor, E A; Janecek, S; Svensson, B


    The hydrolases and transferases that constitute the alpha-amylase family are multidomain proteins, but each has a catalytic domain in the form of a (beta/alpha)(8)-barrel, with the active site being at the C-terminal end of the barrel beta-strands. Although the enzymes are believed to share the same catalytic acids and a common mechanism of action, they have been assigned to three separate families - 13, 70 and 77 - in the classification scheme for glycoside hydrolases and transferases that is based on amino acid sequence similarities. Each enzyme has one glutamic acid and two aspartic acid residues necessary for activity, while most enzymes of the family also contain two histidine residues critical for transition state stabilisation. These five residues occur in four short sequences conserved throughout the family, and within such sequences some key amino acid residues are related to enzyme specificity. A table is given showing motifs distinctive for each specificity as extracted from 316 sequences, which should aid in identifying the enzyme from primary structure information. Where appropriate, existing problems with identification of some enzymes of the family are pointed out. For enzymes of known three-dimensional structure, action is discussed in terms of molecular architecture. The sequence-specificity and structure-specificity relationships described may provide useful pointers for rational protein engineering.

  3. Cloning and Characterization of an alpha-amylase Gene from the Hyperthermophilic Archaeon Thermococcus Thioreducens

    NASA Technical Reports Server (NTRS)

    Bernhardsdotter, Eva C. M. J.; Pusey, Mark L.; Ng, Joseph D.; Garriott, Owen K.


    The gene encoding an extracellular alpha-amylase, TTA, from the hyperthermophilic archaeon Thermococcus thioreducens was cloned and expressed in Escherichia coli. Primary structural analysis revealed high similarity with other a-amylases from the Thermococcus and Pyrococcus genera, as well as the four highly conserved regions typical for a-amylases. The 1374 bp gene encodes a protein of 457 amino acids, of which 435 constitute the mature protein preceded by a 22 amino acid signal peptide. The molecular weight of the purified recombinant enzyme was estimated to be 43 kDa by denaturing gel electrophoresis. Maximal enzymatic activity of recombinant TTA was observed at 90 C and pH 5.5 in the absence of exogenous Ca(2+), and the enzyme was considerably stable even after incubation at 90 C for 2 hours. The thermostability at 90 and 102 C was enhanced in the presence of 5 mM Ca(2+). The extraordinarily high specific activity (about 7.4 x 10(exp 3) U/mg protein at 90 C, pH 5.5 with soluble starch as substrate) together with its low pH optimum makes this enzyme an interesting candidate for starch processing applications.

  4. Children's cortisol and salivary alpha-amylase interact to predict attention bias to threatening stimuli.


    Ursache, Alexandra; Blair, Clancy


    Physiological responses to threat occur through both the autonomic nervous system (ANS) and the hypothalamic pituitary adrenal (HPA) axis. Activity in these systems can be measured through salivary alpha-amylase (sAA) and salivary cortisol, respectively. Theoretical work and empirical studies have suggested the importance of examining the coordination of these systems in relation to cognitive functioning and behavior problems. Less is known, however, about whether these systems interactively predict more automatic aspects of attention processing such as attention toward emotionally salient threatening stimuli. We used a dot probe task to assess attention bias toward threatening stimuli in 347 kindergarten children. Cortisol and sAA were assayed from saliva samples collected prior to children's participation in assessments on a subsequent day. Using regression analyses, we examined relations of sAA and cortisol to attention bias. Results indicate that cortisol and sAA interact in predicting attention bias. Higher levels of cortisol predicted greater bias toward threat for children who had high levels of sAA, but predicted greater bias away from threat for children who had low levels of sAA. These results suggest that greater symmetry in HPA and ANS functioning is associated with greater reliance on automatic attention processes in the face of threat.

  5. Calcium-binding parameter of Bacillus amyloliquefaciens alpha-amylase determined by inactivation kinetics.

    PubMed Central

    Tanaka, Atsushi; Hoshino, Eiichi


    The irreversible thermal inactivation and the thermodynamics of calcium ion binding of Bacillus amyloliquefaciens alpha-amylase in the absence of substrates were studied. The enzyme inactivation on heating was apparently followed by first-order kinetics. The enzyme was stabilized with an increased concentration of calcium ion and thus the inactivation was highly dependent on the state of calcium binding. The activation parameter for the inactivation suggests an unfolding of the enzyme protein upon heating. Values of both the activation enthalpy and entropy were increased with a higher calcium ion concentration. An inactivation kinetic model is based on the assumption of a two-stage unfolding transition in which the bivalent ion dissociation occurs in the first step followed by the secondary structural unfolding. This simple kinetic model provides both a qualitative and quantitative interpretation of calcium ion binding to the enzyme and its effect on the inactivation properties. The specific approximations of the kinetic model were strictly followed in the analysis to calculate the apparent inactivation rate at each calcium ion concentration in terms of the calcium-binding parameters. The enthalpy and entropy changes for the calcium ion binding were calculated to be -149 kJ/mol and -360 J.mol(-1).K(-1) respectively and these values suggest a strong enthalpic affinity for the bivalent ion binding to the enzyme protein. The thermodynamical interpretation attempts to provide clear relations between the terms of an apparent inactivation rate and the calcium binding. PMID:12049626

  6. Job categories and their effect on exposure to fungal alpha-amylase and inhalable dust in the U.K. baking industry.


    Elms, Joanne; Beckett, Paul; Griffin, Peter; Evans, Paul; Sams, Craig; Roff, Martin; Curran, Andrew D


    Enzymes in flour improver, in particular fungal alpha-amylase, are known to be a significant cause of respiratory allergy in the baking industry. This study measured total inhalable dust and fungal alpha-amylase exposures in U.K. bakeries, mills, and a flour improver production and packing facility and determined whether assignment of job description could identify individuals with the highest exposures to fungal alpha-amylase and inhalable dust. A total of 117 personal samples were taken for workers in 19 bakeries, 2 mills, and a flour improver production and packing facility and were analyzed using a monoclonal based immunoassay. Occupational hygiene surveys were undertaken for each site to assign job description and identify individuals who worked directly with flour improvers. Analysis of exposure data identified that mixers and weighers from large bakeries had the highest exposures to both inhalable dust and fungal alpha-amylase among the different categories of bakery workers (p<.01). Currently, the maximum exposure limit for flour dust in the United Kingdom is 10 mg/m(3) (8-hour time-weighted average reference period). In this study 25% of the total dust results for bakers exceeded 10 mg/m(3), and interestingly, 63% of the individuals with exposure levels exceeding 10 mg/m(3) were weighers and mixers. Individuals who worked directly with flour improvers were exposed to higher levels of both inhalable dust and fungal alpha-amylase (p<.01) than those who were not directly handling these products. Before sensitive immunoassays were utilized for the detection of specific inhalable allergens, gravimetric analysis was often used as a surrogate. There was a weak relationship between inhalable dust and fungal alpha-amylase exposures; however, inhalable dust levels could not be used to predict amylase exposures, which highlights the importance of measuring both inhalable dust and fungal alpha-amylase exposures.

  7. Salivary alpha amylase and salivary cortisol response to fluid consumption in exercising athletes

    PubMed Central

    Horvath, PJ; Kazial, KA


    The objective of the study was to examine salivary biomarker response to fluid consumption in exercising athletes. Exercise induces stress on the body and salivary alpha amylase (sAA) and salivary cortisol are useful biomarkers for activity in the sympathoadrenal medullary system and the hypothalamic pituitary adrenal axis which are involved in the stress response. Fifteen college students were given 150 ml and 500 ml of water on different days and blinded to fluid condition. The exercise protocol was identical for both fluid conditions using absolute exercise intensities ranging from moderate to high. Saliva was collected prior to exercise, post moderate and post high intensities and analyzed by Salimetrics assays. Exercise was significant for sAA with values different between pre-exercise (85 ± 10 U · ml−1) and high intensity (284 ± 30 U · ml−1) as well as between moderate intensity (204 ± 32 U · ml−1) and high intensity. There was no difference in sAA values between fluid conditions at either intensity. Exercise intensity and fluid condition were each significant for cortisol. Cortisol values were different between pre-exercise (0.30 ± 0.03 ug · dL−1) and high intensity (0.45 ± 0.05 ug · dL−1) as well as between moderate intensity (0.33 ± 0.04 ug · dL−1) and high intensity. Moderate exercise intensity cortisol was lower in the 500 ml condition (0.33 ± 0.03 ug · dL−1) compared with the 150 ml condition (0.38 ± 0.03 ug · dL−1). This altered physiological response due to fluid consumption could influence sport performance and should be considered. In addition, future sport and exercise studies should control for fluid consumption. PMID:26681828

  8. Elevated Salivary Alpha Amylase in Adolescent Sexual Abuse Survivors with Posttraumatic Stress Disorder Symptoms

    PubMed Central

    Strawn, Jeffrey R.; Out, Dorothee; Granger, Douglas A.; Putnam, Frank W.


    Abstract Objective: Little is known regarding neuroendocrine responses in adolescent girls with posttraumatic stress disorder (PTSD) who have experienced sexual abuse. Therefore, we collected saliva samples three times daily for 3 days to assess concentrations of salivary alpha amylase (sAA) – a surrogate marker for autonomic nervous system (ANS) activity and, in particular, sympathetic activity – in sexually abused adolescent girls. Methods: Twenty-four girls (mean age: 15±1.4 years) who had experienced recent sexual abuse (i.e., sexual abuse occurred 1–6 months prior to study enrollment) and 12 healthy comparison subjects (mean age: 14.8±1.3 years) completed a structured interview and assessments to ascertain symptoms of posttraumatic stress, then collected saliva at home upon awakening, 30 minutes after waking, and at 5 p.m. on three consecutive school days. Results: For sexually abused girls, total PTSD symptoms were associated with higher overall morning levels of sAA (r[20]=0.51, p=0.02), a finding driven by intrusive symptoms (r[20]=0.43, p<0.05) and hyperarousal symptoms (r[20]=0.58, p=0.01). There were no significant differences in diurnal sAA secretion between the sexually abused girls and healthy comparison adolescents. Conclusions: Overall morning concentrations of sAA in sexually abused girls are associated with overall PTSD severity as well as symptoms of hyperarousal and intrusive symptoms, possibly reflecting symptom-linked increases in ANS tone. These data raise the possibility that alterations in ANS activity are related to the pathophysiology of sexual abuse-related PTSD in adolescent girls, and may inform therapeutic interventions (e.g., antiadrenergic medications). PMID:25803321

  9. Alpha-amylase reactivity in relation to psychopathic traits in adults.


    Glenn, Andrea L; Remmel, Rheanna J; Raine, Adrian; Schug, Robert A; Gao, Yu; Granger, Douglas A


    Recent investigations of the psychobiology of stress in antisocial youth have benefited from a multi-system measurement model. The inclusion of salivary alpha-amylase (sAA), a surrogate marker of autonomic/sympathetic nervous system (ANS) activity, in addition to salivary cortisol, a biomarker of the hypothalamic-pituitary-adrenal (HPA) axis functioning, has helped define a more complete picture of individual differences and potential dysfunction in the stress response system of these individuals. To the authors' knowledge, no studies have examined sAA in relation to antisocial behavior in adults or in relation to psychopathic traits specifically. In the present study, we examined sAA, in addition to salivary cortisol, in a relatively large sample (n=158) of adult males (M age=36.81, range=22-67 years; 44% African-American, 34% Caucasian, 16% Hispanic) recruited from temporary employment agencies with varying levels of psychopathic traits. Males scoring highest in psychopathy were found to have attenuated sAA reactivity to social stress compared to those scoring lower in psychopathy. No differential relationships with the different factors of psychopathy were observed. In contrast to studies of antisocial youth, there were no interactions between sAA and cortisol levels in relation to psychopathy, but there was a significant interaction between pre-stressor levels of sAA and cortisol. Findings reveal potential regulatory deficits in the fast-acting, 'fight or flight', component of the stress response in adult males with psychopathic traits, as well as abnormalities in how this system may interact with the HPA axis.

  10. Salivary alpha amylase activity in human beings of different age groups subjected to psychological stress.


    Sahu, Gopal K; Upadhyay, Seema; Panna, Shradha M


    Salivary alpha-amylase (sAA) has been proposed as a sensitive non-invasive biomarker for stress-induced changes in the body that reflect the activity of the sympathetic nervous system. Though several experiments have been conducted to determine the validity of this salivary component as a reliable stress marker in human subjects, the effect of stress induced changes on sAA level in different age groups is least studied. This article reports the activity of sAA in human subjects of different age groups subjected to psychological stress induced through stressful video clip. Differences in sAA level based on sex of different age groups under stress have also been studied. A total of 112 subjects consisting of both the male and female subjects, divided into two groups on basis of age were viewed a video clip of corneal transplant surgery as stressor. Activity of sAA from saliva samples of the stressed subjects were measured and compared with the activity of the samples collected from the subjects before viewing the clip. The age ranges of subjects were 18-25 and 40-60 years. The sAA level increased significantly in both the groups after viewing the stressful video. The increase was more pronounced in the younger subjects. The level of sAA was comparatively more in males than females in the respective groups. No significant change in sAA activity was observed after viewing the soothed video clip. Significant increase of sAA level in response to psychological stress suggests that it might act as a reliable sympathetic activity biochemical marker in different stages of human beings.

  11. Cell-associated alpha-amylases of butyrate-producing Firmicute bacteria from the human colon.


    Ramsay, Alan G; Scott, Karen P; Martin, Jenny C; Rincon, Marco T; Flint, Harry J


    Selected butyrate-producing bacteria from the human colon that are related to Roseburia spp. and Butyrivibrio fibrisolvens showed a good ability to utilize a variety of starches for growth when compared with the Gram-negative amylolytic anaerobe Bacteroides thetaiotaomicron. A major cell-associated amylase of high molecular mass (140-210 kDa) was detected in each strain by SDS-PAGE zymogram analysis, and genes corresponding to these enzymes were analysed for two representative strains. Amy13B from But. fibrisolvens 16/4 is a multi-domain enzyme of 144.6 kDa that includes a family 13 glycoside hydrolase domain, and duplicated family 26 carbohydrate-binding modules. Amy13A (182.4 kDa), from Roseburia inulinivorans A2-194, also includes a family 13 domain, which is preceded by two repeat units of approximately 116 aa rich in aromatic residues, an isoamylase N-terminal domain, a pullulanase-associated domain, and an additional unidentified domain. Both Amy13A and Amy13B have N-terminal signal peptides and C-terminal cell-wall sorting signals, including a modified LPXTG motif similar to that involved in interactions with the cell surface in other Gram-positive bacteria, a hydrophobic transmembrane segment, and a basic C terminus. The overexpressed family 13 domains showed an absolute requirement for Mg2+ or Ca2+ for activity, and functioned as 1,4-alpha-glucanohydrolases (alpha-amylases; EC These major starch-degrading enzymes thus appear to be anchored to the cell wall in this important group of human gut bacteria.

  12. Amylosucrase, a glucan-synthesizing enzyme from the alpha-amylase family.


    Skov, L K; Mirza, O; Henriksen, A; De Montalk, G P; Remaud-Simeon, M; Sarçabal, P; Willemot, R M; Monsan, P; Gajhede, M


    Amylosucrase (E.C. is a member of Family 13 of the glycoside hydrolases (the alpha-amylases), although its biological function is the synthesis of amylose-like polymers from sucrose. The structure of amylosucrase from Neisseria polysaccharea is divided into five domains: an all helical N-terminal domain that is not similar to any known fold, a (beta/alpha)(8)-barrel A-domain, B- and B'-domains displaying alpha/beta-structure, and a C-terminal eight-stranded beta-sheet domain. In contrast to other Family 13 hydrolases that have the active site in the bottom of a large cleft, the active site of amylosucrase is at the bottom of a pocket at the molecular surface. A substrate binding site resembling the amylase 2 subsite is not found in amylosucrase. The site is blocked by a salt bridge between residues in the second and eight loops of the (beta/alpha)(8)-barrel. The result is an exo-acting enzyme. Loop 7 in the amylosucrase barrel is prolonged compared with the loop structure found in other hydrolases, and this insertion (forming domain B') is suggested to be important for the polymer synthase activity of the enzyme. The topology of the B'-domain creates an active site entrance with several ravines in the molecular surface that could be used specifically by the substrates/products (sucrose, glucan polymer, and fructose) that have to get in and out of the active site pocket.

  13. Alpha-Amylase Reactivity in Relation to Psychopathic Traits in Adults

    PubMed Central

    Glenn, Andrea L.; Remmel, Rheanna J.; Raine, Adrian; Schug, Robert A.; Gao, Yu; Granger, Douglas A.


    Recent investigations of the psychobiology of stress in antisocial youth have benefited from a multi-system measurement model. The inclusion of salivary alpha-amylase (sAA), a surrogate marker of autonomic/sympathetic nervous system (ANS) activity, in addition to salivary cortisol, a biomarker of the hypothalamic-pituitary-adrenal (HPA) axis functioning, has helped define a more complete picture of individual differences and potential dysfunction in the stress response system of these individuals. To the authors' knowledge, no studies have examined sAA in relation to antisocial behavior in adults or in relation to psychopathic traits specifically. In the present study, we examined sAA, in addition to salivary cortisol, in a relatively large sample (n = 158) of adult males (M age = 36.81, range = 22-67 years; 44% African-American, 34% Caucasian, 16% Hispanic) recruited from temporary employment agencies with varying levels of psychopathic traits. Males scoring highest in psychopathy were found to have attenuated sAA reactivity to social stress compared to those scoring lower in psychopathy. No differential relationships with the different factors of psychopathy were observed. In contrast to studies of antisocial youth, there were no interactions between sAA and cortisol levels in relation to psychopathy, but there was a significant interaction between pre-stressor levels of sAA and cortisol. Findings reveal potential regulatory deficits in the fast-acting, ‘fight or flight’, component of the stress response in adult males with psychopathic traits, as well as abnormalities in how this system may interact with the HPA axis. PMID:25662339

  14. [The contribution of different alpha-amylase isoenzymes of the commodity grain spring wheat in the formation of falling number values].


    Mamytova, N S; Kuzovlev, V A; Khakimzhanov, A A; Fursov, O V


    The participation of various isoenzymes of alpha-amylase in the formation of falling number values of the commodity grain of wheat grown in the Republic of Kazakhstan was investigated. It was found that active isoenzymes alpha-AMY1 and alpha-AMY2 of the embryonic shield were present in the grain with an index over 200. A significant decrease in the falling number depended mainly on the synthesis of alpha-AMY1 and alpha-AMY2 isoenzymes in the aleurone layer. In the grain, isoenzymes with high isoelectric points (p1 > or = 7.3) were found; these isoenzymes belong to alpha-amylase or late maturing or alpha-amylase of practically mature grains. It was discovered that the exogenous hormone (gibberellic acid) induced synthesis of alpha-amylase isoenzymes of scutellum, whole caryopses, and aleurone. It was shown that the impact of exogenous gibberellic acid on the activity and structure of alpha-amylase is reduced in grain with a low falling number.

  15. Putative implication of alpha-amylase loop 7 in the mechanism of substrate binding and reaction products release.


    André, G; Tran, V


    Alpha-amylases are widespread endo-enzymes involved in the hydrolysis of internal alpha-(1,4) glycosidic linkages of starch polymers. Molecular modeling of amylose-amylase interactions is a step toward enzymatic mechanism understanding and rational design of new enzymes. From the crystallographic complex of barley alpha-amylase AMY2-acarbose, the static aspects of amylose-amylase docking have been characterized with a model of maltododecaose (DP12) (G. André, A. Buléon, R. Haser, and V. Tran, Biopolymers 1999, Vol. 50, pp. 751-762; G. André and V. Tran, Special Publication no. 246 1999, The Royal Society of Chemistry, H. J. Gilbert, G. J. Davies, B. Henrissat, and B. Svensson, Eds., Cambridge, pp. 165-174). These studies, consistent with the experimental subsite mapping (K. Bak-Jensen, G. André, V. Tran, and B. Svensson, Journal of Biological Chemistry, to be published), propose a propagation scheme for an amylose chain in the active cleft of AMY2. The topographical overview of alpha-amylases identified loop 7 as a conserved segment flanking the active site. Since some crystallographic experiments suspected its high flexibility, its putative motion was explored through a robotic scheme, an alternate route to dynamics simulations that consume CPU time. The present article describes the characteristics of the flexibility of loop 7: location and motion in AMY2. A back-and-forth motion with a large amplitude of more than 0.6 nm was evaluated. This movement could be triggered by two hinge residues. It results in the loop flipping over the active site to enhance the docking of the native helical substrate through specific interactions, it positions the catalytic residues, it distorts the substrate towards its transition state geometry, and finally monitors the release of the products after hydrolysis. The residues involved in the process are now rational mutation points in the hands of molecular biologists.

  16. The production of a new fungal alpha-amylase degraded the raw starch by means of solid-state fermentation.


    Balkan, Bilal; Ertan, Figen


    In this study, it was intended to produce a new fungal amylase by solid-state fermentation and purification and also to determine some of its biochemical properties. It was found that Penicillium brevicompactum had the best enzyme activity according to screening methods with amylase degrading raw starch, and P. brevicompactum was selected as the amylase source. Wheat bran, rice husks, and sunflower oil meal were tested to determine the best solid substrate. Wheat bran was determined as the best of these. The fermentation conditions were optimized for the production of amylase. The optimum fermentation conditions were found to be an initial moisture level for the solid substrate of 55%, moistening agent of 0.1 M sodium phosphate buffer (pH 5.0), incubation period of 7 d, inoculum concentration of 2.5 mL, and incubation temperature at 30 degrees C. Penicillium brevicompactum alpha-amylase was purified 45.98 times by the starch affinity method. The K(m) and V(max) values of alpha-amylase for soluble starch were 5.71 mg/mL and 666.6 U/mL, respectively. This amylase showed maximum activity at between 30 and 50 degrees C and at pH 5.0. Initial enzyme activity was kept at 100% after incubation at 30 degrees C for 45 min. Enzyme was stable in the pH range of 4.0-5.0. This enzyme was activated by Mn(2+), Cu(2+), and Na(+) ions, and was inhibited by Mg(2+), K(+), Fe(3+), and ethylenediamine tetraacetic acid (EDTA). The molecular mass of P. brevicompactum alpha-amylase was found to be 32.5 kD by sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis.

  17. Heat shock inhibits. alpha. -amylase synthesis in barley aleurone without inhibiting the activity of endoplasmic reticulum marker enzymes

    SciTech Connect

    Sticher, L.; Biswas, A.K.; Bush, D.S.; Jones, R.L. )


    The effects of heat shock on the synthesis of {alpha}-amylase and on the membranes of the endoplasmic reticulum (ER) of barley (Hordeum vulgare) aleurone were studied. Heat shock, imposed by raising the temperature of incubation from 25{degree}C to 40{degree}C for 3 hours, inhibits the accumulation of {alpha}-amylase and other proteins in the incubation medium of barley aleurone layers treated with gibberellic acid and Ca{sup 2+}. When ER is isolated from heat-shocked aleurone layers, less newly synthesized {alpha}-amylase is found associated with this membrane system. ER membranes, as indicated by the activities of NADH cytochrome c reductase and ATP-dependent Ca{sup 2+} transport, are not destroyed by heat stress, however. Although heat shock did not reduce the activity of ER membrane marker enzymes, it altered the buoyant density of these membranes. Whereas ER from control tissue showed a peak of marker enzyme activity at 27% to 28% sucrose (1.113-1.120 grams per cubic centimeter), ER from heat-shocked tissue peaked at 30% to 32% sucrose (1.127-1.137 grams per cubic centimeter). The synthesis of a group of proteins designated as heat-shock proteins (HSPs) was stimulated by heat shock. These HSPs were localized to different compartments of the aleurone cell. Several proteins ranging from 15 to 30 kilodaltons were found in the ER and the mitochondrial/plasma membrane fractions of heat-shocked cells, but none of the HSPs accumulated in the incubation medium of heat-shocked aleurone layers.

  18. Crystal structure of calcium-depleted Bacillus licheniformis alpha-amylase at 2.2 A resolution.


    Machius, M; Wiegand, G; Huber, R


    The three-dimensional structure of the calcium-free form of Bacillus licheniformis alpha-amylase (BLA) has been determined by multiple isomorphous replacement in a crystal of space group P4(3)2(1)2 (a = b = 119.6 A, c = 85.4 A). The structure was refined using restrained crystallographic refinement to an R-factor of 0.177 for 28,147 independent reflections with intensities FObs > 0 at 2.2 A resolution, with root mean square deviations of 0.008 A and 1.4 degrees from ideal bond lengths and bond angles, respectively. The final model contains 469 residue, 237 water molecules, and one chloride ion. The segment between Trp182 and Asn192 could not be located in the electron density, nor could the N and C termini. Cleavage of the calcium-free form of BLA was observed after Glu189, due to a Glu-C endopeptidase present in trace amounts in the preparation. BLA did not crystallize without this cleavage under the conditions applied. BLA exhibits the characteristic overall topological fold observed for other alpha-amylases and related amylolytic enzymes: a central domain A containing an alpha/beta-barrel with a large protrusion between beta-strand 3 and alpha-helix 3 (domain B) and a C-terminal greek key motif (domain C). Unlike in the other enzymes, domain B possesses a beta-sheet made up of six loosely connected, twisted beta-strands forming a kind of a barrel with a large hole in the interior. Topological comparisons to TAKA-amylase, pig pancreatic alpha-amylase and cyclodextrin glycosyltransferase reveal a very high structural equivalence for large portions of the proteins and an exceptionally pronounced structural similarity for calcium binding, chloride binding and the active site. None of the theories proposed to explain the enhanced thermostability of BLA showed a satisfactory correlation with the three-dimensional structure. Instead, sequence comparisons to the less thermostable bacterial alpha-amylase from Bacillus amyloliquefaciens (BAA) indicate that some ionic

  19. Decreased salivary alpha-amylase levels are associated with performance deficits during sleep loss.


    Pajcin, Maja; Banks, Siobhan; White, Jason M; Dorrian, Jill; Paech, Gemma M; Grant, Crystal; Johnson, Kayla; Tooley, Katie; Fidock, Justin; Kamimori, Gary H; Della Vedova, Chris B


    During sleep deprivation, neurobehavioral functions requiring sustained levels of attention and alertness are significantly impaired. Discrepancies between subjective measures of sleepiness and objective performance during sustained operations have led to interest in physiological monitoring of operator performance. Alertness, vigilance, and arousal are modulated by the wake-promoting actions of the central noradrenergic system. Salivary alpha-amylase (sAA) has been proposed as a sensitive peripheral measure of noradrenergic activity, but limited research has investigated the relationship between sAA and performance. In a laboratory-controlled environment, we investigated the relationship between sAA levels, subjective sleepiness, and performance during two days (50h) of total sleep deprivation. Beginning at 09:00, twelve healthy participants (5 females) aged 22.5±2.5years (mean±SD) provided saliva samples, recorded ratings of subjective sleepiness, completed a brief 3-min psychomotor vigilance task (PVT-B) and performed a 40-min simulated driving task, at regular 3h intervals during wakefulness. Ratings of subjective sleepiness exhibited a constant linear increase (p<0.001) during sleep deprivation. In contrast, sAA levels showed a marked diurnal profile, with levels increasing during the day (p<0.001) and steadily declining in the evening and early-morning (p<0.001). PVT-B (mean reaction time and mean slowest 10% reaction time) and simulated driving performance (speed deviation and lane deviation) also exhibited diurnal profiles across the two days of sleep deprivation. Performance peaked in the afternoon (p<0.001) and then steadily worsened as wakefulness continued into the evening and early-morning (p<0.001). Further analysis revealed that higher sAA levels in the hour preceding each performance assessment were associated with better PVT-B and driving performance (p<0.001). These findings suggest that sAA measures may be suitable indicators of performance

  20. Salivary cortisol and alpha-amylase reactivity to taekwondo competition in children.


    Capranica, Laura; Lupo, Corrado; Cortis, Cristina; Chiodo, Salvatore; Cibelli, Giuseppe; Tessitore, Antonio


    The aim of this study was to evaluate the effects of an official taekwondo competition (three 1-min rounds with a 1-min recovery in-between) on heart rate (HR), salivary alpha-amylase (sAA), and salivary-free cortisol (sC) in children. Parental consent was obtained for 12 young (10.4 ± 0.2 years) male taekwondo athletes. Saliva sample were collected 15 min before and 1 min after an official taekwondo competition, and at 30, 60, and 90 min of the recovery period. To evaluate the exercise intensity during the competition, HR was measured and expressed as a percentage of individuals HR(peak). Athletes spent 78% of the time working at HR > 90% HR(max), with significant increases from round 1 to round 2 and 3. Peak sAA observed at the end of the match (169.6 ± 47.0 U/mL) was different (P = 0.0001) from the other samplings (pre-competition 55.0 ± 14.0 U/mL, 30-min recovery 80.4 ± 17.7 U/mL, 60-min recovery 50.5 ± 7.6 U/ml; 90-min recovery 53.2 ± 9.6 U/mL). Peak sC values observed at 30-min recovery (17.9 ± 3.5 nmol/L) were different (P < 0.0001) from pre-competition (5.6 ± 0.9 nmol/L), post-competition (9.0 ± 2.0 nmol/L), 60-min recovery (10.3 ± 2.6 nmol/L) and 90-min recovery (4.2 ± 0.8 nmol/L) values. These findings confirm that taekwondo competitions pose a high stress on young athletes. The different sAA and sC reactions in response to the physical stressor mirror the faster reactivity of the sympathetic-adrenomedullary system relatively to the hypothalamic-pituitary-adrenocortical system, respectively. This experimental paradigm might represent a useful model for further research on the effects of various stressors (i.e., training and competition) in taekwondo athletes.

  1. Comparison of the wild-type alpha-amylase and its variant enzymes in Bacillus amyloliquefaciens in activity and thermal stability, and insights into engineering the thermal stability of bacillus alpha-amylase.


    Lee, Seunjae; Mouri, Yoshiki; Minoda, Masashi; Oneda, Hiroshi; Inouye, Kuniyo


    The starch hydrolysis activity and thermal stability of Bacillus amyloliquefaciens alpha-amylase (wild-type enzyme or WT) and its variant enzymes, designated as M77, M111, and 21B, were compared. All have an optimal pH at around 6, as well as almost the same reaction rates and Km and kcat values. The optimal temperature in the absence of Ca2+ ions is 60 degrees C for WT and M77 and 40 degrees C for M111 and 21B. Those of M111 and 21B rose to 50-60 degrees C upon the addition of 5 mM CaCl2, while those of WT and M77 did not change. The dissociation constants Kd for Ca2+ to WT and M77 are much lower than those of M111 and 21B. Asp233 in WT is replaced by Asn in M111 and 21B, while it is retained in M77, suggesting that Asp233 is involved in the thermal stability of the enzyme through Ca2+ ion binding. These findings provide insight into engineering the thermal stability of B. amyloliquefaciens alpha-amylase, which would be useful for its applications in the baking industry and in glucose manufacturing.

  2. Synthesis and processing of Escherichia coli TEM-beta-lactamase and Bacillus licheniformis alpha-amylase in E. coli: the role of signal peptidase I.


    van Dijl, J M; Smith, H; Bron, S; Venema, G


    A mutant of Escherichia coli, in which signal peptidase I synthesis can be regulated, was constructed. The mutant was used to study the effects of signal peptidase I limitation on the synthesis and efficiency of processing of two proteins: the periplasmic E. coli TEM-beta-lactamase and Bacillus licheniformis alpha-amylase, which also accumulates in the periplasm of E. coli. Signal peptidase I limitation resulted in reduced rates of processing of pre-beta-lactamase and in strong inhibition of synthesis of alpha-amylase. The data suggest that beta-lactamase is processed post-translationally and that an intimate relationship exists between the synthesis and processing of alpha-amylase.

  3. Analysis of the extreme diversity of salivary alpha-amylase isoforms generated by physiological proteolysis using liquid chromatography-tandem mass spectrometry.


    Bailey, Ulla-Maja; Punyadeera, Chamindie; Cooper-White, Justin J; Schulz, Benjamin L


    Saliva is a crucial biofluid for oral health and is also of increasing importance as a non-invasive source of disease biomarkers. Salivary alpha-amylase is an abundant protein in saliva, and changes in amylase expression have been previously associated with a variety of diseases and conditions. Salivary alpha-amylase is subject to a high diversity of post-translational modifications, including physiological proteolysis in the oral cavity. Here we developed methodology for rapid sample preparation and non-targeted LC-ESI-MS/MS analysis of saliva from healthy subjects and observed an extreme diversity of alpha-amylase proteolytic isoforms. Our results emphasize the importance of consideration of post-translational events such as proteolysis in proteomic studies, biomarker discovery and validation, particularly in saliva.

  4. Mapping of barley alpha-amylases and outer subsite mutants reveals dynamic high-affinity subsites and barriers in the long substrate binding cleft.


    Kandra, Lili; Hachem, Maher Abou; Gyémánt, Gyöngyi; Kramhøft, Birte; Svensson, Birte


    Subsite affinity maps of long substrate binding clefts in barley alpha-amylases, obtained using a series of maltooligosaccharides of degree of polymerization of 3-12, revealed unfavorable binding energies at the internal subsites -3 and -5 and at subsites -8 and +3/+4 defining these subsites as binding barriers. Barley alpha-amylase 1 mutants Y105A and T212Y at subsite -6 and +4 resulted in release or anchoring of bound substrate, thus modifying the affinities of other high-affinity subsites (-2 and +2) and barriers. The double mutant Y105A-T212Y displayed a hybrid subsite affinity profile, converting barriers to binding areas. These findings highlight the dynamic binding energy distribution and the versatility of long maltooligosaccharide derivatives in mapping extended binding clefts in alpha-amylases.

  5. Collecting saliva and measuring salivary cortisol and alpha-amylase in frail community residing older adults via family caregivers.


    Hodgson, Nancy A; Granger, Douglas A


    Salivary measures have emerged in bio-behavioral research that are easy-to-collect, minimally invasive, and relatively inexpensive biologic markers of stress. This article we present the steps for collection and analysis of two salivary assays in research with frail, community residing older adults-salivary cortisol and salivary alpha amylase. The field of salivary bioscience is rapidly advancing and the purpose of this presentation is to provide an update on the developments for investigators interested in integrating these measures into research on aging. Strategies are presented for instructing family caregivers in collecting saliva in the home, and for conducting laboratory analyses of salivary analytes that have demonstrated feasibility, high compliance, and yield quality specimens. The protocol for sample collection includes: (1) consistent use of collection materials; (2) standardized methods that promote adherence and minimize subject burden; and (3) procedures for controlling certain confounding agents. We also provide strategies for laboratory analyses include: (1) saliva handling and processing; (2) salivary cortisol and salivary alpha amylase assay procedures; and (3) analytic considerations.

  6. Production and characterization of alpha-amylase from mango kernel by Fusarium solani NAIMCC-F-02956 using submerged fermentation.


    Kumar, Devendra; Yadav, Kaushlesh K; Muthukumar, M; Garg, Neelima


    Microbial production of enzymes using low valued agro industrial wastes is gaining importance globally. Mango is one of the major fruit processed into a variety of products. During processing 40-50% of solid waste is generated in form of peel and stones. After decortications of mango stone, kernel is obtained which is a rich source of starch (upto 60%). It was utilized as a substrate for alpha-amylase production using Fusarium soloni. Maximum alpha-amylase production (0.889 U g(-1)) was recorded using a substrate concentration of 5% (w/v), pH-4 and temperature 30 degrees C on 9th day of incubation. Supplementation of production medium with micronutrients viz., Ca2+, Fe2+ or Mg2+ improved the enzyme production while, Zn2+, B3+ or Mn2+ ions exhibited inhibitory effect. The extracellular protein was precipitated by ammonium sulphate up to 70% saturation, dialyzed and purified (27.84 fold) by gel-exclusion (Sephadex G-75) chromatography. Protein profiling on 12% SDS-PAGE revealed three bands corresponding to 26, 27 and 30 kDa molecular sizes. The optimum amylase activity was achieved at pH 5.0 at 40 degrees C. The Michaelis constant (KM), Vmax and activation energy (-Ea) were found to be 3.7 mg ml(-1), 0.24 U mg(-1) and 42.39 kJ mole(-1), respectively.

  7. Characterization of BGTG-1, a tergal gland-secreted alpha-amylase, from the German cockroach, Blattella germanica (L.).


    Saltzmann, K D; Saltzmann, K A; Neal, J J; Scharf, M E; Bennett, G W


    The protein fraction of the German cockroach, Blattella germanica (L.), tergal gland secretion was examined. SDS-PAGE separation of proteins present in B. germanica tergal gland secretion revealed a tergal gland-secreted protein, BGTG-1, at approximately 63 kDa. BGTG-1 first appeared in tergal gland secretion at 2 days postimaginal moult and the amount of protein observed increased through day 5. A 2051 bp cDNA sequence, bgtg-1, was obtained by RACE polymerase chain reaction and contains a 1494 bp ORF encoding a predicted protein of 498 amino acids. In a Northern hybridization experiment using total RNA from B. germanica tergal gland tissue, a (32)P-labelled bgtg-1 probe hybridized to an RNA approximately 2000 bp and confirmed the 2051 bp cDNA size obtained by RACE PCR. Using the BLASTx sequence similarity search tool, the top match to the bgtg-1 ORF was found to be an alpha-amylase from Drosophila kikkawai (e-value = 1 x 10(-178)). Alignment of the bgtg-1 deduced protein sequence with alpha-amylases from fruit fly, Drosophila melanogaster, honey bee, Apis mellifera (L.) and yellow mealworm, Tenebrio molitor (L.), revealed conserved residues throughout the ORF and sequence identities ranging from 58.4 to 58.2%. Using a gel-based assay, degradation of starch by native BGTG-1 was demonstrated in vitro and we propose that BGTG-1 may be involved in processing phagostimulatory sugars present in B. germanica tergal gland secretion.

  8. Three alpha-amylases from malted finger millet (Ragi, Eleusine coracana, Indaf-15)--purification and partial characterization.


    Nirmala, M; Muralikrishna, G


    Three alpha-amylases (E.C. were purified to apparent homogeneity from 72 h finger millet malt by three step purification via fractional acetone precipitation, DEAE-Sephacel ion exchange and Sephacryl S-200 gel permeation chromatographies with a recovery of 6.5, 2.9, 9.6% and fold purification of 26, 17 and 31, respectively. alpha-Nature of these amylases was identified by their ability to rapidly reduce the viscosity of starch solution and also in liberating oligosaccharides of higher D.P. and were accordingly designated as amylases alpha-1((b)), alpha-2 and alpha-3, respectively. These amylases, having a molecular weight of 45+/-2 kDa were found to be monomeric. The pH and temperature optima of these alpha-amylases were found to be in the range of 5.0-5.5 and 45-50 degrees C, respectively. K(m) values of these amylases for various cereal starches varied between 0.59 and 1.43%. Carbodiimide (50 mM) and metal ions such as Al(3+), Fe(2+), and Hg(2+) (5 mM) have completely inhibited these enzymes at 45 degrees C. Amino acid analysis of these enzymes indicated high amounts of glycine which is an unusual feature of these enzymes.

  9. Investigation on the effects of three X-->histidine replacements on thermostability of alpha-amylase from Bacillus amyloliquefaciens.


    Haghani, Karimeh; Khajeh, Khosro; Naderi-Manesh, Hossein; Ranjbar, Bijan


    Bacillus licheniformis alpha-amylase (BLA), a thermophilic counterpart of Bacillus amyloliquefaciens alpha-amylase (BAA), is an appropriate model for the design of stabilizing mutations in BAA. BLA has 10 more histidines than BAA. Considering this prominent difference, in the present study, three out of these positions (I34, Q67, and P407; located in the thermostability determinant 1 region and Ca-III binding site of BAA) were replaced with histidine in BAA, using the site-directed mutagenesis technique. The results showed that the thermostability of P407H and Q67H mutants had increased, but no significant changes were observed in their kinetic parameters compared to that of the wild type. I34H replacement resulted in complete loss of enzyme activity. Moreover, fluorescence and circular dichroism data indicated a more rigid structure for the P407H variant compared with that of the wild-type BAA. However, the flexibility of Q67H and I34H mutants increased in comparison with that of wild-type enzyme.

  10. Improvement in lactic acid production from starch using alpha-amylase-secreting Lactococcus lactis cells adapted to maltose or starch.


    Okano, Kenji; Kimura, Sakurako; Narita, Junya; Fukuda, Hideki; Kondo, Akihiko


    To achieve direct and efficient lactic acid production from starch, a genetically modified Lactococcus lactis IL 1403 secreting alpha-amylase, which was obtained from Streptococcus bovis 148, was constructed. Using this strain, the fermentation of soluble starch was achieved, although its rate was far from efficient (0.09 g l(-1) h(-1) lactate). High-performance liquid chromatography revealed that maltose accumulated during fermentation, and this was thought to lead to inefficient fermentation. To accelerate maltose consumption, starch fermentation was examined using L. lactis cells adapted to maltose instead of glucose. This led to a decrease in the amount of maltose accumulation in the culture, and, as a result, a more rapid fermentation was accomplished (1.31 g l(-1) h(-1) lactate). Maximum volumetric lactate productivity was further increased (1.57 g l(-1) h(-1) lactate) using cells adapted to starch, and a high yield of lactate (0.89 g of lactate per gram of consumed sugar) of high optical purity (99.2% of L: -lactate) was achieved. In this study, we propose a new approach to lactate production by alpha-amylase-secreting L. lactis that allows efficient fermentation from starch using cells adapted to maltose or starch before fermentation.

  11. Study of phenolic content and urease and alpha-amylase inhibitory activities of methanolic extract of Rumex acetosella roots and its sub-fractions in different solvents.


    Ahmed, Dildar; Mughal, Qaria Mumtaz; Younas, Saba; Ikram, Muhammad


    The present study aimed to establish relationship between urease and alpha-amylase inhibitory activities on the one hand and on the other between anti-enzymatic activities and total phenolic contents of the methanolic extract of roots of Rumex acetosella and its fractions in various solvents. The methanolic extract and its fractions in chloroform, ethyl acetate, n-butanol and water showed remarkable inhibitory activities against both urease and alpha-amylase, there was a close correspondence between urease and alpha-amylase inhibitory activities of the plant samples. The n-butanol fraction which had the highest total phenolic content (252.19 ± 2.32 µg of Gallic Acid Equivalents/mg of dry mass of the sample) showed prominent activity against both urease and alpha-amylase indicating a possible role of phenolics in inhibiting the activities of these enzymes. The samples displayed enzyme inhibitory activities in a dose dependent manner and their effectiveness was comparable with that of the standards, thiourea (for urease) and acarbose (for alpha-amylase). The samples were manifold more effective against urease than alpha-amylase; 2.8 mg/mL of MeOH extract produced about 81% inhibition in alpha-amylase activity, while only 10 µg/mL of the extract was required to create the same inhibition in urease activity. The IC50 values of methanolic, chloroform, ethyl acetate, n-butanolic, aqueous and standard solutions were 1.29, 1.31, 1.90, 1.38, 0.85 and 1.20 (mg/mL) respectively against alpha-amylase and 0.99, 3.89, 1.76, 0.91, 0.85 and 0.97 (μg/mL) respectively against urease. The total phenolic content in MeOH, hexane, chloroform, ethyl acetate, n-butanol and water fractions was 108.88 ± 2.65, 43.70 ± 1.90, 34.44 ± 2.30, 230.71 ± 1.78, 252.19 ± 2.32 and 94.07 ± 2.25 respectively.

  12. Crystal structure of a catalytic-site mutant alpha-amylase from Bacillus subtilis complexed with maltopentaose.


    Fujimoto, Z; Takase, K; Doui, N; Momma, M; Matsumoto, T; Mizuno, H


    The X-ray crystal structure of a catalytic-site mutant EQ208 [Glu208-->Gln] of alpha-amylase from Bacillus subtilis cocrystallized with maltopentaose (G5) and acarbose has been determined by multiple isomorphous replacement at 2.5 A resolution. Restrained crystallographic refinement has resulted in an R-factor of 19.8% in the 7.0 to 2.5 A resolution range. EQ208 consists of three domains containing a (beta/alpha)8-barrel as observed in other alpha-amylases. Clear connected density corresponding to a pentasaccharide was observed, which was considered as the G5 molecule based on the high affinity of EQ208 for G5 that could replace pre-bound acarbose or a possible transglycosylation product of acarbose. The conformation around the third alpha-(1,4)-glucosidic bond makes a sharp turn, allowing the substrate to fit into the L-shaped cleft. Aromatic residues build the walls of the substrate binding cleft and leucine residues form the inner curvature of the cleft. The amide nitrogen of Gln208 forms a hydrogen bond with the glucosidic oxygen in the scissile bond between Glc3 and Glc4 (Glc1 is the non-reducing end glucose residue of the substrate). This hydrogen-bonding manner may correspond to that of the protonated state of Glu208 in the initial kinetic complex between wild-type enzyme and substrate. The amide oxygen of Gln208 is anchored by two hydrogen bonds with Ala177 and a water molecule, assisting to make the amide proton point precisely to the place of the catalytic attack. The carboxyl oxygen atoms of the other catalytic-site residues Asp176 and Asp269 form hydrogen bonds with the oxygen atoms of Glc3. The carboxyl group of Asp176 has non-bonded contacts to the anomeric carbon atom and to the endocyclic oxygen atom of Glc3. These results suggest that Glu208 acts as a general acid and Asp176 as a general base. Glc3 forms seven hydrogen bonds with the surrounding protein groups and a stacking interaction with Tyr62, which is consistent with the fact that Glc3 has

  13. Effects of sorghum (Sorghum bicolor (L.) Moench) tannins on alpha-amylase activity and in vitro digestibility of starch in raw and processed flours

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The effect of condensed tannins (CT) on in vitro starch digestibility in cooked, wholegrain sorghum flours and on corn starch was investigated. CT extracts were also tested for their inhibitory effect on alpha-amylases. Rapidly digestible starch, slowly digestible starch, and resistant starch were n...

  14. Salivary Alpha Amylase and Cortisol Levels in Children with Global Developmental Delay and Their Relation with the Expectation of Dental Care and Behavior during the Intervention

    ERIC Educational Resources Information Center

    dos Santos, Marcio Jose Possari; Bernabe, Daniel Galera; Nakamune, Ana Claudia de Melo Stevanato; Perri, Silvia Helena Venturoli; de Aguiar, Sandra Maria Herondina Coelho Avila; de Oliveira, Sandra Helena Penha


    The purpose of this study was to analyze the alpha-amylase (sAA) and cortisol levels in children with Global developmental delay (GDD) before and after dental treatment and its association with the children's behavior during treatment. The morning salivary cortisol levels and activity of sAA of 33 children with GDD were evaluated before and after…

  15. General Subject 2. Report to ICUMSA on the determination of carry-over alpha-amylase activity in white and refined sugars by a spectrophotometric method

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A report is given on a new industrial method for the determination of carry-over alpha-amylase activity in raw and refined sugars, as well as a recommendation. In recent years, there has been increased concern over carry-over activity of mostly high temperature (HT) and very high temperature (VHT) s...

