Sample records for pattern generators cpg

  1. Generation of Adaptive Gait Patterns for Quadruped Robot with CPG Network including Motor Dynamic Model

    NASA Astrophysics Data System (ADS)

    Son, Yurak; Kamano, Takuya; Yasuno, Takashi; Suzuki, Takayuki; Harada, Hironobu

    This paper describes the generation of adaptive gait patterns using new Central Pattern Generators (CPGs) including motor dynamic models for a quadruped robot under various environment. The CPGs act as the flexible oscillators of the joints and make the desired angle of the joints. The CPGs are mutually connected each other, and the sets of their coupling parameters are adjusted by genetic algorithm so that the quadruped robot can realize the stable and adequate gait patterns. As a result of generation, the suitable CPG networks for not only a walking straight gait pattern but also rotation gait patterns are obtained. Experimental results demonstrate that the proposed CPG networks are effective to automatically adjust the adaptive gait patterns for the tested quadruped robot under various environment. Furthermore, the target tracking control based on image processing is achieved by combining the generated gait patterns.

  2. Neuromodulation intrinsic to the central pattern generator for escape swimming in Tritonia.

    PubMed

    Katz, P S

    1998-11-16

    Extrinsic neuromodulatory inputs to central pattern generators (CPGs) can alter the properties and synaptic interactions of neurons in those circuits and thereby modify the output of the CPG. Recent work in a number of systems has now demonstrated that neurons intrinsic to CPG can also evoke neuromodulatory actions on other members of the CPG. Such "intrinsic neuromodulation" plays a role in controlling the CPG underlying the escape swim response of the nudibrach mollusc, Tritonia diomedea. The dorsal swim interneurons (DSIs) are a bilaterally represented set of three serotonergic neurons that participate in the generation of the rhythmic swim motor program. Serotonin released from these CPG neurons functions both as a fast neurotransmitter and as a slower neuromodulator. In its modulatory role, serotonin enhances the release of neurotransmitter from another CPG neuron, C2, and also increases C2 excitability by decreasing spike frequency adaptation. These neuromodulatory actions intrinsic to the CPG may be important for the initial self-configuration of the system into a function CPG and for experience-dependent changes in the output such as behavioral sensitization and habituation.

  3. Does Epileptiform Activity Represent a Failure of Neuromodulation to Control Central Pattern Generator-Like Neocortical Behavior?

    PubMed Central

    Traub, Roger D.; Whittington, Miles A.; Hall, Stephen P.

    2017-01-01

    Rhythmic motor patterns in invertebrates are often driven by specialized “central pattern generators” (CPGs), containing small numbers of neurons, which are likely to be “identifiable” in one individual compared with another. The dynamics of any particular CPG lies under the control of modulatory substances, amines, or peptides, entering the CPG from outside it, or released by internal constituent neurons; consequently, a particular CPG can generate a given rhythm at different frequencies and amplitudes, and perhaps even generate a repertoire of distinctive patterns. The mechanisms exploited by neuromodulators in this respect are manifold: Intrinsic conductances (e.g., calcium, potassium channels), conductance state of postsynaptic receptors, degree of plasticity, and magnitude and kinetics of transmitter release can all be affected. The CPG concept has been generalized to vertebrate motor pattern generating circuits (e.g., for locomotion), which may contain large numbers of neurons – a construct that is sensible, if there is enough redundancy: that is, the large number of neurons consists of only a small number of classes, and the cells within any one class act stereotypically. Here we suggest that CPG and modulator ideas may also help to understand cortical oscillations, normal ones, and particularly transition to epileptiform pathology. Furthermore, in the case illustrated, the mechanism of the transition appears to be an exaggerated form of a normal modulatory action used to influence sensory processing. PMID:29093667

  4. Emergent central pattern generator behavior in chemical coupled two-compartment models with time delay

    NASA Astrophysics Data System (ADS)

    Li, Shanshan; Zhang, Guoshan; Wang, Jiang; Chen, Yingyuan; Deng, Bin

    2018-02-01

    This paper proposes that modified two-compartment Pinsky-Rinzel (PR) neural model can be used to develop the simple form of central pattern generator (CPG). The CPG is called as 'half-central oscillator', which constructed by two inhibitory chemical coupled PR neurons with time delay. Some key properties of PR neural model related to CPG are studied and proved to meet the requirements of CPG. Using the simple CPG network, we first study the relationship between rhythmical output and key factors, including ambient noise, sensory feedback signals, morphological character of single neuron as well as the coupling delay time. We demonstrate that, appropriate intensity noise can enhance synchronization between two coupled neurons. Different output rhythm of CPG network can be entrained by sensory feedback signals. We also show that the morphology of single neuron has strong effect on the output rhythm. The phase synchronization indexes decrease with the increase of morphology parameter's difference. Through adjusting coupled delay time, we can get absolutely phase synchronization and antiphase state of CPG. Those results of simulation show the feasibility of PR neural model as a valid CPG as well as the emergent behaviors of the particularly CPG.

  5. Inhibitory and modulatory inputs to the vocal central pattern generator of a teleost fish

    PubMed Central

    Rosner, Elisabeth; Rohmann, Kevin N.; Bass, Andrew H.

    2018-01-01

    Abstract Vocalization is a behavioral feature that is shared among multiple vertebrate lineages, including fish. The temporal patterning of vocal communication signals is set, in part, by central pattern generators (CPGs). Toadfishes are well‐established models for CPG coding of vocalization at the hindbrain level. The vocal CPG comprises three topographically separate nuclei: pre‐pacemaker, pacemaker, motor. While the connectivity between these nuclei is well understood, their neurochemical profile remains largely unexplored. The highly vocal Gulf toadfish, Opsanus beta, has been the subject of previous behavioral, neuroanatomical and neurophysiological studies. Combining transneuronal neurobiotin‐labeling with immunohistochemistry, we map the distribution of inhibitory neurotransmitters and neuromodulators along with gap junctions in the vocal CPG of this species. Dense GABAergic and glycinergic label is found throughout the CPG, with labeled somata immediately adjacent to or within CPG nuclei, including a distinct subset of pacemaker neurons co‐labeled with neurobiotin and glycine. Neurobiotin‐labeled motor and pacemaker neurons are densely co‐labeled with the gap junction protein connexin 35/36, supporting the hypothesis that transneuronal neurobiotin‐labeling occurs, at least in part, via gap junction coupling. Serotonergic and catecholaminergic label is also robust within the entire vocal CPG, with additional cholinergic label in pacemaker and prepacemaker nuclei. Likely sources of these putative modulatory inputs are neurons within or immediately adjacent to vocal CPG neurons. Together with prior neurophysiological investigations, the results reveal potential mechanisms for generating multiple classes of social context‐dependent vocalizations with widely divergent temporal and spectral properties. PMID:29424431

  6. Pattern generating and reflex-like processes controlling aiming movements in the presence of inertia, damping and gravity. A theoretical note.

    PubMed

    Kalveram, K T

    1991-01-01

    A model is proposed, in which goal-directed movements of the forearm are controlled by a central pattern generator (CPG) initiated for exactly one period, and by reflex-analogous processes. Movement width is proportional to the amplitude factor of the CPG's output, and to the square of the CPG's period length. The period duration can be freely selected, thus enabling the CPG to accommodate its time scale to the period of others CPG's. Parameters which influence movement accuracy can be adjusted by means of closed control loop, which are discrete with respect to time: The time unit corresponds to the period of the CPG. For instance, momentum adjustment balances the CPG in such a manner that the velocity of the arm becomes zero on termination of the period, while gain adjustment serves to attain a correct movement length in the presence of an inertial load. Friction, stiffness and gravitational force are neutralized by additional reflex-type processes, interpretable as positive feedback loops with adjustable gain factors, using position and velocity signals.

  7. CPG-inspired workspace trajectory generation and adaptive locomotion control for quadruped robots.

    PubMed

    Liu, Chengju; Chen, Qijun; Wang, Danwei

    2011-06-01

    This paper deals with the locomotion control of quadruped robots inspired by the biological concept of central pattern generator (CPG). A control architecture is proposed with a 3-D workspace trajectory generator and a motion engine. The workspace trajectory generator generates adaptive workspace trajectories based on CPGs, and the motion engine realizes joint motion imputes. The proposed architecture is able to generate adaptive workspace trajectories online by tuning the parameters of the CPG network to adapt to various terrains. With feedback information, a quadruped robot can walk through various terrains with adaptive joint control signals. A quadruped platform AIBO is used to validate the proposed locomotion control system. The experimental results confirm the effectiveness of the proposed control architecture. A comparison by experiments shows the superiority of the proposed method against the traditional CPG-joint-space control method.

  8. Neural basis of singing in crickets: central pattern generation in abdominal ganglia

    NASA Astrophysics Data System (ADS)

    Schöneich, Stefan; Hedwig, Berthold

    2011-12-01

    The neural mechanisms underlying cricket singing behavior have been the focus of several studies, but the central pattern generator (CPG) for singing has not been localized conclusively. To test if the abdominal ganglia contribute to the singing motor pattern and to analyze if parts of the singing CPG are located in these ganglia, we systematically truncated the abdominal nerve cord of fictively singing crickets while recording the singing motor pattern from a front-wing nerve. Severing the connectives anywhere between terminal ganglion and abdominal ganglion A3 did not preclude singing, although the motor pattern became more variable and failure-prone as more ganglia were disconnected. Singing terminated immediately and permanently after transecting the connectives between the metathoracic ganglion complex and the first unfused abdominal ganglion A3. The contribution of abdominal ganglia for singing pattern generation was confirmed by intracellular interneuron recordings and current injections. During fictive singing, an ascending interneuron with its soma and dendrite in A3 depolarized rhythmically. It spiked 10 ms before the wing-opener activity and hyperpolarized in phase with the wing-closer activity. Depolarizing current injection elicited rhythmic membrane potential oscillations and spike bursts that elicited additional syllables and reliably reset the ongoing chirp rhythm. Our results disclose that the abdominal ganglion A3 is directly involved in generating the singing motor pattern, whereas the more posterior ganglia seem to provide only stabilizing feedback to the CPG circuit. Localizing the singing CPG in the anterior abdominal neuromeres now allows analyzing its circuitry at the level of identified interneurons in subsequent studies.

  9. CpG PatternFinder: a Windows-based utility program for easy and rapid identification of the CpG methylation status of DNA.

    PubMed

    Xu, Yi-Hua; Manoharan, Herbert T; Pitot, Henry C

    2007-09-01

    The bisulfite genomic sequencing technique is one of the most widely used techniques to study sequence-specific DNA methylation because of its unambiguous ability to reveal DNA methylation status to the order of a single nucleotide. One characteristic feature of the bisulfite genomic sequencing technique is that a number of sample sequence files will be produced from a single DNA sample. The PCR products of bisulfite-treated DNA samples cannot be sequenced directly because they are heterogeneous in nature; therefore they should be cloned into suitable plasmids and then sequenced. This procedure generates an enormous number of sample DNA sequence files as well as adding extra bases belonging to the plasmids to the sequence, which will cause problems in the final sequence comparison. Finding the methylation status for each CpG in each sample sequence is not an easy job. As a result CpG PatternFinder was developed for this purpose. The main functions of the CpG PatternFinder are: (i) to analyze the reference sequence to obtain CpG and non-CpG-C residue position information. (ii) To tailor sample sequence files (delete insertions and mark deletions from the sample sequence files) based on a configuration of ClustalW multiple alignment. (iii) To align sample sequence files with a reference file to obtain bisulfite conversion efficiency and CpG methylation status. And, (iv) to produce graphics, highlighted aligned sequence text and a summary report which can be easily exported to Microsoft Office suite. CpG PatternFinder is designed to operate cooperatively with BioEdit, a freeware on the internet. It can handle up to 100 files of sample DNA sequences simultaneously, and the total CpG pattern analysis process can be finished in minutes. CpG PatternFinder is an ideal software tool for DNA methylation studies to determine the differential methylation pattern in a large number of individuals in a population. Previously we developed the CpG Analyzer program; CpG PatternFinder is our further effort to create software tools for DNA methylation studies.

  10. Simple robot suggests physical interlimb communication is essential for quadruped walking

    PubMed Central

    Owaki, Dai; Kano, Takeshi; Nagasawa, Ko; Tero, Atsushi; Ishiguro, Akio

    2013-01-01

    Quadrupeds have versatile gait patterns, depending on the locomotion speed, environmental conditions and animal species. These locomotor patterns are generated via the coordination between limbs and are partly controlled by an intraspinal neural network called the central pattern generator (CPG). Although this forms the basis for current control paradigms of interlimb coordination, the mechanism responsible for interlimb coordination remains elusive. By using a minimalistic approach, we have developed a simple-structured quadruped robot, with the help of which we propose an unconventional CPG model that consists of four decoupled oscillators with only local force feedback in each leg. Our robot exhibits good adaptability to changes in weight distribution and walking speed simply by responding to local feedback, and it can mimic the walking patterns of actual quadrupeds. Our proposed CPG-based control method suggests that physical interaction between legs during movements is essential for interlimb coordination in quadruped walking. PMID:23097501

  11. Simple robot suggests physical interlimb communication is essential for quadruped walking.

    PubMed

    Owaki, Dai; Kano, Takeshi; Nagasawa, Ko; Tero, Atsushi; Ishiguro, Akio

    2013-01-06

    Quadrupeds have versatile gait patterns, depending on the locomotion speed, environmental conditions and animal species. These locomotor patterns are generated via the coordination between limbs and are partly controlled by an intraspinal neural network called the central pattern generator (CPG). Although this forms the basis for current control paradigms of interlimb coordination, the mechanism responsible for interlimb coordination remains elusive. By using a minimalistic approach, we have developed a simple-structured quadruped robot, with the help of which we propose an unconventional CPG model that consists of four decoupled oscillators with only local force feedback in each leg. Our robot exhibits good adaptability to changes in weight distribution and walking speed simply by responding to local feedback, and it can mimic the walking patterns of actual quadrupeds. Our proposed CPG-based control method suggests that physical interaction between legs during movements is essential for interlimb coordination in quadruped walking.

  12. Toward robust phase-locking in Melibe swim central pattern generator models

    NASA Astrophysics Data System (ADS)

    Jalil, Sajiya; Allen, Dane; Youker, Joseph; Shilnikov, Andrey

    2013-12-01

    Small groups of interneurons, abbreviated by CPG for central pattern generators, are arranged into neural networks to generate a variety of core bursting rhythms with specific phase-locked states, on distinct time scales, which govern vital motor behaviors in invertebrates such as chewing and swimming. These movements in lower level animals mimic motions of organs in higher animals due to evolutionarily conserved mechanisms. Hence, various neurological diseases can be linked to abnormal movement of body parts that are regulated by a malfunctioning CPG. In this paper, we, being inspired by recent experimental studies of neuronal activity patterns recorded from a swimming motion CPG of the sea slug Melibe leonina, examine a mathematical model of a 4-cell network that can plausibly and stably underlie the observed bursting rhythm. We develop a dynamical systems framework for explaining the existence and robustness of phase-locked states in activity patterns produced by the modeled CPGs. The proposed tools can be used for identifying core components for other CPG networks with reliable bursting outcomes and specific phase relationships between the interneurons. Our findings can be employed for identifying or implementing the conditions for normal and pathological functioning of basic CPGs of animals and artificially intelligent prosthetics that can regulate various movements.

  13. Output variability across animals and levels in a motor system

    PubMed Central

    Norris, Brian J; Günay, Cengiz; Kueh, Daniel

    2018-01-01

    Rhythmic behaviors vary across individuals. We investigated the sources of this output variability across a motor system, from the central pattern generator (CPG) to the motor plant. In the bilaterally symmetric leech heartbeat system, the CPG orchestrates two coordinations in the bilateral hearts with different intersegmental phase relations (Δϕ) and periodic side-to-side switches. Population variability is large. We show that the system is precise within a coordination, that differences in repetitions of a coordination contribute little to population output variability, but that differences between bilaterally homologous cells may contribute to some of this variability. Nevertheless, much output variability is likely associated with genetic and life history differences among individuals. Variability of Δϕ were coordination-specific: similar at all levels in one, but significantly lower for the motor pattern than the CPG pattern in the other. Mechanisms that transform CPG output to motor neurons may limit output variability in the motor pattern. PMID:29345614

  14. The contribution of a central pattern generator in a reflex-based neuromuscular model

    PubMed Central

    Dzeladini, Florin; van den Kieboom, Jesse; Ijspeert, Auke

    2014-01-01

    Although the concept of central pattern generators (CPGs) controlling locomotion in vertebrates is widely accepted, the presence of specialized CPGs in human locomotion is still a matter of debate. An interesting numerical model developed in the 90s’ demonstrated the important role CPGs could play in human locomotion, both in terms of stability against perturbations, and in terms of speed control. Recently, a reflex-based neuro-musculo-skeletal model has been proposed, showing a level of stability to perturbations similar to the previous model, without any CPG components. Although exhibiting striking similarities with human gaits, the lack of CPG makes the control of speed/step length in the model difficult. In this paper, we hypothesize that a CPG component will offer a meaningful way of controlling the locomotion speed. After introducing the CPG component in the reflex model, and taking advantage of the resulting properties, a simple model for gait modulation is presented. The results highlight the advantages of a CPG as feedforward component in terms of gait modulation. PMID:25018712

  15. FPGA implementation of a configurable neuromorphic CPG-based locomotion controller.

    PubMed

    Barron-Zambrano, Jose Hugo; Torres-Huitzil, Cesar

    2013-09-01

    Neuromorphic engineering is a discipline devoted to the design and development of computational hardware that mimics the characteristics and capabilities of neuro-biological systems. In recent years, neuromorphic hardware systems have been implemented using a hybrid approach incorporating digital hardware so as to provide flexibility and scalability at the cost of power efficiency and some biological realism. This paper proposes an FPGA-based neuromorphic-like embedded system on a chip to generate locomotion patterns of periodic rhythmic movements inspired by Central Pattern Generators (CPGs). The proposed implementation follows a top-down approach where modularity and hierarchy are two desirable features. The locomotion controller is based on CPG models to produce rhythmic locomotion patterns or gaits for legged robots such as quadrupeds and hexapods. The architecture is configurable and scalable for robots with either different morphologies or different degrees of freedom (DOFs). Experiments performed on a real robot are presented and discussed. The obtained results demonstrate that the CPG-based controller provides the necessary flexibility to generate different rhythmic patterns at run-time suitable for adaptable locomotion. Copyright © 2013 Elsevier Ltd. All rights reserved.

  16. On the Role of Sensory Feedbacks in Rowat–Selverston CPG to Improve Robot Legged Locomotion

    PubMed Central

    Amrollah, Elmira; Henaff, Patrick

    2010-01-01

    This paper presents the use of Rowat and Selverston-type of central pattern generator (CPG) to control locomotion. It focuses on the role of afferent exteroceptive and proprioceptive signals in the dynamic phase synchronization in CPG legged robots. The sensori-motor neural network architecture is evaluated to control a two-joint planar robot leg that slips on a rail. Then, the closed loop between the CPG and the mechanical system allows to study the modulation of rhythmic patterns and the effect of the sensing loop via sensory neurons during the locomotion task. Firstly simulations show that the proposed architecture easily allows to modulate rhythmic patterns of the leg, and therefore the velocity of the robot. Secondly, simulations show that sensori-feedbacks from foot/ground contact of the leg make the hip velocity smoother and larger. The results show that the Rowat–Selverston-type CPG with sensory feedbacks is an effective choice for building adaptive neural CPGs for legged robots. PMID:21228904

  17. Repetition priming of motor activity mediated by a central pattern generator: the importance of extrinsic vs. intrinsic program initiators

    PubMed Central

    Siniscalchi, Michael J.; Jing, Jian; Weiss, Klaudiusz R.

    2016-01-01

    Repetition priming is characterized by increased performance as a behavior is repeated. Although this phenomenon is ubiquitous, mediating mechanisms are poorly understood. We address this issue in a model system, the feeding network of Aplysia. This network generates both ingestive and egestive motor programs. Previous data suggest a chemical coding model: ingestive and egestive inputs to the feeding central pattern generator (CPG) release different modulators, which act via different second messengers to prime motor activity in different ways. The ingestive input to the CPG (neuron CBI-2) releases the peptides feeding circuit activating peptide and cerebral peptide 2, which produce an ingestive pattern of activity. The egestive input to the CPG (the esophageal nerve) releases the peptide small cardioactive peptide. This model is based on research that focused on a single aspect of motor control (radula opening). Here we ask whether repetition priming is observed if activity is triggered with a neuron within the core CPG itself and demonstrate that it is not. Moreover, previous studies demonstrated that effects of modulatory neurotransmitters that induce repetition priming persist. This suggests that it should be possible to “prime” motor programs triggered from within the CPG by first stimulating extrinsic modulatory inputs. We demonstrate that programs triggered after ingestive input activation are ingestive and programs triggered after egestive input activation are egestive. We ask where this priming occurs and demonstrate modifications within the CPG itself. This arrangement is likely to have important consequences for “task” switching, i.e., the cessation of one type of motor activity and the initiation of another. PMID:27466134

  18. Reinforcement learning for a biped robot based on a CPG-actor-critic method.

    PubMed

    Nakamura, Yutaka; Mori, Takeshi; Sato, Masa-aki; Ishii, Shin

    2007-08-01

    Animals' rhythmic movements, such as locomotion, are considered to be controlled by neural circuits called central pattern generators (CPGs), which generate oscillatory signals. Motivated by this biological mechanism, studies have been conducted on the rhythmic movements controlled by CPG. As an autonomous learning framework for a CPG controller, we propose in this article a reinforcement learning method we call the "CPG-actor-critic" method. This method introduces a new architecture to the actor, and its training is roughly based on a stochastic policy gradient algorithm presented recently. We apply this method to an automatic acquisition problem of control for a biped robot. Computer simulations show that training of the CPG can be successfully performed by our method, thus allowing the biped robot to not only walk stably but also adapt to environmental changes.

  19. Dysfunction of bulbar central pattern generator in ALS patients with dysphagia during sequential deglutition.

    PubMed

    Aydogdu, Ibrahim; Tanriverdi, Zeynep; Ertekin, Cumhur

    2011-06-01

    The aim of this study is to investigate a probable dysfunction of the central pattern generator (CPG) in dysphagic patients with ALS. We investigated 58 patients with ALS, 23 patients with PD, and 33 normal subjects. The laryngeal movements and EMG of the submental muscles were recorded during sequential water swallowing (SWS) of 100ml of water. The coordination of SWS and respiration was also studied in some normal cases and ALS patients. Normal subjects could complete the SWS optimally within 10s using 7 swallows, while in dysphagic ALS patients, the total duration and the number of swallows were significantly increased. The novel finding was that the regularity and rhythmicity of the swallowing pattern during SWS was disorganized to irregular and arhythmic pattern in 43% of the ALS patients. The duration and speed of swallowing were the most sensitive parameters for the disturbed oropharyngeal motility during SWS. The corticobulbar control of swallowing is insufficient in ALS, and the swallowing CPG cannot work very well to produce segmental muscle activation and sequential swallowing. CPG dysfunction can result in irregular and arhythmical sequential swallowing in ALS patients with bulbar plus pseudobulbar types. The arhythmical SWS pattern can be considered as a kind of dysfunction of CPG in human ALS cases with dysphagia. Copyright © 2010 International Federation of Clinical Neurophysiology. Published by Elsevier Ireland Ltd. All rights reserved.

  20. Symmetry in locomotor central pattern generators and animal gaits

    NASA Astrophysics Data System (ADS)

    Golubitsky, Martin; Stewart, Ian; Buono, Pietro-Luciano; Collins, J. J.

    1999-10-01

    Animal locomotion is controlled, in part, by a central pattern generator (CPG), which is an intraspinal network of neurons capable of generating a rhythmic output. The spatio-temporal symmetries of the quadrupedal gaits walk, trot and pace lead to plausible assumptions about the symmetries of locomotor CPGs. These assumptions imply that the CPG of a quadruped should consist of eight nominally identical subcircuits, arranged in an essentially unique matter. Here we apply analogous arguments to myriapod CPGs. Analyses based on symmetry applied to these networks lead to testable predictions, including a distinction between primary and secondary gaits, the existence of a new primary gait called `jump', and the occurrence of half-integer wave numbers in myriapod gaits. For bipeds, our analysis also predicts two gaits with the out-of-phase symmetry of the walk and two gaits with the in-phase symmetry of the hop. We present data that support each of these predictions. This work suggests that symmetry can be used to infer a plausible class of CPG network architectures from observed patterns of animal gaits.

  1. Central pattern generation involved in oral and respiratory control for feeding in the term infant

    PubMed Central

    Barlow, Steven M.

    2009-01-01

    Purpose of review Drinking and eating are essential skills for survival and benefit from the coordination of several pattern generating networks and their musculoskeletal effectors to achieve safe swallows. Oral-pharyngo-esophageal motility develops during infancy and early childhood, and is influenced by various factors, including neuromuscular maturation, dietary and postural habits, arousal state, ongoing illnesses, congenital anomalies, and the effects of medical or surgical interventions. Gastroesophageal reflux is frequent in neonates and infants, and its role in neonatal morbidity including dysphagia, chronic lung disease, or apparent life-threatening events is not well understood. This review highlights recent studies aimed at understanding the development of oral feeding skills, and cross-system interactions among the brainstem, spinal, and cerebral networks involved in feeding. Recent Findings Functional linkages between suck-swallow and swallow-respiration manifest transitional forms during late gestation through the first year of life which can be delayed or modified by sensory experience and/or disease processes. Relevant central pattern generator (CPG) networks and their neuromuscular targets attain functional status at different rates, which ultimately influences cross-system CPG interactions. Entrainment of trigeminal primary afferents accelerates pattern genesis for the suck CPG and transition-to-oral feed in the RDS preterm infant. Summary The genesis of within-system CPG control for rate and amplitude scaling matures differentially for suck, mastication, swallow, and respiration. Cross-system interactions among these CPGs represent targets of opportunity for new interventions which optimize experience-dependent mechanisms to promote safe swallows among newborn and pediatric patients. PMID:19417662

  2. Sherlock Holmes and the Curious Case of the Human Locomotor Central Pattern Generator.

    PubMed

    Klarner, Taryn; Zehr, E Paul

    2018-03-14

    Evidence first described in reduced animal models over 100 years ago led to deductions about the control of locomotion through spinal locomotor central pattern generating (CPG) networks. These discoveries in nature were contemporaneous with another form of deductive reasoning found in popular culture-that of Arthur Conan Doyle's detective "Sherlock Holmes". Since the invasive methods used in reduced non-human animal preparations are not amenable to study in humans, we are left instead with deducing from other measures and observations. Using the deductive reasoning approach of Sherlock Holmes as a metaphor for framing research into human CPGs, we speculate and weigh the evidence that should be observable in humans based on knowledge from other species. This review summarizes indirect inference to assess "observable evidence" of pattern generating activity which leads to the logical deduction of CPG contributions to arm and leg activity during locomotion in humans. The question of where a CPG may be housed in the human nervous system remains incompletely resolved at this time. Ongoing understanding, elaboration and application of functioning locomotor CPGs in humans is important for gait rehabilitation strategies in those with neurological injuries.

  3. Motor Neurons Tune Premotor Activity in a Vertebrate Central Pattern Generator

    PubMed Central

    2017-01-01

    Central patterns generators (CPGs) are neural circuits that drive rhythmic motor output without sensory feedback. Vertebrate CPGs are generally believed to operate in a top-down manner in which premotor interneurons activate motor neurons that in turn drive muscles. In contrast, the frog (Xenopus laevis) vocal CPG contains a functionally unexplored neuronal projection from the motor nucleus to the premotor nucleus, indicating a recurrent pathway that may contribute to rhythm generation. In this study, we characterized the function of this bottom-up connection. The X. laevis vocal CPG produces a 50–60 Hz “fast trill” song used by males during courtship. We recorded “fictive vocalizations” in the in vitro CPG from the laryngeal nerve while simultaneously recording premotor activity at the population and single-cell level. We show that transecting the motor-to-premotor projection eliminated the characteristic firing rate of premotor neurons. Silencing motor neurons with the intracellular sodium channel blocker QX-314 also disrupted premotor rhythms, as did blockade of nicotinic synapses in the motor nucleus (the putative location of motor neuron-to-interneuron connections). Electrically stimulating the laryngeal nerve elicited primarily IPSPs in premotor neurons that could be blocked by a nicotinic receptor antagonist. Our results indicate that an inhibitory signal, activated by motor neurons, is required for proper CPG function. To our knowledge, these findings represent the first example of a CPG in which precise premotor rhythms are tuned by motor neuron activity. SIGNIFICANCE STATEMENT Central pattern generators (CPGs) are neural circuits that produce rhythmic behaviors. In vertebrates, motor neurons are not commonly known to contribute to CPG function, with the exception of a few spinal circuits where the functional significance of motor neuron feedback is still poorly understood. The frog hindbrain vocal circuit contains a previously unexplored connection from the motor to premotor region. Our results indicate that motor neurons activate this bottom-up connection, and blocking this signal eliminates normal premotor activity. These findings may promote increased awareness of potential involvement of motor neurons in a wider range of CPGs, perhaps clarifying our understanding of network principles underlying motor behaviors in numerous organisms, including humans. PMID:28219984

  4. Gait Planning and Stability Control of a Quadruped Robot

    PubMed Central

    Li, Junmin; Wang, Jinge; Yang, Simon X.; Zhou, Kedong; Tang, Huijuan

    2016-01-01

    In order to realize smooth gait planning and stability control of a quadruped robot, a new controller algorithm based on CPG-ZMP (central pattern generator-zero moment point) is put forward in this paper. To generate smooth gait and shorten the adjusting time of the model oscillation system, a new CPG model controller and its gait switching strategy based on Wilson-Cowan model are presented in the paper. The control signals of knee-hip joints are obtained by the improved multi-DOF reduced order control theory. To realize stability control, the adaptive speed adjustment and gait switch are completed by the real-time computing of ZMP. Experiment results show that the quadruped robot's gaits are efficiently generated and the gait switch is smooth in the CPG control algorithm. Meanwhile, the stability of robot's movement is improved greatly with the CPG-ZMP algorithm. The algorithm in this paper has good practicability, which lays a foundation for the production of the robot prototype. PMID:27143959

  5. Gait Planning and Stability Control of a Quadruped Robot.

    PubMed

    Li, Junmin; Wang, Jinge; Yang, Simon X; Zhou, Kedong; Tang, Huijuan

    2016-01-01

    In order to realize smooth gait planning and stability control of a quadruped robot, a new controller algorithm based on CPG-ZMP (central pattern generator-zero moment point) is put forward in this paper. To generate smooth gait and shorten the adjusting time of the model oscillation system, a new CPG model controller and its gait switching strategy based on Wilson-Cowan model are presented in the paper. The control signals of knee-hip joints are obtained by the improved multi-DOF reduced order control theory. To realize stability control, the adaptive speed adjustment and gait switch are completed by the real-time computing of ZMP. Experiment results show that the quadruped robot's gaits are efficiently generated and the gait switch is smooth in the CPG control algorithm. Meanwhile, the stability of robot's movement is improved greatly with the CPG-ZMP algorithm. The algorithm in this paper has good practicability, which lays a foundation for the production of the robot prototype.

  6. Neonatal testosterone suppresses a neuroendocrine pulse generator required for reproduction

    NASA Astrophysics Data System (ADS)

    Israel, Jean-Marc; Cabelguen, Jean-Marie; Le Masson, Gwendal; Oliet, Stéphane H.; Ciofi, Philippe

    2014-02-01

    The pituitary gland releases hormones in a pulsatile fashion guaranteeing signalling efficiency. The determinants of pulsatility are poorly circumscribed. Here we show in magnocellular hypothalamo-neurohypophyseal oxytocin (OT) neurons that the bursting activity underlying the neurohormonal pulses necessary for parturition and the milk-ejection reflex is entirely driven by a female-specific central pattern generator (CPG). Surprisingly, this CPG is active in both male and female neonates, but is inactivated in males after the first week of life. CPG activity can be restored in males by orchidectomy or silenced in females by exogenous testosterone. This steroid effect is aromatase and caspase dependent, and is mediated via oestrogen receptor-α. This indicates the apoptosis of the CPG network during hypothalamic sexual differentiation, explaining why OT neurons do not burst in adult males. This supports the view that stereotypic neuroendocrine pulsatility is governed by CPGs, some of which are subjected to gender-specific perinatal programming.

  7. Towards autonomous locomotion: CPG-based control of smooth 3D slithering gait transition of a snake-like robot.

    PubMed

    Bing, Zhenshan; Cheng, Long; Chen, Guang; Röhrbein, Florian; Huang, Kai; Knoll, Alois

    2017-04-04

    Snake-like robots with 3D locomotion ability have significant advantages of adaptive travelling in diverse complex terrain over traditional legged or wheeled mobile robots. Despite numerous developed gaits, these snake-like robots suffer from unsmooth gait transitions by changing the locomotion speed, direction, and body shape, which would potentially cause undesired movement and abnormal torque. Hence, there exists a knowledge gap for snake-like robots to achieve autonomous locomotion. To address this problem, this paper presents the smooth slithering gait transition control based on a lightweight central pattern generator (CPG) model for snake-like robots. First, based on the convergence behavior of the gradient system, a lightweight CPG model with fast computing time was designed and compared with other widely adopted CPG models. Then, by reshaping the body into a more stable geometry, the slithering gait was modified, and studied based on the proposed CPG model, including the gait transition of locomotion speed, moving direction, and body shape. In contrast to sinusoid-based method, extensive simulations and prototype experiments finally demonstrated that smooth slithering gait transition can be effectively achieved using the proposed CPG-based control method without generating undesired locomotion and abnormal torque.

  8. Peripheral oxygen-sensing cells directly modulate the output of an identified respiratory central pattern generating neuron.

    PubMed

    Bell, Harold J; Inoue, Takuya; Shum, Kelly; Luk, Collin; Syed, Naweed I

    2007-06-01

    Breathing is an essential homeostatic behavior regulated by central neuronal networks, often called central pattern generators (CPGs). Despite ongoing advances in our understanding of the neural control of breathing, the basic mechanisms by which peripheral input modulates the activities of the central respiratory CPG remain elusive. This lack of fundamental knowledge vis-à-vis the role of peripheral influences in the control of the respiratory CPG is due in large part to the complexity of mammalian respiratory control centres. We have therefore developed a simpler invertebrate model to study the basic cellular and synaptic mechanisms by which a peripheral chemosensory input affects the central respiratory CPG. Here we report on the identification and characterization of peripheral chemoreceptor cells (PCRCs) that relay hypoxia-sensitive chemosensory information to the known respiratory CPG neuron right pedal dorsal 1 in the mollusk Lymnaea stagnalis. Selective perfusion of these PCRCs with hypoxic saline triggered bursting activity in these neurons and when isolated in cell culture these cells also demonstrated hypoxic sensitivity that resulted in membrane depolarization and spiking activity. When cocultured with right pedal dorsal 1, the PCRCs developed synapses that exhibited a form of short-term synaptic plasticity in response to hypoxia. Finally, osphradial denervation in intact animals significantly perturbed respiratory activity compared with their sham counterparts. This study provides evidence for direct synaptic connectivity between a peripheral regulatory element and a central respiratory CPG neuron, revealing a potential locus for hypoxia-induced synaptic plasticity underlying breathing behavior.

  9. Removal of spike frequency adaptation via neuromodulation intrinsic to the Tritonia escape swim central pattern generator.

    PubMed

    Katz, P S; Frost, W N

    1997-10-15

    For the mollusc Tritonia diomedea to generate its escape swim motor pattern, interneuron C2, a crucial member of the central pattern generator (CPG) for this rhythmic behavior, must fire repetitive bursts of action potentials. Yet, before swimming, repeated depolarizing current pulses injected into C2 at periods similar those in the swim motor program are incapable of mimicking the firing rate attained by C2 on each cycle of a swim motor program. This resting level of C2 inexcitability is attributable to its own inherent spike frequency adaptation (SFA). Clearly, this property must be altered for the swim behavior to occur. The pathway for initiation of the swimming behavior involves activation of the serotonergic dorsal swim interneurons (DSIs), which are also intrinsic members of the swim CPG. Physiologically appropriate DSI stimulation transiently decreases C2 SFA, allowing C2 to fire at higher rates even when repeatedly depolarized at short intervals. The increased C2 excitability caused by DSI stimulation is mimicked and occluded by serotonin application. Furthermore, the change in excitability is not caused by the depolarization associated with DSI stimulation or serotonin application but is correlated with a decrease in C2 spike afterhyperpolarization. This suggests that the DSIs use serotonin to evoke a neuromodulatory action on a conductance in C2 that regulates its firing rate. This modulatory action of one CPG neuron on another is likely to play a role in configuring the swim circuit into its rhythmic pattern-generating mode and maintaining it in that state.

  10. Bio-inspired control of joint torque and knee stiffness in a robotic lower limb exoskeleton using a central pattern generator.

    PubMed

    Schrade, Stefan O; Nager, Yannik; Wu, Amy R; Gassert, Roger; Ijspeert, Auke

    2017-07-01

    Robotic lower limb exoskeletons are becoming increasingly popular in therapy and recreational use. However, most exoskeletons are still rather limited in their locomotion speed and the activities of daily live they can perform. Furthermore, they typically do not allow for a dynamic adaptation to the environment, as they are often controlled with predefined reference trajectories. Inspired by human leg stiffness modulation during walking, variable stiffness actuators increase flexibility without the need for more complex controllers. Actuation with adaptable stiffness is inspired by the human leg stiffness modulation during walking. However, this actuation principle also introduces the stiffness setpoint as an additional degree of freedom that needs to be coordinated with the joint trajectories. As a potential solution to this issue a bio-inspired controller based on a central pattern generator (CPG) is presented in this work. It generates coordinated joint torques and knee stiffness modulations to produce flexible and dynamic gait patterns for an exoskeleton with variable knee stiffness actuation. The CPG controller is evaluated and optimized in simulation using a model of the exoskeleton. The CPG controller produced stable and smooth gait for walking speeds from 0.4 m/s up to 1.57 m/s with a torso stabilizing force that simulated the use of crutches, which are commonly needed by exoskeleton users. Through the CPG, the knee stiffness intrinsically adapted to the frequency and phase of the gait, when the speed was changed. Additionally, it adjusted to changes in the environment in the form of uneven terrain by reacting to ground contact forces. This could allow future exoskeletons to be more adaptive to various environments, thus making ambulation more robust.

  11. Silicon central pattern generators for cardiac diseases

    PubMed Central

    Nogaret, Alain; O'Callaghan, Erin L; Lataro, Renata M; Salgado, Helio C; Meliza, C Daniel; Duncan, Edward; Abarbanel, Henry D I; Paton, Julian F R

    2015-01-01

    Cardiac rhythm management devices provide therapies for both arrhythmias and resynchronisation but not heart failure, which affects millions of patients worldwide. This paper reviews recent advances in biophysics and mathematical engineering that provide a novel technological platform for addressing heart disease and enabling beat-to-beat adaptation of cardiac pacing in response to physiological feedback. The technology consists of silicon hardware central pattern generators (hCPGs) that may be trained to emulate accurately the dynamical response of biological central pattern generators (bCPGs). We discuss the limitations of present CPGs and appraise the advantages of analog over digital circuits for application in bioelectronic medicine. To test the system, we have focused on the cardio-respiratory oscillators in the medulla oblongata that modulate heart rate in phase with respiration to induce respiratory sinus arrhythmia (RSA). We describe here a novel, scalable hCPG comprising physiologically realistic (Hodgkin–Huxley type) neurones and synapses. Our hCPG comprises two neurones that antagonise each other to provide rhythmic motor drive to the vagus nerve to slow the heart. We show how recent advances in modelling allow the motor output to adapt to physiological feedback such as respiration. In rats, we report on the restoration of RSA using an hCPG that receives diaphragmatic electromyography input and use it to stimulate the vagus nerve at specific time points of the respiratory cycle to slow the heart rate. We have validated the adaptation of stimulation to alterations in respiratory rate. We demonstrate that the hCPG is tuneable in terms of the depth and timing of the RSA relative to respiratory phase. These pioneering studies will now permit an analysis of the physiological role of RSA as well as its any potential therapeutic use in cardiac disease. PMID:25433077

  12. A modeling approach on why simple central pattern generators are built of irregular neurons.

    PubMed

    Reyes, Marcelo Bussotti; Carelli, Pedro Valadão; Sartorelli, José Carlos; Pinto, Reynaldo Daniel

    2015-01-01

    The crustacean pyloric Central Pattern Generator (CPG) is a nervous circuit that endogenously provides periodic motor patterns. Even after about 40 years of intensive studies, the rhythm genesis is still not rigorously understood in this CPG, mainly because it is made of neurons with irregular intrinsic activity. Using mathematical models we addressed the question of using a network of irregularly behaving elements to generate periodic oscillations, and we show some advantages of using non-periodic neurons with intrinsic behavior in the transition from bursting to tonic spiking (as found in biological pyloric CPGs) as building components. We studied two- and three-neuron model CPGs built either with Hindmarsh-Rose or with conductance-based Hodgkin-Huxley-like model neurons. By changing a model's parameter we could span the neuron's intrinsic dynamical behavior from slow periodic bursting to fast tonic spiking, passing through a transition where irregular bursting was observed. Two-neuron CPG, half center oscillator (HCO), was obtained for each intrinsic behavior of the neurons by coupling them with mutual symmetric synaptic inhibition. Most of these HCOs presented regular antiphasic bursting activity and the changes of the bursting frequencies was studied as a function of the inhibitory synaptic strength. Among all HCOs, those made of intrinsic irregular neurons presented a wider burst frequency range while keeping a reliable regular oscillatory (bursting) behavior. HCOs of periodic neurons tended to be either hard to change their behavior with synaptic strength variations (slow periodic burster neurons) or unable to perform a physiologically meaningful rhythm (fast tonic spiking neurons). Moreover, 3-neuron CPGs with connectivity and output similar to those of the pyloric CPG presented the same results.