  16. Discovering an Accessible Enzyme: Salivary [alpha]-Amylase--"Prima Digestio Fit in Ore"--A Didactic Approach for High School Students

    ERIC Educational Resources Information Center

    Marini, Isabella


    Human salivary [alpha]-amylase is used in this experimental approach to introduce biology high school students to the concept of enzyme activity in a dynamic way. Through a series of five easy, rapid, and inexpensive laboratory experiments students learn what the activity of an enzyme consists of: first in a qualitative then in a semi-quantitative…

  17. Bioactive compounds from Carissa opaca roots and xanthine oxidase and alpha-amylase inhibitory activities of their methanolic extract and its fractions in different solvents

    PubMed Central

    Saeed, Ramsha; Ahmed, Dildar


    Background: Carissa opaca is known for its many ethnomedicinal uses. There was a need to study its bioactivities and identify its phytochemicals. Objective: The objective was to isolate and identify phytochemicals from roots of C. opaca and to evaluate xanthine oxidase (XO) and alpha-amylase inhibitory activities of their methanolic extract and its fractions. Materials and Methods: Methanolic extract of finely divided powder of roots of C. opaca was obtained by cold maceration, followed by its fractionation to obtain hexane, chloroform, ethyl acetate, n-butanolic, and aqueous fractions. Phytochemicals screening was done by standard protocols. XO and alpha-amylase inhibitory activities of the methanolic extract and its fractions were studied. The most active ethyl acetate fraction was subjected to the column and thin layer chromatography to isolate its compounds, which were identified by gas chromatography-mass spectrometry and high-performance liquid chromatography comparison. Results: Methanolic extract displayed significant activity against both the enzymes with IC50 of 156.0 mg/mL and 5.6 mg/mL for XO and alpha-amylase, respectively. Ethyl acetate fraction showed highest activity against both the enzymes with IC50 of 129 mg/mL and 4.9 mg/mL for XO and alpha-amylase, respectively. Chloroform fraction had IC50 of 154.2 mg/mL and 5.5 mg/mL for XO and alpha-amylase, respectively. Aqueous fraction exhibited significant efficacy against alpha-amylase (IC50 5.0 mg/mL). Hexane fraction showed good activity against alpha-amylase in a dose-dependent manner but exhibited opposite trend against XO. The compounds isolated from ethyl acetate fraction included limonene, vanillin, lupeol, rutin, quercetin, b-sitosterol, Vitamin E, 2-hydroxyacetophenone, naphthalenone, 2,3,3-trimethyl-2-(3-methylbuta-1,3-dienyl)-6-methylenecyclohexanone, and 2-benzenedicarboxylic acid, mono(2-ethylhexyl) ester. Conclusions: Moderately polar phytochemicals of C. opaca roots possess exploitable

  18. Purification and characterization of novel raw-starch-digesting and cold-adapted alpha-amylases from Eisenia foetida.


    Ueda, Mitsuhiro; Asano, Tomohiko; Nakazawa, Masami; Miyatake, Kazutaka; Inouye, Kuniyo


    Novel raw-starch-digesting and cold-adapted alpha-amylases (Amy I and Amy II) from the earthworm Eisenia foetida were purified to electrophoretically homogeneous states. The molecular weights of both purified enzymes were estimated to be 60,000 by SDS-PAGE. The enzymes were most active at pH 5.5 and 50 degrees C and stable at pH 7.0-9.0 and 50-60 degrees C. Both Amy I and II exhibited activities at 10 degrees C. The enzymes were inhibited by metal ions Cu(2+), Fe(2+), and Hg(2+), and hydrolyzed raw starch into glucose, maltose and maltotriose as end products.

  19. Major water-soluble polyphenols, proanthocyanidins, in leaves of persimmon (Diospyros kaki) and their alpha-amylase inhibitory activity.


    Kawakami, Kayoko; Aketa, Saiko; Nakanami, Mitsuhiro; Iizuka, Shinzo; Hirayama, Masao


    The amounts and compositions of polyphenol in persimmon leaves and persimmon leaf tea were investigated. The predominant polyphenols in fresh leaves were water-soluble, and the contents reached a maximum (2.40% w/w) in June, and then gradually decreased. Separation of them followed by thiolytic degradation revealed that the major components were unique proanthocyanidin oligomers consisting of four heterogeneous extension units, including epigallocatechin-3-O-gallate. Persimmon leaf tea also contained similar proanthocyanidins with similar compositional units. Oral administration of starch with polyphenol concentrate of persimmon leaf tea resulted in a significant and dose-dependent decrease in the blood glucose level in Wistar rats. This effect is considered to be due to inhibition of pancreas alpha-amylase. These results indicate that persimmon leaf tea containing peculiar proanthocyanidins has a significant role in suppressing blood glucose elevation after starch intake, and that the best harvest time is June.

  20. Alpha-amylase production by Streptomyces erumpens MTCC 7317 in solid state fermentation using response surface methodology (RSM).


    Kar, Shaktimay; Ray, Ramesh C; Mohapatra, Uma B


    Production of alpha-amylase under solid state fermentation by Streptomyces erumpens MTCC 7317 has been investigated using different agro-industrial residues, i.e. cassava bagasse, sugarcane bagasse and wheat bran; wheat bran was found to be the best substrate. Among different nitrogen source supplemented to wheat bran, beef extract or peptone (1%) showed maximum enzyme production. Response surface methodology was used to evaluate the effect of main process parameters as incubation period (48 h), moisture holding capacity (70%), pH (7.0) and temperature (50 degrees C) on enzyme production by applying a full factorial central composite design. The maximum hydrolysis of soluble starch (90%) and cassava starch (75%) was obtained with the application of 4 ml (approximately 12096 U) of S. erumpens crude enzyme after 5 h of incubation.

  1. Alpha-Amylase Starch Binding Domains: Cooperative Effects of Binding to Starch Granules of Multiple Tandemly Arranged Domains▿

    PubMed Central

    Guillén, D.; Santiago, M.; Linares, L.; Pérez, R.; Morlon, J.; Ruiz, B.; Sánchez, S.; Rodríguez-Sanoja, R.


    The Lactobacillus amylovorus alpha-amylase starch binding domain (SBD) is a functional domain responsible for binding to insoluble starch. Structurally, this domain is dissimilar from other reported SBDs because it is composed of five identical tandem modules of 91 amino acids each. To understand adsorption phenomena specific to this SBD, the importance of their modular arrangement in relationship to binding ability was investigated. Peptides corresponding to one, two, three, four, or five modules were expressed as His-tagged proteins. Protein binding assays showed an increased capacity of adsorption as a function of the number of modules, suggesting that each unit of the SBD may act in an additive or synergic way to optimize binding to raw starch. PMID:17468268

  2. Effect of gelatinization and hydrolysis conditions on the selectivity of starch hydrolysis with alpha-amylase from Bacillus licheniformis.


    Baks, Tim; Bruins, Marieke E; Matser, Ariette M; Janssen, Anja E M; Boom, Remko M


    Enzymatic hydrolysis of starch can be used to obtain various valuable hydrolyzates with different compositions. The effects of starch pretreatment, enzyme addition point, and hydrolysis conditions on the hydrolyzate composition and reaction rate during wheat starch hydrolysis with alpha-amylase from Bacillus licheniformis were compared. Suspensions of native starch or starch gelatinized at different conditions either with or without enzyme were hydrolyzed. During hydrolysis, the oligosaccharide concentration, the dextrose equivalent, and the enzyme activity were determined. We found that the hydrolyzate composition was affected by the type of starch pretreatment and the enzyme addition point but that it was just minimally affected by the pressure applied during hydrolysis, as long as gelatinization was complete. The differences between hydrolysis of thermally gelatinized, high-pressure gelatinized, and native starch were explained by considering the granule structure and the specific surface area of the granules. These results show that the hydrolyzate composition can be influenced by choosing different process sequences and conditions.

  3. Self-compassion training modulates alpha-amylase, heart rate variability, and subjective responses to social evaluative threat in women

    PubMed Central

    Arch, Joanna J.; Brown, Kirk Warren; Dean, Derek J.; Landy, Lauren N.; Brown, Kimberley; Laudenslager, Mark L.


    A growing body of research has revealed that social evaluative stressors trigger biological and psychological responses that in chronic forms have been linked to aging and disease. Recent research suggests that self-compassion may protect the self from typical defensive responses to evaluation. We investigated whether brief training in self-compassion moderated biopsychological responses to the Trier Social Stress Test (TSST) in women. Compared to attention (placebo) and no-training control conditions, brief self-compassion training diminished sympathetic (salivary alpha-amylase), cardiac parasympathetic, and subjective anxiety responses, though not HPA-axis (salivary cortisol) responses to the TSST. Self-compassion training also led to greater self-compassion under threat relative to the control groups. In that social stress pervades modern life, self-compassion represents a promising approach to diminishing its potentially negative psychological and biological effects. PMID:24636501

  4. Alpha-amylase starch binding domains: cooperative effects of binding to starch granules of multiple tandemly arranged domains.


    Guillén, D; Santiago, M; Linares, L; Pérez, R; Morlon, J; Ruiz, B; Sánchez, S; Rodríguez-Sanoja, R


    The Lactobacillus amylovorus alpha-amylase starch binding domain (SBD) is a functional domain responsible for binding to insoluble starch. Structurally, this domain is dissimilar from other reported SBDs because it is composed of five identical tandem modules of 91 amino acids each. To understand adsorption phenomena specific to this SBD, the importance of their modular arrangement in relationship to binding ability was investigated. Peptides corresponding to one, two, three, four, or five modules were expressed as His-tagged proteins. Protein binding assays showed an increased capacity of adsorption as a function of the number of modules, suggesting that each unit of the SBD may act in an additive or synergic way to optimize binding to raw starch.

  5. Effects of early life adversity on cortisol/salivary alpha-amylase symmetry in free-ranging juvenile rhesus macaques.


    Petrullo, Lauren A; Mandalaywala, Tara M; Parker, Karen J; Maestripieri, Dario; Higham, James P


    Early life adversity (ELA) affects physiological and behavioral development. One key component is the relationship between the developing Hypothalamic-Pituitary-Adrenal (HPA) axis and the Sympathetic Nervous System (SNS). Recent studies suggest a relationship between early life adversity and asymmetry in cortisol (a measure of HPA activation) and salivary alpha-amylase (sAA: a correlate of SNS activation) responses to stress among human children, but to our knowledge there have been no comparable studies in nonhumans. Here, we investigate the responses of these two analytes in "low stress" and "high stress" situations in free-ranging juvenile rhesus macaques (Macaca mulatta) on Cayo Santiago, Puerto Rico. Behavioral data on maternal maltreatment were collected during the first 3months of life to determine individual rates of ELA, and saliva samples were collected from subjects noninvasively during juvenility. Irrespective of ELA, salivary alpha-amylase levels were lower in low stress situations and higher in high stress situations. For cortisol however, high ELA subjects exhibited higher low stress concentrations and blunted acute responses during high stress situations compared to moderate and low ELA subjects. Cortisol and sAA values were positively correlated among low ELA subjects, suggesting symmetry, but were uncorrelated or negatively correlated among moderate and high ELA subjects, suggesting asymmetry in these individuals. These findings indicate dysregulation of the stress response among juveniles maltreated during infancy: specifically, attenuated cortisol reactivity coupled with typical sAA reactivity characterize the stress response profiles of juveniles exposed to higher rates of ELA during the first 3months of life.

  6. [Study on immobilized cells for producing alpha-amylase by using polyving alcohol as the carrier(II): The effect of fermentating conditions on the ability producing alpha-amylase of the cells immobilized with polyving alcohol as the corrier and continuous fermentation of the immobilized cells in CSTR].


    Liu, Z; Wang, J; Li, Z


    The effects of fermentating conditions on the ability of immobilized cells with PVA as carrier for producing alpha-amylase were studied. The continuous fermentation with the immobilized cells were tested in continuous flow stirred tank reactor (CSTR). The results showed that the adaptability of the immobilized Bacillus substilis to pH increased after immobilization. In CSTR, the immobilized cells can be fermentated continuously for 360 hrs and the activity of alpha-amylase can be kept on the level of about 170 u/ml.

  7. AmyA, an alpha-amylase with beta-cyclodextrin-forming activity, and AmyB from the thermoalkaliphilic organism Anaerobranca gottschalkii: two alpha-amylases adapted to their different cellular localizations.


    Ballschmiter, Meike; Armbrecht, Martin; Ivanova, Krasimira; Antranikian, Garabed; Liebl, Wolfgang


    Two alpha-amylase genes from the thermophilic alkaliphile Anaerobranca gottschalkii were cloned, and the corresponding enzymes, AmyA and AmyB, were investigated after purification of the recombinant proteins. Based on their amino acid sequences, AmyA is proposed to be a lipoprotein with extracellular localization and thus is exposed to the alkaline milieu, while AmyB apparently represents a cytoplasmic enzyme. The amino acid sequences of both enzymes bear high similarity to those of GHF13 proteins. The different cellular localizations of AmyA and AmyB are reflected in their physicochemical properties. The alkaline pH optimum (pH 8), as well as the broad pH range, of AmyA activity (more than 50% activity between pH 6 and pH 9.5) mirrors the conditions that are encountered by an extracellular enzyme exposed to the medium of A. gottschalkii, which grows between pH 6 and pH 10.5. AmyB, on the other hand, has a narrow pH range with a slightly acidic pH optimum at 6 to 6.5, which is presumably close to the pH in the cytoplasm. Also, the intracellular AmyB is less tolerant of high temperatures than the extracellular AmyA. While AmyA has a half-life of 48 h at 70 degrees C, AmyB has a half-life of only about 10 min at that temperature, perhaps due to the lack of stabilizing constituents of the cytoplasm. AmyA and AmyB were very similar with respect to their substrate specificity profiles, clearly preferring amylose over amylopectin, pullulan, and glycogen. Both enzymes also hydrolyzed alpha-, beta-, and gamma-cyclodextrin. Very interestingly, AmyA, but not AmyB, displayed high transglycosylation activity on maltooligosaccharides and also had significant beta-cyclodextrin glycosyltransferase (CGTase) activity. CGTase activity has not been reported for typical alpha-amylases before. The mechanism of cyclodextrin formation by AmyA is unknown.

  8. Efficient synthesis and secretion of a thermophilic alpha-amylase by protein-producing Bacillus brevis 47 carrying the Bacillus stearothermophilus amylase gene.

    PubMed Central

    Tsukagoshi, N; Iritani, S; Sasaki, T; Takemura, T; Ihara, H; Idota, Y; Yamagata, H; Udaka, S


    Bacillus subtilis and Bacillus brevis 47-5, carrying the Bacillus stearothermophilus alpha-amylase gene on pUB110 (pBAM101), synthesized the same alpha-amylase as the donor strain as determined by the enzyme's thermal stability and NH2-terminal amino acid sequence. Regardless of the host, the 34-amino acid signal peptide of the enzyme was processed at exactly the same site between two alanine residues. B. brevis 47-5(pBAM101) secreted the enzyme most efficiently of the hosts examined, 100, 15, and 5 times more than B. stearothermophilus, Escherichia coli HB101(pH1301), and B. subtilis 1A289(pBAM101), respectively. The efficient secretion of the enzyme in B. brevis 47-5(pBAM101) was suggested to be due to the unique properties of the cell wall of this organism. Images PMID:2999073

  9. Enzymatic degradation products from a marine polysaccharide YCP with different immunological activity and binding affinity to macrophages, hydrolyzed by alpha-amylases from different origins.


    Ren, Min; Yan, Wei; Yao, Wenbing; Jin, Lei; Gao, Xiangdong


    YCP is a marine polysaccharide with anti-tumor and immune-modulating effects. This study evaluated the effect of enzymatic degradation of YCP by alpha-amylases from different origins on its immunological activity and binding ability to the macrophages. YCP was hydrolyzed by alpha-amylases isolated from Aspergillus oryzae, Bacillus licheniformis, Barley malt, and Porcine pancreas respectively, then four fragments with unique molecular weight (termed: YCP-Ao, YCP-Bl, YCP-Bm, and YCP-Pp, respectively) were obtained. The four fragments showed different immunological activity and the ability to bind to macrophages. Among them, YCP-Ao possessed almost equivalent immunological activity compared to the original YCP, while such properties were not retained in YCP-Bl. Our further study showed that YCP-Ao prevented YCP from binding to macrophages. In conclusion, YCP-Ao and YCP might have similar active regions.

  10. Calcium binding in. alpha. -amylases: An X-ray diffraction study at 2. 1- angstrom resolution of two enzymes from Aspergillus

    SciTech Connect

    Boel, E.; Jensen, V.J.; Petersen, S.B.; Thim, L. Woldike, H.F. ); Brady, L.; Brzozowski, AM.; Derewenda, Z.; Dodson, G.G.; Swift, H. )


    X-ray diffraction analysis (at 2.1-{angstrom} resolution) of an acid alpha-amylase from Aspergillus niger allowed a detailed description of the stereochemistry of the calcium-binding sites. The primary site (which is essential in maintaining proper folding around the active site) contains a tightly bound Ca{sup 2+} with an unusually high number of eight ligands. A secondary binding site was identified at the bottom of the substrate binding cleft; it involves the residues presumed to play a catalytic role (Asp206 and Glu230). This explains the inhibitory effect of calcium observed at higher concentrations. Neutral Aspergillus oryzae (TAKA) {alpha}-amylase was also refined in a new crystal at 2.1-{angstrom} resolution. The structure of this homologous (over 80%) enzyme and addition kinetic studies support all the structural conclusions regarding both calcium-binding sites.

  11. Conversion of starch to ethanol in a recombinant saccharomyces cerevisiae strain expressing rice [alpha]-amylase from a novel Pichia pastoris alcohol oxidase promoter

    SciTech Connect

    Kumagai, M.H.; Sverlow, G.G.; della-Cioppa, G.; Grill, L.K. )


    A recombinant Saccharomyces cerevisiae, expressing and secreting rice [alpha]-amylase, converts starch to ethanol. The rice [alpha]-amylase gene (OS103) was placed under the transcriptional control of the promoter from a newly described Pichia pastoris alcohol oxidase genomic clone. The nucleotide sequences of ZZA1 and other methanol-regulated promoters were analyzed. A highly conserved sequence (TTG-N[sub 3]-GCTTCCAA-N[sub 5]-TGGT) was found in the 5' flanking regions of alcohol oxidase, methanol oxidase, and dihydroxyacetone synthase genes in Pichia pastoris, Hansenula polymorpha, and Candida biodinii S2. The yeast strain containing the ZZA1-OS103 fusion secreted biologically active enzyme into the culture media while fermenting soluble starch. 45 refs., 8 figs.

  12. A quantitative assessment of the importance of barley seed alpha-amylase, beta-amylase, debranching enzyme, and alpha-glucosidase in starch degradation.


    Sun, Z T; Henson, C A


    Extracts of germinated barley (Hordeum vulgare L.) seeds of 41 different genotypes were analyzed for their activities of alpha-amylase, beta-amylase, alpha-glucosidase, and debranching enzyme and for their abilities to hydrolyze boiled soluble starch, nonboiled soluble starch, and starch granules extracted from barley seeds with water. Linear correlation analysis, used to quantitate the interactions between the seven parameters, revealed that boiled soluble starch was not a good substrate for predicting activities of enzymes functioning in in vivo starch hydrolysis as the extracts' abilities to hydrolyze boiled soluble starch was not correlated with their abilities to hydrolyze native starch granules. Activities of alpha-amylase and alpha-glucosidase were positively and significantly correlated with the seed extracts' abilities to hydrolyze all three starches. beta-Amylase was only significantly correlated with hydrolysis of boiled soluble starch. No significant correlations existed between debranching enzyme activity and hydrolysis of any of the three starches. Interactions between the four enzymes as they functioned together to hydrolyze the three types of starch were evaluated by path coefficient analysis. alpha-Amylase contributed to hydrolyses of all three starches primarily by its direct effect (noninteractive component). This direct contribution increased as the substrate progressed from the completely artificial boiled soluble starch, to the most physiologically significant substrate, native starch granules. alpha-Glucosidase contributed to the hydrolysis of boiled soluble starch primarily by its direct effect (noninteractive) yet contributed to starch granule hydrolysis primarily via its interaction with alpha-amylase (indirect effect). The contribution of beta-amylase to hydrolysis of boiled soluble starch was direct and it did not contribute significantly to hydrolysis of native starch granules.

  13. One-step enzymatic hydrolysis of starch using a recombinant strain of Saccharomyces cerevisiae producing alpha-amylase, glucoamylase and pullulanase.


    Janse, B J; Pretorius, I S


    A recombinant strain of Saccharomyces cerevisiae was constructed that contained the genes encoding a bacterial alpha-amylase (AMY1), a yeast glucoamylase (STA2) and a bacterial pullulanase (pulA). The Bacillus amyloliquefaciens alpha-amylase and S. cerevisiae var. diastaticus glucoamylase genes were expressed in S. cerevisiae using their native promoters and the encoded enzymes secreted under direction of their native leader sequences. In contrast, the Klebsiella pneumoniae pullulanase gene was placed under the control of the yeast alcohol dehydrogenase gene promoter (ADC1P) and secreted using the yeast mating pheromone alpha-factor secretion signal (MF alpha 1S). Transcription termination of the pullulanase gene was effected by the yeast tryptophan synthase gene terminator (TRP5T), whereas termination of the glucoamylase and alpha-amylase genes was directed by their native terminators. Pullulanase (PUL1) produced by recombinant yeasts containing ADC1P MF alpha 1S pulA TRP5T (designated PUL1) was further characterized and compared to its bacterial counterpart (PulA). The different genes were introduced into S. cerevisiae in different combinations and the various amylolytic Saccharomyces transformants compared to Schwanniomyces occidentalis. Introduction of PUL1 into a S. cerevisiae strain containing both STA2 and AMY1, resulted in 99% assimilation of starch.

  14. Purification and characterization of two alkaline, thermotolerant alpha-amylases from Bacillus halodurans 38C-2-1 and expression of the cloned gene in Escherichia coli.


    Murakami, Shuichiro; Nishimoto, Haruka; Toyama, Yosuke; Shimamoto, Etsuko; Takenaka, Shinji; Kaulpiboon, Jarunee; Prousoontorn, Manchumas; Limpaseni, Tipaporn; Pongsawasdi, Piamsook; Aoki, Kenji


    A newly isolated strain, 38C-2-1, produced alkaline and thermotolerant alpha-amylases and was identified as Bacillus halodurans. The enzymes were purified to homogeneity and named alpha-amylase I and II. These showed molecular masses of 105 and 75 kDa respectively and showed maximal activities at 50-60 degrees C and pH 10-11, and 42 and 38% relative activities at 30 degrees C. These results indicate that the enzymes are thermotolerant. The enzyme activity was not inhibited by a surfactant or a bleaching reagent used in detergents. A gene encoding alpha-amylase I was cloned and named amyI. Production of AmyI with a signal peptide repressed the growth of an Escherichia coli transformant. When enzyme production was induced by the addition of isopropyl beta-D(-)-thiogalactopyranoside in the late exponential growth phase, the highest enzyme yield was observed. It was 45-fold that of the parent strain 38C-2-1.

  15. Significant differences in the activities of alpha-amylases in the absence and presence of polyethylene glycol assayed on eight starches solubilized by two methods.


    Mukerjea, Rupendra; Slocum, Giles; Mukerjea, Romila; Robyt, John F


    Starch is a reserve chemical source of the energy of the sun found in plants as a water-insoluble granule that differs in their chemical and physical properties, depending on the source. The granules can be solubilized by heating in water or by treatment with various reagents, such as 1M NaOH. alpha-Amylases are widely distributed enzymes that initiate the hydrolysis of starch into low molecular weight maltodextrins. We recently found that the activities of a single alpha-amylase on two different starches were significantly different. We then determined the activities of Bacillus amyloliquefaciens and porcine pancreas alpha-amylases, using eight different starches, solubilized by two methods: autoclaving at 121 degrees C and 1M NaOH at 20 degrees C. There were significant differences in the activities of both of the amylases on all eight of the starches. Previously, it had been found that polyethylene glycol (PEG) stabilized and activated the activities of both enzymes, using a soluble amylose as the substrate. Addition of PEG to the enzymes greatly increased the activities on the eight starches, but the activities still differed significantly. The different activities with the starches were hypothesized as differences in the amounts of secondary and tertiary structures that are partially retained when the different starches are solubilized; the activities on addition of PEG is hypothesized as the formation of highly active species from a series of less active forms.

  16. Improvement of cloned [alpha]-amylase gene expression in fed-batch culture of recombinant Saccharomyces cerevisiae by regulating both glucose and ethanol concentrations using a fuzzy controller

    SciTech Connect

    Shiba, Sumihisa; Nishida, Yoshio; Park, Y.S.; Iijima, Shinji; Kobayashi, Takeshi . Dept. of Biotechnology)


    The effect of ethanol concentration on cloned gene expression in recombinant Saccharomyces cerevisiae strain 20B-12 containing one of two plasmids, pNA3 and pNA7, was investigated in batch cultures. Plasmids pNA3 and pNA7 contain the [alpha]-amylase gene under the control of the SUC2 or PGK promoter, respectively. When the ethanol concentration was controlled at 2 to 5 g/L, the gene expressions were two times higher than those at 20 g/L ethanol. To increase the gene expression by maintaining both the ethanol and glucose concentrations at low levels, a fuzzy controller was developed. The concentrations of glucose and ethanol were controlled simultaneously at 0.15 and 2 g/L, respectively, in the production phase using the fuzzy controller in fed-batch culture. The synthesis of [alpha]-amylase was induced by the low glucose concentration and maintained at a high level of activity by regulating the ethanol concentration at 2 g/L. The secretory [alpha]-amylase activities of cells harboring plasmids pNA3 and pNA7 in fed-batch culture were 175 and 392 U/mL, and their maximal specific activities 7.7 and 12.4 U/mg dry cells, respectively. These values are two to three times higher in activity and three to four times higher in specific activity than those obtained when glucose only was controlled.

  17. A fluid response: Alpha-amylase reactions to acute laboratory stress are related to sample timing and saliva flow rate.


    Nagy, Tamás; van Lien, René; Willemsen, Gonneke; Proctor, Gordon; Efting, Marieke; Fülöp, Márta; Bárdos, György; Veerman, Enno C I; Bosch, Jos A


    Salivary alpha-amylase (sAA) is used as a sympathetic (SNS) stress marker, though its release is likely co-determined by SNS and parasympathetic (PNS) activation. The SNS and PNS show asynchronous changes during acute stressors, and sAA responses may thus vary with sample timing. Thirty-four participants underwent an eight-minute memory task (MT) and cold pressor task (CPT). Cardiovascular SNS (pre-ejection period, blood pressure) and PNS (heart rate variability) activity were monitored continuously. Unstimulated saliva was collected repeatedly during and after each laboratory stressor, and sAA concentration (U/ml) and secretion (U/minute) determined. Both stressors increased anxiety. The MT caused an immediate and continued cardiac SNS activation, but sAA concentration increased at task cessation only (+54%); i.e., when there was SNS-PNS co-activation. During the MT sAA secretion even decreased (-35%) in conjunction with flow rate and vagal tone. The CPT robustly increased blood pressure but not sAA. In summary, sAA fluctuations did not parallel changes in cardiac SNS activity or anxiety. sAA responses seem contingent on sample timing and flow rate, likely involving both SNS and PNS influences. Verification using other stressors and contexts seems warranted.

  18. The psychosocial stress-induced increase in salivary alpha-amylase is independent of saliva flow rate.


    Rohleder, Nicolas; Wolf, Jutta M; Maldonado, Enrique F; Kirschbaum, Clemens


    The stress response of salivary alpha-amylase (sAA) has been suggested as an index for sympathetic nervous system activation. However, concurrent inhibition of the parasympathetic nervous system is discussed as a confounder due to suppression of saliva flow rate. Here we set out to test the influence of stress-induced changes in flow rate on sAA secretion. Twenty-six subjects underwent the Trier Social Stress Test and a control condition. Saliva was sampled by passive drooling or salivettes. Saliva flow rate, sAA levels and output, salivary cortisol, and heart rate variability were measured. Flow rate increased only when sampled by passive drooling. Stress-induced increases in amylase levels were correlated with increases of amylase output but not with flow rate. Results indicate that flow rate is not a confounder of stress-induced sAA activation and suggest that valid measurements of sAA can be obtained by salivettes without the need for assessment of flow rate.

  19. Evaluation of column flotation in the downstream processing of fermentation products: recovery of a genetically engineered alpha-amylase.


    Miranda, E A; Berglund, K A


    Flotation is a simple, inexpensive, and versatile unit operation with a largely unexplored potential in biotechnology. There is a general lack of research concerning biotechnological applications in this area, especially in the recovery of fermentation products. Moreover, the few reports in the literature do not consider the modern concept of column flotation as practiced in the mineral industry. We report herein the application of column flotation for the recovery of a Bacillus stearothermophilus alpha-amylase expressed in Escherichia coli by the use of a food-grade polymer, (hydroxypropyl)methylcellulose (HPMC), and ammonium sulfate. First, the enzyme was removed from the liquid phase by partition to a salted-out HPMC phase. The enzyme-containing polymer flocs were then floated from the liquid. Recovery of active enzyme was as high as 90%, with throughput as high as 94 m3/(h.m2). The floatability of the enzyme from a periplasmic extract was higher than extracellular enzyme in the broth due to the presence of depressors of molecular weight lower than 10,000 in the broth.

  20. Aging diurnal rhythms and chronic stress: Distinct alteration of diurnal rhythmicity of salivary alpha-amylase and cortisol.


    Strahler, Jana; Berndt, Christiane; Kirschbaum, Clemens; Rohleder, Nicolas


    The present study assessed diurnal profiles of salivary alpha-amylase (sAA), proposed as a marker of autonomic activity, and salivary cortisol in competitive ballroom dancers as well as age- and sex-matched controls to investigate age-related changes of basal activity and potential chronic psychosocial stress-related alterations. According to the Allostatic Load (AL) hypothesis of a cumulative wear and tear of the body we expected to see physiological accumulation of the effects of stress and age especially pronounced in older dancers. Dancers and controls collected five saliva samples throughout the day. Daily overall output of sAA was elevated in older adults while there was no effect of age on mean cortisol levels. Alterations of diurnal rhythms were only seen in younger male dancers showing a flattened diurnal profile of sAA and younger dancers and female older dancers showing a blunted diurnal rhythmicity of cortisol. Furthermore, we found a negative correlation between summary indices of basal sAA and the amount of physical activity. In conclusion, higher overall output of sAA in older adults is in line with the phenomenon of a sympathetic "drive" with increasing age. Furthermore, a lower output of sAA in people who are more physical active is in line with the hypothesis of an exercise-induced decrease of sympathetic activity. Overall, our study does not support the AL hypothesis, but rather highlights the importance of regular physical activity and social environment in promoting health.

  1. A dispersion model for predicting the extent of starch liquefaction by Bacillus licheniformis alpha-amylase during reactive extrusion.


    Komolprasert, V; Ofoli, R Y


    A Baker-Perkins corotating twin screw extruder was used as a bioreactor to hydrolyze pregelantinized corn starch by themophilic Bacillus licheniformis alpha-amylase. The extruder was modeled as a tube, and characterized as a closed system. This characterization is not in the thermodynamic sense; rather, it relates to the profile of a tracer fluid upon entry to and exit from the reaction zone. The reaction kinetics were modeled by a modified first-order equation, which allowed the dispersion equation to be solved analytically with the Danckwerts boundary condition. Data from several extrusion runs were super-imposed to obtain a profile to evaluate the model. The dispersion number, determined from the first and second moments of the RTD curve, was primarily a function of the length of the reaction zone. There was good agreement between predictions and experimental data, especially at low dispersion numbers. In general, the axial dispersion model appears to be suitable for analysis of enzymatic reactions of up to 30% conversion. At a fixed flow rate and constant temperature, the extent of starch conversion depends significantly on moisture content, residence time and enzyme dosage, but not on screw speed.

  2. Porcine pancreatic alpha-amylase hydrolysis of native starch granules as a function of granule surface area.


    Kong, Byoung-Wook; Kim, Jung-In; Kim, Myo-Jeong; Kim, Jae Cherl


    Porcine pancreatic alpha-amylase activity on native starch granules is more accurately described as a function of surface area of the granules rather than of substrate concentration. The apparent K(m) of alpha-amylolysis of native starch from potato, maize, and rice expressed as a function of substrate concentration was largest for potato with a single value of V(max). However, the ratio of the slope of a Lineweaver-Burk plot to that of rice for enzymatic hydrolysis of native potato and maize starch were 7.78 and 2.58, respectively, which were very close to the ratio of surface area per mass of the two starch granules to that of rice. Therefore, the reciprocal of initial velocity was a linear function of the reciprocal of surface area for each starch granule. Surface area was calculated assuming the starch granules were spherical. The values obtained by this calculation were in good agreement with the value obtained by the photomicrographic method. By comparing enzymatic digestion of native maize granules to that of rice granules, it was concluded that the presence of pores in maize granules appeared to significantly affect overall rate of digestion after sufficient reaction time, but not at the very initial stage of hydrolysis.

  3. Role of disulfide bridges in the activity and stability of a cold-active alpha-amylase.


    Siddiqui, Khawar Sohail; Poljak, Anne; Guilhaus, Michael; Feller, Georges; D'Amico, Salvino; Gerday, Charles; Cavicchioli, Ricardo


    The cold-adapted alpha-amylase from Pseudoalteromonas haloplanktis unfolds reversibly and cooperatively according to a two-state mechanism at 30 degrees C and unfolds reversibly and sequentially with two transitions at temperatures below 12 degrees C. To examine the role of the four disulfide bridges in activity and conformational stability of the enzyme, the eight cysteine residues were reduced with beta-mercaptoethanol or chemically modified using iodoacetamide or iodoacetic acid. Matrix-assisted laser desorption-time of flight mass spectrometry analysis confirmed that all of the cysteines were modified. The iodoacetamide-modified enzyme reversibly folded/unfolded and retained approximately one-third of its activity. Removal of all disulfide bonds resulted in stabilization of the least stable region of the enzyme (including the active site), with a concomitant decrease in activity (increase in activation enthalpy). Disulfide bond removal had a greater impact on enzyme activity than on stability (particularly the active-site region). The functional role of the disulfide bridges appears to be to prevent the active site from developing ionic interactions. Overall, the study demonstrated that none of the four disulfide bonds are important in stabilizing the native structure of enzyme, and instead, they appear to promote a localized destabilization to preserve activity.

  4. Fermentation of starch by Klebsiella oxytoca P2, containing plasmids with {alpha}-amylase and pullulanase genes

    SciTech Connect

    Santos, V.L. dos; Araujo, E.F.; Barros, E.G. de; Guimaraes, W.V.


    Klebsiella oxytoca P2(pC46), an ethanol-producing recombinant, has been evaluated in fermentation of maltose and starch. The maximum ethanol produced by P2(pC46) was 0.34 g ethanol/g maltose and 0.38, 0.40, or 0.36 g ethanol/g starch in fermentation of 1, 2, or 4% starch, representing 68, 71, and 64% the theoretical yield. The pC46 plasmid transformed to cells of K. oxytoca P2 reduced the ethanol production from maltose and starch. In fermentation of starch after its digestion at 60 C for 24 h, in two-step fermentation, the time for maximum ethanol production was reduced to 12--24 h and the theoretical yield was around 90%. The increase in starch concentration resulted in lower {alpha}-amylase activity but in higher pullulanase activity. The high activity and thermostability of the amylolytic enzymes from this transformant suggest that it has a potential for amylolytic enzymes source.

  5. Effects of Cardiorespiratory Fitness and Obesity on Salivary Secretory IgA and Alpha-Amylase in South African Children

    PubMed Central

    Starzak, Dorota E.; Konkol, Kristen F.; McKune, Andrew J.


    This study examined whether cardiorespiratory fitness (CRF) and body composition are associated with salivary secretory immunoglobulin A (SIgA), a mucosal immunity marker, and salivary alpha-amylase (sAA), a marker of stress-related sympathetic nervous system (SNS) activity, in South African children. Morning (7:30–8:00 a.m.) saliva samples were collected from 132 children (10.05 ± 1.68 years old, 74 females, 58 males). Body composition, resting blood pressure, and predicted maximal aerobic capacity (VO2max) were determined, and SIgA and sAA were quantified. Obese children had significantly higher sAA compared with overweight and normal weight children (p < 0.01). SIgA secretion rate was significantly lower in obese and overweight vs. normal weight children (p < 0.01). Multiple-linear regression analysis revealed that body mass index (BMI) (p < 0.05) and diastolic blood pressure (DBP) (p < 0.05) were independent predictors of sAA with CRF acting as a mitigator. Age and BMI predicted SIgA secretion rate (p < 0.05) with BMI (p < 0.001) found to be an independent predictor of SIgA secretion rate. Obesity, based on BMI, was associated with elevated SNS activity and lowered mucosal immunity. CRF-mitigated sympathetic activation was not associated with mucosal immunity. PMID:27483329

  6. New action pattern of a maltose-forming alpha-amylase from Streptomyces sp. and its possible application in bakery.


    Ammar, Youssef Ben; Matsubara, Takayoshi; Ito, Kazuo; Iizuka, Masaru; Limpaseni, Tipaporn; Pongsawasdi, Piamsook; Minamiura, Noshi


    An a-Amylase (EC was purified that catalyses the production of a high level of maltose from starch without the attendant production of glucose. The enzyme was produced extracellularly by thermophilic Streptomyces sp. that was isolated from Thailand's soil. Purification was achieved by alcohol precipitation, DEAE-Cellulose, and Gel filtration chromatographies. The purified enzyme exhibited maximum activity at pH 6-7 and 60 degrees C. It had a relative molecular mass of 45 kDa, as determined by SDS-PAGE. The hydrolysis products from starch had alpha-anomeric forms, as determined by 1H-NMR. This maltose-forming alpha-Amylase completely hydrolyzed the soluble starch to produce a high level of maltose, representing up to 90%. It hydrolyzed maltotetrose and maltotriose to primarily produce maltose (82% and 62% respectively) without the attendant production of glucose. The high maltose level as a final end-product from starch and maltooligosaccharides, and the unique action pattern of this enzyme, indicate an unusual maltose-forming system. After the addition of the enzyme in the bread-baking process, the bread's volume increased and kept its softness longer than when the bread had no enzyme.

  7. Structure-activity relationship of benzoxazinones and related compounds with respect to the growth inhibition and alpha-amylase activity in cress seedlings.


    Kato-Noguchi, Hisashi; Macías, Francisco A; Molinillo, José M G


    Benzoxazinones and their degradation compounds inhibited root growth and alpha-amylase activity in cress seedlings. The inhibitory activity of these compounds was divided into three groups: the high active group; 2,4-dihydroxy-7-methoxy-(2H)-1,4-benzoxazin-3(4H)-one, 2,4-dihydroxy-(2H)-1,4-benzoxazin-3(4H)-one, 4-hydroxy-7-methoxy-(2H)-1,4-benzoxazin-3(4H)-one, 4-hydroxy-(2H)-1,4-benzoxazin-3(4H)-one, the moderate active group; 7-methoxy-(2H)-1,4-benzoxazin-3(4H)-one, (2H)-1,4-benzoxazin-3(4H)-one, 6-methoxy-benzoxazolin-2(3H)-one, benzoxazolin-2(3H)-one and 2-amino-phenoxazine-3-one, and the low active group; 2-hydroxy-(2H)-1,4-benzoxazin-3(4H)-one, 2-hydroxy-7-methoxy-(2H)-1,4-benzoxazin-3(4H)-one, 2-amino-7-hydroxyphenoxazine-3-one and 2-amino-7-methoxyphenoxazine-3-one. The structure-activity of these compounds suggests that compounds that have benzoxazinone skeletons are the most active structure, and a hydroxyl group at position C-2 on the benzoxazinone skeleton may not affect inhibitory activity, whereas a hydroxyl group at position N-4 on the skeleton is essential for inhibitory activity. However, the concentration-response curves of these compounds and the I(50) values (the concentrations required for 50% inhibition) for root growth and alpha-amylase indicated that root growth was positively correlated with the alpha-amylase activity in the seedlings. alpha-Amylase is required not only for seed germination, but also subsequent seedling growth until photosynthesis is sufficient to support seedling growth. Therefore, these results suggest that the compounds studied here may inhibit the root growth of cress seedlings by inhibiting alpha-amylase activity.

  8. Crystal structure of Thermoactinomyces vulgaris R-47 alpha-amylase II (TVAII) hydrolyzing cyclodextrins and pullulan at 2.6 A resolution.


    Kamitori, S; Kondo, S; Okuyama, K; Yokota, T; Shimura, Y; Tonozuka, T; Sakano, Y


    The crystal structure of Thermoactinomyces vulgaris R-47 alpha-Amylase II (TVAII) has been determined by multiple isomorphous replacement at 2.6 A resolution. TVAII was crystallized in an orthorhombic system with the space group P212121 and the cell dimensions a=118.5 A, b=119.5 A, c=114.5 A. There are two molecules in an asymmetric unit, related by the non-crystallographic 2-fold symmetry. Diffraction data were collected at 113 K and the cell dimensions reduced to a=114.6 A, b=117.9 A, c=114.2 A, and the model was refined against 7.0-2.6 A resolution data giving an R-factor of 0.204 (Rfree=0.272). The final model consists of 1170 amino acid residues (two molecules) and 478 water molecules with good chemical geometry. TVAII has three domains, A, B, and C, like other alpha-amylases. Domain A with a (beta/alpha)8 barrel structure and domain C with a beta-sandwich structure are very similar to those found in other alpha-amylases. Additionally, TVAII has an extra domain N composed of 121 amino acid residues at the N-terminal site, which has a beta-barrel-like structure consisting of seven antiparallel beta-strands. Domain N is one of the driving forces in the formation of the dimer structure of TVAII, but its role in the enzyme activity is still not clear. TVAII does not have the Ca2+ binding site that connects domains A and B in other alpha-amylases, rather the NZ atom of Lys299 of TVAII serves as the connector between these domains. TVAII can hydrolyze cyclodextrins and pullulan as well as starch. Based on a structural comparison with the complex between a mutant cyclodextrin glucanotransferase and a beta-cyclodextrin derivative, Phe286 located at domain B is considered the residue most likely to recognize the hydrophobic cavity of cyclodextrins. The active-site cleft of TVAII is wider and shallower than that of other alpha-amylases, and seems to be suitable for the binding of pullulan which is expected not to adopt the helical structure of amylose.

  9. Immediate Effects of Traditional Thai Massage on Psychological Stress as Indicated by Salivary Alpha-Amylase Levels in Healthy Persons.


    Sripongngam, Thanarat; Eungpinichpong, Wichai; Sirivongs, Dhavee; Kanpittaya, Jaturat; Tangvoraphonkchai, Kamonwan; Chanaboon, Sutin


    BACKGROUND Stress can cause psychological and physiological changes. Many studies revealed that massage can decrease stress. However, traditional Thai massage has not been well researched in this regard. The purpose of this study was to investigate the immediate effects of traditional Thai massage (TTM) on salivary alpha-amylase levels (sAA), heart rate variability (HRV), autonomic nervous system (ANS) function, and plasma renin activity (PRA). MATERIAL AND METHODS Twenty-nine healthy participants were randomly allocated into either a traditional Thai massage (TTM) group or Control (C) group, after which they were switched to the other group with a 2-week wash-out period. Each of them was given a 10-minute mental arithmetic test to induce psychological stress before a 1-hour session of TTM or rest. RESULTS Within-groups comparison revealed that sAA was significantly decreased (p<0.05) in the TTM group but not in the C group. HRV and ANS function were significantly increased (p<0.05) and PRA was significantly decreased (p<0.05) in both groups. However, low frequency per high frequency ratio (LF/HF ratio) and ANS balance status were not changed. Only sAA was found to be significantly different between groups (p<0.05). CONCLUSIONS We conclude that both TTM and rest can reduce psychological stress, as indicated by decreased sAA levels, increased parasympathetic activity, decreased sympathetic activity, and decreased PRA. However, TTM may have a modest effect on stress reduction as indicated by a reduced sAA.

  10. Phylogenetic Distribution of Intron Positions in Alpha-Amylase Genes of Bilateria Suggests Numerous Gains and Losses

    PubMed Central

    Da Lage, Jean-Luc; Maczkowiak, Frédérique; Cariou, Marie-Louise


    Most eukaryotes have at least some genes interrupted by introns. While it is well accepted that introns were already present at moderate density in the last eukaryote common ancestor, the conspicuous diversity of intron density among genomes suggests a complex evolutionary history, with marked differences between phyla. The question of the rates of intron gains and loss in the course of evolution and factors influencing them remains controversial. We have investigated a single gene family, alpha-amylase, in 55 species covering a variety of animal phyla. Comparison of intron positions across phyla suggests a complex history, with a likely ancestral intronless gene undergoing frequent intron loss and gain, leading to extant intron/exon structures that are highly variable, even among species from the same phylum. Because introns are known to play no regulatory role in this gene and there is no alternative splicing, the structural differences may be interpreted more easily: intron positions, sizes, losses or gains may be more likely related to factors linked to splicing mechanisms and requirements, and to recognition of introns and exons, or to more extrinsic factors, such as life cycle and population size. We have shown that intron losses outnumbered gains in recent periods, but that “resets” of intron positions occurred at the origin of several phyla, including vertebrates. Rates of gain and loss appear to be positively correlated. No phase preference was found. We also found evidence for parallel gains and for intron sliding. Presence of introns at given positions was correlated to a strong protosplice consensus sequence AG/G, which was much weaker in the absence of intron. In contrast, recent intron insertions were not associated with a specific sequence. In animal Amy genes, population size and generation time seem to have played only minor roles in shaping gene structures. PMID:21611157

  11. Differences in Salivary Alpha-Amylase and Cortisol Responsiveness following Exposure to Electrical Stimulation versus the Trier Social Stress Tests

    PubMed Central

    Maruyama, Yoshihiro; Kawano, Aimi; Okamoto, Shizuko; Ando, Tomoko; Ishitobi, Yoshinobu; Tanaka, Yoshihiro; Inoue, Ayako; Imanaga, Junko; Kanehisa, Masayuki; Higuma, Haruka; Ninomiya, Taiga; Tsuru, Jusen; Hanada, Hiroaki; Akiyoshi, Jotaro


    Background Cortisol is an essential hormone in the regulation of the stress response along the HPA axis, and salivary cortisol has been used as a measure of free circulating cortisol levels. Recently, salivary alpha-amylase (sAA) has also emerged as a novel biomarker for psychosocial stress responsiveness within the sympathetic adrenomedullary (SAM) system. Principal Findings We measured sAA and salivary cortisol in healthy volunteers after exposure to the Trier Social Stress Test (TSST) and electric stimulation stress. One hundred forty-nine healthy volunteers participated in this study. All subjects were exposed to both the TSST and electric stimulation stress on separate days. We measured sAA and salivary cortisol levels three times immediately before, immediately after, and 20 min after the stress challenge. The State (STAI-S) and Trait (STAI-T) versions of the Spielberger Anxiety Inventory test and the Profile of Mood State (POMS) tests were administered to participants before the electrical stimulation and TSST protocols. We also measured HF, LF and LF/HF Heart Rate Variability ratio immediately after electrical stimulation and TSST exposure. Following TSST exposure or electrical stimulation, sAA levels displayed a rapid increase and recovery, returning to baseline levels 20 min after the stress challenge. Salivary cortisol responses showed a delayed increase, which remained significantly elevated from baseline levels 20 min after the stress challenge. Analyses revealed no differences between men and women with regard to their sAA response to the challenges (TSST or electric stimulations), while we found significantly higher salivary cortisol responses to the TSST in females. We also found that younger subjects tended to display higher sAA activity. Salivary cortisol levels were significantly correlated with the strength of the applied electrical stimulation. Conclusions These preliminary results suggest that the HPA axis (but not the SAM system) may show

  12. Increased alpha-amylase response to an acute psychosocial stress challenge in healthy adults with childhood adversity.


    Kuras, Yuliya I; McInnis, Christine M; Thoma, Myriam V; Chen, Xuejie; Hanlin, Luke; Gianferante, Danielle; Rohleder, Nicolas


    Childhood adversity is highly prevalent and linked to lasting psychological and physiological consequences. A potential mechanism for negative health outcomes is altered stress reactivity. While previous research has addressed associations of childhood adversity with stress system reactivity, sympathetic nervous system (SNS) stress reactivity is understudied. We therefore set out here to examining salivary alpha-amylase (sAA) reactivity in relation with childhood adversity. Forty-one healthy adult subjects (n = 24 male; n = 17 female) aged 18-34 years underwent the Trier Social Stress Test (TSST) and completed the Childhood Trauma Questionnaire (CTQ). Saliva for measurement of sAA was collected at three time points; before the TSST, immediately after, and 10 min post-TSST. We found that those with childhood trauma had a higher overall sAA response to the TSST, as seen in a repeated measures ANOVA (CTQ by time interaction: F(1.8,71.5) = 6.46, p = .01) and an independent samples t-test indicating higher sAA baseline to peak response (t = 3.22, p = .003). There was also a positive correlation between sAA reactivity and the CTQ subscales of childhood physical abuse (r = .46, p = .005) and emotional abuse (r = .37, p = .024). Healthy adults with low-to-moderate childhood adversity had a heightened sAA response immediately following the stressor. Higher SNS reactivity could be a link to negative health outcomes in adults with early adversity. Future research should address whether altered sAA reactivity is predictive of negative health outcomes in those with childhood adversity.

  13. Miconia sp. Increases mRNA Levels of PPAR Gamma and Inhibits Alpha Amylase and Alpha Glucosidase.


    Ortíz-Martinez, David Mizael; Rivas-Morales, Catalina; de la Garza-Ramos, Myriam Angelica; Verde-Star, Maria Julia; Nuñez-Gonzalez, Maria Adriana; Leos-Rivas, Catalina


    Diabetes mellitus is a public health problem worldwide. For this reason, ethanolic extract of Miconia sp. from Oaxaca, Mexico, was selected in search of an alternative against this disease. The effect of Miconia sp. on mRNA expression of PPARγ on cell line 3T3-L1, its effect on alpha amylase and alpha glucosidase, lipid accumulation during adipogenesis, and cell viability on VERO cells were evaluated. The mRNA levels of PPARγ increased on 1.393 ± 0.008 folds, lipid accumulation was increased by 29.55% with Miconia sp. extract and 34.57% with rosiglitazone, and α-amylase and α-glycosidase were inhibited with IC50 values from 28.23 ± 2.15 μg/mL and 1.95 ± 0.15 μg/mL, respectively; the IC50 on antiproliferative activity on VERO cells was 314.54 ± 45.40 μg/mL. In case of α-amylase and α-glycosidase assays, IC50 (inhibitory concentration 50) refers to necessary extract amounts to inhibit 50% of enzymatic activity. On the other hand, on antiproliferative activity, IC50 (inhibitory concentration 50) refers to necessary extract amounts to inhibit 50% of cell proliferation. It was concluded that the compounds present in Miconia sp. ethanolic extract increase mRNA expression of PPARγ, inhibit α-amylase and α-glucosidase, and increase lipid accumulation. It constitutes an alternative as adjuvant in diabetes mellitus treatment; therefore, we recommend continuing identifying the compounds responsible for its promising in vivo antidiabetic activity.

  14. Miconia sp. Increases mRNA Levels of PPAR Gamma and Inhibits Alpha Amylase and Alpha Glucosidase

    PubMed Central

    Ortíz-Martinez, David Mizael; Rivas-Morales, Catalina; de la Garza-Ramos, Myriam Angelica; Verde-Star, Maria Julia; Nuñez-Gonzalez, Maria Adriana


    Diabetes mellitus is a public health problem worldwide. For this reason, ethanolic extract of Miconia sp. from Oaxaca, Mexico, was selected in search of an alternative against this disease. The effect of Miconia sp. on mRNA expression of PPARγ on cell line 3T3-L1, its effect on alpha amylase and alpha glucosidase, lipid accumulation during adipogenesis, and cell viability on VERO cells were evaluated. The mRNA levels of PPARγ increased on 1.393 ± 0.008 folds, lipid accumulation was increased by 29.55% with Miconia sp. extract and 34.57% with rosiglitazone, and α-amylase and α-glycosidase were inhibited with IC50 values from 28.23 ± 2.15 μg/mL and 1.95 ± 0.15 μg/mL, respectively; the IC50 on antiproliferative activity on VERO cells was 314.54 ± 45.40 μg/mL. In case of α-amylase and α-glycosidase assays, IC50 (inhibitory concentration 50) refers to necessary extract amounts to inhibit 50% of enzymatic activity. On the other hand, on antiproliferative activity, IC50 (inhibitory concentration 50) refers to necessary extract amounts to inhibit 50% of cell proliferation. It was concluded that the compounds present in Miconia sp. ethanolic extract increase mRNA expression of PPARγ, inhibit α-amylase and α-glucosidase, and increase lipid accumulation. It constitutes an alternative as adjuvant in diabetes mellitus treatment; therefore, we recommend continuing identifying the compounds responsible for its promising in vivo antidiabetic activity. PMID:27478477

  15. Evidence for pentagalloyl glucose binding to human salivary alpha-amylase through aromatic amino acid residues.


    Gyémánt, Gyöngyi; Zajácz, Agnes; Bécsi, Bálint; Ragunath, Chandran; Ramasubbu, Narayanan; Erdodi, Ferenc; Batta, Gyula; Kandra, Lili


    We demonstrate here that pentagalloyl glucose (PGG), a main component of gallotannins, was an effective inhibitor of HSA and it exerted similar inhibitory potency to Aleppo tannin used in this study. The inhibition of HSA by PGG was found to be non-competitive and inhibitory constants of K(EI)=2.6 microM and K(ESI)=3.9 microM were determined from Lineweaver-Burk secondary plots. PGG as a model compound for gallotannins was selected to study the inhibitory mechanism and to characterize the interaction of HSA with this type of molecules. Surface plasmon resonance (SPR) binding experiments confirmed the direct interaction of HSA and PGG, and it also established similar binding of Aleppo tannin to HSA. Saturation transfer difference (STD) experiment by NMR clearly demonstrated the aromatic rings of PGG may be involved in the interaction suggesting a possible stacking with the aromatic side chains of HSA. The role of aromatic amino acids of HSA in PGG binding was reinforced by kinetic studies with the W58L and Y151M mutants of HSA: the replacement of the active site aromatic amino acids with aliphatic ones decreased the PGG inhibition dramatically, which justified the importance of these residues in the interaction.

  16. Double-sided staining with a gold probe and silver enhancement to detect alpha-amylase and sugar moieties in the mouse salivary glands.


    Menghi, G; Marchetti, L; Bondi, A M; Accili, D; Sabbieti, M G; Materazzi, G


    In the present study we report the development of an ultrastructural electron microscopic double-sided staining technique that, using gold probes of 10 nm and enhancement of the gold signal by silver amplification, allows the demonstration of two antigenic sites on the same section. The labeling was carried out in the following manner: one face of uncoated floating grids was incubated with an antibody directed to alpha-amylase, followed by a secondary gold-labeled antibody, amplification of gold particles, drying and carbon coating; subsequently, the reverse face of the same grid, was processed for lectin cytochemistry, with and without sialidase digestion, and it was incubated with HRP-conjugated lectins, anti-HRP antibody and protein-A gold. Also the reverse sequence of steps and amplification of gold signal after the first or second labeling were experimented. The resultant small and large particles revealed different distributional patterns of antigenic sites on the opposite faces of the same tissue section. The transparency of the resin-embedded ultrathin sections in the electron beam allowed the simultaneous visualization of the gold probes of different sizes present on the two faces. The analysis of immunolabeling revealed that the alpha-amylase is chiefly secreted by the parotid and submandibular glands. The application of this double-sided staining technique also indicated that, when present in glycosylated form, the alpha-amylase enzyme does not contain sialic acid in the submandibular and sublingual glands; conversely, its location on the electron-dense areas of target granules in the parotid acinar cells seems to suggest that a sialylated isoenzymatic form can occur within these granule regions where sialic, acid linked to beta-galactose, was found to be located.

  17. The effect of single and repeated bouts of prolonged cycling and circadian variation on saliva flow rate, immunoglobulin A and alpha-amylase responses.


    Li, Tzai-Li; Gleeson, Michael


    The purpose of this study was to establish the effect of exercise at different times of day on saliva flow rate, immunoglobulin A (sIgA) concentration and secretion rate, and alpha-amylase activity, and to establish how these parameters change following a second exercise bout performed on the same day. In a counterbalanced design, eight male volunteers participated in three experimental trials separated by at least 4 days. On the trial with afternoon exercise only, the participants cycled for 2 h at 60% VO2max starting at 14:00 h. On the other two trials, participants performed either two bouts of exercise at 60% VO2max for 2 h (the first started at 09:00 h and the second started at 14:00 h) or a separate resting trial. Unstimulated saliva samples were obtained 10 min before exercise, after 58 - 60 min and during the last 2 min of exercise, and at 1 h and 2 h after exercise. Venous blood samples were taken 5 min before exercise and immediately after exercise for both bouts. Participants remained fasted between 23:00 h on the day before the trials and 18:00 h on the day of the trial. Circadian variations were found in sIgA concentration, which decreased with time from its highest value in the early morning to its lowest value in the evening, and salivary alpha-amylase secretion rate, which increased from its lowest value in the morning to its highest value in the late afternoon. Cycling at 60% VO2max for 2 h significantly decreased saliva flow rate, increased sIgA concentration and alpha-amylase activity, but did not influence sIgA secretion rate. Performing prolonged cycling at different times of day did not differentially affect the salivary and plasma hormonal responses in the short term. Performance of a second prolonged exercise bout elicited a greater plasma stress hormone response but did not appear to compromise oral immunity acutely. These findings also suggest that, in terms of saliva secretion, sIgA and alpha-amylase responses, a 3 h rest is enough to

  18. Association of alpha-amylase and the R1 protein with starch granules precedes the initiation of net starch degradation in turions of Spirodela polyrhiza.


    Reimann, Rezarta; Ritte, Gerhard; Steup, Martin; Appenroth, Klaus-J


    In turions of Spirodela polyrhiza (L.) Schleiden, net degradation of storage starch is controlled by a special low fluence response of phytochrome requiring illumination for several days. This light effect has been used to study protein-starch interactions that occur prior to and during net degradation of starch. Following various pretreatments on S. polyrhiza turions, native starch granules were isolated and two fractions of starch-related proteins were distinguished: proteins enclosed within the starch particles (starch-internalized proteins) and those attached to the surface (starch-associated proteins). The pattern of starch-associated proteins as resolved by SDS-PAGE was more complex than that of starch-internalized proteins and varied depending upon the pretreatment of the turions. Two starch associated proteins were identified immunochemically as alpha-amylase (EC and the R1 protein (Lorberth et al. (1998) Nature Biotechnology 16: 473-477). Dark-pretreatment of non-dormant turions does not induce starch net degradation. Under these conditions, alpha-amylase and R1 were bound to the surface of the starch granules. Continuous illumination with red light induces a rapid degradation of starch. Within the first 24 h of illumination the level of starch-associated alpha-amylase transiently increased and subsequently decreased rapidly. Similarly, the amount of the starch-associated R1 also decreased during illumination. The dissociation of both alpha-amylase and R1 from the starch granules preceded the decrease in starch content. However, binding of the two proteins to starch granules remained unchanged when the turions did not perform net starch degradation (as observed during continuous darkness, orthophosphate deficiency, or dormancy of the turions). Thus, during net starch degradation, so far unidentified changes are postulated to occur at the surface of the starch particles that are relevant for protein binding. This conclusion was supported by in

  19. Polymer masked-unmasked protein therapy. 1. Bioresponsive dextrin-trypsin and -melanocyte stimulating hormone conjugates designed for alpha-amylase activation.


    Duncan, Ruth; Gilbert, Helena R P; Carbajo, Rodrigo J; Vicent, María J


    Polymer-protein conjugation, particularly PEGylation, is well-established as a means of increasing circulation time, reducing antigenicity, and improving the stability of protein therapeutics. However, PEG has limitations including lack of polymer biodegradability, and conjugation can diminish or modify protein activity. The aim of this study was to explore a novel approach for polymer-protein modification called polymer-masking-unmasking-protein therapy (PUMPT), the hypothesis being that conjugation of a biodegradable polymer to a protein would protect it and mask activity in transit, while enabling controlled reinstatement of activity at the target site by triggered degradation of the polymeric component. To test this hypothesis, dextrin (alpha-1,4 polyglucose, a natural polymer degraded by alpha-amylase) was conjugated to trypsin as a model enzyme or to melanocyte stimulating hormone (MSH) as a model receptor-binding ligand. The effect of dextrin molecular weight (7700, and 47200 g/mol) and degree of succinoylation (9-32 mol %) on its ability to mask/unmask trypsin activity was assessed using N-benzoyl-L-arginine-p-nitroanilide (L-BAPNA). Dextrin conjugation reduced enzyme activity by 34-69% depending on the molecular weight and degree of succinoylation of dextrin. However, incubation with alpha-amylase led to reinstatement of activity to a maximum of 92-115%. The highest molecular dextrin (26 mol % succinoylation) gave optimum trypsin masking-unmasking. This intermediate was used to synthesize a dextrin-MSH conjugate (dextrin Mw = 47200 g/mol; MSH content 37 wt %), and its biological activity (+/-alpha-amylase) was assessed by measuring melanin production by murine melanoma (B16F10) cells. Conjugation reduced melanin production to 11%, but addition of alpha-amylase was able to restore activity to 33% of the control value. These were the first studies to confirm the potential of PUMPT for further application to clinically important protein therapeutics. The

  20. Alpha-Amylase

    NASA Technical Reports Server (NTRS)


    Both (Porcine and bacterial) starch degrading enzymes highly valued by the biotechnology industry. (Porcine) A major target for protein engineering and the study of diabetes, obesity and dental care. (Bacterial) Major industrial and biotechnology interest used in brewing, baking, and food processing. World's number one industrial protein.

  1. Asymmetry in children's salivary cortisol and alpha-amylase in the context of marital conflict: links to children's emotional security and adjustment.


    Koss, Kalsea J; George, Melissa R W; Cummings, E Mark; Davies, Patrick T; El-Sheikh, Mona; Cicchetti, Dante


    Recent research supports the promise of examining interactive models of physiological processes on children's adjustment. The present study investigates interactions between children's autonomic nervous system activity and adrenocortical functioning in the context of marital discord; specifically, testing models of concurrent responses proposed by Bauer et al. ([2002] Developmental and Behavioral Pediatrics 23:102-113) in the prediction of children's behavioral responses to conflict and adjustment. Asymmetry and symmetry in children's salivary alpha-amylase and cortisol were examined in 195 children (M age = 8 years) in response to viewing conflict vignettes. Results were partially consistent with an interactive model in the context of high marital discord; asymmetry among higher alpha-amylase and lower cortisol related to higher emotional insecurity and concurrent and subsequent maladjustment. In contrast, patterns of symmetrical responses were related to greater maladjustment for children exposed to lower levels of marital discord, supporting an additive model. Findings support the importance of a multisystem approach to investigating the adaptiveness of children's physiological stress responses, while also highlighting the value of considering physiological responses in the context of family risk.

  2. Optimized conditions for determining activity concentration of alpha-amylase in serum, with 1,4-alpha-D-4-nitrophenylmaltoheptaoside as substrate.


    Rauscher, E; Neumann, U; Schaich, E; von Bülow, S; Wahlefeld, A W


    We describe a method for measuring the catalytic activity of alpha-amylase (EC in serum and urine, by use of a defined substrate: 1,4-alpha, D-4-nitrophenyl maltoheptaoside. We use a phosphate buffer of pH 7.10, containing chloride as activator and alpha-glucosidase (EC as the auxiliary enzyme. After a lag phase of 4 min at 25 degrees C or 30 degrees C, or 3 min at 37 degrees C, the increase of absorption of 4-nitrophenol is measured at 410 nm or 405 nm. The pH value of the assay mixture is a compromise between optimum pH for the alpha-amylase reaction, shortest possible lag phase, and an acceptable absorptivity of 4-nitrophenol. Because the dissociation of 4-nitrophenol depends strongly on pH and temperature, we determined its absorptivity with various combinations of these variables in the assay. Heparin-treated plasma can be used, but not EDTA, fluoride, or citrate. Lipemia, hemoglobin less than or equal to mumol/L, bilirubin less than or equal to 170 mumol/L, glucose less than or equal to 100 mmol/L, and ascorbic acid less than or equal to 1 mmol/L of sample do not interfere in the assay.

  3. In silico analysis of the thermodynamic stability changes of psychrophilic and mesophilic alpha-amylases upon exhaustive single-site mutations.


    Gilis, Dimitri


    Identifying sequence modifications that distinguish psychrophilic from mesophilic proteins is important for designing enzymes with different thermodynamic stabilities and to understand the underlying mechanisms. The PoPMuSiC algorithm is used to introduce, in silico, all the single-site mutations in four mesophilic and one psychrophilic chloride-dependent alpha-amylases and to evaluate the changes in thermodynamic stability. The analysis of the distribution of the sequence positions that could be stabilized upon mutation shows a clear difference between the three domains of psychrophilic and mesophilic alpha-amylases. Most of the mutations stabilizing the psychrophilic enzyme are found in domains B and C, contrary to the mesophilic proteins where they are preferentially situated in the catalytic domain A. Moreover, the calculations show that the environment of some residues responsible for the activity of the psychrophilic protein has evolved to reinforce favorable interactions with these residues. In the second part, these results are exploited to propose rationally designed mutations that are predicted to confer to the psychrophilic enzyme mesophilic-like thermodynamic properties. Interestingly, most of the mutations found in domain C strengthen the interactions with domain A, in agreement with suggestions made on the basis of structural analyses. Although this study focuses on single-site mutations, the thermodynamic effects of the recommended mutations should be additive if the mutated residues are not close in space.

  4. Insecticidal effects of extracts of seven plant species on larval development, alpha-amylase activity and offspring production of Tribolium castaneum (Herbst) (Insecta: Coleoptera: Tenebrionidae).


    Jbilou, R; Amri, H; Bouayad, N; Ghailani, N; Ennabili, A; Sayah, F


    Bioinsecticidal effects of methanol extracts from seven plant species on Tribolium castaneum were investigated. Centaurium erythraea, Peganum harmala, Ajuga iva, Aristolochia baetica, Pteridium aquilinum and Raphanus raphanistrum extracts inhibit growth of larvae. C. erythraea was the most toxic with 63% mortality 10 days after treatment, followed by P. harmala with 58%. C. erythraea and P. aquilinum reduce the emergence rate respectively of 66% and 19%. The duration of larval period was shortened by Launaea arborescens, P. aquilinum and A. iva extracts, whereas R. raphanistrum and P. harmala extracts extend the larval period when compared to the control. Extracts of C. erythraea, P. harmala, A. iva and A. baetica inhibited F1 progeny production. Larvae possess three alpha-amylase isoforms as determined by SDS-PAGE. Larvae fed on treated diet had lower alpha-amylase activity than larvae feed on untreated diet. C. erythraea and P. harmala are the most potent extracts. These plant extracts could be useful to reduce seed damage caused by this pest species.

  5. Improving production of hyperthermostable and high maltose-forming alpha-amylase by an extreme thermophile Geobacillus thermoleovorans using response surface methodology and its applications.


    Uma Maheswar Rao, J L; Satyanarayana, T


    By cultivating Geobacillus thermoleovorans in shake flasks containing cane molasses medium at 70 degrees C, the fermentation variables were optimized by 'one variable at a time' approach followed by response surface methodology (RSM). The statistical model was obtained by central composite design (CCD) using three variables (cane-molasses, urea and inoculum density). An overall 1.6- and 2.1-fold increase in enzyme production was achieved in the optimized medium in shake flasks and fermenter, respectively. The alpha-amylase titre increased significantly in cane-molasses medium (60 U ml(-1)) as compared to that in the synthetic medium (26 U ml(-1)). Thus the cost of enzyme produced in cane molasses medium (0.823 euros per million U) was much lower than that produced in the synthetic starch-yeast extract-tryptone medium (18.52 euros per million U). The shelf life of bread was improved by supplementing dough with alpha-amylase, and thus, the enzyme was found to be useful in preventing the staling of bread. Reducing sugars liberated from 20% and 30% raw pearl millet starch were fermented to ethanol; ethanol production levels attained were 35.40 and 28.0 g l(-1), respectively.

  6. The 'pair of sugar tongs' site on the non-catalytic domain C of barley alpha-amylase participates in substrate binding and activity.


    Bozonnet, Sophie; Jensen, Morten T; Nielsen, Morten M; Aghajari, Nushin; Jensen, Malene H; Kramhøft, Birte; Willemoës, Martin; Tranier, Samuel; Haser, Richard; Svensson, Birte


    Some starch-degrading enzymes accommodate carbohydrates at sites situated at a certain distance from the active site. In the crystal structure of barley alpha-amylase 1, oligosaccharide is thus bound to the 'sugar tongs' site. This site on the non-catalytic domain C in the C-terminal part of the molecule contains a key residue, Tyr380, which has numerous contacts with the oligosaccharide. The mutant enzymes Y380A and Y380M failed to bind to beta-cyclodextrin-Sepharose, a starch-mimic resin used for alpha-amylase affinity purification. The K(d) for beta-cyclodextrin binding to Y380A and Y380M was 1.4 mm compared to 0.20-0.25 mm for the wild-type, S378P and S378T enzymes. The substitution in the S378P enzyme mimics Pro376 in the barley alpha-amylase 2 isozyme, which in spite of its conserved Tyr378 did not bind oligosaccharide at the 'sugar tongs' in the structure. Crystal structures of both wild-type and S378P enzymes, but not the Y380A enzyme, showed binding of the pseudotetrasaccharide acarbose at the 'sugar tongs' site. The 'sugar tongs' site also contributed importantly to the adsorption to starch granules, as Kd = 0.47 mg.mL(-1) for the wild-type enzyme increased to 5.9 mg.mL(-1) for Y380A, which moreover catalyzed the release of soluble oligosaccharides from starch granules with only 10% of the wild-type activity. beta-cyclodextrin both inhibited binding to and suppressed activity on starch granules for wild-type and S378P enzymes, but did not affect these properties of Y380A, reflecting the functional role of Tyr380. In addition, the Y380A enzyme hydrolyzed amylose with reduced multiple attack, emphasizing that the 'sugar tongs' participates in multivalent binding of polysaccharide substrates.

  7. SusG: a unique cell-membrane-associated alpha-amylase from a prominent human gut symbiont targets complex starch molecules.


    Koropatkin, Nicole M; Smith, Thomas J


    SusG is an alpha-amylase and part of a large protein complex on the outer surface of the bacterial cell and plays a major role in carbohydrate acquisition by the animal gut microbiota. Presented here, the atomic structure of SusG has an unusual extended, bilobed structure composed of amylase at one end and an unprecedented internal carbohydrate-binding motif at the other. Structural studies further demonstrate that the carbohydrate-binding motif binds maltooligosaccharide distal to, and on the opposite side of, the amylase catalytic site. SusG has an additional starch-binding site on the amylase domain immediately adjacent to the active cleft. Mutagenesis analysis demonstrates that these two additional starch-binding sites appear to play a role in catabolism of insoluble starch. However, elimination of these sites has only a limited effect, suggesting that they may have a more important role in product exchange with other Sus components.

  8. SusG: A Unique Cell-Membrane-Associated [alpha]-Amylase from a Prominent Human Gut Symbiont Targets Complex Starch Molecules

    SciTech Connect

    Koropatkin, Nicole M.; Smith, Thomas J.


    SusG is an {alpha}-amylase and part of a large protein complex on the outer surface of the bacterial cell and plays a major role in carbohydrate acquisition by the animal gut microbiota. Presented here, the atomic structure of SusG has an unusual extended, bilobed structure composed of amylase at one end and an unprecedented internal carbohydrate-binding motif at the other. Structural studies further demonstrate that the carbohydrate-binding motif binds maltooligosaccharide distal to, and on the opposite side of, the amylase catalytic site. SusG has an additional starch-binding site on the amylase domain immediately adjacent to the active cleft. Mutagenesis analysis demonstrates that these two additional starch-binding sites appear to play a role in catabolism of insoluble starch. However, elimination of these sites has only a limited effect, suggesting that they may have a more important role in product exchange with other Sus components.

  9. Three dimensional structure of porcine pancreatic alpha-amylase at 2.9 A resolution. Role of calcium in structure and activity.

    PubMed Central

    Buisson, G; Duée, E; Haser, R; Payan, F


    The crystal structure of porcine pancreatic alpha-amylase (PPA) has been solved at 2.9 A resolution by X-ray crystallographic methods. The enzyme contains three domains. The larger, in the N-terminal part, consists of 330 amino acid residues. This central domain has the typical parallel-stranded alpha-beta barrel structure (alpha beta)8, already found in a number of other enzymes like triose phosphate isomerase and pyruvate kinase. The C-terminal domain forms a distinct globular unit where the chain folds into an eight-stranded antiparallel beta-barrel. The third domain lies between a beta-strand and a alpha-helix of the central domain, in a position similar to those found for domain B in triose phosphate isomerase and pyruvate kinase. It is essentially composed of antiparallel beta-sheets. The active site is located in a cleft within the N-terminal central domain, at the carboxy-end of the beta-strands of the (alpha beta)8 barrel. Binding of various substrate analogues to the enzyme suggests that the amino acid residues involved in the catalytic reaction are a pair of aspartic acids. A number of other residues surround the substrate and seem to participate in its binding via hydrogen bonds and hydrophobic interactions. The 'essential' calcium ion has been located near the active site region and between two domains, each of them providing two calcium ligands. On the basis of sequence comparisons this calcium binding site is suggested to be a common structural feature of all alpha-amylases. It represents a new type of calcium-protein interaction pattern.(ABSTRACT TRUNCATED AT 250 WORDS) Images Fig. 1. Fig. 5. Fig. 7. PMID:3502087

  10. Purification, characterization, and partial primary sequence of a major-maltotriose-producing alpha-amylase, ScAmy43, from Sclerotinia sclerotiorum.


    Ben Abdelmalek-Khedher, Imen; Urdaci, Maria Camino; Limam, Ferid; Schmitter, Jean Marie; Marzouki, M Nejib; Bressollier, Philippe


    A novel alpha-amylase (alpha-1,4-alpha-D-glucan glucanohydrolase, E.C., ScAmy43, was found in the culture medium of the phytopathogenic fungus Sclerotinia sclerotiorum grown on oats flour. Purified to homogeneity, ScAmy43 appeared as a 43 kDa monomeric enzyme, as estimated by SDS-PAGE and Superdex 75 gel filtration. The MALDI peptide mass fingerprint of ScAmy43 tryptic digest as well as internal sequence analyses indicate that the enzyme has an original primary structure when compared with other fungal alpha- amylases. However, the sequence of the 12 N-terminal residues is homologous with those of Aspergillus awamori and Aspergillus kawachii amylases, suggesting that the new enzyme belongs to the same GH13 glycosyl hydrolase family. Assayed with soluble starch as substrate, this enzyme displayed optimal activity at pH 4 and 55oC with an apparent Km value of 1.66 mg/ml and Vmax of 0.1 micromol glucose x min-1 x ml-1. ScAmy43 activity was strongly inhibited by Cu2+, Mn2+, and Ba2+, moderately by Fe2+, and was only weakly affected by Ca2+ addition. However, since EDTA and EGTA did not inhibit ScAmy43 activity, this enzyme is probably not a metalloprotein. DTT and beta-mercaptoethanol strongly increased the enzyme activity. Starting with soluble starch as substrate, the end products were mainly maltotriose, suggesting for this enzyme an endo action.

  11. Three dimensional structure of porcine pancreatic alpha-amylase at 2.9 A resolution. Role of calcium in structure and activity.


    Buisson, G; Duée, E; Haser, R; Payan, F


    The crystal structure of porcine pancreatic alpha-amylase (PPA) has been solved at 2.9 A resolution by X-ray crystallographic methods. The enzyme contains three domains. The larger, in the N-terminal part, consists of 330 amino acid residues. This central domain has the typical parallel-stranded alpha-beta barrel structure (alpha beta)8, already found in a number of other enzymes like triose phosphate isomerase and pyruvate kinase. The C-terminal domain forms a distinct globular unit where the chain folds into an eight-stranded antiparallel beta-barrel. The third domain lies between a beta-strand and a alpha-helix of the central domain, in a position similar to those found for domain B in triose phosphate isomerase and pyruvate kinase. It is essentially composed of antiparallel beta-sheets. The active site is located in a cleft within the N-terminal central domain, at the carboxy-end of the beta-strands of the (alpha beta)8 barrel. Binding of various substrate analogues to the enzyme suggests that the amino acid residues involved in the catalytic reaction are a pair of aspartic acids. A number of other residues surround the substrate and seem to participate in its binding via hydrogen bonds and hydrophobic interactions. The 'essential' calcium ion has been located near the active site region and between two domains, each of them providing two calcium ligands. On the basis of sequence comparisons this calcium binding site is suggested to be a common structural feature of all alpha-amylases. It represents a new type of calcium-protein interaction pattern.(ABSTRACT TRUNCATED AT 250 WORDS)

  12. Study of starch fermentation at low pH by Lactobacillus fermentum Ogi E1 reveals uncoupling between growth and alpha-amylase production at pH 4.0.


    Calderon Santoyo, M; Loiseau, G; Rodriguez Sanoja, R; Guyot, J P


    Lactobacillus fermentum Ogi E1 is an amylolytic heterofermentative lactic acid bacterium previously isolated from ogi, a Benin maize sourdough. In the present study, the effect of different pH between 3.5 and 6.0 on starch fermentation products and alpha-amylase production was investigated. Whereas a pH of 5.0 was optimum for specific growth rate and lactic acid production, growth was only slightly affected at suboptimal pH of 4.0 and 6.0. Over a pH range of 6.0 to 3.5, yields of product formation from substrate and of biomass relative to ATP were constant. These results showed that L. fermentum Ogi E1 was particularly acid tolerant, and well adapted to the acid conditions that develop during natural fermentation of cereal doughs. This acid tolerance may partly explain the dominance of L. fermentum in various traditional African sourdoughs. Surprisingly, alpha-amylase production, unlike growth, dropped dramatically when the strain was cultivated at pH 4.0 with starch. With maltose as substrate, the yield of alpha-amylase relative to biomass remained unchanged at pH 4.0 and 5.0, unlike that observed with starch. Based on the distribution of enzyme activity between extra- and intracellular fractions and fermentation kinetics, it appears that starch was first hydrolyzed into dextrins by alpha-amylase activity, and maltose was produced from dextrins by extracellular enzyme activity, transferred into the cell and then hydrolyzed into glucose by intracellular alpha-glucosidase.

  13. Action pattern of human pancreatic and salivary alpha-amylase on 1,4-alpha-D-nitrophenylmaltooligosaccharides. 1,4-alpha-D-nitrophenylmaltooligosaccharides as substrates of alpha-amylse, I.


    Wallenfels, K; Laule, G; Meltzer, B


    High performance liquid chromatography (HPLC) was used to monitor the purity of the substrates and to establish the patterns of hydrolysis of ortho- and para-nitrophenylmaltooligosaccharides (2-7 glucose residues) catalysed by human pancreatic and salivary alpha-amylase. Separation of the reaction products from the remaining substrate was performed on a TSK-G-2000 PW or a RP18 column. By measuring the quantitative distribution of products, and assuming a 5-subsite model for the active site of alpha-amylase, differential activities for the hydrolysis of the different glycosidic bonds in the 2 series of substrates were deduced. A highly sensitive coupled continuous assay system is based on the formation of phenyloligosaccharides with 1-4 glucose residues by the action of the amylase under test, coupled to hydrolysis of these products by yeast alpha-glucosidase. The most suitable test substrates were shown to be para-nitrophenyl-alpha-D-maltotetraoside and -pentaoside. Direct production of nitrophenol from ortho-nitrophenyl-alpha-D-maltotrioside is recommended for the measurement of the alpha-amylase activity of pancreatic and salivary gland secretions and extracts.

  14. Differences in saliva collection location and disparities in baseline and diurnal rhythms of alpha-amylase: a preliminary note of caution.


    Harmon, Amanda G; Towe-Goodman, Nissa R; Fortunato, Christine K; Granger, Douglas A


    Identified in the early 1980s as a surrogate marker of the sympathetic nervous system component of the stress response, there has been renewed interest in measuring salivary alpha-amylase (sAA) to test biosocial models of stress vulnerability. This brief report presents studies that document that oral fluids from the parotid and submandibular gland areas had higher sAA values than did whole saliva specimens, and sAA values in whole saliva were higher than levels measured in oral fluids from the sublingual gland area. sAA in oral fluids from the parotid and submandibular gland areas showed the highest and more pronounced diurnal variation than levels in whole saliva, and sAA in sublingual saliva showed the lowest and shallowest diurnal variation. When this source of inherent variability in sAA activity levels is not controlled for by collecting oral fluids consistently from specific gland areas, the detection of individual differences, associations between sAA and "behavioral" variables, and intra-individual change in sAA levels may be compromised. Awareness, and management, of this ubiquitous source of measurement error in sAA are essential to ensure the success of future research on the correlates and concomitants of sAA levels, stress-related reactivity and recovery, and diurnal variation.

  15. Mind your thoughts: associations between self-generated thoughts and stress-induced and baseline levels of cortisol and alpha-amylase.


    Engert, Veronika; Smallwood, Jonathan; Singer, Tania


    Stress is a major health burden in today's society. Research shows that negative cognitive styles are associated with increased stress reactivity, low mood and accelerated cellular aging. Our study sought to unravel the relationship between the content of self-generated thoughts and psychosocial stress measured in terms of hypothalamic-pituitary-adrenal axis and sympathetic activity. Features of self-generated thoughts were assessed using thought sampling while participants performed cognitive tasks following a stress induction or in a baseline condition. More negatively toned emotional thoughts and more social temporal thoughts with a past focus were associated with increased cortisol and alpha-amylase levels, both after stress and at baseline. More social temporal thoughts with a future focus, on the other hand, had an overall attenuating effect on the levels of both stress markers. Our results indicate a fundamental link between the thoughts and stress levels we experience. Understanding the mechanisms governing this mind-body association may have important implications for understanding and counteracting the high incidence of stress-related disorders in today's society.

  16. Heterologous expression of Thermobifida fusca thermostable alpha-amylase in Yarrowia lipolytica and its application in boiling stable resistant sago starch preparation.


    Yang, Chao-Hsun; Huang, Yu-Chun; Chen, Cheng-Yu; Wen, Chia-Ying


    A gene encoding the thermostable alpha-amylase in Thermobifida fusca NTU22 was amplified by PCR, sequenced, and cloned into Yarrowia lipolytica P01g host strain using the vector pYLSC1 allowing constitutive expression and secretion of the protein. Recombinant expression resulted in high levels of extracellular amylase production, as high as 730 U/l in the Hinton flask culture broth. It is higher than that observed in P. pastoris expression system and E. coli expression system. The purified amylase showed a single band at about 65 kDa by SDS-polyacrylamide gel electrophoresis and this agrees with the predicted size based on the nucleotide sequence. About 70% of the original activity remained after heat treatment at 60 degrees C for 3 h. The optimal pH and temperature of the purified amylase were 7.0 and 60 degrees C, respectively. The purified amylase exhibited a high level of activity with raw sago starch. After 72-h treatment, the DP(w) of raw sago starch obviously decreased from 830,945 to 237,092. The boiling stable resistant starch content of the sago starch increased from 8.3 to 18.1%. The starch recovery rate was 71%.

  17. Introduction of raw starch-binding domains into Bacillus subtilis alpha-amylase by fusion with the starch-binding domain of Bacillus cyclomaltodextrin glucanotransferase.


    Ohdan, K; Kuriki, T; Takata, H; Kaneko, H; Okada, S


    We constructed two types of chimeric enzymes, Ch1 Amy and Ch2 Amy. Ch1 Amy consisted of a catalytic domain of Bacillus subtilis X-23 alpha-amylase (Ba-S) and the raw starch-binding domain (domain E) of Bacillus A2-5a cyclomaltodextrin glucanotransferase (A2-5a CGT). Ch2 Amy consisted of Ba-S and D (function unknown) plus E domains of A2-5a CGT. Ch1 Amy acquired raw starch-binding and -digesting abilities which were not present in the catalytic part (Ba-S). Furthermore, the specific activity of Ch1 Amy was almost identical when enzyme activity was evaluated on a molar basis. Although Ch2 Amy exhibited even higher raw starch-binding and -digesting abilities than Ch1 Amy, the specific activity was lower than that of Ba-S. We did not detect any differences in other enzymatic characteristics (amylolytic pattern, transglycosylation ability, effects of pH, and temperature on stability and activity) among Ba-S, Ch1 Amy, and Ch2 Amy.

  18. Expression of Thermobifida fusca thermostable raw starch digesting alpha-amylase in Pichia pastoris and its application in raw sago starch hydrolysis.


    Yang, Chao-Hsun; Huang, Yu-Chun; Chen, Cheng-Yu; Wen, Chia-Ying


    A gene encoding the thermostable raw starch digesting alpha-amylase in Thermobifida fusca NTU22 was amplified by PCR, sequenced and cloned into Pichia pastoris X-33 host strain using the vector pGAPZalphaA, allowing constitutive expression and secretion of the protein. Recombinant expression resulted in high levels of extracellular amylase production, as high as 510 U/l in the Hinton flask culture broth. The purified amylase showed a single band at about 65 kDa by SDS-polyacrylamide gel electrophoresis after being treated with endo-beta-N-acetylglycosaminidase H, and this agrees with the predicted size based on the nucleotide sequence. About 75% of the original activity remained after heat treatment at 60 degrees C for 3 h. The optimal pH and temperature of the purified amylase were 7.0 and 60 degrees C, respectively. The purified amylase exhibited a high level of activity with raw sago starch. After 48-h treatment, the DPw of raw sago starch obviously decreased from 830,945 to 378,732. The surface of starch granules was rough, and some granules displayed deep cavities.

  19. Salivary alpha-amylase and cortisol in infancy and toddlerhood: direct and indirect relations with executive functioning and academic ability in childhood.


    Berry, Daniel; Blair, Clancy; Willoughby, Michael; Granger, Douglas A


    Using data from a predominantly low-income, population-based prospective longitudinal sample of 1292 children followed from birth, indicators of children's autonomic (salivary alpha-amylase; sAA) and hypothalamic-pituitary-adrenal (HPA) axis (salivary cortisol) activity at 7, 15, and 24 months of age were found to predict executive functioning at 36-months and academic achievement in pre-kindergarten. The findings suggested that the respective cortisol and sAA effects on executive functioning and academic achievement were interactive. Optimal developmental outcomes were associated with asymmetrical cortisol/sAA profiles. Higher cortisol levels were predictive of lower executive functioning and academic abilities, but only for those with concurrently moderate to high levels of sAA. In contrast, higher sAA concentrations were predictive of better executive functioning and academic abilities, but only for those with concurrently moderate to low levels of cortisol. These relations were statistically identical across infancy and toddlerhood. The conditional effects of cortisol and sAA on pre-kindergarten academic achievement were mediated fully by links between these early physiological indicators and executive functioning.

  20. Gedunin and Azadiradione: Human Pancreatic Alpha-Amylase Inhibiting Limonoids from Neem (Azadirachta indica) as Anti-Diabetic Agents

    PubMed Central

    Zinjarde, Smita; Thulasiram, Hirekodathakallu; RaviKumar, Ameeta


    Human pancreatic α-amylase (HPA) inhibitors offer an effective strategy to lower postprandial hyperglycemia via control of starch breakdown. Limonoids from Azadirachta indica known for their therapeutic potential were screened for pancreatic α-amylase inhibition, a known anti-diabetic target. Studies were carried out to reveal their mode of action so as to justify their hypoglycemic potential. Of the nine limonoids isolated/semi-synthesized from A.indica and screened for α-amylase inhibition, azadiradione and exhibited potential inhibition with an IC50 value of 74.17 and 68.38 μM, respectively against HPA under in vitro conditions. Further screening on AR42J α-amylase secretory cell line for cytotoxicity and bioactivity revealed that azadiradione and gedunin exhibited cytotoxicity with IC50 of 11.1 and 13.4μM. Maximal secreted α-amylase inhibition of 41.8% and 53.4% was seen at 3.5 and 3.3μM, respectively. Michaelis-Menten kinetics suggested a mixed mode of inhibition with maltopentaose (Ki 42.2, 18.6 μM) and starch (Ki′ 75.8, 37.4 μM) as substrate with a stiochiometry of 1:1 for both azadiradione and gedunin, respectively. The molecular docking simulation indicated plausible π-alkyl and alkyl-alkyl interactions between the aromatic amino acids and inhibitors. Fluorescence and CD confirmed the involvement of tryptophan and tyrosine in ligand binding to HPA. Thermodynamic parameters suggested that binding is enthalpically and entropically driven with ΔG° of -21.25 kJ mol-1 and -21.16 kJ mol-1 for azadiradione and gedunin, respectively. Thus, the limonoids azadiradione and gedunin could bind and inactivate HPA (anti-diabetic target) and may prove to be lead drug candidates to reduce/control post-prandial hyperglycemia. PMID:26469405

  1. Age Differences of Salivary Alpha-Amylase Levels of Basal and Acute Responses to Citric Acid Stimulation Between Chinese Children and Adults

    PubMed Central

    Yang, Ze-Min; Chen, Long-Hui; Zhang, Min; Lin, Jing; Zhang, Jie; Chen, Wei-Wen; Yang, Xiao-Rong


    It remains unclear how salivary alpha-amylase (sAA) levels respond to mechanical stimuli in different age groups. In addition, the role played by the sAA gene (AMY1) copy number and protein expression (glycosylated and non-glycosylated) in sAA activity has also been rarely reported. In this study, we analyzed saliva samples collected before and after citric acid stimulation from 47 child and 47 adult Chinese subjects. We observed that adults had higher sAA activity and sAA glycosylated levels (glycosylated sAA amount/total sAA amount) in basal and stimulated saliva when compared with children, while no differences were found in total or glycosylated sAA amount between them. Interestingly, adults showed attenuated sAA activity levels increase over those of children after stimulation. Correlation analysis showed that total sAA amount, glycosylated sAA amount, and AMY1 copy number × total sAA amount were all positively correlated with sAA activity before and after stimulation in both groups. Interestingly, correlation r between sAA levels (glycosylated sAA amount and total sAA amount) and sAA activity decreased after stimulation in children, while adults showed an increase in correlation r. In addition, the correlation r between AMY1 copy number × total sAA amount and sAA activity was higher than that between AMY1 copy number, total sAA amount, and sAA activity, respectively. Taken together, our results suggest that total sAA amount, glycosylated sAA amount, and the positive interaction between AMY1 copy number and total sAA amount are crucial in influencing sAA activity before and after stimulation in children and adults. PMID:26635626

  2. Measurements of salivary alpha amylase and salivary cortisol in hominoid primates reveal within-species consistency and between-species differences.


    Behringer, Verena; Borchers, Claudia; Deschner, Tobias; Möstl, Erich; Selzer, Dieter; Hohmann, Gottfried


    Salivary alpha amylase (sAA) is the most abundant enzyme in saliva. Studies in humans found variation in enzymatic activity of sAA across populations that could be linked to the copy number of loci for salivary amylase (AMY1), which was seen as an adaptive response to the intake of dietary starch. In addition to diet dependent variation, differences in sAA activity have been related to social stress. In a previous study, we found evidence for stress-induced variation in sAA activity in the bonobos, a hominoid primate that is closely related to humans. In this study, we explored patterns of variation in sAA activity in bonobos and three other hominoid primates, chimpanzee, gorilla, and orangutan to (a) examine if within-species differences in sAA activity found in bonobos are characteristic for hominoids and (b) assess the extent of variation in sAA activity between different species. The results revealed species-differences in sAA activity with gorillas and orangutans having higher basal sAA activity when compared to Pan. To assess the impact of stress, sAA values were related to cortisol levels measured in the same saliva samples. Gorillas and orangutans had low salivary cortisol concentrations and the highest cortisol concentration was found in samples from male bonobos, the group that also showed the highest sAA activity. Considering published information, the differences in sAA activity correspond with differences in AMY1 copy numbers and match with general features of natural diet. Studies on sAA activity have the potential to complement molecular studies and may contribute to research on feeding ecology and nutrition.

  3. Alpha-amylase and alpha-glucosidase inhibition is differentially modulated by fucoidan obtained from Fucus vesiculosus and Ascophyllum nodosum.


    Kim, Kyung-Tae; Rioux, Laurie-Eve; Turgeon, Sylvie L


    Fucoidan is a water-soluble, negatively charged, biologically active polysaccharide found in great abundance in brown marine algae. However, the inhibition of α-amylase and α-glucosidase by fucoidan derived from two algal species (Ascophyllum nodosum and Fucus vesiculosus) harvested at different periods (accounting for seasonal and yearly variations) has never been investigated. It was found that fucoidans inhibited α-glucosidase differently, depending on the algal species from which it was extracted and the algae's season of harvest. Fucoidan extracted from A. nodosum was a more potent inhibitor of α-glucosidase, with an IC50 ranging from 0.013 to 0.047 mg/mL, than the inhibition by fucoidan extracted from F. vesiculosus (IC50=0.049 mg/mL). In contrast, fucoidan extracted from F. vesiculosus did not inhibit α-amylase activity, while fucoidan from A. nodosum decreased α-amylase activity by 7-100% at 5 mg/mL depending upon the algae harvest period. An IC50 of 0.12-4.64 mg/mL for fucoidan from A. nodosum was found for the α-amylase inhibition. The ability of fucoidan to inhibit α-amylase and α-glucosidase thus varies according to the algae species and harvest period. A. nodosum is more suitable than F. vesiculosus as a source of fucoidan to inhibit α-amylase and α-glucosidase activities. Their potential benefits towards Type 2 diabetes management should be further investigated.

  4. Effectively nursing patients receiving aromatase inhibitor therapy.


    Wengström, Y


    Inhibiting estrogen production is a common means of preventing breast cancer recurrence. The aromatase inhibitors (AIs) are becoming the preferred treatment over tamoxifen as adjuvant therapy for postmenopausal women with hormone-sensitive early breast cancer. Like all adjuvant therapies, AIs have adverse events (AEs) associated with their use, many of which resemble symptoms common to menopause. Because of the greater efficacy of AIs in preventing breast cancer recurrence over tamoxifen, these AEs may be considered tolerable by many patients and often can be effectively managed and/or prevented. Educating patients about anticipated AEs may help them understand, accept, and cope with these AEs. This article reviews the AEs associated with different adjuvant AI treatments and highlights some strategies to manage them effectively. It also highlights the importance of patient education regarding AI therapy and involvement in treatment decisions, which may lead to better long-term adherence and ultimately to better outcomes.

  5. Effect of chronic training on heart rate variability, salivary IgA and salivary alpha-amylase in elite swimmers with a disability.