  13. Asymmetric Operation of the Locomotor Central Pattern Generator in the Neonatal Mouse Spinal Cord

    PubMed Central

    Endo, Toshiaki; Kiehn, Ole

    2008-01-01

    The rhythmic voltage oscillations in motor neurons (MNs) during locomotor movements reflect the operation of the pre-MN central pattern generator (CPG) network. Recordings from MNs can thus be used as a method to deduct the organization of CPGs. Here, we use continuous conductance measurements and decomposition methods to quantitatively assess the weighting and phase tuning of synaptic inputs to different flexor and extensor MNs during locomotor-like activity in the isolated neonatal mice lumbar spinal cord preparation. Whole cell recordings were obtained from 22 flexor and 18 extensor MNs in rostral and caudal lumbar segments. In all flexor and the large majority of extensor MNs the extracted excitatory and inhibitory synaptic conductances alternate but with a predominance of inhibitory conductances, most pronounced in extensors. These conductance changes are consistent with a “push–pull” operation of locomotor CPG. The extracted excitatory and inhibitory synaptic conductances varied between 2 and 56% of the mean total conductance. Analysis of the phase tuning of the extracted synaptic conductances in flexor and extensor MNs in the rostral lumbar cord showed that the flexor-phase–related synaptic conductance changes have sharper locomotor-phase tuning than the extensor-phase–related conductances, suggesting a modular organization of premotor CPG networks consisting of reciprocally coupled, but differently composed, flexor and extensor CPG networks. There was a clear difference between phase tuning in rostral and caudal MNs, suggesting a distinct operation of CPG networks in different lumbar segments. The highly asymmetric features were preserved throughout all ranges of locomotor frequencies investigated and with different combinations of locomotor-inducing drugs. The asymmetric nature of CPG operation and phase tuning of the conductance profiles provide important clues to the organization of the rodent locomotor CPG and are compatible with a multilayered and distributed structure of the network. PMID:18829847

  14. Minimal feedback to a rhythm generator improves the robustness to slope variations of a compass biped.

    PubMed

    Spitz, Jonathan; Evstrachin, Alexandrina; Zacksenhouse, Miriam

    2015-08-20

    In recent years there has been a growing interest in the field of dynamic walking and bio-inspired robots. However, while walking and running on a flat surface have been studied extensively, walking dynamically over terrains with varying slope remains a challenge. Previously we developed an open loop controller based on a central pattern generator (CPG). The controller applied predefined torque patterns to a compass-gait biped, and achieved stable gaits over a limited range of slopes. In this work, this range is greatly extended by applying a once per cycle feedback to the CPG controller. The terrain's slope is measured and used to modify both the CPG frequency and the torque amplitude once per step. A multi-objective optimization algorithm was used to tune the controller parameters for a simulated CB model. The resulting controller successfully traverses terrains with slopes ranging from +7° to -8°, comparable to most slopes found in human constructed environments. Gait stability was verified by computing the linearized Poincaré Map both numerically and analytically.

  15. Leveraging workflow control patterns in the domain of clinical practice guidelines.

    PubMed

    Kaiser, Katharina; Marcos, Mar

    2016-02-10

    Clinical practice guidelines (CPGs) include recommendations describing appropriate care for the management of patients with a specific clinical condition. A number of representation languages have been developed to support executable CPGs, with associated authoring/editing tools. Even with tool assistance, authoring of CPG models is a labor-intensive task. We aim at facilitating the early stages of CPG modeling task. In this context, we propose to support the authoring of CPG models based on a set of suitable procedural patterns described in an implementation-independent notation that can be then semi-automatically transformed into one of the alternative executable CPG languages. We have started with the workflow control patterns which have been identified in the fields of workflow systems and business process management. We have analyzed the suitability of these patterns by means of a qualitative analysis of CPG texts. Following our analysis we have implemented a selection of workflow patterns in the Asbru and PROforma CPG languages. As implementation-independent notation for the description of patterns we have chosen BPMN 2.0. Finally, we have developed XSLT transformations to convert the BPMN 2.0 version of the patterns into the Asbru and PROforma languages. We showed that although a significant number of workflow control patterns are suitable to describe CPG procedural knowledge, not all of them are applicable in the context of CPGs due to their focus on single-patient care. Moreover, CPGs may require additional patterns not included in the set of workflow control patterns. We also showed that nearly all the CPG-suitable patterns can be conveniently implemented in the Asbru and PROforma languages. Finally, we demonstrated that individual patterns can be semi-automatically transformed from a process specification in BPMN 2.0 to executable implementations in these languages. We propose a pattern and transformation-based approach for the development of CPG models. Such an approach can form the basis of a valid framework for the authoring of CPG models. The identification of adequate patterns and the implementation of transformations to convert patterns from a process specification into different executable implementations are the first necessary steps for our approach.

  16. Real-time biomimetic Central Pattern Generators in an FPGA for hybrid experiments

    PubMed Central

    Ambroise, Matthieu; Levi, Timothée; Joucla, Sébastien; Yvert, Blaise; Saïghi, Sylvain

    2013-01-01

    This investigation of the leech heartbeat neural network system led to the development of a low resources, real-time, biomimetic digital hardware for use in hybrid experiments. The leech heartbeat neural network is one of the simplest central pattern generators (CPG). In biology, CPG provide the rhythmic bursts of spikes that form the basis for all muscle contraction orders (heartbeat) and locomotion (walking, running, etc.). The leech neural network system was previously investigated and this CPG formalized in the Hodgkin–Huxley neural model (HH), the most complex devised to date. However, the resources required for a neural model are proportional to its complexity. In response to this issue, this article describes a biomimetic implementation of a network of 240 CPGs in an FPGA (Field Programmable Gate Array), using a simple model (Izhikevich) and proposes a new synapse model: activity-dependent depression synapse. The network implementation architecture operates on a single computation core. This digital system works in real-time, requires few resources, and has the same bursting activity behavior as the complex model. The implementation of this CPG was initially validated by comparing it with a simulation of the complex model. Its activity was then matched with pharmacological data from the rat spinal cord activity. This digital system opens the way for future hybrid experiments and represents an important step toward hybridization of biological tissue and artificial neural networks. This CPG network is also likely to be useful for mimicking the locomotion activity of various animals and developing hybrid experiments for neuroprosthesis development. PMID:24319408

  17. In Vivo Control of CpG and Non-CpG DNA Methylation by DNA Methyltransferases

    PubMed Central

    Arand, Julia; Spieler, David; Karius, Tommy; Branco, Miguel R.; Meilinger, Daniela; Meissner, Alexander; Jenuwein, Thomas; Xu, Guoliang; Leonhardt, Heinrich; Wolf, Verena; Walter, Jörn

    2012-01-01

    The enzymatic control of the setting and maintenance of symmetric and non-symmetric DNA methylation patterns in a particular genome context is not well understood. Here, we describe a comprehensive analysis of DNA methylation patterns generated by high resolution sequencing of hairpin-bisulfite amplicons of selected single copy genes and repetitive elements (LINE1, B1, IAP-LTR-retrotransposons, and major satellites). The analysis unambiguously identifies a substantial amount of regional incomplete methylation maintenance, i.e. hemimethylated CpG positions, with variant degrees among cell types. Moreover, non-CpG cytosine methylation is confined to ESCs and exclusively catalysed by Dnmt3a and Dnmt3b. This sequence position–, cell type–, and region-dependent non-CpG methylation is strongly linked to neighboring CpG methylation and requires the presence of Dnmt3L. The generation of a comprehensive data set of 146,000 CpG dyads was used to apply and develop parameter estimated hidden Markov models (HMM) to calculate the relative contribution of DNA methyltransferases (Dnmts) for de novo and maintenance DNA methylation. The comparative modelling included wild-type ESCs and mutant ESCs deficient for Dnmt1, Dnmt3a, Dnmt3b, or Dnmt3a/3b, respectively. The HMM analysis identifies a considerable de novo methylation activity for Dnmt1 at certain repetitive elements and single copy sequences. Dnmt3a and Dnmt3b contribute de novo function. However, both enzymes are also essential to maintain symmetrical CpG methylation at distinct repetitive and single copy sequences in ESCs. PMID:22761581

  18. Critical Points and Traveling Wave in Locomotion: Experimental Evidence and Some Theoretical Considerations.

    PubMed

    Saltiel, Philippe; d'Avella, Andrea; Tresch, Matthew C; Wyler, Kuno; Bizzi, Emilio

    2017-01-01

    The central pattern generator (CPG) architecture for rhythm generation remains partly elusive. We compare cat and frog locomotion results, where the component unrelated to pattern formation appears as a temporal grid, and traveling wave respectively. Frog spinal cord microstimulation with N-methyl-D-Aspartate (NMDA), a CPG activator, produced a limited set of force directions, sometimes tonic, but more often alternating between directions similar to the tonic forces. The tonic forces were topographically organized, and sites evoking rhythms with different force subsets were located close to the constituent tonic force regions. Thus CPGs consist of topographically organized modules. Modularity was also identified as a limited set of muscle synergies whose combinations reconstructed the EMGs. The cat CPG was investigated using proprioceptive inputs during fictive locomotion. Critical points identified both as abrupt transitions in the effect of phasic perturbations, and burst shape transitions, had biomechanical correlates in intact locomotion. During tonic proprioceptive perturbations, discrete shifts between these critical points explained the burst durations changes, and amplitude changes occurred at one of these points. Besides confirming CPG modularity, these results suggest a fixed temporal grid of anchoring points, to shift modules onsets and offsets. Frog locomotion, reconstructed with the NMDA synergies, showed a partially overlapping synergy activation sequence. Using the early synergy output evoked by NMDA at different spinal sites, revealed a rostrocaudal topographic organization, where each synergy is preferentially evoked from a few, albeit overlapping, cord regions. Comparing the locomotor synergy sequence with this topography suggests that a rostrocaudal traveling wave would activate the synergies in the proper sequence for locomotion. This output was reproduced in a two-layer model using this topography and a traveling wave. Together our results suggest two CPG components: modules, i.e., synergies; and temporal patterning, seen as a temporal grid in the cat, and a traveling wave in the frog. Animal and limb navigation have similarities. Research relating grid cells to the theta rhythm and on segmentation during navigation may relate to our temporal grid and traveling wave results. Winfree's mathematical work, combining critical phases and a traveling wave, also appears important. We conclude suggesting tracing, and imaging experiments to investigate our CPG model.

  19. Computational Models and Emergent Properties of Respiratory Neural Networks

    PubMed Central

    Lindsey, Bruce G.; Rybak, Ilya A.; Smith, Jeffrey C.

    2012-01-01

    Computational models of the neural control system for breathing in mammals provide a theoretical and computational framework bringing together experimental data obtained from different animal preparations under various experimental conditions. Many of these models were developed in parallel and iteratively with experimental studies and provided predictions guiding new experiments. This data-driven modeling approach has advanced our understanding of respiratory network architecture and neural mechanisms underlying generation of the respiratory rhythm and pattern, including their functional reorganization under different physiological conditions. Models reviewed here vary in neurobiological details and computational complexity and span multiple spatiotemporal scales of respiratory control mechanisms. Recent models describe interacting populations of respiratory neurons spatially distributed within the Bötzinger and pre-Bötzinger complexes and rostral ventrolateral medulla that contain core circuits of the respiratory central pattern generator (CPG). Network interactions within these circuits along with intrinsic rhythmogenic properties of neurons form a hierarchy of multiple rhythm generation mechanisms. The functional expression of these mechanisms is controlled by input drives from other brainstem components, including the retrotrapezoid nucleus and pons, which regulate the dynamic behavior of the core circuitry. The emerging view is that the brainstem respiratory network has rhythmogenic capabilities at multiple levels of circuit organization. This allows flexible, state-dependent expression of different neural pattern-generation mechanisms under various physiological conditions, enabling a wide repertoire of respiratory behaviors. Some models consider control of the respiratory CPG by pulmonary feedback and network reconfiguration during defensive behaviors such as cough. Future directions in modeling of the respiratory CPG are considered. PMID:23687564

  20. Optimization of stable quadruped locomotion using mutual information

    NASA Astrophysics Data System (ADS)

    Silva, Pedro; Santos, Cristina P.; Polani, Daniel

    2013-10-01

    Central Pattern Generators (CPG)s have been widely used in the field of robotics to address the task of legged locomotion generation. The adequate configuration of these structures for a given platform can be accessed through evolutionary strategies, according to task dependent selection pressures. Information driven evolution, accounts for information theoretical measures as selection pressures, as an alternative to a fully task dependent selection pressure. In this work we exploit this concept and evaluate the use of mean Mutual Information, as a selection pressure towards a CPG configuration capable of faster, yet more coordinated and stabler locomotion than when only a task dependent selection pressure is used.

  1. Interactions between Dorsal and Ventral Root Stimulation on the Generation of Locomotor-Like Activity in the Neonatal Mouse Spinal Cord

    PubMed Central

    2016-01-01

    Abstract We investigated whether dorsal (DR) and ventral root (VR) stimulus trains engage common postsynaptic components to activate the central pattern generator (CPG) for locomotion in the neonatal mouse spinal cord. VR stimulation did not activate the first order interneurons mediating the activation of the locomotor CPG by sacrocaudal afferent stimulation. Simultaneous stimulation of adjacent dorsal or ventral root pairs, subthreshold for evoking locomotor-like activity, did not summate to activate the CPG. This suggests that locomotor-like activity is triggered when a critical class of efferent or afferent axons is stimulated and does not depend on the number of stimulated axons or activated postsynaptic neurons. DR- and VR-evoked episodes exhibited differences in the coupling between VR pairs. In DR-evoked episodes, the coupling between the ipsilateral and contralateral flexor/extensor roots was similar and stronger than the bilateral extensor roots. In VR-evoked episodes, ipsilateral flexor/extensor coupling was stronger than both the contralateral flexor/extensor and the bilateral extensor coupling. For both types of stimulation, the coupling was greatest between the bilateral L1/L2 flexor-dominated roots. This indicates that the recruitment and/or the firing pattern of motoneurons differed in DR and VR-evoked episodes. However, the DR and VR trains do not appear to activate distinct CPGs because trains of DR and VR stimuli at frequencies too low to evoke locomotor-like activity did so when they were interleaved. These results indicate that the excitatory actions of VR stimulation converge onto the CPG through an unknown pathway that is not captured by current models of the locomotor CPG. PMID:27419215

  2. A silicon central pattern generator controls locomotion in vivo.

    PubMed

    Vogelstein, R J; Tenore, F; Guevremont, L; Etienne-Cummings, R; Mushahwar, V K

    2008-09-01

    We present a neuromorphic silicon chip that emulates the activity of the biological spinal central pattern generator (CPG) and creates locomotor patterns to support walking. The chip implements ten integrate-and-fire silicon neurons and 190 programmable digital-to-analog converters that act as synapses. This architecture allows for each neuron to make synaptic connections to any of the other neurons as well as to any of eight external input signals and one tonic bias input. The chip's functionality is confirmed by a series of experiments in which it controls the motor output of a paralyzed animal in real-time and enables it to walk along a three-meter platform. The walking is controlled under closed-loop conditions with the aide of sensory feedback that is recorded from the animal's legs and fed into the silicon CPG. Although we and others have previously described biomimetic silicon locomotor control systems for robots, this is the first demonstration of a neuromorphic device that can replace some functions of the central nervous system in vivo.

  3. Methylation oligonucleotide microarray: a novel tool to analyze methylation patterns

    NASA Astrophysics Data System (ADS)

    Hou, Peng; Ji, Meiju; He, Nongyao; Lu, Zuhong

    2003-04-01

    A new technique to analyze methylation patterns in several adjacent CpG sites was developed and reported here. We selected a 336bp segment of the 5"-untranslated region and the first exon of the p16Ink4a gene, which include the most densely packed CpG fragment of the islands containing 32 CpG dinucleotides, as the investigated target. The probes that include all types of methylation patterns were designed to fabricate a DNA microarray to determine the methylation patterns of seven adjacent CpG dinucleotides sites. High accuracy and reproducibility were observed in several parallel experiments. The results led us to the conclusion that the methylation oligonucleotide microarray can be applied as a novel and powerful tool to map methylation patterns and changes in multiple CpG island loci in a variety of tumors.

  4. Neuronal activity in the isolated mouse spinal cord during spontaneous deletions in fictive locomotion: insights into locomotor central pattern generator organization

    PubMed Central

    Zhong, Guisheng; Shevtsova, Natalia A; Rybak, Ilya A; Harris-Warrick, Ronald M

    2012-01-01

    We explored the organization of the spinal central pattern generator (CPG) for locomotion by analysing the activity of spinal interneurons and motoneurons during spontaneous deletions occurring during fictive locomotion in the isolated neonatal mouse spinal cord, following earlier work on locomotor deletions in the cat. In the isolated mouse spinal cord, most spontaneous deletions were non-resetting, with rhythmic activity resuming after an integer number of cycles. Flexor and extensor deletions showed marked asymmetry: flexor deletions were accompanied by sustained ipsilateral extensor activity, whereas rhythmic flexor bursting was not perturbed during extensor deletions. Rhythmic activity on one side of the cord was not perturbed during non-resetting spontaneous deletions on the other side, and these deletions could occur with no input from the other side of the cord. These results suggest that the locomotor CPG has a two-level organization with rhythm-generating (RG) and pattern-forming (PF) networks, in which only the flexor RG network is intrinsically rhythmic. To further explore the neuronal organization of the CPG, we monitored activity of motoneurons and selected identified interneurons during spontaneous non-resetting deletions. Motoneurons lost rhythmic synaptic drive during ipsilateral deletions. Flexor-related commissural interneurons continued to fire rhythmically during non-resetting ipsilateral flexor deletions. Deletion analysis revealed two classes of rhythmic V2a interneurons. Type I V2a interneurons retained rhythmic synaptic drive and firing during ipsilateral motor deletions, while type II V2a interneurons lost rhythmic synaptic input and fell silent during deletions. This suggests that the type I neurons are components of the RG, whereas the type II neurons are components of the PF network. We propose a computational model of the spinal locomotor CPG that reproduces our experimental results. The results may provide novel insights into the organization of spinal locomotor networks. PMID:22869012

  5. Multilevel Analysis of Locomotion in Immature Preparations Suggests Innovative Strategies to Reactivate Stepping after Spinal Cord Injury.

    PubMed

    Brumley, Michele R; Guertin, Pierre A; Taccola, Giuliano

    2017-01-01

    Locomotion is one of the most complex motor behaviors. Locomotor patterns change during early life, reflecting development of numerous peripheral and hierarchically organized central structures. Among them, the spinal cord is of particular interest since it houses the central pattern generator (CPG) for locomotion. This main command center is capable of eliciting and coordinating complex series of rhythmic neural signals sent to motoneurons and to corresponding target-muscles for basic locomotor activity. For a long-time, the CPG has been considered a black box. In recent years, complementary insights from in vitro and in vivo animal models have contributed significantly to a better understanding of its constituents, properties and ways to recover locomotion after a spinal cord injury (SCI). This review discusses key findings made by comparing the results of in vitro isolated spinal cord preparations and spinal-transected in vivo models from neonatal animals. Pharmacological, electrical, and sensory stimulation approaches largely used to further understand CPG function may also soon become therapeutic tools for potent CPG reactivation and locomotor movement induction in persons with SCI or developmental neuromuscular disorder. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  6. Regulation of ventral surface chemoreceptors by the central respiratory pattern generator.

    PubMed

    Guyenet, Patrice G; Mulkey, Daniel K; Stornetta, Ruth L; Bayliss, Douglas A

    2005-09-28

    The rat retrotrapezoid nucleus (RTN) contains neurons described as central chemoreceptors in the adult and respiratory rhythm-generating pacemakers in neonates [parafacial respiratory group (pfRG)]. Here we test the hypothesis that both RTN and pfRG neurons are intrinsically chemosensitive and tonically firing neurons whose respiratory rhythmicity is caused by a synaptic feedback from the central respiratory pattern generator (CPG). In halothane-anesthetized adults, RTN neurons were silent below 4.5% end-expiratory (e-exp) CO2. Their activity increased linearly (3.2 Hz/1% CO2) up to 6.5% (CPG threshold) and then more slowly to peak approximately 10 Hz at 10% CO2. Respiratory modulation of RTN neurons was absent below CPG threshold, gradually stronger beyond, and, like pfRG neurons, typically (42%) characterized by twin periods of reduced activity near phrenic inspiration. After CPG inactivation with kynurenate (KYN), RTN neurons discharged linearly as a function of e-exp CO2 (slope, +1.7 Hz/1% CO2) and arterial pH (threshold, 7.48; slope, 39 Hz/pH unit). In coronal brain slices (postnatal days 7-12), RTN chemosensitive neurons were silent at pH 7.55. Their activity increased linearly with acidification up to pH 7.2 (17 Hz/pH unit at 35 degrees C) and was always tonic. In conclusion, consistent with their postulated central chemoreceptor role, RTN/pfRG neurons encode pH linearly and discharge tonically when disconnected from the rest of the respiratory centers in vivo (KYN treatment) and in vitro. In vivo, RTN neurons receive respiratory synchronous inhibitory inputs that may serve as feedback and impart these neurons with their characteristic respiratory modulation.

  7. An automated graphics tool for comparative genomics: the Coulson plot generator

    PubMed Central

    2013-01-01

    Background Comparative analysis is an essential component to biology. When applied to genomics for example, analysis may require comparisons between the predicted presence and absence of genes in a group of genomes under consideration. Frequently, genes can be grouped into small categories based on functional criteria, for example membership of a multimeric complex, participation in a metabolic or signaling pathway or shared sequence features and/or paralogy. These patterns of retention and loss are highly informative for the prediction of function, and hence possible biological context, and can provide great insights into the evolutionary history of cellular functions. However, representation of such information in a standard spreadsheet is a poor visual means from which to extract patterns within a dataset. Results We devised the Coulson Plot, a new graphical representation that exploits a matrix of pie charts to display comparative genomics data. Each pie is used to describe a complex or process from a separate taxon, and is divided into sectors corresponding to the number of proteins (subunits) in a complex/process. The predicted presence or absence of proteins in each complex are delineated by occupancy of a given sector; this format is visually highly accessible and makes pattern recognition rapid and reliable. A key to the identity of each subunit, plus hierarchical naming of taxa and coloring are included. A java-based application, the Coulson plot generator (CPG) automates graphic production, with a tab or comma-delineated text file as input and generating an editable portable document format or svg file. Conclusions CPG software may be used to rapidly convert spreadsheet data to a graphical matrix pie chart format. The representation essentially retains all of the information from the spreadsheet but presents a graphically rich format making comparisons and identification of patterns significantly clearer. While the Coulson plot format is highly useful in comparative genomics, its original purpose, the software can be used to visualize any dataset where entity occupancy is compared between different classes. Availability CPG software is available at sourceforge http://sourceforge.net/projects/coulson and http://dl.dropbox.com/u/6701906/Web/Sites/Labsite/CPG.html PMID:23621955

  8. Intra- and intersegmental influences among central pattern generating networks in the walking system of the stick insect.

    PubMed

    Mantziaris, Charalampos; Bockemühl, Till; Holmes, Philip; Borgmann, Anke; Daun, Silvia; Büschges, Ansgar

    2017-10-01

    To efficiently move around, animals need to coordinate their limbs. Proper, context-dependent coupling among the neural networks underlying leg movement is necessary for generating intersegmental coordination. In the slow-walking stick insect, local sensory information is very important for shaping coordination. However, central coupling mechanisms among segmental central pattern generators (CPGs) may also contribute to this. Here, we analyzed the interactions between contralateral networks that drive the depressor trochanteris muscle of the legs in both isolated and interconnected deafferented thoracic ganglia of the stick insect on application of pilocarpine, a muscarinic acetylcholine receptor agonist. Our results show that depressor CPG activity is only weakly coupled between all segments. Intrasegmental phase relationships differ between the three isolated ganglia, and they are modified and stabilized when ganglia are interconnected. However, the coordination patterns that emerge do not resemble those observed during walking. Our findings are in line with recent studies and highlight the influence of sensory input on coordination in slowly walking insects. Finally, as a direct interaction between depressor CPG networks and contralateral motoneurons could not be observed, we hypothesize that coupling is based on interactions at the level of CPG interneurons. NEW & NOTEWORTHY Maintaining functional interleg coordination is vitally important as animals locomote through changing environments. The relative importance of central mechanisms vs. sensory feedback in this process is not well understood. We analyzed coordination among the neural networks generating leg movements in stick insect preparations lacking phasic sensory feedback. Under these conditions, the networks governing different legs were only weakly coupled. In stick insect, central connections alone are thus insufficient to produce the leg coordination observed behaviorally. Copyright © 2017 the American Physiological Society.

  9. The central pattern generator underlying swimming in Dendronotus iris: a simple half-center network oscillator with a twist.

    PubMed

    Sakurai, Akira; Katz, Paul S

    2016-10-01

    The nudibranch mollusc, Dendronotus iris, swims by rhythmically flexing its body from left to right. We identified a bilaterally represented interneuron, Si3, that provides strong excitatory drive to the previously identified Si2, forming a half-center oscillator, which functions as the central pattern generator (CPG) underlying swimming. As with Si2, Si3 inhibited its contralateral counterpart and exhibited rhythmic bursts in left-right alternation during the swim motor pattern. Si3 burst almost synchronously with the contralateral Si2 and was coactive with the efferent impulse activity in the contralateral body wall nerve. Perturbation of bursting in either Si3 or Si2 by current injection halted or phase-shifted the swim motor pattern, suggesting that they are both critical CPG members. Neither Si2 nor Si3 exhibited endogenous bursting properties when activated alone; activation of all four neurons was necessary to initiate and maintain the swim motor pattern. Si3 made a strong excitatory synapse onto the contralateral Si2 to which it is also electrically coupled. When Si3 was firing tonically but not exhibiting bursting, artificial enhancement of the Si3-to-Si2 synapse using dynamic clamp caused all four neurons to burst. In contrast, negation of the Si3-to-Si2 synapse by dynamic clamp blocked ongoing swim motor patterns. Together, these results suggest that the Dendronotus swim CPG is organized as a "twisted" half-center oscillator in which each "half" is composed of two excitatory-coupled neurons from both sides of the brain, each of which inhibits its contralateral counterpart. Consisting of only four neurons, this is perhaps the simplest known network oscillator for locomotion. Copyright © 2016 the American Physiological Society.

  10. Cellular basis for singing motor pattern generation in the field cricket (Gryllus bimaculatus DeGeer)

    PubMed Central

    Schöneich, Stefan; Hedwig, Berthold

    2012-01-01

    The singing behavior of male crickets allows analyzing a central pattern generator (CPG) that was shaped by sexual selection for reliable production of species-specific communication signals. After localizing the essential ganglia for singing in Gryllus bimaculatus, we now studied the calling song CPG at the cellular level. Fictive singing was initiated by pharmacological brain stimulation. The motor pattern underlying syllables and chirps was recorded as alternating spike bursts of wing-opener and wing-closer motoneurons in a truncated wing nerve; it precisely reflected the natural calling song. During fictive singing, we intracellularly recorded and stained interneurons in thoracic and abdominal ganglia and tested their impact on the song pattern by intracellular current injections. We identified three interneurons of the metathoracic and first unfused abdominal ganglion that rhythmically de- and hyperpolarized in phase with the syllable pattern and spiked strictly before the wing-opener motoneurons. Depolarizing current injection in two of these opener interneurons caused additional rhythmic singing activity, which reliably reset the ongoing chirp rhythm. The closely intermeshing arborizations of the singing interneurons revealed the dorsal midline neuropiles of the metathoracic and three most anterior abdominal neuromeres as the anatomical location of singing pattern generation. In the same neuropiles, we also recorded several closer interneurons that rhythmically hyper- and depolarized in the syllable rhythm and spiked strictly before the wing-closer motoneurons. Some of them received pronounced inhibition at the beginning of each chirp. Hyperpolarizing current injection in the dendrite revealed postinhibitory rebound depolarization as one functional mechanism of central pattern generation in singing crickets. PMID:23170234

  11. Central pattern generator for vocalization: is there a vertebrate morphotype?

    PubMed

    Bass, Andrew H

    2014-10-01

    Animals that generate acoustic signals for social communication are faced with two essential tasks: generate a temporally precise signal and inform the auditory system about the occurrence of one's own sonic signal. Recent studies of sound producing fishes delineate a hindbrain network comprised of anatomically distinct compartments coding equally distinct neurophysiological properties that allow an organism to meet these behavioral demands. A set of neural characters comprising a vocal-sonic central pattern generator (CPG) morphotype is proposed for fishes and tetrapods that shares evolutionary developmental origins with pectoral appendage motor systems. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. Central pattern generator for vocalization: Is there a vertebrate morphotype?

    PubMed Central

    Bass, Andrew H.

    2014-01-01

    Animals that generate acoustic signals for social communication are faced with two essential tasks: generate a temporally precise signal and inform the auditory system about the occurrence of one’s own sonic signal. Recent studies of sound producing fishes delineate a hindbrain network comprised of anatomically distinct compartments coding equally distinct neurophysiological properties that allow an organism to meet these behavioral demands. A set of neural characters comprising a vocal-sonic central pattern generator (CPG) morphotype is proposed for fishes and tetrapods that shares evolutionary developmental origins with pectoral appendage motor systems. PMID:25050813

  13. Computer simulations of neural mechanisms explaining upper and lower limb excitatory neural coupling

    PubMed Central

    2010-01-01

    Background When humans perform rhythmic upper and lower limb locomotor-like movements, there is an excitatory effect of upper limb exertion on lower limb muscle recruitment. To investigate potential neural mechanisms for this behavioral observation, we developed computer simulations modeling interlimb neural pathways among central pattern generators. We hypothesized that enhancement of muscle recruitment from interlimb spinal mechanisms was not sufficient to explain muscle enhancement levels observed in experimental data. Methods We used Matsuoka oscillators for the central pattern generators (CPG) and determined parameters that enhanced amplitudes of rhythmic steady state bursts. Potential mechanisms for output enhancement were excitatory and inhibitory sensory feedback gains, excitatory and inhibitory interlimb coupling gains, and coupling geometry. We first simulated the simplest case, a single CPG, and then expanded the model to have two CPGs and lastly four CPGs. In the two and four CPG models, the lower limb CPGs did not receive supraspinal input such that the only mechanisms available for enhancing output were interlimb coupling gains and sensory feedback gains. Results In a two-CPG model with inhibitory sensory feedback gains, only excitatory gains of ipsilateral flexor-extensor/extensor-flexor coupling produced reciprocal upper-lower limb bursts and enhanced output up to 26%. In a two-CPG model with excitatory sensory feedback gains, excitatory gains of contralateral flexor-flexor/extensor-extensor coupling produced reciprocal upper-lower limb bursts and enhanced output up to 100%. However, within a given excitatory sensory feedback gain, enhancement due to excitatory interlimb gains could only reach levels up to 20%. Interconnecting four CPGs to have ipsilateral flexor-extensor/extensor-flexor coupling, contralateral flexor-flexor/extensor-extensor coupling, and bilateral flexor-extensor/extensor-flexor coupling could enhance motor output up to 32%. Enhancement observed in experimental data exceeded 32%. Enhancement within this symmetrical four-CPG neural architecture was more sensitive to relatively small interlimb coupling gains. Excitatory sensory feedback gains could produce greater output amplitudes, but larger gains were required for entrainment compared to inhibitory sensory feedback gains. Conclusions Based on these simulations, symmetrical interlimb coupling can account for much, but not all of the excitatory neural coupling between upper and lower limbs during rhythmic locomotor-like movements. PMID:21143960

  14. Spontaneous Symmetry-Breaking in a Network Model for Quadruped Locomotion

    NASA Astrophysics Data System (ADS)

    Stewart, Ian

    2017-12-01

    Spontaneous symmetry-breaking proves a mechanism for pattern generation in legged locomotion of animals. The basic timing patterns of animal gaits are produced by a network of spinal neurons known as a Central Pattern Generator (CPG). Animal gaits are primarily characterized by phase differences between leg movements in a periodic gait cycle. Many different gaits occur, often having spatial or spatiotemporal symmetries. A natural way to explain gait patterns is to assume that the CPG is symmetric, and to classify the possible symmetry-breaking periodic motions. Pinto and Golubitsky have discussed a four-node model CPG network for biped gaits with ℤ2 × ℤ2 symmetry, classifying the possible periodic states that can arise. A more specific rate model with this structure has been analyzed in detail by Stewart. Here we extend these methods to quadruped gaits, using an eight-node network with ℤ4 × ℤ2 symmetry proposed by Golubitsky and coworkers. We formulate a rate model and calculate how the first steady or Hopf bifurcation depends on its parameters, which represent four connection strengths. The calculations involve a distinction between “real” gaits with one or two phase shifts (pronk, bound, pace, trot) and “complex” gaits with four phase shifts (forward and reverse walk, forward and reverse buck). The former correspond to real eigenvalues of the connection matrix, the latter to complex conjugate pairs. The partition of parameter space according to the first bifurcation, ignoring complex gaits, is described explicitly. The complex gaits introduce further complications, not yet fully understood. All eight gaits can occur as the first bifurcation from a fully synchronous equilibrium, for suitable parameters, and numerical simulations indicate that they can be asymptotically stable.

  15. Survival differences of CIMP subtypes integrated with CNA information in human breast cancer.

    PubMed

    Wang, Huihan; Yan, Weili; Zhang, Shumei; Gu, Yue; Wang, Yihan; Wei, Yanjun; Liu, Hongbo; Wang, Fang; Wu, Qiong; Zhang, Yan

    2017-07-25

    CpG island methylator phenotype of breast cancer is associated with widespread aberrant methylation at specified CpG islands and distinct patient outcomes. However, the influence of copy number contributing to the prognosis of tumors with different CpG island methylator phenotypes is still unclear. We analyzed both genetic (copy number) and epigenetic alterations in 765 breast cancers from The Cancer Genome Atlas data portal and got a panel of 15 biomarkers for copy number and methylation status evaluation. The gene panel identified two groups corresponding to distinct copy number profiles. In status of mere-loss copy number, patients were faced with a greater risk if they presented a higher CpG islands methylation pattern in biomarker panels. But for samples presenting merely-gained copy number, higher methylation level of CpG islands was associated with improved viability. In all, the integration of copy number alteration and methylation information enhanced the classification power on prognosis. Moreover, we found the molecular subtypes of breast cancer presented different distributions in two CpG island methylation phenotypes. Generated by the same set of human methylation 450K data, additional copy number information could provide insights into survival prediction of cancers with less heterogeneity and might help to determine the biomarkers for diagnosis and treatment for breast cancer patients in a more personalized approach.

  16. Survival differences of CIMP subtypes integrated with CNA information in human breast cancer

    PubMed Central

    Wang, Huihan; Yan, Weili; Zhang, Shumei; Gu, Yue; Wang, Yihan; Wei, Yanjun; Liu, Hongbo; Wang, Fang; Wu, Qiong; Zhang, Yan

    2017-01-01

    CpG island methylator phenotype of breast cancer is associated with widespread aberrant methylation at specified CpG islands and distinct patient outcomes. However, the influence of copy number contributing to the prognosis of tumors with different CpG island methylator phenotypes is still unclear. We analyzed both genetic (copy number) and epigenetic alterations in 765 breast cancers from The Cancer Genome Atlas data portal and got a panel of 15 biomarkers for copy number and methylation status evaluation. The gene panel identified two groups corresponding to distinct copy number profiles. In status of mere-loss copy number, patients were faced with a greater risk if they presented a higher CpG islands methylation pattern in biomarker panels. But for samples presenting merely-gained copy number, higher methylation level of CpG islands was associated with improved viability. In all, the integration of copy number alteration and methylation information enhanced the classification power on prognosis. Moreover, we found the molecular subtypes of breast cancer presented different distributions in two CpG island methylation phenotypes. Generated by the same set of human methylation 450K data, additional copy number information could provide insights into survival prediction of cancers with less heterogeneity and might help to determine the biomarkers for diagnosis and treatment for breast cancer patients in a more personalized approach. PMID:28415743

  17. Conserved DNA methylation patterns in healthy blood cells and extensive changes in leukemia measured by a new quantitative technique

    PubMed Central

    Jelinek, Jaroslav; Liang, Shoudan; Lu, Yue; He, Rong; Ramagli, Louis S.; Shpall, Elizabeth J.; Estecio, Marcos R.H.; Issa, Jean-Pierre J.

    2012-01-01

    Genome wide analysis of DNA methylation provides important information in a variety of diseases, including cancer. Here, we describe a simple method, Digital Restriction Enzyme Analysis of Methylation (DREAM), based on next generation sequencing analysis of methylation-specific signatures created by sequential digestion of genomic DNA with SmaI and XmaI enzymes. DREAM provides information on 150,000 unique CpG sites, of which 39,000 are in CpG islands and 30,000 are at transcription start sites of 13,000 RefSeq genes. We analyzed DNA methylation in healthy white blood cells and found methylation patterns to be remarkably uniform. Inter individual differences > 30% were observed only at 227 of 28,331 (0.8%) of autosomal CpG sites. Similarly, > 30% differences were observed at only 59 sites when we comparing the cord and adult blood. These conserved methylation patterns contrasted with extensive changes affecting 18–40% of CpG sites in a patient with acute myeloid leukemia and in two leukemia cell lines. The method is cost effective, quantitative (r2 = 0.93 when compared with bisulfite pyrosequencing) and reproducible (r2 = 0.997). Using 100-fold coverage, DREAM can detect differences in methylation greater than 10% or 30% with a false positive rate below 0.05 or 0.001, respectively. DREAM can be useful in quantifying epigenetic effects of environment and nutrition, correlating developmental epigenetic variation with phenotypes, understanding epigenetics of cancer and chronic diseases, measuring the effects of drugs on DNA methylation or deriving new biological insights into mammalian genomes. PMID:23075513

  18. A DNA methylation fingerprint of 1628 human samples

    PubMed Central

    Fernandez, Agustin F.; Assenov, Yassen; Martin-Subero, Jose Ignacio; Balint, Balazs; Siebert, Reiner; Taniguchi, Hiroaki; Yamamoto, Hiroyuki; Hidalgo, Manuel; Tan, Aik-Choon; Galm, Oliver; Ferrer, Isidre; Sanchez-Cespedes, Montse; Villanueva, Alberto; Carmona, Javier; Sanchez-Mut, Jose V.; Berdasco, Maria; Moreno, Victor; Capella, Gabriel; Monk, David; Ballestar, Esteban; Ropero, Santiago; Martinez, Ramon; Sanchez-Carbayo, Marta; Prosper, Felipe; Agirre, Xabier; Fraga, Mario F.; Graña, Osvaldo; Perez-Jurado, Luis; Mora, Jaume; Puig, Susana; Prat, Jaime; Badimon, Lina; Puca, Annibale A.; Meltzer, Stephen J.; Lengauer, Thomas; Bridgewater, John; Bock, Christoph; Esteller, Manel

    2012-01-01

    Most of the studies characterizing DNA methylation patterns have been restricted to particular genomic loci in a limited number of human samples and pathological conditions. Herein, we present a compromise between an extremely comprehensive study of a human sample population with an intermediate level of resolution of CpGs at the genomic level. We obtained a DNA methylation fingerprint of 1628 human samples in which we interrogated 1505 CpG sites. The DNA methylation patterns revealed show this epigenetic mark to be critical in tissue-type definition and stemness, particularly around transcription start sites that are not within a CpG island. For disease, the generated DNA methylation fingerprints show that, during tumorigenesis, human cancer cells underwent a progressive gain of promoter CpG-island hypermethylation and a loss of CpG methylation in non-CpG-island promoters. Although transformed cells are those in which DNA methylation disruption is more obvious, we observed that other common human diseases, such as neurological and autoimmune disorders, had their own distinct DNA methylation profiles. Most importantly, we provide proof of principle that the DNA methylation fingerprints obtained might be useful for translational purposes by showing that we are able to identify the tumor type origin of cancers of unknown primary origin (CUPs). Thus, the DNA methylation patterns identified across the largest spectrum of samples, tissues, and diseases reported to date constitute a baseline for developing higher-resolution DNA methylation maps and provide important clues concerning the contribution of CpG methylation to tissue identity and its changes in the most prevalent human diseases. PMID:21613409

  19. Association of the CpG Methylation Pattern of the Proximal Insulin Gene Promoter with Type 1 Diabetes

    PubMed Central

    Fradin, Delphine; Le Fur, Sophie; Mille, Clémence; Naoui, Nadia; Groves, Chris; Zelenika, Diana; McCarthy, Mark I.; Lathrop, Mark; Bougnères, Pierre

    2012-01-01

    The insulin (INS) region is the second most important locus associated with Type 1 Diabetes (T1D). The study of the DNA methylation pattern of the 7 CpGs proximal to the TSS in the INS gene promoter revealed that T1D patients have a lower level of methylation of CpG -19, -135 and -234 (p = 2.10−16) and a higher methylation of CpG -180 than controls, while methylation was comparable for CpG -69, -102, -206. The magnitude of the hypomethylation relative to a control population was 8–15% of the corresponding levels in controls and was correlated in CpGs -19 and -135 (r = 0.77) and CpG -135 and -234 (r = 0.65). 70/485 (14%) of T1D patients had a simultaneous decrease in methylation of CpG -19, -135, -234 versus none in 317 controls. CpG methylation did not correlate with glycated hemoglobin or with T1D duration. The methylation of CpG -69, -102, -180, -206, but not CpG -19, -135, -234 was strongly influenced by the cis-genotype at rs689, a SNP known to show a strong association with T1D. We hypothesize that part of this genetic association could in fact be mediated at the statistical and functional level by the underlying changes in neighboring CpG methylation. Our observation of a CpG-specific, locus-specific methylation pattern, although it can provide an epigenetic biomarker of a multifactorial disease, does not indicate whether the reported epigenetic pattern preexists or follows the establishment of T1D. To explore the effect of chronic hyperglycemia on CpG methylation, we studied non obese patients with type 2 diabetes (T2D) who were found to have decreased CpG-19 methylation versus age-matched controls, similar to T1D (p = 2.10−6) but increased CpG-234 methylation (p = 5.10−8), the opposite of T1D. The causality and natural history of the different epigenetic changes associated with T1D or T2D remain to be determined. PMID:22567146

  20. An Integrative, Multi-Scale Computational Model of a Swimming Lamprey Fully Coupled to Its Fluid Environment and Incorporating Proprioceptive Feedback

    NASA Astrophysics Data System (ADS)

    Hamlet, C. L.; Hoffman, K.; Fauci, L.; Tytell, E.