    Edmonds, Rohan; Burkett, Brendan; Leicht, Anthony; McKean, Mark


    The purpose of this study was to a) determine the heart rate variability (HRV) and saliva markers of immunity (salivary immunoglobulin A; sIgA) and stress (salivary alpha-amylase; sAA) responses to chronic training in elite swimmers with a disability; and b) identify the relationships between HRV, sIgA, sAA and training volume. Eight members of a high performance Paralympic swimming program were monitored for their weekly resting HRV, sIgA and sAA levels in the 14 weeks leading up to a major international competition. The 14 week training program included aerobic, anaerobic, power and speed, and taper training phases, while also incorporating two swimming step tests and two swimming competitions. Specific time (root mean square of the successive differences; RMSSD) and frequency (high frequency normalized units [HFnu]) domain measures, along with non-linear indices (standard deviation of instantaneous RR variability; SD1 and short term fractal scaling exponent; α1) of HRV were used for all analyses with effects examined using magnitude-based inferences. Relationships between HRV and saliva markers were identified by Spearman rank rho (ρ) correlation coefficients. Compared with week 1, SD1 was very likely lower (96/4/0, ES = -2.21), while sAA was very likely elevated (100/0/0, ES = 2.32) at the beginning of week 7 for all athletes. The training program did not alter HRV or saliva whereas competition did. There were also no apparent differences observed for HRV, sIgA and sAA between each of the training phases during the 14 week swimming program. Correlations were observed between sAA and SD1 (ρ = -0.212, p<0.05), along with sAA and mean HR (ρ = 0.309, p<0.05). These results show that high level national competition influences depresses HRV (SD1) and increases saliva biomarkers of stress (sAA). It appears that a well-managed and periodised swimming program can maintain these indices within normal baseline levels. The study also highlighted the parasympathetic

  6. Two secondary carbohydrate binding sites on the surface of barley alpha-amylase 1 have distinct functions and display synergy in hydrolysis of starch granules.


    Nielsen, Morten M; Bozonnet, Sophie; Seo, Eun-Seong; Mótyán, János A; Andersen, Joakim M; Dilokpimol, Adiphol; Abou Hachem, Maher; Gyémánt, Gyöngyi; Naested, Henrik; Kandra, Lili; Sigurskjold, Bent W; Svensson, Birte


    Some polysaccharide processing enzymes possess secondary carbohydrate binding sites situated on the surface far from the active site. In barley alpha-amylase 1 (AMY1), two such sites, SBS1 and SBS2, are found on the catalytic (beta/alpha)(8)-barrel and the noncatalytic C-terminal domain, respectively. Site-directed mutagenesis of Trp(278) and Trp(279), stacking onto adjacent ligand glucosyl residues at SBS1, and of Tyr(380) and His(395), making numerous ligand contacts at SBS2, suggested that SBS1 and SBS2 act synergistically in degradation of starch granules. While SBS1 makes the major contribution to binding and hydrolysis of starch granules, SBS2 exhibits a higher affinity for the starch mimic beta-cyclodextrin. Compared to that of wild-type AMY1, the K(d) of starch granule binding by the SBS1 W278A, W279A, and W278A/W279A mutants thus increased 15-35 times; furthermore, the k(cat)/K(m) of W278A/W279A was 2%, whereas both affinity and activity for Y380A at SBS2 were 10% of the wild-type values. Dual site double and triple SBS1/SBS2 substitutions eliminated binding to starch granules, and the k(cat)/K(m) of W278A/W279A/Y380A AMY1 was only 0.4% of the wild-type value. Surface plasmon resonance analysis of mutants showed that beta-cyclodextrin binds to SBS2 and SBS1 with K(d,1) and K(d,2) values of 0.07 and 1.40 mM, respectively. A model that accounts for the observed synergy in starch hydrolysis, where SBS1 and SBS2 bind ordered and free alpha-glucan chains, respectively, thus targeting the enzyme to single alpha-glucan chains accessible for hydrolysis, is proposed. SBS1 and SBS2 also influence the kinetics of hydrolysis for amylose and maltooligosaccharides, the degree of multiple attack on amylose, and subsite binding energies.

  7. New approach for separating Bacillus subtilis metalloprotease and alpha-amylase by affinity chromatography and for purifying neutral protease by hydrophobic chromatography.


    Lauer, I; Bonnewitz, B; Meunier, A; Beverini, M


    Proteases are commonly used in the biscuit and cracker industry as processing aids. They cause moderate hydrolysis of gluten proteins and improve dough rheology to better control product texture and crunchiness. Commercial bacterial proteases are derived from Bacillus fermentation broth. As filtration and ultrafiltration are carried out as the only recovery steps, these preparations contain also alpha-amylase and beta-glucanase as the main side activities. The aim of this study is to purify and characterize the Bacillus subtilis metalloprotease from a commercial preparation, in order to study separately the impact of the protease activity with regards to its functionality on biscuit properties. Purification was achieved by means of affinity chromatography on Cibacron Blue and HIC as a polishing step. Affinity appeared to be the most appropriate matrix for large scale purification while ion exchange chromatography was inefficient in terms of recovery yields. The crude product was first loaded on a Hi Trap Blue column (34 microm, Pharmacia Biotech); elution was carried out with a gradient of NaCl in the presence of 1 mM ZnCl2. This step was only efficient in the presence of Zn cations, because this salt promoted both protease stabilization resulting in high recovery yields and also complexation of amylase units into dimers resulting in amylase retention on the column and a better separation of the 3 activities. Beta-glucanase was mostly non retained on the column and a part was coeluted with the protease. This protease fraction was then loaded on a Resource Phe column (15 microm, Pharmacia Biotech) in a last step of polishing. Elution was carried out with a linear gradient of 100-0% ammonium sulfate 1.3 M; protease was eluted at the beginning of the gradient and well separated from amylase and glucanase trace impurities. The homogeneity of the purified protease was confirmed by SDS-PAGE, which showed that its MW was about 38. pH and temperature optima were also

  8. Amide proton exchange in the. cap alpha. -amylase polypeptide inhibitor tendamistat studied by two-dimensional /sup 1/H nuclear magnetic resonance

    SciTech Connect

    Wang, O.; Kline, A.D.; Wuethrich, K.


    The individual amide proton exchange rates in Tendamistat at pH 3.0 and 50/sup 0/C were measured by using two-dimensional ..cap alpha..H nuclear magnetic resonance. Overall, it was found that the distribution of exchange rates along the sequence is dominated by the interstrand hydrogen bonds of the ..beta..-sheet structures. The slowly exchanging protons in the core of the two ..beta..-sheets were shown to exchange via an EX2 mechanism. Further analysis of the data indicates that different large-scale structure fluctuations are responsible for the exchange from the two ..beta..-sheets, even though the three-dimensional structure of Tendamistat appears to consist of a single structural domain.

  9. Physical and psychosocial challenges in adult hemophilia patients with inhibitors

    PubMed Central

    duTreil, Sue


    Numerous challenges confront adult hemophilia patients with inhibitors, including difficulty in controlling bleeding episodes, deterioration of joints, arthritic pain, physical disability, emotional turmoil, and social issues. High-intensity treatment regimens often used in the treatment of patients with inhibitors also impose significant scheduling, economic, and emotional demands on patients and their families or primary caregivers. A comprehensive multidisciplinary assessment of the physical, emotional, and social status of adult hemophilia patients with inhibitors is essential for the development of treatment strategies that can be individualized to address the complex needs of these patients. PMID:25093002

  10. Achievements, challenges and unmet needs for haemophilia patients with inhibitors

    PubMed Central



    Summary Over the past 20 years, there have been many advances in haemophilia treatment that have allowed patients to take greater control of their disease. However, the development of factor VIII (FVIII) inhibitors is the greatest complication of the disease and a challenge in the treatment of haemophilia making management of bleeding episodes difficult and surgical procedures very challenging. A meeting to discuss the unmet needs of haemophilia patients with inhibitors was held in Paris on 20 November 2014. Topics discussed were genetic and non-genetic risk factors for the development of inhibitors, immunological aspects of inhibitor development, FVIII products and inhibitor development, generation and functional properties of engineered antigen-specific T regulatory cells, suppression of immune responses to FVIII, prophylaxis in haemophilia patients with inhibitors, epitope mapping of FVIII inhibitors, current controversies in immune tolerance induction therapy, surgery in haemophilia patients with inhibitors and future perspectives for the treatment of haemophilia patients with inhibitors. A summary of the key points discussed is presented in this paper. PMID:26728503

  11. Bone scan alterations in aromatase inhibitor-treated patients.


    De Geeter, Frank; Van den Bruel, Annick; De Cuypere, Eveline; Langlois, Michel


    We report bone scan changes in 3 patients receiving aromatase inhibitors as adjuvant treatment for postmenopausal hormone receptor-positive breast cancer. Compared with bone scans before treatment, repeated scans after at least 10 months of aromatase inhibitor treatment showed increased activity in the peripheral skeleton and the skull. In 2 patients, these alterations could be correlated with increased markers of bone turnover. They probably result from high bone turnover induced by estrogen depletion caused by aromatase inhibitors. This effect should be taken into account in the differential diagnosis of a bone scan pattern suggestive of hyperparathyroidism, which was ruled out.

  12. Patient compliance with MAO inhibitor therapy.


    Walker, J I; Davidson, J; Zung, W W


    Exaggerated fears of monoamine oxidase inhibitors (MAOIs) and of their interactions with foods often restrict their use. A review of the literature reveals seven food items most likely to produce a hypertensive crisis in combination with MAOI administration: aged cheeses, smoked or pickled fish, beef or chicken liver, dry fermented sausage, pods of broad beans, brewer's yeast products, and certain alcoholic beverages. Improved understanding of the dietary restrictions, benefits, and mechanism of action of the MAOIs can enhance cooperation with the prescribed treatment program.

  13. New type of starch-binding domain: the direct repeat motif in the C-terminal region of Bacillus sp. no. 195 alpha-amylase contributes to starch binding and raw starch degrading.

    PubMed Central

    Sumitani, J; Tottori, T; Kawaguchi, T; Arai, M


    The alpha-amylase from Bacillus sp. no. 195 (BAA) consists of two domains: one is the catalytic domain similar to alpha-amylases from animals and Streptomyces in the N-terminal region; the other is the functionally unknown domain composed of an approx. 90-residue direct repeat in the C-terminal region. The gene coding for BAA was expressed in Streptomyces lividans TK24. Three active forms of the gene products were found. The pH and thermal profiles of BAAs, and their catalytic activities for p-nitrophenyl maltopentaoside and soluble starch, showed almost the same behaviours. The largest, 69 kDa, form (BAA-alpha) was of the same molecular mass as that of the mature protein estimated from the nucleotide sequence, and had raw-starch-binding and -degrading abilities. The second largest, 60 kDa, form (BAA-beta), whose molecular mass was the same as that of the natural enzyme from Bacillus sp. no. 195, was generated by proteolytic processing between the two repeat sequences in the C-terminal region, and had lower activities for raw starch binding and degrading than those of BAA-alpha. The smallest, 50 kDa, form (BAA-gamma) contained only the N-terminal catalytic domain as a result of removal of the C-terminal repeat sequence, which led to loss of binding and degradation of insoluble starches. Thus the starch adsorption capacity and raw-starch-degrading activity of BAAs depends on the existence of the repeat sequence in the C-terminal region. BAA-alpha was specifically adsorbed on starch or dextran (alpha-1,4 or alpha-1,6 glucan), and specifically desorbed with maltose or beta-cyclodextrin. These observations indicated that the repeat sequence of the enzyme was functional in the starch-binding domain (SBD). We propose the designation of the homologues to the SBD of glucoamylase from Aspergillus niger as family I SBDs, the homologues to that of glucoamylase from Rhizopus oryzae as family II, and the homologues of this repeat sequence of BAA as family III. PMID:10947962

  14. New type of starch-binding domain: the direct repeat motif in the C-terminal region of Bacillus sp. no. 195 alpha-amylase contributes to starch binding and raw starch degrading.


    Sumitani, J; Tottori, T; Kawaguchi, T; Arai, M


    The alpha-amylase from Bacillus sp. no. 195 (BAA) consists of two domains: one is the catalytic domain similar to alpha-amylases from animals and Streptomyces in the N-terminal region; the other is the functionally unknown domain composed of an approx. 90-residue direct repeat in the C-terminal region. The gene coding for BAA was expressed in Streptomyces lividans TK24. Three active forms of the gene products were found. The pH and thermal profiles of BAAs, and their catalytic activities for p-nitrophenyl maltopentaoside and soluble starch, showed almost the same behaviours. The largest, 69 kDa, form (BAA-alpha) was of the same molecular mass as that of the mature protein estimated from the nucleotide sequence, and had raw-starch-binding and -degrading abilities. The second largest, 60 kDa, form (BAA-beta), whose molecular mass was the same as that of the natural enzyme from Bacillus sp. no. 195, was generated by proteolytic processing between the two repeat sequences in the C-terminal region, and had lower activities for raw starch binding and degrading than those of BAA-alpha. The smallest, 50 kDa, form (BAA-gamma) contained only the N-terminal catalytic domain as a result of removal of the C-terminal repeat sequence, which led to loss of binding and degradation of insoluble starches. Thus the starch adsorption capacity and raw-starch-degrading activity of BAAs depends on the existence of the repeat sequence in the C-terminal region. BAA-alpha was specifically adsorbed on starch or dextran (alpha-1,4 or alpha-1,6 glucan), and specifically desorbed with maltose or beta-cyclodextrin. These observations indicated that the repeat sequence of the enzyme was functional in the starch-binding domain (SBD). We propose the designation of the homologues to the SBD of glucoamylase from Aspergillus niger as family I SBDs, the homologues to that of glucoamylase from Rhizopus oryzae as family II, and the homologues of this repeat sequence of BAA as family III.

  15. Enzymatic synthesis of a selective inhibitor for alpha-glucosidases: alpha-acarviosinyl-(1-->9)-3-alpha-D-glucopyranosylpropen.


    Lee, Young-Su; Lee, Myoung-Hee; Lee, Hee-Seob; Lee, Seung-Jae; Kim, Young-Wan; Zhang, Ran; Withers, Stephen G; Kim, Kwan Soo; Lee, Sung-Joon; Park, Kwan-Hwa


    Here, we describe the enzymatic synthesis of novel inhibitors using acarviosine-glucose as a donor and 3-alpha-D-glucopyranosylpropen (alphaGP) as an acceptor. Maltogenic amylase from Thermus sp. (ThMA) catalyzed the transglycosylation of the acarviosine moiety to alphaGP. The two major reaction products were isolated using chromatographies. Structural analyses revealed that acarviosine was transferred to either C-7 or C-9 of the alphaGP, which correspond to C-4 and C-6 of glucose. Both inhibited rat intestine alpha-glucosidase competitively but displayed a mixed-type inhibition mode against human pancreatic alpha-amylase. The alpha-acarviosinyl-(1-->7)-3-alpha-D-glucopyranosylpropen showed weaker inhibition potency than acarbose against both alpha-glycosidases. In contrast, the alpha-acarviosinyl-(1-->9)-3-alpha-D-glucopyranosylpropen exhibited a 3.0-fold improved inhibition potency against rat intestine alpha-glucosidase with 0.3-fold inhibition potency against human pancreatic alpha-amylase relative to acarbose. In conclusion, alpha-acarviosinyl-(1-->9)-3-alpha-D-glucopyranosylpropen is a novel alpha-glucosidase-selective inhibitor with 10-fold enhanced selectivity toward alpha-glucosidase over alpha-amylase relative to acarbose, and it could be applied as a potent hypoglycemic agent.

  16. Effect of the lectins wheat germ agglutinin (WGA) and Ulex europaeus agglutinin (UEA-I) on the alpha-amylase secretion of rat pancreas in vitro and in vivo.


    Mikkat, U; Damm, I; Schröder, G; Schmidt, K; Wirth, C; Weber, H; Jonas, L


    Lectins are able to bind to cholecystokinin (CCK) receptors and other glycosylated membrane proteins. The lectins wheat germ agglutinin (WGA) and Ulex europaeus agglutinin (UEA-I) are used for affinity chromatography to isolate the highly glycosylated CCK-A receptor of pancreatic acinar cells. According to the working hypothesis that lectin binding to the CCK receptor should alter the ligand-receptor interaction, the effect of WGA and UEA-I on CCK-8-induced enzyme secretion was studied on isolated rat pancreatic acini in vitro. In vitro both lectins showed a dosage-dependent inhibition of CCK-8-induced alpha-amylase secretion of acini over 60 min. WGA showed a strong inhibitory effect on amylase secretion, approximately 40%, in vitro. UEA-I caused a smaller, but significant decrease, approximately 20%, in enzyme secretion of isolated acini. Additionally, both lectins inhibited cerulein/secretin- or cerulein-induced pancreatic secretion of rats in vivo, but not after secretin alone. The results are discussed with respect to a possible influence of both lectins on the interaction of CCK or cerulein with the CCK-A receptor.

  17. Efficient production of optically pure D-lactic acid from raw corn starch by using a genetically modified L-lactate dehydrogenase gene-deficient and alpha-amylase-secreting Lactobacillus plantarum strain.


    Okano, Kenji; Zhang, Qiao; Shinkawa, Satoru; Yoshida, Shogo; Tanaka, Tsutomu; Fukuda, Hideki; Kondo, Akihiko


    In order to achieve direct and efficient fermentation of optically pure D-lactic acid from raw corn starch, we constructed L-lactate dehydrogenase gene (ldhL1)-deficient Lactobacillus plantarum and introduced a plasmid encoding Streptococcus bovis 148 alpha-amylase (AmyA). The resulting strain produced only D-lactic acid from glucose and successfully expressed amyA. With the aid of secreting AmyA, direct D-lactic acid fermentation from raw corn starch was accomplished. After 48 h of fermentation, 73.2 g/liter of lactic acid was produced with a high yield (0.85 g per g of consumed sugar) and an optical purity of 99.6%. Moreover, a strain replacing the ldhL1 gene with an amyA-secreting expression cassette was constructed. Using this strain, direct D-lactic acid fermentation from raw corn starch was accomplished in the absence of selective pressure by antibiotics. This is the first report of direct D-lactic acid fermentation from raw starch.

  18. The literature on inhibitors: articles that influence my management of patients with hemophilia A and high-titer inhibitors.


    Leissinger, Cindy A


    High-titer inhibitors represent the greatest management challenge faced by clinicians who treat patients with hemophilia A, as bleeding episodes no longer respond to standard factor VIII replacement therapy. Over the last seven decades, major strides have been made in inhibitor treatment. This article focuses on the seminal clinical observations and studies that provided the foundation for these advances in hemophilia care.

  19. Elevated Salivary Alpha-Amylase Level, Association Between Depression and Disease Activity, and Stress as a Predictor of Disease Flare in Systemic Lupus Erythematosus

    PubMed Central

    Jung, Ju-Yang; Nam, Jin-Young; Kim, Hyoun-Ah; Suh, Chang-Hee


    Abstract Psychological stress has been shown to trigger systemic lupus erythematosus (SLE). However, objective evidence of symptom aggravation due to mental stress is difficult to identify. We aimed to investigate the relationship between SLE disease activity and mental stress, and the usefulness of saliva as an assessment index for stress in patients with SLE. We prospectively assessed the salivary stress hormone and disease-related biomarkers, and questionnaire data regarding stress and depression in 100 patients with SLE and 49 sex- and age-matched normal controls (NCs). Patients with SLE had higher mean salivary α-amylase levels (5.7 ± 4.6 U/mL vs 2.7 ± 2.5 U/mL, P < 0.001), anti-chromatin antibody levels (25.3 ± 22.9 U/mL vs 15.9 ± 10.9 U/mL, P < 0.001), and Beck Depression Index (BDI) scores (11.1 ± 9.2 vs 5.3 ± 5.1, P < 0.001) than NCs. However, salivary cortisol levels and Perceived Stress Scale (PSS) scores did not differ between the groups. The BDI scores correlated with the SLE disease activity index (SLEDAI) scores (r = 0.253, P = 0.011) and erythrocyte sedimentation rates (r = 0.234, P = 0.019). SLE patients with the highest-quartile PSS scores had significantly increased SLEDAI scores compared to those with the lowest-quartile PSS scores after 4 to 5 months’ follow-up. Moreover, SLE patients with elevated SLEDAI scores had higher baseline PSS scores. Patients with SLE showed uncoupling of the sympathetic nervous system and hypothalamic–pituitary–adrenal axis; higher salivary α-amylase and no different cortisol levels compared with NCs. Also, patients with SLE were more depressed, which correlated with disease activity. Furthermore, perceived stress was not correlated with disease activity; however, disease activity worsened several months later with elevated perceived stress levels. PMID:26222848

  20. alpha 2-Plasmin inhibitor metabolism in patients with liver cirrhosis.


    Knot, E A; Drijfhout, H R; ten Cate, J W; de Jong, E; Iburg, A H; Kahlé, L H; Grijm, R


    We describe the metabolism of purified human alpha 2-plasmin inhibitor in patients with liver cirrhosis to determine whether low plasma concentrations of alpha 2-plasmin inhibitor are the result of impaired synthesis or increased catabolism or both. A kinetic study was performed with 131I-alpha 2-plasmin inhibitor as a sensitive parameter of fibrinolysis in 14 patients with histologically proved liver cirrhosis compared with six healthy control subjects. Eight patients had macronodular cirrhosis (with positive hepatitis B surface antigen), and six had micronodular cirrhosis as a result of alcohol abuse. None of the patients had clinical signs of ascites, and in all the disease was stabilized. alpha 2-Plasmin inhibitor levels biologically and immunologically measured were decreased in all patients. Ten microCi 131I-alpha 2PI was injected intravenously, the disappearance of plasma radioactivity was measured, and turnover data were calculated according to the function x(t) = A1e-alpha 1t + A2e-alpha 2t + Be-beta t. Mean (+/- SD) turnover data in the control subjects were plasma radioactivity half-life 60.1 +/- 5.3 hours, fractional catabolic rate constant of the plasma pool 0.0318 +/- 0.0106 hr-1, and absolute catabolic (synthetic) rate constant 2.10 +/- 0.60 mg/kg/day. The alpha 1-phase was 1.26 +/- 0.23, and the transcapillary influx constant (k2,1) was 0.974 +/- 0.109 hr-1. In the patients, plasma radioactivity half-life was 58.7 +/- 12.09 hr, and fractional catabolic rate constant of the plasma pool 0.0283 +/- 0.0043 hr-1. The alpha 1-phase 4.74 +/- 6.48 and the transcapillary influx (k2,1) 3.08 +/- 3.9 hr-1 were both significantly increased compared with control values (p less than 0.05 and p less than 0.05, respectively.(ABSTRACT TRUNCATED AT 250 WORDS)

  1. Pattern of factor VIII inhibitors in patients with hemophilia A in the north east of Iran.


    Modaresi, A R; Torghabeh, H Mansouri; Pourfathollah, A A; Shooshtari, M Mahmoodian; Yazdi, Z Rezaie


    This survey was conducted to evaluate coagulation factor VIII:C inhibitors among 102 hemophilia A patients from different cities of Khorasan province in north east of Iran in order to identify and characterize the pattern of inhibitor formation in these patients population. For this purpose, we randomly obtained plasma samples of 102 hemophilia A patients (44 patients with severe, 28 patients with intermediate and 30 patients with mild hemophilia A) and studied them using two tests: the APTT mix and Bethesda test were performed. In the whole group 20 patients (19.6%) factor VIII inhibitors were detected. These were in 11 patients with severe, five patients with intermediate and four patients with mild hemophilia A. None of patients with hemophilia A had previously been studied for the presence of an inhibitor, so there was no existing history of inhibitor evaluation.

  2. Alteration of consciousness via diverse photo-acoustic stimulatory patterns. Phenomenology and effect on salivary flow rate, alpha-amylase and total protein levels.


    Beck, Anita; Fábián, Gábor; Fejérdy, Pál; Krause, Wolf-Rainer; Hermann, Péter; Módos, Károly; Varga, Gábor; Fábián, Tibor Károly


    Long-term photo-acoustic stimulation is used for the induction of altered states of consciousness for both therapeutic and experimental purposes. Long-term photo-acoustic stimulation also leads to changes in the composition of saliva which have a key contribution to the efficiency of this technique in easing mucosal symptoms of oral psychosomatic patients. The aim of this study is to find out whether there is any cumulative effect of repeated stimulation and whether there are any detectable differences between diverse stimulatory patterns of long lasting photo-acoustic stimulation on the phenomenology of the appearing trance state and on salivary secretion. There was significant cumulative effect in relation with the appearance of day dreaming as phenomenological parameter, and in relation with protein output and amylase/protein ratio as salivary parameter. Pattern specific effect was detectable in relation with salivary flow rate only. Although our results clearly indicate the existence of certain cumulative and stimulation-pattern specific effects of repeated photo-acoustic stimulation, the absolute values of all these effects were relatively small in this study. Therefore, in spite of their theoretical importance there are no direct clinical consequences of these findings. However, our data do not exclude at all the possibility that repeated stimulation with other stimulatory parameters may lead to more pronounced effects. Further studies are needed to make clear conclusion in this respect.

  3. Determining the relationship of acute stress, anxiety, and salivary alpha-amylase level with performance of student nurse anesthetists during human-based anesthesia simulator training.


    McKay, Kelly A Chiffer; Buen, John E; Bohan, Kevin J; Maye, John P


    Managing stress for student nurse anesthetists represents a multifaceted educational concern for anesthesia educators. Our purpose was to determine the relationship between physiologic measures of stress and performance of student nurse anesthetists during anesthesia simulator training. Following institutional review board approval, 78 students were enrolled from a nurse anesthesia program. A prospective descriptive design was used to compare baseline, acute, and recovery measurements of stress with performance scores of students during an induction and intubation sequence in a patient simulator. Performance scores were stratified into low-, moderate-, and high-performing groups based on scores received from trained observers. A statistically significant difference in physiologic measures of stress was detected between baseline and acute levels of salivary a-amylase (P = .017), heart rate (P = .003), and anxiety levels (P = .001). No significant differences were found when measures of stress were compared with performance of low, moderate, or high performers. This investigation revealed remarkable findings regarding the relationship between stress and student performance. Analysis of the descriptive statistics and means of each group suggests that low performers have increased stress and perform poorly, whereas high performers have increased stress and perform superbly, and moderate performers have modest stress and perform moderately.

  4. Cardiovascular considerations in patients treated with HIV protease inhibitors.


    Colagreco, Joseph P


    Highly active antiretroviral therapy (HAART) has dramatically reduced mortality from HIV infection, transforming it in many cases to a chronic condition. However, protease inhibitors (PIs), which are integral components of most HAART regimens, are commonly associated with a host of metabolic disturbances that may increase the risk of cardiovascular disease in patients with HIV infection, potentially counteracting some of the positive health effects of PIs. Dyslipidemia is of particular concern. The Adult AIDS Clinical Trials Group has established preliminary guidelines to evaluate and treat PI-associated dyslipidemia. A number of strategies exist for the management of PI-based dyslipidemia in HAART recipients; their advantages and disadvantages should be considered when treating patients with HIV infection.

  5. Treatment of young patients with lupus nephritis using calcineurin inhibitors

    PubMed Central

    Tanaka, Hiroshi; Tsuruga, Kazushi; Aizawa-Yashiro, Tomomi; Watanabe, Shojiro; Imaizumi, Tadaatsu


    Recent advances in the management of lupus nephritis, together with earlier renal biopsy and selective use of aggressive immunosuppressive therapy, have contributed to a favorable outcome in children and adolescents with systemic lupus erythematosus (SLE). Nevertheless, we believe that a more effective and less toxic treatment is needed to attain an optimal control of the activity of lupus nephritis. Recent published papers and our experiences regarding treatment of young patients with lupus nephritis using calcineurin inhibitors are reviewed. Although it has been reported that intermittent monthly pulses of intravenous cyclophosphamide (IVCY) are effective for preserving renal function in adult patients, CPA is a potent immunosuppressive agent that induces severe toxicity, including myelo- and gonadal toxicity, and increases the risk of secondary malignancy. Thus, treatment for controlling lupus nephritis activity, especially in children and adolescents, remains challenging. Cyclosporine A (CsA) and tacrolimus (Tac) are T-cell-specific calcineurin inhibitors that prevent the activation of helper T cells, thereby inhibiting the transcription of the early activation genes of interleukin (IL)-2 and suppressing T cell-induced activation of tumor necrosis factor-α, IL-1β and IL-6. Therefore, both drugs, which we believe may be less cytotoxic, are attractive therapeutic options for young patients with lupus nephritis. Recently, a multidrug regimen of prednisolone (PDN), Tac, and mycophenolate mofetile (MMF) has been found effective and relatively safe in adult lupus nephritis. Since the mechanisms of action of MMF and Tac are probably complementary, multidrug therapy for lupus nephritis may be useful. We propose as an alternative to IVCY, a multidrug therapy with mizoribine, which acts very similarly to MMF, and Tac, which has a different mode of action, combined with PDN for pediatric-onset lupus nephritis. We also believe that a multidrug therapy including CsA and

  6. Genetic factors influencing inhibitor development in a cohort of South African haemophilia A patients.


    Lochan, A; Macaulay, S; Chen, W C; Mahlangu, J N; Krause, A


    A critical complication of factor VIII (FVIII) replacement therapy in Haemophilia A (HA) treatment is inhibitor development. Known genetic factors predisposing to inhibitor development include FVIII (F8) gene mutations, ethnicity, a family history of inhibitors and FVIII haplotype mismatch. The aim of this study was to characterize and correlate these genetic factors in a cohort of South African HA patients. This was a retrospective study that included 229 patients and involved the analysis of patient files, HA molecular and clinical databases and molecular analysis of the F8 gene haplotype. Of the 229 patients, 51% were of black ethnicity, 49% were white, 5% had mild HA, 4% were moderate and 91% were severe, 36% were int22 positive and 13% were inhibitor positive. Of the inhibitor positive patients, 72% were black patients. Inhibitors were reported in 27% of black int22 positive patients, 13% of black int22 negative patients, 9% of white int22 positive patients and 7% of white int22 negative. The H1 haplotype was more common in whites (75%) and H2 was more common in blacks (74%). H3 and H5 were only found in black patients and had a higher frequency of inhibitor development than H1 and H2. In this small HA cohort, black patients had a significantly higher frequency of inhibitor development and the results were indicative of an association between inhibitor development, ethnicity and haplotype.

  7. The prevalence of factor VIII and IX inhibitors among Saudi patients with hemophilia

    PubMed Central

    Owaidah, Tarek; Momen, Abdulkareem Al; Alzahrani, Hazzaa; Almusa, Abdulrahman; Alkasim, Fawaz; Tarawah, Ahmed; Nouno, Randa Al; Batniji, Fatima Al; Alothman, Fahad; Alomari, Ali; Abu-Herbish, Saud; Abu-Riash, Mahmoud; Siddiqui, Khawar; Ahmed, Mansor; Mohamed, SY; Saleh, Mahasen


    Abstract Hemophilia A and B are X-linked diseases that predominantly affect male patients. Patients can develop coagulation factor inhibitors, which exponentially increases the treatment cost. However, the prevalence of factor VIII and IX inhibitors in Saudi Arabia is unclear. This study aimed to determine the Saudi prevalence of factor VIII and IX inhibitors. This 4-year, 7-center, cross-sectional study evaluated the Saudi prevalences of hemophilia A and B. We collected the patients’ clinical data, evaluated their disease, and tested for factor inhibitors. We included 202 patients with hemophilia (median age at diagnosis: 0.13 years, range: birth–34.8 years). The patients included 198 male patients (98%), 148 patients with hemophilia A (73.3%), and 54 patients with hemophilia B (26.7%). The patients exhibited severe factor VIII activity (<1%; 121 patients; 5.2%), moderate activity (1–5%; 7 patients; 4.9%), and mild activity (14 patients; 9.9%). Among the patients with care-related data, most patients were treated for episodic bleeding (76.8%) or received prophylaxis (22.6%); 1 patient received both treatments. Among the patients with source-related data, the factor replacements were derived from plasma (48.4%), recombinant concentrates (22.9%), both sources (14.6%), or fresh frozen plasma (14.1%). Factor VIII inhibitors were observed in 43 (29.3%) of the 147 patients, and only 1 of the 54 patients developed factor IX inhibitors. Most patients who developed inhibitors had severe hemophilia (40/44; 90.9%), and inhibitors were also common among patients who received recombinant products (14/43; 32.6%). The Saudi prevalence of factor inhibitors was similar to those among other ethnic populations. PMID:28079788

  8. Selective serotonin reuptake inhibitor drug interactions in patients receiving statins.


    Andrade, Chittaranjan


    Elderly patients commonly receive statin drugs for the primary or secondary prevention of cardiovascular and cerebrovascular events. Elderly patients also commonly receive antidepressant drugs, usually selective serotonin reuptake inhibitors (SSRIs), for the treatment of depression, anxiety, or other conditions. SSRIs are associated with many pharmacokinetic drug interactions related to the inhibition of the cytochrome P450 (CYP) metabolic pathways. There is concern that drugs that inhibit statin metabolism can trigger statin adverse effects, especially myopathy (which can be potentially serious, if rhabdomyolysis occurs). However, a detailed literature review of statin metabolism and of SSRI effects on CYP enzymes suggests that escitalopram, citalopram, and paroxetine are almost certain to be safe with all statins, and rosuvastatin, pitavastatin, and pravastatin are almost certain to be safe with all SSRIs. Even though other SSRI-statin combinations may theoretically be associated with risks, the magnitude of the pharmacokinetic interaction is likely to be below the threshold for clinical significance. Risk, if at all, lies in combining fluvoxamine with atorvastatin, simvastatin, or lovastatin, and even this risk can be minimized by using lower statin doses and monitoring the patient.

  9. Treatment of patients with hemophilia A and inhibitors to factor FVIII with cimetidine.


    Ambriz Fernandez, R; Quintana Gonzalez, S; Martinez Murillo, C; Dominguez Garcia, V; Rodriguez Moyado, H; Collazo Jaloma, J


    In this study, cimetidine was used to treat patients with hemophilia A and inhibitors to factor VIII who presented with acute hemorrhages (Group A) and those without hemorrhages (Group B). The dose of cimetidine was 15 mg/kg/day. Group A consisted of five patients with inhibitors between 156 and > 10,000 Bethesda Units (BU), all with serious hemorrhagic problems. The control of hemorrhaging was effective in 100% of these patients, although inhibitor levels remained high (25-380 BU). Group B consisted of seven patients who did not have hemorrhages, whose inhibitor levels were 41-358 BU. Five of these patients no longer had anamnestic responses to Factor VIII after several months of treatment with cimetidine. No difference in the response to cimetidine was seen between HIV positive and HIV negative patients. The results suggest that cimetidine is useful to suppress inhibitors to Factor VIII in patients with hemophilia A.

  10. Synthesis of nitrogen analogues of salacinol and their evaluation as glycosidase inhibitors.


    Ghavami, A; Johnston, B D; Jensen, M T; Svensson, B; Pinto, B M


    The syntheses of two nitrogen analogues (11 and 12) of the naturally occurring sulfonium ion, salacinol (7) are described. The latter compound is one of the active principles in the aqueous extracts of Salacia reticulata that are traditionally used in Sri Lanka and India for the treatment of diabetes. The synthetic strategy relies on the nucleophilic attack of a 1,4-dideoxy-1,4-imino-D- or L-arabinitol at the least hindered carbon of 2,4-O-benzylidene D- or L-erythritol-1,3-cyclic sulfate. The nitrogen analogues bear a permanent positive charge and serve as mimics of the sulfonium ion. We reasoned that these ammonium derivatives should function in a manner similar to that of known glycosidase inhibitors of the alkaloid class such as castanospermine (4) and deoxynojirimycin (5). Enzyme inhibition assays indicate that salacinol (7) is a weak (K(i) = 1.7 mM) inhibitor of glucoamylase, whereas compounds 11 and 12 inhibit glucoamylase with K(i) values in the range approximately 10-fold higher. The nitrogen analogues 11 and 12 showed no significant inhibitory effect of either barley alpha-amylase (AMY1) or porcine pancreatic alpha-amylase (PPA) at concentrations of 5 mM. In contrast, salacinol (7) inhibited AMY1 and PPA in the micromolar range, with K(i) values of 15 +/- 1 and 10 +/- 2 microM, respectively.

  11. Serious infection from Staphylococcus aureus in 2 HIV-infected patients receiving fusion inhibitor therapy.


    Gaughan, Elizabeth M; Ritter, Michelle L; Kumar, Princy N; Timpone, Joseph G


    Fusion inhibitors are novel antiretroviral agents, administered as subcutaneous injections, approved for use in treatment-experienced HIV-infected patients. HIV-infected patients are at increased risk for Staphylococcus aureus colonization, specifically with methicillin-resistant S aureus (MRSA), and subsequent systemic infection. We present the cases of 2 patients without a history of MRSA infection in whom a series of severe S aureus infections developed after fusion inhibitor therapy.

  12. Improved prediction of inhibitor development in previously untreated patients with severe haemophilia A.


    Hashemi, S M; Fischer, K; Moons, K G M; van den Berg, H M


    Treatment of previously untreated patients (PUPs) with severe haemophilia A is complicated by the formation of inhibitors. Prediction of PUPs with high risk is important to allow altering treatment with the intention to reduce the occurrence of inhibitors. An unselected multicentre cohort of 825 PUPs with severe haemophilia A (FVIII<0.01 IU mL(-1) ) was used. Patients were followed until 50 exposure days (EDs) or inhibitor development. All predictors of the existing prediction model including three new potential predictors were studied using multivariable logistic regression. Model performance was quantified [area under the curve (AUC), calibration plot] and internal validation (bootstrapping) was performed. A nomogram for clinical application was developed. Of the 825 patients, 225 (28%) developed inhibitors. The predictors family history of inhibitors, F8 gene mutation and an interaction variable of dose and number of EDs of intensive treatment were independently associated with inhibitor development. Age and reason for first treatment were not associated with inhibitor development. The AUC was 0.69 (95% CI 0.65-0.72) and calibration was good. An improved prediction model for inhibitor development and a nomogram for clinical use were developed in a cohort of 825 PUPs with severe haemophilia A. Clinical applicability was improved by combining dose and duration of intensive treatment, allowing the assessment of the effects of treatment decisions on inhibitor risk and potentially modify treatment.

  13. Characteristics of hemophilia patients with factor VIII inhibitors detected by prospective screening

    PubMed Central

    Miller, Connie H.; Rice, Anne S.; Boylan, Brian; Payne, Amanda B.; Kelly, Fiona M.; Escobar, Miguel A.; Gill, Joan; Leissinger, Cindy; Soucie, J. Michael


    Characteristics of inhibitors identified by prospective screening may differ from those detected clinically. In a prospective study at 17 hemophilia centers with central inhibitor measurement by Nijmegen-Bethesda assay, 23 (2.8%) of 824 hemophilia A patients had new inhibitors detected: nine high-titer inhibitors (HTI: 7 ≥5.0 NBU plus 2 of 2.6 and 3.4 NBU at immune tolerance induction initiation) and 14 low-titer inhibitors (LTI: 0.5–1.9 NBU). HTI occurred at an earlier age (median 2 years, range 1–18, vs. median 11 years, range 2–61, P = 0.016). Both HTI (22%) and LTI (43%) occurred in non-severe patients. All HTI, but only 64% of LTI, were found to be FVIII-specific by chromogenic Bethesda assay or fluorescence immunoassay (FLI), indicating a high rate of false-positive LTI. Repeat specimens confirmed all HTI, 7/9 LTI, and 7/7 FVIII-specific LTI. FLI results were similar between HTI and FVIII-specific LTI; all included IgG1 and IgG4 subclasses. A comparable prospective study conducted from 1975 to 1979 at 13 U.S. centers found 31 (2.4%) new inhibitors among 1,306 patients. In both studies, one-third of inhibitors occurred in non-severe patients and one-quarter after 150 exposure days (ED). Significant differences were seen in the age at which inhibitors occurred (median 16 years in the older study vs. 5 years currently, P = 0.024) and in ED before inhibitor development, 10% in the older study and 43% currently study occurring within 20 ED, suggesting a temporal change in inhibitor development. Prospective screening detects inhibitors in patients of all severities, ages, and ED. Some LTI, however, are false positives. PMID:26147783

  14. Lyme neuroborreliosis in a patient treated with TNF-alpha inhibitor.


    Merkac, Maja Ivartnik; Tomazic, Janez; Strle, Franc


    A 57-year-old woman, receiving TNF-alpha inhibitor adalimumab for psoriasis, presented with early Lyme neuroborreliosis (Bannwarth's syndrome). Discontinuation of adalimumab and 14-day therapy with ceftriaxone resulted in a smooth course and favorable outcome of Lyme borreliosis. This is the first report on Lyme neuroborreliosis in a patient treated with TNF-alpha inhibitor.

  15. Case Reports That Illustrate the Efficacy of SGLT2 Inhibitors in the Type 1 Diabetic Patient.


    Bell, David S H


    SGLT2 inhibitors are only approved for use in adults with type 2 diabetes. However, because SGLT2 inhibitors have a mechanism of action that does not require the presence of endogenous insulin, these drugs should also be efficacious in type 1 diabetes where endogenous insulin production is greatly reduced or absent. Herein, I present five cases which illustrate the benefits of utilizing an SGLT2 inhibitor with type 1 diabetes. In these cases the use of SGLT2 inhibitors resulted not only in better glycemic control in most patients but also in some patients' less hypoglycemia, weight loss, and decreased doses of insulin. In type 1 diabetes Candida albicans vaginitis and balanitis may occur more frequently than in type 2 diabetes. These cases show that a large randomized clinical trial of SGLT2 inhibitors in type 1 diabetes needs to be performed.

  16. Do renin–angiotensin system inhibitors influence the recurrence, metastasis, and survival in cancer patients?

    PubMed Central

    Sun, Hong; Li, Tao; Zhuang, Rongyuan; Cai, Weimin; Zheng, Yuanting


    Abstract Background: Renin–angiotensin system inhibitors (RAS inhibitors) are antihypertensive agents with potential antitumor effects. However, various studies have yielded conflicting results on the influence of RAS inhibitors on survival of cancer patients. The aim of this study was to evaluate the effect of RAS inhibitors on recurrence, metastasis, and survival in cancer patients through a meta-analysis. Methods: PubMed, Web of Science, EMBASE, and Cochrane Library were systematically searched from inception to December 2016. The pooled hazard ratio (HR) with its 95% confidence interval (95% CI) was calculated to evaluate the association between RAS inhibitors and recurrence, metastasis, and survival in cancer patients. Results: Fifty-five eligible studies were included in the present meta-analysis. Results showed that there were significant improvements in overall survival (OS) (HR = 0.82; 95% CI: 0.77–0.88; P < 0.001), progression-free survival (HR = 0.74; 95% CI: 0.66–0.84; P < 0.001), and disease-free survival (HR = 0.80; 95% CI: 0.67–0.95; P = 0.01) in RAS inhibitor users compared with nonusers. Subgroup analyses revealed that the effect of RAS inhibitors on OS depended on the cancer type or different RAS inhibitors. Conclusion: This meta-analysis suggests that RAS inhibitors could improve the survival of cancer patients and depend on cancer type and types of RAS inhibitors. PMID:28353566

  17. Full-fledged proteomic analysis of bioactive wheat amylase inhibitors by a 3-D analytical technique: Identification of new heterodimeric aggregation states.


    Zoccatelli, Gianni; Dalla Pellegrina, Chiara; Mosconi, Silvia; Consolini, Marica; Veneri, Gianluca; Chignola, Roberto; Peruffo, Angelo; Rizzi, Corrado


    Wheat proteinaceous alpha-amylase inhibitors (alpha-AIs) are increasingly investigated for their agronomical role as natural defence molecules of plants against the attack of insects and pests, but also for their effects on human health. The wheat genomes code for several bioactive alpha-AIs that share sequence homology, but differ in their specificity against alpha-amylases from different species and for their aggregation states. Wheat alpha-AIs are traditionally classified as belonging to the three classes of tetrameric, homodimeric and monomeric forms, each class being constituted by a number of polypeptides that display different electrophoretic mobilities. Here we describe a proteomic approach for the identification of bioactive alpha-AIs from wheat and, in particular, a 3-D technique that allows to best identify and characterize the dimeric fraction. The technique takes advantage of the thermal resistance of alpha-AIs (resistant to T > 70 degrees C) and consists in the separation of protein mixtures by 2-D polyacrylamide/starch electrophoresis under nondissociating PAGE (ND-PAGE, first dimension) and dissociating (urea-PAGE or U-PAGE second dimension) conditions, followed by in-gel spontaneous reaggregation of protein complexes and identification of the alpha-amylase inhibitory activity (antizymogram, third dimension) using enzymes from human salivary glands and from the larvae of Tenebrio molitor coleopter (yellow mealworm). Dimeric alpha-AIs from Triticum aestivum (bread wheat) were observed to exist as heterodimers. The formation of heterodimeric complexes was also confirmed by in vitro reaggregation assays carried out on RP-HPLC purified wheat dimeric alpha-AIs, and their bioactivity assayed by antizymogram analysis. The present 3-D analytical technique can be exploited for fast, full-fledged identification and characterization of wheat alpha-AIs.

  18. [Laboratory monitoring of efficiency of different approaches to the therapy of patients with inhibitor form of haemophilia A].


    Nabieva, M I


    Revealing of inhibitors form of hemophilia A form patients of hemophilia in Republic of Uzbekistan was studied and peculiarities of this form of hemophilia also was studied. Shown, that revealing of inhibitors form from 405 patients of hemophilia A was 7,7%. Shown that from patients with inhibitors form more patients with low titr of inhibitors (77,1%). In patients with high titr of inhibitors in high degree was more heavy degree of hemophilia A, in patients with low titr of inhibitors more heavy form and heavy form of hemophilia A was in equal degree. Shown, that Cogenait drug and plasmapheresis in Pph-3 - Pph-5 regime render equal effect in reducing of inhibitor titr.

  19. The incidence and treatment of bleeding episodes in non-severe haemophilia A patients with inhibitors.


    van Velzen, Alice S; Eckhardt, Corien L; Streefkerk, Nina; Peters, Marjolein; Hart, Daniel P; Hamulyak, Karly; Klamroth, Robert; Meijer, Karina; Nijziel, Marten; Schinco, Piercarla; Yee, Thynn T; van der Bom, Johanna G; Fijnvandraat, Karin


    The development of an inhibitory antibody in non-severe haemophilia A patients may aggravate the bleeding phenotype considerably. Effective treatment of bleeding episodes may be challenging, with ensuing severe complications. At present, evidence is scarce for optimal treatment of bleeding episodes in this patient group. The aim of this study was to describe the incidence and the treatment of bleeding episodes in inhibitor patients in a population-based unselected cohort of non-severe haemophilia A patients with clinically relevant inhibitors. Data were available for 100 of the 107 non-severe haemophilia A patients (factor VIII (FVIII) baseline, 2-40 IU/dl) from 29 centres in Europe and one centre in Australia who had developed a clinically relevant inhibitor between 1980 and 2011. The majority (89 %) of the patients were treated during the inhibitor period for bleeding episodes or a surgical intervention: 66 % needed treatment for bleeding episodes, at a median annual bleeding rate (ABR) of 1.1 (interquartile range (IQR) 0.1-2.5) and a median total of 2 (IQR 1-6) bleeding episodes. Compared to the median ABR before inhibitor development of 0.095 bleeds per year (IQR 0.02-0.42), the increase in ABR is more than a 10-fold. More than 90 % of the bleeding episodes were treated with only one type of product, most frequently (51 %) FVIII concentrates. This study provides the incidence of bleeding episodes and treatment choices in non-severe haemophilia A patients with inhibitors. The 10-fold increase to a median ABR of 1.1 episodes per year emphasizes the impact of inhibitor development for non-severe haemophilia A patients.

  20. Factor 8 (F8) gene mutation profile of Turkish hemophilia A patients with inhibitors.


    Fidanci, Inanç D; Kavakli, Kaan; Uçar, Canan; Timur, Cetin; Meral, Adalet; Kilinç, Yurdanur; Sayilan, Hülya; Kazanci, Elif; Cağlayan, S Hande


    Factor VIII (FVIII) replacement therapy is ineffective in hemophilia A patients who develop alloantibodies (inhibitors) against FVIII. The type of factor 8 (F8) gene mutation, genes in the major histocompatibility complex loci, and also polymorphisms in IL-10 and tumor necrosis factor-alpha are the major predisposing factors for inhibitor formation. The present study was initiated to reveal the F8 gene mutation profile of 30 severely affected high-responder patients with inhibitor levels of more than 5 Bethesda U (BU)/ml and four low-responder patients with inhibitors less than 5 BU/ml. Southern blot and PCR analysis were performed to detect intron 22 and intron 1 inversions, respectively. Point mutations were screened by DNA sequence analysis of all coding regions, intron/exon boundaries, promoter and 3' UTR regions of the F8 gene. The prevalent mutation was the intron 22 inversion among the high-responder patients followed by large deletions, small deletions, and nonsense mutations. Only one missense and one splicing error mutation was seen. Among the low-responder patients, three single nucleotide deletions and one intron 22 inversion were found. All mutation types detected were in agreement with the severe hemophilia A phenotype, most likely leading to a deficiency of and predisposition to the development of alloantibodies against FVIII. It is seen that Turkish hemophilia A patients with major molecular defects have a higher possibility of developing inhibitors.

  1. We Avoid RAAS Inhibitors in PD Patients with Residual Renal Function.


    Turner, Jeffrey M


    Preserving residual renal function in patients on peritoneal dialysis (PD) positively impacts mortality. While it is important to avoid nephrotoxic agents in this setting, clinicians should appreciate that inhibitors of the renin-angiotensin-aldosterone system (RAAS), including angiotensin converting enzyme inhibitors, and angiotensin receptor blockers are likely to preserve glomerular filtration rate and prolong the time until patients on PD reach anuria, and this may improve mortality in these patients. In addition, RAAS blockade favorably affects the peritoneal membrane by reducing morphologic changes that can lead to ultrafiltration failure. This in turn may delay or prevent modality failure in patients on PD. Thus, clinicians should avoid the impulse to stop RAAS inhibitors in the PD population.

  2. Evaluation of Fibrinolytic Inhibitors: Alpha-2-Antiplasmin and Plasminogen Activator Inhibitor 1 in Patients with Obstructive Sleep Apnoea

    PubMed Central

    Kiciński, Paweł; Przybylska-Kuć, Sylwia; Dybała, Andrzej; Myśliński, Wojciech; Pastryk, Jolanta; Tomaszewski, Tomasz; Mosiewicz, Jerzy


    Obstructive sleep apnoea (OSA) induces thrombophilia and reduces fibrinolysis. Alpha-2-antiplasmin (a-2-AP) and plasminogen activator inhibitor 1 (PAI-1) are major inhibitors of the fibrinolytic system. Increased concentrations of these factors are associated with a higher risk of cardiovascular diseases. The aim of this study was to assess plasma a-2-AP and PAI-1 in patients with OSA and evaluate correlations with the polysomnographic record and selected risk factors of cardiovascular diseases. The study group comprised 45 patients with OSA, and the control group consisted of 19 patients who did not meet the diagnostic criteria of OSA. Plasma a-2-AP and PAI-1 concentrations were assessed by enzyme-linked immunosorbent assay (ELISA). In the study group, the median value of plasma a-2-AP was higher than that of the control group (157.34 vs. 11.89 pg/ml, respectively, P<0.0001). A-2-AP concentration increased proportionally to the severity of OSA. The concentration of a-2-AP was positively correlated with the apnoea-hypopnoea index (AHI), apnoea index (AI), respiratory disturbances time (RDT), and desaturaion index (DI), and negatively correlated with mean and minimal oxygen saturation (SpO2 mean, SpO2 min, respectively). The median value of PAI-1 was higher in the study group than the control group (12.55 vs. 5.40 ng/ml, respectively, P = 0.006) and increased along with OSA severity. PAI-1 concentration was positively correlated with AHI, AI, RDT, DI, and body mass index (BMI) and negatively correlated with SpO2 mean and SpO2 min. Higher plasma concentrations of a-2-AP and PAI-1 in patients with OSA indicated that these patients had increased prothrombotic activity. OSA increases the risk of cardiovascular complications as it enhances prothrombotic activity. PMID:27861608

  3. Evaluation of safety and effectiveness of factor VIII treatment in haemophilia A patients with low titre inhibitors or a personal history of inhibitor. Patient Data Meta-analysis of rAFH-PFM Post-Authorization Safety Studies.


    Romanov, Vadim; Marcucci, Maura; Cheng, Ji; Thabane, Lehana; Iorio, Alfonso


    There is no prospective evidence on inhibitor recurrence among haemophilia A patients with low titre inhibitors or history of inhibitors, and whether or how therapeutic choices affect the risk of recurrence. The aims of this study were to synthesise safety data in patients with moderate-severe haemophilia A and with low titre inhibitors or inhibitor history enrolled in the rAHF PFM (ADVATE) - Post-Authorization Safety Studies (ADVATE-PASS) international programme. The study was conducted in clinics participating to the ADVATE PASS programme. The patient population consisted of patients entering the studies with low titre (≤ 5 BU) inhibitors or a positive personal history of inhibitors. Patients on Immune Tolerance Induction at study entry were excluded. Primary outcome was new or recurrent inhibitor titre > 5 BU. Secondary outcomes were any increase of inhibitor titre not reaching 5 BU; any unexplained change in treatment regimen. Primary analysis was done by two-stage random effects meta-analysis. Secondary analysis was done by a hierarchical Bayesian random effects logistic model. A total of 219 patients from seven studies were included. Of these 214 (97.7 %) patients had been previously treated for more than 50 exposure days. Two hundred ten patients had positive history for inhibitors, nine a baseline measurable titre. No patient presented a primary outcome event (95 % confidence interval [CI] 0-1.6 %). Six patients with previous history developed a low titre recurrence (overall rate 2.2, 95 %CI 0-4.8 %). When any increase of inhibitor titre or any treatment change was accounted for, overall 3.7 % (95 % CI 0 %-8.0 %) of patients experienced the outcome. In conclusion, the observed rate of events does not support the definition of this population as at high risk for inhibitor development.

  4. Coagulation inhibitors and fibrinolytic parameters in patients on peritoneal dialysis and haemodialysis.


    Alwakeel, J; Gader, A M; Hurieb, S; al-Momen, A K; Mitwalli, A; Abu Aisha, H


    Coagulation inhibitors and fibrinolytic parameters were studied in twelve patients on continuous ambulatory peritoneal dialysis (CAPD) and ten patients on haemodialysis (HD). Patients on CAPD exhibited higher levels of ATIII and proteins C and S than those on HD. No significant differences were noted in tPA and PAI levels. Both groups of patients showed higher levels of tPA than controls. Besides, patients on HD had significantly lower levels of ATIII and protein C than controls. PAI levels in both patient groups were similar to those of the controls, but tPA levels were higher in patients than in controls. These results indicate that HD is associated with marked diminution in the circulating levels of coagulation inhibitors. This is in contrast to CAPD patients who showed elevated levels of these inhibitors, despite their significant loss in the dialysate. The finding of enhanced fibrinolysis in both patient groups may be a natural protective mechanism against the development of a thrombotic tendency.

  5. Assessment of 105 Patients with Angiotensin Converting Enzyme-Inhibitor Induced Angioedema

    PubMed Central

    von Buchwald, Christian; Prasad, Sumangali Chandra; Kamaleswaran, Shailajah; Ajgeiy, Kawa Khaled; Authried, Georg; Pallesen, Kristine Appel U.


    Objective. To asses a cohort of 105 consecutive patients with angiotensin converting enzyme-inhibitor induced angioedema with regard to demographics, risk factors, family history of angioedema, hospitalization, airway management, outcome, and use of diagnostic codes used for the condition. Study Design. Cohort study. Methods. This was a retrospective cohort study of 105 patients with angiotensin converting enzyme-inhibitor induced angioedema in the period 1995–2014. Results. The cohort consisted of 67 females and 38 males (F : M ratio 1.8), with a mean age of 63 [range 26–86] years. Female gender was associated with a significantly higher risk of angiotensin converting enzyme-inhibitor induced angioedema. 6.7% had a positive family history of angioedema. Diabetes seemed to be a protective factor with regard to angioedema. 95% experienced angioedema of the head and neck. 4.7% needed intubation or tracheostomy. 74 admissions took place during the study period with a total of 143 days spent in the hospital. The diagnosis codes most often used for this condition were “DT783 Quincke's oedema” and “DT78.4 Allergy unspecified”. Complement C1 inhibitor was normal in all tested patients. Conclusion. Female gender predisposes to angiotensin converting enzyme-inhibitor induced angioedema, whereas diabetes seems to be a protective factor. PMID:28286522

  6. Effects of xanthine oxidase inhibitors on renal function and blood pressure in hypertensive patients with hyperuricemia.


    Kohagura, Kentaro; Tana, Takeshi; Higa, Akira; Yamazato, Masanobu; Ishida, Akio; Nagahama, Kazufumi; Sakima, Atsushi; Iseki, Kunitoshi; Ohya, Yusuke


    Hyperuricemia may promote the progression of hypertension and renal dysfunction. However, the effects of hyperuricemia treatment on blood pressure and renal function in adult hypertensive patients with hyperuricemia remain unclear. A total of 137 hypertensive patients with hyperuricemia (96 men and 41 women; mean age of 67 years) who recently started taking xanthine oxidase inhibitors (allopurinol or febuxostat) as outpatients were recruited. Serum uric acid level, estimated glomerular filtration rate (eGFR, ml min(-1) per 1.73 m(2)) and blood pressure (mm Hg) were retrospectively compared immediately before and shortly after starting treatment with xanthine oxidase inhibitors. The mean blood pressure and the eGFR immediately before starting treatment were 128/71 mm Hg and 44.6 ml min(-1) per 1.73 m(2), respectively. Although the eGFR decreased from 46.6 to 44.6 ml min(-1) per 1.73 m(2) before starting treatment with xanthine oxidase inhibitors, it increased to 46.2 ml min(-1) per 1.73 m(2) (P=0.001, compared with immediately before treatment) without any significant changes in blood pressure after the administration of xanthine oxidase inhibitors. Multiple regression analysis revealed that the increase in eGFR after starting xanthine oxidase inhibitor treatment positively correlated with the changes in systolic blood pressure and negatively correlated with the changes in uric acid levels and the use of renin-angiotensin system inhibitors. These results suggest that xanthine oxidase inhibitors may delay the progression of renal dysfunction in adult hypertensive patients with hyperuricemia.

  7. Current European practice in immune tolerance induction therapy in patients with haemophilia and inhibitors.


    Astermark, J; Morado, M; Rocino, A; van den Berg, H M; von Depka, M; Gringeri, A; Mantovani, L; Garrido, R P; Schiavoni, M; Villar, A; Windyga, J


    The management of patients with inhibitors is an important challenge in haemophilia care. The lack of randomized controlled trials means that clinical decisions are generally based on subjective opinions, and purchasers' attention is likely to focus on the costs of treatment. In order to assess the current management of inhibitor patients and use of immune tolerance induction therapy (ITI) in Europe, we performed a survey within a European network of 21 comprehensive care centres from 14 countries (the European Haemophilia Therapy Standardisation Board). The survey identified a total of 381 patients with inhibitors attending the centres, 211 (55.4%) of whom had never been exposed to ITI. Between 1998 and 2003, the centres performed 233 procedures and 114 (48.9%) were successful. The survey demonstrated that dosing, which is the time to start and stop the ITI, the type of concentrate to use and the definition of success varied among the centres. Well-designed trials are warranted to guide decision-making, but in the absence of these studies we have developed consensus guidance for the management of inhibitor patients based on current clinical practice, as identified by the survey, and review of the literature.

  8. Relation of factor VIII and IX inhibitors with ABO blood groups in 150 patients with haemophilia A and B.


    Torghabeh, Hassan Mansouri; Pourfathollah, Aliakbar; Shooshtari, Mahmood Mahmoodian; Yazdi, Zahra Rezaie


    Many investigations have proved relations between ABO blood groups with some diseases and factor VIII and von willebrand level in plasma. In this study we investigated a relation between ABO blood groups and factor VIII and IX inhibitors in 102 patients with haemophilia A and 48 patients with haemophilia B. The assay of inhibitor was done by Bethesda method. There were no relation between ABO blood groups and factor VIII and IX inhibitors.

  9. Rocky Mountain Spotted Fever in a patient treated with anti-TNF-alpha inhibitors.


    Mays, Rana M; Gordon, Rachel A; Durham, K Celeste; LaPolla, Whitney J; Tyring, Stephen K


    Rocky Mountain Spotted Fever (RMSF) is a tick-bourne illness, which can be fatal if unrecognized. We discuss the case of a patient treated with an anti-TNF-alpha inhibitor for rheumatoid arthritis who later developed a generalized erythematous macular eruption accompanied by fever. The clinical findings were suggestive of RMSF, which was later confirmed with serology. Prompt treatment with doxyclycine is recommended for all patients with clinical suspicion of RMSF.

  10. Circulating tumour DNA profiling reveals heterogeneity of EGFR inhibitor resistance mechanisms in lung cancer patients.


    Chabon, Jacob J; Simmons, Andrew D; Lovejoy, Alexander F; Esfahani, Mohammad S; Newman, Aaron M; Haringsma, Henry J; Kurtz, David M; Stehr, Henning; Scherer, Florian; Karlovich, Chris A; Harding, Thomas C; Durkin, Kathleen A; Otterson, Gregory A; Purcell, W Thomas; Camidge, D Ross; Goldman, Jonathan W; Sequist, Lecia V; Piotrowska, Zofia; Wakelee, Heather A; Neal, Joel W; Alizadeh, Ash A; Diehn, Maximilian


    Circulating tumour DNA (ctDNA) analysis facilitates studies of tumour heterogeneity. Here we employ CAPP-Seq ctDNA analysis to study resistance mechanisms in 43 non-small cell lung cancer (NSCLC) patients treated with the third-generation epidermal growth factor receptor (EGFR) inhibitor rociletinib. We observe multiple resistance mechanisms in 46% of patients after treatment with first-line inhibitors, indicating frequent intra-patient heterogeneity. Rociletinib resistance recurrently involves MET, EGFR, PIK3CA, ERRB2, KRAS and RB1. We describe a novel EGFR L798I mutation and find that EGFR C797S, which arises in ∼33% of patients after osimertinib treatment, occurs in <3% after rociletinib. Increased MET copy number is the most frequent rociletinib resistance mechanism in this cohort and patients with multiple pre-existing mechanisms (T790M and MET) experience inferior responses. Similarly, rociletinib-resistant xenografts develop MET amplification that can be overcome with the MET inhibitor crizotinib. These results underscore the importance of tumour heterogeneity in NSCLC and the utility of ctDNA-based resistance mechanism assessment.

  11. Circulating tumour DNA profiling reveals heterogeneity of EGFR inhibitor resistance mechanisms in lung cancer patients

    PubMed Central

    Chabon, Jacob J.; Simmons, Andrew D.; Lovejoy, Alexander F.; Esfahani, Mohammad S.; Newman, Aaron M.; Haringsma, Henry J.; Kurtz, David M.; Stehr, Henning; Scherer, Florian; Karlovich, Chris A.; Harding, Thomas C.; Durkin, Kathleen A.; Otterson, Gregory A.; Purcell, W. Thomas; Camidge, D. Ross; Goldman, Jonathan W.; Sequist, Lecia V.; Piotrowska, Zofia; Wakelee, Heather A.; Neal, Joel W.; Alizadeh, Ash A.; Diehn, Maximilian


    Circulating tumour DNA (ctDNA) analysis facilitates studies of tumour heterogeneity. Here we employ CAPP-Seq ctDNA analysis to study resistance mechanisms in 43 non-small cell lung cancer (NSCLC) patients treated with the third-generation epidermal growth factor receptor (EGFR) inhibitor rociletinib. We observe multiple resistance mechanisms in 46% of patients after treatment with first-line inhibitors, indicating frequent intra-patient heterogeneity. Rociletinib resistance recurrently involves MET, EGFR, PIK3CA, ERRB2, KRAS and RB1. We describe a novel EGFR L798I mutation and find that EGFR C797S, which arises in ∼33% of patients after osimertinib treatment, occurs in <3% after rociletinib. Increased MET copy number is the most frequent rociletinib resistance mechanism in this cohort and patients with multiple pre-existing mechanisms (T790M and MET) experience inferior responses. Similarly, rociletinib-resistant xenografts develop MET amplification that can be overcome with the MET inhibitor crizotinib. These results underscore the importance of tumour heterogeneity in NSCLC and the utility of ctDNA-based resistance mechanism assessment. PMID:27283993

  12. Differences between Type I Autoimmune Inhibitors of Fibrin Stabilization in Two Patients with Severe Hemorrhagic Disorder

    PubMed Central

    Lopaciuk, S.; Bykowska, K.; McDonagh, J. M.; McDonagh, R. P.; Yount, W. J.; Fuller, C. R.; Cooperstein, L.; Gray, A.; Lorand, L.


    Inhibitors of fibrin stabilization of apparently autoimmune origin, found in two severely bleeding unrelated patients (W. G. and G. A.), were compared with regard to their biological target specificities, potencies and immunological characteristics. Both interfered only with the activation of fibrin stabilizing factor (coagulation Factor XIII) and, while totally preventing the conversion of this zymogen to the functional transamidating enzyme, fibrinoligase (Factor XIIIa), they showed very little inhibition toward the enzyme itself. Thus, according to the classification of Lorand concerning biological specificities, both can be characterized as Type I inhibitors of fibrin stabilization. Potencies of the two inhibitors were quite similar when measured in conjunction with the plasma zymogen, but they differed remarkably in tests with platelet Factor 13. The inhibitor of patient W. G. prevented the activation of the zymogen from platelets, but that of G. A. had no effect on the platelet factor. It may therefore be concluded that the inhibitor of W. G. is directed exclusively against the a subunit which is a common constituent of plasma as well as platelet factors. The inhibitor of G. A., however, must be targeted against determinants uniquely characteristic for the ab ensemble of the plasma zymogen including the b subunit. On the basis of this difference in target specificity, the inhibitor of W. G. is designated as Type I-1 and that of G. A. as Type I-2. The inhibitors of both patients were isolated as immunoglobulins, and neutralization tests revealed that the antibody of W. G. comprised mainly heavy chains of the IgG1 and light chains of the κ class. The antibody of G. A. proved to be considerably more heterogeneous and contained IgG1 and IgG3 heavy chains as well as κ- and λ-light chains. The finding that the antibody of W. G. inhibited conversion of platelet Factor 13 and also its thrombinmodified form, but had no effect on the thrombin and Ca2+-activated

  13. Adjuvant therapy with tamoxifen compared to aromatase inhibitors for 257 male breast cancer patients.


    Eggemann, Holm; Ignatov, Atanas; Smith, Bobbie J; Altmann, Udo; von Minckwitz, Gunter; Röhl, Freidrich W; Jahn, Mark; Costa, Serban-Dan


    To determine the impact of adjuvant treatment with tamoxifen and aromatase inhibitors (AI) on the survival of men with breast cancer. We analyzed 257 male patients with hormone-receptor-positive breast cancer from numerous German population-based cancer registries treated with tamoxifen (N = 207) or aromatase inhibitors (N = 50). The median follow-up was 42.2 (range 2-115) months. Median age at diagnosis was 68 (range 36-91) years. Thirty-seven (17.9 %) patients treated with tamoxifen and 16 (32.0 %) patients treated with AI died (log rank p = 0.007). After the adjustment for the patient's age, tumor size, node status, and tumor grading, the AI treatment was linked to a 1.5-fold increase in risk of mortality compared to tamoxifen (HR 1.55; 95 % CI: 1.13-2.13; p = 0.007). The overall survival in male breast cancer was significantly better after adjuvant treatment with tamoxifen compared to an aromatase inhibitor. Tamoxifen should be considered as the treatment of choice for hormone-receptor-positive male breast cancer.

  14. Is some better than none: are TEG and TGA profiles different in severe FVIII-deficient patients with inhibitors?


    Salinas, V; Carmona, R; Mohammed, B M; Martin, E J; Brophy, D F; Young, G


    Severe factor VIII (FVIII)-deficient patients with and without FVIII inhibitors cannot be distinguished using FVIII levels. The FVIII assay is sensitive to detect factor levels below 1%. While severe FVIII-deficient, non-inhibitor patients have FVIII < 1%, they may retain unmeasurable residual factor activity. In contrast, inhibitor patients have a FVIII antibody that presumably fully eliminates FVIII activity. It is unknown whether thromboelastography (TEG) and thrombin generation assay (TGA) can differentiate between patients with FVIII < 1% with and without the presence of FVIII inhibitors. The primary objective was to discern whether TEG and TGA could differentiate between severe FVIII-deficient patients with and without the presence of FVIII inhibitors. A secondary objective was to correlate TEG and TGA to annualized bleeding rates. This observational study performed TEG and TGA in healthy volunteers (N = 15), severe FVIII-deficient (N = 15) and severe FVIII-deficient patients with inhibitors (N = 15). Kaolin-activated TEG was better at differentiating reaction time (31.3 vs. 120 min respectively, P = 0.004) and kinetics time (6.1 vs. 23.1 min respectively, P = 0.028) between the non-inhibitor and inhibitor patients. TEG activated by tissue factor in plasma-containing corn trypsin inhibitor failed to differentiate groups. The TGA failed to differentiate peak thrombin, endogenous thrombin potential and lag time between groups. There was no correlation between TEG and TGA with annualized bleeding rates. Kaolin-activated TEG, but not TGA, differentiated between severe FVIII-deficient patients with and without inhibitors. These assays did not find a correlation to annualized bleeding rate.

  15. Risk of Infectious Complications in Hemato-Oncological Patients Treated with Kinase Inhibitors

    PubMed Central

    Reinwald, Mark; Boch, Tobias; Hofmann, Wolf-Karsten; Buchheidt, Dieter


    Infectious complications are a major cause of morbidity and mortality in patients with hemato-oncological diseases. Although disease-related immunosuppression represents one factor, aggressive treatment regimens, such as chemotherapy, stem cell transplantation, or antibody treatment, account for a large proportion of infectious side effects. With the advent of targeted therapies affecting specific kinases in malignant diseases, the outcome of patients has further improved. Nonetheless, dependent on the specific pathway targeted or off-target activity of the kinase inhibitor, therapy-associated infectious complications may occur. We review the most common and approved kinase inhibitors targeting a variety of hemato-oncological malignancies for their immunosuppressive potential and evaluate their risk of infectious side effects based on preclinical evidence and clinical data in order to raise awareness of the potential risks involved. PMID:27127405

  16. Acquired Factor V Inhibitors in a Patient with End-stage Renal Disease

    PubMed Central

    Kitazawa, Atsushi; Misawa, Hideo; Nagahori, Katsuhiro; Koda, Ryo; Yoshino, Atsunori; Kawamoto, Shinya; Takeda, Tetsuro


    We report a case of acquired factor V inhibitors (AFVIs) in a patient with end-stage renal disease receiving warfarin therapy for atrial fibrillation. A 72-year-old Japanese man was admitted to our hospital complaining of tarry stools and abdominal pain. The laboratory findings revealed eosinophilia (52.1%), prolonged activated partial thromboplastin time (APTT) (98 s), PT (84 s), a factor V (FV) activity of <3%, and an FV inhibitor level of 6 Bethesda units/mL. After administration of prednisolone was started, his coagulation findings improved. However, his renal failure progressed, and he ultimately required chronic hemodialysis. This is the first case of AFVIs in a patient starting hemodialysis for end-stage renal disease. PMID:27904118

  17. Acquired Factor V Inhibitors in a Patient with End-stage Renal Disease.


    Kitazawa, Atsushi; Misawa, Hideo; Nagahori, Katsuhiro; Koda, Ryo; Yoshino, Atsunori; Kawamoto, Shinya; Takeda, Tetsuro

    We report a case of acquired factor V inhibitors (AFVIs) in a patient with end-stage renal disease receiving warfarin therapy for atrial fibrillation. A 72-year-old Japanese man was admitted to our hospital complaining of tarry stools and abdominal pain. The laboratory findings revealed eosinophilia (52.1%), prolonged activated partial thromboplastin time (APTT) (98 s), PT (84 s), a factor V (FV) activity of <3%, and an FV inhibitor level of 6 Bethesda units/mL. After administration of prednisolone was started, his coagulation findings improved. However, his renal failure progressed, and he ultimately required chronic hemodialysis. This is the first case of AFVIs in a patient starting hemodialysis for end-stage renal disease.

  18. Managing stomatitis in patients treated with Mammalian target of rapamycin inhibitors.


    Pilotte, Amy Potter; Hohos, Melissa Beth; Polson, Kathleen M O; Huftalen, Tarsha Marie; Treister, Nathaniel


    Mammalian target of rapamycin (mTOR) inhibitors are a class of targeted cancer therapeutic agents with clinical benefit for multiple tumor types. Oral ulcerations are a common side effect of mTOR inhibitors; however, the clinical findings resemble aphthous stomatitis rather than the mucositis seen with chemotherapy. Consequently, the appearance of aphthous-like oral ulcerations has been referred to as mTOR inhibitor-associated stomatitis (mIAS). The severity of mIAS can be minimized by following common preventive steps and initiating treatment at the first sign of mouth discomfort, thereby reducing the likelihood of treatment discontinuation. mIAS can be managed through prophylactic measures, such as patient education in oral hygiene and avoidance of triggers. Patients who develop mIAS may be treated topically using rinses or other local therapies, including corticosteroids. In severe cases, dose modifications may be required. Oncology nurses have an important role in the management of patients with cancer and are well positioned to offer strategies for minimizing the occurrence and impact of mIAS.

  19. Outcomes of Allogeneic Hematopoietic Cell Transplantation in Patients with Myelofibrosis With Prior exposure to JAK1/2 Inhibitors

    PubMed Central

    Shanavas, Mohamed; Popat, Uday; Michaelis, Laura C; Fauble, Veena; McLornan, Donal; Klisovic, Rebecca; Mascarenhas, John; Tamari, Roni; Arcasoy, Murat O; Davies, James; Gergis, Usama; Ukaegbu, Oluchi C; Kamble, Rammurti T; Storring, John M; Majhail, Navneet S; Romee, Rizwan; Verstovsek, Srdan; Pagliuca, Antonio; Vasu, Sumithira; Ernst, Brenda; Atenafu, Eshetu G; Hanif, Ahmad; Champlin, Richard; Hari, Paremeswaran; Gupta, Vikas


    The impact of JAK1/2 inhibitor therapy prior to allogeneic hematopoietic cell transplantation (HCT) has not been studied in a large cohort in myelofibrosis (MF). In this retrospective multicenter study, we analyzed outcomes of patients who underwent HCT for MF with prior exposure to JAK1/2 inhibitors. One hundred consecutive patients from participating centers were analyzed, and based on clinical status and response to JAK1/2 inhibitors at the time of HCT, patients were stratified into five groups: (a) clinical improvement (n=23), (b) stable disease (n=31), (c) new cytopenia/increasing blasts/intolerance (n=15), (d) progressive disease: splenomegaly (n=18), and (e) progressive disease: leukemic transformation (LT) (n=13). Overall survival (OS) at two years was 61% (95%CI, 49–71). This was 91% (95% CI, 69–98) for those who experienced clinical improvement, and 32% (95% CI, 8–59) for those who developed LT on JAK1/2 inhibitors. In multivariable analysis, response to JAK1/2 inhibitors (p=0.03), DIPSS score (p=0.003), and donor type (p=0.006) were independent predictors of survival. Among the 66 patients who remained on JAK1/2 inhibitors until stopped for HCT, two patients developed serious adverse events necessitating delaying of HCT, and another 8 patients had symptoms with lesser severity. Adverse events were more common in patients who started tapering or abruptly stopped their regular dose ≥6 days prior to conditioning therapy. We conclude that prior exposure to JAK1/2 inhibitors did not adversely affect post-transplant outcomes. Our data suggest that JAK1/2 inhibitors should be continued near to the start of conditioning therapy. The favorable outcomes of patients who experienced clinical improvement with JAK1/2 inhibitor therapy prior to HCT were particularly encouraging, and need further prospective validation. PMID:26493563

  20. Reinduction of PD1-inhibitor therapy: first experience in eight patients with metastatic melanoma.


    Blasig, Hanna; Bender, Carolin; Hassel, Jessica C; Eigentler, Thomas K; Sachse, Michael M; Hiernickel, Julia; Koop, Anika; Satzger, Imke; Gutzmer, Ralf


    Significant progress has been made in the treatment of metastatic melanoma during the last years. Approval of immune-checkpoint inhibitors and targeted therapies has been achieved recently. The sequencing of these therapies is an important issue. Here, we report our experience with the treatment and retreatment with PD1-inhibitors (PD1i) in eight patients. The patients (two female and seven male with a median age of 70 years, all melanoma stage IV, M1c) underwent a first treatment period with PD1i for a median of 5.5 months. Three (37.5%) patients had a stable disease as best response, two (25%) showed progression, two (25%) showed partial response, and one (12.5%) achieved complete remission. PD1i was discontinued due to disease progression in seven patients and due to side effects (pancreatitis) in one patient. Patients were subsequently treated with ipilimumab (n=2), or chemotherapy (n=4), or no other medical treatment (n=2). All eight patients were subsequently retreated with PD1i for a median of 2.5 months. One (12.5%) developed a partial response, whereas in three patients (37.5%) the disease was stabilized. PD1i have shown a high and durable response rate in the first-line treatment of metastatic melanoma. Our study suggests PD1i retreatment as a reasonable option for selected patients. Further investigations are needed to verify the value of PD1i re-exposure and to identify subgroups of patients who can benefit.

  1. Effects of tyramine administration in Parkinson's disease patients treated with selective MAO-B inhibitor rasagiline.


    deMarcaida, J Antonelle; Schwid, Steven R; White, William B; Blindauer, Karen; Fahn, Stanley; Kieburtz, Karl; Stern, Matthew; Shoulson, Ira


    Rasagiline is a novel, potent, and selective MAO-B inhibitor shown to be effective for Parkinson's disease. Traditional nonselective MAO inhibitors have been associated with dietary tyramine interactions that can induce hypertensive reactions. To test safety, tyramine challenges (50-75 mg) were performed in 72 rasagiline-treated and 38 placebo-treated Parkinson's disease (PD) patients at the end of two double-blind placebo-controlled trials of rasagiline. An abnormal pressor response was prespecified as three consecutive measurements of systolic blood pressure (BP) increases of >or= 30 mm Hg and/or bradycardia of < 40 beats/min. In the first study involving 55 patients with early PD on rasagiline monotherapy, no patients randomized to rasagiline (1 mg/2 mg; n = 38) or placebo (n = 17) developed systolic BP (SBP) or heart rate changes indicative of a tyramine reaction. In the second trial involving 55 levodopa-treated patients, 3 of 22 subjects on rasagiline 0.5 mg/day and 1 of 21 subjects on placebo developed asymptomatic, self-limiting SBP elevations >or= 30 mm Hg on three measurements. No subject on 1 mg/day rasagiline (0/12) experienced significant BP or heart rate changes following tyramine ingestion. These data demonstrate that rasagiline 0.5 to 2 mg daily is not associated with clinically significant tyramine reactions and can be used as monotherapy or adjunct to levodopa in PD patients without specific dietary tyramine restriction.

  2. F8 and F9 mutations in US haemophilia patients: correlation with history of inhibitor and race/ethnicity.


    Miller, C H; Benson, J; Ellingsen, D; Driggers, J; Payne, A; Kelly, F M; Soucie, J M; Craig Hooper, W


    Both genetic and treatment-related risk factors contribute to the development of inhibitors in haemophilia. An inhibitor surveillance system piloted at 12 US sites has the goal of assessing risk factors through prospective data collection. This report examines the relationship of genotype and race/ethnicity to history of inhibitor in a large cohort of US haemophilia patients. Mutation analysis was performed on 676 haemophilia A (HA) and 153 haemophilia B (HB) patients by sequencing, Multiplex Ligation-dependent Probe Amplification, and PCR for inversions in F8 introns 22 (inv22) and 1 (inv1). Two HB patients with deletions had history of inhibitor. In severe HA, frequency of history of inhibitor was: large deletion 57.1%, splice site 35.7%, inv22 26.8%, nonsense 24.5%, frameshift 12.9%, inv1 11.1% and missense 9.5%. In HA, 19.6% of 321 White non-Hispanics (Whites), 37.1% of 35 Black non-Hispanics (Blacks) and 46.9% of 32 Hispanics had history of inhibitor (P = 0.0003). Mutation types and novel mutation rates were similar across ethnicities. When F8 haplotypes were constructed, Whites and Hispanics showed only H1 and H2. Within H1, history of inhibitor was 12.4% in Whites, 40.0% in Blacks (P = 0.009) and 32.4% in Hispanics (P = 0.002). Inhibitor frequency is confirmed to vary by mutation type and race in a large US population. White patients with history of inhibitor did not exhibit rare F8 haplotypes. F8 gene analysis did not reveal a cause for the higher inhibitor frequencies in Black and Hispanic patients.

  3. Neurocognitive Impairment in Patients Treated with Protease Inhibitor Monotherapy or Triple Drug Antiretroviral Therapy

    PubMed Central

    Pérez-Valero, Ignacio; González-Baeza, Alicia; Estébanez, Miriam; Montes-Ramírez, María L.; Bayón, Carmen; Pulido, Federico; Bernardino, José I.; Zamora, Francisco X.; Monge, Susana; Gaya, Francisco; Lagarde, María; Rubio, Rafael; Hernando, Asunción; Arnalich, Francisco; Arribas, José R.


    Background In patients who remain virologically suppressed in plasma with triple-drug ART a switch to protease inhibitor monotherapy maintains high rates of suppression; however it is unknown if protease inhibitor monotherapy is associated to a higher rate of neurocognitive impairment. Methods In this observational, cross-sectional study we included patients with plasma virological suppression (≥1 year) without concomitant major neurocognitive confounders, currently receiving for ≥1 year boosted lopinavir or darunavir as monotherapy or as triple ART. Neurocognitive impairment was defined as per the 2007 consensus of the American Association of Neurology. The association between neurocognitive impairment and protease inhibitor monotherapy, adjusted by significant confounders, was analysed. Results Of the 191 included patients - triple therapy: 96, 1–2 years of monotherapy: 40 and >2 years of monotherapy: 55 - proportions (95% CI) with neurocognitive impairment were: overall, 27.2% (20.9–33.6); triple therapy, 31.6% (22.1–41.0); short-term monotherapy, 25.0% (11.3–38.7); long-term monotherapy: 21.4% (10.5–32.3); p = 0.38. In all groups, neurocognitive impairment was mildly symptomatic or asymptomatic by self-report. There were not significant differences in Global Deficit Score by group. In the regression model confounding variables for neurocognitive impairment were years on ART, ethnicity, years of education, transmission category and the HOMA index. Adjusted by these variables the Odds Ratio (95% CI) for neurocognitive impairment of patients receiving short-term monotherapy was 0.85 (0.29–2.50) and for long-term monotherapy 0.40 (0.14–1.15). Conclusions Compared to triple drug antiretroviral therapy, monotherapy with lopinavir/ritonavir or darunavir/ritonavir in patients with adequate plasma suppression was not associated with a higher rate of asymptomatic neurocognitive impairment than triple drug ART. PMID:23936029

  4. Effect of angiotensin-converting enzyme inhibitors on vascular endothelial function in hypertensive patients after intensive periodontal treatment.


    Rubio, María C; Lewin, Pablo G; De la Cruz, Griselda; Sarudiansky, Andrea N; Nieto, Mauricio; Costa, Osvaldo R; Nicolosi, Liliana N


    There is a relation between vascular endothelial function, atherosclerotic disease, and inflammation. Deterioration of endothelial function has been observed twenty-four hours after intensive periodontal treatment. This effect may be counteracted by the action of angiotensin-converting enzyme inhibitors, which improve endothelial function. The aim of the present study was to evaluate vascular endothelial function after intensive periodontal treatment, in hypertensive patients treated with angiotensinconverting enzyme inhibitors. A prospective, longitudinal, comparative study involving repeated measurements was conducted. Fifty-two consecutive patients with severe periodontal disease were divided into two groups, one comprising hypertensive patients treated with converting enzyme inhibitors and the other comprising patients with no clinical signs of pathology and not receiving angiotensin-converting enzyme inhibitors. Endothelial function was assessed by measuring postischemic dilation of the humeral artery (baseline echocardiography Doppler), and intensive periodontal treatment was performed 24h later. Endothelial function was re-assessed 24h and 15 days after periodontal treatment.

  5. F8 gene mutation type and inhibitor development in patients with severe hemophilia A: systematic review and meta-analysis.


    Gouw, Samantha C; van den Berg, H Marijke; Oldenburg, Johannes; Astermark, Jan; de Groot, Philip G; Margaglione, Maurizio; Thompson, Arthur R; van Heerde, Waander; Boekhorst, Jorien; Miller, Connie H; le Cessie, Saskia; van der Bom, Johanna G


    This systematic review was designed to provide more precise effect estimates of inhibitor development for the various types of F8 gene mutations in patients with severe hemophilia A. The primary outcome was inhibitor development and the secondary outcome was high-titer-inhibitor development. A systematic literature search was performed to include cohort studies published in peer-reviewed journals with data on inhibitor incidences in the various F8 gene mutation types and a mutation detection rate of at least 80%. Pooled odds ratios (ORs) of inhibitor development for different types of F8 gene mutations were calculated with intron 22 inversion as the reference. Data were included from 30 studies on 5383 patients, including 1029 inhibitor patients. The inhibitor risk in large deletions and nonsense mutations was higher than in intron 22 inversions (pooled OR = 3.6, 95% confidence interval [95% CI], 2.3-5.7 and OR = 1.4, 95% CI, 1.1-1.8, respectively), the risk in intron 1 inversions and splice-site mutations was equal (pooled OR = 0.9; 95% CI, 0.6-1.5 and OR = 1.0; 95% CI, 0.6-1.5), and the risk in small deletions/insertions and missense mutations was lower (pooled OR = 0.5; 95% CI, 0.4-0.6 and OR = 0.3; 95% CI, 0.2-0.4, respectively). The relative risks for developing high titer inhibitors were similar.

  6. Patient-driven discontinuation of tyrosine kinase inhibitors: single institution experience.


    Benjamini, Ohad; Kantarjian, Hagop; Rios, Mary Beth; Jabbour, Elias; O'Brien, Susan; Jain, Preetesh; Cardenas-Turanzas, Marylou; Faderl, Stefan; Garcia-Manero, Guillermo; Ravandi, Farhad; Borthakur, Gautam; Quintas-Cardama, Alfonso; Cortes, Jorge


    Abstract With improved outcome for patients with chronic myeloid leukemia (CML) treated with tyrosine kinase inhibitors (TKIs), treatment discontinuation has become increasingly attractive to patients. We analyzed the outcomes of patients who chose to discontinue TKI therapy regardless of their ongoing response. Thirty-five patients with chronic phase CML discontinued TKI in complete cytogenetic response. Of them, 51% discontinued due to adverse effects, 23% due to long complete molecular response (CMR) (> 5 years), 9% due to pregnancy and 17% due to financial problems. After TKI discontinuation, patients were followed for a median of 16 months. Among 27 patients (77%) who discontinued TKIs in CMR, 11 (41%) had a molecular relapse after a median of 3.5 months. In univariate analysis we observed that patients with ≥ 64 months of CMR before TKI discontinuation had superior cumulative proportions of sustained CMR and major molecular response (MMR) at 12 months after discontinuation: 88.9% vs. 45.5% (p = 0.02) and 100% vs. 75% (p = 0.05), respectively. Patients treated with high dose imatinib or second generation TKIs had a higher cumulative proportion of sustained MMR at 12 months after discontinuation than patients treated with standard dose imatinib: 100% vs. 72.2% (p = 0.03), respectively. Of the five patients who stopped TKI in MR(4.5) (molecular response of 4.5-log reduction) one lost cytogenetic response. All three patients who discontinued TKIs in MMR lost cytogenetic response; one progressed to accelerated phase. Thirteen patients (37%) restarted TKIs after loss of response: 11 improved their response, and for two it is too early to assess. Treatment discontinuation can lead to sustained CMR in some patients, but risk of relapse is higher if patients discontinue TKIs when not in CMR.

  7. Pharmacokinetics, Pharmacodynamics and Clinical Use of SGLT2 Inhibitors in Patients with Type 2 Diabetes Mellitus and Chronic Kidney Disease.


    Scheen, André J


    Inhibitors of sodium-glucose cotransporters type 2 (SGLT2) are proposed as a novel approach for the management of type 2 diabetes mellitus. SGLT2 cotransporters are responsible for reabsorption of 90 % of the glucose filtered by the kidney. The glucuretic effect resulting from SGLT2 inhibition contributes to reduce hyperglycaemia and also assists weight loss and blood pressure reduction. Several SGLT2 inhibitors are already available in many countries (dapagliflozin, canagliflozin, empagliflozin) and in Japan (ipragliflozin, tofogliflozin). These SGLT2 inhibitors share similar pharmacokinetic characteristics with a rapid oral absorption, a long elimination half-life allowing once-daily administration, an extensive hepatic metabolism mainly via glucuronidation to inactive metabolites and a low renal elimination as a parent drug. Pharmacokinetic parameters are slightly altered in the case of chronic kidney disease (CKD). While no dose adjustment is required in the case of mild CKD, SGLT2 inhibitors may not be used or only at a lower daily dose in patients with moderate CKD. Furthermore, the pharmacodynamic response to SGLT2 inhibitors as assessed by urinary glucose excretion declines with increasing severity of renal impairment as assessed by a reduction in the estimated glomerular filtration rate. Nevertheless, the glucose-lowering efficacy and safety of SGLT2 inhibitors are almost comparable in patients with mild CKD as in patients with normal kidney function. In patients with moderate CKD, the efficacy tends to be dampened and safety concerns may occur. In patients with severe CKD, the use of SGLT2 inhibitors is contraindicated. Thus, prescribing information should be consulted regarding dosage adjustments or restrictions in the case of renal dysfunction for each SGLT2 inhibitor. The clinical impact of SGLT2 inhibitors on renal function and their potential to influence the course of diabetic nephropathy deserve attention because of preliminary favourable results

  8. QTc intervals in drug poisoning patients with tricyclic antidepressants and selective serotonin reuptake inhibitors.


    Açikalin, Ayça; Satar, Salim; Avc, Akkan; Topal, Metin; Kuvandk, Güven; Sebe, Ahmet


    Commonly used agents of drug poisoning among patients who come to the emergency services are tricyclic antidepressants (TCAs). These drugs may cause defect in cardiac conduction due to the slowdown in the cardiac depolarization and expansions in the QT interval. Selective serotonin reuptake inhibitors (SSRIs) are less expansion of the QT period and lower cardio toxic side effects. The aim of this study was to investigate QTc intervals and prognosis of the patients who come to the emergency service due to TCA and SSRI group antidepressant drug poisoning. In a study of 96 patients, 75 of whom were diagnosed to be poisoned by TCAs (TCA group) and 21 by SSRIs (SSRI group) were examined. Electrocardiographic alterations and QTc intervals all of patients were evaluated. QTc intervals of patients in TCA group were determined to be slightly more than those in SSRI group and it was not statistically significant. In the SSRI group, only one patient had QTc period more than 500 milliseconds (520 milliseconds); however, TCA overdose showed 9 (12%) patients with QTc interval over 500 milliseconds, and QTc values of 2 patients were over 600 milliseconds. In our study, it was determined that SSRI group drugs caused similar expansion of the QTc period as TCA drugs but they did not reach high values like TCA drugs, and their OTc intervals stayed in more innocent levels.

  9. Outcome of 82 chronic myeloid leukemia patients treated with nilotinib or dasatinib after failure of two prior tyrosine kinase inhibitors

    PubMed Central

    Rossi, Antonella Russo; Breccia, Massimo; Abruzzese, Elisabetta; Castagnetti, Fausto; Luciano, Luigiana; Gozzini, Antonella; Annunziata, Mario; Martino, Bruno; Stagno, Fabio; Cavazzini, Francesco; Tiribelli, Mario; Visani, Giuseppe; Pregno, Patrizia; Musto, Pellegrino; Fava, Carmen; Sgherza, Nicola; Albano, Francesco; Rosti, Gianantonio; Alimena, Giuliana; Specchia, Giorgina


    There have been few reports of a response to dasatinib or nilotinib after failure of two prior sequential tyrosine kinase inhibitors. We report the outcome of 82 chronic phase patients who received nilotinib or dasatinib as third-line alternative tyrosine kinase inhibitor therapy. Thirty-four patients failed to respond to nilotinib and were started on dasatinib as third-line tyrosine kinase inhibitor therapy while 48 patients were switched to nilotinib after dasatinib failure. Overall, we obtained a cytogenetic response in 32 of 82 patients and major molecular response in 13 patients; disease progression occurred in 12 patients. At last follow up, 70 patients (85.4%) were alive with a median overall survival of 46 months. Our results show that third-line tyrosine kinase inhibitor therapy in chronic myeloid leukemia patients after failure of two prior sequential tyrosine kinase inhibitors may induce a response that, in some instances, could prolong overall survival and affect event-free survival. PMID:22801965

  10. Repeated daclizumab administration to delay the introduction of calcineurin inhibitors in heart transplant patients with postoperative renal dysfunction.


    Sánchez Lázaro, Ignacio J; Almenar Bonet, Luis; Martínez Dolz, Luis; Buendía Fuentes, Francisco; Navarro Manchón, Josep; Agüero Ramón-Llin, Jaime; Vicente Sánchez, José Luis; Salvador Sanz, Antonio


    Daclizumab is an interleukin-2 receptor antagonist which is used for induction therapy in heart transplant patients. It has few side effects and is associated with a low infection rate. Postoperative renal failure after heart transplantation is common and potentially fatal. The administration of calcineurin inhibitors in the postoperative period can aggravate the situation. We report the cases of six patients who underwent heart transplantation and developed acute renal failure in the immediate postoperative period. All were administered daclizumab weekly to avoid the introduction of calcineurin inhibitors and to facilitate recovery of renal function. Calcineurin inhibitors were introduced only once renal function had improved. Renal function recovered in all cases and there was a low complication rate. The administration of repeated doses of daclizumab to patients who experience acute postoperative renal failure after heart transplantation may provide an alternative therapeutic approach that enables calcineurin inhibitors to be avoided and, consequently, renal function to recover.

  11. Replication of PTPRC as genetic biomarker of response to TNF inhibitors in patients with rheumatoid arthritis.


    Ferreiro-Iglesias, A; Montes, A; Perez-Pampin, E; Cañete, J D; Raya, E; Magro-Checa, C; Vasilopoulos, Y; Sarafidou, T; Caliz, R; Ferrer, M A; Joven, B; Carreira, P; Balsa, A; Pascual-Salcedo, D; Blanco, F J; Moreno-Ramos, M J; Fernández-Nebro, A; Ordóñez, M C; Alegre-Sancho, J J; Narváez, J; Navarro-Sarabia, F; Moreira, V; Valor, L; García-Portales, R; Marquez, A; Martin, J; Gómez-Reino, J J; Gonzalez, A


    Genetic biomarkers could be useful for orienting treatment of patients with rheumatoid arthritis (RA), but none has been convincingly validated yet. Putative biomarkers include 14 single nucleotide polymorphisms that have shown association with response to TNF inhibitors (TNFi) in candidate gene studies and that we assayed here in 755 RA patients. Three of them, in the PTPRC, IL10 and CHUK genes, were significantly associated with response to TNFi. The most significant result was obtained with rs10919563 in PTPRC, which is a confirmed RA susceptibility locus. Its RA risk allele was associated with improved response (B=0.33, P=0.006). This is the second independent replication of this biomarker (P=9.08 × 10(-8) in the combined 3003 RA patients). In this way, PTPRC has become the most replicated genetic biomarker of response to TNFi. In addition, the positive but weaker replication of IL10 and CHUK should stimulate further validation studies.