    2016-02-01

    The lamprey is a model organism for both neurophysiology and locomotion studies. To study the role of sensory feedback as an organism moves through its environment, a 2D, integrative, multi-scale model of an anguilliform swimmer driven by neural activation from a central pattern generator (CPG) is constructed. The CPG in turn drives muscle kinematics and is fully coupled to the surrounding fluid. The system is numerically evolved in time using an immersed boundary framework producing an emergent swimming mode. Proprioceptive feedback to the CPG based on experimental observations adjust the activation signal as the organism interacts with its environment. Effects on the speed, stability and cost (metabolic work) of swimming due to nonlinear dependencies associated with muscle force development combined with proprioceptive feedback to neural activation are estimated and examined.

  1. Using an Artificial Neural Bypass to Restore Cortical Control of Rhythmic Movements in a Human with Quadriplegia

    NASA Astrophysics Data System (ADS)

    Sharma, Gaurav; Friedenberg, David A.; Annetta, Nicholas; Glenn, Bradley; Bockbrader, Marcie; Majstorovic, Connor; Domas, Stephanie; Mysiw, W. Jerry; Rezai, Ali; Bouton, Chad

    2016-09-01

    Neuroprosthetic technology has been used to restore cortical control of discrete (non-rhythmic) hand movements in a paralyzed person. However, cortical control of rhythmic movements which originate in the brain but are coordinated by Central Pattern Generator (CPG) neural networks in the spinal cord has not been demonstrated previously. Here we show a demonstration of an artificial neural bypass technology that decodes cortical activity and emulates spinal cord CPG function allowing volitional rhythmic hand movement. The technology uses a combination of signals recorded from the brain, machine-learning algorithms to decode the signals, a numerical model of CPG network, and a neuromuscular electrical stimulation system to evoke rhythmic movements. Using the neural bypass, a quadriplegic participant was able to initiate, sustain, and switch between rhythmic and discrete finger movements, using his thoughts alone. These results have implications in advancing neuroprosthetic technology to restore complex movements in people living with paralysis.

  2. Mapping the zebrafish brain methylome using reduced representation bisulfite sequencing

    PubMed Central

    Chatterjee, Aniruddha; Ozaki, Yuichi; Stockwell, Peter A; Horsfield, Julia A; Morison, Ian M; Nakagawa, Shinichi

    2013-01-01

    Reduced representation bisulfite sequencing (RRBS) has been used to profile DNA methylation patterns in mammalian genomes such as human, mouse and rat. The methylome of the zebrafish, an important animal model, has not yet been characterized at base-pair resolution using RRBS. Therefore, we evaluated the technique of RRBS in this model organism by generating four single-nucleotide resolution DNA methylomes of adult zebrafish brain. We performed several simulations to show the distribution of fragments and enrichment of CpGs in different in silico reduced representation genomes of zebrafish. Four RRBS brain libraries generated 98 million sequenced reads and had higher frequencies of multiple mapping than equivalent human RRBS libraries. The zebrafish methylome indicates there is higher global DNA methylation in the zebrafish genome compared with its equivalent human methylome. This observation was confirmed by RRBS of zebrafish liver. High coverage CpG dinucleotides are enriched in CpG island shores more than in the CpG island core. We found that 45% of the mapped CpGs reside in gene bodies, and 7% in gene promoters. This analysis provides a roadmap for generating reproducible base-pair level methylomes for zebrafish using RRBS and our results provide the first evidence that RRBS is a suitable technique for global methylation analysis in zebrafish. PMID:23975027

  3. Functional characterization of dI6 interneurons in the neonatal mouse spinal cord.

    PubMed

    Dyck, Jason; Lanuza, Guillermo M; Gosgnach, Simon

    2012-06-01

    Our understanding of the neural control of locomotion has been greatly enhanced by the ability to identify and manipulate genetically defined populations of interneurons that comprise the locomotor central pattern generator (CPG). To date, the dI6 interneurons are one of the few populations that settle in the ventral region of the postnatal spinal cord that have not been investigated. In the present study, we utilized a novel transgenic mouse line to electrophysiologically characterize dI6 interneurons located close to the central canal and study their function during fictive locomotion. The majority of dI6 cells investigated were found to be rhythmically active during fictive locomotion and could be divided into two electrophysiologically distinct populations of interneurons. The first population fired rhythmic trains of action potentials that were loosely coupled to ventral root output and contained several intrinsic membrane properties of rhythm-generating neurons, raising the possibility that these cells may be involved in the generation of rhythmic activity in the locomotor CPG. The second population fired rhythmic trains of action potentials that were tightly coupled to ventral root output and lacked intrinsic oscillatory mechanisms, indicating that these neurons may be driven by a rhythm-generating network. Together these results indicate that dI6 neurons comprise an important component of the locomotor CPG that participate in multiple facets of motor behavior.

  4. Functional characterization of dI6 interneurons in the neonatal mouse spinal cord

    PubMed Central

    Dyck, Jason; Lanuza, Guillermo M.

    2012-01-01

    Our understanding of the neural control of locomotion has been greatly enhanced by the ability to identify and manipulate genetically defined populations of interneurons that comprise the locomotor central pattern generator (CPG). To date, the dI6 interneurons are one of the few populations that settle in the ventral region of the postnatal spinal cord that have not been investigated. In the present study, we utilized a novel transgenic mouse line to electrophysiologically characterize dI6 interneurons located close to the central canal and study their function during fictive locomotion. The majority of dI6 cells investigated were found to be rhythmically active during fictive locomotion and could be divided into two electrophysiologically distinct populations of interneurons. The first population fired rhythmic trains of action potentials that were loosely coupled to ventral root output and contained several intrinsic membrane properties of rhythm-generating neurons, raising the possibility that these cells may be involved in the generation of rhythmic activity in the locomotor CPG. The second population fired rhythmic trains of action potentials that were tightly coupled to ventral root output and lacked intrinsic oscillatory mechanisms, indicating that these neurons may be driven by a rhythm-generating network. Together these results indicate that dI6 neurons comprise an important component of the locomotor CPG that participate in multiple facets of motor behavior. PMID:22442567

  5. Activation of Central Pattern Generator for Respiration Following Complete High Cervical Spinal Cord Interruption

    DTIC Science & Technology

    2016-09-01

    suppression of the respiratory CPG in both intact and post-injury (high cervical transection) conditions. Adhering to the experiments outlined in our SOW...spinal respiratory neurons (cervical C3-C5 and C1-C2 levels) were characterized by their location, pattern (via extra- and intracellular recordings...Marchenko, 2016). These ‘spinal bursts’ were not phase-locked to the supraspinal (ponto-medullary) respiratory rhythm. We recorded spinal interneurons

  6. Predicting aberrant CpG island methylation

    PubMed Central

    Feltus, F. A.; Lee, E. K.; Costello, J. F.; Plass, C.; Vertino, P. M.

    2003-01-01

    Epigenetic silencing associated with aberrant methylation of promoter region CpG islands is one mechanism leading to loss of tumor suppressor function in human cancer. Profiling of CpG island methylation indicates that some genes are more frequently methylated than others, and that each tumor type is associated with a unique set of methylated genes. However, little is known about why certain genes succumb to this aberrant event. To address this question, we used Restriction Landmark Genome Scanning to analyze the susceptibility of 1,749 unselected CpG islands to de novo methylation driven by overexpression of DNA cytosine-5-methyltransferase 1 (DNMT1). We found that although the overall incidence of CpG island methylation was increased in cells overexpressing DNMT1, not all loci were equally affected. The majority of CpG islands (69.9%) were resistant to de novo methylation, regardless of DNMT1 overexpression. In contrast, we identified a subset of methylation-prone CpG islands (3.8%) that were consistently hypermethylated in multiple DNMT1 overexpressing clones. Methylation-prone and methylation-resistant CpG islands were not significantly different with respect to size, C+G content, CpG frequency, chromosomal location, or promoter association. We used DNA pattern recognition and supervised learning techniques to derive a classification function based on the frequency of seven novel sequence patterns that was capable of discriminating methylation-prone from methylation-resistant CpG islands with 82% accuracy. The data indicate that CpG islands differ in their intrinsic susceptibility to de novo methylation, and suggest that the propensity for a CpG island to become aberrantly methylated can be predicted based on its sequence context. PMID:14519846

  7. Predicting aberrant CpG island methylation.

    PubMed

    Feltus, F A; Lee, E K; Costello, J F; Plass, C; Vertino, P M

    2003-10-14

    Epigenetic silencing associated with aberrant methylation of promoter region CpG islands is one mechanism leading to loss of tumor suppressor function in human cancer. Profiling of CpG island methylation indicates that some genes are more frequently methylated than others, and that each tumor type is associated with a unique set of methylated genes. However, little is known about why certain genes succumb to this aberrant event. To address this question, we used Restriction Landmark Genome Scanning to analyze the susceptibility of 1,749 unselected CpG islands to de novo methylation driven by overexpression of DNA cytosine-5-methyltransferase 1 (DNMT1). We found that although the overall incidence of CpG island methylation was increased in cells overexpressing DNMT1, not all loci were equally affected. The majority of CpG islands (69.9%) were resistant to de novo methylation, regardless of DNMT1 overexpression. In contrast, we identified a subset of methylation-prone CpG islands (3.8%) that were consistently hypermethylated in multiple DNMT1 overexpressing clones. Methylation-prone and methylation-resistant CpG islands were not significantly different with respect to size, C+G content, CpG frequency, chromosomal location, or promoter association. We used DNA pattern recognition and supervised learning techniques to derive a classification function based on the frequency of seven novel sequence patterns that was capable of discriminating methylation-prone from methylation-resistant CpG islands with 82% accuracy. The data indicate that CpG islands differ in their intrinsic susceptibility to de novo methylation, and suggest that the propensity for a CpG island to become aberrantly methylated can be predicted based on its sequence context.

  8. Liposomal SLA co-incorporated with PO CpG ODNs or PS CpG ODNs induce the same protection against the murine model of leishmaniasis.

    PubMed

    Shargh, Vahid Heravi; Jaafari, Mahmoud Reza; Khamesipour, Ali; Jaafari, Iman; Jalali, Seyed Amir; Abbasi, Azam; Badiee, Ali

    2012-06-06

    First generation Leishmania vaccines consisting of whole killed parasites with or without adjuvants have reached phase 3 trial and failed to show enough efficacy mainly due to the lack of an appropriate adjuvant. In this study, the nuclease-resistant phosphorothioate CpG oligodeoxynucleotides (PS CpG) or nuclease-sensitive phosphodiester CpG ODNs (PO CpG) were used as adjuvants to enhance immunogenicity and rate of protection against leishmaniasis. Due to the susceptibility of PO CpG to nuclease degradation, an efficient liposomal delivery system was developed to protect them from degradation. 1, 2-dioleoyl-3-trimethylammonium-propane (DOTAP) as a cationic lipid was used because of its unique adjuvanticity and electrostatic interaction with negatively charged CpG ODNs. To evaluate the role of liposomal formulation in protection rate and enhanced immune response, BALB/c mice were immunized subcutaneously with liposomal soluble Leishmania antigens (SLA) co-incorporated with PO CpG (Lip-SLA-PO CpG), Lip-SLA-PS CpG, SLA+PO CpG, SLA+PS CpG, SLA or buffer. As criteria for protection, footpad swelling at the site of challenge, parasite loads, the levels of IFN-γ and IL-4, and the IgG subtypes were evaluated. The groups of mice receiving Lip-SLA-PO CpG or Lip-SLA-PS CpG showed a high protection rate compared with the control groups. In addition, there was no significant difference in immune response generation between mice immunized with PS CpG and the group receiving PO CpG when incorporated into the liposomes. The results suggested that liposomal form of PO CpG might be used instead of PS CpG in future vaccine formulations as an efficient adjuvant. Copyright © 2012 Elsevier Ltd. All rights reserved.

  9. CpG Dinucleotide Frequencies Reveal the Role of Host Methylation Capabilities in Parvovirus Evolution

    PubMed Central

    Upadhyay, Mohita; Samal, Jasmine; Kandpal, Manish; Vasaikar, Suhas; Biswas, Banhi; Gomes, James

    2013-01-01

    Parvoviruses are rapidly evolving viruses that infect a wide range of hosts, including vertebrates and invertebrates. Extensive methylation of the parvovirus genome has been recently demonstrated. A global pattern of methylation of CpG dinucleotides is seen in vertebrate genomes, compared to “fractional” methylation patterns in invertebrate genomes. It remains unknown if the loss of CpG dinucleotides occurs in all viruses of a given DNA virus family that infect host species spanning across vertebrates and invertebrates. We investigated the link between the extent of CpG dinucleotide depletion among autonomous parvoviruses and the evolutionary lineage of the infected host. We demonstrate major differences in the relative abundance of CpG dinucleotides among autonomous parvoviruses which share similar genome organization and common ancestry, depending on the infected host species. Parvoviruses infecting vertebrate hosts had significantly lower relative abundance of CpG dinucleotides than parvoviruses infecting invertebrate hosts. The strong correlation of CpG dinucleotide depletion with the gain in TpG/CpA dinucleotides and the loss of TpA dinucleotides among parvoviruses suggests a major role for CpG methylation in the evolution of parvoviruses. Our data present evidence that links the relative abundance of CpG dinucleotides in parvoviruses to the methylation capabilities of the infected host. In sum, our findings support a novel perspective of host-driven evolution among autonomous parvoviruses. PMID:24109231

  10. CpG dinucleotide frequencies reveal the role of host methylation capabilities in parvovirus evolution.

    PubMed

    Upadhyay, Mohita; Samal, Jasmine; Kandpal, Manish; Vasaikar, Suhas; Biswas, Banhi; Gomes, James; Vivekanandan, Perumal

    2013-12-01

    Parvoviruses are rapidly evolving viruses that infect a wide range of hosts, including vertebrates and invertebrates. Extensive methylation of the parvovirus genome has been recently demonstrated. A global pattern of methylation of CpG dinucleotides is seen in vertebrate genomes, compared to "fractional" methylation patterns in invertebrate genomes. It remains unknown if the loss of CpG dinucleotides occurs in all viruses of a given DNA virus family that infect host species spanning across vertebrates and invertebrates. We investigated the link between the extent of CpG dinucleotide depletion among autonomous parvoviruses and the evolutionary lineage of the infected host. We demonstrate major differences in the relative abundance of CpG dinucleotides among autonomous parvoviruses which share similar genome organization and common ancestry, depending on the infected host species. Parvoviruses infecting vertebrate hosts had significantly lower relative abundance of CpG dinucleotides than parvoviruses infecting invertebrate hosts. The strong correlation of CpG dinucleotide depletion with the gain in TpG/CpA dinucleotides and the loss of TpA dinucleotides among parvoviruses suggests a major role for CpG methylation in the evolution of parvoviruses. Our data present evidence that links the relative abundance of CpG dinucleotides in parvoviruses to the methylation capabilities of the infected host. In sum, our findings support a novel perspective of host-driven evolution among autonomous parvoviruses.

  11. Association of Tissue-Specific DNA Methylation Alterations with α-Thalassemia Southeast Asian Deletion

    PubMed Central

    Pangeson, Tanapat; Sanguansermsri, Phanchana; Sanguansermsri, Torpong; Seeratanachot, Teerapat; Suwanakhon, Narutchala; Srikummool, Metawee; Kaewkong, Worasak; Mahingsa, Khwanruedee

    2017-01-01

    In the wild-type allele, DNA methylation levels of 10 consecutive CpG sites adjacent to the upstream 5′-breakpoint of α-thalassemia Southeast Asian (SEA) deletion are not different between placenta and leukocytes. However, no previous study has reported the map of DNA methylation in the SEA allele. This report aims to show that the SEA mutation is associated with DNA methylation changes, resulting in differential methylation between placenta and leukocytes. Methylation-sensitive high-resolution analysis was used to compare DNA methylation among placenta, leukocytes, and unmethylated control DNA. The result indicates that the DNA methylation between placenta and leukocyte DNA is different and shows that the CpG status of both is not fully unmethylated. Mapping of individual CpG sites was performed by targeted bisulfite sequencing. The DNA methylation level of the 10 consecutive CpG sites was different between placenta and leukocyte DNA. When the 10th CpG of the mutation allele was considered as a hallmark for comparing DNA methylation level, it was totally different from the unmethylated 10th CpG of the wild-type allele. Finally, the distinct DNA methylation patterns between both DNA were extracted. In total, 24 patterns were found in leukocyte samples and 9 patterns were found in placenta samples. This report shows that the large deletion is associated with DNA methylation change. In further studies for clinical application, the distinct DNA methylation pattern might be a potential marker for detecting cell-free fetal DNA. PMID:29162979

  12. A physical model of sensorimotor interactions during locomotion

    NASA Astrophysics Data System (ADS)

    Klein, Theresa J.; Lewis, M. Anthony

    2012-08-01

    In this paper, we describe the development of a bipedal robot that models the neuromuscular architecture of human walking. The body is based on principles derived from human muscular architecture, using muscles on straps to mimic agonist/antagonist muscle action as well as bifunctional muscles. Load sensors in the straps model Golgi tendon organs. The neural architecture is a central pattern generator (CPG) composed of a half-center oscillator combined with phase-modulated reflexes that is simulated using a spiking neural network. We show that the interaction between the reflex system, body dynamics and CPG results in a walking cycle that is entrained to the dynamics of the system. We also show that the CPG helped stabilize the gait against perturbations relative to a purely reflexive system, and compared the joint trajectories to human walking data. This robot represents a complete physical, or ‘neurorobotic’, model of the system, demonstrating the usefulness of this type of robotics research for investigating the neurophysiological processes underlying walking in humans and animals.

  13. Using an Artificial Neural Bypass to Restore Cortical Control of Rhythmic Movements in a Human with Quadriplegia

    PubMed Central

    Sharma, Gaurav; Friedenberg, David A.; Annetta, Nicholas; Glenn, Bradley; Bockbrader, Marcie; Majstorovic, Connor; Domas, Stephanie; Mysiw, W. Jerry; Rezai, Ali; Bouton, Chad

    2016-01-01

    Neuroprosthetic technology has been used to restore cortical control of discrete (non-rhythmic) hand movements in a paralyzed person. However, cortical control of rhythmic movements which originate in the brain but are coordinated by Central Pattern Generator (CPG) neural networks in the spinal cord has not been demonstrated previously. Here we show a demonstration of an artificial neural bypass technology that decodes cortical activity and emulates spinal cord CPG function allowing volitional rhythmic hand movement. The technology uses a combination of signals recorded from the brain, machine-learning algorithms to decode the signals, a numerical model of CPG network, and a neuromuscular electrical stimulation system to evoke rhythmic movements. Using the neural bypass, a quadriplegic participant was able to initiate, sustain, and switch between rhythmic and discrete finger movements, using his thoughts alone. These results have implications in advancing neuroprosthetic technology to restore complex movements in people living with paralysis. PMID:27658585

  14. Synthetic orocutaneous stimulation entrains preterm infants with feeding difficulties to suck

    PubMed Central

    Barlow, SM; Finan, DS; Lee, J; Chu, S

    2013-01-01

    Background Prematurity can disrupt the development of a specialized neural circuit known as suck central pattern generator (sCPG), which often leads to poor feeding skills. The extent to which suck can be entrained using a synthetically patterned orocutaneous input to promote its development in preterm infants who lack a functional suck is unknown. Objective To evaluate the effects of a new motorized ‘pulsating’ pacifier capable of entraining the sCPG in tube-fed premature infants who lack a functional suck and exhibit feeding disorders. Methods Prospective cohort study of 31 preterm infants assigned to either the oral patterned entrainment intervention (study) or non-treated (controls) group, matched by gestational age, birth weight, oxygen supplementation history, and oral feed status. Study infants received a daily regimen of orocutaneous pulse trains through a pneumatically-controlled silicone pacifier concurrent with gavage feeds. Results The patterned orocutaneous stimulus was highly effective in accelerating the development of NNS in preterm infants. A repeated-measure multivariate analysis of covariance revealed significant increases in minute-rates for total oral compressions, NNS bursts, and NNS cycles, suck cycles per burst, and the ratiometric measure of NNS cycles as a percentage of total ororhythmic output. Moreover, study infants also manifest significantly greater success at achieving oral feeds, surpassing their control counterparts by a factor of 3.1× (72.8% daily oral feed versus 23.3% daily oral feed, respectively). Conclusion Functional expression of the sCPG among preterm infants who lack an organized suck can be induced through the delivery of synthetically patterned orocutaneous pulse trains. The rapid emergence of NNS in treated infants is accompanied by a significant increase in the proportion of nutrient taken orally. PMID:18548084

  15. Promoter methylation assay of SASH1 gene in hepatocellular carcinoma.

    PubMed

    Peng, Liu; Wei, He; Liren, Li

    2014-01-01

    To analyse the relationship between the expression of SASH1 and its methylation level in human hepatocellular carcinoma. Expression levels of SASH1 were examined with real-time PCR (RT-PCR) in tissues and cells, and methylation analysis was performed with MassArray. The expression levels of SASH1 were strongly reduced in liver cancer tissues compared with adjacent normal tissues. Quantitative methylation analysis by MassArray revealed different CpG sites in SASH1 promoter shared similar methylation pattern between liver cancer tissues and adjacent normal tissues and the CpG sites of significant difference in methylation level were found as follows: CpG_3, CpG_17, CpG_21.22, CpG_25, CpG_26.27, CpG_28, CpG_34.35.36 and CpG_51.52. Moreover, 5-aza-2'-deoxycytidine treatment of Hep-G2 cell line caused significant elevation of SASH1 mRNA. Based on these data, we propose that increase of DNA methylation degree in the promoter region of SASH1 gene, particularly CpG_26.27 sites, possibly repressed SASH1 expression in liver cancer.

  16. Discovering high-resolution patterns of differential DNA methylation that correlate with gene expression changes

    PubMed Central

    VanderKraats, Nathan D.; Hiken, Jeffrey F.; Decker, Keith F.; Edwards, John R.

    2013-01-01

    Methylation of the CpG-rich region (CpG island) overlapping a gene’s promoter is a generally accepted mechanism for silencing expression. While recent technological advances have enabled measurement of DNA methylation and expression changes genome-wide, only modest correlations between differential methylation at gene promoters and expression have been found. We hypothesize that stronger associations are not observed because existing analysis methods oversimplify their representation of the data and do not capture the diversity of existing methylation patterns. Recently, other patterns such as CpG island shore methylation and long partially hypomethylated domains have also been linked with gene silencing. Here, we detail a new approach for discovering differential methylation patterns associated with expression change using genome-wide high-resolution methylation data: we represent differential methylation as an interpolated curve, or signature, and then identify groups of genes with similarly shaped signatures and corresponding expression changes. Our technique uncovers a diverse set of patterns that are conserved across embryonic stem cell and cancer data sets. Overall, we find strong associations between these methylation patterns and expression. We further show that an extension of our method also outperforms other approaches by generating a longer list of genes with higher quality associations between differential methylation and expression. PMID:23748561

  17. The Network Spinal Wave as a Central Pattern Generator.

    PubMed

    Senzon, Simon A; Epstein, Donald M; Lemberger, Daniel

    2016-07-01

    This article explains the research on a unique spinal wave visibly observed in association with network spinal analysis care. Since 1997, the network wave has been studied using surface electromyography (sEMG), characterized mathematically, and determined to be a unique and repeatable phenomenon. The authors provide a narrative review of the research and a context for the network wave's development. The sEMG research demonstrates that the movement of the musculature of the spine during the wave phenomenon is electromagnetic and mechanical. The changes running along the spine were characterized mathematically at three distinct levels of care. Additionally, the wave has the mathematical properties of a central pattern generator (CPG). The network wave may be the first CPG discovered in the spine unrelated to locomotion. The mathematical characterization of the signal also demonstrates coherence at a distance between the sacral to cervical spine. According to mathematical engineers, based on studies conducted a decade apart, the wave itself is a robust phenomenon and the detection methods for this coherence may represent a new measure for central nervous system health. This phenomenon has implications for recovery from spinal cord injury and for reorganizational healing development.

  18. The Network Spinal Wave as a Central Pattern Generator

    PubMed Central

    Epstein, Donald M.; Lemberger, Daniel

    2016-01-01

    Abstract Objectives: This article explains the research on a unique spinal wave visibly observed in association with network spinal analysis care. Since 1997, the network wave has been studied using surface electromyography (sEMG), characterized mathematically, and determined to be a unique and repeatable phenomenon. Methods: The authors provide a narrative review of the research and a context for the network wave's development. Results: The sEMG research demonstrates that the movement of the musculature of the spine during the wave phenomenon is electromagnetic and mechanical. The changes running along the spine were characterized mathematically at three distinct levels of care. Additionally, the wave has the mathematical properties of a central pattern generator (CPG). Conclusions: The network wave may be the first CPG discovered in the spine unrelated to locomotion. The mathematical characterization of the signal also demonstrates coherence at a distance between the sacral to cervical spine. According to mathematical engineers, based on studies conducted a decade apart, the wave itself is a robust phenomenon and the detection methods for this coherence may represent a new measure for central nervous system health. This phenomenon has implications for recovery from spinal cord injury and for reorganizational healing development. PMID:27243963

  19. New insights into sucking, swallowing and breathing central generators: A complexity analysis of rhythmic motor behaviors.

    PubMed

    Samson, Nathalie; Praud, Jean-Paul; Quenet, Brigitte; Similowski, Thomas; Straus, Christian

    2017-01-18

    Sucking, swallowing and breathing are dynamic motor behaviors. Breathing displays features of chaos-like dynamics, in particular nonlinearity and complexity, which take their source in the automatic command of breathing. In contrast, buccal/gill ventilation in amphibians is one of the rare motor behaviors that do not display nonlinear complexity. This study aimed at assessing whether sucking and swallowing would also follow nonlinear complex dynamics in the newborn lamb. Breathing movements were recorded before, during and after bottle-feeding. Sucking pressure and the integrated EMG of the thyroartenoid muscle, as an index of swallowing, were recorded during bottle-feeding. Nonlinear complexity of the whole signals was assessed through the calculation of the noise limit value (NL). Breathing and swallowing always exhibited chaos-like dynamics. The NL of breathing did not change significantly before, during or after bottle-feeding. On the other hand, sucking inconsistently and significantly less frequently than breathing exhibited a chaos-like dynamics. Therefore, the central pattern generator (CPG) that drives sucking may be functionally different from the breathing CPG. Furthermore, the analogy between buccal/gill ventilation and sucking suggests that the latter may take its phylogenetic origin in the gill ventilation CPG of the common ancestor of extant amphibians and mammals. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  20. Feed forward and feedback control for over-ground locomotion in anaesthetized cats

    NASA Astrophysics Data System (ADS)

    Mazurek, K. A.; Holinski, B. J.; Everaert, D. G.; Stein, R. B.; Etienne-Cummings, R.; Mushahwar, V. K.

    2012-04-01

    The biological central pattern generator (CPG) integrates open and closed loop control to produce over-ground walking. The goal of this study was to develop a physiologically based algorithm capable of mimicking the biological system to control multiple joints in the lower extremities for producing over-ground walking. The algorithm used state-based models of the step cycle each of which produced different stimulation patterns. Two configurations were implemented to restore over-ground walking in five adult anaesthetized cats using intramuscular stimulation (IMS) of the main hip, knee and ankle flexor and extensor muscles in the hind limbs. An open loop controller relied only on intrinsic timing while a hybrid-CPG controller added sensory feedback from force plates (representing limb loading), and accelerometers and gyroscopes (representing limb position). Stimulation applied to hind limb muscles caused extension or flexion in the hips, knees and ankles. A total of 113 walking trials were obtained across all experiments. Of these, 74 were successful in which the cats traversed 75% of the 3.5 m over-ground walkway. In these trials, the average peak step length decreased from 24.9 ± 8.4 to 21.8 ± 7.5 (normalized units) and the median number of steps per trial increased from 7 (Q1 = 6, Q3 = 9) to 9 (8, 11) with the hybrid-CPG controller. Moreover, within these trials, the hybrid-CPG controller produced more successful steps (step length ≤ 20 cm ground reaction force ≥ 12.5% body weight) than the open loop controller: 372 of 544 steps (68%) versus 65 of 134 steps (49%), respectively. This supports our previous preliminary findings, and affirms that physiologically based hybrid-CPG approaches produce more successful stepping than open loop controllers. The algorithm provides the foundation for a neural prosthetic controller and a framework to implement more detailed control of locomotion in the future.

  1. Feed forward and feedback control for over-ground locomotion in anaesthetized cats

    PubMed Central

    Mazurek, K A; Holinski, B J; Everaert, D G; Stein, R B; Etienne-Cummings, R; Mushahwar, V K

    2012-01-01

    The biological central pattern generator (CPG) integrates open and closed loop control to produce over-ground walking. The goal of this study was to develop a physiologically based algorithm capable of mimicking the biological system to control multiple joints in the lower extremities for producing over-ground walking. The algorithm used state-based models of the step cycle each of which produced different stimulation patterns. Two configurations were implemented to restore over-ground walking in five adult anaesthetized cats using intramuscular stimulation (IMS) of the main hip, knee and ankle flexor and extensor muscles in the hind limbs. An open loop controller relied only on intrinsic timing while a hybrid-CPG controller added sensory feedback from force plates (representing limb loading), and accelerometers and gyroscopes (representing limb position). Stimulation applied to hind limb muscles caused extension or flexion in the hips, knees and ankles. A total of 113 walking trials were obtained across all experiments. Of these, 74 were successful in which the cats traversed 75% of the 3.5 m over-ground walkway. In these trials, the average peak step length decreased from 24.9 ± 8.4 to 21.8 ± 7.5 (normalized units) and the median number of steps per trial increased from 7 (Q1=6, Q3 = 9) to 9 (8, 11) with the hybrid-CPG controller. Moreover, these trials, the hybrid-CPG controller produced more successful steps (step length ≤ 20 cm; ground reaction force ≥ 12.5% body weight) than the open loop controller: 372 of 544 steps (68%) versus 65 of 134 steps (49%), respectively. This supports our previous preliminary findings, and affirms that physiologically based hybrid-CPG approaches produce more successful stepping than open loop controllers. The algorithm provides the foundation for a neural prosthetic controller and a framework to implement more detailed control of locomotion in the future. PMID:22328615

  2. Changes in the activity of a CpG neuron after the reinforcement of an operantly conditioned behavior in Lymnaea.

    PubMed

    Spencer, Gaynor E; Kazmi, Mustapha H; Syed, Naweed I; Lukowiak, Ken

    2002-10-01

    We have previously shown that the aerial respiratory behavior of the mollusk Lymnaea stagnalis can be operantly conditioned, and the central pattern generating (CPG) neurons underlying this behavior have been identified. As neural correlates of operant conditioning remain poorly defined in both vertebrates and invertebrates, we have used the Lymnaea respiratory CPG to investigate neuronal changes associated with the change in behavior after conditioning. After operant conditioning of the intact animals, semi-intact preparations were dissected, so that changes in the respiratory behavior (pneumostome openings) and underlying activity of the identified CPG neuron, right pedal dorsal 1 (RPeD1), could be monitored simultaneously. RPeD1 was studied because it initiates the rhythmic activity of the CPG and receives chemo-sensory input from the pneumostome area. Pneumostome openings and RPeD1 activity were monitored both before and after a reinforcing training stimulus applied to the open pneumostome of operantly conditioned and yoked control preparations. After presentation of the reinforcing stimulus, there was a significant reduction in both breathing behavior and RPeD1 activity in operant preparations but not in yoked and naïve controls. Furthermore these changes were only significant in the subgroup of operantly conditioned animals described as good learners and not in poor learners. These data strongly suggest that changes in RPeD1 activity may underlie the behavioral changes associated with the reinforcement of operant conditioning of the respiratory behavior.

  3. Humanoids Learning to Walk: A Natural CPG-Actor-Critic Architecture.

    PubMed

    Li, Cai; Lowe, Robert; Ziemke, Tom

    2013-01-01

    The identification of learning mechanisms for locomotion has been the subject of much research for some time but many challenges remain. Dynamic systems theory (DST) offers a novel approach to humanoid learning through environmental interaction. Reinforcement learning (RL) has offered a promising method to adaptively link the dynamic system to the environment it interacts with via a reward-based value system. In this paper, we propose a model that integrates the above perspectives and applies it to the case of a humanoid (NAO) robot learning to walk the ability of which emerges from its value-based interaction with the environment. In the model, a simplified central pattern generator (CPG) architecture inspired by neuroscientific research and DST is integrated with an actor-critic approach to RL (cpg-actor-critic). In the cpg-actor-critic architecture, least-square-temporal-difference based learning converges to the optimal solution quickly by using natural gradient learning and balancing exploration and exploitation. Futhermore, rather than using a traditional (designer-specified) reward it uses a dynamic value function as a stability indicator that adapts to the environment. The results obtained are analyzed using a novel DST-based embodied cognition approach. Learning to walk, from this perspective, is a process of integrating levels of sensorimotor activity and value.

  4. Humanoids Learning to Walk: A Natural CPG-Actor-Critic Architecture

    PubMed Central

    Li, Cai; Lowe, Robert; Ziemke, Tom

    2013-01-01

    The identification of learning mechanisms for locomotion has been the subject of much research for some time but many challenges remain. Dynamic systems theory (DST) offers a novel approach to humanoid learning through environmental interaction. Reinforcement learning (RL) has offered a promising method to adaptively link the dynamic system to the environment it interacts with via a reward-based value system. In this paper, we propose a model that integrates the above perspectives and applies it to the case of a humanoid (NAO) robot learning to walk the ability of which emerges from its value-based interaction with the environment. In the model, a simplified central pattern generator (CPG) architecture inspired by neuroscientific research and DST is integrated with an actor-critic approach to RL (cpg-actor-critic). In the cpg-actor-critic architecture, least-square-temporal-difference based learning converges to the optimal solution quickly by using natural gradient learning and balancing exploration and exploitation. Futhermore, rather than using a traditional (designer-specified) reward it uses a dynamic value function as a stability indicator that adapts to the environment. The results obtained are analyzed using a novel DST-based embodied cognition approach. Learning to walk, from this perspective, is a process of integrating levels of sensorimotor activity and value. PMID:23675345

  5. Collaborations between CpG sites in DNA methylation

    NASA Astrophysics Data System (ADS)

    Song, You; Ren, Honglei; Lei, Jinzhi

    2017-08-01

    DNA methylation patterns have profound impacts on genome stability, gene expression and development. The molecular base of DNA methylation patterns has long been focused at single CpG sites level. Here, we construct a kinetic model of DNA methylation with collaborations between CpG sites, from which a correlation function was established based on experimental data. The function consists of three parts that suggest three possible sources of the correlation: movement of enzymes along DNA, collaboration between DNA methylation and nucleosome modification, and global enzyme concentrations within a cell. Moreover, the collaboration strength between DNA methylation and nucleosome modification is universal for mouse early embryo cells. The obtained correlation function provides insightful understanding for the mechanisms of inheritance of DNA methylation patterns.

  6. Early demethylation of non-CpG, CpC-rich, elements in the myogenin 5′-flanking region

    PubMed Central

    Fuso, Andrea; Ferraguti, Giampiero; Grandoni, Francesco; Ruggeri, Raffaella; Scarpa, Sigfrido; Strom, Roberto

    2010-01-01

    The dynamic changes and structural patterns of DNA methylation of genes without CpG islands are poorly characterized. The relevance of CpG to the non-CpG methylation equilibrium in transcriptional repression is unknown. In this work, we analyzed the DNA methylation pattern of the 5′-flanking of the myogenin gene, a positive regulator of muscle differentiation with no CpG island and low CpG density, in both C2C12 muscle satellite cells and embryonic muscle. Embryonic brain was studied as a non-expressing tissue. High levels of both CpG and non-CpG methylation were observed in non-expressing experimental conditions. Both CpG and non-CpG methylation rapidly dropped during muscle differentiation and myogenin transcriptional activation with active demethylation dynamics. Non-CpG demethylation occurred more rapidly than CpG demethylation. Demethylation spread from initially highly methylated short CpC-rich elements to a virtually unmethylated status. These short elements have a high CpC content and density, share some motifs and largely coincide with putative recognition sequences of some differentiation-related transcription factors. Our findings point to a dynamically controlled equilibrium between CpG and non-CpG active demethylation in the transcriptional control of tissue-specific genes. The short CpC-rich elements are new structural features of the methylation machinery, whose functions may include priming the complete demethylation of a transcriptionally crucial DNA region. PMID:20935518

  7. A cross-study analysis of prenatal exposures to environmental contaminants and the epigenome: support for stress-responsive transcription factor occupancy as a mediator of gene-specific CpG methylation patterning

    PubMed Central

    Martin, Elizabeth M.; Fry, Rebecca C.

    2016-01-01

    Abstract A biological mechanism by which exposure to environmental contaminants results in gene-specific CpG methylation patterning is currently unknown. We hypothesize that gene-specific CpG methylation is related to environmentally perturbed transcription factor occupancy. To test this hypothesis, a database of 396 genes with altered CpG methylation either in cord blood leukocytes or placental tissue was compiled from 14 studies representing assessments of six environmental contaminants. Subsequently, an in silico approach was used to identify transcription factor binding sites enriched among the genes with altered CpG methylation in relationship to the suite of environmental contaminants. For each study, the sequences of the promoter regions (representing −1000 to +500 bp from the transcription start site) of all genes with altered CpG methylation were analyzed for enrichment of transcription factor binding sites. Binding sites for a total of 56 unique transcription factors were identified to be enriched within the promoter regions of the genes. Binding sites for the Kidney-Enriched Krupple-like Factor 15, a known responder to endogenous stress, were enriched ( P  < 0.001–0.041) among the genes with altered CpG methylation associated for five of the six environmental contaminants. These data support the transcription factor occupancy theory as a potential mechanism underlying environmentally-induced gene-specific CpG methylation. PMID:27066266

  8. Extensive sequence-influenced DNA methylation polymorphism in the human genome

    PubMed Central

    2010-01-01

    Background Epigenetic polymorphisms are a potential source of human diversity, but their frequency and relationship to genetic polymorphisms are unclear. DNA methylation, an epigenetic mark that is a covalent modification of the DNA itself, plays an important role in the regulation of gene expression. Most studies of DNA methylation in mammalian cells have focused on CpG methylation present in CpG islands (areas of concentrated CpGs often found near promoters), but there are also interesting patterns of CpG methylation found outside of CpG islands. Results We compared DNA methylation patterns on both alleles between many pairs (and larger groups) of related and unrelated individuals. Direct observation and simulation experiments revealed that around 10% of common single nucleotide polymorphisms (SNPs) reside in regions with differences in the propensity for local DNA methylation between the two alleles. We further showed that for the most common form of SNP, a polymorphism at a CpG dinucleotide, the presence of the CpG at the SNP positively affected local DNA methylation in cis. Conclusions Taken together with the known effect of DNA methylation on mutation rate, our results suggest an interesting interdependence between genetics and epigenetics underlying diversity in the human genome. PMID:20497546

  9. Immunotherapeutic potential of CpG oligodeoxynucleotides in veterinary species.

    PubMed

    Manuja, Anju; Manuja, Balvinder K; Kaushik, Jyoti; Singha, Harisankar; Singh, Raj Kumar

    2013-10-01

    Innate immunity plays a critical role in host defense against infectious diseases by discriminating between self and infectious non-self. The recognition of infectious non-self involves germ-line encoded pattern recognition receptors (PRRs) that recognize pathogen-associated molecular patterns (PAMPs). The PAMPs are the components of pathogenic microbes which include not only the cell wall constituents but also the unmethylated 2'-deoxy-ribo-cytosine-phosphate-guanosine (CpG) motifs. These CpG motifs present within bacterial and viral DNA are recognized by toll-like receptor 9 (TLR9), and signaling by this receptor triggers a proinflammatory cytokine response which, in turn, influences both innate and adaptive immune responses. The activation of TLR9 with synthetic CpG oligodeoxynucleotides (ODNs) induces powerful Th1-like immune responses. It has been shown to provide protection against infectious diseases, allergy and cancer in laboratory animal models and some domestic animal species. With better understanding of the basic biology and immune mechanisms, it would be possible to exploit the potential of CpG motifs for animal welfare. The research developments in the area of CpG and TLR9 and the potential applications in animal health have been reviewed in this article.

  10. Conserved Role of Intragenic DNA Methylation in Regulating Alternative Promoters

    PubMed Central

    Maunakea, Alika K.; Nagarajan, Raman P.; Bilenky, Mikhail; Ballinger, Tracy J.; D’Souza, Cletus; Fouse, Shaun D.; Johnson, Brett E.; Hong, Chibo; Nielsen, Cydney; Zhao, Yongjun; Turecki, Gustavo; Delaney, Allen; Varhol, Richard; Thiessen, Nina; Shchors, Ksenya; Heine, Vivi M.; Rowitch, David H.; Xing, Xiaoyun; Fiore, Chris; Schillebeeckx, Maximiliaan; Jones, Steven J.M.; Haussler, David; Marra, Marco A.; Hirst, Martin; Wang, Ting; Costello, Joseph F.

    2014-01-01

    While the methylation of DNA in 5′ promoters suppresses gene expression, the role of DNA methylation in gene bodies is unclear1–5. In mammals, tissue- and cell type-specific methylation is present in a small percentage of 5′ CpG island (CGI) promoters, while a far greater proportion occurs across gene bodies, coinciding with highly conserved sequences5–10. Tissue-specific intragenic methylation might reduce,3 or, paradoxically, enhance transcription elongation efficiency1,2,4,5. Capped analysis of gene expression (CAGE) experiments also indicate that transcription commonly initiates within and between genes11–15. To investigate the role of intragenic methylation, we generated a map of DNA methylation from human brain encompassing 24.7 million of the 28 million CpG sites. From the dense, high-resolution coverage of CpG islands, the majority of methylated CpG islands were revealed to be in intragenic and intergenic regions, while less than 3% of CpG islands in 5′ promoters were methylated. The CpG islands in all three locations overlapped with RNA markers of transcription initiation, and unmethylated CpG islands also overlapped significantly with trimethylation of H3K4, a histone modification enriched at promoters16. The general and CpG-island-specific patterns of methylation are conserved in mouse tissues. An in-depth investigation of the human SHANK3 locus17,18 and its mouse homologue demonstrated that this tissue-specific DNA methylation regulates intragenic promoter activity in vitro and in vivo. These methylation-regulated, alternative transcripts are expressed in a tissue and cell type-specific manner, and are expressed differentially within a single cell type from distinct brain regions. These results support a major role for intragenic methylation in regulating cell context-specific alternative promoters in gene bodies. PMID:20613842

  11. CpG methylation patterns and decitabine treatment response in acute myeloid leukemia cells and normal hematopoietic precursors

    PubMed Central

    Negrotto, Soledad; Ng, Kwok Peng; Jankowska, Ania M.; Bodo, Juraj; Gopalan, Banu; Guinta, Kathryn; Mulloy, James C.; Hsi, Eric; Maciejewski, Jaroslaw; Saunthararajah, Yogen

    2011-01-01

    The DNA hypomethylating drug decitabine maintains normal hematopoietic stem cell (HSC) self-renewal but induces terminal differentiation in acute myeloid leukemia (AML) cells. The basis for these contrasting cell-fates, and for selective CpG hypomethylation by decitabine, is poorly understood. Promoter CpGs, with methylation measured by microarray, were classified by the direction of methylation change with normal myeloid maturation. In AML cells, the methylation pattern at maturation-responsive CpG suggested at least partial maturation. Consistent with partial maturation, in gene expression analyses, AML cells expressed high levels of the key lineage-specifying factor CEBPA, but relatively low levels of the key late-differentiation driver CEBPE. In methylation analysis by mass-spectrometry, CEBPE promoter CpG that are usually hypomethylated during granulocyte maturation were significantly hypermethylated in AML cells. Decitabine treatment induced cellular differentiation of AML cells, and the largest methylation decreases were at CpG that are hypomethylated with myeloid maturation, including CEBPE promoter CpG. In contrast, decitabine-treated normal HSC retained immature morphology, and methylation significantly decreased at CpG that are less methylated in immature cells. High expression of lineage-specifying factor and aberrant epigenetic repression of some key late-differentiation genes distinguishes AML cells from normal HSC and could explain the contrasting differentiation and methylation responses to decitabine. PMID:21836612

  12. Bidirectional plasticity of pontine pneumotaxic postinspiratory drive: implication for a pontomedullary respiratory central pattern generator.

    PubMed

    Poon, Chi-Sang; Song, Gang

    2014-01-01

    The "pneumotaxic center" in the rostral dorsolateral pons as delineated by Lumsden nine decades ago is known to play an important role in promoting the inspiratory off-switch (IOS) for inspiratory-expiratory phase transition as a fail-safe mechanism for preventing apneusis in the absence of vagal input. Traditionally, the pontine pneumotaxic mechanism has been thought to contribute a tonic descending input that lowers the IOS threshold in medullary respiratory central pattern generator (rCPG) circuits, but otherwise does not constitute part of the rCPG. Recent evidence indicates that descending input from the Kölliker-Fuse nucleus (KFN) within the pneumotaxic center is essential for gating the postinspiratory phase of the three-phase respiratory rhythm to control the IOS in vagotomized animals. A critical question arising is whether such a descending pneumotaxic input from KFN that drives postinspiratory activity is tonic (null hypothesis) or rhythmic with postinspiratory phase modulation (alternative hypothesis). Here, we show that multifarious evidence reported in the literature collectively indicates that the descending pneumotaxic input may exhibit NMDA receptor-dependent short-term plasticity in the form of a biphasic neural differentiator that bidirectionally and phase-selectively modulates postinspiratory phase duration in response to vagal and peripheral chemoreceptor inputs independent of the responses in inspiratory and late-expiratory activities. The phase-selectivity property of the descending pneumotaxic input implicates a population of pontine early-expiratory (postinspiratory/expiratory-decrementing) neurons as the most likely neural correlate of the pneumotaxic mechanism that drives post-I activity, suggesting that the pontine pneumotaxic mechanism may be an integral part of a pontomedullary rCPG that underlies the three-phase respiratory rhythm. © 2014 Elsevier B.V. All rights reserved.

  13. DNA methylation patterns in tissues from mid-gestation bovine foetuses produced by somatic cell nuclear transfer show subtle abnormalities in nuclear reprogramming.

    PubMed

    Couldrey, Christine; Lee, Rita Sf

    2010-03-07

    Cloning of cattle by somatic cell nuclear transfer (SCNT) is associated with a high incidence of pregnancy failure characterized by abnormal placental and foetal development. These abnormalities are thought to be due, in part, to incomplete re-setting of the epigenetic state of DNA in the donor somatic cell nucleus to a state that is capable of driving embryonic and foetal development to completion. Here, we tested the hypothesis that DNA methylation patterns were not appropriately established during nuclear reprogramming following SCNT. A panel of imprinted, non-imprinted genes and satellite repeat sequences was examined in tissues collected from viable and failing mid-gestation SCNT foetuses and compared with similar tissues from gestation-matched normal foetuses generated by artificial insemination (AI). Most of the genomic regions examined in tissues from viable and failing SCNT foetuses had DNA methylation patterns similar to those in comparable tissues from AI controls. However, statistically significant differences were found between SCNT and AI at specific CpG sites in some regions of the genome, particularly those associated with SNRPN and KCNQ1OT1, which tended to be hypomethylated in SCNT tissues. There was a high degree of variation between individuals in methylation levels at almost every CpG site in these two regions, even in AI controls. In other genomic regions, methylation levels at specific CpG sites were tightly controlled with little variation between individuals. Only one site (HAND1) showed a tissue-specific pattern of DNA methylation. Overall, DNA methylation patterns in tissues of failing foetuses were similar to apparently viable SCNT foetuses, although there were individuals showing extreme deviant patterns. These results show that SCNT foetuses that had developed to mid-gestation had largely undergone nuclear reprogramming and that the epigenetic signature at this stage was not a good predictor of whether the foetus would develop to term or not.

  14. DNA methylation patterns in tissues from mid-gestation bovine foetuses produced by somatic cell nuclear transfer show subtle abnormalities in nuclear reprogramming

    PubMed Central

    2010-01-01

    Background Cloning of cattle by somatic cell nuclear transfer (SCNT) is associated with a high incidence of pregnancy failure characterized by abnormal placental and foetal development. These abnormalities are thought to be due, in part, to incomplete re-setting of the epigenetic state of DNA in the donor somatic cell nucleus to a state that is capable of driving embryonic and foetal development to completion. Here, we tested the hypothesis that DNA methylation patterns were not appropriately established during nuclear reprogramming following SCNT. A panel of imprinted, non-imprinted genes and satellite repeat sequences was examined in tissues collected from viable and failing mid-gestation SCNT foetuses and compared with similar tissues from gestation-matched normal foetuses generated by artificial insemination (AI). Results Most of the genomic regions examined in tissues from viable and failing SCNT foetuses had DNA methylation patterns similar to those in comparable tissues from AI controls. However, statistically significant differences were found between SCNT and AI at specific CpG sites in some regions of the genome, particularly those associated with SNRPN and KCNQ1OT1, which tended to be hypomethylated in SCNT tissues. There was a high degree of variation between individuals in methylation levels at almost every CpG site in these two regions, even in AI controls. In other genomic regions, methylation levels at specific CpG sites were tightly controlled with little variation between individuals. Only one site (HAND1) showed a tissue-specific pattern of DNA methylation. Overall, DNA methylation patterns in tissues of failing foetuses were similar to apparently viable SCNT foetuses, although there were individuals showing extreme deviant patterns. Conclusion These results show that SCNT foetuses that had developed to mid-gestation had largely undergone nuclear reprogramming and that the epigenetic signature at this stage was not a good predictor of whether the foetus would develop to term or not. PMID:20205951

  15. [Web Visit Patterns for the Clinical Practice Guidelines for Management of Depressive Disorder and Alcohol Abuse-Dependence].

    PubMed

    Suárez-Obando, Fernando; Restrepo, Carlos Gómez

    Clinical practice guidelines (CPG) are a set of recommendations for professionals, patients, and families, in order to make decisions about health care. The CPG respond to the need for concise, accurate, practical, and up to date information. In the field of mental health, Colombia has developed three GPC; alcohol (GPC-OH), depression (GPC-TDA), and schizophrenia. To describe the Web Portal traffic related to psychiatry guidelines, with emphasis on the number of visits, distribution throughout Colombian cities, and estimating user behaviour patterns. An evaluation was made of the traffic at the Clinical Practice Guidelines Web Portal of the Ministry of Health and Social Protection between 2013 and 2015 (two years of observation since the inauguration of the Portal). Out of the 45 GPC published on the website, the CPG-OH represented 1.21% of all page views of the Portal. CPG-TDA reached 1.52% (accumulated percentage of 2.73%), being the eighth most consulted guideline, with CPG-OH being number 16. The highest mean monthly number of visits for this group of guideliness was for the CPG-OH for health professionals (353 visits/month), and the lowest was for the CPG-AD for patients and relatives (24 single visits/month). Bogotá D.C. was the city where health carers accessed the guidelines more often. The guidelines for patients and relatives were consulted more in Villavicencio, Cúcuta, Manizales, Pereira, and Pasto. The web portal partially fulfills the purpose of circulating the CPG in Colombia. The visits to the CPG of mental health is quite low, and requires better dissemination strategies that allow the use of information and communication technology. Copyright © 2016 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.

  16. Epigenetic Loss of MLH1 Expression in Normal Human Hematopoietic Stem Cell Clones is Defined by the Promoter CpG Methylation Pattern Observed by High-Throughput Methylation Specific Sequencing

    PubMed Central

    Kenyon, Jonathan; Nickel-Meester, Gabrielle; Qing, Yulan; Santos-Guasch, Gabriela; Drake, Ellen; PingfuFu; Sun, Shuying; Bai, Xiaodong; Wald, David; Arts, Eric; Gerson, Stanton L.

    2016-01-01

    Normal human hematopoietic stem and progenitor cells (HPC) lose expression of MLH1, an important mismatch repair (MMR) pathway gene, with age. Loss of MMR leads to replication dependent mutational events and microsatellite instability observed in secondary acute myelogenous leukemia and other hematologic malignancies. Epigenetic CpG methylation upstream of the MLH1 promoter is a contributing factor to acquired loss of MLH1 expression in tumors of the epithelia and proximal mucosa. Using single molecule high-throughput bisulfite sequencing we have characterized the CpG methylation landscape from −938 to −337 bp upstream of the MLH1 transcriptional start site (position +0), from 30 hematopoietic colony forming cell clones (CFC) either expressing or not expressing MLH1. We identify a correlation between MLH1 promoter methylation and loss of MLH1 expression. Additionally, using the CpG site methylation frequencies obtained in this study we were able to generate a classification algorithm capable of sorting the expressing and non-expressing CFC. Thus, as has been previously described for many tumor cell types, we report for the first time a correlation between the loss of MLH1 expression and increased MLH1 promoter methylation in CFC derived from CD34+ selected hematopoietic stem and progenitor cells. PMID:27570841

  17. Epigenetic Loss of MLH1 Expression in Normal Human Hematopoietic Stem Cell Clones is Defined by the Promoter CpG Methylation Pattern Observed by High-Throughput Methylation Specific Sequencing.

    PubMed

    Kenyon, Jonathan; Nickel-Meester, Gabrielle; Qing, Yulan; Santos-Guasch, Gabriela; Drake, Ellen; PingfuFu; Sun, Shuying; Bai, Xiaodong; Wald, David; Arts, Eric; Gerson, Stanton L

    Normal human hematopoietic stem and progenitor cells (HPC) lose expression of MLH1 , an important mismatch repair (MMR) pathway gene, with age. Loss of MMR leads to replication dependent mutational events and microsatellite instability observed in secondary acute myelogenous leukemia and other hematologic malignancies. Epigenetic CpG methylation upstream of the MLH1 promoter is a contributing factor to acquired loss of MLH1 expression in tumors of the epithelia and proximal mucosa. Using single molecule high-throughput bisulfite sequencing we have characterized the CpG methylation landscape from -938 to -337 bp upstream of the MLH1 transcriptional start site (position +0), from 30 hematopoietic colony forming cell clones (CFC) either expressing or not expressing MLH1 . We identify a correlation between MLH1 promoter methylation and loss of MLH1 expression. Additionally, using the CpG site methylation frequencies obtained in this study we were able to generate a classification algorithm capable of sorting the expressing and non-expressing CFC. Thus, as has been previously described for many tumor cell types, we report for the first time a correlation between the loss of MLH1 expression and increased MLH1 promoter methylation in CFC derived from CD34 + selected hematopoietic stem and progenitor cells.

  18. CpG DNA in the prevention and treatment of infections.

    PubMed

    Dalpke, Alexander; Zimmermann, Stefan; Heeg, Klaus

    2002-01-01

    Microbial infection is sensed by Toll-like receptors (TLRs) on innate immune cells. Among the ten so far defined TLRs, TLR9 and its ligand are peculiar. TLR9 recognises bacterial DNA characterised by the abundance of unmethylated CpG dinucleotides, which distinguish bacterial DNA (CpG DNA) from mammalian DNA. Moreover, TLR9 shows a restricted cellular and subcellular pattern of expression. In contrast to other TLR agonists, CpG DNA is superior in activation of dendritic dells and induction of costimulatory cytokines such as interleukin (IL)-12 and IL-18. This qualifies CpG DNA as a Th1-promoting adjuvant. During infection, recognition of CpG DNA of intracellular pathogens skews and fine-tunes the ongoing immune response and induces long-lasting Th1 milieus. Thus, CpG DNA might play an important role in driving the immune system to a Th1 profile, preventing undesired Th2 milieus that might favour induction of allergic responses. Since CpG DNA can be synthesised with high purity and sequence fidelity, synthetic CpG DNA will become an important agent for Th1 instruction and be an effective adjuvant during vaccination.

  19. Bayesian inference supports a location and neighbour-dependent model of DNA methylation propagation at the MGMT gene promoter in lung tumours.

    PubMed

    Bonello, Nicolas; Sampson, James; Burn, John; Wilson, Ian J; McGrown, Gail; Margison, Geoff P; Thorncroft, Mary; Crossbie, Philip; Povey, Andrew C; Santibanez-Koref, Mauro; Walters, Kevin

    2013-11-07

    We exploit model-based Bayesian inference methodologies to analyse lung tumour-derived methylation data from a CpG island in the O6-methylguanine-DNA methyltransferase (MGMT) promoter. Interest is in modelling the changes in methylation patterns in a CpG island in the first exon of the promoter during lung tumour development. We propose four competils of methylation state propagation based on two mechanisms. The first is the location-dependence mechanism in which the probability of a gain or loss of methylation at a CpG within the promoter depends upon its location in the CpG sequence. The second mechanism is that of neighbour-dependence in which gain or loss of methylation at a CpG depends upon the methylation status of the immediately preceding CpG. Our data comprises the methylation status at 12 CpGs near the 5' end of the CpG island in two lung tumour samples for both alleles of a nearby polymorphism. We use approximate Bayesian computation, a computationally intensive rejection-sampling algorithm to infer model parameters and compare models without the need to evaluate the likelihood function. We compare the four proposed models using two criteria: the approximate Bayes factors and the distribution of the Euclidean distance between the summary statistics of the observed and simulated datasets. Our model-based analysis demonstrates compelling evidence for both location and neighbour dependence in the process of aberrant DNA methylation of this MGMT promoter CpG island in lung tumours. We find equivocal evidence to support the hypothesis that the methylation patterns of the two alleles evolve independently. © 2013 Published by Elsevier Ltd. All rights reserved.

  20. Transformation of Context-dependent Sensory Dynamics into Motor Behavior

    PubMed Central

    Latorre, Roberto; Levi, Rafael; Varona, Pablo

    2013-01-01

    The intrinsic dynamics of sensory networks play an important role in the sensory-motor transformation. In this paper we use conductance based models and electrophysiological recordings to address the study of the dual role of a sensory network to organize two behavioral context-dependent motor programs in the mollusk Clione limacina. We show that: (i) a winner take-all dynamics in the gravimetric sensory network model drives the typical repetitive rhythm in the wing central pattern generator (CPG) during routine swimming; (ii) the winnerless competition dynamics of the same sensory network organizes the irregular pattern observed in the wing CPG during hunting behavior. Our model also shows that although the timing of the activity is irregular, the sequence of the switching among the sensory cells is preserved whenever the same set of neurons are activated in a given time window. These activation phase locks in the sensory signals are transformed into specific events in the motor activity. The activation phase locks can play an important role in motor coordination driven by the intrinsic dynamics of a multifunctional sensory organ. PMID:23459114

  1. Exploiting Semantic Web Technologies to Develop OWL-Based Clinical Practice Guideline Execution Engines.

    PubMed

    Jafarpour, Borna; Abidi, Samina Raza; Abidi, Syed Sibte Raza

    2016-01-01

    Computerizing paper-based CPG and then executing them can provide evidence-informed decision support to physicians at the point of care. Semantic web technologies especially web ontology language (OWL) ontologies have been profusely used to represent computerized CPG. Using semantic web reasoning capabilities to execute OWL-based computerized CPG unties them from a specific custom-built CPG execution engine and increases their shareability as any OWL reasoner and triple store can be utilized for CPG execution. However, existing semantic web reasoning-based CPG execution engines suffer from lack of ability to execute CPG with high levels of expressivity, high cognitive load of computerization of paper-based CPG and updating their computerized versions. In order to address these limitations, we have developed three CPG execution engines based on OWL 1 DL, OWL 2 DL and OWL 2 DL + semantic web rule language (SWRL). OWL 1 DL serves as the base execution engine capable of executing a wide range of CPG constructs, however for executing highly complex CPG the OWL 2 DL and OWL 2 DL + SWRL offer additional executional capabilities. We evaluated the technical performance and medical correctness of our execution engines using a range of CPG. Technical evaluations show the efficiency of our CPG execution engines in terms of CPU time and validity of the generated recommendation in comparison to existing CPG execution engines. Medical evaluations by domain experts show the validity of the CPG-mediated therapy plans in terms of relevance, safety, and ordering for a wide range of patient scenarios.

  2. Development of quadruped walking locomotion gait generator using a hybrid method

    NASA Astrophysics Data System (ADS)

    Jasni, F.; Shafie, A. A.

    2013-12-01

    The earth, in many areas is hardly reachable by the wheeled or tracked locomotion system. Thus, walking locomotion system is becoming a favourite option for mobile robot these days. This is because of the ability of walking locomotion to move on the rugged and unlevel terrains. However, to develop a walking locomotion gait for a robot is not a simple task. Central Pattern Generator (CPGs) method is a biological inspired method that is introduced as a method to develop the gait for the walking robot recently to tackle the issue faced by the conventional method of pre-designed trajectory based method. However, research shows that even the CPG method do have some limitations. Thus, in this paper, a hybrid method that combines CPG and the pre-designed trajectory based method is introduced to develop a walking gait for quadruped walking robot. The 3-D foot trajectories and the joint angle trajectories developed using the proposed method are compared with the data obtained via the conventional method of pre-designed trajectory to confirm the performance.

  3. Plasticity of spinal centers in spinal cord injury patients: new concepts for gait evaluation and training.

    PubMed

    Scivoletto, Giorgio; Ivanenko, Yuri; Morganti, Barbara; Grasso, Renato; Zago, Mirka; Lacquaniti, Francesco; Ditunno, John; Molinari, Marco

    2007-01-01

    Recent data on spinal cord plasticity after spinal cord injury (SCI) were reviewed to analyze the influence of training on the neurophysiological organization of locomotor spinal circuits in SCI patients. In particular, the authors studied the relationship between central pattern generators (CPGs) and motor neuron pool activation during gait. An analysis of the relations between locomotor recovery and compensatory mechanisms focuses on the hierarchical organization of gait parameters and allows characterizing kinematic parameters that are highly stable during different gait conditions and in recovered gait after SCI. The importance of training characteristics and the use of robotic/automated devices in gait recovery is analyzed and discussed. The role of CPG in defining kinematic gait parameters is summarized, and spatio-temporal maps of EMG activity during gait are used to clarify the role of CPG plasticity in sustaining gait recovery.

  4. Spinal cord electrophysiology II: extracellular suction electrode fabrication.

    PubMed

    Garudadri, Suresh; Gallarda, Benjamin; Pfaff, Samuel; Alaynick, William

    2011-02-20

    Development of neural circuitries and locomotion can be studied using neonatal rodent spinal cord central pattern generator (CPG) behavior. We demonstrate a method to fabricate suction electrodes that are used to examine CPG activity, or fictive locomotion, in dissected rodent spinal cords. The rodent spinal cords are placed in artificial cerebrospinal fluid and the ventral roots are drawn into the suction electrode. The electrode is constructed by modifying a commercially available suction electrode. A heavier silver wire is used instead of the standard wire given by the commercially available electrode. The glass tip on the commercial electrode is replaced with a plastic tip for increased durability. We prepare hand drawn electrodes and electrodes made from specific sizes of tubing, allowing consistency and reproducibility. Data is collected using an amplifier and neurogram acquisition software. Recordings are performed on an air table within a Faraday cage to prevent mechanical and electrical interference, respectively.

  5. Spinal Cord Electrophysiology II: Extracellular Suction Electrode Fabrication

    PubMed Central

    Garudadri, Suresh; Gallarda, Benjamin; Pfaff, Samuel; Alaynick, William

    2011-01-01

    Development of neural circuitries and locomotion can be studied using neonatal rodent spinal cord central pattern generator (CPG) behavior. We demonstrate a method to fabricate suction electrodes that are used to examine CPG activity, or fictive locomotion, in dissected rodent spinal cords. The rodent spinal cords are placed in artificial cerebrospinal fluid and the ventral roots are drawn into the suction electrode. The electrode is constructed by modifying a commercially available suction electrode. A heavier silver wire is used instead of the standard wire given by the commercially available electrode. The glass tip on the commercial electrode is replaced with a plastic tip for increased durability. We prepare hand drawn electrodes and electrodes made from specific sizes of tubing, allowing consistency and reproducibility. Data is collected using an amplifier and neurogram acquisition software. Recordings are performed on an air table within a Faraday cage to prevent mechanical and electrical interference, respectively. PMID:21372792

  6. Prediction of epigenetically regulated genes in breast cancer cell lines.

    PubMed

    Loss, Leandro A; Sadanandam, Anguraj; Durinck, Steffen; Nautiyal, Shivani; Flaucher, Diane; Carlton, Victoria E H; Moorhead, Martin; Lu, Yontao; Gray, Joe W; Faham, Malek; Spellman, Paul; Parvin, Bahram

    2010-06-04

    Methylation of CpG islands within the DNA promoter regions is one mechanism that leads to aberrant gene expression in cancer. In particular, the abnormal methylation of CpG islands may silence associated genes. Therefore, using high-throughput microarrays to measure CpG island methylation will lead to better understanding of tumor pathobiology and progression, while revealing potentially new biomarkers. We have examined a recently developed high-throughput technology for measuring genome-wide methylation patterns called mTACL. Here, we propose a computational pipeline for integrating gene expression and CpG island methylation profiles to identify epigenetically regulated genes for a panel of 45 breast cancer cell lines, which is widely used in the Integrative Cancer Biology Program (ICBP). The pipeline (i) reduces the dimensionality of the methylation data, (ii) associates the reduced methylation data with gene expression data, and (iii) ranks methylation-expression associations according to their epigenetic regulation. Dimensionality reduction is performed in two steps: (i) methylation sites are grouped across the genome to identify regions of interest, and (ii) methylation profiles are clustered within each region. Associations between the clustered methylation and the gene expression data sets generate candidate matches within a fixed neighborhood around each gene. Finally, the methylation-expression associations are ranked through a logistic regression, and their significance is quantified through permutation analysis. Our two-step dimensionality reduction compressed 90% of the original data, reducing 137,688 methylation sites to 14,505 clusters. Methylation-expression associations produced 18,312 correspondences, which were used to further analyze epigenetic regulation. Logistic regression was used to identify 58 genes from these correspondences that showed a statistically significant negative correlation between methylation profiles and gene expression in the panel of breast cancer cell lines. Subnetwork enrichment of these genes has identified 35 common regulators with 6 or more predicted markers. In addition to identifying epigenetically regulated genes, we show evidence of differentially expressed methylation patterns between the basal and luminal subtypes. Our results indicate that the proposed computational protocol is a viable platform for identifying epigenetically regulated genes. Our protocol has generated a list of predictors including COL1A2, TOP2A, TFF1, and VAV3, genes whose key roles in epigenetic regulation is documented in the literature. Subnetwork enrichment of these predicted markers further suggests that epigenetic regulation of individual genes occurs in a coordinated fashion and through common regulators.

  7. Phenotype-specific CpG island methylation events in a murine model of prostate cancer.

    PubMed

    Camoriano, Marta; Kinney, Shannon R Morey; Moser, Michael T; Foster, Barbara A; Mohler, James L; Trump, Donald L; Karpf, Adam R; Smiraglia, Dominic J

    2008-06-01

    Aberrant DNA methylation plays a significant role in nearly all human cancers and may contribute to disease progression to advanced phenotypes. Study of advanced prostate cancer phenotypes in the human disease is hampered by limited availability of tissues. We therefore took advantage of the Transgenic Adenocarcinoma of Mouse Prostate (TRAMP) model to study whether three different phenotypes of TRAMP tumors (PRIM, late-stage primary tumors; AIP, androgen-independent primary tumors; and MET, metastases) displayed specific patterns of CpG island hypermethylation using Restriction Landmark Genomic Scanning. Each tumor phenotype displayed numerous hypermethylation events, with the most homogeneous methylation pattern in AIP and the most heterogeneous pattern in MET. Several loci displayed a phenotype-specific methylation pattern; the most striking pattern being loci methylated at high frequency in PRIM and AIP but rarely in MET. Examination of the mRNA expression of three genes, BC058385, Goosecoid, and Neurexin 2, which exhibited nonpromoter methylation, revealed increased expression associated with downstream methylation. Only methylated samples showed mRNA expression, in which tumor phenotype was a key factor determining the level of expression. The CpG island in the human orthologue of BC058385 was methylated in human AIP but not in primary androgen-stimulated prostate cancer or benign prostate. The clinical data show a proof-of-principle that the TRAMP model can be used to identify targets of aberrant CpG island methylation relevant to human disease. In conclusion, phenotype-specific hypermethylation events were associated with the overexpression of different genes and may provide new markers of prostate tumorigenesis.

  8. A Quadruped Robot Exhibiting Spontaneous Gait Transitions from Walking to Trotting to Galloping.

    PubMed

    Owaki, Dai; Ishiguro, Akio

    2017-03-21

    The manner in which quadrupeds change their locomotive patterns-walking, trotting, and galloping-with changing speed is poorly understood. In this paper, we provide evidence for interlimb coordination during gait transitions using a quadruped robot for which coordination between the legs can be self-organized through a simple "central pattern generator" (CPG) model. We demonstrate spontaneous gait transitions between energy-efficient patterns by changing only the parameter related to speed. Interlimb coordination was achieved with the use of local load sensing only without any preprogrammed patterns. Our model exploits physical communication through the body, suggesting that knowledge of physical communication is required to understand the leg coordination mechanism in legged animals and to establish design principles for legged robots that can reproduce flexible and efficient locomotion.

  9. Frequency Modulation and Spatiotemporal Stability of the sCPG in Preterm Infants with RDS

    PubMed Central

    Barlow, Steven M.; Burch, Mimi; Venkatesan, Lalit; Harold, Meredith; Zimmerman, Emily

    2012-01-01

    The nonnutritive suck (NNS) is an observable and accessible motor behavior which is often used to make inference about brain development and pre-feeding skill in preterm and term infants. The purpose of this study was to model NNS burst compression pressure dynamics in the frequency and time domain among two groups of preterm infants, including those with respiratory distress syndrome (RDS, N = 15) and 17 healthy controls. Digitized samples of NNS compression pressure waveforms recorded at a 1-week interval were collected 15 minutes prior to a scheduled feed. Regression analysis and ANOVA revealed that healthy preterm infants produced longer NNS bursts and the mean burst initiation cycle frequencies were higher when compared to the RDS group. Moreover, the initial 5 cycles of the NNS burst manifest a frequency modulated (FM) segment which is a significant feature of the suck central pattern generator (sCPG), and differentially expressed in healthy and RDS infants. The NNS burst structure revealed significantly lower spatiotemporal index values for control versus RDS preterm infants during FM, and provides additional information on the microstructure of the sCPG which may be used to gauge the developmental status and progression of oromotor control systems among these fragile infants. PMID:22888359

  10. Sequence-Dependent Diastereospecific and Diastereodivergent Crosslinking of DNA by Decarbamoylmitomycin C.

    PubMed

    Aguilar, William; Paz, Manuel M; Vargas, Anayatzinc; Clement, Cristina C; Cheng, Shu-Yuan; Champeil, Elise

    2018-04-20

    Mitomycin C (MC), a potent antitumor drug, and decarbamoylmitomycin C (DMC), a derivative lacking the carbamoyl group, form highly cytotoxic DNA interstrand crosslinks. The major interstrand crosslink formed by DMC is the C1'' epimer of the major crosslink formed by MC. The molecular basis for the stereochemical configuration exhibited by DMC was investigated using biomimetic synthesis. The formation of DNA-DNA crosslinks by DMC is diastereospecific and diastereodivergent: Only the 1''S-diastereomer of the initially formed monoadduct can form crosslinks at GpC sequences, and only the 1''R-diastereomer of the monoadduct can form crosslinks at CpG sequences. We also show that CpG and GpC sequences react with divergent diastereoselectivity in the first alkylation step: 1"S stereochemistry is favored at GpC sequences and 1''R stereochemistry is favored at CpG sequences. Therefore, the first alkylation step results, at each sequence, in the selective formation of the diastereomer able to generate an interstrand DNA-DNA crosslink after the "second arm" alkylation. Examination of the known DNA adduct pattern obtained after treatment of cancer cell cultures with DMC indicates that the GpC sequence is the major target for the formation of DNA-DNA crosslinks in vivo by this drug. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Adaptive walking of a quadrupedal robot based on layered biological reflexes

    NASA Astrophysics Data System (ADS)

    Zhang, Xiuli; Mingcheng, E.; Zeng, Xiangyu; Zheng, Haojun

    2012-07-01

    A multiple-legged robot is traditionally controlled by using its dynamic model. But the dynamic-model-based approach fails to acquire satisfactory performances when the robot faces rough terrains and unknown environments. Referring animals' neural control mechanisms, a control model is built for a quadruped robot walking adaptively. The basic rhythmic motion of the robot is controlled by a well-designed rhythmic motion controller(RMC) comprising a central pattern generator(CPG) for hip joints and a rhythmic coupler (RC) for knee joints. CPG and RC have relationships of motion-mapping and rhythmic couple. Multiple sensory-motor models, abstracted from the neural reflexes of a cat, are employed. These reflex models are organized and thus interact with the CPG in three layers, to meet different requirements of complexity and response time to the tasks. On the basis of the RMC and layered biological reflexes, a quadruped robot is constructed, which can clear obstacles and walk uphill and downhill autonomously, and make a turn voluntarily in uncertain environments, interacting with the environment in a way similar to that of an animal. The paper provides a biologically inspired architecture, with which a robot can walk adaptively in uncertain environments in a simple and effective way, and achieve better performances.

  12. The Human Central Pattern Generator for Locomotion.

    PubMed

    Minassian, Karen; Hofstoetter, Ursula S; Dzeladini, Florin; Guertin, Pierre A; Ijspeert, Auke

    2017-03-01

    The ability of dedicated spinal circuits, referred to as central pattern generators (CPGs), to produce the basic rhythm and neural activation patterns underlying locomotion can be demonstrated under specific experimental conditions in reduced animal preparations. The existence of CPGs in humans is a matter of debate. Equally elusive is the contribution of CPGs to normal bipedal locomotion. To address these points, we focus on human studies that utilized spinal cord stimulation or pharmacological neuromodulation to generate rhythmic activity in individuals with spinal cord injury, and on neuromechanical modeling of human locomotion. In the absence of volitional motor control and step-specific sensory feedback, the human lumbar spinal cord can produce rhythmic muscle activation patterns that closely resemble CPG-induced neural activity of the isolated animal spinal cord. In this sense, CPGs in humans can be defined by the activity they produce. During normal locomotion, CPGs could contribute to the activation patterns during specific phases of the step cycle and simplify supraspinal control of step cycle frequency as a feedforward component to achieve a targeted speed. Determining how the human CPGs operate will be essential to advance the theory of neural control of locomotion and develop new locomotor neurorehabilitation paradigms.

  13. Promoter methylation assay of SASH1 gene in breast cancer.

    PubMed

    Sheyu, Lin; Hui, Liu; Junyu, Zhang; Jiawei, Xu; Honglian, Wang; Qing, Sang; Hengwei, Zhang; Xuhui, Guo; Qinghe, Xing; Lin, He

    2013-01-01

    To analyze the relationship between the expression of SASH1 and its methylation level of SASH1 gene promoter in human breast cancer. Expression levels of SASH1 were examined in breast cancer tissues and adjacent normal tissues with immunohistochemistry and with real time PCR (RT-PCR) methylation analysis was performed with MassArray. Immunohistochemistry showed that SASH1 expression was strongly reduced in breast cancer compared with adjacent normal tissues. Quantitative methylation analysis by MassArray revealed that CpG sites in SASH1 promoter shared similar methylation pattern in tumor tissue and adjacent normal tissue. The CpG sites with significant difference in methylation level were CpG_26.27 and CpG_54.55. Moreover, 5-aza-2'-deoxycytidine (5-Aza-dc) treatment of tumor cell line MDA-MB-231 caused significant elevation of SASH1 mRNA. Based on these data, we propose that increase of DNA methylation level in the promoter region of gene SASH1, particularly CpG_26.27 or CpG_54.55 sites, possibly repressed SASH1 expression in breast cancer.

  14. Nucleosome dynamics and maintenance of epigenetic states of CpG islands

    NASA Astrophysics Data System (ADS)

    Sneppen, Kim; Dodd, Ian B.

    2016-06-01

    Methylation of mammalian DNA occurs primarily at CG dinucleotides. These CpG sites are located nonrandomly in the genome, tending to occur within high density clusters of CpGs (islands) or within large regions of low CpG density. Cluster methylation tends to be bimodal, being dominantly unmethylated or mostly methylated. For CpG clusters near promoters, low methylation is associated with transcriptional activity, while high methylation is associated with gene silencing. Alternative CpG methylation states are thought to be stable and heritable, conferring localized epigenetic memory that allows transient signals to create long-lived gene expression states. Positive feedback where methylated CpG sites recruit enzymes that methylate nearby CpGs, can produce heritable bistability but does not easily explain that as clusters increase in size or density they change from being primarily methylated to primarily unmethylated. Here, we show that an interaction between the methylation state of a cluster and its occupancy by nucleosomes provides a mechanism to generate these features and explain genome wide systematics of CpG islands.

  15. Combinations of various CpG motifs cloned into plasmid backbone modulate and enhance protective immunity of viral replicon DNA anthrax vaccines.

    PubMed

    Yu, Yun-Zhou; Ma, Yao; Xu, Wen-Hui; Wang, Shuang; Sun, Zhi-Wei

    2015-08-01

    DNA vaccines are generally weak stimulators of the immune system. Fortunately, their efficacy can be improved using a viral replicon vector or by the addition of immunostimulatory CpG motifs, although the design of these engineered DNA vectors requires optimization. Our results clearly suggest that multiple copies of three types of CpG motifs or combinations of various types of CpG motifs cloned into a viral replicon vector backbone with strong immunostimulatory activities on human PBMC are efficient adjuvants for these DNA vaccines to modulate and enhance protective immunity against anthrax, although modifications with these different CpG forms in vivo elicited inconsistent immune response profiles. Modification with more copies of CpG motifs elicited more potent adjuvant effects leading to the generation of enhanced immunity, which indicated a CpG motif dose-dependent enhancement of antigen-specific immune responses. Notably, the enhanced and/or synchronous adjuvant effects were observed in modification with combinations of two different types of CpG motifs, which provides not only a contribution to the knowledge base on the adjuvant activities of CpG motifs combinations but also implications for the rational design of optimal DNA vaccines with combinations of CpG motifs as "built-in" adjuvants. We describe an efficient strategy to design and optimize DNA vaccines by the addition of combined immunostimulatory CpG motifs in a viral replicon DNA plasmid to produce strong immune responses, which indicates that the CpG-modified viral replicon DNA plasmid may be desirable for use as vector of DNA vaccines.