  12. Proton pump inhibitors use in hemodialysis patients and serum magnesium levels

    PubMed Central

    Erdem, Emre


    Hypomagnesemia is reported in patients who use proton pump inhibitors (PPIs). We investigated the effect of PPIs use on serum magnesium levels in hemodialysis patients. Our study was conducted in a hemodialysis center including 75 end stage renal disease patients. PPI use and duration were investigated. All patients were dialyzed using a dialysate magnesium level of 0.5-0.75 mmol/L. After at least one month of hemodialysis with the mentioned dialysate, laboratory tests were performed. Fifty-four patients (72%) used PPIs while 21 (28%) did not. The mean duration of PPI use was 42.5 ± 35 months. There was no significant difference between serum magnesium levels of patients who used and did not use PPIs (2.73 ± 0.3 vs. 2.88 ± 0.3 mg/dL, P = ns). There were 15 patients (20%) with a dialysate magnesium level of 0.5 mmol/l and 60 patients (80%) with a dialysate magnesium level of 0.75 mmol/L. The mean serum magnesium levels of patients with a dialysate magnesium level of 0.5 mmol/L was 2.45 ± 0.3 mg/dL while that of patients with a dialysate magnesium level of 0.75 mmol/L was 2.85 ± 0.3 mg/dL (P<0.0001). In hemodialysis patients, PPI use did not affect serum magnesium levels. The most important factor affecting the serum magnesium levels in hemodialysis patients is the dialysate magnesium concentration. PMID:26885127

  13. Cognitive Evaluation in Liver Transplant Patients Under Calcineurin Inhibitor Maintenance Therapy

    PubMed Central

    Heits, Nils; Keserovic, Dalibor; Mund, Niclas; Ehmke, Nicola; Bernsmeier, Alexander; Hendricks, Alexander; Gunther, Rainer; Witt, Karsten; Becker, Thomas; Braun, Felix


    Background Neurological disorders due to calcineurin inhibitor (CNI) treatment pose a well-known problem after liver transplantation (LTx). In this study, the impact of CNIs on cognitive functioning during maintenance therapy was analyzed. A possible improvement of cognitive functioning, compliance and health-related quality of life (HRQoL) after conversion to a once-daily tacrolimus formulation was prospectively assessed. Methods In a cross-section analysis cognitive functioning of living donors (LD), waiting list patients and LTx patients was tested using a 4 times trail making test (4-TTMT). In a further investigator-initiated trial a possible improvement of cognitive functioning, HRQoL and compliance after conversion to the once-daily tacrolimus formulation was prospectively assessed over 1 year. HRQoL was assessed using an EORTC-QLQ C30 questionnaire and patient’s compliance was assessed by the Basel Assessment of Compliance with Immunosuppressive Medication Scales questionnaire. Correlated data were sex, age, time after surgery, liver disease, model of end-stage liver disease score, creatinine, CNI type, and CNI trough levels. Results Two hundred eleven patients were included in this cross-section analysis. Twenty-seven patients agreed to participate in the investigator-initiated trial. LTx patients completed the 4-TTMT slower than living donor patients and faster than waiting list patients. Patients with twice daily cyclosporine A (CSA) formulation needed longer to finish the 4-TTMT than patients with the once-daily tacrolimus formulation. After drug conversion of a twice-daily CNI formulation to a once-daily tacrolimus formulation, CSA-treated patients needed longer to improve their cognitive functioning. HRQoL and compliance did not improve after drug conversion. Conclusions Patients with once-daily tacrolimus formulation had a better psychomotor speed than CSA-treated patients. The conversion to once-daily tacrolimus formulation significantly improved

  14. The Levels of Tissue Factor Pathway Inhibitor in Sepsis Patients Receiving Prophylactic Enoxaparin

    PubMed Central

    Al Otair, Hadil A.; Abdel Gader, Abdel Galil M.; Khurshid, Syed M.; Alzeer, Abdulaziz H.; Al Momen, Abdul Kareem; Al Shaikh, Mashael; Al Gahtani, Farja; Al Aseri, Zohair A.; Abdelrazik, Hossam A.H.


    Objective: Sepsis syndrome is usually accompanied by activation of blood coagulation mechanisms. Earlier studies found deficiencies of the 3 main natural anticoagulants, antithrombin, protein C, and protein S. However, none of these inhibitors block tissue factor, the prime trigger of coagulation during sepsis that is controlled specifically by the tissue factor pathway inhibitor (TFPI). The aim of this study was to characterize the fluctuations in the levels of natural anticoagulants, particularly TFPI, in the course of sepsis and to find out their association with the anticoagulant action of the low-molecular-weight heparin enoxaparin. Materials and Methods: We studied 51 consecutive patients with sepsis. Blood samples were collected from patients at baseline (0 h) and at 4, 12, and 24 h after enoxaparin administration. The following assays were undertaken using commercial kits: activated partial thromboplastin time, prothrombin time, thrombin time, total and free TFPI, protein C and protein S, antithrombin, fibrinogen, and anti-factor Xa. Results: Before enoxaparin administration, there was significant prolongation of the prothrombin time and activated partial thromboplastin time, and this remained the case in the 3 subsequent samples. There was marked reduction in the levels of antithrombin, protein C, and total and free protein S to below control values throughout the study. In contrast, plasma levels of both total and free TFPI were markedly elevated and increased after enoxaparin therapy. Anti-factor Xa levels were within the therapeutic range throughout. There was no difference in TFPI levels between those patients who died and those who survived. Conclusion: Sepsis triggered marked release of TFPI from endothelial cells. This persisted and was increased further following the administration of enoxaparin. In contrast, there was marked consumption of the natural coagulation inhibitors antithrombin, protein C, and protein S. These results go some way towards

  15. Limited HIV-1 Reactivation in Resting CD4+ T cells from Aviremic Patients under Protease Inhibitors

    PubMed Central

    Kumar, Amit; Abbas, Wasim; Bouchat, Sophie; Gatot, Jean-Stéphane; Pasquereau, Sébastien; Kabeya, Kabamba; Clumeck, Nathan; De Wit, Stéphane; Van Lint, Carine; Herbein, Georges


    A latent viral reservoir that resides in resting CD4+ T cells represents a major barrier for eradication of HIV infection. We test here the impact of HIV protease inhibitor (PI) based combination anti-retroviral therapy (cART) over nonnucleoside reverse transcriptase inhibitor (NNRTI)-based cART on HIV-1 reactivation and integration in resting CD4+ T cells. This is a prospective cohort study of patients with chronic HIV-1 infection treated with conventional cART with an undetectable viremia. We performed a seven-year study of 47 patients with chronic HIV-infection treated with cART regimens and with undetectable plasma HIV-1 RNA levels for at least 1 year. Of these 47 patients treated with cART, 24 were treated with a PI-based regimen and 23 with a NNRTI-based regimen as their most recent treatment for more than one year. We evaluated the HIV-1 reservoir using reactivation assay and integrated HIV-1 DNA, respectively, in resting CD4+ T cells. Resting CD4+ T cells isolated from PI-treated patients compared to NNRTI-treated patients showed a limited HIV-1 reactivation upon T-cell stimulation (p = 0·024) and a lower level of HIV-1 integration (p = 0·024). Our study indicates that PI-based cART could be more efficient than NNRTI-based cART for limiting HIV-1 reactivation in aviremic chronically infected patients. PMID:27922055

  16. Inhibitor treatment of peripheral mononuclear cells from Parkinson's disease patients further validates LRRK2 dephosphorylation as a pharmacodynamic biomarker.


    Perera, G; Ranola, M; Rowe, D B; Halliday, G M; Dzamko, N


    Activating mutations in leucine-rich repeat kinase 2 (LRRK2) are strongly associated with increased risk of Parkinson's disease (PD). Thus, LRRK2 kinase inhibitors are in development as potential Parkinson's disease therapeutics. A reduction in the constitutive levels of phosphorylation on leucine-rich repeat kinase 2 (LRRK2) is currently used to measure target engagement of LRRK2 kinase inhibitors in cell and animal models. We aimed to determine if reduced phosphorylation of LRRK2 following inhibitor treatment is also a valid measure of target engagement in peripheral mononuclear cells from Parkinson's disease patients. Peripheral mononuclear cells from idiopathic Parkinson's disease patients and controls were treated ex vivo with two structurally distinct inhibitors of LRRK2, at four different doses, and immunoblotting was used to assess the reduction in LRRK2 phosphorylation at Ser910, Ser935, Ser955 and Ser973. Both inhibitors showed no acute toxicity in primary cells and both inhibitors reduced the constitutive phosphorylation of LRRK2 at all measured residues equally in both control and Parkinson's disease groups. Measuring the reduction in LRRK2 phosphorylation resulting from LRRK2 kinase inhibition, is thus a valid measure of acute peripheral target engagement in Parkinson's disease patients. This is important if LRRK2 kinase inhibitors are to be used in a clinical setting.

  17. Phase I dose-escalation study of the mTOR inhibitor sirolimus and the HDAC inhibitor vorinostat in patients with advanced malignancy

    PubMed Central

    Park, Haeseong; Garrido-Laguna, Ignacio; Naing, Aung; Fu, Siqing; Falchook, Gerald S.; Piha-Paul, Sarina A.; Wheler, Jennifer J.; Hong, David S.; Tsimberidou, Apostolia M.; Subbiah, Vivek; Zinner, Ralph G.; Kaseb, Ahmed O.; Patel, Shreyaskumar; Fanale, Michelle A.; Velez-Bravo, Vivianne M.; Meric-Bernstam, Funda; Kurzrock, Razelle; Janku, Filip


    Preclinical models suggest that histone deacetylase (HDAC) and mammalian target of rapamycin (mTOR) inhibitors have synergistic anticancer activity. We designed a phase I study to determine the safety, maximum tolerated dose (MTD), recommended phase II dose (RP2D), and dose-limiting toxicities (DLTs) of combined mTOR inhibitor sirolimus (1 mg-5 mg PO daily) and HDAC inhibitor vorinostat (100 mg-400 mg PO daily) in patients with advanced cancer. Seventy patients were enrolled and 46 (66%) were evaluable for DLT assessment since they completed cycle 1 without dose modification unless they had DLT. DLTs comprised grade 4 thrombocytopenia (n = 6) and grade 3 mucositis (n = 1). Sirolimus 4 mg and vorinostat 300 mg was declared RP2D because MTD with sirolimus 5 mg caused significant thrombocytopenia. The grade 3 and 4 drug-related toxic effects (including DLTs) were thrombocytopenia (31%), neutropenia (8%), anemia (7%), fatigue (3%), mucositis (1%), diarrhea (1%), and hyperglycemia (1%). Of the 70 patients, 35 (50%) required dose interruption or modification and 61 were evaluable for response. Partial responses were observed in refractory Hodgkin lymphoma (−78%) and perivascular epithelioid tumor (−54%), and stable disease in hepatocellular carcinoma and fibromyxoid sarcoma. In conclusion, the combination of sirolimus and vorinostat was feasible, with thrombocytopenia as the main DLT. Preliminary anticancer activity was observed in patients with refractory Hodgkin lymphoma, perivascular epithelioid tumor, and hepatocellular carcinoma. PMID:27589687

  18. Proton Pump Inhibitor use in Hospitalized Patients: Is Overutilization Becoming a Problem?

    PubMed Central

    Durand, Cheryl; Willett, Kristine C.; Desilets, Alicia R.


    Proton pump inhibitors (PPIs) are among the most common classes of medications prescribed. Though they were previously thought of as safe, recent literature has shown risks associated with their use including increased risk for Clostridium difficile infection, pneumonia, and fractures. Due to these risks, it is important to determine if PPIs are being used appropriately. This review evaluates seven studies in hospitalized patients. Additionally, this review evaluates literature pertaining to recently discovered adverse reactions; all studies found PPIs are being overutilized. Findings highlight the importance of evaluating appropriate therapy with these agents and recommending discontinuation if a proper indication does not exist. PMID:24833936

  19. Estimated Glomerular Filtration Rate Changes in Patients with Chronic Myeloid Leukemia Treated with Tyrosine Kinase Inhibitors

    PubMed Central

    Yilmaz, Musa; Lahoti, Amit; O'Brien, Susan; Nogueras-González, Graciela M.; Burger, Jan; Ferrajoli, Alessandra; Borthakur, Gautam; Ravandi, Farhad; Pierce, Sherry; Jabbour, Elias; Kantarjian, Hagop; Cortes, Jorge E


    Background Chronic use of tyrosine kinase inhibitor (TKI) may lead to previously unrecognized adverse events. We evaluated the incidence of acute kidney injury (AKI) and chronic kidney disease (CKD) in chronic phase (CP) chronic myeloid leukemia (CML) patients treated with imatinib, dasatinib and nilotinib. Methods Four hundred and sixty-eight newly diagnosed CP CML patients treated with TKIs were analyzed. Molecular and cytogenetic response data, creatinine, glomerular filtration rate (GFR) were followed from start of therapy to last follow-up (median 52 months). GFR was estimated using the Modification of Diet in Renal Disease (MDRD) equation. Results Nineteen patients (4%) had TKI-associated AKI. Imatinib was associated with higher incidence of AKI compared to dasatinib and nilotinib (p=0.014). 58 patients (14%) developed CKD while receiving TKI, 49 of them (84%) while treated with imatinib (p<0.001). Besides imatinib, age, history of hypertension and diabetes mellitus were also associated with development of CKD. In patients with no CKD at baseline, imatinib was shown to decrease GFR overtime. Interestingly, imatinib did not cause significant decline in GFR of patients with history of CKD. Imatinib, dasatinib and nilotinib increased mean GFR after three months of treatment, and nilotinib led with the most significant increase (p<0.001). Acute or chronic kidney disease had no significant impact on overall cytogenetic and molecular response rates or survival. Conclusion Administration of TKI may be safe in the setting of CKD in CP CML patients, but close monitoring is still warranted. PMID:26217876

  20. Tyrosine Kinase Inhibitors as Initial Therapy for Patients with Chronic Myeloid Leukemia in Accelerated Phase

    PubMed Central

    Ohanian, Maro; Kantarjian, Hagop M.; Quintas-Cardama, Alfonso; Jabbour, Elias; Abruzzo, Lynne; Verstovsek, Srdan; Borthakur, Gautam; Ravandi, Farhad; Garcia-Manero, Guillermo; Champlin, Richard; Pierce, Sherry; Alattar, Mona Lisa; Trinh, Long Xuan; Luthra, Raja; Ferrajoli, Alessandra; Kadia, Tapan; O’Brien, Susan; Cortes, Jorge E.


    Background Accelerated phase CML (CML-AP) most frequently represents a progression state in CML. However, some patients present with AP features at the time of diagnosis. There is limited information on the outcome of these patients when receiving tyrosine kinase inhibitors (TKI) as initial therapy. Methods We analyzed the outcome of 51 consecutive patients with CML who presented with features of AP at the time of diagnosis, including blasts ≥15% (n=6), basophils ≥20%, (n=22), platelets <100×109/L (n=3), cytogenetic clonal evolution (n=17), or more than 1 feature (n=3). Patients received initial therapy with imatinib (n=30), dasatinib (n=5) or nilotinib (n=16). Results The rate of complete cytogenetic response (CCyR) for patients treated with imatinib was 80%, and with dasatinib or nilotinib was 90%. Major molecular response (MMR, BCR-ABL/ABL ≤0.1%, by International Scale [IS]) was achieved in 69% including complete molecular responses (MR4.5, BCR-ABL/ABL ≤0.0032% IS) in 49%. MMR rates for patients treated with imatinib were 63%, and with second generation TKI (2GTKIs) 76%. Overall survival at 36 months was 87% with imatinib and 95% with 2GTKI’s. Conclusion TKIs should be considered standard initial therapy for patients with AP at the time of diagnosis. PMID:24332214

  1. Gastric juice for the diagnosis of H pylori infection in patients on proton pump inhibitors

    PubMed Central

    Yakoob, Javed; Rasool, Shahid; Abbas, Zaigham; Jafri, Wasim; Abid, Shahab; Islam, Muhammad; Ahmad, Zubair


    AIM: To determine the efficacy of gastric juice polymerase chain reaction (PCR) for the detection of H pylori infection in comparison with histology and gastric antral biopsy PCR in patients on a proton pump inhibitor (PPI). METHODS: Eighty-five consecutive patients with dyspeptic symptoms were enrolled. Gastric biopsies for histology, PCR and gastric juice were collected at endoscopy for PCR of the H pylori urease C gene (ure C). Sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV), accuracy, positive and negative likelihood ratio for PCR of gastric juice for the H pylori ure C gene was compared to histology and gastric antral biopsy H pylori ure C PCR in patients with and without PPI. RESULTS: Gastric juice PCR was positive in 66 (78%) patients. Histology showed H pylori associated gastritis in 57 (67%). Gastric biopsy PCR was positive in 72 (85%). In patients not taking PPI, the sensitivity, specificity, PPV, NPV, accuracy and positive and negative likelihood ratio for gastric juice PCR were 89%, 72%, 91%, 67%, 90%, 85%, 3.1 and 0.1 respectively. In patients on PPI these values were 86%, 100%%, 100%, 29%, 86%, 9.5 and 1.4, respectively. CONCLUSION: Gastric juice PCR for the diagnosis of H pylori infection has increased sensitivity compared to histology with PPI. The use of gastric juice PCR is recommended to confirm H pylori status in patients taking PPIs. PMID:18330944

  2. Neurophysiological predictors of long term response to AChE inhibitors in AD patients

    PubMed Central

    Di, L; Oliviero, A; Pilato, F; Saturno, E; Dileone, M; Marra, C; Ghirlanda, S; Ranieri, F; Gainotti, G; Tonali, P


    Background: In vivo evaluation of cholinergic circuits of the human brain has recently been introduced using a transcranial magnetic stimulation (TMS) protocol based on coupling peripheral nerve stimulation with motor cortex TMS (short latency afferent inhibition, SAI). SAI is reduced in Alzheimer's disease (AD) and drugs enhancing cholinergic transmission increase SAI. Methods: We evaluated whether SAI testing, together with SAI test-retest, after a single dose of the acetylcholinesterase (AChE) inhibitor rivastigmine, might be useful in predicting the response after 1 year treatment with rivastigmine in 16 AD patients. Results: Fourteen AD patients had pathologically reduced SAI. SAI was increased after administration of a single oral dose of rivastigmine in AD patients with abnormal baseline SAI, but individual responses to rivastigmine varied widely, with SAI change ranging from an increase in inhibition of ∼50% of test size to no change. Baseline SAI and the increase in SAI after a single dose of rivastigmine were correlated with response to long term treatment. A normal SAI in baseline conditions, or an abnormal SAI in baseline conditions that was not greatly increased by a single oral dose of rivastigmine, were invariably associated with poor response to long term treatment, while an abnormal SAI in baseline conditions in conjunction with a large increase in SAI after a single dose of rivastigmine was associated with good response to long term treatment in most of the patients. Conclusions: Evaluation of SAI may be useful for identifying AD patients likely to respond to treatment with AChE inhibitors. PMID:16024879

  3. Expression of ADAMs and their inhibitors in sputum from patients with asthma.


    Paulissen, Geneviève; Rocks, Natacha; Quesada-Calvo, Florence; Gosset, Philippe; Foidart, Jean-Michel; Noel, Agnès; Louis, Renaud; Cataldo, Didier D


    ADAMs (a disintegrin and metalloprotease) constitute a family of cell surface proteins containing disintegrin and metalloprotease domains which associate features of adhesion molecules and proteases. ADAMTSs (a disintegrin and metalloprotease with thrombospondin motifs) bear thrombospondin type I motifs in C-terminal extremity, and most of them are secreted proteins. Because genetic studies have shown that ADAM-33 gene polymorphisms are associated with asthma, we designed this study to assess mRNA expression profile of several ADAM and ADAMTS proteases in sputum from patients with asthma and to investigate the relationship between expression of these proteases and asthma-associated inflammation and airway obstruction. mRNA expression profile of selected ADAM and ADAMTS proteinases (ADAM-8, -9, -10, -12, -15, -17, and -33; ADAMTS-1, -2, -15, -16, -17, -18, and -19), their physiological inhibitors TIMP-1 and TIMP-3, and RECK, a membrane-anchored MMP activity regulator, was obtained by RT-PCR analysis performed on cells collected by sputum induction from 21 patients with mild to moderate asthma and 17 healthy individuals. mRNA levels of ADAM-8, ADAM-9, ADAM-12, TIMP-1, and TIMP-3 were significantly increased, whereas mRNA levels coding for ADAMTS-1, ADAMTS-15, and RECK were significantly decreased in patients with asthma compared with control patients. ADAM-8 expression was negatively correlated with the forced expiratory volume at the first second (FEV(1)) (r = -0.57, P < 0.01), whereas ADAMTS-1 and RECK expressions were positively correlated to FEV(1) (r = 0.45, P < 0.05, and r = 0.55, P = 0.01, respectively). We conclude that expression of ADAMs and ADAMTSs and their inhibitors is modulated in airways from patients with asthma and that these molecules may play a role in the pathogenesis of asthma.

  4. Binding of ACE-inhibitors to in vitro and patient-derived amyloid-β fibril models

    NASA Astrophysics Data System (ADS)

    Bhavaraju, Manikanthan; Phillips, Malachi; Bowman, Deborah; Aceves-Hernandez, Juan M.; Hansmann, Ulrich H. E.


    Currently, no drugs exist that can prevent or reverse Alzheimer's disease, a neurodegenerative disease associated with the presence, in the brain, of plaques that are composed of β-amyloid (Aβ) peptides. Recent studies suggest that angiotensin-converting enzyme (ACE) inhibitors, a set of drugs used to treat hypertension, may inhibit amyloid formation in vitro. In the present study, we investigate through computer simulations the binding of ACE inhibitors to patient-derived Aβ fibrils and contrast it with that of ACE inhibitors binding to in vitro generated fibrils. The binding affinities of the ACE inhibitors are compared with that of Congo red, a dye that is used to identify amyloid structures and that is known to be a weak inhibitor of Aβ aggregation. We find that ACE inhibitors have a lower binding affinity to the patient-derived fibrils than to in vitro generated ones. For patient-derived fibrils, their binding affinities are even lower than that of Congo red. Our observations raise doubts on the hypothesis that these drugs inhibit fibril formation in Alzheimer patients by interacting directly with the amyloids.

  5. Effects of rikkunshito on quality of life in patients with gastroesophageal reflux disease refractory to proton pump inhibitor therapy

    PubMed Central

    Kawai, Takashi; Hirayama, Yoji; Oguchi, Aiko; Ishii, Fumi; Matushita, Masanao; Kitayama, Naoya; Morishita, Shinji; Hiratsuka, Noboru; Ohata, Ken; Konishi, Hiroyuki; Kishino, Maiko; Nakamura, Shinichi


    We investigated the effects of rikkunshito, in combination with a proton pump inhibitor, on symptoms and quality of life in patients with proton pump inhibitor-refractory gastroesophageal reflux disease. The subjects were 47 patients with gastroesophageal reflux disease with residual symptoms such as heartburn following 8 weeks of proton pump inhibitor therapy. We administered these subjects rikkunshito in combination with a proton pump inhibitor for 6–8 weeks. We scored their symptoms of heartburn, fullness, abdominal discomfort, and abdominal pain, and surveyed their quality of life using the Reflux Esophagitis Symptom Questionnaire, comprising questions concerning daily activities, meals (changes in amount and favorite foods), and sleep (getting to sleep and early morning waking). Improvement was seen in all symptoms, and quality of life scores for meals and sleep also improved. These results indicate that combination therapy with rikkunshito and a proton pump inhibitor improves quality of life related to eating and sleep in patients with patients with proton pump inhibitor-refractory gastroesophageal reflux disease.

  6. Dual ACE and neutral endopeptidase inhibitors: novel therapy for patients with cardiovascular disorders.


    Tabrizchi, Reza


    Elevated blood pressure is a risk factor for a variety of cardiovascular disorders, including coronary heart disease, peripheral vascular disease, cardiac failure and cerebrovascular disease. The prevailing view is that an elevated systolic rather than diastolic blood pressure is the major contributor in mortality and morbidity attributed to cardiovascular disorders. Isolated high systolic blood pressure, especially in the elderly, is a major risk factor and should undoubtedly be a target for drug treatment. In the general population, systolic and diastolic blood pressure are highly correlated, and thus it is difficult to dissociate the effects of these two components of the blood pressure and specifically ascribe cardiovascular risk factors to just elevated systolic blood pressure. Therefore, the goal in therapy of an individual with hypertension must be to reduce elevated systolic and diastolic blood pressure in order to reduce mortality and morbidity. ACE and neutral peptidase inhibitors are a new class of drugs that may be beneficial in the treatment of patients with hypertension and heart failure. They may also be useful in the treatment of diabetic patients with hypertension and/or heart failure. Drugs of this class are dual inhibitors of ACE and neutral endopeptidase, and are capable of affecting vascular tone and fluid balance. They are capable of producing vasodilatation by virtue of inhibiting the production of angiotensin II, degradation of natriuretic peptides and bradykinin. They also appear to promote natriuresis and diuresis by amplifying the actions of natriuretic peptidase and reducing aldosterone effects. In addition, they should also attenuate trophogenic actions of the renin angiotensin system and the sympathetic nervous system. Omapatrilat is one drug that appears to be at the advanced stages of clinical development. This drug has been shown to be quite effective in the treatment of hypertension. Evidence also seems to indicate that treatment

  7. Effects of levodopa and COMT inhibitors on plasma homocysteine in Parkinson's disease patients.


    Lamberti, Paolo; Zoccolella, Stefano; Iliceto, Giovanni; Armenise, Elio; Fraddosio, Angela; de Mari, Michele; Livrea, Paolo


    Homocysteine (Hcy) is a risk factor for vascular diseases, cognitive impairment, and dementia. Elevated plasma concentrations of Hcy have been found recently in Parkinson's disease (PD) patients treated with levodopa, suggesting that levodopa is a cause of hyperhomocysteinemia (HHcy). The mechanism underlying HHcy in PD is the O-methylation of levodopa catalyzed by catechol-O-methyltransferase (COMT) that produces S-adenosylhomocysteine, which is hydrolyzed rapidly to Hcy. COMT inhibitors (COMT-I) are used currently in the treatment of PD; however, no study has assessed the effects of COMT-I administration on Hcy concentrations in PD patients. We compared plasma levels of Hcy, B12, and folate in 26 PD patients treated with levodopa, 20 PD patients treated with levodopa + COMT-I, and 32 controls. No significant differences were found in vitamin B12 levels, whereas folate concentrations were significantly lower in the levodopa-treated group. Plasma Hcy was increased significantly in the two groups of PD patients and was significantly lower in the group treated with levodopa + COMT-I. Statistical analysis showed that the difference in mean Hcy levels observed among PD patients was related to the addition of COMT-I, rather than to folate concentrations. We conclude that levodopa treatment increases plasma Hcy and the addition of COMT-I effectively reduces HHcy.

  8. What factors determine patients' preference for tumour necrosis factor inhibitors in ankylosing spondylitis?


    Fajri, Dessy W; Brand, Caroline A; Dharmage, Shyamali C; Martin, Belinda J; Buchanan, Russell R C; Schachna, Lionel


    Tumour necrosis factor inhibitor (TNFi) therapy, either intravenous (IV) or subcutaneous (SQ), demonstrates similar efficacy in ankylosing spondylitis (AS). The objective of this study was to examine factors influencing patient preference of TNFi. Fifty-nine (79.7%) participants were male with mean age 43.9 years and disease duration of 22.0 years. Fifty-nine patients (79.7%) agreed with the statement 'My doctor gave me a choice and I made a decision based on my personal preference'. Patients commenced first on IV TNFi most commonly cited reduced frequency of injections (96.6%), administration by a trained professional (89.7%) and use of infusion time for leisure activities (86.2%). Patients commenced on SQ TNFi cited flexibility with timing of treatment (80%), shortened administration time (73.3%) and the convenience of home therapy (73.3%). Shared clinical decision-making between clinicians and patients may be desirable for AS patients commencing TNFi therapy.

  9. Increased prevalence of inhibitors in Hispanic patients with severe haemophilia A enrolled in the Universal Data Collection database.


    Carpenter, S L; Michael Soucie, J; Sterner, S; Presley, R


    Neutralizing inhibitors develop in 20-30% of patients with severe factor VIII (FVIII) deficiency. It is well established that Blacks have a higher prevalence of inhibitors than Whites. This is the first study to definitively demonstrate increased inhibitor prevalence in the Hispanic population. We compared inhibitor prevalence among various racial and ethnic groups in a cross-sectional analysis of 5651 males with severe haemophilia A that participated in the Universal Data Collection project sponsored by the Centers for Disease Control and Prevention. We used logistic regression analysis to control for potential confounding variables. We assigned as Hispanic those participants who were white and labelled themselves Hispanic. The prevalence of high-titre inhibitors in the Hispanic participants was 24.5% compared to 16.4% for White non-Hispanic patients (OR 1.4, 95% CI 1.1, 1.7). Possibilities as to the underlying cause of increased inhibitor prevalence in minority ethnic populations include polymorphisms in the FVIII molecule, HLA subtypes and differing inflammatory responses. A better understanding may lead to tailored treatment programmes, or other therapies, to decrease or prevent inhibitor development.

  10. Plant Defense Inhibitors Affect the Structures of Midgut Cells in Drosophila melanogaster and Callosobruchus maculatus

    PubMed Central

    Li-Byarlay, Hongmei; Pittendrigh, Barry R.; Murdock, Larry L.


    Plants produce proteins such as protease inhibitors and lectins as defenses against herbivorous insects and pathogens. However, no systematic studies have explored the structural responses in the midguts of insects when challenged with plant defensive proteins and lectins across different species. In this study, we fed two kinds of protease inhibitors and lectins to the fruit fly Drosophila melanogaster and alpha-amylase inhibitors and lectins to the cowpea bruchid Callosobruchus maculatus. We assessed the changes in midgut cell structures by comparing them with such structures in insects receiving normal diets or subjected to food deprivation. Using light and transmission electron microscopy in both species, we observed structural changes in the midgut peritrophic matrix as well as shortened microvilli on the surfaces of midgut epithelial cells in D. melanogaster. Dietary inhibitors and lectins caused similar lesions in the epithelial cells but not much change in the peritrophic matrix in both species. We also noted structural damages in the Drosophila midgut after six hours of starvation and changes were still present after 12 hours. Our study provided the first evidence of key structural changes of midguts using a comparative approach between a dipteran and a coleopteran. Our particular observation and discussion on plant–insect interaction and dietary stress are relevant for future mode of action studies of plant defensive protein in insect physiology. PMID:27594789

  11. Plant Defense Inhibitors Affect the Structures of Midgut Cells in Drosophila melanogaster and Callosobruchus maculatus.


    Li-Byarlay, Hongmei; Pittendrigh, Barry R; Murdock, Larry L


    Plants produce proteins such as protease inhibitors and lectins as defenses against herbivorous insects and pathogens. However, no systematic studies have explored the structural responses in the midguts of insects when challenged with plant defensive proteins and lectins across different species. In this study, we fed two kinds of protease inhibitors and lectins to the fruit fly Drosophila melanogaster and alpha-amylase inhibitors and lectins to the cowpea bruchid Callosobruchus maculatus. We assessed the changes in midgut cell structures by comparing them with such structures in insects receiving normal diets or subjected to food deprivation. Using light and transmission electron microscopy in both species, we observed structural changes in the midgut peritrophic matrix as well as shortened microvilli on the surfaces of midgut epithelial cells in D. melanogaster. Dietary inhibitors and lectins caused similar lesions in the epithelial cells but not much change in the peritrophic matrix in both species. We also noted structural damages in the Drosophila midgut after six hours of starvation and changes were still present after 12 hours. Our study provided the first evidence of key structural changes of midguts using a comparative approach between a dipteran and a coleopteran. Our particular observation and discussion on plant-insect interaction and dietary stress are relevant for future mode of action studies of plant defensive protein in insect physiology.

  12. Switching of adenosine diphosphate receptor inhibitor after hospital discharge among myocardial infarction patients: Insights from the Treatment with Adenosine Diphosphate Receptor Inhibitors: Longitudinal Assessment of Treatment Patterns and Events after Acute Coronary Syndrome (TRANSLATE-ACS) observational study.


    Zettler, Marjorie E; Peterson, Eric D; McCoy, Lisa A; Effron, Mark B; Anstrom, Kevin J; Henry, Timothy D; Baker, Brian A; Messenger, John C; Cohen, David J; Wang, Tracy Y


    The reasons for postdischarge adenosine diphosphate receptor inhibitor (ADPri) switching among patients with myocardial infarction (MI) are unclear. We sought to describe the incidence and patterns of postdischarge ADPri switching among patients with acute MI treated with percutaneous coronary intervention.

  13. Sarilumab improves patient-reported outcomes in rheumatoid arthritis patients with inadequate response/intolerance to tumour necrosis factor inhibitors

    PubMed Central

    Strand, Vibeke; Reaney, Matthew; Chen, Chieh-I; Proudfoot, Clare W J; Guillonneau, Sophie; Bauer, Deborah; Mangan, Erin; Graham, Neil M H; van Hoogstraten, Hubert; Lin, Yong; Pacheco-Tena, César; Fleischmann, Roy


    Objective To evaluate effects of the anti-interleukin-6 receptor monoclonal antibody sarilumab administered with conventional synthetic disease-modifying antirheumatic drugs (csDMARDs) on patient-reported outcomes (PROs) in the TARGET trial in patients with rheumatoid arthritis (RA) with inadequate response or intolerance to tumour necrosis factor inhibitors (TNF-IR). Methods 546 patients (81.9% female, mean age 52.9 years) were randomised to placebo, sarilumab 150 or 200 mg subcutaneously every 2 weeks + csDMARDs. PROs included patient global assessment (PtGA); pain and morning stiffness visual analogue scales; Health Assessment Questionnaire Disability Index (HAQ-DI); Short Form-36 Health Survey (SF-36); FACIT-Fatigue (FACIT-F); Work Productivity Survey-Rheumatoid Arthritis (WPS-RA) and Rheumatoid Arthritis Impact of Disease (RAID). Changes from baseline at weeks 12 and 24 were analysed using a mixed model for repeated measures; post hoc analyses included percentages of patients reporting improvements ≥ minimum clinically important differences (MCID) and scores ≥ normative values. Results Sarilumab + csDMARDs doses resulted in improvements from baseline at week 12 vs placebo + csDMARDs in PtGA, pain, HAQ-DI, SF-36 and FACIT-F that were maintained at week 24. Sarilumab improved morning stiffness and reduced the impact of RA on work, family, social/leisure activities participation (WPS-RA) and on patients' lives (RAID). Percentages of patients reporting improvements ≥MCID and ≥ normative scores were greater with sarilumab than placebo. Conclusions In patients with TNF-IR RA, 150 and 200 mg sarilumab + csDMARDs resulted in clinically meaningful patient-reported benefits on pain, fatigue, function, participation and health status at 12 and 24 weeks that exceeded placebo + csDMARDs, and were consistent with the clinical profile previously reported. Trial registration number NCT01709578; Results. PMID:28326189

  14. Outcomes of preoperative angiotensin-converting enzyme inhibitor therapy in patients undergoing isolated coronary artery bypass grafting.


    Bandeali, Salman J; Kayani, Waleed T; Lee, Vei-Vei; Pan, Wei; Elayda, Mac Arthur A; Nambi, Vijay; Jneid, Hani M; Alam, Mahboob; Wilson, James M; Birnbaum, Yochai; Ballantyne, Christie M; Virani, Salim S


    The association between preoperative use of angiotensin-converting enzyme (ACE) inhibitors and outcomes after coronary artery bypass grafting (CABG) remain controversial. Our aim was to study in-hospital outcomes after isolated CABG in patients on preoperative ACE inhibitors. A retrospective analysis of 8,889 patients who underwent isolated CABG from 2000 through 2011 was conducted. The primary outcome of interest was the incidence of major adverse events (MAEs) defined as a composite of mortality, postoperative renal dysfunction, myocardial infarction, stroke, and atrial fibrillation during index hospitalization. The secondary outcome was the incidence of individual outcomes included in MAEs. Logistic regression analyses were performed. Of 8,889 patients, 3,983 (45%) were on preoperative ACE inhibitors and 4,906 (55%) were not. Overall incidence of MAEs was 38.1% (n = 1,518) in the ACE inhibitor group compared to 33.6% (n = 1,649) in the no-ACE inhibitor group. Preoperative use of ACE inhibitors was independently associated with MAEs (odds ratio 1.13, 95% confidence interval 1.03 to 1.24), most of which was driven by a statistically significant increase in postoperative renal dysfunction (odds ratio 1.18, 95% confidence interval 1.03 to 1.36) and atrial fibrillation (odds ratio 1.15, 95% confidence interval 1.05 to 1.27). In-hospital mortality, postoperative myocardial infarction, and stroke were not significantly associated with preoperative ACE inhibitor use. Analyses performed after excluding patients with low ejection fractions yielded similar results. In conclusion, preoperative ACE inhibitor use was associated with an increased risk of MAEs after CABG, in particular postoperative renal dysfunction and atrial fibrillation.

  15. Interaction of europium and curium with alpha-amylase.


    Barkleit, Astrid; Heller, Anne; Ikeda-Ohno, Atsushi; Bernhard, Gert


    The complexation of Eu(iii) and Cm(iii) with the protein α-amylase (Amy), a major enzyme in saliva and pancreatic juice, was investigated over wide ranges of pH and concentration at both ambient and physiological temperatures. Macroscopic sorption experiments demonstrated a strong and fast binding of Eu(iii) to Amy between pH 5 and 8. The protein provides three independent, non-cooperative binding sites for Eu(iii). The overall association constant of these three binding sites on the protein was calculated to be log K = 6.4 ± 0.1 at ambient temperature. With potentiometric titration, the averaged deprotonation constant of the carboxyl groups (the aspartic and glutamic acid residues) of Amy was determined to be pKa = 5.23 ± 0.14 at 25 °C and 5.11 ± 0.24 at 37 °C. Time-resolved laser-induced fluorescence spectroscopy (TRLFS) revealed two different species for both Eu(iii) and Cm(iii) with Amy. In the case of the Eu(iii) species, the stability constants were determined to be log β11 = 4.7 ± 0.2 and log β13 = 12.0 ± 0.4 for Eu : Amy = 1 : 1 and 1 : 3 complexes, respectively, whereas the values for the respective Cm(iii) species were log β11 = 4.8 ± 0.1 and log β13 = 12.1 ± 0.1. Furthermore, the obtained stability constants were extrapolated to infinite dilution to make our data compatible with the existing thermodynamic database.

  16. Structure and sequence based analysis of alpha-amylase evolution.


    Singh, Swati; Guruprasad, Lalitha


    α-Amylases hydrolyze α- 1,4-glycosidic bonds during assimilation of biological macromolecules. The amino acid sequences of these enzymes in thousands of diverse organisms are known and the 3D structures of several proteins have been solved. The 3D structure analysis of these universal enzymes from diverse organisms has been studied by the generation of phylogenetic trees and structure based sequence analysis to generate a metric for the degree of conservation that is responsible for individual speciation. Greater similarities are observed between reference NCBI tree and structure based phylogenetic tree compared to sequence based phylogenetic tree indicating that structures truly represent the functional aspects of proteins than from the sequence information alone. We report differences in the profile specific conserved and insertion/deletion regions, factors responsible for the Ca(2+) and Cl(-) ion binding and the disulfide connectivity pattern that discriminate the enzymes over evolution.

  17. Use of dipeptidyl peptidase-4 inhibitors for the treatment of patients with type 2 diabetes mellitus and chronic kidney disease.


    Mikhail, Nasser


    Choices of antidiabetic agents for patients with type 2 diabetes mellitus (T2DM) and chronic kidney disease (CKD) are limited. Available data suggest that the use of dipeptidyl peptidase-4 (DPP-4) inhibitors may be safe in patients at various stages of renal insufficiency. However, except for linagliptin, dosage adjustment is necessary. The efficacy of DPP-4 inhibitors in patients with renal insufficiency is generally similar to that of the general population with T2DM, with reductions in mean glycated hemoglobin (HbA(1c)) levels of 0.7% to 1.0% compared with baseline, and 0.4% to 0.7% compared with placebo. The frequency of moderate hypoglycemia is 21% to 80% higher with DPP-4 inhibitors compared with placebo, but the frequency of severe hypoglycemia is similar to that with placebo. The use of DPP-4 inhibitors in patients with renal insufficiency is associated with a slight weight loss of < 1 kg. Dipeptidyl peptidase-4 inhibitors may be used as monotherapy in patients with CKD and HbA1c levels < 8.5% as an alternative to insulin, glipizide, or pioglitazone. They can also be used as add-on therapy to glipizide and/or pioglitazone in patients with HbA(1c) levels < 9%, but studies are needed to evaluate these combinations in patients with renal insufficiency. Long-term and large-scale clinical trials are underway to better determine the safety and efficacy of DPP-4 inhibitors in patients with T2DM with and without CKD.

  18. Renal Protective Effect of DPP-4 Inhibitors in Type 2 Diabetes Mellitus Patients: A Cohort Study

    PubMed Central

    Byun, JungHyun; Yoon, Dukyong; Jeon, Ja Young; Han, Seung Jin; Kim, Dae Jung; Lee, Kwan-Woo


    Aims. Dipeptidyl-peptidase IV inhibitors (DPP-4i) are among the most popular oral antidiabetic agents. However, the effects of DPP-4i on diabetic nephropathy are not well-established. The aim of this study was to determine the renoprotective effects of DPP-4i, using albuminuria and glomerular filtration rate (GFR) as indicators, in type 2 diabetes mellitus (T2DM) patients. Methods. This retrospective observational cohort study used the clinical database of a tertiary hospital. The changes of urine albumin/creatinine ratio (UACR), estimated GFR (eGFR), and metabolic parameters after treatment were compared with the changes of those parameters before treatment using paired Student's t-test. Results. The mean UACR in the entire study population decreased to approximately 45 mg/g 1 year after DPP-4i treatment, while it was increased approximately 39 mg/g 1 year before DPP-4i treatment (p < 0.05). Patients with macroalbuminuria showed a significant reduction in albumin levels after DPP-4i treatment (p < 0.05); however, patients with microalbuminuria and normoalbuminuria did not show improvements in albuminuria levels after treatment. Although eGFR was not changed 1 year after DPP-4i treatment, reductions in eGFR were slowed in patients with microalbuminuria and reversed in the macroalbuminuria or normoalbuminuria groups, 4 years after treatment. Conclusions. Administration of DPP-4i reduces urine albumin excretion and mitigates reduction of eGFR in T2DM patients. PMID:28119930

  19. Cyclooxygenase-2 Inhibitor Reduces Hepatic Stiffness in Pediatric Chronic Liver Disease Patients Following Kasai Portoenterostomy

    PubMed Central

    Chang, Hye Kyung; Chang, Eun Young; Ryu, Seonae


    Purpose The purpose of this study was to define the role of cyclooxygenase-2 inhibitors (COX-2i) in reducing hepatic fibrosis in pediatric patients with chronic liver disease. Materials and Methods From September 2009 to September 2010, patients over 2 years old who visited our outpatient clinic for follow-up to manage their chronic liver disease after Kasai portoenterostomy for biliary atresia, were included in this study. Volunteers were assigned to the study or control groups, according to their preference. A COX-2i was given to only the study group after obtaining consent. The degree of hepatic fibrosis (liver stiffness score, LSS) was prospectively measured using FibroScan, and liver function was examined using serum analysis before and after treatment. After 1 year, changes in LSSs and liver function were compared between the two groups. Results Twenty-five patients (18 females and 7 males) were enrolled in the study group. The control group included 44 patients (26 females and 18 males). After 1 year, the least square mean values for the LSSs were significantly decreased by 3.91±0.98 kPa (p=0.004) only in the study group. Serum total bilirubin did not decrease significantly in either group. Conclusion COX-2i treatment improved the LSS in patients with chronic liver disease after Kasai portoenterostomy for biliary atresia. PMID:27189282

  20. Comorbidities and inhibitors in adult patients with haemophilia: issues, costs and management strategies.


    Berntorp, Erik; Mauser-Bunschoten, Evelien; Jiménez-Yuste, Víctor; Spears, Jeffrey B


    Along with greater life expectancy in patients with haemophilia has been an increase in associated haemophilia-related (arthropathy, osteoporosis, viral infections) and age-related (cardiovascular disease, renal disease, cancer and others) comorbidities, many of which are only just emerging as the population ages. At present, experience in managing these comorbidities is limited. As the demographic shift continues, haemophilia care centres can expect to encounter more patients with greater levels of complexity. In the absence of evidence-based information to guide the management of adult patients with haemophilia, it is important that the scientific position be reviewed on a regular basis. To this end, several topics relevant to the clinical management of adult patients with haemophilia were examined in a symposium entitled Comorbidities and inhibitors in adult patients with haemophilia: issues, costs and management strategies held on 11 February 2015 in Helsinki, Finland, in conjunction with the 8th Annual Congress of the European Association for Haemophilia and Allied Disorders. This article is a summary of that event.

  1. Management of sexual dysfunction in postmenopausal breast cancer patients taking adjuvant aromatase inhibitor therapy

    PubMed Central

    Derzko, C.; Elliott, S.; Lam, W.


    Treatment with aromatase inhibitors for postmenopausal women with breast cancer has been shown to reduce or obviate invasive procedures such as hysteroscopy or curettage associated with tamoxifen-induced endometrial abnormalities. The side effect of upfront aromatase inhibitors, diminished estrogen synthesis, is similar to that seen with the natural events of aging. The consequences often include vasomotor symptoms (hot flushes) and vaginal dryness and atrophy, which in turn may result in cystitis and vaginitis. Not surprisingly, painful intercourse (dyspareunia) and loss of sexual interest (decreased libido) frequently occur as well. Various interventions, both non-hormonal and hormonal, are currently available to manage these problems. The purpose of the present review is to provide the practitioner with a wide array of management options to assist in treating the sexual consequences of aromatase inhibitors. The suggestions in this review are based on recent literature and on the recommendations set forth both by the North American Menopause Association and in the clinical practice guidelines of the Society of Gynaecologists and Obstetricians of Canada. The complexity of female sexual dysfunction necessitates a biopsychosocial approach to assessment and management alike, with interventions ranging from education and lifestyle changes to sexual counselling, pelvic floor therapies, sexual aids, medications, and dietary supplements—all of which have been reported to have a variable, but often successful, effect on symptom amelioration. Although the use of specific hormone replacement—most commonly local estrogen, and less commonly, systemic estrogen with or without an androgen, progesterone, or the additional of an androgen in an estrogenized woman (or a combination)—may be highly effective, the concern remains that in patients with estrogen-dependent breast cancer, including those receiving anti-estrogenic adjuvant therapies, the use of these hormones may be

  2. Management of sexual dysfunction in postmenopausal breast cancer patients taking adjuvant aromatase inhibitor therapy.