  16. Rhythm generation, coordination, and initiation in the vocal pathways of male African clawed frogs

    PubMed Central

    Cavin Barnes, Jessica; Appleby, Todd

    2016-01-01

    Central pattern generators (CPGs) in the brain stem are considered to underlie vocalizations in many vertebrate species, but the detailed mechanisms underlying how motor rhythms are generated, coordinated, and initiated remain unclear. We addressed these issues using isolated brain preparations of Xenopus laevis from which fictive vocalizations can be elicited. Advertisement calls of male X. laevis that consist of fast and slow trills are generated by vocal CPGs contained in the brain stem. Brain stem central vocal pathways consist of a premotor nucleus [dorsal tegmental area of medulla (DTAM)] and a laryngeal motor nucleus [a homologue of nucleus ambiguus (n.IX-X)] with extensive reciprocal connections between the nuclei. In addition, DTAM receives descending inputs from the extended amygdala. We found that unilateral transection of the projections between DTAM and n.IX-X eliminated premotor fictive fast trill patterns but did not affect fictive slow trills, suggesting that the fast and slow trill CPGs are distinct; the slow trill CPG is contained in n.IX-X, and the fast trill CPG spans DTAM and n.IX-X. Midline transections that eliminated the anterior, posterior, or both commissures caused no change in the temporal structure of fictive calls, but bilateral synchrony was lost, indicating that the vocal CPGs are contained in the lateral halves of the brain stem and that the commissures synchronize the two oscillators. Furthermore, the elimination of the inputs from extended amygdala to DTAM, in addition to the anterior commissure, resulted in autonomous initiation of fictive fast but not slow trills by each hemibrain stem, indicating that the extended amygdala provides a bilateral signal to initiate fast trills. NEW & NOTEWORTHY Central pattern generators (CPGs) are considered to underlie vocalizations in many vertebrate species, but the detailed mechanisms underlying their functions remain unclear. We addressed this question using an isolated brain preparation of African clawed frogs. We discovered that two vocal phases are mediated by anatomically distinct CPGs, that there are a pair of CPGs contained in the left and right half of the brain stem, and that mechanisms underlying initiation of the two vocal phases are distinct. PMID:27760822

  17. Quantitative, high-resolution epigenetic profiling of CpG loci identifies associations with cord blood plasma homocysteine and birth weight in humans

    PubMed Central

    Ismail, Khaled MK; Haworth, Kim E; Mein, Charles; Carroll, William D

    2011-01-01

    Supplementation with folic acid during pregnancy is known to reduce the risk of neural tube defects and low birth weight. It is thought that folate and other one-carbon intermediates might secure these clinical effects via DNA methylation. We examined the effects of folate on the human methylome using quantitative interrogation of 27,578 CpG loci associated with 14,496 genes at single-nucleotide resolution across 12 fetal cord blood samples. Consistent with previous studies, the majority of CpG dinucleotides located within CpG islands exhibited hypomethylation while those outside CpG islands showed mid-high methylation. However, for the first time in human samples, unbiased analysis of methylation across samples revealed a significant correlation of methylation patterns with plasma homocysteine, LINE-1 methylation and birth weight centile. Additionally, CpG methylation significantly correlated with either birth weight or LINE-1 methylation were predominantly located in CpG islands. These data indicate that levels of folate-associated intermediates in cord blood reflect their influence and consequences for the fetal epigenome and potentially on pregnancy outcome. In these cases, their influence might be exerted during late gestation or reflect those present during the peri-conceptual period. PMID:20864804

  18. The evolution of CpG density and lifespan in conserved primate and mammalian promoters

    PubMed Central

    McLain, Adam T.

    2018-01-01

    Gene promoters are evolutionarily conserved across holozoans and enriched in CpG sites, the target for DNA methylation. As animals age, the epigenetic pattern of DNA methylation degrades, with highly methylated CpG sites gradually becoming demethylated while CpG islands increase in methylation. Across vertebrates, aging is a trait that varies among species. We used this variation to determine whether promoter CpG density correlates with species’ maximum lifespan. Human promoter sequences were used to identify conserved regions in 131 mammals and a subset of 28 primate genomes. We identified approximately 1000 gene promoters (5% of the total), that significantly correlated CpG density with lifespan. The correlations were performed via the phylogenetic least squares method to account for trait similarity by common descent using phylogenetic branch lengths. Gene set enrichment analysis revealed no significantly enriched pathways or processes, consistent with the hypothesis that aging is not under positive selection. However, within both mammals and primates, 95% of the promoters showed a positive correlation between increasing CpG density and species lifespan, and two thirds were shared between the primate subset and mammalian datasets. Thus, these genes may require greater buffering capacity against age-related dysregulation of DNA methylation in longer-lived species. PMID:29661983

  19. Clinical evaluation of CpG oligonucleotides as adjuvants for vaccines targeting infectious diseases and cancer

    PubMed Central

    Scheiermann, Julia; Klinman, Dennis M.

    2014-01-01

    Synthetic oligonucleotides (ODN) that express unmethylated “CpG motifs” trigger cells that express Toll-like receptor 9. In humans this includes plasmacytoid dendritic cells and B cells. CpG ODN induce an innate immune response characterized by the production of Th1 and pro-inflammatory cytokines. Their utility as vaccine adjuvants was evaluated in a number of clinical trials. Results indicate that CpG ODN improve antigen presentation and the generation of vaccine-specific cellular and humoral responses. This work provides an up-to-date overview of the utility of CpG ODN as adjuvants for vaccines targeting infectious agents and cancer. PMID:24975812

  20. DNA methylation-based forensic age prediction using artificial neural networks and next generation sequencing.

    PubMed

    Vidaki, Athina; Ballard, David; Aliferi, Anastasia; Miller, Thomas H; Barron, Leon P; Syndercombe Court, Denise

    2017-05-01

    The ability to estimate the age of the donor from recovered biological material at a crime scene can be of substantial value in forensic investigations. Aging can be complex and is associated with various molecular modifications in cells that accumulate over a person's lifetime including epigenetic patterns. The aim of this study was to use age-specific DNA methylation patterns to generate an accurate model for the prediction of chronological age using data from whole blood. In total, 45 age-associated CpG sites were selected based on their reported age coefficients in a previous extensive study and investigated using publicly available methylation data obtained from 1156 whole blood samples (aged 2-90 years) analysed with Illumina's genome-wide methylation platforms (27K/450K). Applying stepwise regression for variable selection, 23 of these CpG sites were identified that could significantly contribute to age prediction modelling and multiple regression analysis carried out with these markers provided an accurate prediction of age (R 2 =0.92, mean absolute error (MAE)=4.6 years). However, applying machine learning, and more specifically a generalised regression neural network model, the age prediction significantly improved (R 2 =0.96) with a MAE=3.3 years for the training set and 4.4 years for a blind test set of 231 cases. The machine learning approach used 16 CpG sites, located in 16 different genomic regions, with the top 3 predictors of age belonged to the genes NHLRC1, SCGN and CSNK1D. The proposed model was further tested using independent cohorts of 53 monozygotic twins (MAE=7.1 years) and a cohort of 1011 disease state individuals (MAE=7.2 years). Furthermore, we highlighted the age markers' potential applicability in samples other than blood by predicting age with similar accuracy in 265 saliva samples (R 2 =0.96) with a MAE=3.2 years (training set) and 4.0 years (blind test). In an attempt to create a sensitive and accurate age prediction test, a next generation sequencing (NGS)-based method able to quantify the methylation status of the selected 16 CpG sites was developed using the Illumina MiSeq ® platform. The method was validated using DNA standards of known methylation levels and the age prediction accuracy has been initially assessed in a set of 46 whole blood samples. Although the resulted prediction accuracy using the NGS data was lower compared to the original model (MAE=7.5years), it is expected that future optimization of our strategy to account for technical variation as well as increasing the sample size will improve both the prediction accuracy and reproducibility. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  1. Experimental murine myopia induces collagen type Iα1 (COL1A1) DNA methylation and altered COL1A1 messenger RNA expression in sclera

    PubMed Central

    Zhou, Xiangtian; Ji, Fengtao; An, Jianhong; Zhao, Fuxin; Shi, Fanjun; Huang, Furong; Li, Yuan; Jiao, Shiming; Yan, Dongsheng; Chen, Xiaoyan; Chen, JiangFan

    2012-01-01

    Purpose To investigate whether myopia development is associated with changes of scleral DNA methylation in cytosine-phosphate-guanine (CpG) sites in the collagen 1A1 (COL1A1) promoter and messenger RNA (mRNA) levels following murine form deprivation myopia. Methods Fifty-seven C57BL/6 mice (postnatal day 23) were randomly assigned to four groups: (1) monocular form deprivation (MD) in which a diffuser lens was placed over one eye for 28 days; (2) normal controls without MD; (3) MD recovery in which the diffuser lens was removed for seven days; and (4) MD recovery normal controls. The DNA methylation pattern in COL1A1 promoter and exon 1 was determined by bisulfite DNA sequencing, and the COL1A1 mRNA level in sclera was determined by quantitative PCR. Results MD was found to induce myopia in the treated eyes. Six CpG sites in the promoter and exon 1 region of COL1A1 were methylated with significantly higher frequency in the treated eyes than normal control eyes (p<0.05), with CpG island methylation in MD-contralateral eyes being intermediate. Consistent with the CpG methylation, scleral COL1A1 mRNA was reduced by 57% in the MD-treated eyes compared to normal controls (p<0.05). After seven days of MD recovery, CpG methylation was significantly reduced (p=0.01). The methylation patterns returned to near normal level in five CpG sites, but the sixth was hypomethylated compared to normal controls. Conclusions In parallel with the development of myopia and the reduced COL1A1 mRNA, the frequency of methylation in CpG sites of the COL1A1 promoter/exon 1 increased during MD and returned to near normal during recovery. Thus, hypermethylation of CpG sites in the promoter/exon 1 of COL1A1 may underlie reduced collagen synthesis at the transcriptional level in myopic scleras. PMID:22690110

  2. A model-based exploration of the role of pattern generating circuits during locomotor adaptation.

    PubMed

    Marjaninejad, Ali; Finley, James M

    2016-08-01

    In this study, we used a model-based approach to explore the potential contributions of central pattern generating circuits (CPGs) during adaptation to external perturbations during locomotion. We constructed a neuromechanical modeled of locomotion using a reduced-phase CPG controller and an inverted pendulum mechanical model. Two different forms of locomotor adaptation were examined in this study: split-belt treadmill adaptation and adaptation to a unilateral, elastic force field. For each simulation, we first examined the effects of phase resetting and varying the model's initial conditions on the resulting adaptation. After evaluating the effect of phase resetting on the adaptation of step length symmetry, we examined the extent to which the results from these simple models could explain previous experimental observations. We found that adaptation of step length symmetry during split-belt treadmill walking could be reproduced using our model, but this model failed to replicate patterns of adaptation observed in response to force field perturbations. Given that spinal animal models can adapt to both of these types of perturbations, our findings suggest that there may be distinct features of pattern generating circuits that mediate each form of adaptation.

  3. CpG island methylator phenotype in colorectal cancer

    PubMed Central

    Toyota, Minoru; Ahuja, Nita; Ohe-Toyota, Mutsumi; Herman, James G.; Baylin, Stephen B.; Issa, Jean-Pierre J.

    1999-01-01

    Aberrant methylation of promoter region CpG islands is associated with transcriptional inactivation of tumor-suppressor genes in neoplasia. To understand global patterns of CpG island methylation in colorectal cancer, we have used a recently developed technique called methylated CpG island amplification to examine 30 newly cloned differentially methylated DNA sequences. Of these 30 clones, 19 (63%) were progressively methylated in an age-dependent manner in normal colon, 7 (23%) were methylated in a cancer-specific manner, and 4 (13%) were methylated only in cell lines. Thus, a majority of CpG islands methylated in colon cancer are also methylated in a subset of normal colonic cells during the process of aging. In contrast, methylation of the cancer-specific clones was found exclusively in a subset of colorectal cancers, which appear to display a CpG island methylator phenotype (CIMP). CIMP+ tumors also have a high incidence of p16 and THBS1 methylation, and they include the majority of sporadic colorectal cancers with microsatellite instability related to hMLH1 methylation. We thus define a pathway in colorectal cancer that appears to be responsible for the majority of sporadic tumors with mismatch repair deficiency. PMID:10411935

  4. Identification of regions correlating MGMT promoter methylation and gene expression in glioblastomas

    PubMed Central

    Everhard, Sibille; Tost, Jörg; Abdalaoui, Hafida El; Crinière, Emmanuelle; Busato, Florence; Marie, Yannick; Gut, Ivo G.; Sanson, Marc; Mokhtari, Karima; Laigle-Donadey, Florence; Hoang-Xuan, Khê; Delattre, Jean-Yves; Thillet, Joëlle

    2009-01-01

    The O6-methylguanine-DNA methyltransferase gene (MGMT) is methylated in several cancers, including gliomas. However, the functional role of cysteine-phosphate-guanine (CpG) island (CGI) methylation in MGMT silencing is still controversial. The aim of this study was to investigate whether MGMT CGI methylation correlates inversely with RNA expression of MGMT in glioblastomas and to determine the CpG region whose methylation best reflects the level of expression. The methylation level of CpG sites that are potentially related to expression was investigated in 54 glioblastomas by pyrosequencing, a highly quantitative method, and analyzed with respect to their MGMT mRNA expression status. Three groups of patients were identified according to the methylation pattern of all 52 analyzed CpG sites. Overall, an 85% rate of concordance was observed between methylation and expression (p < 0.0001). When analyzing each CpG separately, six CpG sites were highly correlated with expression (p < 0.0001), and two CpG regions could be used as surrogate markers for RNA expression in 81.5% of the patients. This study indicates that there is good statistical agreement between MGMT methylation and expression, and that some CpG regions better reflect MGMT expression than do others. However, if transcriptional repression is the key mechanism in explaining the higher chemosensitivity of MGMT-methylated tumors, a substantial rate of discordance should lead clinicians to be cautious when deciding on a therapeutic strategy based on MGMT methylation status alone. PMID:19224763

  5. Identification of regions correlating MGMT promoter methylation and gene expression in glioblastomas.

    PubMed

    Everhard, Sibille; Tost, Jörg; El Abdalaoui, Hafida; Crinière, Emmanuelle; Busato, Florence; Marie, Yannick; Gut, Ivo G; Sanson, Marc; Mokhtari, Karima; Laigle-Donadey, Florence; Hoang-Xuan, Khê; Delattre, Jean-Yves; Thillet, Joëlle

    2009-08-01

    The O(6)-methylguanine-DNA methyltransferase gene (MGMT) is methylated in several cancers, including gliomas. However, the functional role of cysteine-phosphate-guanine (CpG) island (CGI) methylation in MGMT silencing is still controversial. The aim of this study was to investigate whether MGMT CGI methylation correlates inversely with RNA expression of MGMT in glioblastomas and to determine the CpG region whose methylation best reflects the level of expression. The methylation level of CpG sites that are potentially related to expression was investigated in 54 glioblastomas by pyrosequencing, a highly quantitative method, and analyzed with respect to their MGMT mRNA expression status. Three groups of patients were identified according to the methylation pattern of all 52 analyzed CpG sites. Overall, an 85% rate of concordance was observed between methylation and expression (p < 0.0001). When analyzing each CpG separately, six CpG sites were highly correlated with expression (p < 0.0001), and two CpG regions could be used as surrogate markers for RNA expression in 81.5% of the patients. This study indicates that there is good statistical agreement between MGMT methylation and expression, and that some CpG regions better reflect MGMT expression than do others. However, if transcriptional repression is the key mechanism in explaining the higher chemosensitivity of MGMT-methylated tumors, a substantial rate of discordance should lead clinicians to be cautious when deciding on a therapeutic strategy based on MGMT methylation status alone.

  6. Quadrupedal Robot Locomotion: A Biologically Inspired Approach and Its Hardware Implementation

    PubMed Central

    Espinal, A.; Rostro-Gonzalez, H.; Carpio, M.; Guerra-Hernandez, E. I.; Ornelas-Rodriguez, M.; Puga-Soberanes, H. J.; Sotelo-Figueroa, M. A.; Melin, P.

    2016-01-01

    A bioinspired locomotion system for a quadruped robot is presented. Locomotion is achieved by a spiking neural network (SNN) that acts as a Central Pattern Generator (CPG) producing different locomotion patterns represented by their raster plots. To generate these patterns, the SNN is configured with specific parameters (synaptic weights and topologies), which were estimated by a metaheuristic method based on Christiansen Grammar Evolution (CGE). The system has been implemented and validated on two robot platforms; firstly, we tested our system on a quadruped robot and, secondly, on a hexapod one. In this last one, we simulated the case where two legs of the hexapod were amputated and its locomotion mechanism has been changed. For the quadruped robot, the control is performed by the spiking neural network implemented on an Arduino board with 35% of resource usage. In the hexapod robot, we used Spartan 6 FPGA board with only 3% of resource usage. Numerical results show the effectiveness of the proposed system in both cases. PMID:27436997

  7. Quadrupedal Robot Locomotion: A Biologically Inspired Approach and Its Hardware Implementation.

    PubMed

    Espinal, A; Rostro-Gonzalez, H; Carpio, M; Guerra-Hernandez, E I; Ornelas-Rodriguez, M; Puga-Soberanes, H J; Sotelo-Figueroa, M A; Melin, P

    2016-01-01

    A bioinspired locomotion system for a quadruped robot is presented. Locomotion is achieved by a spiking neural network (SNN) that acts as a Central Pattern Generator (CPG) producing different locomotion patterns represented by their raster plots. To generate these patterns, the SNN is configured with specific parameters (synaptic weights and topologies), which were estimated by a metaheuristic method based on Christiansen Grammar Evolution (CGE). The system has been implemented and validated on two robot platforms; firstly, we tested our system on a quadruped robot and, secondly, on a hexapod one. In this last one, we simulated the case where two legs of the hexapod were amputated and its locomotion mechanism has been changed. For the quadruped robot, the control is performed by the spiking neural network implemented on an Arduino board with 35% of resource usage. In the hexapod robot, we used Spartan 6 FPGA board with only 3% of resource usage. Numerical results show the effectiveness of the proposed system in both cases.

  8. Immunostimulatory Properties of Lipid Modified CpG Oligonucleotides.

    PubMed

    Yu, Chunsong; An, Myunggi; Li, Meng; Liu, Haipeng

    2017-08-07

    Innate immune responses recognizing pathogen associated molecular patterns play important roles in adaptive immunity. As such, ligands which mimic the conserved products of microbial and activate innate immunity are widely used as adjuvants for vaccines. Synthetic single strand oligodeoxynucleotides (ODNs) containing unmethylated cytosine-guanine (CpG) motifs which bind Toll-like receptor 9 (TLR9) are powerful molecular adjuvants, potentiating both humoral and cellular responses. However, CpG ODN's in vitro potency has not been translated to in vivo settings primarily due to issues associated with delivery and toxicity. A major challenge in clinical application of CpG ODN is the efficient delivery to lymph nodes, the anatomic sites where all the immune responses are initiated. Targeting CpG to the key antigen presenting cells (APC) is essential for its application as a vaccine adjuvant, as it not only enhances CpG's efficacy, but also greatly reduces the systemic toxicity. We recently discovered an "albumin-hitchhiking" approach by which CpG ODNs were conjugated to a lipophilic lipid tail and follow subcutaneous injection, accumulated in lymph nodes by binding and transporting with endogenous albumin. This molecular approach targets CpG to antigen presenting cells in the draining lymph nodes via an endogenous albumin-mediated mechanism and simultaneously improves both the efficacy and safety of CpG as a vaccine adjuvant. Since CpG ODNs can be divided into structurally distinct classes, and each class of CpG ODN activates different types of immune cells and triggers different types of immunostimulatory activities, it is important to thoroughly evaluate the efficacy of this "albumin-hitchhiking" strategy in each class of CpG. Here we compare the immunostimulatory activities of three classes of lipid conjugated CpG ODNs in vitro and in vivo. Three representative sequences of lipid modified CpG ODNs were synthesized and their stimulatory effects as a vaccine adjuvant were evaluated. Our results showed that in vitro, lipid modified class A CpG exhibited enhanced stimulatory activities toward TLR transfected reporter cells or bone-marrow derived dendritic cells, whereas lipid-modification of class B or C CpG reduces the activation of TLR9 by 2-3 fold, as compared with unmodified class B and class C CpG, respectively. However, in vivo coadministration of ovalbumin (OVA) protein antigen mixed with lipid-conjugated class B or C CpG ODNs, but not class A CpGs induced dramatically increased OVA-specific humoral and cytotoxic CD8 + T cells responses compared with OVA mixed with unmodified CpGs. Further, lipid-modification greatly reduces the toxicity associated with CpG by minimizing the systemic dissemination. Taken together, these results demonstrated that amphiphilic modification of three classes of CpG motifs differentially affected and modulated the immunostimulatory activities in vitro and in vivo. Our study highlights the importance of in vivo lymph node targeting of CpG ODNs in fulfilling their use as vaccine adjuvants, providing implications for the rational design of molecular adjuvant for subunit vaccines.

  9. Temperature-dependent regulation of vocal pattern generator.

    PubMed

    Yamaguchi, Ayako; Gooler, David; Herrold, Amy; Patel, Shailja; Pong, Winnie W

    2008-12-01

    Vocalizations of Xenopus laevis are generated by central pattern generators (CPGs). The advertisement call of male X. laevis is a complex biphasic motor rhythm consisting of fast and slow trills (a train of clicks). We found that the trill rate of these advertisement calls is sensitive to temperature and that this rate modification of the vocal rhythms originates in the central pattern generators. In vivo the rates of fast and slow trills increased linearly with an increase in temperature. In vitro a similar linear relation between temperature and compound action potential frequency in the laryngeal nerve was found when fictive advertisement calls were evoked in the isolated brain. Temperature did not limit the contractile properties of laryngeal muscles within the frequency range of vocalizations. We next took advantage of the temperature sensitivity of the vocal CPG in vitro to localize the source of the vocal rhythms. We focused on the dorsal tegmental area of the medulla (DTAM), a brain stem nucleus that is essential for vocal production. We found that bilateral cooling of DTAM reduced both fast and slow trill rates. Thus we conclude that DTAM is a source of biphasic vocal rhythms.

  10. Evolution of central pattern generators and rhythmic behaviours

    PubMed Central

    Katz, Paul S.

    2016-01-01

    Comparisons of rhythmic movements and the central pattern generators (CPGs) that control them uncover principles about the evolution of behaviour and neural circuits. Over the course of evolutionary history, gradual evolution of behaviours and their neural circuitry within any lineage of animals has been a predominant occurrence. Small changes in gene regulation can lead to divergence of circuit organization and corresponding changes in behaviour. However, some behavioural divergence has resulted from large-scale rewiring of the neural network. Divergence of CPG circuits has also occurred without a corresponding change in behaviour. When analogous rhythmic behaviours have evolved independently, it has generally been with different neural mechanisms. Repeated evolution of particular rhythmic behaviours has occurred within some lineages due to parallel evolution or latent CPGs. Particular motor pattern generating mechanisms have also evolved independently in separate lineages. The evolution of CPGs and rhythmic behaviours shows that although most behaviours and neural circuits are highly conserved, the nature of the behaviour does not dictate the neural mechanism and that the presence of homologous neural components does not determine the behaviour. This suggests that although behaviour is generated by neural circuits, natural selection can act separately on these two levels of biological organization. PMID:26598733

  11. Evolution of central pattern generators and rhythmic behaviours.

    PubMed

    Katz, Paul S

    2016-01-05

    Comparisons of rhythmic movements and the central pattern generators (CPGs) that control them uncover principles about the evolution of behaviour and neural circuits. Over the course of evolutionary history, gradual evolution of behaviours and their neural circuitry within any lineage of animals has been a predominant occurrence. Small changes in gene regulation can lead to divergence of circuit organization and corresponding changes in behaviour. However, some behavioural divergence has resulted from large-scale rewiring of the neural network. Divergence of CPG circuits has also occurred without a corresponding change in behaviour. When analogous rhythmic behaviours have evolved independently, it has generally been with different neural mechanisms. Repeated evolution of particular rhythmic behaviours has occurred within some lineages due to parallel evolution or latent CPGs. Particular motor pattern generating mechanisms have also evolved independently in separate lineages. The evolution of CPGs and rhythmic behaviours shows that although most behaviours and neural circuits are highly conserved, the nature of the behaviour does not dictate the neural mechanism and that the presence of homologous neural components does not determine the behaviour. This suggests that although behaviour is generated by neural circuits, natural selection can act separately on these two levels of biological organization. © 2015 The Author(s).

  12. Genomic sequencing and in vivo footprinting of an expression-specific DNase I-hypersensitive site of avian vitellogenin II promoter reveal a demethylation of a mCpG and a change in specific interactions of proteins with DNA.

    PubMed Central

    Saluz, H P; Feavers, I M; Jiricny, J; Jost, J P

    1988-01-01

    Genomic sequencing was used to study the in vivo methylation pattern of two CpG sites in the promoter region of the avian vitellogenin gene. The CpG at position +10 was fully methylated in DNA isolated from tissues that do not express the gene but was unmethylated in the liver of mature hens and estradiol-treated roosters. In the latter tissue, this site became demethylated and DNase I hypersensitive after estradiol treatment. A second CpG (position -52) was unmethylated in all tissues examined. In vivo genomic footprinting with dimethyl sulfate revealed different patterns of DNA protection in silent and expressed genes. In rooster liver cells, at least 10 base pairs of DNA, including the methylated CpG, were protected by protein(s). Gel-shift assays indicated that a protein factor, present in rooster liver nuclear extract, bound at this site only when it was methylated. In hen liver cells, the same unmethylated CpG lies within a protected region of approximately equal to 20 base pairs. In vitro DNase I protection and gel-shift assays indicate that this sequence is bound by a protein, which binds both double- and single-stranded DNA. For the latter substrate, this factor was shown to bind solely the noncoding (i.e., mRNA-like) strand. Images PMID:3413118

  13. Asymmetric DNA methylation of CpG dyads is a feature of secondary DMRs associated with the Dlk1/Gtl2 imprinting cluster in mouse.

    PubMed

    Guntrum, Megan; Vlasova, Ekaterina; Davis, Tamara L

    2017-01-01

    Differential DNA methylation plays a critical role in the regulation of imprinted genes. The differentially methylated state of the imprinting control region is inherited via the gametes at fertilization, and is stably maintained in somatic cells throughout development, influencing the expression of genes across the imprinting cluster. In contrast, DNA methylation patterns are more labile at secondary differentially methylated regions which are established at imprinted loci during post-implantation development. To investigate the nature of these more variably methylated secondary differentially methylated regions, we adopted a hairpin linker bisulfite mutagenesis approach to examine CpG dyad methylation at differentially methylated regions associated with the murine Dlk1/Gtl2 imprinting cluster on both complementary strands. We observed homomethylation at greater than 90% of the methylated CpG dyads at the IG-DMR, which serves as the imprinting control element. In contrast, homomethylation was only observed at 67-78% of the methylated CpG dyads at the secondary differentially methylated regions; the remaining 22-33% of methylated CpG dyads exhibited hemimethylation. We propose that this high degree of hemimethylation could explain the variability in DNA methylation patterns at secondary differentially methylated regions associated with imprinted loci. We further suggest that the presence of 5-hydroxymethylation at secondary differentially methylated regions may result in hemimethylation and methylation variability as a result of passive and/or active demethylation mechanisms.

  14. Design of Spiking Central Pattern Generators for Multiple Locomotion Gaits in Hexapod Robots by Christiansen Grammar Evolution

    PubMed Central

    Espinal, Andres; Rostro-Gonzalez, Horacio; Carpio, Martin; Guerra-Hernandez, Erick I.; Ornelas-Rodriguez, Manuel; Sotelo-Figueroa, Marco

    2016-01-01

    This paper presents a method to design Spiking Central Pattern Generators (SCPGs) to achieve locomotion at different frequencies on legged robots. It is validated through embedding its designs into a Field-Programmable Gate Array (FPGA) and implemented on a real hexapod robot. The SCPGs are automatically designed by means of a Christiansen Grammar Evolution (CGE)-based methodology. The CGE performs a solution for the configuration (synaptic weights and connections) for each neuron in the SCPG. This is carried out through the indirect representation of candidate solutions that evolve to replicate a specific spike train according to a locomotion pattern (gait) by measuring the similarity between the spike trains and the SPIKE distance to lead the search to a correct configuration. By using this evolutionary approach, several SCPG design specifications can be explicitly added into the SPIKE distance-based fitness function, such as looking for Spiking Neural Networks (SNNs) with minimal connectivity or a Central Pattern Generator (CPG) able to generate different locomotion gaits only by changing the initial input stimuli. The SCPG designs have been successfully implemented on a Spartan 6 FPGA board and a real time validation on a 12 Degrees Of Freedom (DOFs) hexapod robot is presented. PMID:27516737

  15. Prediction of epigenetically regulated genes in breast cancer cell lines

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Loss, Leandro A; Sadanandam, Anguraj; Durinck, Steffen

    Methylation of CpG islands within the DNA promoter regions is one mechanism that leads to aberrant gene expression in cancer. In particular, the abnormal methylation of CpG islands may silence associated genes. Therefore, using high-throughput microarrays to measure CpG island methylation will lead to better understanding of tumor pathobiology and progression, while revealing potentially new biomarkers. We have examined a recently developed high-throughput technology for measuring genome-wide methylation patterns called mTACL. Here, we propose a computational pipeline for integrating gene expression and CpG island methylation profles to identify epigenetically regulated genes for a panel of 45 breast cancer cell lines,more » which is widely used in the Integrative Cancer Biology Program (ICBP). The pipeline (i) reduces the dimensionality of the methylation data, (ii) associates the reduced methylation data with gene expression data, and (iii) ranks methylation-expression associations according to their epigenetic regulation. Dimensionality reduction is performed in two steps: (i) methylation sites are grouped across the genome to identify regions of interest, and (ii) methylation profles are clustered within each region. Associations between the clustered methylation and the gene expression data sets generate candidate matches within a fxed neighborhood around each gene. Finally, the methylation-expression associations are ranked through a logistic regression, and their significance is quantified through permutation analysis. Our two-step dimensionality reduction compressed 90% of the original data, reducing 137,688 methylation sites to 14,505 clusters. Methylation-expression associations produced 18,312 correspondences, which were used to further analyze epigenetic regulation. Logistic regression was used to identify 58 genes from these correspondences that showed a statistically signifcant negative correlation between methylation profles and gene expression in the panel of breast cancer cell lines. Subnetwork enrichment of these genes has identifed 35 common regulators with 6 or more predicted markers. In addition to identifying epigenetically regulated genes, we show evidence of differentially expressed methylation patterns between the basal and luminal subtypes. Our results indicate that the proposed computational protocol is a viable platform for identifying epigenetically regulated genes. Our protocol has generated a list of predictors including COL1A2, TOP2A, TFF1, and VAV3, genes whose key roles in epigenetic regulation is documented in the literature. Subnetwork enrichment of these predicted markers further suggests that epigenetic regulation of individual genes occurs in a coordinated fashion and through common regulators.« less

  16. Enhancement of infectious disease vaccines through TLR9-dependent recognition of CpG DNA.

    PubMed

    McCluskie, M J; Krieg, A M

    2006-01-01

    The adaptive immune system-with its remarkable ability to generate antigen-specific antibodies and T lymphocytes against pathogens never before "seen" by an organism-is one of the marvels of evolution. However, to generate these responses, the adaptive immune system requires activation by the innate immune system. Toll-like receptors (TLRs) are perhaps the best-understood family of innate immune receptors for detecting infections and stimulating adaptive immune responses. TLR9 appears to have evolved to recognize infections by a subtle structural difference between eukaryotic and prokaryotic/viral DNA; only the former frequently methylates CpG dinucleotides. Used as vaccine adjuvants, synthetic oligodeoxynucleotide (ODN) ligands for TLR9--CpG ODN--greatly enhance the speed and strength of the immune responses to vaccination.

  17. Hebbian Plasticity in CPG Controllers Facilitates Self-Synchronization for Human-Robot Handshaking.

    PubMed

    Jouaiti, Melanie; Caron, Lancelot; Hénaff, Patrick

    2018-01-01

    It is well-known that human social interactions generate synchrony phenomena which are often unconscious. If the interaction between individuals is based on rhythmic movements, synchronized and coordinated movements will emerge from the social synchrony. This paper proposes a plausible model of plastic neural controllers that allows the emergence of synchronized movements in physical and rhythmical interactions. The controller is designed with central pattern generators (CPG) based on rhythmic Rowat-Selverston neurons endowed with neuronal and synaptic Hebbian plasticity. To demonstrate the interest of the proposed model, the case of handshaking is considered because it is a very common, both physically and socially, but also, a very complex act in the point of view of robotics, neuroscience and psychology. Plastic CPGs controllers are implemented in the joints of a simulated robotic arm that has to learn the frequency and amplitude of an external force applied to its effector, thus reproducing the act of handshaking with a human. Results show that the neural and synaptic Hebbian plasticity are working together leading to a natural and autonomous synchronization between the arm and the external force even if the frequency is changing during the movement. Moreover, a power consumption analysis shows that, by offering emergence of synchronized and coordinated movements, the plasticity mechanisms lead to a significant decrease in the energy spend by the robot actuators thus generating a more adaptive and natural human/robot handshake.

  18. Sensitivity analysis of multi-objective optimization of CPG parameters for quadruped robot locomotion

    NASA Astrophysics Data System (ADS)

    Oliveira, Miguel; Santos, Cristina P.; Costa, Lino

    2012-09-01

    In this paper, a study based on sensitivity analysis is performed for a gait multi-objective optimization system that combines bio-inspired Central Patterns Generators (CPGs) and a multi-objective evolutionary algorithm based on NSGA-II. In this system, CPGs are modeled as autonomous differential equations, that generate the necessary limb movement to perform the required walking gait. In order to optimize the walking gait, a multi-objective problem with three conflicting objectives is formulated: maximization of the velocity, the wide stability margin and the behavioral diversity. The experimental results highlight the effectiveness of this multi-objective approach and the importance of the objectives to find different walking gait solutions for the quadruped robot.

  19. Levels of DNA Methylation Vary at CpG Sites across the BRCA1 Promoter, and Differ According to Triple Negative and "BRCA-Like" Status, in Both Blood and Tumour DNA.

    PubMed

    Daniels, Sarah L; Burghel, George J; Chambers, Philip; Al-Baba, Shadi; Connley, Daniel D; Brock, Ian W; Cramp, Helen E; Dotsenko, Olena; Wilks, Octavia; Wyld, Lynda; Cross, Simon S; Cox, Angela

    2016-01-01

    Triple negative breast cancer is typically an aggressive and difficult to treat subtype. It is often associated with loss of function of the BRCA1 gene, either through mutation, loss of heterozygosity or methylation. This study aimed to measure methylation of the BRCA1 gene promoter at individual CpG sites in blood, tumour and normal breast tissue, to assess whether levels were correlated between different tissues, and with triple negative receptor status, histopathological scoring for BRCA-like features and BRCA1 protein expression. Blood DNA methylation levels were significantly correlated with tumour methylation at 9 of 11 CpG sites examined (p<0.0007). The levels of tumour DNA methylation were significantly higher in triple negative tumours, and in tumours with high BRCA-like histopathological scores (10 of 11 CpG sites; p<0.01 and p<0.007 respectively). Similar results were observed in blood DNA (6 of 11 CpG sites; p<0.03 and 7 of 11 CpG sites; p<0.02 respectively). This study provides insight into the pattern of CpG methylation across the BRCA1 promoter, and supports previous studies suggesting that tumours with BRCA1 promoter methylation have similar features to those with BRCA1 mutations, and therefore may be suitable for the same targeted therapies.

  20. Episodic swimming in the larval zebrafish is generated by a spatially distributed spinal network with modular functional organization

    PubMed Central

    Wiggin, Timothy D.; Anderson, Tatiana M.; Eian, John; Peck, Jack H.

    2012-01-01

    Despite the diverse methods vertebrates use for locomotion, there is evidence that components of the locomotor central pattern generator (CPG) are conserved across species. When zebrafish begin swimming early in development, they perform short episodes of activity separated by periods of inactivity. Within these episodes, the trunk flexes with side-to-side alternation and the traveling body wave progresses rostrocaudally. To characterize the distribution of the swimming CPG along the rostrocaudal axis, we performed transections of the larval zebrafish spinal cord and induced fictive swimming using N-methyl-d-aspartate (NMDA). In both intact and spinalized larvae, bursting is found throughout the rostrocaudal extent of the spinal cord, and the properties of fictive swimming observed were dependent on the concentration of NMDA. We isolated series of contiguous spinal segments by performing multiple spinal transections on the same larvae. Although series from all regions of the spinal cord have the capacity to produce bursts, the capacity to produce organized episodes of fictive swimming has a rostral bias: in the rostral spinal cord, only 12 contiguous body segments are necessary, whereas 23 contiguous body segments are necessary in the caudal spinal cord. Shorter series of segments were often active but produced either continuous rhythmic bursting or sporadic, nonrhythmic bursting. Both episodic and continuous bursting alternated between the left and right sides of the body and showed rostrocaudal progression, demonstrating the functional dissociation of the circuits responsible for episodic structure and fine burst timing. These findings parallel results in mammalian locomotion, and we propose a hierarchical model of the larval zebrafish swimming CPG. PMID:22572943

  1. Modelling gait transition in two-legged animals

    NASA Astrophysics Data System (ADS)

    Pinto, Carla M. A.; Santos, Alexandra P.

    2011-12-01

    The study of locomotor patterns has been a major research goal in the last decades. Understanding how intralimb and interlimb coordination works out so well in animals' locomotion is a hard and challenging task. Many models have been proposed to model animal's rhythms. These models have also been applied to the control of rhythmic movements of adaptive legged robots, namely biped, quadruped and other designs. In this paper we study gait transition in a central pattern generator (CPG) model for bipeds, the 4-cells model. This model is proposed by Golubitsky, Stewart, Buono and Collins and is studied further by Pinto and Golubitsky. We briefly resume the work done by Pinto and Golubitsky. We compute numerically gait transition in the 4-cells CPG model for bipeds. We use Morris-Lecar equations and Wilson-Cowan equations as the internal dynamics for each cell. We also consider two types of coupling between the cells: diffusive and synaptic. We obtain secondary gaits by bifurcation of primary gaits, by varying the coupling strengths. Nevertheless, some bifurcating branches could not be obtained, emphasizing the fact that despite analytically those bifurcations exist, finding them is a hard task and requires variation of other parameters of the equations. We note that the type of coupling did not influence the results.

  2. Central pattern generators for social vocalization: Androgen-dependent neurophysiological mechanisms

    PubMed Central

    Bass, Andrew H.; Remage-Healey, Luke

    2008-01-01

    Historically, most studies of vertebrate central pattern generators (CPGs) have focused on mechanisms for locomotion and respiration. Here, we highlight new results for ectothermic vertebrates, namely teleost fish and amphibians, showing how androgenic steroids can influence the temporal patterning of CPGs for social vocalization. Investigations of vocalizing teleosts show how androgens can rapidly (within minutes) modulate the neurophysiological output of the vocal CPG (fictive vocalizations that mimic the temporal properties of natural vocalizations) inclusive of their divergent actions between species, as well as intraspecific differences between male reproductive morphs. Studies of anuran amphibians (frogs) demonstrate that long-term steroid treatments (wks) can masculinize the fictive vocalizations of females, inclusive of its sensitivity to rapid modulation by serotonin. Given the conserved organization of vocal control systems across vertebrate groups, the vocal CPGs of fish and amphibians provide tractable models for identifying androgen-dependent events that are fundamental to the mechanisms of vocal motor patterning. These basic mechanisms can also inform our understanding of the more complex CPGs for vocalization, and social behaviors in general, that have evolved among birds and mammals. PMID:18262186

  3. Combined DNA methylation and gene expression profiling in gastrointestinal stromal tumors reveals hypomethylation of SPP1 as an independent prognostic factor.

    PubMed

    Haller, Florian; Zhang, Jitao David; Moskalev, Evgeny A; Braun, Alexander; Otto, Claudia; Geddert, Helene; Riazalhosseini, Yasser; Ward, Aoife; Balwierz, Aleksandra; Schaefer, Inga-Marie; Cameron, Silke; Ghadimi, B Michael; Agaimy, Abbas; Fletcher, Jonathan A; Hoheisel, Jörg; Hartmann, Arndt; Werner, Martin; Wiemann, Stefan; Sahin, Ozgür

    2015-03-01

    Gastrointestinal stromal tumors (GISTs) have distinct gene expression patterns according to localization, genotype and aggressiveness. DNA methylation at CpG dinucleotides is an important mechanism for regulation of gene expression. We performed targeted DNA methylation analysis of 1.505 CpG loci in 807 cancer-related genes in a cohort of 76 GISTs, combined with genome-wide mRNA expression analysis in 22 GISTs, to identify signatures associated with clinicopathological parameters and prognosis. Principal component analysis revealed distinct DNA methylation patterns associated with anatomical localization, genotype, mitotic counts and clinical follow-up. Methylation of a single CpG dinucleotide in the non-CpG island promoter of SPP1 was significantly correlated with shorter disease-free survival. Hypomethylation of this CpG was an independent prognostic parameter in a multivariate analysis compared to anatomical localization, genotype, tumor size and mitotic counts in a cohort of 141 GISTs with clinical follow-up. The epigenetic regulation of SPP1 was confirmed in vitro, and the functional impact of SPP1 protein on tumorigenesis-related signaling pathways was demonstrated. In summary, SPP1 promoter methylation is a novel and independent prognostic parameter in GISTs, and might be helpful in estimating the aggressiveness of GISTs from the intermediate-risk category. © 2014 UICC.

  4. Topical CpG enhances the response of murine malignant melanoma to dacarbazine.

    PubMed

    Najar, Hossain M; Dutz, Jan P

    2008-09-01

    Malignant melanoma is a potentially fatal skin cancer that is increasing in incidence. Standard chemoimmunotherapy consisting of dacarbazine (DTIC) given with IFN-alpha has had disappointing results. We describe a chemoimmunotherapy protocol for cutaneous melanoma that combines the administration of DTIC with the topical application of CpG oligodinucleotide (ODN). Subcutaneous B16 melanoma tumors in C57BL/6 mice were treated with intraperitoneal injections of DTIC followed by the topical application of CpG-ODN over the tumors. This therapeutic approach abrogated the growth of established tumors and significantly enhanced survival. Topical CpG application was more effective than intratumoral CpG. Cell depletion studies indicated that the antitumor effect was dependent on both CD4(+) and CD8(+) cells but not on natural killer (NK) cells. Tumor-specific cytotoxic T-lymphocyte activity was generated in treated animals and was highest in topically treated animals. Immunohistochemical analysis revealed that DTIC, but not CpG, enhanced tumor cell apoptosis. Further, topical CpG induced an expansion of a B220(+)CD8(+) subset of dendritic cells and a subset of NK1.1(+) CD11c(+) cells within the tumors. By enhancing both tumor cell death and local immune activation, DTIC/topical CpG chemoimmunotherapy induced an effective T-cell-dependent host-immune response against melanoma.

  5. Physiological characterization, localization and synaptic inputs of bursting and nonbursting neurons in the trigeminal principal sensory nucleus of the rat.

    PubMed

    Athanassiadis, T; Westberg, K-G; Olsson, K A; Kolta, A

    2005-12-01

    A population of neurons in the trigeminal principal sensory nucleus (NVsnpr) fire rhythmically during fictive mastication induced in the in vivo rabbit. To elucidate whether these neurons form part of the central pattern generator (CPG) for mastication, we performed intracellular recordings in brainstem slices taken from young rats. Two cell types were defined, nonbursting (63%) and bursting (37%). In response to membrane depolarization, bursting cells, which dominated in the dorsal part of the NVsnpr, fired an initial burst followed by single spikes or recurring bursts. Non-bursting neurons, scattered throughout the nucleus, fired single action potentials. Microstimulation applied to the trigeminal motor nucleus (NVmt), the reticular border zone surrounding the NVmt, the parvocellular reticular formation or the nucleus reticularis pontis caudalis (NPontc) elicited a postsynaptic potential in 81% of the neurons tested for synaptic inputs. Responses obtained were predominately excitatory and sensitive to glutamatergic antagonists DNQX and/or APV. Some inhibitory and biphasic responses were also evoked. Bicuculline methiodide or strychnine blocked the IPSPs indicating that they were mediated by GABA(A) or glycinergic receptors. About one-third of the stimulations activated both types of neurons antidromically, mostly from the masseteric motoneuron pool of NVmt and dorsal part of NPontc. In conclusion, our new findings show that some neurons in the dorsal NVsnpr display both firing properties and axonal connections which support the hypothesis that they may participate in masticatory pattern generation. Thus, the present data provide an extended basis for further studies on the organization of the masticatory CPG network.

  6. Profiling the genome-wide DNA methylation pattern of porcine ovaries using reduced representation bisulfite sequencing.

    PubMed

    Yuan, Xiao-Long; Gao, Ning; Xing, Yan; Zhang, Hai-Bin; Zhang, Ai-Ling; Liu, Jing; He, Jin-Long; Xu, Yuan; Lin, Wen-Mian; Chen, Zan-Mou; Zhang, Hao; Zhang, Zhe; Li, Jia-Qi

    2016-02-25

    Substantial evidence has shown that DNA methylation regulates the initiation of ovarian and sexual maturation. Here, we investigated the genome-wide profile of DNA methylation in porcine ovaries at single-base resolution using reduced representation bisulfite sequencing. The biological variation was minimal among the three ovarian replicates. We found hypermethylation frequently occurred in regions with low gene abundance, while hypomethylation in regions with high gene abundance. The DNA methylation around transcriptional start sites was negatively correlated with their own CpG content. Additionally, the methylation level in the bodies of genes was higher than that in their 5' and 3' flanking regions. The DNA methylation pattern of the low CpG content promoter genes differed obviously from that of the high CpG content promoter genes. The DNA methylation level of the porcine ovary was higher than that of the porcine intestine. Analyses of the genome-wide DNA methylation in porcine ovaries would advance the knowledge and understanding of the porcine ovarian methylome.

  7. Information to cerebellum on spinal motor networks mediated by the dorsal spinocerebellar tract

    PubMed Central

    Stecina, Katinka; Fedirchuk, Brent; Hultborn, Hans

    2013-01-01

    The main objective of this review is to re-examine the type of information transmitted by the dorsal and ventral spinocerebellar tracts (DSCT and VSCT respectively) during rhythmic motor actions such as locomotion. Based on experiments in the 1960s and 1970s, the DSCT was viewed as a relay of peripheral sensory input to the cerebellum in general, and during rhythmic movements such as locomotion and scratch. In contrast, the VSCT was seen as conveying a copy of the output of spinal neuronal circuitry, including those circuits generating rhythmic motor activity (the spinal central pattern generator, CPG). Emerging anatomical and electrophysiological information on the putative subpopulations of DSCT and VSCT neurons suggest differentiated functions for some of the subpopulations. Multiple lines of evidence support the notion that sensory input is not the only source driving DSCT neurons and, overall, there is a greater similarity between DSCT and VSCT activity than previously acknowledged. Indeed the majority of DSCT cells can be driven by spinal CPGs for locomotion and scratch without phasic sensory input. It thus seems natural to propose the possibility that CPG input to some of these neurons may contribute to distinguishing sensory inputs that are a consequence of the active locomotion from those resulting from perturbations in the external world. PMID:23613538

  8. Quadruped robots' modular trajectories: Stability issues

    NASA Astrophysics Data System (ADS)

    Pinto, Carla M. A.

    2012-09-01

    Pinto, Santos, Rocha and Matos [13, 12] study a CPG model for the generation of modular trajectories of quadruped robots. They consider that each movement is composed of two types of primitives: rhythmic and discrete. The rhythmic primitive models the periodic patterns and the discrete primitive is inserted as a perturbation of those patterns. In this paper we begin to tackle numerically the problem of the stability of that mathematical model. We observe that if the discrete part is inserted in all limbs, with equal values, and as an offset of the rhythmic part, the obtained gait is stable and has the same spatial and spatio-temporal symmetry groups as the purely rhythmic gait, differing only on the value of the offset.

  9. Rhythm Pattern of Sole through Electrification of the Human Body When Walking

    NASA Astrophysics Data System (ADS)

    Takiguchi, Kiyoaki; Wada, Takayuki; Tohyama, Shigeki

    The rhythm of automatic cyclic movements such as walking is known to be generated by a rhythm generator called CPG in the spinal cord. The measurement of rhythm characteristics in walking is considered to be important for analyzing human bipedal walking and adaptive walking on irregular terrain. In particular, the soles that contact the terrain surface perform flexible movements similar to the movement of the fins of a lungfish, which is considered to be the predecessor of land animals. The sole movements are believed to be a basic movement acquired during prehistoric times. The detailed rhythm pattern of sole motion is considered to be important. We developed a method for measuring electrification without installing device on a subject's body and footwear for stabilizing the electrification of the human body. We measured the rhythm pattern of 20 subjects including 4 infants when walking by using this system and the corresponding equipment. Therefore, we confirmed the commonality of the correlative rhythm patterns of 20 subjects. Further, with regard to an individual subject, the reproducibility of a rhythm pattern with strong correlation coefficient > 0.93 ± 0.5 (mean ± SD) concerning rhythms of trials that are differently conducted on adult subjects could be confirmed.

  10. Performance of Different Analytical Software Packages in Quantification of DNA Methylation by Pyrosequencing.

    PubMed

    Grasso, Chiara; Trevisan, Morena; Fiano, Valentina; Tarallo, Valentina; De Marco, Laura; Sacerdote, Carlotta; Richiardi, Lorenzo; Merletti, Franco; Gillio-Tos, Anna

    2016-01-01

    Pyrosequencing has emerged as an alternative method of nucleic acid sequencing, well suited for many applications which aim to characterize single nucleotide polymorphisms, mutations, microbial types and CpG methylation in the target DNA. The commercially available pyrosequencing systems can harbor two different types of software which allow analysis in AQ or CpG mode, respectively, both widely employed for DNA methylation analysis. Aim of the study was to assess the performance for DNA methylation analysis at CpG sites of the two pyrosequencing software which allow analysis in AQ or CpG mode, respectively. Despite CpG mode having been specifically generated for CpG methylation quantification, many investigations on this topic have been carried out with AQ mode. As proof of equivalent performance of the two software for this type of analysis is not available, the focus of this paper was to evaluate if the two modes currently used for CpG methylation assessment by pyrosequencing may give overlapping results. We compared the performance of the two software in quantifying DNA methylation in the promoter of selected genes (GSTP1, MGMT, LINE-1) by testing two case series which include DNA from paraffin embedded prostate cancer tissues (PC study, N = 36) and DNA from blood fractions of healthy people (DD study, N = 28), respectively. We found discrepancy in the two pyrosequencing software-based quality assignment of DNA methylation assays. Compared to the software for analysis in the AQ mode, less permissive criteria are supported by the Pyro Q-CpG software, which enables analysis in CpG mode. CpG mode warns the operators about potential unsatisfactory performance of the assay and ensures a more accurate quantitative evaluation of DNA methylation at CpG sites. The implementation of CpG mode is strongly advisable in order to improve the reliability of the methylation analysis results achievable by pyrosequencing.

  11. CpG Distribution and Methylation Pattern in Porcine Parvovirus

    PubMed Central

    Tóth, Renáta; Mészáros, István; Stefancsik, Rajmund; Bartha, Dániel; Bálint, Ádám; Zádori, Zoltán

    2013-01-01

    Based on GC content and the observed/expected CpG ratio (oCpGr), we found three major groups among the members of subfamily Parvovirinae: Group I parvoviruses with low GC content and low oCpGr values, Group II with low GC content and high oCpGr values and Group III with high GC content and high oCpGr values. Porcine parvovirus belongs to Group I and it features an ascendant CpG distribution by position in its coding regions similarly to the majority of the parvoviruses. The entire PPV genome remains hypomethylated during the viral lifecycle independently from the tissue of origin. In vitro CpG methylation of the genome has a modest inhibitory effect on PPV replication. The in vitro hypermethylation disappears from the replicating PPV genome suggesting that beside the maintenance DNMT1 the de novo DNMT3a and DNMT3b DNA methyltransferases can’t methylate replicating PPV DNA effectively either, despite that the PPV infection does not seem to influence the expression, translation or localization of the DNA methylases. SNP analysis revealed high mutability of the CpG sites in the PPV genome, while introduction of 29 extra CpG sites into the genome has no significant biological effects on PPV replication in vitro. These experiments raise the possibility that beyond natural selection mutational pressure may also significantly contribute to the low level of the CpG sites in the PPV genome. PMID:24392033

  12. Levels of DNA Methylation Vary at CpG Sites across the BRCA1 Promoter, and Differ According to Triple Negative and “BRCA-Like” Status, in Both Blood and Tumour DNA

    PubMed Central

    Burghel, George J.; Chambers, Philip; Al-Baba, Shadi; Connley, Daniel D.; Brock, Ian W.; Cramp, Helen E.; Dotsenko, Olena; Wilks, Octavia; Wyld, Lynda; Cross, Simon S.; Cox, Angela

    2016-01-01

    Triple negative breast cancer is typically an aggressive and difficult to treat subtype. It is often associated with loss of function of the BRCA1 gene, either through mutation, loss of heterozygosity or methylation. This study aimed to measure methylation of the BRCA1 gene promoter at individual CpG sites in blood, tumour and normal breast tissue, to assess whether levels were correlated between different tissues, and with triple negative receptor status, histopathological scoring for BRCA-like features and BRCA1 protein expression. Blood DNA methylation levels were significantly correlated with tumour methylation at 9 of 11 CpG sites examined (p<0.0007). The levels of tumour DNA methylation were significantly higher in triple negative tumours, and in tumours with high BRCA-like histopathological scores (10 of 11 CpG sites; p<0.01 and p<0.007 respectively). Similar results were observed in blood DNA (6 of 11 CpG sites; p<0.03 and 7 of 11 CpG sites; p<0.02 respectively). This study provides insight into the pattern of CpG methylation across the BRCA1 promoter, and supports previous studies suggesting that tumours with BRCA1 promoter methylation have similar features to those with BRCA1 mutations, and therefore may be suitable for the same targeted therapies. PMID:27463681

  13. Characterization of Immune Responses to an Inactivated Avian Influenza Virus Vaccine Adjuvanted with Nanoparticles Containing CpG ODN.

    PubMed

    Singh, Shirene M; Alkie, Tamiru N; Abdelaziz, Khaled Taha; Hodgins, Douglas C; Novy, Anastasia; Nagy, Éva; Sharif, Shayan

    2016-06-01

    Avian influenza virus (AIV), a mucosal pathogen, gains entry into host chickens through respiratory and gastrointestinal routes. Most commercial AIV vaccines for poultry consist of inactivated, whole virus with adjuvant, delivered by parenteral administration. Recent advances in vaccine development have led to the application of nanoparticle emulsion delivery systems, such as poly (d,l-lactic-co-glycolic acid) (PLGA) nanoparticles to enhance antigen-specific immune responses. In chickens, the Toll-like receptor 21 ligand, CpG oligodeoxynucleotides (ODNs), have been demonstrated to be immunostimulatory. The objective of this study was to compare the adjuvant potential of CpG ODN 2007 encapsulated in PLGA nanoparticles with nonencapsulated CpG ODN 2007 when combined with a formalin-inactivated H9N2 virus, through intramuscular and aerosol delivery routes. Chickens were vaccinated at days 7 and 21 posthatch for the intramuscular route and at days 7, 21, and 35 for the aerosol route. Antibody-mediated responses were evaluated weekly in sera and lacrimal secretions in specific pathogen-free chickens. The results indicate that nonencapsulated CpG ODN 2007 in inactivated AIV vaccines administered by the intramuscular route generated higher antibody responses compared to the encapsulated CpG ODN 2007 formulation by the same route. Additionally, encapsulated CpG ODN 2007 in AIV vaccines administered by the aerosol route elicited higher mucosal responses compared to nonencapsulated CpG ODN 2007. Future studies may be aimed at evaluating protective immune responses induced with PLGA encapsulation of AIV and adjuvants.

  14. Lack of chart reminder effectiveness on family medicine resident JNC-VI and NCEP III guideline knowledge and attitudes.

    PubMed

    Echlin, Paul S; Upshur, Ross E G; Markova, Tsveti P

    2004-07-05

    The literature demonstrates that medical residents and practicing physicians have an attitudinal-behavioral discordance concerning their positive attitudes towards clinical practice guidelines (CPG), and the implementation of these guidelines into clinical practice patterns. A pilot study was performed to determine if change in a previously identified CPG compliance factor (accessibility) would produce a significant increase in family medicine resident knowledge and attitude toward the guidelines. The primary study intervention involved placing a summary of the Sixth Report of the Joint National Committee on Prevention, Detection, Evaluation, and Treatment of High Blood Pressure (JNC VI) and the National Cholesterol Education Program Expert Panel on Detection, Evaluation, and Treatment of High Blood Cholesterol in Adults (NCEP III) CPGs in all patient (>18 yr.) charts for a period of three months. The JNC VI and NCEP III CPGs were also distributed to each Wayne State family medicine resident, and a copy of each CPG was placed in the preceptor's area of the involved clinics. Identical pre- and post- intervention questionnaires were administered to all residents concerning CPG knowledge and attitude. Post-intervention analysis failed to demonstrate a significant difference in CPG knowledge. A statistically significant post-intervention difference was found in only on attitude question. The barriers to CPG compliance were identified as 1) lack of CPG instruction; 2) lack of critical appraisal ability; 3) insufficient time; 4) lack of CPG accessibility; and 5) lack of faculty modeling. This study demonstrated no significant post intervention changes in CPG knowledge, and only one question that reflected attitude change. Wider resident access to dedicated clinic time, increased faculty modeling, and the implementation of an electronic record/reminder system that uses a team-based approach are compliance factors that should be considered for further investigation. The interpretation of CPG non-compliance will benefit from a causal matrix focused on physician knowledge, attitudes, and behavior. Recent findings in resident knowledge-behavior discordance may direct the future investigation of physician CPG non-compliance away from generalized barrier research, and toward the development of information that maximizes the sense of individual practitioner urgency and certainty.

  15. Characterization of a cerebral palsy-like model in rats: Analysis of gait pattern and of brain and spinal cord motor areas.

    PubMed

    Dos Santos, Adriana Souza; de Almeida, Wellington; Popik, Bruno; Sbardelotto, Bruno Marques; Torrejais, Márcia Miranda; de Souza, Marcelo Alves; Centenaro, Lígia Aline

    2017-08-01

    In an attempt to propose an animal model that reproduces in rats the phenotype of cerebral palsy, this study evaluated the effects of maternal exposure to bacterial endotoxin associated with perinatal asphyxia and sensorimotor restriction on gait pattern, brain and spinal cord morphology. Two experimental groups were used: Control Group (CTG) - offspring of rats injected with saline during pregnancy and Cerebral Palsy Group (CPG) - offspring of rats injected with lipopolysaccharide during pregnancy, submitted to perinatal asphyxia and sensorimotor restriction for 30days. At 29days of age, the CPG exhibited coordination between limbs, weight-supported dorsal steps or weight-supported plantar steps with paw rotation. At 45days of age, CPG exhibited plantar stepping with the paw rotated in the balance phase. An increase in the number of glial cells in the primary somatosensory cortex and dorsal striatum were observed in the CPG, but the corpus callosum thickness and cross-sectional area of lateral ventricle were similar between studied groups. No changes were found in the number of motoneurons, glial cells and soma area of the motoneurons in the ventral horn of spinal cord. The combination of insults in the pre, peri and postnatal periods produced changes in hindlimbs gait pattern of animals similar to those observed in diplegic patients, but motor impairments were attenuated over time. Besides, the greater number of glial cells observed seems to be related to the formation of a glial scar in important sensorimotor brain areas. Copyright © 2017 ISDN. Published by Elsevier Ltd. All rights reserved.

  16. GRASP/Ada 95: Reverse Engineering Tools for Ada

    NASA Technical Reports Server (NTRS)

    Cross, James H., II

    1996-01-01

    The GRASP/Ada project (Graphical Representations of Algorithms, Structures, and Processes for Ada) has successfully created and prototyped an algorithmic level graphical representation for Ada software, the Control Structure Diagram (CSD), and a new visualization for a fine-grained complexity metric called the Complexity Profile Graph (CPG). By synchronizing the CSD and the CPG, the CSD view of control structure, nesting, and source code is directly linked to the corresponding visualization of statement level complexity in the CPG. GRASP has been integrated with GNAT, the GNU Ada 95 Translator to provide a comprehensive graphical user interface and development environment for Ada 95. The user may view, edit, print, and compile source code as a CSD with no discernible addition to storage or computational overhead. The primary impetus for creation of the CSD was to improve the comprehension efficiency of Ada software and, as a result, improve reliability and reduce costs. The emphasis has been on the automatic generation of the CSD from Ada 95 source code to support reverse engineering and maintenance. The CSD has the potential to replace traditional prettyprinted Ada source code. The current update has focused on the design and implementation of a new Motif compliant user interface, and a new CSD generator consisting of a tagger and renderer. The Complexity Profile Graph (CPG) is based on a set of functions that describes the context, content, and the scaling for complexity on a statement by statement basis. When combined graphicafly, the result is a composite profile of complexity for the program unit. Ongoing research includes the development and refinement of the associated functions, and the development of the CPG generator prototype. The current Version 5.0 prototype provides the capability for the user to generate CSDs and CPGs from Ada 95 source code in a reverse engineering as well as forward engineering mode with a level of flexibility suitable for practical application. This report provides an overview of the GRASP/Ada project with an emphasis on the current update.

  17. Effect of dietary betaine supplementation on lipogenesis gene expression and CpG methylation of lipoprotein lipase gene in broilers.

    PubMed

    Xing, Jinyi; Kang, Li; Jiang, Yunliang

    2011-03-01

    Experiments were conducted to investigate the effect of betaine supplementation on mRNA expression levels of lipogenesis genes and CpG methylation of lipoprotein lipase gene (LPL) in broilers. From 22 days of age, 78 broilers were feed basal diet without betaine and basal diet supplemented with 0.1% betaine, respectively, and at 56 and 66 days of age, the traits of 15 chickens (7 males and 8 females) of each group were recorded and abdominal fat pads were collected. The mRNA expression levels of several lipogenesis gene were analyzed by semi-quantitative RT-PCR and real-time quantitative RT-PCR (qPCR), respectively. The CpG methylation profile at the promoter region of LPL gene in 66-day-old broilers was determined by bisulfite sequencing. The average daily gain and percent abdominal fat traits were slightly improved in 56-day-old and 66-day-old broilers after dietary supplementation of betaine to diet. After adding 0.1% betaine to diet, the mRNA levels of fatty acid synthase (FAS) and adipocyte-type fatty acid-binding protein genes in abdominal adipose were significantly decreased in 56-day-old broilers, and those of LPL and FAS genes in abdominal adipose were significantly decreased in 66-day-old broilers comparing with the control group (P < 0.05 and P < 0.001). Moreover, in 66-day-old broilers fed 0.1% betaine diet, a different CpG methylation pattern was observed: the CpG dinucleotides of 1st, 6th, 7th, 8th and from 10th to 50th were less methylated; however, those of 2nd, 5th and 9th were more heavily methylated. The results suggest that transcription of some lipogenesis genes was decreased by betaine supplementation and betaine may decrease LPL mRNA expression by altering CpG methylation pattern on LPL promoter region.

  18. [SPRINT on clinical practice: It's time to change the management of arterial hypertension in Latin America?

    PubMed

    Galvez-Olortegui, José Kelvin; Condor-Rojas, Yudy; Galvez-Olortegui, Tomas Vladimir; Camacho-Saavedra, Luis

    This paper analyzes the feasibility of the implementation of SPRINT trial results, the need to rethink the clinical practice guidelines(CPG) for the management of arterial hypertension and associated costs with daily practice applicability. SPRINT is a clinical trial comparing systolic blood pressure control <120mmHg and <140mmHg over cardiovascular complications, generating a great worldwide impact followed by publication of several studies that addressed relevance, usefulness, applicability and controversial aspects of SPRINT from different perspectives. Achieving blood pressure goals is one of the most discussed issue in widely used hypertension CPG around the world and in Latin American. SPRINT has generated and will generate a great impact on CPG, being necessary the reassessment of blood pressure goals and inclusion in future CPG, as has been considered in 2016 Canadian guideline and will be considered in NICE guideline update scheduled for June. The SPRINT trial raises new evidence for the management of hypertension, useful in people over 50 years, from urban populations, with defined cardiovascular risk without associated comorbidities. The applicability of SPRINT in Latin America is limited by increased costs associated with hypertensive patients' integrated health care, low care coverage, and lack of integrated care programs. Copyright © 2016 Instituto Nacional de Cardiología Ignacio Chávez. Publicado por Masson Doyma México S.A. All rights reserved.

  19. Design and control of an embedded vision guided robotic fish with multiple control surfaces.

    PubMed

    Yu, Junzhi; Wang, Kai; Tan, Min; Zhang, Jianwei

    2014-01-01

    This paper focuses on the development and control issues of a self-propelled robotic fish with multiple artificial control surfaces and an embedded vision system. By virtue of the hybrid propulsion capability in the body plus the caudal fin and the complementary maneuverability in accessory fins, a synthesized propulsion scheme including a caudal fin, a pair of pectoral fins, and a pelvic fin is proposed. To achieve flexible yet stable motions in aquatic environments, a central pattern generator- (CPG-) based control method is employed. Meanwhile, a monocular underwater vision serves as sensory feedback that modifies the control parameters. The integration of the CPG-based motion control and the visual processing in an embedded microcontroller allows the robotic fish to navigate online. Aquatic tests demonstrate the efficacy of the proposed mechatronic design and swimming control methods. Particularly, a pelvic fin actuated sideward swimming gait was first implemented. It is also found that the speeds and maneuverability of the robotic fish with coordinated control surfaces were largely superior to that of the swimming robot propelled by a single control surface.

  20. Design and Control of an Embedded Vision Guided Robotic Fish with Multiple Control Surfaces

    PubMed Central

    Wang, Kai; Tan, Min; Zhang, Jianwei

    2014-01-01

    This paper focuses on the development and control issues of a self-propelled robotic fish with multiple artificial control surfaces and an embedded vision system. By virtue of the hybrid propulsion capability in the body plus the caudal fin and the complementary maneuverability in accessory fins, a synthesized propulsion scheme including a caudal fin, a pair of pectoral fins, and a pelvic fin is proposed. To achieve flexible yet stable motions in aquatic environments, a central pattern generator- (CPG-) based control method is employed. Meanwhile, a monocular underwater vision serves as sensory feedback that modifies the control parameters. The integration of the CPG-based motion control and the visual processing in an embedded microcontroller allows the robotic fish to navigate online. Aquatic tests demonstrate the efficacy of the proposed mechatronic design and swimming control methods. Particularly, a pelvic fin actuated sideward swimming gait was first implemented. It is also found that the speeds and maneuverability of the robotic fish with coordinated control surfaces were largely superior to that of the swimming robot propelled by a single control surface. PMID:24688413

  1. [Central Pattern Generators: Mechanisms of the Activity and Their Role in the Control of "Automatic" Movements].

    PubMed

    Arshavsky, I; Deliagina, T G; Orlovsky, G N

    2015-01-01

    Central pattern generators (CPGs) are a set of interconnected neurons capable of generating a basic pattern of motor output underlying "automatic" movements (breathing, locomotion, chewing, swallowing, and so on) in the absence of afferent signals from the executive motor apparatus. They can be divided into the constitutive CPGs active throughout the entire lifetime (respiratory CPGs) and conditional CPGs controlling episodic movements (locomotion, chewing, swallowing, and others). Since a motor output of CPGs is determined by their internal organization, the activities of the conditional CPGs are initiated by simple commands coming from higher centers. We describe the structural and functional organization of the locomotor CPGs in the marine mollusk Clione limacina, lamprey, frog embryo, and laboratory mammals (cat, mouse, and rat), CPGs controlling the respiratory and swallowing movements in mammals, and CPGs controlling discharges of the electric organ in the gymnotiform fish. It is shown that in all these cases, the generation of rhythmic motor output is based both on the endogenous (pacemaker) activity of specific groups of interneurons and on interneural interactions. These two interrelated mechanisms complement each other, ensuring the high reliability of CPG functionality. We discuss how the experience obtained in studying CPGs can be used to understand mechanisms of more complex functions of the brain, including its cognitive functions.

  2. Methylation analysis of plasma cell-free DNA for breast cancer early detection using bisulfite next-generation sequencing.

    PubMed

    Li, Zibo; Guo, Xinwu; Tang, Lili; Peng, Limin; Chen, Ming; Luo, Xipeng; Wang, Shouman; Xiao, Zhi; Deng, Zhongping; Dai, Lizhong; Xia, Kun; Wang, Jun

    2016-10-01

    Circulating cell-free DNA (cfDNA) has been considered as a potential biomarker for non-invasive cancer detection. To evaluate the methylation levels of six candidate genes (EGFR, GREM1, PDGFRB, PPM1E, SOX17, and WRN) in plasma cfDNA as biomarkers for breast cancer early detection, quantitative analysis of the promoter methylation of these genes from 86 breast cancer patients and 67 healthy controls was performed by using microfluidic-PCR-based target enrichment and next-generation bisulfite sequencing technology. The predictive performance of different logistic models based on methylation status of candidate genes was investigated by means of the area under the ROC curve (AUC) and odds ratio (OR) analysis. Results revealed that EGFR, PPM1E, and 8 gene-specific CpG sites showed significantly hypermethylation in cancer patients' plasma and significantly associated with breast cancer (OR ranging from 2.51 to 9.88). The AUC values for these biomarkers were ranging from 0.66 to 0.75. Combinations of multiple hypermethylated genes or CpG sites substantially improved the predictive performance for breast cancer detection. Our study demonstrated the feasibility of quantitative measurement of candidate gene methylation in cfDNA by using microfluidic-PCR-based target enrichment and bisulfite next-generation sequencing, which is worthy of further validation and potentially benefits a broad range of applications in clinical oncology practice. Quantitative analysis of methylation pattern of plasma cfDNA by next-generation sequencing might be a valuable non-invasive tool for early detection of breast cancer.

  3. Association between Promoter Methylation of Gene ERCC3 and Benzene Hematotoxicity.

    PubMed

    Zheng, Min; Lin, Feiliang; Hou, Fenxia; Li, Guilan; Zhu, Caiying; Xu, Peiyu; Xing, Caihong; Wang, Qianfei

    2017-08-16

    Benzene is a primary industrial chemical and a ubiquitous environmental pollutant. ERCC3 is a key player in nucleotide excision repair. Recent studies suggested that site-specific methylation is a possible mechanism of the transcriptional dysregulation by blocking transcription factors binding. We previously found that the average promoter methylation level of ERCC3 was increased in benzene-exposed workers. In order to test whether specific CpG sites of ERCC3 play an important role in benzene-induced epigenetic changes and whether the specific methylation patterns are associated with benzene hematotoxicity, we analyzed the promoter methylation levels of individual CpG sites, transcription factor binding motif and the correlation between aberrant CpG methylation and hematotoxicity in 76 benzene-exposed workers and 24 unexposed controls in China. Out of all the CpGs analyzed, two CpG units located 43 bp upstream and 99 bp downstream of the transcription start site of ERCC3 (CpG 2-4 and CpG 17-18, respectively), showed the most pronounced increase in methylation levels in benzene-exposed workers, compared with unexposed controls (Mean ± SD: 5.86 ± 2.77% vs. 4.92 ± 1.53%, p = 0.032; 8.45 ± 4.09% vs. 6.79 ± 2.50%, p = 0.024, respectively). Using the JASPAR CORE Database, we found that CpG 2-4 and CpG 17-18 were bound by three putative transcription factors (TFAP2A, E2F4 and MZF1). Furthermore, the methylation levels for CpG 2-4 were correlated negatively with the percentage of neutrophils ( β = -0.676, p = 0.005) in benzene-exposed workers. This study demonstrates that CpG-specific DNA methylation in the ERCC3 promoter region may be involved in benzene-induced epigenetic modification and it may contribute to benzene-induced hematotoxicity.

  4. Association between Promoter Methylation of Gene ERCC3 and Benzene Hematotoxicity

    PubMed Central

    Lin, Feiliang; Hou, Fenxia; Li, Guilan; Zhu, Caiying; Xu, Peiyu; Xing, Caihong; Wang, Qianfei

    2017-01-01

    Benzene is a primary industrial chemical and a ubiquitous environmental pollutant. ERCC3 is a key player in nucleotide excision repair. Recent studies suggested that site-specific methylation is a possible mechanism of the transcriptional dysregulation by blocking transcription factors binding. We previously found that the average promoter methylation level of ERCC3 was increased in benzene-exposed workers. In order to test whether specific CpG sites of ERCC3 play an important role in benzene-induced epigenetic changes and whether the specific methylation patterns are associated with benzene hematotoxicity, we analyzed the promoter methylation levels of individual CpG sites, transcription factor binding motif and the correlation between aberrant CpG methylation and hematotoxicity in 76 benzene-exposed workers and 24 unexposed controls in China. Out of all the CpGs analyzed, two CpG units located 43 bp upstream and 99 bp downstream of the transcription start site of ERCC3 (CpG 2–4 and CpG 17–18, respectively), showed the most pronounced increase in methylation levels in benzene-exposed workers, compared with unexposed controls (Mean ± SD: 5.86 ± 2.77% vs. 4.92 ± 1.53%, p = 0.032; 8.45 ± 4.09% vs. 6.79 ± 2.50%, p = 0.024, respectively). Using the JASPAR CORE Database, we found that CpG 2–4 and CpG 17–18 were bound by three putative transcription factors (TFAP2A, E2F4 and MZF1). Furthermore, the methylation levels for CpG 2–4 were correlated negatively with the percentage of neutrophils (β = −0.676, p = 0.005) in benzene-exposed workers. This study demonstrates that CpG-specific DNA methylation in the ERCC3 promoter region may be involved in benzene-induced epigenetic modification and it may contribute to benzene-induced hematotoxicity. PMID:28813025

  5. Genome-Wide Estimates of Mutation Rates and Spectrum in Schizosaccharomyces pombe Indicate CpG Sites are Highly Mutagenic Despite the Absence of DNA Methylation

    PubMed Central

    Behringer, Megan G.; Hall, David W.

    2015-01-01

    We accumulated mutations for 1952 generations in 79 initially identical, haploid lines of the fission yeast Schizosaccharomyces pombe, and then performed whole-genome sequencing to determine the mutation rates and spectrum. We captured 696 spontaneous mutations across the 79 mutation accumulation (MA) lines. We compared the mutation spectrum and rate to a recently published equivalent experiment on the same species, and to another model ascomycetous yeast, the budding yeast Saccharomyces cerevisiae. While the two species are approximately 600 million years diverged from each other, they share similar life histories, genome size and genomic G/C content. We found that Sc. pombe and S. cerevisiae have similar mutation rates, but Sc. pombe exhibits a stronger insertion bias. Intriguingly, we observed an increased mutation rate at cytosine nucleotides, specifically CpG nucleotides, which is also seen in S. cerevisiae. However, the absence of methylation in Sc. pombe and the pattern of mutation at these sites, primarily C → A as opposed to C → T, strongly suggest that the increased mutation rate is not caused by deamination of methylated cytosines. This result implies that the high mutability of CpG dinucleotides in other species may be caused in part by a methylation-independent mechanism. Many of our findings mirror those seen in the recent study, despite the use of different passaging conditions, indicating that MA is a reliable method for estimating mutation rates and spectra. PMID:26564949

  6. Rolling Thunder -- Integration of the Solo 161 Stirling engine with the CPG-460 solar concentrator at Ft. Huachuca

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Diver, R.B.; Moss, T.A.; Goldberg, V.

    Project Rolling Thunder is a dish/Stirling demonstration project at Ft. Huachuca, a US Army fort in southeastern Arizona (Huachuca means rolling thunder in Apache). It has been supported by the Strategic Environmental Research and Development Program (SERDP), a cooperative program between the Department of Defense (DoD) and the Department of Energy (DOE). As part of a 1992 SERDP project, Cummins Power Generation, Inc. (CPG) installed a CPG 7 kW(c) dish/Stirling system at the Joint Interoperability Test Command (JITC) in Ft. Huachuca, Arizona. The primary objective of the SERDP Dish/Stirling for DoD Applications project was to demonstrate a CPG 7-kW(c) dish/Stirlingmore » system at a military facility. Unfortunately, Cummins Engine Company decided to divest its solar operations. As a direct result of Ft. Huachuca`s interest in the Cummins dish/Stirling technology, Sandia explored the possibility of installing a SOLO 161 Stirling power conversion unit (PCU) on the Ft. Huachuca CPG-460. In January 1997, a decision was made to retrofit a SOLO 161 Stirling engine on the CPG-460 at Ft. Huachuca. Project Rolling Thunder. The SOLO 161 Demonstration at Ft. Huachuca has been a challenge. Although, the SOLO 161 PCU has operated nearly flawlessly and the CPG-460 has been, for the most part, a solid and reliable component, integration of the SOLO PCU with the CPG-460 has required significant attention. In this paper, the integration issues and technical approaches of project Rolling Thunder are presented. Lessons of the project are also discussed.« less

  7. A generalized locomotion CPG architecture based on oscillatory building blocks.

    PubMed

    Yang, Zhijun; França, Felipe M G

    2003-07-01

    Neural oscillation is one of the most extensively investigated topics of artificial neural networks. Scientific approaches to the functionalities of both natural and artificial intelligences are strongly related to mechanisms underlying oscillatory activities. This paper concerns itself with the assumption of the existence of central pattern generators (CPGs), which are the plausible neural architectures with oscillatory capabilities, and presents a discrete and generalized approach to the functionality of locomotor CPGs of legged animals. Based on scheduling by multiple edge reversal (SMER), a primitive and deterministic distributed algorithm, it is shown how oscillatory building block (OBB) modules can be created and, hence, how OBB-based networks can be formulated as asymmetric Hopfield-like neural networks for the generation of complex coordinated rhythmic patterns observed among pairs of biological motor neurons working during different gait patterns. It is also shown that the resulting Hopfield-like network possesses the property of reproducing the whole spectrum of different gaits intrinsic to the target locomotor CPGs. Although the new approach is not restricted to the understanding of the neurolocomotor system of any particular animal, hexapodal and quadrupedal gait patterns are chosen as illustrations given the wide interest expressed by the ongoing research in the area.

  8. CpG methylation in human papillomavirus (HPV) type 31 long control region (LCR) in cervical infections associated with cytological abnormalities.

    PubMed

    László, Brigitta; Ferenczi, Annamária; Madar, László; Gyöngyösi, Eszter; Szalmás, Anita; Szakács, Levente; Veress, György; Kónya, József

    2016-08-01

    The mechanisms that regulate papillomavirus gene expression include DNA methylation. The transcription of papillomavirus oncogenes E6 and E7 is controlled by certain regulatory elements in the LCR, which include binding sites for the E2 protein, a viral regulator of oncogene expression. In HPV-31-infected exfoliated cervical cells, the CpG methylation of the entire LCR was determined by next-generation sequencing after bisulfite modification. Six of the 22 cases had methylated CpG sites in the HPV-31 LCR, including position 7479 and/or 7485, at the promoter distal E2 binding site, thus suggesting a potential regulatory mechanism for papillomavirus transcription.

  9. Predicting Adaptive Behavior in the Environment from Central Nervous System Dynamics

    PubMed Central

    Proekt, Alex; Wong, Jane; Zhurov, Yuriy; Kozlova, Nataliya; Weiss, Klaudiusz R.; Brezina, Vladimir

    2008-01-01

    To generate adaptive behavior, the nervous system is coupled to the environment. The coupling constrains the dynamical properties that the nervous system and the environment must have relative to each other if adaptive behavior is to be produced. In previous computational studies, such constraints have been used to evolve controllers or artificial agents to perform a behavioral task in a given environment. Often, however, we already know the controller, the real nervous system, and its dynamics. Here we propose that the constraints can also be used to solve the inverse problem—to predict from the dynamics of the nervous system the environment to which they are adapted, and so reconstruct the production of the adaptive behavior by the entire coupled system. We illustrate how this can be done in the feeding system of the sea slug Aplysia. At the core of this system is a central pattern generator (CPG) that, with dynamics on both fast and slow time scales, integrates incoming sensory stimuli to produce ingestive and egestive motor programs. We run models embodying these CPG dynamics—in effect, autonomous Aplysia agents—in various feeding environments and analyze the performance of the entire system in a realistic feeding task. We find that the dynamics of the system are tuned for optimal performance in a narrow range of environments that correspond well to those that Aplysia encounter in the wild. In these environments, the slow CPG dynamics implement efficient ingestion of edible seaweed strips with minimal sensory information about them. The fast dynamics then implement a switch to a different behavioral mode in which the system ignores the sensory information completely and follows an internal “goal,” emergent from the dynamics, to egest again a strip that proves to be inedible. Key predictions of this reconstruction are confirmed in real feeding animals. PMID:18989362

  10. The Control Region of Mitochondrial DNA Shows an Unusual CpG and Non-CpG Methylation Pattern

    PubMed Central

    Bellizzi, Dina; D'Aquila, Patrizia; Scafone, Teresa; Giordano, Marco; Riso, Vincenzo; Riccio, Andrea; Passarino, Giuseppe

    2013-01-01

    DNA methylation is a common epigenetic modification of the mammalian genome. Conflicting data regarding the possible presence of methylated cytosines within mitochondrial DNA (mtDNA) have been reported. To clarify this point, we analysed the methylation status of mtDNA control region (D-loop) on human and murine DNA samples from blood and cultured cells by bisulphite sequencing and methylated/hydroxymethylated DNA immunoprecipitation assays. We found methylated and hydroxymethylated cytosines in the L-strand of all samples analysed. MtDNA methylation particularly occurs within non-C-phosphate-G (non-CpG) nucleotides, mainly in the promoter region of the heavy strand and in conserved sequence blocks, suggesting its involvement in regulating mtDNA replication and/or transcription. We observed DNA methyltransferases within the mitochondria, but the inactivation of Dnmt1, Dnmt3a, and Dnmt3b in mouse embryonic stem (ES) cells results in a reduction of the CpG methylation, while the non-CpG methylation shows to be not affected. This suggests that D-loop epigenetic modification is only partially established by these enzymes. Our data show that DNA methylation occurs in the mtDNA control region of mammals, not only at symmetrical CpG dinucleotides, typical of nuclear genome, but in a peculiar non-CpG pattern previously reported for plants and fungi. The molecular mechanisms responsible for this pattern remain an open question. PMID:23804556

  11. Long-Range Correlations in Stride Intervals May Emerge from Non-Chaotic Walking Dynamics

    PubMed Central

    Ahn, Jooeun; Hogan, Neville

    2013-01-01

    Stride intervals of normal human walking exhibit long-range temporal correlations. Similar to the fractal-like behaviors observed in brain and heart activity, long-range correlations in walking have commonly been interpreted to result from chaotic dynamics and be a signature of health. Several mathematical models have reproduced this behavior by assuming a dominant role of neural central pattern generators (CPGs) and/or nonlinear biomechanics to evoke chaos. In this study, we show that a simple walking model without a CPG or biomechanics capable of chaos can reproduce long-range correlations. Stride intervals of the model revealed long-range correlations observed in human walking when the model had moderate orbital stability, which enabled the current stride to affect a future stride even after many steps. This provides a clear counterexample to the common hypothesis that a CPG and/or chaotic dynamics is required to explain the long-range correlations in healthy human walking. Instead, our results suggest that the long-range correlation may result from a combination of noise that is ubiquitous in biological systems and orbital stability that is essential in general rhythmic movements. PMID:24086274

  12. Variation in motor output and motor performance in a centrally generated motor pattern

    PubMed Central

    Norris, Brian J.; Doloc-Mihu, Anca; Calabrese, Ronald L.