    Derzko, C; Elliott, S; Lam, W


    Treatment with aromatase inhibitors for postmenopausal women with breast cancer has been shown to reduce or obviate invasive procedures such as hysteroscopy or curettage associated with tamoxifen-induced endometrial abnormalities. The side effect of upfront aromatase inhibitors, diminished estrogen synthesis, is similar to that seen with the natural events of aging. The consequences often include vasomotor symptoms (hot flushes) and vaginal dryness and atrophy, which in turn may result in cystitis and vaginitis. Not surprisingly, painful intercourse (dyspareunia) and loss of sexual interest (decreased libido) frequently occur as well. Various interventions, both non-hormonal and hormonal, are currently available to manage these problems. The purpose of the present review is to provide the practitioner with a wide array of management options to assist in treating the sexual consequences of aromatase inhibitors. The suggestions in this review are based on recent literature and on the recommendations set forth both by the North American Menopause Association and in the clinical practice guidelines of the Society of Gynaecologists and Obstetricians of Canada. The complexity of female sexual dysfunction necessitates a biopsychosocial approach to assessment and management alike, with interventions ranging from education and lifestyle changes to sexual counselling, pelvic floor therapies, sexual aids, medications, and dietary supplements-all of which have been reported to have a variable, but often successful, effect on symptom amelioration. Although the use of specific hormone replacement-most commonly local estrogen, and less commonly, systemic estrogen with or without an androgen, progesterone, or the additional of an androgen in an estrogenized woman (or a combination)-may be highly effective, the concern remains that in patients with estrogen-dependent breast cancer, including those receiving anti-estrogenic adjuvant therapies, the use of these hormones may be

  3. Factors associated with residual gastroesophageal reflux disease symptoms in patients receiving proton pump inhibitor maintenance therapy

    PubMed Central

    Kawara, Fumiaki; Fujita, Tsuyoshi; Morita, Yoshinori; Uda, Atsushi; Masuda, Atsuhiro; Saito, Masaya; Ooi, Makoto; Ishida, Tsukasa; Kondo, Yasuyuki; Yoshida, Shiei; Okuno, Tatsuya; Yano, Yoshihiko; Yoshida, Masaru; Kutsumi, Hiromu; Hayakumo, Takanobu; Yamashita, Kazuhiko; Hirano, Takeshi; Hirai, Midori; Azuma, Takeshi


    AIM To elucidate the factors associated with residual gastroesophageal reflux disease (GERD) symptoms in patients receiving proton pump inhibitor (PPI) maintenance therapy in clinical practice. METHODS The study included 39 GERD patients receiving maintenance PPI therapy. Residual symptoms were assessed using the Frequency Scale for Symptoms of GERD (FSSG) questionnaire and the Gastrointestinal Symptom Rating Scale (GSRS). The relationships between the FSSG score and patient background factors, including the CYP2C19 genotype, were analyzed. RESULTS The FSSG scores ranged from 1 to 28 points (median score: 7.5 points), and 19 patients (48.7%) had a score of 8 points or more. The patients’ GSRS scores were significantly correlated with their FSSG scores (correlation coefficient = 0.47, P < 0.005). In erosive esophagitis patients, the FSSG scores of the CYP2C19 rapid metabolizers (RMs) were significantly higher than the scores of the poor metabolizers and intermediate metabolizers (total scores: 16.7 ± 8.6 vs 7.8 ± 5.4, P < 0.05; acid reflux-related symptom scores: 12 ± 1.9 vs 2.5 ± 0.8, P < 0.005). In contrast, the FSSG scores of the CYP2C19 RMs in the non-erosive reflux disease patients were significantly lower than those of the other patients (total scores: 5.5 ± 1.0 vs 11.8 ± 6.3, P < 0.05; dysmotility symptom-related scores: 1.0 ± 0.4 vs 6.0 ± 0.8, P < 0.01). CONCLUSION Approximately half of the GERD patients receiving maintenance PPI therapy had residual symptoms associated with a lower quality of life, and the CYP2C19 genotype appeared to be associated with these residual symptoms. PMID:28373773

  4. What causes a small increase in radiographic progression in rheumatoid arthritis patients tapering TNF inhibitors?

    PubMed Central

    Bouman, Chantal A M; den Broeder, Alfons A; van der Maas, Aatke; van den Hoogen, Frank H J; Landewé, Robert B M; van Herwaarden, Noortje


    Objective In a randomised controlled trial investigating tapering of TNF inhibitors (TNFi) compared with usual care (UC) in rheumatoid arthritis patients, minimal radiographic progression was more frequent in patients who attempted tapering. Possible explanations include higher incidence of flaring, higher mean disease activity or lower TNFi use. Methods 18 months data from the DRESS study were used. Change in Sharp-van der Heijde (ΔSvdH) score (linear regression) and proportion of patients with >0.5 ΔSvdH (logistic regression) were used as outcomes. The cumulative incidence and number of short-lived and major flares per patient, mean time-weighted disease activity (MTW-DAS28-CRP) and TNFi use were used as independent variables. Regression models were performed stratified per study group and corrected for possible confounders. Results 175 of 180 patients had 18-month data available. The mean ΔSvdH were 0.75 and 0.15 units with 37 of 116 (32%) and 9 of 59 (15%) patients exceeding 0.5 points in the tapering and UC group, respectively (both p<0.05). MTW-DAS28-CRP, but not incidence or number of short-lived or major flares, or TNFi use, was independently associated with the mean progression score, but only in the tapering group. Additional analyses on DAS28-CRP subcomponents showed that this was mainly caused by MTW swollen joint count. No confounders were identified. Conclusions Radiographic progression was associated with higher MTW-DAS28-CRP (and especially swollen joint count), but only in patients who tapered TNFi. This finding stresses the importance of maintaining disease activity as low as possible in patients in whom TNFi is tapered and to check for radiographic progression regularly. Trial registration number NTR 3216; Post-results.

  5. Effects of the angiotensin converting enzyme inhibitor enalapril compared with diuretic therapy in elderly hypertensive patients.


    Verza, M; Cacciapuoti, F; Spiezia, R; D'Avino, M; Arpino, G; D'Errico, S; Sepe, J; Varricchio, M


    The aim of this study was to evaluate the usefulness of the angiotensin converting enzyme (ACE) inhibitor enalapril in a group of 30 patients (mean age 73.3 years) with moderate hypertension and normal haematological and chemical parameters (170 +/- 8.1 mmHg systolic and 104 +/- 5.8 mmHg diastolic blood pressure), who were receiving diuretic therapy with chlorthalidone (12.5 mg/day). This therapy caused a significant decrease in systolic and diastolic blood pressure (to 165 +/- 6.7 and 98 +/- 4.7 mmHg, respectively; P less than 0.001) but it also induced hypokalaemia (3.04 +/- 0.7 mmol/l; P less than 0.001) and multiple (greater than 10/h) and complex premature ventricular depolarizations (2nd, 3rd and 4th Lown grade). Enalapril treatment (5 mg/day for 5 days and 10 mg thereafter) was added to the diuretic therapy and after 2 months a further decrease in blood pressure was observed (to 158 +/- 5.6 mmHg systolic, P less than 0.001; 87.2 +/- 5.0 mmHg diastolic, P less than 0.001). Moreover, there was a significant reduction in the mean heart rate (from 79 to 72 beats/min, P less than 0.005) and an increase in serum potassium (to 4.19 +/- 0.2 mmol/l; P less than 0.001). In 80% of patients a 24-h dynamic electrocardiogram showed a significant reduction in both the number and complexity of premature ventricular depolarizations. Our findings suggest that ACE inhibitors can be useful in patients developing hypokalaemia during therapy. However, we are not yet able to explain the beneficial effects of enalapril in decreasing the frequency of premature ventricular depolarizations.

  6. Plasminogen activator inhibitor-1 is elevated in patients with COPD independent of metabolic and cardiovascular function

    PubMed Central

    Waschki, Benjamin; Watz, Henrik; Holz, Olaf; Magnussen, Helgo; Olejnicka, Beata; Welte, Tobias; Rabe, Klaus F; Janciauskiene, Sabina


    Introduction Plasminogen activator inhibitor-1 (PAI-1), a major inhibitor of fibrinolysis, is associated with thrombosis, obesity, insulin resistance, dyslipidemia, and premature aging, which all are coexisting conditions of chronic obstructive pulmonary disease (COPD). The role of PAI-1 in COPD with respect to metabolic and cardiovascular functions is unclear. Methods In this study, which was nested within a prospective cohort study, the serum levels of PAI-1 were cross-sectionally measured in 74 stable COPD patients (Global Initiative for Chronic Obstructive Lung Disease [GOLD] Stages I–IV) and 18 controls without lung disease. In addition, triglycerides, high-density lipoprotein cholesterol, fasting plasma glucose, waist circumference, blood pressure, smoking status, high-sensitive C-reactive protein (hs-CRP), adiponectin, ankle–brachial index, N-terminal pro-B-type natriuretic peptide, and history of comorbidities were also determined. Results The serum levels of PAI-1 were significantly higher in COPD patients than in controls, independent of a broad spectrum of possible confounders including metabolic and cardiovascular dysfunction. A multivariate regression analysis revealed triglyceride and hs-CRP levels to be the best predictors of PAI-1 within COPD. GOLD Stages II and III remained independently associated with higher PAI-1 levels in a final regression analysis. Conclusion The data from the present study showed that the serum levels of PAI-1 are higher in patients with COPD and that moderate-to-severe airflow limitation, hypertriglyceridemia, and systemic inflammation are independent predictors of an elevated PAI-1 level. PAI-1 may be a potential biomarker candidate for COPD-specific and extra-pulmonary manifestations. PMID:28356730

  7. Effects of neutrophil elastase inhibitor in patients undergoing esophagectomy: A systematic review and meta-analysis

    PubMed Central

    Wang, Zhi-Qiang; Chen, Long-Qi; Yuan, Yong; Wang, Wen-Ping; Niu, Zhong-Xi; Yang, Yu-Shang; Cai, Jie


    AIM: To evaluate the benefit and safety of sivelestat (a neutrophil elastase inhibitor) administration in patients undergoing esophagectomy. METHODS: Online databases including PubMed, EMBASE, the Cochrane Library, Web of Knowledge, and Chinese databases (Wanfang database, VIP and CNKI) were searched systematically up to November 2013. Randomized controlled trials and high-quality comparative studies were considered eligible for inclusion. Three reviewers evaluated the methodological quality of the included studies, and Stata 12.0 software was used to analyze the extracted data. The risk ratio (RR) was used to express the effect size of dichotomous outcomes, and mean difference (MD) or standardized mean difference was used to express the effect size of continuous outcomes. RESULTS: Thirteen studies were included in this systematic review and nine studies were included in the meta-analysis. The duration of mechanical ventilation was significantly decreased in the sivelestat group on postoperative day 5 [I2 = 76.3%, SMD = -1.41, 95%CI: -2.63-(-0.19)]. Sivelestat greatly lowered the incidence of acute lung injury in patients after surgery (I2 = 0%, RR = 0.27, 95%CI: 0.08-0.93). However, it did not decrease the incidence of pneumonia, intensive care unit stay or postoperative hospital stay, and did not increase the incidence of complications such as anastomotic leakage, recurrent nerve palsy, wound infection, sepsis and catheter-related fever. CONCLUSION: A neutrophil elastase inhibitor is beneficial in patients undergoing esophagectomy. More high quality, large sample, multi-center and randomized controlled trials are needed to validate this effect. PMID:25834341

  8. Impact of comorbidities on TNF inhibitor persistence in rheumatoid arthritis patients: an analysis of Korean National Health Insurance claims data.


    Cho, Soo-Kyung; Sung, Yoon-Kyoung; Choi, Chan-Bum; Bae, Sang-Cheol


    The aim of this study is to evaluate tumor necrosis factor (TNF) inhibitor persistence and the impact of comorbidity on treatment persistence in patients with rheumatoid arthritis (RA). In a Korean National Health Insurance claims database, patients with a diagnosis code of RA (M05 or M06) who started TNF inhibitor therapy between July 1, 2007 and June 30, 2008 were enrolled. The study cohort was followed until December 31, 2009. Persistence was examined using Kaplan-Meier survival analysis, and multivariate Cox proportional hazard models were developed to examine the potential impact of comorbidities on drug persistence. A total of 388 patients were enrolled in the study cohort. The mean persistence rate in the overall population was 61% at 18 months. Drug survival rates for adalimumab and etanercept at 6 months were 82 and 85%, respectively, and 73 and 78%, respectively, at 12 months. Charlson comorbidity index (CCI) scores and comorbidities such as diabetes, chronic pulmonary disease, mild liver disease, and depression at initiation were not related with drug persistence, while peptic ulcer disease (PUD) lowered the risk of discontinuation of TNF inhibitors (HR 0.73, 95% CI 0.55-0.97). Old age (HR 1.59, 95% CI 1.09-2.33) and prescription of inhibitors by an internist (HR 1.59, 95% CI 1.02-2.48) were associated with discontinuation of TNF inhibitors. The persistence of TNF inhibitors was 61% at 18 months. CCI score and other comorbidities were not related with early discontinuation of TNF inhibitors, while PUD was an independent contributing factor to TNF inhibitor persistence.

  9. Influence of Tyrosine Kinase Inhibitors on Hypertension and Nephrotoxicity in Metastatic Renal Cell Cancer Patients.


    Semeniuk-Wojtaś, Aleksandra; Lubas, Arkadiusz; Stec, Rafał; Szczylik, Cezary; Niemczyk, Stanisław


    Renal cell carcinoma (RCC) is one of the most common kidney malignancies. An upgraded comprehension of the molecular biology implicated in the development of cancer has stimulated an increase in research and development of innovative antitumor therapies. The aim of the study was to analyze the medical literature for hypertension and renal toxicities as the adverse events of the vascular endothelial growth factor (VEGF) signaling pathway inhibitor (anti-VEGF) therapy. Relevant studies were identified in PubMed and databases. Eligible studies were phase III and IV prospective clinical trials, meta-analyses and retrospective studies that had described events of hypertension or nephrotoxicity for patients who received anti-VEGF therapy. A total of 48 studies were included in the systematic review. The incidence of any grade hypertension ranged from 17% to 49.6%. Proteinuria and increased creatinine levels were ascertained in 8% to 73% and 5% to 65.6% of patients, respectively. These adverse events are most often mild in severity but may sometimes lead to treatment discontinuation. Nephrotoxicity and hypertension are related to multiple mechanisms; however, one of the main disturbances in those patients is VEGF inhibition. There is a significant risk of developing hypertension and renal dysfunction among patients receiving anti-VEGF treatment; however, there is also some evidence that these side effects may be used as biomarkers of response to antiangiogenic agents.

  10. Ophthalmic results in patients with macroprolactinomas treated with a new prolactin inhibitor CV 205-502.

    PubMed Central

    Grochowicki, M; Khalfallah, Y; Vighetto, A; Berquet, S; Sassolas, G


    Macroprolactinomas are pituitary tumours which have been effectively treated medically since the introduction of bromocriptine. The visual function of 13 patients treated with a new prolactin (PRL) inhibitor CV 205-502 (Sandoz Basle), a potent and selective dopamine D2 receptor agonist, was evaluated. This is the first detailed ophthalmic report of the use of this drug in macroprolactinomas. Patients were enrolled from June 1988 to July 1990 (mean follow up 30 months). Visual function including visual acuity, ocular pressure, and visual fields was regularly controlled. Visual fields (VF) were tested with Goldmann and automatic static perimetry (Vision Monitor). Treatment was globally effective. No modifications of the visual function were observed in nine patients (six normal, three previous VF losses after surgery). In four other patients, visual function dramatically improved (regression of a III paresis, one case; disappearance of a chiasmatic syndrome, three cases). A pituitary necrosis was observed in one case and successfully cured. CV 205-502 seems to be an effective and well tolerated treatment of macroprolactinomas. Images PMID:7906538

  11. Influence of Tyrosine Kinase Inhibitors on Hypertension and Nephrotoxicity in Metastatic Renal Cell Cancer Patients

    PubMed Central

    Semeniuk-Wojtaś, Aleksandra; Lubas, Arkadiusz; Stec, Rafał; Szczylik, Cezary; Niemczyk, Stanisław


    Renal cell carcinoma (RCC) is one of the most common kidney malignancies. An upgraded comprehension of the molecular biology implicated in the development of cancer has stimulated an increase in research and development of innovative antitumor therapies. The aim of the study was to analyze the medical literature for hypertension and renal toxicities as the adverse events of the vascular endothelial growth factor (VEGF) signaling pathway inhibitor (anti-VEGF) therapy. Relevant studies were identified in PubMed and databases. Eligible studies were phase III and IV prospective clinical trials, meta-analyses and retrospective studies that had described events of hypertension or nephrotoxicity for patients who received anti-VEGF therapy. A total of 48 studies were included in the systematic review. The incidence of any grade hypertension ranged from 17% to 49.6%. Proteinuria and increased creatinine levels were ascertained in 8% to 73% and 5% to 65.6% of patients, respectively. These adverse events are most often mild in severity but may sometimes lead to treatment discontinuation. Nephrotoxicity and hypertension are related to multiple mechanisms; however, one of the main disturbances in those patients is VEGF inhibition. There is a significant risk of developing hypertension and renal dysfunction among patients receiving anti-VEGF treatment; however, there is also some evidence that these side effects may be used as biomarkers of response to antiangiogenic agents. PMID:27941701

  12. Second-Generation Tyrosine Kinase Inhibitors (Tki) as Salvage Therapy for Resistant or Intolerant Patients to Prior TKIs.


    Breccia, Massimo; Alimena, Giuliana


    With the advent of target therapies, imatinib became the mainstay for treatment of chronic myeloid leukemia. However, despite the brilliant results obtained with this drug, more than 30% of patients discontinue therapy in long-term due to several reasons, including failure and/or intolerance. Second-generation tyrosine kinase inhibitors (TKIs) are more potent drugs and have expanded inhibition against a broad spectrum of mutations resistant to imatinib. Both nilotinib and dasatinib have demonstrated in vitro and in vivo clinical activity against different types of mutations and various forms of resistance. However, patients with T315I mutation do not obtain an advantage from these drugs and a third generation inhibitor ponatinib, a pan-BCR drug, was tested with significant results. In this review, we report the results of second-and third-generation TKIs tested as second or third line therapy in patients resistant and/or intolerant to previous inhibitors.

  13. DPP-4 Inhibitor Reduces Central Blood Pressure in a Diabetic and Hypertensive Patient

    PubMed Central

    Cosenso-Martin, Luciana Neves; Giollo-Junior, Luiz Tadeu; Vilela-Martin, José Fernando


    Abstract Hypertension and type 2 diabetes mellitus (DM) are among the main risk factors for the development of cardiovascular disease. Pharmacotherapy for DM should not only improve blood glucose control, but also provide beneficial glucose-independent cardiovascular effects. The central systolic blood pressure (SBP) has become more important than the brachial SBP in the assessment of cardiovascular risk. This case report describes the effect of vildagliptin, a dipeptidyl peptidase-4 (DPP-4) inhibitor, on the central SBP in a 54-year-old woman with hypertension and DM. She was submitted to applanation tonometry (AT) before and after vildagliptin association. AT of the radial artery is a non-invasive method that indirectly assesses arterial stiffness by calculating the central SBP and the augmentation index (AIx). After 3 months of follow-up using vildagliptin, central SBP and AIx were improved. Moreover, she presented better glycemic control. This case suggests an effect of DPP-4 inhibitor on arterial stiffness parameter (central SBP) in a hypertensive and diabetic patient, which shows a glucose-independent beneficial cardiovascular effect of this group of drugs. PMID:26166078

  14. The prevalence of factor VIII and IX inhibitors among Saudi patients with hemophilia: Results from the Saudi national hemophilia screening program.


    Owaidah, Tarek; Momen, Abdulkareem Al; Alzahrani, Hazzaa; Almusa, Abdulrahman; Alkasim, Fawaz; Tarawah, Ahmed; Nouno, Randa Al; Batniji, Fatima Al; Alothman, Fahad; Alomari, Ali; Abu-Herbish, Saud; Abu-Riash, Mahmoud; Siddiqui, Khawar; Ahmed, Mansor; Mohamed, S Y; Saleh, Mahasen


    Hemophilia A and B are X-linked diseases that predominantly affect male patients. Patients can develop coagulation factor inhibitors, which exponentially increases the treatment cost. However, the prevalence of factor VIII and IX inhibitors in Saudi Arabia is unclear.This study aimed to determine the Saudi prevalence of factor VIII and IX inhibitors.This 4-year, 7-center, cross-sectional study evaluated the Saudi prevalences of hemophilia A and B. We collected the patients' clinical data, evaluated their disease, and tested for factor inhibitors.We included 202 patients with hemophilia (median age at diagnosis: 0.13 years, range: birth-34.8 years). The patients included 198 male patients (98%), 148 patients with hemophilia A (73.3%), and 54 patients with hemophilia B (26.7%). The patients exhibited severe factor VIII activity (<1%; 121 patients; 5.2%), moderate activity (1-5%; 7 patients; 4.9%), and mild activity (14 patients; 9.9%). Among the patients with care-related data, most patients were treated for episodic bleeding (76.8%) or received prophylaxis (22.6%); 1 patient received both treatments. Among the patients with source-related data, the factor replacements were derived from plasma (48.4%), recombinant concentrates (22.9%), both sources (14.6%), or fresh frozen plasma (14.1%). Factor VIII inhibitors were observed in 43 (29.3%) of the 147 patients, and only 1 of the 54 patients developed factor IX inhibitors. Most patients who developed inhibitors had severe hemophilia (40/44; 90.9%), and inhibitors were also common among patients who received recombinant products (14/43; 32.6%).The Saudi prevalence of factor inhibitors was similar to those among other ethnic populations.

  15. Association Between Ischemic Stroke and Tumor Necrosis Factor Inhibitor Therapy in Patients With Rheumatoid Arthritis

    PubMed Central

    Low, Audrey S. L.; Lunt, Mark; Mercer, Louise K.; Watson, Kath D.; Dixon, William G.; Symmons, Deborah P. M.


    Objective Patients with rheumatoid arthritis (RA) are at an increased risk of ischemic stroke. Tumor necrosis factor inhibitors (TNFi) may influence risk and mortality after ischemic stroke by reducing inflammation. This study was undertaken to examine the association of TNFi with the risk of incident ischemic stroke and with 30‐day and 1‐year mortality after ischemic stroke. Methods Patients with RA starting therapy with TNFi and a biologics‐naive comparator group treated with synthetic disease‐modifying antirheumatic drugs (DMARDs) only were recruited to the British Society for Rheumatology Biologics Register for Rheumatoid Arthritis from 2001 to 2009. Patients were followed up via clinical and patient questionnaires as well as the national death register. Incident strokes were classified as ischemic if brain imaging reports suggested ischemia or if ischemic stroke was reported as the underlying cause of death on a death certificate. Patients with a previous stroke were excluded. Risk of ischemic stroke was compared between patients receiving synthetic DMARDs only and those ever‐exposed to TNFi using a Cox proportional hazards regression model adjusted for potential confounders. Mortality after ischemic stroke was compared between synthetic DMARD–treated patients and TNFi‐treated patients using logistic regression, adjusted for age and sex. Results To April 2010, 127 verified incident ischemic strokes (21 in 3,271 synthetic DMARD–treated patients and 106 in 11,642 TNFi‐treated patients) occurred during 11,973 and 61,226 person‐years of observation, respectively (incidence rate 175 versus 173 per 100,000 person‐years). After adjustment for confounders, there was no association between ever‐exposure to TNFi and ischemic stroke (hazard ratio 0.99 [95% confidence interval (95% CI) 0.54–1.81]). Mortality 30 days or 1 year after ischemic stroke was not associated with concurrent TNFi exposure (odds ratio 0.18 [95% CI 0.03–1.21] and 0.60 [95

  16. [Efficacy of levocarnitine for tyrosine kinase inhibitor-induced painful muscle cramps in patients with chronic myelogenous leukemia].


    Yamada, Michiko; Kuroda, Hiroyuki; Shimoyama, Saori; Ito, Ryo; Sugama, Yusuke; Sato, Ken; Yamauchi, Natsumi; Horiguchi, Hiroto; Nakamura, Hajime; Hamaguchi, Kota; Abe, Tomoyuki; Fujii, Shigeyuki; Maeda, Masahiro; Kato, Junji


    Muscle cramps are side effects commonly associated with tyrosine kinase inhibitor (TKI) treatment. Patients suffering from muscle cramps are treated with various medications such as calcium, magnesium and vitamin supplements, but these therapies are often ineffective. We report two patients with chronic myelogenous leukemia who developed muscle cramps caused by TKI. These patients were treated successfully with levocarnitine. Both of our cases revealed the beneficial effects of levocarnitine treatment on TKI-induced muscle cramps.

  17. Transitioning issues in adolescent to young adult hemophilia patients with inhibitors: an approach for a growing population.


    Young, Guy


    The major adverse effect of factor replacement therapy in patients with hemophilia is the development of neutralizing antibodies termed inhibitors. This complication renders standard factor replacement therapy ineffective resulting in increased morbidity and mortality. Until recently, the population of adults with inhibitors was relatively small due to the death of many of the patients from HIV that they contracted from contaminated factor in the early 1980s. With the advent of factor products with reduced risks for deadly infections in the mid-1980s to early 1990s, a cohort of inhibitor patients is now beginning to enter adulthood thus raising the issues regarding the transition of these patients into adulthood. It is, therefore, expected that adult hematologists will be seeing more inhibitor patients and that pediatric hematologists will be faced with managing this transition process, which may not necessarily include transition to an adult facility or adult hematologist. This review will discuss the various issues ranging from choice of medical provider to a discussion of psychosocial and financial issues facing this specific patient population.

  18. Clinical significance of plasminogen activator inhibitor activity in patients with exercise-induced ischemia

    SciTech Connect

    Sakata, K.; Kurata, C.; Taguchi, T.; Suzuki, S.; Kobayashi, A.; Yamazaki, N.; Rydzewski, A.; Takada, Y.; Takada, A. )


    To assess the fibrinolytic system in patients with exercise-induced ischemia and its relation to ischemia and severity of coronary artery disease (CAD), 47 patients with CAD confirmed by results of coronary angiography underwent symptom-limited multistage exercise thallium-201 emission computed tomography. All patients with CAD had exercise-induced ischemia as assessed from thallium-201 images. Pre- and peak exercise blood samples from each patient and preexercise blood samples from control subjects were assayed for several fibrinolytic components and were also assayed for plasma adrenaline. The extent of ischemia was defined as delta visual uptake score (total visual uptake score in delayed images minus total visual uptake score in initial images) and the severity of CAD as the number of diseased vessels. In the basal condition, plasminogen activator inhibitor (PAI) activity was significantly higher in patients with exercise-induced ischemia as compared to control subjects (p less than 0.01), although there were no significant differences in other fibrinolytic variables between the two groups. Moreover, PAI activity in the basal condition displayed a significantly positive correlation with the extent of ischemia (r = 0.47, p less than 0.01). Patients with exercise-induced ischemia were divided into two groups (24 with single-vessel disease and 23 with multivessel disease). There were no significant differences in coronary risk factors, hemodynamics, or plasma adrenaline levels during exercise between single-vessel and multivessel disease except that delta visual uptake score was significantly higher in multivessel disease (p less than 0.01).

  19. ACE Inhibitor and Angiotensin Receptor Blocker Use and Mortality in Patients with Chronic Kidney Disease

    PubMed Central

    Molnar, Miklos Z; Kalantar-Zadeh, Kamyar; Lott, Evan H; Lu, Jun Ling; Malakauskas, Sandra M; Ma, Jennie Z; Quarles, Darryl L; Kovesdy, Csaba P


    Objective To assess the association between ACEI/ARB use and mortality in CKD patients. Background There is insufficient evidence about the association of angiotensin converting enzyme inhibitors (ACEI) or angiotensin receptor blockers (ARBs) with mortality in chronic kidney disease (CKD) patients. Methods A logistic regression analysis was used to calculate the propensity of ACEI/ARB initiation in 141,413 US veterans with non-dialysis CKD previously unexposed to ACEI/ARB treatment. We examined the association of ACEI/ARB administration with all-cause mortality in patients matched by propensity scores, using the Kaplan-Meier method and Cox models in “intention-to-treat” analyses, and in generalized linear models with binary outcomes and inverse probability treatment weighing (IPTW) in “as-treated” analyses. Results The mean±SD age of the patients at baseline was 75±10 years, 8% of patients were black, and 22% were diabetic. ACEI/ARB administration was associated with significantly lower risk of mortality both in the intention-to-treat analysis (HR=0.81; 95%CI: 0.78-0.84, p<0.001) and in the as-treated analysis with IPTW (OR=0.37; 95%CI: 0.34-0.41, p<0.001). The association of ACEI/ARB treatment with lower risk of mortality was present in all examined subgroups. Conclusions In this large contemporary cohort of non-dialysis dependent CKD patients, ACEI/ARB administration was associated with greater survival. PMID:24269363

  20. The aromatase inhibitors (plus ovarian function suppression) in premenopausal breast cancer patients: ready for prime time?


    Montagna, Emilia; Cancello, Giuseppe; Colleoni, Marco


    Tamoxifen alone or the combination of ovarian function suppression (OFS) and tamoxifen are the mainstay of hormonal therapy in premenopausal women with endocrine-responsive breast cancer. The results of large trials conducted with the third generation of aromatase inhibitors (AIs) in the metastatic, neoadjuvant and adjuvant setting, indicated better outcomes among postmenopausal breast cancer patients with endocrine responsive disease given AIs than among those given tamoxifen. These results supported the investigation of AIs in combination with OFS in premenopausal women with hormone receptor positive breast cancer. In this article we reviewed the efficacy and toxicity data on the use of AIs combined with OFS in premenopausal breast cancer patients in metastatic, neoadjuvant and adjuvant setting. Given the available evidence at the time in metastatic setting for premenopausal patients suitable of endocrine therapy the AI is a viable option, if tamoxifen resistance is proven, although mandates the use of OFS. In neoadjuvant setting the AIs in combination of OFS should not be used outside of a clinical trial. In the adjuvant setting, tamoxifen alone or OFS plus tamoxifen are reasonable options. Despite the lack of conclusive data favoring the combination of tamoxifen plus OFS, this treatment might be a reasonable option for subgroups of patients such as very young patients, OFS alone should nort be considered unless tamoxifen was contraindicated. Similarly, in cases where tamoxifen is contraindicated, AIs as an adjunct to OFS is a treatment option in premenopausal patients. New large randomized studies are required to confirm the role of OFS plus an AI in premenopausal women.

  1. Inequity of access to ACE inhibitors in Swedish heart failure patients: a register-based study

    PubMed Central

    Lindahl, Bertil; Hanning, Marianne; Westerling, Ragnar


    Background Several international studies suggest inequity in access to evidence-based heart failure (HF) care. Specifically, studies of ACE inhibitors (ACEIs) point to reduced ACEI access related to female sex, old age and socioeconomic position. Thus far, most studies have either been rather small, lacking diagnostic data, or lacking the possibility to account for several individual-based sociodemographic factors. Our aim was to investigate differences, which could reflect inequity in access to ACEIs based on sex, age, socioeconomic status or immigration status in Swedish patients with HF. Methods Individually linked register data for all Swedish adults hospitalised for HF in 2005–2010 (n=93 258) were analysed by multivariate regression models to assess the independent risk of female sex, high age, low employment status, low income level, low educational level or foreign country of birth, associated with lack of an ACEI dispensation within 1 year of hospitalisation. Adjustment for possible confounding was made for age, comorbidity, Angiotensin receptor blocker therapy, period and follow-up time. Results Analysis revealed an adjusted OR for no ACEI dispensation for women of 1.31 (95% CI 1.27 to 1.35); for the oldest patients of 2.71 (95% CI 2.53 to 2.91); and for unemployed patients of 1.59 (95% CI 1.46 to 1.73). Conclusions Access to ACEI treatment was reduced in women, older patients and unemployed patients. We conclude that access to ACEIs is inequitable among Swedish patients with HF. Future studies should include clinical data, as well as mortality outcomes in different groups. PMID:26261264

  2. Effects of tumor necrosis factor α inhibitors extend beyond psoriasis: insulin sensitivity in psoriasis patients with type 2 diabetes mellitus.


    Al-Mutairi, Nawaf; Shabaan, Dalia


    Psoriasis is a chronic inflammatory disease that has been associated with an increased incidence of insulin resistance and diabetes mellitus (DM). Tumor necrosis factor (TNF) α inhibitors and IL-6 blockers, which are routinely used for the treatment of psoriasis, have been positively associated with insulin sensitivity. The aim of this study was to assess the effects of treatment with TNF-α inhibitors on insulin sensitivity in psoriatic patients with type 2 DM. This study confirms a beneficial effect of anti-TNF-α agents on insulin resistance and insulin sensitivity in psoriasis patients with type 2 DM.

  3. Fatal serotonin syndrome precipitated by oxcarbazepine in a patient using an selective serotonin reuptake inhibitor.


    Dardis, Christopher; Omoregie, Eghosa; Ly, Vanthanh


    Oxcarbazepine, a metabolite of carbamazepine, is used as an antiepileptic, analgesic for neuropathic pain and in the treatment of affective disorders. It has been approved by the Food and Drug Administration for partial seizures in adults as both adjunctive and monotherapy, and as adjunctive therapy in children aged from 2 to 16 years ( We present a case of serotonin syndrome, which was precipitated by this medicine in a patient who had been predisposed by long-term treatment with sertraline, a selective serotonin reuptake inhibitor. This is the first reported fatality due to this drug interaction and only the second case of serotonin syndrome reported with oxcarbazepine. Physicians should consider this risk when prescribing the above combination.

  4. [Susceptibility of the elderly patient to hyponatremia induced by selective serotonin reuptake inhibitors].


    Fonzo-Christe, C; Vogt, N


    Numerous spontaneous reports of the syndrome of inappropriate secretion of antidiuretic hormone (SIADH) have followed the increased use of selective serotonin reuptake inhibitors (SSRI). It has been estimated that 1 in 200 patients treated per year developed SIADH, age and low body weight being particular risk factors. No clear gender effect has been detected when confounding factors such as body weight or antidepressant consumption are taken into account. Age-related susceptibility to hyponatraemia may be explained by physiological changes in renal and endocrine function. The high prevalence of polymedication and pluripathology in the elderly may be a contributing factor as well. To date, no study has demonstrated how SSRIs affect the regulation of fluid/sodium balance nor whether they have an independent effect on this regulation in depressed subjects.

  5. Left ventricular hypertrophy among black hypertensive patients: focusing on the efficacy of angiotensin converting enzyme inhibitors

    PubMed Central


    Background Left ventricular hypertrophy (LVH) is an independent cardiovascular risk factor in patients with essential hypertension. The main objective of this study was to assess the echocardiographic prevalence of left ventricular hypertrophy in patients with hypertension, its risk factors and effect of antihypertensive drugs on its prevalence. Methods A hospital based cross sectional study was conducted on 200 hypertensive patients on treatment in southwest Ethiopia. A pretested structured questionnaire was used to collect data from participants and their clinical records. Blood pressure and anthropometric measurements were taken according to recommended standards. Left ventricular mass was measured by transthoracic echocardiography. Associations between categorical variables were assessed using chi-square test and odds ratio with 95% confidence interval. Logistic regression model was done to identify risks factors of LVH. P values of < 0.05 were considered as statistically significant. Results The mean age, systolic blood pressure, diastolic blood pressure and body mass index were 55.7 ± 11.3 years, 139.2 ± 7.7 mmHg, 89.2 ± 5.7 mmHg and 24.2 ± 3.4 Kg/m2 respectively. The overall prevalence of LVH among these study subjects was 52%. Age ≥50 years (OR: 3.49, 95% CI 1.33-9.14, P = 0.011), female gender (OR: 7.69, 95% CI 3.23-20.0, P < 0.001), systolic blood pressure ≥140 mmHg (OR: 2.85, 95% CI 1.27-6.41, P = 0.011), and duration of hypertension (OR: 3.59, 95% CI 1.47-8.76, P = 0.005) were independent predictors of left ventricular hypertrophy. Angiotensin converting enzyme (ACE) inhibitors were the only antihypertensive drugs associated with lower risk of left ventricular hypertrophy (OR: 0.08, 95% CI 0.03-0.19, p < 0.001). Conclusions Left ventricular hypertrophy was found to be highly prevalent in hypertensive patients in Ethiopia. ACE inhibitors were the only antihypertensive drugs associated with reduced risk

  6. Potential risk of TNF inhibitors on the progression of interstitial lung disease in patients with rheumatoid arthritis

    PubMed Central

    Nakashita, Tamao; Ando, Katsutoshi; Kaneko, Norihiro; Takahashi, Kazuhisa; Motojima, Shinji


    Objectives Biological therapy represents important advances in alleviating rheumatoid arthritis (RA), but the effect on interstitial lung disease (ILD) has been controversial. The objective of this study was to assess the risk of such treatment for patients with ILD. Design Case–control cohorts. Setting Single centre in Japan. Participants This study included 163 patients with RA who underwent biological therapy. Outcome measured We assessed chest CT before initiation of biological therapy and grouped 163 patients according to the presence of ILD (with (n=58) and without pre-existing ILD (n=105)). Next, we evaluated serial changes of chest CT after treatment and visually assessed the emergence of ILD or its progression, which was referred to as an ‘ILD event’. Then, we also classified the patients according to the presence of ILD events and analysed their characteristics. Results Tumour necrosis factor (TNF) inhibitors were administered to more patients with ILD events than those without ILD events (88% vs 60%, p<0.05), but recipients of tocilizumab or abatacept did not differ in this respect. Of 58 patients with pre-existing ILD, 14 had ILD events, and that proportion was greater than for those without pre-existing ILD (24% vs 3%, p<0.001). Of these 14 patients, all were treated with TNF inhibitors. Four patients developed generalised lung disease and two died from ILD progression. Baseline levels of KL-6 were similar in both groups, but increased in patients with ILD events. Conclusions TNF inhibitors have the potential risk of ILD events, particularly for patients with pre-existing ILD, and KL-6 is a valuable surrogate marker for detecting ILD events. Our data suggest that non-TNF inhibitors are a better treatment option for these patients. PMID:25125479

  7. Exercise intervention in breast cancer patients with aromatase inhibitor-associated arthralgia: a pilot study.


    DeNysschen, C A; Burton, H; Ademuyiwa, F; Levine, E; Tetewsky, S; O'Connor, T


    Aromatase inhibitors (AIs) block estrogen synthesis and are commonly used as adjuvant treatments for breast cancer patients. A common side effect is joint pain. This was a pilot study to examine implementation of an exercise program in reducing joint pain and improving quality of life (QoL) and functional performance in breast cancer patients treated with AIs. Twenty-six participants completed an 8-week, home-based program that combined upper and lower body resistance exercises with self-selected aerobic exercises. We measured: (1) anthropometry (2) functional performance (grip strength, biceps curl to exhaustion, and sit-to-stand and cardiovascular endurance (3-min step test). Joint pain and QoL were assessed using self-administered surveys. Participants reported a significantly lower number of painful joints, an improvement in QoL and a reduction in depressive symptoms. Significant improvements in grip strength, biceps curl, and sit-to-stand (by 14%, 51% and 15% respectively) were also observed. However, we found no significant changes in cardiovascular endurance or in anthropometric measures. An 8-week, home-based exercise program may provide potential benefit to the breast cancer patients undergoing AI treatment by reducing joint pain, improving functional performance and QoL, and reducing depressive symptoms. Further studies are needed to confirm these results.

  8. A clinical observation of Chinese chronic myelogenous leukemia patients after discontinuation of tyrosine kinase inhibitors

    PubMed Central

    Zeng, Chen; Meng, Li; Li, Chunrui; Luo, Yi; Wang, Hongxiang; Li, Weiming; Wang, Jue; Cheng, Fanjun; Guo, Anyuan; Liu, Songya; Jin, Caibao; Zhu, Xiaojian; You, Yong; Zou, Ping


    Whether tyrosine kinase inhibitors (TKIs) can be safely discontinued is a key focus of chronic myelogenous leukemia (CML) at present. We report a clinical observation of TKIs cessation in Chinese CML patients and a probable connection between CML leukemia stem cells (LSCs) and relapse. In all, 22 of 1057 patients consented to participate in this observation. The average time of complete molecular response was 12.73 months after TKI withdrawal. LSCs could be flow cytometrically detected in most of the patients. However, the number of LSCs did not differ between the relapsers and non-relapsers. We evaluated the leukemogenetic ability of the LSCs by transplanting bone marrow into irradiated NOD/SCID mice. The results indicated that part of the bone marrow from the relapsers lead to leukemogensis in the mice. Besides, we found that LSCs-derived microvesicles might serve as a novel factor for the stratification of undetectable minimal residual disease and an early warning sign of relapse. In summary, post-TKI cessation relapse seems to show none association with the number of LSCs. A mouse xenograft model would provide a novel and useful method of analyzing LSCs function and predicting relapse. Microvesicles may provide important information about optimal molecular monitoring schedules in TKI discontinuation strategies. PMID:27533462

  9. Early eradication of factor VIII inhibitor in patients with congenital hemophilia A by immune tolerance induction with a high dose of immunoglobulin.


    Mizoguchi, Yoko; Furue, Aya; Kagawa, Reiko; Chijimatsu, Ikue; Tomioka, Keita; Shimomura, Maiko; Imanaka, Yusuke; Nishimura, Shiho; Saito, Satoshi; Miki, Mizuka; Ono, Atsushi; Konishi, Nakao; Kawaguchi, Hiroshi; Kobayashi, Masao


    The production of factor VIII (FVIII) inhibitory antibodies is a serious problem in patients with hemophilia A. Immune tolerance induction (ITI) is the only strategy proven to eradicate persistent inhibitors and has been shown to be successful in 70 % of patients with hemophilia A. However, a minority of hemophilia patients present life-long inhibitors. To eliminate such inhibitors, we designed an intravenous immunoglobulin (IVIG) strategy in combination with high dose recombinant FVIII for ITI in hemophilia A children with inhibitors. Four previously untreated patients produced inhibitors within 16 exposures to FVIII. The peak inhibitor titers in these patients ranged from 3 to 14 BU/mL. The patients received ITI combined with IVIG within 1.5 months after the inhibitors were detected. All patients showed a negative titer for inhibitors by 28 days, with no anamnestic responses. The recovery of FVIII in the plasma concentration was normalized within three months after initiation of ITI. An additional course of IVIG administration led to induction of complete tolerance by 20 months after initiation of ITI therapy in all patients. ITI treatment with high-dose FVIII combined with IVIG may be effective for the early elimination of inhibitors.

  10. Therapists' and patients' stress responses during graduated versus flooding in vivo exposure in the treatment of specific phobia: A preliminary observational study.


    Schumacher, Sarah; Miller, Robert; Fehm, Lydia; Kirschbaum, Clemens; Fydrich, Thomas; Ströhle, Andreas


    Exposure therapy is considered an effective treatment strategy for phobic anxiety, however, it is rarely applied in clinical practice. The under-usage might be due to various factors of which heightened stress levels not only in patients but also in therapists are presumed to be of particular relevance. The present study aimed to investigate whether different forms of exposure might lead to varying physiological and psychological stress responses in therapists and phobic patients. 25 patients with specific phobia underwent individual cognitive behavioural therapy, performed by 25 psychotherapist trainees, applying exposure sessions in graduated form or the flooding technique. Patients and therapists provided subjective evaluations of stress and five saliva samples for analysis of salivary cortisol and alpha-amylase either during two graduated exposure sessions or during one flooding session, while a regular therapy session served as control condition. Therapists displayed heightened salivary alpha-amylase release during exposure of the flooding, but not the graduated, type. Patients showed elevated salivary cortisol during flooding exposure numerically, however, not on a statistically significant level. Therapists reported more pronounced subjective stress during flooding compared to graduated exposure. Elevated stress levels should be addressed in clinical training in order to improve application of exposure in routine practice.

  11. [ACE inhibitors and its usefulness in the prevention of aspiration pneumonia in chronic cerebrovascular disease patients with asymptomatic swallowing dysfunction].


    Shibuya, Seiji; Murahashi, Makoto; Inoue, Masahiko; Jimi, Takahiro; Wakayama, Yoshihiro


    The double contrast pharyngogram by use of computed radiography (DCP-CR) has been found to be useful in detection of asymptomatic swallowing dysfunction. Following the DCP-CR examination, we investigated the incidence of aspiration pneumonia in 143 patients with chronic cerebrovascular disease (CVD) for 3 years and the effects of ACE inhibitors on the prevention of pneumonia. Aspiration pneumonia occurred in 29 out of 143 patients, and more frequently in the elderly chronic CVD patients with multiple brain lesions. Aspiration pneumonia was confirmed in 26 out of 85 patients (30.6%) with abnormal barium adhesion to the pharyngeal wall on the double contrast pharyngogram image by DCP-CR; whereas pneumonia occurred in 3 out of 58 patients (5.2%) with normal findings of DCP-CR pharyngogram. Among chronic CVD patients with abnormal findings of DCP-CR pharyngogram, the incidence of aspiration pneumonia was significantly lower in the patients treated with ACE inhibitors than in those treated with other antihypertensive agents or without antihypertensive agents (chi 2 value = 7.163, p < 0.05). Accordingly, ACE inhibitors may prevent the aspiration pneumonia and reduce the incidence of aspiration pneumonia in the chronic CVD patients with abnormal DCP-CR pharyngogram images.

  12. [Side effects of COX-2 selective inhibitors. Critic related with its administration in patients with rheumatoid arthritis and osteoarthritis].


    Carrillo Gutiérrez, Ofmara Y; Pérez Sánchez, Adriana G; Medina Serriteño, Nicolás; Rodríguez Orozco, Alain R


    At the end of 2000 the new age of AINEs was introduced, specially the selective inhibitors of the COX-2, whose main function is to block the production of the prostaglandins and the acute tissue inflammation. These inhibitors have analgesic, antithermal and antiinflammatory effects similar to traditional AINEs; they are prescribed specifically to diminish pain and inflammation in patients with rheumatoid arthritis and osteoarthritis. After them introduction, it was reported that they can produce cardiovascular effects, mainly infarcts. This revision exposes the adverse effects that selective inhibitors of the COX-2 produce when elevated doses are administered, during prolonged time, in patients with rheumatoid arthritis and osteoarthritis; in addition, it comments present recommendations for them prescription.