    2014-01-01

    Central pattern generators (CPGs) produce motor patterns that ultimately drive motor outputs. We studied how functional motor performance is achieved, specifically, whether the variation seen in motor patterns is reflected in motor performance and whether fictive motor patterns differ from those in vivo. We used the leech heartbeat system in which a bilaterally symmetrical CPG coordinates segmental heart motor neurons and two segmented heart tubes into two mutually exclusive coordination modes: rear-to-front peristaltic on one side and nearly synchronous on the other, with regular side-to-side switches. We assessed individual variability of the motor pattern and the beat pattern in vivo. To quantify the beat pattern we imaged intact adults. To quantify the phase relations between motor neurons and heart constrictions we recorded extracellularly from two heart motor neurons and movement from the corresponding heart segments in minimally dissected leeches. Variation in the motor pattern was reflected in motor performance only in the peristaltic mode, where larger intersegmental phase differences in the motor neurons resulted in larger phase differences between heart constrictions. Fictive motor patterns differed from those in vivo only in the synchronous mode, where intersegmental phase differences in vivo had a larger front-to-rear bias and were more constrained. Additionally, load-influenced constriction timing might explain the amplification of the phase differences between heart segments in the peristaltic mode and the higher variability in motor output due to body shape assumed in this soft-bodied animal. The motor pattern determines the beat pattern, peristaltic or synchronous, but heart mechanics influence the phase relations achieved. PMID:24717348

  13. Maternal BMI as a predictor of methylation of obesity-related genes in saliva samples from preschool-age Hispanic children at-risk for obesity.

    PubMed

    Oelsner, Kathryn Tully; Guo, Yan; To, Sophie Bao-Chieu; Non, Amy L; Barkin, Shari L

    2017-01-09

    The study of epigenetic processes and mechanisms present a dynamic approach to assess complex individual variation in obesity susceptibility. However, few studies have examined epigenetic patterns in preschool-age children at-risk for obesity despite the relevance of this developmental stage to trajectories of weight gain. We hypothesized that salivary DNA methylation patterns of key obesogenic genes in Hispanic children would 1) correlate with maternal BMI and 2) allow for identification of pathways associated with children at-risk for obesity. Genome-wide DNA methylation was conducted on 92 saliva samples collected from Hispanic preschool children using the Infinium Illumina HumanMethylation 450 K BeadChip (Illumina, San Diego, CA, USA), which interrogates >484,000 CpG sites associated with ~24,000 genes. The analysis was limited to 936 genes that have been associated with obesity in a prior GWAS Study. Child DNA methylation at 17 CpG sites was found to be significantly associated with maternal BMI, with increased methylation at 12 CpG sites and decreased methylation at 5 CpG sites. Pathway analysis revealed methylation at these sites related to homocysteine and methionine degradation as well as cysteine biosynthesis and circadian rhythm. Furthermore, eight of the 17 CpG sites reside in genes (FSTL1, SORCS2, NRF1, DLC1, PPARGC1B, CHN2, NXPH1) that have prior known associations with obesity, diabetes, and the insulin pathway. Our study confirms that saliva is a practical human tissue to obtain in community settings and in pediatric populations. These salivary findings indicate potential epigenetic differences in Hispanic preschool children at risk for pediatric obesity. Identifying early biomarkers and understanding pathways that are epigenetically regulated during this critical stage of child development may present an opportunity for prevention or early intervention for addressing childhood obesity. The clinical trial protocol is available at ClinicalTrials.gov ( NCT01316653 ). Registered 3 March 2011.

  14. PiiL: visualization of DNA methylation and gene expression data in gene pathways.

    PubMed

    Moghadam, Behrooz Torabi; Zamani, Neda; Komorowski, Jan; Grabherr, Manfred

    2017-08-02

    DNA methylation is a major mechanism involved in the epigenetic state of a cell. It has been observed that the methylation status of certain CpG sites close to or within a gene can directly affect its expression, either by silencing or, in some cases, up-regulating transcription. However, a vertebrate genome contains millions of CpG sites, all of which are potential targets for methylation, and the specific effects of most sites have not been characterized to date. To study the complex interplay between methylation status, cellular programs, and the resulting phenotypes, we present PiiL, an interactive gene expression pathway browser, facilitating analyses through an integrated view of methylation and expression on multiple levels. PiiL allows for specific hypothesis testing by quickly assessing pathways or gene networks, where the data is projected onto pathways that can be downloaded directly from the online KEGG database. PiiL provides a comprehensive set of analysis features that allow for quick and specific pattern searches. Individual CpG sites and their impact on host gene expression, as well as the impact on other genes present in the regulatory network, can be examined. To exemplify the power of this approach, we analyzed two types of brain tumors, Glioblastoma multiform and lower grade gliomas. At a glance, we could confirm earlier findings that the predominant methylation and expression patterns separate perfectly by mutations in the IDH genes, rather than by histology. We could also infer the IDH mutation status for samples for which the genotype was not known. By applying different filtering methods, we show that a subset of CpG sites exhibits consistent methylation patterns, and that the status of sites affect the expression of key regulator genes, as well as other genes located downstream in the same pathways. PiiL is implemented in Java with focus on a user-friendly graphical interface. The source code is available under the GPL license from https://github.com/behroozt/PiiL.git .

  15. Motoneurons regulate the central pattern generator during drug-induced locomotor-like activity in the neonatal mouse

    PubMed Central

    Falgairolle, Melanie; Puhl, Joshua G; Pujala, Avinash; Liu, Wenfang; O’Donovan, Michael J

    2017-01-01

    Motoneurons are traditionally viewed as the output of the spinal cord that do not influence locomotor rhythmogenesis. We assessed the role of motoneuron firing during ongoing locomotor-like activity in neonatal mice expressing archaerhopsin-3 (Arch), halorhodopsin (eNpHR), or channelrhodopsin-2 (ChR2) in Choline acetyltransferase neurons (ChAT+) or Arch in LIM-homeodomain transcription factor Isl1+ neurons. Illumination of the lumbar cord in mice expressing eNpHR or Arch in ChAT+ or Isl1+ neurons, depressed motoneuron discharge, transiently decreased the frequency, and perturbed the phasing of the locomotor-like rhythm. When the light was turned off motoneuron firing and locomotor frequency both transiently increased. These effects were not due to cholinergic neurotransmission, persisted during partial blockade of gap junctions and were mediated, in part, by AMPAergic transmission. In spinal cords expressing ChR2, illumination increased motoneuron discharge and transiently accelerated the rhythm. We conclude that motoneurons provide feedback to the central pattern generator (CPG) during drug-induced locomotor-like activity. DOI: http://dx.doi.org/10.7554/eLife.26622.001 PMID:28671548

  16. Predicting neural network firing pattern from phase resetting curve

    NASA Astrophysics Data System (ADS)

    Oprisan, Sorinel; Oprisan, Ana

    2007-04-01

    Autonomous neural networks called central pattern generators (CPG) are composed of endogenously bursting neurons and produce rhythmic activities, such as flying, swimming, walking, chewing, etc. Simplified CPGs for quadrupedal locomotion and swimming are modeled by a ring of neural oscillators such that the output of one oscillator constitutes the input for the subsequent neural oscillator. The phase response curve (PRC) theory discards the detailed conductance-based description of the component neurons of a network and reduces them to ``black boxes'' characterized by a transfer function, which tabulates the transient change in the intrinsic period of a neural oscillator subject to external stimuli. Based on open-loop PRC, we were able to successfully predict the phase-locked period and relative phase between neurons in a half-center network. We derived existence and stability criteria for heterogeneous ring neural networks that are in good agreement with experimental data.

  17. Genome-wide DNA Methylation Profiling of CpG Islands in Hypospadias

    PubMed Central

    Choudhry, Shweta; Deshpande, Archana; Qiao, Liang; Beckman, Kenneth; Sen, Saunak; Baskin, Laurence S.

    2013-01-01

    Purpose Hypospadias is one of the most frequent genital malformations in the male newborn, and results from abnormal penile and urethral development. The etiology of hypospadias remains largely unknown despite intensive investigations. Fetal androgens have a crucial role in genital differentiation. Recent studies have suggested that molecular mechanisms that underlie the effects of androgens on the fetus may involve disruption of epigenetic programming of gene expression during development. We assessed whether epigenetic modification of DNA methylation is associated with hypospadias in a case-control study of 12 hypospadias and 8 control subjects. Materials and Methods Genome-wide DNA methylation profiling was performed on the study subjects using the Illumina Infinium® HumanMethylation450 Bead-Chip, which enables the direct investigation of methylation status of more than 485,000 individual CpG sites throughout the genome. The methylation level at each CpG site was compared between cases and controls using the t test and logistic regression. Results We identified 14 CpG sites that were associated with hypospadias with p <0.00001. These CpG sites were in or near the SCARB1, MYBPH, SORBS1, LAMA4, HOXD11, MYO1D, EGFL7, C10orf41, LMAN1L and SULF1 genes. Two CpG sites in SCARB1 and MYBPH genes remained statistically significant after correction for multiple testing (p = 2.61×10−09, pcorrected = 0.008; p = 3.06×10−08, pcorrected = 0.02, respectively). Conclusions To our knowledge this is the first study to investigate hypospadias using a unique and novel epigenetic approach. Our findings suggest DNA methylation patterns are useful in identifying new genes such as SCARB1 and MYBPH that may be involved in the etiology of hypospadias. PMID:22906644

  18. Glucocorticoid receptor gene expression and promoter CpG modifications throughout the human brain.

    PubMed

    Cao-Lei, Lei; Suwansirikul, Songkiet; Jutavijittum, Prapan; Mériaux, Sophie B; Turner, Jonathan D; Muller, Claude P

    2013-11-01

    Glucocorticoids and the glucocorticoid (GR) and mineralocorticoid (MR) receptors have been implicated in many processes, particularly in negative feedback regulation of the hypothalamic-pituitary-adrenal axis. Epigenetically programmed GR alternative promoter usage underlies transcriptional control of GR levels, generation of GR 3' splice variants, and the overall GC response in the brain. No detailed analysis of GR first exons or GR transcript variants throughout the human brain has been reported. Therefore we investigated post mortem tissues from 28 brain regions of 5 individuals. GR first exons were expressed throughout the healthy human brain with no region-specific usage patterns. First exon levels were highly inter-correlated suggesting that they are co-regulated. GR 3' splice variants (GRα and GR-P) were equally distributed in all regions, and GRβ expression was always low. GR/MR ratios showed significant differences between the 28 tissues with the highest ratio in the pituitary gland. Modification levels of individual CpG dinucleotides, including 5-mC and 5-hmC, in promoters 1D, 1E, 1F, and 1H were low, and diffusely clustered; despite significant heterogeneity between the donors. In agreement with this clustering, sum modification levels rather than individual CpG modifications correlated with GR expression. Two-way ANOVA showed that this sum modification was both promoter and brain region specific, but that there was however no promoter*tissue interaction. The heterogeneity between donors may however hide such an interaction. In both promoters 1F and 1H modification levels correlated with GRα expression suggesting that 5-mC and 5-hmC play an important role in fine tuning GR expression levels throughout the brain. Copyright © 2013 Elsevier Ltd. All rights reserved.

  19. Beta-Glucan Activated Human B-Lymphocytes Participate in Innate Immune Responses by Releasing Pro-inflammatory Cytokines and Stimulating Neutrophil Chemotaxis

    PubMed Central

    Ali, Mohamed F.; Driscoll, Christopher B.; Walters, Paula R.; Limper, Andrew H.; Carmona, Eva M.

    2015-01-01

    B-lymphocytes play an essential regulatory role in the adaptive immune response through antibody production during infection. A less known function of B-lymphocytes is their ability to respond directly to infectious antigens through stimulation of pattern recognition receptors expressed on their surfaces. β-glucans are carbohydrates present in the cell wall of many pathogenic fungi that can be detected in the peripheral blood of patients during infection. They have been shown to participate in the innate inflammatory response as they can directly activate peripheral macrophages and dendritic cells. However, their effect as direct stimulators of B-lymphocytes has not been yet fully elucidated. The aim of this study was to examine the molecular mechanisms and cytokine profiles generated following β-glucan stimulation of B-lymphocytes, compared with the well-established TLR-9 agonist CpG-oligodeoxynucleotide (CpG) and study the participation of β-glucan stimulated B-cells in the innate immune response. Herein, we demonstrate that β-glucan activated B-lymphocytes upregulate pro-inflammatory cytokines (TNFα, IL-6 and IL-8). Interestingly, β-glucan, unlike CpG, had no effect on B-lymphocyte proliferation or IgM production. When compared with CpG (TLR9 agonist), β-glucan-activated cells secreted significantly higher levels of IL-8. Furthermore, IL-8 secretion was partially mediated by Dectin-1 and required SYK, MAPKs and the transcription factors NF-κB and AP-1. Moreover, we observed that conditioned media from β-glucan stimulated B-lymphocytes elicited neutrophil chemotaxis. These studies suggest that β-glucan activated B-lymphocytes have an important and novel role in fungal innate immune responses. PMID:26519534

  20. Grafting of fetal brainstem 5-HT neurons into the sublesional spinal cord of paraplegic rats restores coordinated hindlimb locomotion.

    PubMed

    Sławińska, Urszula; Miazga, Krzysztof; Cabaj, Anna M; Leszczyńska, Anna N; Majczyński, Henryk; Nagy, James I; Jordan, Larry M

    2013-09-01

    In rodent models of spinal cord injury, there is increasing evidence that activation of the locomotor central pattern generator (CPG) below the site of injury with 5-hydroxytryptamine (5-HT) agonists improves locomotor recovery and restores coordination. A promising means of replacing 5-HT control of locomotion is to graft brainstem 5-HT neurons into the spinal cord below the level of the spinal cord injury. However, it is not known whether this approach improves limb coordination because recovery of coordinated stepping has not been documented in detail in previous studies employing this transplantation strategy. Here, adult rats with complete spinal cord transections at the T9/10 level were grafted with E14 fetal neurons from the medulla at the T10/11 vertebra level one month after injury. The B1, B2 and B3 fetal anlagen of brainstem 5-HT neurons, a grouping that included the presumed precursors of recently described 5-HT locomotor command neurons, were used in these grafts. EMG and video recordings of treadmill locomotion evoked by tail stimulation showed full recovery of inter- and intralimb coordination in the grafted rats. We showed, using systemically applied antagonists, that 5-HT₂ and 5-HT₇ receptors mediate the improved locomotion after grafting, but through actions on different populations of spinal locomotor neurons. Specifically, 5-HT₂ receptors control CPG activation as well as motoneuron output, while 5-HT₇ receptors contribute primarily to activity of the locomotor CPG. These results are consistent with the roles for these receptors during locomotion in intact rodents and in rodent brainstem-spinal cord in vitro preparations. Copyright © 2013 Elsevier Inc. All rights reserved.

  1. Cationic liposomes containing soluble Leishmania antigens (SLA) plus CpG ODNs induce protection against murine model of leishmaniasis.

    PubMed

    Heravi Shargh, Vahid; Jaafari, Mahmoud Reza; Khamesipour, Ali; Jalali, Seyed Amir; Firouzmand, Hengameh; Abbasi, Azam; Badiee, Ali

    2012-07-01

    Development of an effective vaccine against leishmaniasis is possible due to the fact that individuals cured from cutaneous leishmaniasis (CL) are protected from further infection. First generation Leishmania vaccines consisting of whole killed parasites reached to phase 3 clinical trials but failed to show enough efficacies mainly due to the lack of an appropriate adjuvant. In this study, an efficient liposomal protein-based vaccine against Leishmania major infection was developed using soluble Leishmania antigens (SLA) as a first generation vaccine and cytidine phosphate guanosine oligodeoxynucleotides (CpG ODNs) as an immunostimulatory adjuvant. 1, 2-Dioleoyl-3-trimethylammonium-propane was used as a cationic lipid to prepare the liposomes due to its intrinsic adjuvanticity. BALB/c mice were immunized subcutaneously (SC), three times in 2-week intervals, with Lip-SLA-CpG, Lip-SLA, SLA + CpG, SLA, or HEPES buffer. As criteria for protection, footpad swelling at the site of challenge and spleen parasite loads were assessed, and the immune responses were evaluated by determination of IFN-γ and IL-4 levels of cultured splenocytes, and IgG subtypes. The group of mice that received Lip-SLA-CpG showed a significantly smaller footpad swelling, lower spleen parasite burden, higher IgG2a antibody, and lower IL-4 level compared to the control groups. It is concluded that cationic liposomes containing SLA and CpG ODNs are appropriate to induce Th1 type of immune response and protection against leishmaniasis.

  2. Relatively high rates of G:C → A:T transitions at CpG sites were observed in certain epithelial tissues including pancreas and submaxillary gland of adult big blue® mice.

    PubMed

    Prtenjaca, Anita; Tarnowski, Heather E; Marr, Alison M; Heney, Melanie A; Creamer, Laura; Sathiamoorthy, Sarmitha; Hill, Kathleen A

    2014-01-01

    With few exceptions, spontaneous mutation frequency and pattern are similar across tissue types and relatively constant in young to middle adulthood in wild type mice. Underrepresented in surveys of spontaneous mutations across murine tissues is the diversity of epithelial tissues. For the first time, spontaneous mutations were detected in pancreas and submaxillary gland and compared with kidney, lung, and male germ cells from five adult male Big Blue® mice. Mutation load was assessed quantitatively through measurement of mutant and mutation frequency and qualitatively through identification of mutations and characterization of recurrent mutations, multiple mutations, mutation pattern, and mutation spectrum. A total of 9.6 million plaque forming units were screened, 226 mutants were collected, and 196 independent mutations were identified. Four novel mutations were discovered. Spontaneous mutation frequency was low in pancreas and high in the submaxillary gland. The submaxillary gland had multiple recurrent mutations in each of the mice and one mutant had two independent mutations. Mutation patterns for epithelial tissues differed from that observed in male germ cells with a striking bias for G:C to A:T transitions at CpG sites. A comprehensive review of lacI spontaneous mutation patterns in young adult mice and rats identified additional examples of this mutational bias. An overarching observation about spontaneous mutation frequency in adult tissues of the mouse remains one of stability. A repeated observation in certain epithelial tissues is a higher rate of G:C to A:T transitions at CpG sites and the underlying mechanisms for this bias are not known. Copyright © 2013 Wiley Periodicals, Inc.

  3. Unique DNA methylome profiles in CpG island methylator phenotype colon cancers

    PubMed Central

    Xu, Yaomin; Hu, Bo; Choi, Ae-Jin; Gopalan, Banu; Lee, Byron H.; Kalady, Matthew F.; Church, James M.; Ting, Angela H.

    2012-01-01

    A subset of colorectal cancers was postulated to have the CpG island methylator phenotype (CIMP), a higher propensity for CpG island DNA methylation. The validity of CIMP, its molecular basis, and its prognostic value remain highly controversial. Using MBD-isolated genome sequencing, we mapped and compared genome-wide DNA methylation profiles of normal, non-CIMP, and CIMP colon specimens. Multidimensional scaling analysis revealed that each specimen could be clearly classified as normal, non-CIMP, and CIMP, thus signifying that these three groups have distinctly different global methylation patterns. We discovered 3780 sites in various genomic contexts that were hypermethylated in both non-CIMP and CIMP colon cancers when compared with normal colon. An additional 2026 sites were found to be hypermethylated in CIMP tumors only; and importantly, 80% of these sites were located in CpG islands. These data demonstrate on a genome-wide level that the additional hypermethylation seen in CIMP tumors occurs almost exclusively at CpG islands and support definitively that these tumors were appropriately named. When these sites were examined more closely, we found that 25% were adjacent to sites that were also hypermethylated in non-CIMP tumors. Thus, CIMP is also characterized by more extensive methylation of sites that are already prone to be hypermethylated in colon cancer. These observations indicate that CIMP tumors have specific defects in controlling both DNA methylation seeding and spreading and serve as an important first step in delineating molecular mechanisms that control these processes. PMID:21990380

  4. Genome-wide DNA methylation profiling identifies ALDH1A3 promoter methylation as a prognostic predictor in G-CIMP- primary glioblastoma.

    PubMed

    Zhang, Wei; Yan, Wei; You, Gan; Bao, Zhaoshi; Wang, Yongzhi; Liu, Yanwei; You, Yongping; Jiang, Tao

    2013-01-01

    To date, the aberrations in the DNA methylation patterns that are associated with different prognoses of G-CIMP- primary GBMs remain to be elucidated. Here, DNA methylation profiling of primary GBM tissues from 13 long-term survivors (LTS; overall survival ⩾18months) and 20 short-term survivors (STS; overall survival ⩽9months) was performed. Then G-CIMP+ samples were excluded. The differentially expressed CpG loci were identified between residual 18 STS and 9 LTS G-CIMP- samples. Methylation levels of 11 CpG loci (10genes) were statistically significantly lower, and 43 CpG loci (40genes) were statistically significantly higher in the tumor tissues of LTS than those of STS G-CIMP- samples (P<0.01). Of the 43 CpG loci that were hypermethylated in LTS G-CIMP- samples, 3 CpG loci localized in the promoter of ALDH1A3. Furthermore, using an independent validation cohort containing 37 primary GBM samples without IDH1 mutation and MGMT promoter methylation, the hypermethylation status of ALDH1A3 promoter predicted a better prognosis with an accompanied low expression of ALDH1A3 protein. Taken together, our results defined prognosis-related methylation signatures systematically for the first time in G-CIMP- primary GBMs. ALDH1A3 promoter methylation conferred a favorable prognosis in G-CIMP- primary GBMs. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  5. Identification of Gene Networks Associated with Acute Myeloid Leukemia by Comparative Molecular Methylation and Expression Profiling

    PubMed Central

    Dellett, Margaret; O’Hagan, Kathleen Ann; Colyer, Hilary Ann Alexandra; Mills, Ken I.

    2010-01-01

    Around 80% of acute myeloid leukemia (AML) patients achieve a complete remission, however many will relapse and ultimately die of their disease. The association between karyotype and prognosis has been studied extensively and identified patient cohorts as having favourable [e.g. t(8; 21), inv (16)/t(16; 16), t(15; 17)], intermediate [e.g. cytogenetically normal (NK-AML)] or adverse risk [e.g. complex karyotypes]. Previous studies have shown that gene expression profiling signatures can classify the sub-types of AML, although few reports have shown a similar feature by using methylation markers. The global methylation patterns in 19 diagnostic AML samples were investigated using the Methylated CpG Island Amplification Microarray (MCAM) method and CpG island microarrays containing 12,000 CpG sites. The first analysis, comparing favourable and intermediate cytogenetic risk groups, revealed significantly differentially methylated CpG sites (594 CpG islands) between the two subgroups. Mutations in the NPM1 gene occur at a high frequency (40%) within the NK-AML subgroup and are associated with a more favourable prognosis in these patients. A second analysis comparing the NPM1 mutant and wild-type research study subjects again identified distinct methylation profiles between these two subgroups. Network and pathway analysis revealed possible molecular mechanisms associated with the different risk and/or mutation sub-groups. This may result in a better classification of the risk groups, improved monitoring targets, or the identification of novel molecular therapies. PMID:24179384

  6. Characterization and expression of cyp19a gene in the Chinese giant salamander Andrias davidianus.

    PubMed

    Hu, Qiaomu; Xiao, Hanbing; Tian, HaiFeng; Meng, Yan

    2016-02-01

    We cloned the full length cyp19a of Chinese giant salamander Andrias davidianus, determined its distribution in tissues and developing gonads, and analyzed the CpG methylation pattern of the cyp19a promoter. The results revealed isoforms of 1706 bp (G arom) and 1698 bp (B arom) in length, differing in the 5' flanking region, both encoding 502 amino acids. The G arom gene was observed mainly in the ovary and kidney, with little in other investigated tissues, while B arom expression was high in the brain, ovary, testis, and pituitary, with low or undetected expression in other examined tissues. Total aromatase expression was high in the ovary; moderate in the kidney, brain, testis, and pituitary; and low in the remaining tissues. G arom expression was significantly higher in the ovary than in the testis and gradually decreased with maturation of the salamander. A single injection of methyltestosterone or letrozole resulted in ovarian G arom expression decreasing over a 12-96 h period. A 1366 bp sequence of the cyp19a promoter was cloned and shown to be conserved in selected species. CpG methylation level was negatively correlated with cyp19a expression in the examined tissues and developing ovaries. Five and three CpG methylation sites positively correlated with DNA methylation levels in tissues and developing ovary, suggesting that they play an important role in regulating cyp19a expression. The aromatase gene showed two isoforms with distinct expression patterns, and the promoter methylation level at specific CpG sites was associated with variation in expression profiles of tissues and developing ovaries. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. The Generation of Antiphase Oscillations and Synchrony by a Rebound-Based Vertebrate Central Pattern Generator

    PubMed Central

    Merrison-Hort, Robert; Zhang, Hong-Yan; Borisyuk, Roman

    2014-01-01

    Many neural circuits are capable of generating multiple stereotyped outputs after different sensory inputs or neuromodulation. We have previously identified the central pattern generator (CPG) for Xenopus tadpole swimming that involves antiphase oscillations of activity between the left and right sides. Here we analyze the cellular basis for spontaneous left–right motor synchrony characterized by simultaneous bursting on both sides at twice the swimming frequency. Spontaneous synchrony bouts are rare in most tadpoles, and they instantly emerge from and switch back to swimming, most frequently within the first second after skin stimulation. Analyses show that only neurons that are active during swimming fire action potentials in synchrony, suggesting both output patterns derive from the same neural circuit. The firing of excitatory descending interneurons (dINs) leads that of other types of neurons in synchrony as it does in swimming. During synchrony, the time window between phasic excitation and inhibition is 7.9 ± 1 ms, shorter than that in swimming (41 ± 2.3 ms). The occasional, extra midcycle firing of dINs during swimming may initiate synchrony, and mismatches of timing in the left and right activity can switch synchrony back to swimming. Computer modeling supports these findings by showing that the same neural network, in which reciprocal inhibition mediates rebound firing, can generate both swimming and synchrony without circuit reconfiguration. Modeling also shows that lengthening the time window between phasic excitation and inhibition by increasing dIN synaptic/conduction delay can improve the stability of synchrony. PMID:24760866

  8. DNA methylation and healthy human aging.

    PubMed

    Jones, Meaghan J; Goodman, Sarah J; Kobor, Michael S

    2015-12-01

    The process of aging results in a host of changes at the cellular and molecular levels, which include senescence, telomere shortening, and changes in gene expression. Epigenetic patterns also change over the lifespan, suggesting that epigenetic changes may constitute an important component of the aging process. The epigenetic mark that has been most highly studied is DNA methylation, the presence of methyl groups at CpG dinucleotides. These dinucleotides are often located near gene promoters and associate with gene expression levels. Early studies indicated that global levels of DNA methylation increase over the first few years of life and then decrease beginning in late adulthood. Recently, with the advent of microarray and next-generation sequencing technologies, increases in variability of DNA methylation with age have been observed, and a number of site-specific patterns have been identified. It has also been shown that certain CpG sites are highly associated with age, to the extent that prediction models using a small number of these sites can accurately predict the chronological age of the donor. Together, these observations point to the existence of two phenomena that both contribute to age-related DNA methylation changes: epigenetic drift and the epigenetic clock. In this review, we focus on healthy human aging throughout the lifetime and discuss the dynamics of DNA methylation as well as how interactions between the genome, environment, and the epigenome influence aging rates. We also discuss the impact of determining 'epigenetic age' for human health and outline some important caveats to existing and future studies. © 2015 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.

  9. Homology and homoplasy of swimming behaviors and neural circuits in the Nudipleura (Mollusca, Gastropoda, Opisthobranchia)

    PubMed Central

    Newcomb, James M.; Sakurai, Akira; Lillvis, Joshua L.; Gunaratne, Charuni A.; Katz, Paul S.

    2012-01-01

    How neural circuit evolution relates to behavioral evolution is not well understood. Here the relationship between neural circuits and behavior is explored with respect to the swimming behaviors of the Nudipleura (Mollusca, Gastropoda, Opithobranchia). Nudipleura is a diverse monophyletic clade of sea slugs among which only a small percentage of species can swim. Swimming falls into a limited number of categories, the most prevalent of which are rhythmic left–right body flexions (LR) and rhythmic dorsal–ventral body flexions (DV). The phylogenetic distribution of these behaviors suggests a high degree of homoplasy. The central pattern generator (CPG) underlying DV swimming has been well characterized in Tritonia diomedea and in Pleurobranchaea californica. The CPG for LR swimming has been elucidated in Melibe leonina and Dendronotus iris, which are more closely related. The CPGs for the categorically distinct DV and LR swimming behaviors consist of nonoverlapping sets of homologous identified neurons, whereas the categorically similar behaviors share some homologous identified neurons, although the exact composition of neurons and synapses in the neural circuits differ. The roles played by homologous identified neurons in categorically distinct behaviors differ. However, homologous identified neurons also play different roles even in the swim CPGs of the two LR swimming species. Individual neurons can be multifunctional within a species. Some of those functions are shared across species, whereas others are not. The pattern of use and reuse of homologous neurons in various forms of swimming and other behaviors further demonstrates that the composition of neural circuits influences the evolution of behaviors. PMID:22723353

  10. Comparative mapping of GABA-immunoreactive neurons in the central nervous systems of nudibranch molluscs.

    PubMed

    Gunaratne, Charuni A; Sakurai, Akira; Katz, Paul S

    2014-03-01

    The relative simplicity of certain invertebrate nervous systems, such as those of gastropod molluscs, allows behaviors to be dissected at the level of small neural circuits composed of individually identifiable neurons. Elucidating the neurotransmitter phenotype of neurons in neural circuits is important for understanding how those neural circuits function. In this study, we examined the distribution of γ-aminobutyric-acid;-immunoreactive (GABA-ir) neurons in four species of sea slugs (Mollusca, Gastropoda, Opisthobranchia, Nudibranchia): Tritonia diomedea, Melibe leonina, Dendronotus iris, and Hermissenda crassicornis. We found consistent patterns of GABA immunoreactivity in the pedal and cerebral-pleural ganglia across species. In particular, there were bilateral clusters in the lateral and medial regions of the dorsal surface of the cerebral ganglia as well as a cluster on the ventral surface of the pedal ganglia. There were also individual GABA-ir neurons that were recognizable across species. The invariant presence of these individual neurons and clusters suggests that they are homologous, although there were interspecies differences in the numbers of neurons in the clusters. The GABAergic system was largely restricted to the central nervous system, with the majority of axons confined to ganglionic connectives and commissures, suggesting a central, integrative role for GABA. GABA was a candidate inhibitory neurotransmitter for neurons in central pattern generator (CPG) circuits underlying swimming behaviors in these species, however none of the known swim CPG neurons were GABA-ir. Although the functions of these GABA-ir neurons are not known, it is clear that their presence has been strongly conserved across nudibranchs. Copyright © 2013 Wiley Periodicals, Inc.

  11. Visually guided gait modifications for stepping over an obstacle: a bio-inspired approach.

    PubMed

    Silva, Pedro; Matos, Vitor; Santos, Cristina P

    2014-02-01

    There is an increasing interest in conceiving robotic systems that are able to move and act in an unstructured and not predefined environment, for which autonomy and adaptability are crucial features. In nature, animals are autonomous biological systems, which often serve as bio-inspiration models, not only for their physical and mechanical properties, but also their control structures that enable adaptability and autonomy-for which learning is (at least) partially responsible. This work proposes a system which seeks to enable a quadruped robot to online learn to detect and to avoid stumbling on an obstacle in its path. The detection relies in a forward internal model that estimates the robot's perceptive information by exploring the locomotion repetitive nature. The system adapts the locomotion in order to place the robot optimally before attempting to step over the obstacle, avoiding any stumbling. Locomotion adaptation is achieved by changing control parameters of a central pattern generator (CPG)-based locomotion controller. The mechanism learns the necessary alterations to the stride length in order to adapt the locomotion by changing the required CPG parameter. Both learning tasks occur online and together define a sensorimotor map, which enables the robot to learn to step over the obstacle in its path. Simulation results show the feasibility of the proposed approach.

  12. Multivariable harmonic balance analysis of the neuronal oscillator for leech swimming.

    PubMed

    Chen, Zhiyong; Zheng, Min; Friesen, W Otto; Iwasaki, Tetsuya

    2008-12-01

    Biological systems, and particularly neuronal circuits, embody a very high level of complexity. Mathematical modeling is therefore essential for understanding how large sets of neurons with complex multiple interconnections work as a functional system. With the increase in computing power, it is now possible to numerically integrate a model with many variables to simulate behavior. However, such analysis can be time-consuming and may not reveal the mechanisms underlying the observed phenomena. An alternative, complementary approach is mathematical analysis, which can demonstrate direct and explicit relationships between a property of interest and system parameters. This paper introduces a mathematical tool for analyzing neuronal oscillator circuits based on multivariable harmonic balance (MHB). The tool is applied to a model of the central pattern generator (CPG) for leech swimming, which comprises a chain of weakly coupled segmental oscillators. The results demonstrate the effectiveness of the MHB method and provide analytical explanations for some CPG properties. In particular, the intersegmental phase lag is estimated to be the sum of a nominal value and a perturbation, where the former depends on the structure and span of the neuronal connections and the latter is roughly proportional to the period gradient, communication delay, and the reciprocal of the intersegmental coupling strength.

  13. A molluscan model system in the search for the engram.

    PubMed

    Lukowiak, Ken; Sangha, Susan; Scheibenstock, Andi; Parvez, Kashif; McComb, Chloe; Rosenegger, David; Varshney, Nishi; Sadamoto, Hisayo

    2003-01-01

    A 3-neuron central pattern generator, whose sufficiency and necessity has been directly demonstrated, mediates aerial respiratory behaviour in the pond snail, Lymnaea stagnalis. This behaviour can be operantly conditioned, and this associative learning is consolidated into long-lasting memory. Depending on the operant conditioning training procedure used the learning can be consolidated into intermediate term (ITM) or long-term memory (LTM). ITM persists for only 2-3 h, whilst LTM persists for days to weeks. LTM is dependent on both altered gene activity and new protein synthesis while ITM is only dependent on new protein synthesis. We have now directly established that one of the 3-CPG neurons, RPeD1, is a site of LTM formation and storage. We did this by ablating the soma of RPeD1 and leaving behind a functional primary neurite capable of mediating the necessary synaptic interactions to drive aerial respiratory behaviour by the 3-neuron CPG. However, following soma ablation the neuronal circuit is only capable of mediating learning and ITM. LTM can no longer be demonstrated. However, if RPeD1's soma is ablated after LTM consolidation memory is still present. Thus the soma is not needed for the retention of LTM. Using a similar strategy it may be possible to block forgetting.

  14. DNA methylation profiles of donor nuclei cells and tissues of cloned bovine fetuses.

    PubMed

    Kremenskoy, Maksym; Kremenska, Yuliya; Suzuki, Masako; Imai, Kei; Takahashi, Seiya; Hashizume, Kazuyoshi; Yagi, Shintaro; Shiota, Kunio

    2006-04-01

    Methylation of DNA in CpG islands plays an important role during fetal development and differentiation because CpG islands are preferentially located in upstream regions of mammalian genomic DNA, including the transcription start site of housekeeping genes and are also associated with tissue-specific genes. Somatic nuclear transfer (NT) technology has been used to generate live clones in numerous mammalian species, but only a low percentage of nuclear transferred animals develop to term. Abnormal epigenetic changes in the CpG islands of donor nuclei after nuclear transfer could contribute to a high rate of abortion during early gestation and increase perinatal death. These changes have yet to be explored. Thus, we investigated the genome-wide DNA methylation profiles of CpG islands in nuclei donor cells and NT animals. Using Restriction Landmark Genomic Scanning (RLGS), we showed, for the first time, the epigenetic profile formation of tissues from NT bovine fetuses produced from cumulus cells. From approximately 2600 unmethylated NotI sites visualized on the RLGS profile, at least 35 NotI sites showed different methylation statuses. Moreover, we proved that fetal and placental tissues from artificially inseminated and cloned cattle have tissue-specific differences in the genome-wide methylation profiles of the CpG islands. We also found that possible abnormalities occurred in the fetal brain and placental tissues of cloned animals.

  15. Combined study of genetic and epigenetic biomarker risperidone treatment efficacy in Chinese Han schizophrenia patients

    PubMed Central

    Shi, Y; Li, M; Song, C; Xu, Q; Huo, R; Shen, L; Xing, Q; Cui, D; Li, W; Zhao, J; He, L; Qin, S

    2017-01-01

    Nowadays, risperidone is an atypical antipsychotic drug that has been increasingly used for treatment and maintenance therapy in schizophrenia. However, partially affected by genetic or environmental factors, there is significant difference in treatment outcomes among patients. In this study, we aimed to interpret the difference between good and poor responders treated with risperidone in both genetic and epigenetic levels in 288 mainland Chinese patients. We recruited a Henan cohort including 98 patients as initial discovery group and then confirmed our results in Shanghai cohort. In genetic studies, we found 10 candidate single-nucleotide polymorphisms (SNPs) and 2 rare variants in Henan cohort by next-generation sequencing of 100 risperidone-response-related genes. After replication in Shanghai cohort by massarray platform, ultimately, rs6706232 and rs4818 were significantly associated with risperidone response in the two cohort meta-analysis (P=0.024 and 0.04, respectively). Besides, we also selected another reported 17 candidate SNPs associated with risperidone drug response to replicate in our mainland Chinese samples, while, we found no significant SNPs after Bonferroni correction. In epigenetic studies, we investigated the methylation status in promoters or gene-coding region of risperidone drug response-related genes including CYP3A4, CYP2D6, ABCB1, HTR2A, DRD2. Totally we found seven significant CpG sites in the meta-analysis with Bonferroni-corrected PCYP3A4_CpG_-36=0.0014, PCYP3A4_CpG_-258=0.0013, PCYP3A4_CpG_-296=0.0014, PCYP3A4_CpG_-367:-372:-374=0.028, PCYP2D6_CpG_193=0.012, PCYP2D6_CpG_242:244:250=0.00076 and PCYP2D6_CpG_284=0.034, respectively. As genetic and epigenetic factors may interactively affect drug response, we finally carried out a multivariant interaction analysis with multifactor dimensionality reduction and discovered a significant four-locus model (CYP3A4_CpG_-82:-86 +rs6280+rs1800497+rs6265, P=0.038) affecting drug response. These findings could partially explain different risperidone response outcome in Chinese population in a systematic level. PMID:28696411

  16. Biologically inspired adaptive walking of a quadruped robot.

    PubMed

    Kimura, Hiroshi; Fukuoka, Yasuhiro; Cohen, Avis H

    2007-01-15

    We describe here the efforts to induce a quadruped robot to walk with medium-walking speed on irregular terrain based on biological concepts. We propose the necessary conditions for stable dynamic walking on irregular terrain in general, and we design the mechanical and the neural systems by comparing biological concepts with those necessary conditions described in physical terms. PD-controller at joints constructs the virtual spring-damper system as the viscoelasticity model of a muscle. The neural system model consists of a central pattern generator (CPG), reflexes and responses. We validate the effectiveness of the proposed neural system model control using the quadruped robots called 'Tekken1&2'. MPEG footage of experiments can be seen at http://www.kimura.is.uec.ac.jp.

  17. Modulation of transcription factor binding and epigenetic regulation of the MLH1 CpG island and shore by polymorphism rs1800734 in colorectal cancer

    PubMed Central

    Savio, Andrea J.; Bapat, Bharati

    2017-01-01

    ABSTRACT The MLH1 promoter polymorphism rs1800734 is associated with MLH1 CpG island hypermethylation and expression loss in colorectal cancer (CRC). Conversely, variant rs1800734 is associated with MLH1 shore, but not island, hypomethylation in peripheral blood mononuclear cell DNA. To explore these distinct patterns, MLH1 CpG island and shore methylation was assessed in CRC cell lines stratified by rs1800734 genotype. Cell lines containing the variant A allele demonstrated MLH1 shore hypomethylation compared to wild type (GG). There was significant enrichment of transcription factor AP4 at the MLH1 promoter in GG and GA cell lines, but not the AA cell line, by chromatin immunoprecipitation studies. Preferential binding to the G allele was confirmed by sequencing in the GA cell line. The enhancer-associated histone modification H3K4me1 was enriched at the MLH1 shore; however, H3K27ac was not, indicating the shore is an inactive enhancer. These results demonstrate the role of variant rs1800734 in altering transcription factor binding as well as epigenetics at regions beyond the MLH1 CpG island in which it is located. PMID:28304185

  18. Modulation of transcription factor binding and epigenetic regulation of the MLH1 CpG island and shore by polymorphism rs1800734 in colorectal cancer.