  13. Efficacy of different dipeptidyl peptidase-4 (DPP-4) inhibitors on metabolic parameters in patients with type 2 diabetes undergoing dialysis

    PubMed Central

    Park, Se Hee; Nam, Joo Young; Han, Eugene; Lee, Yong-ho; Lee, Byung-Wan; Kim, Beom Seok; Cha, Bong-Soo; Kim, Chul Sik; Kang, Eun Seok


    Abstract Hyperglycemia is associated with increased mortality and morbidity in patients with type 2 diabetes mellitus (T2DM) who are undergoing dialysis. Although dipeptidyl peptidase-4 (DPP-4) inhibitors have been widely used in end-stage renal disease (ESRD) patients with T2DM, there are few studies on their efficacy in this population. We studied the effect of 3 different DPP-4 inhibitors on metabolic parameters in ESRD patients with T2DM. Two hundred ESRD patients with T2DM who were treated with DPP-4 inhibitors (sitagliptin, vildagliptin, or linagliptin) were enrolled and analyzed retrospectively. The changes in glycated hemoglobin (HbA1c), fasting plasma glucose, and lipid profiles were assessed before and after 3 months of treatment with DPP-4 inhibitors. Subgroup analysis was done for each hemodialysis (HD) and peritoneal dialysis (PD) group. There was no significant difference in the decrease in the HbA1c level among sitagliptin, vildagliptin, and linagliptin treatment groups (−0.74 ± 1.57, −0.39 ± 1.45, and −0.08 ± 1.40, respectively, P = 0.076). The changes in fasting blood glucose and lipid profiles were also not significantly different. In HD patients (n = 115), there was no difference in the HbA1c level among the 3 groups. In contrast, in PD patients (n = 85), HbA1c was reduced more after 3 months of treatment with sitagliptin compared with vildagliptin and linagliptin (−1.58 ± 0.95, −0.46 ± 0.98, −0.04 ± 1.22, respectively, P = 0.001). There was no significant difference in the glucose-lowering effect between the different DPP-4 inhibitors tested in ESRD patients. In PD patients, sitagliptin tends to lower the HbA1c level more than the other inhibitors. The glucose-lowering efficacy of the 3 DPP-4 inhibitors was comparable. PMID:27512877

  14. Review of hormone-based treatments in postmenopausal patients with advanced breast cancer focusing on aromatase inhibitors and fulvestrant

    PubMed Central

    Kümler, Iben; Knoop, Ann S; Jessing, Christina A R; Ejlertsen, Bent; Nielsen, Dorte L


    Background Endocrine therapy constitutes a central modality in the treatment of oestrogen receptor (ER)-positive advanced breast cancer. Purpose To evaluate the evidence for endocrine treatment in postmenopausal patients with advanced breast cancer focusing on the aromatase inhibitors, letrozole, anastrozole, exemestane and fulvestrant. Methods A review was carried out using PubMed. Randomised phase II and III trials reporting on ≥100 patients were included. Results 35 trials met the inclusion criteria. If not used in the adjuvant setting, a non-steroid aromatase inhibitor was the optimal first-line option. In general, the efficacy of the different aromatase inhibitors and fulvestrant was similar in tamoxifen-refractory patients. A randomised phase II trial of palbociclib plus letrozole versus letrozole alone showed significantly increased progression-free survival (PFS) when compared with endocrine therapy alone in the first-line setting (20.2 vs 10.2 months). Furthermore, the addition of everolimus to exemestane in the Breast Cancer Trials of OraL EveROlimus-2 (BOLERO-2) study resulted in an extension of median PFS by 4.5 months after recurrence/progression on a non-steroid aromatase inhibitor. However, overall survival was not significantly increased. Conclusion Conventional treatment with an aromatase inhibitor or fulvestrant may be an adequate treatment option for most patients with hormone receptor-positive advanced breast cancer. Mammalian target of rapamycin (mTOR) inhibition and cyclin-dependent kinase 4/6 (CDK4/6) inhibition might represent substantial advances for selected patients in some specific settings. However, there is an urgent need for prospective biomarker-driven trials to identify patients for whom these treatments are cost-effective. PMID:27843622

  15. Liver Fibrosis in HCV Monoinfected and HIV/HCV Coinfected Patients: Dysregulation of Matrix Metalloproteinases (MMPs) and Their Tissue Inhibitors TIMPs and Effect of HCV Protease Inhibitors.


    Latronico, Tiziana; Mascia, Claudia; Pati, Ilaria; Zuccala, Paola; Mengoni, Fabio; Marocco, Raffaella; Tieghi, Tiziana; Belvisi, Valeria; Lichtner, Miriam; Vullo, Vincenzo; Mastroianni, Claudio Maria; Liuzzi, Grazia Maria


    An imbalance between matrix metalloproteinases (MMPs) and tissue inhibitors of metalloproteinases (TIMPs) may contribute to liver fibrosis in patients with hepatitis C (HCV) infection. We measured the circulating levels of different MMPs and TIMPs in HCV monoinfected and HIV/HCV coinfected patients and evaluated the potential for anti-HCV therapy to modulate MMP and TIMP levels in HCV subjects. We analyzed 83 plasma samples from 16 HCV monoinfected patients undergoing dual or triple anti-HCV therapy, 15 HIV/HCV coinfected patients with undetectable HIV load, and 10 healthy donors (HD). Levels of MMP-1, MMP-2, MMP-3, MMP-8, MMP-9, MMP-10, TIMP-1, and TIMP-2 were measured by a SearchLight Multiplex Immunoassay Kit. MMP-2 and MMP-9 were the highest expressed MMPs among all the analyzed samples and their levels significantly increased in HCV monoinfected and HIV/HCV coinfected subjects compared to HD. TIMP-1 levels were significantly higher in HCV and HIV/HCV subjects compared to HD and were correlated with liver stiffness. These findings raise the possibility of using circulating TIMP-1 as a non-invasive marker of liver fibrosis in HCV infection. A longitudinal study demonstrated that MMP-9 levels significantly decreased (40% reduction from baseline) in patients receiving dual as well as triple direct-acting antivirals (DAA) anti-HCV therapy, which had no effect on MMP-2, TIMP-1, and TIMP-2. As the dysregulation of MMP-2 and MMP-9 may reflect inflammatory processes in the liver, the decrease of MMP-9 following HCV protease inhibitor treatment suggests a positive effect on the reduction of liver inflammation.

  16. Phase II study of tivozanib, an oral VEGFR inhibitor, in patients with recurrent glioblastoma.


    Kalpathy-Cramer, Jayashree; Chandra, Vyshak; Da, Xiao; Ou, Yangming; Emblem, Kyrre E; Muzikansky, Alona; Cai, Xuezhu; Douw, Linda; Evans, John G; Dietrich, Jorg; Chi, Andrew S; Wen, Patrick Y; Stufflebeam, Stephen; Rosen, Bruce; Duda, Dan G; Jain, Rakesh K; Batchelor, Tracy T; Gerstner, Elizabeth R


    Targeting tumor angiogenesis is a potential therapeutic strategy for glioblastoma because of its high vascularization. Tivozanib is an oral pan-VEGF receptor tyrosine kinase inhibitor that hits a central pathway in glioblastoma angiogenesis. We conducted a phase II study to test the effectiveness of tivozanib in patients with recurrent glioblastoma. Ten adult patients were enrolled and treated with tivozanib 1.5 mg daily, 3 weeks on/1 week off in 28-day cycles. Brain MRI and blood biomarkers of angiogenesis were performed at baseline, within 24-72 h of treatment initiation, and monthly thereafter. Dynamic contrast enhanced MRI, dynamic susceptibility contrast MRI, and vessel architecture imaging were used to assess vascular effects. Resting state MRI was used to assess brain connectivity. Best RANO criteria responses were: 1 complete response, 1 partial response, 4 stable diseases, and 4 progressive disease (PD). Two patients were taken off study for toxicity and 8 patients were taken off study for PD. Median progression-free survival was 2.3 months and median overall survival was 8.1 months. Baseline abnormal tumor vascular permeability, blood flow, tissue oxygenation and plasma sVEGFR2 significantly decreased and plasma PlGF and VEGF increased after treatment, suggesting an anti-angiogenic effect of tivozanib. However, there were no clear structural changes in vasculature as vessel caliber and enhancing tumor volume did not significantly change. Despite functional changes in tumor vasculature, tivozanib had limited anti-tumor activity, highlighting the limitations of anti-VEGF monotherapy. Future studies in glioblastoma should leverage the anti-vascular activity of agents targeting VEGF to enhance the activity of other therapies.

  17. Long-Term Use of Selective Serotonin Reuptake Inhibitors and Risk of Glaucoma in Depression Patients.


    Chen, Hsin-Yi; Lin, Cheng-Li; Kao, Chia-Hung


    This study investigated whether the long-term use of selective serotonin reuptake inhibitors (SSRIs) influences the risk of primary open-angle glaucoma (POAG) and primary angle-closure glaucoma (PACG) in the Chinese ethnic population in Taiwan.The authors retrieved the data under analysis from the National Health Insurance Research Database in Taiwan and identified 26,186 newly diagnosed depression patients without preexisting glaucoma. The study cohort included 13,093 patients with over 1 year of SSRI use, and a comparison cohort of 13,093 patients who had never used SSRIs. The main outcome was a diagnosis of POAG or PACG during follow-up. The authors used univariable and multivariable Cox proportional hazards regression models to assess the effects of SSRIs on the risk of POAG and PACG.The cumulative incidences of POAG and PACG between the SSRI and comparison cohorts exhibited nonsignificant differences (log-rank test P = .52 for POAG, P = .32 for PACG). The overall incidence of POAG in the SSRI cohort was nonsignificantly higher than that in the comparison cohort (1.51 versus 1.39 per 1000 person-years), with an adjusted hazard ratio of 1.07 (95% confidence interval = 0.82-1.40). The overall incidence of PACG in the SSRI cohort was nonsignificantly lower than that in the comparison cohort (0.95 versus 1.11 per 1000 person-years), with an adjusted hazard ratio of 0.85 (95% confidence interval = 0.62-1.18).The long-term use of SSRIs does not influence the risk of POAG or PACG in depression patients.

  18. Biochemical characterization, stability studies and N-terminal sequence of a bi-functional inhibitor from Phaseolus aureus Roxb. (Mung bean).


    Haq, Soghra Khatun; Atif, Shaikh Muhammad; Khan, Rizwan Hasan


    Herein, we report the purification and biochemical characterization of a novel bi-functional protein proteinase/amylase inhibitor from the dietary leguminous pulse Phaseolus aureus Roxb. (Vigna radiata L.) by means of acetic acid precipitation, salt fractionation, ion-exchange chromatography (DEAE-cellulose) and affinity chromatography on trypsin-sepharose column. P. aureus inhibitor is a bi-functional inhibitor since it exhibits inhibitory activity towards trypsin-like and alpha-chymotrypsin-like serine proteinases as well as against alpha-amylases. It is a helix-rich protein (Mr 13,600) containing approximately eight tyrosines, one tryptophan and two cystines. N-terminal sequence alignment reveals no homology to other proteinase inhibitors reported from Phaseolus sp. thereby confirming that it is a novel inhibitor. Inhibitory activity measurements show that the inhibitor is quite stable even at extremely high temperatures and is only slightly affected by pH changes. Circular dichroism (CD) conformational studies revealed some changes in its near- as well as far-ultraviolet spectrum at extremes of pH and temperature. Treatments with trypsin for varying time periods did not alter its proteolytic inhibitory activity but caused some reduction in its amylase inhibitory activity.

  19. Lipid metabolism and lipodystrophy in HIV-1-infected patients: the role played by nonnucleoside reverse transcriptase inhibitors.


    Sension, Michael; Deckx, Henri


    Dyslipidemia and lipodystrophy represent significant healthcare concerns in HIV-infected patients due to their association with diabetes mellitus and increased cardiovascular disease risk. Since the lipid effects of the nonnucleoside reverse transcriptase inhibitors are not well characterized, we systematically summarized the effects of nonnucleoside reverse transcriptase inhibitor treatment on dyslipidemia and lipodystrophy in HIV-1 infection. As with other classes of antiretroviral agents, the nonnucleoside reverse transcriptase inhibitors are associated with lipid changes, although individual agents exhibit differing effects on lipid profiles. Comparative trials have shown that the risk for hypertriglyceridemia is lower with efavirenz than with the use of ritonavir-boosted lopinavir, but there is a greater likelihood of hypercholesterolemia compared to ritonavir-boosted atazanavir. Data also suggest that efavirenz results in greater increases in plasma lipid levels than integrase inhibitors and CC-chemokine-receptor-5 antagonists. Lipid disturbances are less frequent with the newer nonnucleoside reverse transcriptase inhibitors than with efavirenz. However, in most cases, no change in the total:high-density lipoprotein-cholesterol ratio was seen between the efavirenz and comparator groups. Switching from efavirenz to etravirine or rilpivirine, or the integrase inhibitors raltegravir or elvitegravir, resulted in significant reductions in lipid levels. There appears to be minimal potential for efavirenz or rilpivirine to result in development of lipodystrophy. Overall, nonnucleoside reverse transcriptase inhibitors have a smaller impact on plasma lipids than ritonavir-boosted protease inhibitors, with the newer agents exhibiting more favorable lipid profiles than efavirenz. When considering antiretroviral regimens, awareness of the different lipid effect profiles of the third agent is important, without forgetting the critical contribution of the background

  20. Phase I Study of LY2606368, a Checkpoint Kinase 1 Inhibitor, in Patients With Advanced Cancer

    PubMed Central

    Infante, Jeffrey; Janku, Filip; Jones, Suzanne; Nguyen, Ly M.; Burris, Howard; Naing, Aung; Bauer, Todd M.; Piha-Paul, Sarina; Johnson, Faye M.; Kurzrock, Razelle; Golden, Lisa; Hynes, Scott; Lin, Ji; Lin, Aimee Bence; Bendell, Johanna


    Purpose The primary objective was to determine safety, toxicity, and a recommended phase II dose regimen of LY2606368, an inhibitor of checkpoint kinase 1, as monotherapy. Patients and Methods This phase I, nonrandomized, open-label, dose-escalation trial used a 3 + 3 dose-escalation scheme and included patients with advanced solid tumors. Intravenous LY2606368 was dose escalated from 10 to 50 mg/m2 on schedule 1 (days 1 to 3 every 14 days) or from 40 to 130 mg/m2 on schedule 2 (day 1 every 14 days). Safety measures and pharmacokinetics were assessed, and pharmacodynamics were measured in blood, hair follicles, and circulating tumor cells. Results Forty-five patients were treated; seven experienced dose-limiting toxicities (all hematologic). The maximum-tolerated doses (MTDs) were 40 mg/m2 (schedule 1) and 105 mg/m2 (schedule 2). The most common related grade 3 or 4 treatment-emergent adverse events were neutropenia, leukopenia, anemia, thrombocytopenia, and fatigue. Grade 4 neutropenia occurred in 73.3% of patients and was transient (typically < 5 days). Febrile neutropenia incidence was low (7%). The LY2606368 exposure over the first 72 hours (area under the curve from 0 to 72 hours) at the MTD for each schedule coincided with the exposure in mouse xenografts that resulted in maximal tumor responses. Minor intra- and intercycle accumulation of LY2606368 was observed at the MTDs for both schedules. Two patients (4.4%) had a partial response; one had squamous cell carcinoma (SCC) of the anus and one had SCC of the head and neck. Fifteen patients (33.3%) had a best overall response of stable disease (range, 1.2 to 6.7 months), six of whom had SCC. Conclusion An LY2606368 dose of 105 mg/m2 once every 14 days is being evaluated as the recommended phase II dose in dose-expansion cohorts for patients with SCC. PMID:27044938

  1. The role of chemoprevention by selective cyclooxygenase-2 inhibitors in colorectal cancer patients - a population-based study

    PubMed Central


    Background There are limited population-based studies focusing on the chemopreventive effects of selective cyclooxygenase-2 (COX-2) inhibitors against colorectal cancer. The purpose of this study is to assess the trends and dose–response effects of various medication possession ratios (MPR) of selective COX-2 inhibitor used for chemoprevention of colorectal cancer. Methods A population-based case–control study was conducted using the Taiwan Health Insurance Research Database (NHIRD). The study comprised 21,460 colorectal cancer patients and 79,331 controls. The conditional logistic regression was applied to estimate the odds ratios (ORs) for COX-2 inhibitors used for several durations (5 years, 3 years, 1 year, 6 months and 3 months) prior to the index date. Results In patients receiving selective COX-2 inhibitors, the OR was 0.51 (95% CI=0.29~0.90, p=0.021) for an estimated 5-year period in developing colorectal cancer. ORs showing significant protection effects were found in 10% of MPRs for 5-year, 3-year, and 1-year usage. Risk reduction against colorectal cancer by selective COX-2 inhibitors was observed as early as 6 months after usage. Conclusion Our results indicate that selective COX-2 inhibitors may reduce the development of colorectal cancer by at least 10% based on the MPRs evaluated. Given the limited number of clinical reports from general populations, our results add to the knowledge of chemopreventive effects of selective COX-2 inhibitors against cancer in individuals at no increased risk of colorectal cancer. PMID:23217168

  2. A patient previously treated with ALK inhibitors for central nervous system lesions from ALK rearranged lung cancer: a case report

    PubMed Central

    Kashima, Jumpei; Okuma, Yusuke; Hishima, Tsunekazu


    Background Patients with anaplastic lymphoma kinase (ALK)-rearranged non-small-cell lung cancer (NSCLC) are now preferentially treated with tyrosine kinase inhibitors (TKIs). However, patients treated with ALK inhibitors end up with acquired resistance. Case presentation We present a patient with recurrent ALK-rearranged NSCLC that developed multiple brain metastases and meningitis carcinomatosa after sequential treatment with several lines of cytotoxic chemotherapy, crizotinib, and alectinib. After the patient underwent retreatment with crizotinib as salvage therapy because of poor performance status, the intracranial metastatic foci and meningeal thickening were shrank within 1 week. Conclusion Our experience with this case suggests that alectinib may restore sensitivity to crizotinib or amplified pathway such as MET which bestowed alectinib resistance was inhibited with crizotinib. PMID:27785052


    PubMed Central

    Robinson, Emily S.; Khankin, Eliyahu V.; Choueiri, Toni K.; Dhawan, Mallika D.; Rogers, Miranda J.; Karumanchi, S. Ananth; Humphreys, Benjamin D.


    Therapies that target the vascular endothelial growth factor (VEGF) pathway cause hypertension but the mechanism remains unknown. This cross-sectional study tested the hypothesis that VEGF inhibition causes hypertension by suppressing VEGF-mediated vasodilatory pathways. Urine was collected from 80 patients with metastatic renal cell carcinoma from 2002–2009, 40 at baseline and 40 while on VEGF inhibitors. Measured urinary biomarkers include albumin, metabolites of the nitric oxide pathway and its downstream effector, cGMP, and prostaglandin pathway biomarkers prostaglandin E2, 6-keto PGF 1α, and cAMP, all normalized to urinary creatinine. The mean age in both groups was 61.8 years, 76% were male, and urinary albumin was higher in patients receiving VEGF inhibitors (median 18.4mg/g vs. 4.6 mg/g; p=0.009). cGMP/Cr was suppressed in patients on VEGF inhibitors (0.28 pmol/ug vs. 0.39 pmol/ug; p=0.01), with a trend toward suppression of nitrate/Cr (0.46 umol/mg vs. 0.62 umol/mg; p=0.09). Both comparisons were strengthened when patients on bevacizumab were excluded and only those receiving small molecule tyrosine kinase inhibitors were analyzed (cGMP/Cr, p=0.003; Nitrate/Cr, p=0.01). Prostaglandin E2, 6-keto PGF1α, and cAMP did not differ between groups. These results suggest that hypertension induced by VEGF inhibitors is mediated by suppression of nitric oxide production. Prospective studies are needed to explore whether these biomarkers may be useful predictors of efficacy in patients receiving VEGF-targeted therapies. PMID:20956731

  4. The case for aromatase inhibitors use in oncofertility patients. Should aromatase inhibitors be combined with gonadotropin treatment in breast cancer patients undergoing ovarian stimulation for fertility preservation prior to chemotherapy? A debate.


    Fatum, Muhammad; McVeigh, Enda; Child, Tim


    Breast cancer is one of the hormone-dependent cancers that may be adversely affected by elevated oestrogen or progesterone concentrations, particularly the endocrine active (hormone receptor positive) breast cancers. Treatment for breast cancer patients aimed at fertility preservation, includes ovarian hyperstimulation, the harvest of oocytes, and subsequent cryopreservation of oocytes or embryos. Classically, gonadotrophins have been used effectively for ovulation induction, a treatment often accompanied by high blood oestrogen concentrations produced by the hyperstimulated granulosa cells. Despite the uncertainty which surrounds this issue and the lack of clear-cut clinical evidence, it is still of major concern that these ensuing high hormone levels might be associated with a high risk of recurrence of the cancer. A growing number of clinical studies have strongly suggested the benefits of using aromatase inhibitors in infertility treatment, both as single agents or as adjuncts to FSH-containing ovulation induction regimes in reproductive medicine. Combining gonadotrophins with aromatase inhibitors would augment the stimulation effect, with a reduced increase in serum concentrations of estradiol. We propose to open a debate over the use of aromatase inhibitors in combination with FSH in ovulation induction treatment of breast cancer oncofertility patients. As the safety of aromatase inhibitors such as letrozole has recently been demonstrated in several studies, and there is growing concern over the possible detrimental effects of high estradiol levels on breast cancer cells (at least in mouse models), the co-administration of letrozole in these patients would reduce both the high supraphysiologic serum levels of estradiol and the intratumoral in situ production of oestrogen. However, since it is unlikely that a well-founded evidence-based justification of this treatment will be formulated in the near future, based on well-designed prospective randomised

  5. Cost-effectiveness of dipeptidyl peptidase-4 inhibitor monotherapy in elderly type 2 diabetes patients in Thailand

    PubMed Central

    Permsuwan, Unchalee; Dilokthornsakul, Piyameth; Saokaew, Surasak; Thavorn, Kednapa; Chaiyakunapruk, Nathorn


    Background The management of type 2 diabetes mellitus (T2DM) in elderly population poses many challenges. Dipeptidyl peptidase-4 (DPP-4) inhibitors show particular promise due to excellent tolerability profiles, low risk of hypoglycemia, and little effect on body weight. This study evaluated, from the health care system’s perspective, the long-term cost-effectiveness of DPP-4 inhibitor monotherapy vs metformin and sulfonylurea (SFU) monotherapy in Thai elderly T2DM patients. Methods The clinical efficacy was estimated from a systematic review and meta-analysis. Baseline cohort characteristics and cost parameters were obtained from published studies and hospital databases in Thailand. A validated IMS CORE Diabetes Model version 8.5 was used to project clinical and economic outcomes over a lifetime horizon using a 3% annual discount rate. Costs were expressed in 2014 Thai Baht (THB) (US dollar value). Incremental cost-effectiveness ratios were calculated. Base-case assumptions were assessed through several sensitivity analyses. Results For treating elderly T2DM patients, DPP-4 inhibitors were more expensive and less effective, ie, a dominated strategy, than the metformin monotherapy. Compared with SFU, treatment with DPP-4 inhibitors gained 0.031 more quality-adjusted life years (QALYs) at a total cost incurred over THB113,701 or US$3,449.67, resulting in an incremental cost-effectiveness ratio of THB3.63 million or US$110,133.50 per QALY. At the acceptable Thai ceiling threshold of THB160,000/QALY (US$4,854.37/QALY), DPP-4 inhibitors were not a cost-effective treatment. Conclusion DPP-4 inhibitor monotherapy is not a cost-effective treatment for elderly T2DM patients compared with metformin monotherapy and SFU monotherapy, given current resource constraints in Thailand. PMID:27703387

  6. The role of B-cell receptor inhibitors in the treatment of patients with chronic lymphocytic leukemia.


    Wiestner, Adrian


    Chronic lymphocytic leukemia is a malignancy of mature auto-reactive B cells. Genetic and functional studies implicate B-cell receptor signaling as a pivotal pathway in its pathogenesis. Full B-cell receptor activation requires tumor-microenvironment interactions in lymphoid tissues. Spleen tyrosine kinase, Bruton's tyrosine kinase, and the phosphatidylinositol 3-kinase (PI3K) δ isoform are essential for B-cell receptor signal transduction but also mediate the effect of other pathways engaged in chronic lymphocytic leukemia cells in the tissue-microenvironment. Orally bioavailable inhibitors of spleen tyrosine kinase, Bruton's tyrosine kinase, or PI3Kδ, induce high rates of durable responses. Ibrutinib, a covalent inhibitor of Bruton's tyrosine kinase, and idelalisib, a selective inhibitor of PI3Kδ, have obtained regulatory approval in chronic lymphocytic leukemia. Ibrutinib and idelalisib are active in patients with high-risk features, achieving superior disease control in difficult-to-treat patients than prior best therapy, making them the preferred agents for chronic lymphocytic leukemia with TP53 aberrations and for patients resistant to chemoimmunotherapy. In randomized trials, both ibrutinib, versus ofatumumab, and idelalisib in combination with rituximab, versus placebo with rituximab improved survival in relapsed/refractory chronic lymphocytic leukemia. Responses to B-cell receptor inhibitors are mostly partial, and within clinical trials treatment is continued until progression or occurrence of intolerable side effects. Ibrutinib and idelalisib are, overall, well tolerated; notable adverse events include increased bruising and incidence of atrial fibrillation on ibrutinib and colitis, pneumonitis and transaminase elevations on idelalisib. Randomized trials investigate the role of B-cell receptor inhibitors in first-line therapy and the benefit of combinations. This review discusses the biological basis for targeted therapy of chronic lymphocytic

  7. The role of B-cell receptor inhibitors in the treatment of patients with chronic lymphocytic leukemia

    PubMed Central

    Wiestner, Adrian


    Chronic lymphocytic leukemia is a malignancy of mature auto-reactive B cells. Genetic and functional studies implicate B-cell receptor signaling as a pivotal pathway in its pathogenesis. Full B-cell receptor activation requires tumor-microenvironment interactions in lymphoid tissues. Spleen tyrosine kinase, Bruton’s tyrosine kinase, and the phosphatidylinositol 3-kinase (PI3K) δ isoform are essential for B-cell receptor signal transduction but also mediate the effect of other pathways engaged in chronic lymphocytic leukemia cells in the tissue-microenvironment. Orally bioavailable inhibitors of spleen tyrosine kinase, Bruton’s tyrosine kinase, or PI3Kδ, induce high rates of durable responses. Ibrutinib, a covalent inhibitor of Bruton’s tyrosine kinase, and idelalisib, a selective inhibitor of PI3Kδ, have obtained regulatory approval in chronic lymphocytic leukemia. Ibrutinib and idelalisib are active in patients with high-risk features, achieving superior disease control in difficult-to-treat patients than prior best therapy, making them the preferred agents for chronic lymphocytic leukemia with TP53 aberrations and for patients resistant to chemoimmunotherapy. In randomized trials, both ibrutinib, versus ofatumumab, and idelalisib in combination with rituximab, versus placebo with rituximab improved survival in relapsed/refractory chronic lymphocytic leukemia. Responses to B-cell receptor inhibitors are mostly partial, and within clinical trials treatment is continued until progression or occurrence of intolerable side effects. Ibrutinib and idelalisib are, overall, well tolerated; notable adverse events include increased bruising and incidence of atrial fibrillation on ibrutinib and colitis, pneumonitis and transaminase elevations on idelalisib. Randomized trials investigate the role of B-cell receptor inhibitors in first-line therapy and the benefit of combinations. This review discusses the biological basis for targeted therapy of chronic lymphocytic

  8. Statins and Renin Angiotensin System Inhibitors Dose-Dependently Protect Hypertensive Patients against Dialysis Risk

    PubMed Central

    Wu, Szu-Yuan


    Background Taiwan has the highest renal disease incidence and prevalence in the world. We evaluated the association of statin and renin–angiotensin system inhibitor (RASI) use with dialysis risk in hypertensive patients. Methods Of 248,797 patients who received a hypertension diagnosis in Taiwan during 2001–2012, our cohort contained 110,829 hypertensive patients: 44,764 who used RASIs alone; 7,606 who used statins alone; 27,836 who used both RASIs and statins; and 33,716 who used neither RASIs or statins. We adjusted for the following factors to reduce selection bias by using propensity scores (PSs): age; sex; comorbidities; urbanization level; monthly income; and use of nonstatin lipid-lowering drugs, metformin, aspirin, antihypertensives, diuretics, and beta and calcium channel blockers. The statin and RASI use index dates were considered the hypertension confirmation dates. To examine the dose–response relationship, we categorized only statin or RASI use into four groups in each cohort: <28 (nonusers), 28–90, 91–365, and >365 cumulative defined daily doses (cDDDs). Results In the main model, PS-adjusted hazard ratios (aHRs; 95% confidence intervals [CIs]) for dialysis risk were 0.57 (0.50–0.65), 0.72 (0.53–0.98), and 0.47 (0.41–0.54) in the only RASI, only statin, and RASI + statin users, respectively. RASIs dose-dependently reduced dialysis risk in most subgroups and in the main model. RASI use significantly reduced dialysis risk in most subgroups, regardless of comorbidities or other drug use (P < 0.001). Statins at >365 cDDDs protected hypertensive patients against dialysis risk in the main model (aHR = 0.62, 95% CI: 0.54–0.71), regardless of whether a high cDDD of RASIs, metformin, or aspirin was used. Conclusion Statins and RASIs independently have a significant dose-dependent protective effect against dialysis risk in hypertensive patients. The combination of statins and RASIs can additively protect hypertensive patients against dialysis

  9. Efficacy of Exemestane in Korean Patients with Metastatic Breast Cancer after Failure of Nonsteroidal Aromatase Inhibitors

    PubMed Central

    Lee, June Koo; Lee, Daewon; Kim, Ji-Yeon; Lim, Yoojoo; Lee, Eunyoung; Moon, Hyeong-Gon; Kim, Tae-Yong; Han, Sae-Won; Oh, Do-Youn; Lee, Se-Hoon; Han, Wonshik; Kim, Dong-Wan; Kim, Tae-You; Noh, Dong-Young


    Purpose Exemestane has shown good efficacy and tolerability in postmenopausal women with hormone receptor-positive metastatic breast cancer. However, clinical outcomes in Korean patients have not yet been reported. Methods Data on 112 postmenopausal women with metastatic breast cancer were obtained retrospectively. Clinicopathological characteristics and treatment history were extracted from medical records. All patients received 25 mg exemestane daily until objective disease progression. Progression-free survival (PFS) was the primary endpoint, and secondary endpoints were overall survival (OS), objective response rate (ORR), and clinical benefit rate (CBR=complete response+partial response+stable disease for 6 months). Results The median age of the subjects was 55 years (range, 28-76 years). Exemestane treatment resulted in a median PFS of 5.7 months (95% confidence interval [CI], 4.4-7.0 months) and median OS of 21.9 months (95% CI, 13.6-30.3 months). ORR was 6.4% and CBR was 46.4% for the 110 patients with evaluable lesions. Symptomatic visceral disease was independently associated with shorter PFS (hazard ratio, 3.611; 95% CI, 1.904-6.848; p<0.001), compared with bone-dominant disease in a multivariate analysis of PFS after adjusting for age, hormone receptor, human epidermal growth factor receptor 2, Ki-67 status, dominant metastasis site, and sensitivity to nonsteroidal aromatase inhibitor (AI) treatment. Sensitivity to previous nonsteroidal AI treatment was not associated with PFS, suggesting no cross-resistance between exemestane and nonsteroidal AIs. Conclusion Exemestane was effective in postmenopausal Korean women with hormone receptor-positive metastatic breast cancer who failed previous nonsteroidal AI treatment. PMID:23593084

  10. Predictive Factors of Response to Proton Pump Inhibitors in Korean Patients With Gastroesophageal Reflux Disease

    PubMed Central

    Kim, Sung Eun; Kim, Nayoung; Oh, Sooyeon; Kim, Hee Man; Park, Moo In; Lee, Dong Ho; Jung, Hyun Chae


    Background/Aims Proton pump inhibitors (PPIs) are widely used in the treatment of gastroesophageal reflux disease (GERD). However, some patients fail to respond to PPI therapy. We investigated the efficacy of response to PPI therapy in patients with GERD symptoms. Methods A total of 179 subjects with GERD symptoms were prospectively enrolled and diagnosed with non-erosive reflux disease (NERD, n = 100) and erosive reflux disease (n = 79) by gastroscopy and Bernstein test and/or 24-hour esophageal pH testing. Subjects then received a standard dose of daily PPI therapy for at least 4 weeks. PPI therapy response was evaluated using questionnaires including questions about demographics, GERD symptoms, GERD impact scale, Epworth sleepiness scale, Pittsburgh sleep quality index (PSQI), hospital anxiety and depression scale, and abbreviated version of the World Health Organization quality of life scale. Results The rates of complete (≥ 80%), satisfactory (≥ 50%), partial (< 50%), and refractory response in the 179 participants were 41.3%, 30.2%, 18.4%, and 10.1%, respectively. Thus, overall response rate (complete and satisfactory responses) was 71.5%. Multivariate analysis showed body mass index < 23 kg/m2 (OR, 2.20; 95% CI, 1.12–4.34), higher total PSQI score (OR, 1.20; 95% CI, 1.05–1.35), history of psychotherapy or neuropsychiatric medication (OR, 2.44; 95% CI, 1.23–4.85), and NERD (OR, 3.30; 95% CI, 1.54–7.11) were associated with poor response to PPI therapy. Conclusions Psychological factors, sleep dysfunction, body mass index < 23 kg/m2, and NERD seem to be the major factors that lead to a poor response to PPI treatment in patients with GERD symptoms. PMID:25537676

  11. Effect of selective serotonin reuptake inhibitors on bleeding risk in patients with atrial fibrillation taking warfarin.


    Quinn, Gene R; Singer, Daniel E; Chang, Yuchiao; Go, Alan S; Borowsky, Leila H; Udaltsova, Natalia; Fang, Margaret C


    Selective serotonin reuptake inhibitor (SSRI) medications have been linked to increased bleeding risk; however, the actual association among warfarin, SSRI exposure, and bleeding risk has not been well-established. We studied the AnTicoagulation and Risk factors In Atrial fibrillation cohort of 13,559 adults with atrial fibrillation, restricted to the 9,186 patients contributing follow-up time while taking warfarin. Exposure to SSRIs and tricyclic antidepressants (TCAs) was assessed from pharmacy database dispensing data. The main outcome was hospitalization for major hemorrhage. Results were adjusted for bleeding risk and time in international normalized ratio range >3. We identified 461 major hemorrhages during 32,888 person-years of follow-up, 45 events during SSRI use, 12 during TCA-only use, and 404 without either medication. Hemorrhage rates were higher during periods of SSRI exposure compared with periods on no antidepressants (2.32 per 100 person-years vs 1.35 per 100 person-years, p <0.001) and did not differ between TCA exposure and no antidepressants (1.30 per 100 person-years on TCAs, p = 0.94). After adjustment for underlying bleeding risk and time in international normalized ratio range >3, SSRI exposure was associated with an increased rate of hemorrhage compared with no antidepressants (adjusted relative risk 1.41, 95% confidence interval 1.04 to 1.92, p = 0.03), whereas TCA exposure was not (adjusted relative risk 0.82, 95% confidence interval 0.46 to 1.46, p = 0.50). In conclusion, SSRI exposure was associated with higher major hemorrhage risk in patients taking warfarin, and this risk should be considered when selecting antidepressant treatments in those patients.

  12. Molecular Testing Guideline for Selection of Lung Cancer Patients for EGFR and ALK Tyrosine Kinase Inhibitors

    PubMed Central

    Lindeman, Neal I.; Cagle, Philip T.; Beasley, Mary Beth; Chitale, Dhananjay Arun; Dacic, Sanja; Giaccone, Giuseppe; Jenkins, Robert Brian; Kwiatkowski, David J.; Saldivar, Juan-Sebastian; Squire, Jeremy; Thunnissen, Erik; Ladanyi, Marc


    Objective To establish evidence-based recommendations for the molecular analysis of lung cancers that are that are required to guide EGFR- and ALK-directed therapies, addressing which patients and samples should be tested, and when and how testing should be performed. Participants Three cochairs without conflicts of interest were selected, one from each of the 3 sponsoring professional societies: College of American Pathologists, International Association for the Study of Lung Cancer, and Association for Molecular Pathology. Writing and advisory panels were constituted from additional experts from these societies. Evidence Three unbiased literature searches of electronic databases were performed to capture articles published published from January 2004 through February 2012, yielding 1533 articles whose abstracts were screened to identify 521 pertinent articles that were then reviewed in detail for their relevance to the recommendations. Evidence was formally graded for each recommendation. Consensus Process Initial recommendations were formulated by the cochairs and panel members at a public meeting. Each guideline section was assigned to at least 2 panelists. Drafts were circulated to the writing panel (version 1), advisory panel (version 2), and the public (version 3) before submission (version 4). Conclusions The 37 guideline items address 14 subjects, including 15 recommendations (evidence grade A/B). The major recommendations are to use testing for EGFR mutations and ALK fusions to guide patient selection for therapy with an epidermal growth factor receptor (EGFR) or anaplastic lymphoma kinase (ALK) inhibitor, respectively, in all patients with advanced-stage adenocarcinoma, regardless of sex, race, smoking history, or other clinical risk factors, and to prioritize EGFR and ALK testing over other molecular predictive tests. As scientific discoveries and clinical practice outpace the completion of randomized clinical trials, evidence-based guidelines developed

  13. Altered expression of metalloproteinase-2 and tissue inhibitor of metalloproteinase-2 in cervical disc herniation patients.


    Zhuang, H M; Xu, G T; Wen, S F; Guo, Y Y; Huang, Q


    The aim of the current study was to examine matrix metalloproteinase-2 (MMP-2) and tissue inhibitor of metalloproteinase-2 (TIMP-2) expression in patients with cervical disc herniation (CDH). A total of 127 specimens from CDH patients undergoing posterior spinal surgery were obtained for the case group, which was divided into three subgroups: lateral protrusion (N = 102), median protrusion (N = 18), and paramedian protrusion (N = 7). Another 55 specimens from subjects who had cervical spine trauma and underwent spinal canal decompression were obtained for the control group. Routine hematoxylin and eosin staining was performed for pathological diagnosis. Immunohistochemical (IHC) analysis was used to determine MMP-2 and TIMP-2 expression. Under light microscopy, MMP-2-positive cells presented brown-yellow or dark brown staining in the cell membrane or cytoplasm. MMP-2 expression in the case group was significantly higher than that in controls (P < 0.05). Furthermore, MMP-2 expression in the lateral and median protrusion groups was significantly higher compared to that in the paramedian protrusion group (both P < 0.05), while there was no apparent difference in MMP-2 expression between the lateral and median protrusion groups (P > 0.05). IHC results showed that TIMP-2 expression in cases was significantly lower than that in controls (P < 0.05). Spearman correlation analysis indicated that MMP- 2 was negatively correlated with TIMP-2 expression (r = -0.418, P < 0.001). In conclusion, MMP-2 expression increased, whereas TIMP- 2 expression decreased in CDH patients, suggesting that MMP-2 and TIMP-2 expression may contribute to CDH development.

  14. Dabigatran and rivaroxaban do not affect AA- and ADP-induced platelet aggregation in patients receiving concomitant platelet inhibitors.


    Olivier, Christoph B; Weik, Patrick; Meyer, Melanie; Weber, Susanne; Diehl, Philipp; Bode, Christoph; Moser, Martin; Zhou, Qian


    Dabigatran and rivaroxaban are novel, vitamin K-independent oral anticoagulants (NOACs) and act via antagonism of the coagulation factor (F) IIa (dabigatran) or FXa (rivaroxaban), respectively. Compared to vitamin-K-antagonists, NOACs have shown non-inferiority of risk and benefit in patients with non valvular atrial fibrillation (AF). In clinical practice there is increasing use of NOACs combined with platelet inhibitors in patients with AF and coronary artery disease. However, whether NOACs affect the function of platelet inhibitors remains incompletely known. This observational study aimed to assess the platelet function in patients receiving dabigatran or rivaroxaban and concomitant platelet inhibitors. A single centre observational study was performed analysing the platelet aggregation of patients treated with dabigatran or rivaroxaban with or without concomitant platelet inhibitors. Measurements before the initiation of NOAC therapy served as the respective control group. Platelet aggregation was measured by multiple electrode aggregometry and was induced with adenosine diphosphate (ADP, 6.5 µM) and arachidonic acid (AA, 0.5 mM), respectively. In order to evaluate whether NOACs interact with platelet inhibition by ASA or the P2Y12-antagonist clopidogrel, 87 patients were grouped according to their concomitant antiplatelet medication. Comparing the ADP- and AA-induced platelet aggregation in patients without concomitant platelet inhibitors (n = 45) no significant differences under therapy with dabigatran (d) or rivaroxaban (r) compared to the control group (c) were observed. In patients taking clopidogrel as a concomitant platelet inhibitor (n = 21), neither dabigatran nor rivaroxaban affected the ADP-induced platelet aggregation (c 20 ± 11, d 21 ± 14, r 18 ± 8 AU*min, p = 0.200). Patients receiving dabigatran or rivaroxaban in combination with ASA (n = 42; 21 ASA only, 21 ASA + clopidogrel) showed no significant differences of the AA

  15. Achievements, challenges and unmet needs for haemophilia patients with inhibitors: Report from a symposium in Paris, France on 20 November 2014.


    Dargaud, Y; Pavlova, A; Lacroix-Desmazes, S; Fischer, K; Soucie, M; Claeyssens, S; Scott, D W; d'Oiron, R; Lavigne-Lissalde, G; Kenet, G; Escuriola Ettingshausen, C; Borel-Derlon, A; Lambert, T; Pasta, G; Négrier, C


    Over the past 20 years, there have been many advances in haemophilia treatment that have allowed patients to take greater control of their disease. However, the development of factor VIII (FVIII) inhibitors is the greatest complication of the disease and a challenge in the treatment of haemophilia making management of bleeding episodes difficult and surgical procedures very challenging. A meeting to discuss the unmet needs of haemophilia patients with inhibitors was held in Paris on 20 November 2014. Topics discussed were genetic and non-genetic risk factors for the development of inhibitors, immunological aspects of inhibitor development, FVIII products and inhibitor development, generation and functional properties of engineered antigen-specific T regulatory cells, suppression of immune responses to FVIII, prophylaxis in haemophilia patients with inhibitors, epitope mapping of FVIII inhibitors, current controversies in immune tolerance induction therapy, surgery in haemophilia patients with inhibitors and future perspectives for the treatment of haemophilia patients with inhibitors. A summary of the key points discussed is presented in this paper.

  16. Improved kidney function in patients who switch their protease inhibitor from atazanavir or lopinavir to darunavir

    PubMed Central

    Jose, Sophie; Nelson, Mark; Phillips, Andrew; Chadwick, David; Trevelion, Roy; Jones, Rachael; Williams, Deborah I.; Hamzah, Lisa; Sabin, Caroline A.; Post, Frank A.


    Objective: Atazanavir (ATV) and lopinavir (LPV) have been associated with kidney disease progression in HIV positive patients, with no data reported for darunavir (DRV). We examined kidney function in patients who switched their protease inhibitor from ATV or LPV to DRV. Design: Cohort study. Methods: Data were from the UK CHIC study. We compared pre and post switch estimated glomerular filtration rate (eGFR) slopes (expressed in ml/min per 1.73 m2 per year) in all switchers and those with rapid eGFR decline (>5 ml/min per 1.73 m2 per year) on ATV or LPV. Mixed-effects models were adjusted for age, gender, ethnicity, eGFR at switch and time updated CD4+ cell count, HIV RNA and cumulative tenofovir (tenofovir disoproxil fumarate) exposure. Results: Data from 1430 patients were included. At the time of switching to DRV, median age was 45 years, 79% were men, 76% had an undetectable viral load, and median eGFR was 93 ml/min per 1.73 m2. Adjusted mean (95% confidence interval) pre and post switch eGFR slopes were −0.84 (−1.31, −0.36) and 1.23 (0.80, 1.66) for ATV (P < 0.001), and −0.57 (−1.09, −0.05) and 0.62 (0.28, 0.96) for LPV (P < 0.001). Stable or improved renal function was observed in patients with rapid eGFR decline on ATV or LPV who switched to DRV [−15.27 (−19.35, −11.19) and 3.72 (1.78, 5.66), P < 0.001 for ATV, −11.93 (−14.60, −9.26) and 0.87 (−0.54, 2.27), P < 0.001 for LPV]. Similar results were obtained if participants who discontinued tenofovir disoproxil fumarate at the time of switch were excluded. Conclusions: We report improved kidney function in patients who switched from ATV or LPV to DRV, suggesting that DRV may have a more favourable renal safety profile. PMID:28121667

  17. Population pharmacokinetics of recombinant human C1 inhibitor in patients with hereditary angioedema

    PubMed Central

    Farrell, Colm; Hayes, Siobhan; Relan, Anurag; van Amersfoort, Edwin S; Pijpstra, Rienk; Hack, C Erik


    Aims To characterize the pharmacokinetics (PK) of recombinant human C1 inhibitor (rhC1INH) in healthy volunteers and hereditary angioedema (HAE) patients. Methods Plasma levels of C1INH following 294 administrations of rhC1INH in 133 subjects were fitted using nonlinear mixed-effects modelling. The model was used to simulate maximal C1INH levels for the proposed dosing scheme. Results A one-compartment model with Michaelis–Menten elimination kinetics described the data. Baseline C1INH levels were 0.901 [95% confidence interval (CI): 0.839–0.968] and 0.176 U ml−1 (95% CI: 0.154–0.200) in healthy volunteers and HAE patients, respectively. The volume of distribution of rhC1INH was 2.86 l (95% CI: 2.68–3.03). The maximal rate of elimination and the concentration corresponding to half this maximal rate were 1.63 U ml−1 h−1 (95% CI: 1.41–1.88) and 1.60 U ml−1 (95% CI: 1.14–2.24), respectively, for healthy volunteers and symptomatic HAE patients. The maximal elimination rate was 36% lower in asymptomatic HAE patients. Peak C1INH levels did not change upon repeated administration of rhC1INH. Bodyweight was found to be an important predictor of the volume of distribution. Simulations of the proposed dosing scheme predicted peak C1INH concentrations above the lower level of the normal range (0.7 U ml−1) for at least 94% of all patients. Conclusions The population PK model for C1INH supports a dosing scheme on a 50 U kg−1 basis up to 84 kg, with a fixed dose of 4200 U above 84 kg. The PK of rhC1INH following repeat administration are consistent with the PK following the first administration. PMID:23594263

  18. Initial Assessment, Surveillance, and Management of Blood Pressure in Patients Receiving Vascular Endothelial Growth Factor Signaling Pathway Inhibitors

    PubMed Central

    Bakris, George L.; Black, Henry R.; Chen, Helen X.; Durand, Jean-Bernard; Elliott, William J.; Ivy, S. Percy; Leier, Carl V.; Lindenfeld, JoAnn; Liu, Glenn; Remick, Scot C.; Steingart, Richard; Tang, W. H. Wilson


    Hypertension is a mechanism-based toxic effect of drugs that inhibit the vascular endothelial growth factor signaling pathway (VSP). Substantial evidence exists for managing hypertension as a chronic condition, but there are few prospectively collected data on managing acute hypertension caused by VSP inhibitors. The Investigational Drug Steering Committee of the National Cancer Institute convened an interdisciplinary cardiovascular toxicities expert panel to evaluate this problem, to make recommendations to the Cancer Therapy Evaluation Program on further study, and to structure an approach for safe management by treating physicians. The panel reviewed: the published literature on blood pressure (BP), hypertension, and specific VSP inhibitors; abstracts from major meetings; shared experience with the development of VSP inhibitors; and established principles of hypertension care. The panel generated a consensus report including the recommendations on clinical concerns summarized here. To support the greatest possible number of patients to receive VSP inhibitors safely and effectively, the panel had four recommendations: 1) conduct and document a formal risk assessment for potential cardiovascular complications, 2) recognize that preexisting hypertension will be common in cancer patients and should be identified and addressed before initiation of VSP inhibitor therapy, 3) actively monitor BP throughout treatment with more frequent assessments during the first cycle of treatment, and 4) manage BP with a goal of less than 140/90 mmHg for most patients (and to lower, prespecified goals in patients with specific preexisting cardiovascular risk factors). Proper agent selection, dosing, and scheduling of follow-up should enable maintaining VSP inhibition while avoiding the complications associated with excessive or prolonged elevation in BP. PMID:20351338

  19. Impact of Sodium-Glucose Cotransporter 2 Inhibitors on Nonglycemic Outcomes in Patients with Type 2 Diabetes.


    Trujillo, Jennifer M; Nuffer, Wesley A


    The efficacy of the sodium-glucose cotransporter 2 (SGLT2) inhibitors canagliflozin, dapagliflozin, and empagliflozin in reducing hyperglycemia in patients with type 2 diabetes is well documented. In additio