    PubMed

    Savio, Andrea J; Bapat, Bharati

    2017-06-03

    The MLH1 promoter polymorphism rs1800734 is associated with MLH1 CpG island hypermethylation and expression loss in colorectal cancer (CRC). Conversely, variant rs1800734 is associated with MLH1 shore, but not island, hypomethylation in peripheral blood mononuclear cell DNA. To explore these distinct patterns, MLH1 CpG island and shore methylation was assessed in CRC cell lines stratified by rs1800734 genotype. Cell lines containing the variant A allele demonstrated MLH1 shore hypomethylation compared to wild type (GG). There was significant enrichment of transcription factor AP4 at the MLH1 promoter in GG and GA cell lines, but not the AA cell line, by chromatin immunoprecipitation studies. Preferential binding to the G allele was confirmed by sequencing in the GA cell line. The enhancer-associated histone modification H3K4me1 was enriched at the MLH1 shore; however, H3K27ac was not, indicating the shore is an inactive enhancer. These results demonstrate the role of variant rs1800734 in altering transcription factor binding as well as epigenetics at regions beyond the MLH1 CpG island in which it is located.

  19. CpG ODN 1668 induce innate and adaptive immune responses in rock bream (Oplegnathus fasciatus) against rock bream iridovirus (RBIV) infection.

    PubMed

    Jung, Myung-Hwa; Jung, Sung-Ju

    2017-10-01

    Rock bream iridovirus (RBIV) causes severe mass mortalities in rock bream in Korea. CpG ODN 1668 showed promise as immunoprotective agents against RBIV infection in rock bream. In this study, we assessed innate/adaptive-related gene expression patterns in RBIV-infected rock bream with and without CpG ODN 1668 administration to determine important immune defense related factors that may affect fish survival. In the CpG ODN 1668+virus-injected group, virus copies were more than 7.4- to 790591-fold lower than in the virus-injected group at 4 d (8.79 × 10 4 and 6.58 × 10 5 /μl, respectively), 7 d (5.30 × 10 2 and 2.29 × 10 7 /μl, respectively) and 10 dpi (7.79 × 10 1 and 6.16 × 10 7 /μl, respectively). Furthermore, in the CpG ODN 1668+virus-injected group, significantly higher levels of MyD88 (6 h, 1 d, 4 d and 7 dpi), IL1β (1 d, 2 d and 7 dpi) and perforin/granzyme (1 dpi) expression were observed, whereas these genes were not significantly expressed in the virus-injected group at that time points. Mx, ISG15 and PKR were significantly highly expressed at 4 d and 7 dpi and reduced when low viral loads at 10 dpi in the CpG ODN 1668+virus-injected group. Conversely, in the virus-injected group, Mx, ISG15 and PKR expression were significantly higher than the control group until 10 dpi. However, MHC class I, CD8, Fas, Fas ligand and caspases (3, 8 and 9) expression levels showed no statistically significant differences between virus- and CpG ODN 1668+virus-injected group. In summary, CpG ODN 1668 administration in fish induces innate immune response or cell death pathway, which could be a major contributing factor to effective fish control over viral transcription on 4 d to 10 dpi. Expression of MyD88, IL1β, perforin and granzyme-related immune gene response is critical factor for inhibition of RBIV replication. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Cooperative Control for A Hybrid Rehabilitation System Combining Functional Electrical Stimulation and Robotic Exoskeleton

    PubMed Central

    Zhang, Dingguo; Ren, Yong; Gui, Kai; Jia, Jie; Xu, Wendong

    2017-01-01

    Functional electrical stimulation (FES) and robotic exoskeletons are two important technologies widely used for physical rehabilitation of paraplegic patients. We developed a hybrid rehabilitation system (FEXO Knee) that combined FES and an exoskeleton for swinging movement control of human knee joints. This study proposed a novel cooperative control strategy, which could realize arbitrary distribution of torque generated by FES and exoskeleton, and guarantee harmonic movements. The cooperative control adopted feedfoward control for FES and feedback control for exoskeleton. A parameter regulator was designed to update key parameters in real time to coordinate FES controller and exoskeleton controller. Two muscle groups (quadriceps and hamstrings) were stimulated to generate active torque for knee joint in synchronization with torque compensation from exoskeleton. The knee joint angle and the interactive torque between exoskeleton and shank were used as feedback signals for the control system. Central pattern generator (CPG) was adopted that acted as a phase predictor to deal with phase confliction of motor patterns, and realized synchronization between the two different bodies (shank and exoskeleton). Experimental evaluation of the hybrid FES-exoskeleton system was conducted on five healthy subjects and four paraplegic patients. Experimental results and statistical analysis showed good control performance of the cooperative control on torque distribution, trajectory tracking, and phase synchronization. PMID:29311798

  1. Cooperative Control for A Hybrid Rehabilitation System Combining Functional Electrical Stimulation and Robotic Exoskeleton.

    PubMed

    Zhang, Dingguo; Ren, Yong; Gui, Kai; Jia, Jie; Xu, Wendong

    2017-01-01

    Functional electrical stimulation (FES) and robotic exoskeletons are two important technologies widely used for physical rehabilitation of paraplegic patients. We developed a hybrid rehabilitation system (FEXO Knee) that combined FES and an exoskeleton for swinging movement control of human knee joints. This study proposed a novel cooperative control strategy, which could realize arbitrary distribution of torque generated by FES and exoskeleton, and guarantee harmonic movements. The cooperative control adopted feedfoward control for FES and feedback control for exoskeleton. A parameter regulator was designed to update key parameters in real time to coordinate FES controller and exoskeleton controller. Two muscle groups (quadriceps and hamstrings) were stimulated to generate active torque for knee joint in synchronization with torque compensation from exoskeleton. The knee joint angle and the interactive torque between exoskeleton and shank were used as feedback signals for the control system. Central pattern generator (CPG) was adopted that acted as a phase predictor to deal with phase confliction of motor patterns, and realized synchronization between the two different bodies (shank and exoskeleton). Experimental evaluation of the hybrid FES-exoskeleton system was conducted on five healthy subjects and four paraplegic patients. Experimental results and statistical analysis showed good control performance of the cooperative control on torque distribution, trajectory tracking, and phase synchronization.

  2. Comprehensive DNA methylation analysis of human neuroblastoma cells treated with blonanserin.

    PubMed

    Murata, Yui; Nishioka, Masaki; Bundo, Miki; Sunaga, Fumiko; Kasai, Kiyoto; Iwamoto, Kazuya

    2014-03-20

    Blonanserin is a second-generation antipsychotic drug for schizophrenia. The pharmacological actions of blonanserin are shown to be the antagonism of dopamine receptor 2 and serotonin receptors. However, its molecular mechanisms in brain cells have not been fully characterized. Accumulating evidence suggests that antipsychotic drugs and mood stabilizers show epigenetic effects on a wide range of genes in animal and cellular models. We performed genome-wide DNA methylation analysis targeting 479,814 CpG sites of cultured human neuroblastoma cells administered with blonanserin. We found that 3,057 CpG sites showed statistically significant changes in DNA methylation at two different doses of blonanserin (1.36 nM and 13.6 nM). These included hypermethylated CpG sites that were enriched in genes related to axonogenesis and cell morphogenesis involved in neuron differentiation. We also showed that the global effect on DNA methylome depends on the concentration of the drug. With a high dose of blonanserin, the overall methylation levels across all CpG sites significantly increased. These increases in DNA methylation were prominent in the CpG sites distant from promoter regions. We further examined DNA methylation changes in specific genes implicated for the actions of antipsychotic drugs, such as the dopamine receptor 2 (DRD2) gene and the serotonin receptor 2A (HTR2A) gene. We observed that CpG sites that were located within DRD2 and HTR2A genes were significantly hypermethylated by blonanserin. The DNA methylation changes induced by the treatment with blonanserin will be useful for understanding its pharmacological actions at the cellular level. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  3. Neonatal Persistent Exposure to 6-Propyl-2-thiouracil, a Thyroid-Disrupting Chemical, Differentially Modulates Expression of Hepatic Catalase and C/EBP-β in Adult Rats.

    PubMed

    Bunker, Suresh Kumar; Dandapat, Jagneshwar; Sahoo, Sunil Kumar; Roy, Anita; Chainy, Gagan B N

    2016-02-01

    Persistent exposure of rats to 6-propyl-2-thiouracil (PTU) from birth resulted in decreases in plasma thyroid hormone (TH) levels and hepatic expression of catalase and CCAAT enhancer binding protein β (C/EBP-β). Catalase promoter region (-185 to +52) that contains binding sites for C/EBP-β showed an augmentation in the methylation level along with a change in methylation pattern of CpG islands in response to PTU treatment. PTU withdrawal on 30 days of birth restored TH levels and C/EBP-β to control rats in adulthood. Although catalase expression was restored to some extent in adult rats in response to PTU withdrawal, a permanent change in its promoter CpG methylation pattern was recorded. The results suggest that downregulation of adult hepatic catalase gene in response to persistent neonatal PTU exposure may not solely be attributed to thyroid-disrupting properties of PTU. It is possible that besides thyroid-disrupting behavior, PTU may impair expression of hepatic catalase by altering methylation pattern of its promoter. © 2015 Wiley Periodicals, Inc.

  4. DNA methylation patterns of behavior-related gene promoter regions dissect the gray wolf from domestic dog breeds.

    PubMed

    Banlaki, Zsofia; Cimarelli, Giulia; Viranyi, Zsofia; Kubinyi, Eniko; Sasvari-Szekely, Maria; Ronai, Zsolt

    2017-06-01

    A growing body of evidence highlights the relationship between epigenetics, especially DNA methylation, and population divergence as well as speciation. However, little is known about how general the phenomenon of epigenetics-wise separation of different populations is, or whether population assignment is, possible based on solely epigenetic marks. In the present study, we compared DNA methylation profiles between four different canine populations: three domestic dog breeds and their ancestor the gray wolf. Altogether, 79 CpG sites constituting the 65 so-called CpG units located in the promoter regions of genes affecting behavioral and temperamental traits (COMT, HTR1A, MAOA, OXTR, SLC6A4, TPH1, WFS1)-regions putatively targeted during domestication and breed selection. Methylation status of buccal cells was assessed using EpiTYPER technology. Significant inter-population methylation differences were found in 52.3% of all CpG units investigated. DNA methylation profile-based hierarchical cluster analysis indicated an unambiguous segregation of wolf from domestic dog. In addition, one of the three dog breeds (Golden Retriever) investigated also formed a separate, autonomous group. The findings support that population segregation is interrelated with shifts in DNA methylation patterns, at least in putative selection target regions, and also imply that epigenetic profiles could provide a sufficient basis for population assignment of individuals.

  5. Determining coding CpG islands by identifying regions significant for pattern statistics on Markov chains.

    PubMed

    Singer, Meromit; Engström, Alexander; Schönhuth, Alexander; Pachter, Lior

    2011-09-23

    Recent experimental and computational work confirms that CpGs can be unmethylated inside coding exons, thereby showing that codons may be subjected to both genomic and epigenomic constraint. It is therefore of interest to identify coding CpG islands (CCGIs) that are regions inside exons enriched for CpGs. The difficulty in identifying such islands is that coding exons exhibit sequence biases determined by codon usage and constraints that must be taken into account. We present a method for finding CCGIs that showcases a novel approach we have developed for identifying regions of interest that are significant (with respect to a Markov chain) for the counts of any pattern. Our method begins with the exact computation of tail probabilities for the number of CpGs in all regions contained in coding exons, and then applies a greedy algorithm for selecting islands from among the regions. We show that the greedy algorithm provably optimizes a biologically motivated criterion for selecting islands while controlling the false discovery rate. We applied this approach to the human genome (hg18) and annotated CpG islands in coding exons. The statistical criterion we apply to evaluating islands reduces the number of false positives in existing annotations, while our approach to defining islands reveals significant numbers of undiscovered CCGIs in coding exons. Many of these appear to be examples of functional epigenetic specialization in coding exons.

  6. Formulation of vaccines containing CpG oligonucleotides and alum

    PubMed Central

    Aebig, Joan A.; Mullen, Gregory E. D.; Dobrescu, Gelu; Rausch, Kelly; Lambert, Lynn; Ajose-Popoola, Olubunmi; Long, Carole A.; Saul, Allan; Miles, Aaron P.

    2007-01-01

    CpG oligodeoxynucleotides are potent immunostimulants. For parenterally delivered alum based vaccines, the immunostimulatory effect of CpG depends on the association of the CpG and antigen to the alum. We describe effects of buffer components on the binding of CPG 7909 to aluminum hydroxide (Alhydrogel), assays for measuring binding of CPG 7909 to alum and CPG 7909 induced dissociation of antigen from the alum. Free CPG 7909 is a potent inducer of IP-10 in mice. However the lack of IP-10 production from formulations containing bound CPG 7909 suggested that CPG 7909 does not rapidly dissociate from the alum after injection. It also suggests that IP-10 assays are not a good basis for potency assays for alum based vaccines containing CPG 7909. PMID:17512533

  7. A glycine receptor is involved in the organization of swimming movements in an invertebrate chordate.

    PubMed

    Nishino, Atsuo; Okamura, Yasushi; Piscopo, Stefania; Brown, Euan R

    2010-01-19

    Rhythmic motor patterns for locomotion in vertebrates are generated in spinal cord neural networks known as spinal Central Pattern Generators (CPGs). A key element in pattern generation is the role of glycinergic synaptic transmission by interneurons that cross the cord midline and inhibit contralaterally-located excitatory neurons. The glycinergic inhibitory drive permits alternating and precisely timed motor output during locomotion such as walking or swimming. To understand better the evolution of this system we examined the physiology of the neural network controlling swimming in an invertebrate chordate relative of vertebrates, the ascidian larva Ciona intestinalis. A reduced preparation of the larva consisting of nerve cord and motor ganglion generates alternating swimming movements. Pharmacological and genetic manipulation of glycine receptors shows that they are implicated in the control of these locomotory movements. Morphological molecular techniques and heterologous expression experiments revealed that glycine receptors are inhibitory and are present on both motoneurones and locomotory muscle while putative glycinergic interneurons were identified in the nerve cord by labeling with an anti-glycine antibody. In Ciona intestinalis, glycine receptors, glycinergic transmission and putative glycinergic interneurons, have a key role in coordinating swimming movements through a simple CPG that is present in the motor ganglion and nerve cord. Thus, the strong association between glycine receptors and vertebrate locomotory networks may now be extended to include the phylum chordata. The results suggest that the basic network for 'spinal-like' locomotion is likely to have existed in the common ancestor of extant chordates some 650 M years ago.

  8. A glycine receptor is involved in the organization of swimming movements in an invertebrate chordate

    PubMed Central

    2010-01-01

    Background Rhythmic motor patterns for locomotion in vertebrates are generated in spinal cord neural networks known as spinal Central Pattern Generators (CPGs). A key element in pattern generation is the role of glycinergic synaptic transmission by interneurons that cross the cord midline and inhibit contralaterally-located excitatory neurons. The glycinergic inhibitory drive permits alternating and precisely timed motor output during locomotion such as walking or swimming. To understand better the evolution of this system we examined the physiology of the neural network controlling swimming in an invertebrate chordate relative of vertebrates, the ascidian larva Ciona intestinalis. Results A reduced preparation of the larva consisting of nerve cord and motor ganglion generates alternating swimming movements. Pharmacological and genetic manipulation of glycine receptors shows that they are implicated in the control of these locomotory movements. Morphological molecular techniques and heterologous expression experiments revealed that glycine receptors are inhibitory and are present on both motoneurones and locomotory muscle while putative glycinergic interneurons were identified in the nerve cord by labeling with an anti-glycine antibody. Conclusions In Ciona intestinalis, glycine receptors, glycinergic transmission and putative glycinergic interneurons, have a key role in coordinating swimming movements through a simple CPG that is present in the motor ganglion and nerve cord. Thus, the strong association between glycine receptors and vertebrate locomotory networks may now be extended to include the phylum chordata. The results suggest that the basic network for 'spinal-like' locomotion is likely to have existed in the common ancestor of extant chordates some 650 M years ago. PMID:20085645

  9. Regulation of DNA methylation patterns by CK2-mediated phosphorylation of Dnmt3a.

    PubMed

    Deplus, Rachel; Blanchon, Loïc; Rajavelu, Arumugam; Boukaba, Abdelhalim; Defrance, Matthieu; Luciani, Judith; Rothé, Françoise; Dedeurwaerder, Sarah; Denis, Hélène; Brinkman, Arie B; Simmer, Femke; Müller, Fabian; Bertin, Benjamin; Berdasco, Maria; Putmans, Pascale; Calonne, Emilie; Litchfield, David W; de Launoit, Yvan; Jurkowski, Tomasz P; Stunnenberg, Hendrik G; Bock, Christoph; Sotiriou, Christos; Fraga, Mario F; Esteller, Manel; Jeltsch, Albert; Fuks, François

    2014-08-07

    DNA methylation is a central epigenetic modification that is established by de novo DNA methyltransferases. The mechanisms underlying the generation of genomic methylation patterns are still poorly understood. Using mass spectrometry and a phosphospecific Dnmt3a antibody, we demonstrate that CK2 phosphorylates endogenous Dnmt3a at two key residues located near its PWWP domain, thereby downregulating the ability of Dnmt3a to methylate DNA. Genome-wide DNA methylation analysis shows that CK2 primarily modulates CpG methylation of several repeats, most notably of Alu SINEs. This modulation can be directly attributed to CK2-mediated phosphorylation of Dnmt3a. We also find that CK2-mediated phosphorylation is required for localization of Dnmt3a to heterochromatin. By revealing phosphorylation as a mode of regulation of de novo DNA methyltransferase function and by uncovering a mechanism for the regulation of methylation at repetitive elements, our results shed light on the origin of DNA methylation patterns. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  10. Distribution of CpG Motifs in Upstream Gene Domains in a Reef Coral and Sea Anemone: Implications for Epigenetics in Cnidarians.

    PubMed

    Marsh, Adam G; Hoadley, Kenneth D; Warner, Mark E

    2016-01-01

    Coral reefs are under assault from stressors including global warming, ocean acidification, and urbanization. Knowing how these factors impact the future fate of reefs requires delineating stress responses across ecological, organismal and cellular scales. Recent advances in coral reef biology have integrated molecular processes with ecological fitness and have identified putative suites of temperature acclimation genes in a Scleractinian coral Acropora hyacinthus. We wondered what unique characteristics of these genes determined their coordinate expression in response to temperature acclimation, and whether or not other corals and cnidarians would likewise possess these features. Here, we focus on cytosine methylation as an epigenetic DNA modification that is responsive to environmental stressors. We identify common conserved patterns of cytosine-guanosine dinucleotide (CpG) motif frequencies in upstream promoter domains of different functional gene groups in two cnidarian genomes: a coral (Acropora digitifera) and an anemone (Nematostella vectensis). Our analyses show that CpG motif frequencies are prominent in the promoter domains of functional genes associated with environmental adaptation, particularly those identified in A. hyacinthus. Densities of CpG sites in upstream promoter domains near the transcriptional start site (TSS) are 1.38x higher than genomic background levels upstream of -2000 bp from the TSS. The increase in CpG usage suggests selection to allow for DNA methylation events to occur more frequently within 1 kb of the TSS. In addition, observed shifts in CpG densities among functional groups of genes suggests a potential role for epigenetic DNA methylation within promoter domains to impact functional gene expression responses in A. digitifera and N. vectensis. Identifying promoter epigenetic sequence motifs among genes within specific functional groups establishes an approach to describe integrated cellular responses to environmental stress in reef corals and potential roles of epigenetics on survival and fitness in the face of global climate change.

  11. Influence of the Prader-Willi syndrome imprinting center on the DNA methylation landscape in the mouse brain

    PubMed Central

    Brant, Jason O; Riva, Alberto; Resnick, James L; Yang, Thomas P

    2014-01-01

    Reduced representation bisulfite sequencing (RRBS) was used to analyze DNA methylation patterns across the mouse brain genome in mice carrying a deletion of the Prader-Willi syndrome imprinting center (PWS-IC) on either the maternally- or paternally-inherited chromosome. Within the ∼3.7 Mb imprinted Angelman/Prader-Willi syndrome (AS/PWS) domain, 254 CpG sites were interrogated for changes in methylation due to PWS-IC deletion. Paternally-inherited deletion of the PWS-IC increased methylation levels ∼2-fold at each CpG site (compared to wild-type controls) at differentially methylated regions (DMRs) associated with 5′ CpG island promoters of paternally-expressed genes; these methylation changes extended, to a variable degree, into the adjacent CpG island shores. Maternal PWS-IC deletion yielded little or no changes in methylation at these DMRs, and methylation of CpG sites outside of promoter DMRs also was unchanged upon maternal or paternal PWS-IC deletion. Using stringent ascertainment criteria, ∼750,000 additional CpG sites were also interrogated across the entire mouse genome. This analysis identified 26 loci outside of the imprinted AS/PWS domain showing altered DNA methylation levels of ≥25% upon PWS-IC deletion. Curiously, altered methylation at 9 of these loci was a consequence of maternal PWS-IC deletion (maternal PWS-IC deletion by itself is not known to be associated with a phenotype in either humans or mice), and 10 of these loci exhibited the same changes in methylation irrespective of the parental origin of the PWS-IC deletion. These results suggest that the PWS-IC may affect DNA methylation at these loci by directly interacting with them, or may affect methylation at these loci through indirect downstream effects due to PWS-IC deletion. They further suggest the PWS-IC may have a previously uncharacterized function outside of the imprinted AS/PWS domain. PMID:25482058

  12. Influence of the Prader-Willi syndrome imprinting center on the DNA methylation landscape in the mouse brain.

    PubMed

    Brant, Jason O; Riva, Alberto; Resnick, James L; Yang, Thomas P

    2014-11-01

    Reduced representation bisulfite sequencing (RRBS) was used to analyze DNA methylation patterns across the mouse brain genome in mice carrying a deletion of the Prader-Willi syndrome imprinting center (PWS-IC) on either the maternally- or paternally-inherited chromosome. Within the ~3.7 Mb imprinted Angelman/Prader-Willi syndrome (AS/PWS) domain, 254 CpG sites were interrogated for changes in methylation due to PWS-IC deletion. Paternally-inherited deletion of the PWS-IC increased methylation levels ~2-fold at each CpG site (compared to wild-type controls) at differentially methylated regions (DMRs) associated with 5' CpG island promoters of paternally-expressed genes; these methylation changes extended, to a variable degree, into the adjacent CpG island shores. Maternal PWS-IC deletion yielded little or no changes in methylation at these DMRs, and methylation of CpG sites outside of promoter DMRs also was unchanged upon maternal or paternal PWS-IC deletion. Using stringent ascertainment criteria, ~750,000 additional CpG sites were also interrogated across the entire mouse genome. This analysis identified 26 loci outside of the imprinted AS/PWS domain showing altered DNA methylation levels of ≥25% upon PWS-IC deletion. Curiously, altered methylation at 9 of these loci was a consequence of maternal PWS-IC deletion (maternal PWS-IC deletion by itself is not known to be associated with a phenotype in either humans or mice), and 10 of these loci exhibited the same changes in methylation irrespective of the parental origin of the PWS-IC deletion. These results suggest that the PWS-IC may affect DNA methylation at these loci by directly interacting with them, or may affect methylation at these loci through indirect downstream effects due to PWS-IC deletion. They further suggest the PWS-IC may have a previously uncharacterized function outside of the imprinted AS/PWS domain.

  13. Computational Modeling Approach in Probing the Effects of Cytosine Methylation on the Transcription Factor Binding to DNA.

    PubMed

    Tenayuca, John; Cousins, Kimberley; Yang, Shumei; Zhang, Lubo

    2017-01-01

    Cytosine methylation at CpG dinucleotides is a chief mechanism in epigenetic modification of gene expression patterns. Previous studies demonstrated that increased CpG methylation of Sp1 sites at -268 and -346 of protein kinase C ε promoter repressed the gene expression. The present study investigated the impact of CpG methylation on the Sp1 binding via molecular modeling and electrophoretic mobility shift assay. Each of the Sp1 sites contain two CpGs. Methylation of either CpG lowered the binding affinity of Sp1, whereas methylation of both CpGs produced a greater decrease in the binding affinity. Computation of van der Waals (VDW) energy of Sp1 in complex with the Sp1 sites demonstrated increased VDW values from one to two sites of CpG methylation. Molecular modeling indicated that single CpG methylation caused underwinding of the DNA fragment, with the phosphate groups at C1, C4 and C5 reoriented from their original positions. Methylation of both CpGs pinched the minor groove and increased the helical twist concomitant with a shallow, hydrophobic major groove. Additionally, double methylation eliminated hydrogen bonds on recognition helix residues located at positions -1 and 1, which were essential for interaction with O6/N7 of G-bases. Bonding from linker residues Arg565, Lys595 and Lys596 were also reduced. Methylation of single or both CpGs significantly affected hydrogen bonding from all three Sp1 DNA binding domains, demonstrating that the consequences of cytosine modification extend beyond the neighboring nucleotides. The results indicate that cytosine methylation causes subtle structural alterations in Sp1 binding sites consequently resulting in inhibition of side chain interactions critical for specific base recognition and reduction of the binding affinity of Sp1. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  14. Dendritic Cell-Based Immunotherapy of Breast Cancer: Modulation by CpG DNA

    DTIC Science & Technology

    2005-09-01

    tumor-associated antigens and bacterial DNA oligodeoxynucleotides containing unmethylated CpG sequences (CpG DNA) further augment the immune priming...associated antigens by cytotoxic T lymphocytes, and bacterial DNA oligodeoxy- nucleotides containing unmethylated CpG sequences (CpG DNA) can further...further amplify their immunostimulatory capacity and bacterial DNA oligodeoxynucleotides (ODN) containing unmethylated CpG sequences (CpG DNA) provide such

  15. Magnifying narrow-band imaging of gastric mucosal morphology predicts the H. pylori-related epigenetic field defect.

    PubMed

    Tahara, Tomomitsu; Yamazaki, Jumpei; Tahara, Sayumi; Okubo, Masaaki; Kawamura, Tomohiko; Horiguchi, Noriyuki; Ishizuka, Takamitsu; Nagasaka, Mitsuo; Nakagawa, Yoshihito; Shibata, Tomoyuki; Kuroda, Makoto; Ohmiya, Naoki

    2017-06-08

    DNA methylation is associated with "field defect" in the gastric mucosa. To characterize "field defect" morphologically, we examined DNA methylation of non-neoplastic gastric mucosa in relation to their morphology seen by narrow-band imaging (NBI) with magnifying endoscopy. Magnifying NBI of non-neoplastic gastric body was classified as follows: normal-small and round pits with uniform subepithelial capillary networks; type 1-a little enlarged round pits with indistinct subepithelial capillary networks; type 2-remarkably enlarged pits with irregular vessels; and type 3-clearly demarcated oval or tubulovillous pits with bulky coiled or wavy vessels. Methylation of nine candidate genes (MYOD1, SLC16A12, GDNF, IGF2, MIR 124A1, CDH1, PRDM5, RORA and MLF1) were determined by bisulfite pyrosequencing. Infinium HumanMethylation450 array was used to characterize the methylation of >450,000 CpG sites. Mean Z score methylation of nine genes positively correlated with the changes of mucosal patterns from normal to types 1, 2, and 3 (P < 0.0001). Genome-wide analysis showed that development of mucosal patterns correlated with methylation accumulation especially at CpG islands. Genes with promoter CpG islands that were gradually methylated with the development of mucosal patterns significantly enriched the genes involved in zinc-related pathways. The results indicates that gastric mucosal morphology predicts a "field defect" in this tissue type. Accumulation of DNA methylation is associated with "field defect" in the non-neoplastic gastric mucosa. Endoscopic identification of "field defect" has important implications for preventing gastric cancer. Our results suggest that magnifying NBI of gastric mucosal morphology predicts a "field defect" in the gastric mucosa.

  16. Genomic Distribution and Inter-Sample Variation of Non-CpG Methylation across Human Cell Types

    PubMed Central

    Liao, Jing; Zhang, Yingying; Gu, Hongcang; Bock, Christoph; Boyle, Patrick; Epstein, Charles B.; Bernstein, Bradley E.; Lengauer, Thomas; Gnirke, Andreas; Meissner, Alexander

    2011-01-01

    DNA methylation plays an important role in development and disease. The primary sites of DNA methylation in vertebrates are cytosines in the CpG dinucleotide context, which account for roughly three quarters of the total DNA methylation content in human and mouse cells. While the genomic distribution, inter-individual stability, and functional role of CpG methylation are reasonably well understood, little is known about DNA methylation targeting CpA, CpT, and CpC (non-CpG) dinucleotides. Here we report a comprehensive analysis of non-CpG methylation in 76 genome-scale DNA methylation maps across pluripotent and differentiated human cell types. We confirm non-CpG methylation to be predominantly present in pluripotent cell types and observe a decrease upon differentiation and near complete absence in various somatic cell types. Although no function has been assigned to it in pluripotency, our data highlight that non-CpG methylation patterns reappear upon iPS cell reprogramming. Intriguingly, the patterns are highly variable and show little conservation between different pluripotent cell lines. We find a strong correlation of non-CpG methylation and DNMT3 expression levels while showing statistical independence of non-CpG methylation from pluripotency associated gene expression. In line with these findings, we show that knockdown of DNMTA and DNMT3B in hESCs results in a global reduction of non-CpG methylation. Finally, non-CpG methylation appears to be spatially correlated with CpG methylation. In summary these results contribute further to our understanding of cytosine methylation patterns in human cells using a large representative sample set. PMID:22174693

  17. Characterization of tumor cells and stem cells by differential nuclear methylation imaging

    NASA Astrophysics Data System (ADS)

    Tajbakhsh, Jian; Wawrowsky, Kolja A.; Gertych, Arkadiusz; Bar-Nur, Ori; Vishnevsky, Eugene; Lindsley, Erik H.; Farkas, Daniel L.

    2008-02-01

    DNA methylation plays a key role in cellular differentiation. Aberrant global methylation patterns are associated with several cancer types, as a result of changes in long-term activation status of up to 50% of genes, including oncogenes and tumor-suppressor genes, which are regulated by methylation and demethylation of promoter region CpG dinucleotides (CpG islands). Furthermore, DNA methylation also occurs in nonisland CpG sites (> 95% of the genome), present once per 80 dinucleotides on average. Nuclear DNA methylation increases during the course of cellular differentiation while cancer cells usually show a net loss in methylation. Given the large dynamic range in DNA methylation load, the methylation pattern of a cell can provide a valuable distinction as to its status during differentiation versus the disease state. By applying immunofluorescence, confocal microscopy and 3D image analysis we assessed the potential of differential nuclear distribution of methylated DNA to be utilized as a biomarker to characterize cells during development and when diseased. There are two major fields that may immediately benefit from this development: (1) the search for factors that contribute to pluripotency and cell fate in human embryonic stem cell expansion and differentiation, and (2) the characterization of tumor cells with regard to their heterogeneity in molecular composition and behavior. We performed topological analysis of the distribution of methylated CpG-sites (MeC) versus heterochromatin. This innovative approach revealed significant differences in colocalization patterns of MeC and heterochromatin-derived signals between undifferentiated and differentiated human embryonic stem cells, as well as untreated AtT20 mouse pituitary tumor cells compared to a subpopulation of these cells treated with 5-azacytidine for 48 hours.

  18. Expression and methylation of BDNF in the human brain in schizophrenia.

    PubMed

    Cheah, Sern-Yih; McLeay, Robert; Wockner, Leesa F; Lawford, Bruce R; Young, Ross McD; Morris, Charles P; Voisey, Joanne

    2017-08-01

    To examine the combined effect of the BDNF Val66Met (rs6265) polymorphism and BDNF DNA methylation on transcriptional regulation of the BDNF gene. DNA methylation profiles were generated for CpG sites proximal to Val66Met, within BDNF promoter I and exon V for prefrontal cortex samples from 25 schizophrenia and 25 control subjects. Val66Met genotypes and BDNF mRNA expression data were generated by transcriptome sequencing. Expression, methylation and genotype data were correlated and examined for association with schizophrenia. There was 43% more of the BDNF V-VIII-IX transcript in schizophrenia samples. BDNF mRNA expression and DNA methylation of seven CpG sites were not associated with schizophrenia after accounting for age and PMI effects. BDNF mRNA expression and DNA methylation were not altered by Val66Met after accounting for age and PMI effects. DNA methylation of one CpG site had a marginally significant positive correlation with mRNA expression in schizophrenia subjects. Schizophrenia risk was not associated with differential BDNF mRNA expression and DNA methylation. A larger age-matched cohort with comprehensive clinical history is required to accurately identify the effects of genotype, mRNA expression and DNA methylation on schizophrenia risk.

  19. Mechanism of Mitochondrial Transcription Factor A Attenuation of CpG-Induced Antibody Production

    PubMed Central

    Saifee, Jessica F.; Torres, Raul M.; Janoff, Edward N.

    2016-01-01

    Mitochondrial transcription factor A (TFAM) had previously been shown to act as a damage associated molecular pattern with the ability to enhance CpG-A phosphorothioate oligodeoxynucleotide (ODN)-mediated stimulation of IFNα production from human plasmacytoid dendritic cells. Examination of the mechanism by which TFAM might influence CpG ODN mediated innate immune responses revealed that TFAM binds directly, tightly and selectively to the structurally related CpG-A, -B, and -C ODN. TFAM also modulated the ability of the CpG-B or -C to stimulate the production of antibodies from human B cells. TFAM showed a dose-dependent modulation of CpG-B, and -C -induced antibody production from human B cells in vitro, with enhancement of high dose and inhibition of low doses of CpG stimulation. This effect was linked to the ability of TFAM to directly inhibit the binding of CpG ODNs to B cells, in a manner consistent with the relative binding affinities of TFAM for the ODNs. These data suggest that TFAM alters the free concentration of the CpG available to stimulate B cells by sequestering this ODN in a TFAM-CpG complex. Thus, TFAM has the potential to decrease the pathogenic consequences of exposure to natural CpG-like hypomethylated DNA in vivo, as well as such as that found in traumatic injury, infection, autoimmune disease and during pregnancy. PMID:27280778

  20. Gene silencing of Nox4 by CpG island methylation during hepatocarcinogenesis in rats

    PubMed Central

    López-Álvarez, Guadalupe S.; Wojdacz, Tomasz K.; García-Cuellar, Claudia M.; Monroy-Ramírez, Hugo C.; Rodríguez-Segura, Miguel A.; Pacheco-Rivera, Ruth A.; Valencia-Antúnez, Carlos A.; Cervantes-Anaya, Nancy; Soto-Reyes, Ernesto; Vásquez-Garzón, Verónica R.; Sánchez-Pérez, Yesennia; Villa-Treviño, Saúl

    2017-01-01

    ABSTRACT The association between the downregulation of genes and DNA methylation in their CpG islands has been extensively studied as a mechanism that favors carcinogenesis. The objective of this study was to analyze the methylation of a set of genes selected based on their microarray expression profiles during the process of hepatocarcinogenesis. Rats were euthanized at: 24 h, 7, 11, 16 and 30 days and 5, 9, 12 and 18 months post-treatment. We evaluated the methylation status in the CpG islands of four deregulated genes (Casp3, Cldn1, Pex11a and Nox4) using methylation-sensitive high-resolution melting technology for the samples obtained from different stages of hepatocarcinogenesis. We did not observe methylation in Casp3, Cldn1 or Pex11a. However, Nox4 exhibited altered methylation patterns, reaching a maximum of 10%, even during the early stages of hepatocarcinogenesis. We observed downregulation of mRNA and protein of Nox4 (97.5% and 40%, respectively) after the first carcinogenic stimulus relative to the untreated samples. Our results suggest that Nox4 downregulation is associated with DNA methylation of the CpG island in its promoter. We propose that methylation is a mechanism that can silence the expression of Nox4, which could contribute to the acquisition of neoplastic characteristics during hepatocarcinogenesis in rats. PMID:27895046

  1. Site-specific methylation of the rat prolactin and growth hormone promoters correlates with gene expression.

    PubMed Central

    Ngô, V; Gourdji, D; Laverrière, J N

    1996-01-01

    The methylation patterns of the rat prolactin (rPRL) (positions -440 to -20) and growth hormone (rGH) (positions -360 to -110) promoters were analyzed by bisulfite genomic sequencing. Two normal tissues, the anterior pituitary and the liver, and three rat pituitary GH3 cell lines that differ considerably in their abilities to express both genes were tested. High levels of rPRL gene expression were correlated with hypomethylation of the CpG dinucleotides located at positions -277 and -97, near or within positive cis-acting regulatory elements. For the nine CpG sites analyzed in the rGH promoter, an overall hypomethylation-expression coupling was also observed for the anterior pituitary, the liver, and two of the cell lines. The effect of DNA methylation was tested by measuring the transient expression of the chloramphenicol acetyltransferase reporter gene driven by a regionally methylated rPRL promoter. CpG methylation resulted in a decrease in the activity of the rPRL promoter which was proportional to the number of modified CpG sites. The extent of the inhibition was also found to be dependent on the position of methylated sites. Taken together, these data suggest that site-specific methylation may modulate the action of transcription factors that dictate the tissue-specific expression of the rPRL and rGH genes in vivo. PMID:8668139

  2. Immortalization of T-cells is accompanied by gradual changes in CpG methylation resulting in a profile resembling a subset of T-cell leukemias.

    PubMed

    Degerman, Sofie; Landfors, Mattias; Siwicki, Jan Konrad; Revie, John; Borssén, Magnus; Evelönn, Emma; Forestier, Erik; Chrzanowska, Krystyna H; Rydén, Patrik; Keith, W Nicol; Roos, Göran

    2014-07-01

    We have previously described gene expression changes during spontaneous immortalization of T-cells, thereby identifying cellular processes important for cell growth crisis escape and unlimited proliferation. Here, we analyze the same model to investigate the role of genome-wide methylation in the immortalization process at different time points pre-crisis and post-crisis using high-resolution arrays. We show that over time in culture there is an overall accumulation of methylation alterations, with preferential increased methylation close to transcription start sites (TSSs), islands, and shore regions. Methylation and gene expression alterations did not correlate for the majority of genes, but for the fraction that correlated, gain of methylation close to TSS was associated with decreased gene expression. Interestingly, the pattern of CpG site methylation observed in immortal T-cell cultures was similar to clinical T-cell acute lymphoblastic leukemia (T-ALL) samples classified as CpG island methylator phenotype positive. These sites were highly overrepresented by polycomb target genes and involved in developmental, cell adhesion, and cell signaling processes. The presence of non-random methylation events in in vitro immortalized T-cell cultures and diagnostic T-ALL samples indicates altered methylation of CpG sites with a possible role in malignant hematopoiesis. Copyright © 2014 Neoplasia Press, Inc. Published by Elsevier Inc. All rights reserved.

  3. Variation in Post-Injury Antibiotic Prophylaxis Patterns over Five Years in a Combat Zone

    PubMed Central

    Lloyd, Col Bradley A; Murray, COL Clinton K.; Bradley, William; Shaikh, Faraz; Aggarwal, Deepak; Carson, M. Leigh; Tribble, David R.

    2016-01-01

    In 2008, a clinical practice guideline (CPG) was developed for the prevention of infections among combat casualties and was later revised in 2011. We evaluated utilization of antimicrobials within 48 hours following injury in the combat zone over a five-year period (June 2009–May 2014) with regard to number of regimens, type of antimicrobial, and adherence to the 2011 CPG. The study population consisted of 5196 wounded military personnel. Open fractures and skin and soft-tissue injuries were the most frequent injuries. Closed injuries had the highest overall compliance (83%), while open fractures and maxillofacial injuries had significant improvement in compliance from 2009–2010 (34% and 50%, respectively) to 2013–2014 (73% and 76%; p<0.05). Part of the improvement with open fractures was a significant reduction of expanded Gram-negative coverage (61% received it in 2009–2010 compared to 7% in 2013–2014; p<0.001). Use of Gram-negative coverage with maxillofacial injuries also significantly declined (37% to 12%; p=0.001). Being injured during 2011–2014 compared to 2009–2010 was associated with CPG compliance (p<0.001), while high injury severity scores (≥10) and admission to the intensive care unit in Germany were associated with noncompliance (p<0.001). Our analysis demonstrates an increasing trend toward CPG compliance with significant reduction of expanded Gram-negative coverage. PMID:28291497

  4. Effect of amino groups of mesoporous silica nanoparticles on CpG oligodexynucleotide delivery

    NASA Astrophysics Data System (ADS)

    Xu, Yi; Claiden, Peter; Zhu, Yufang; Morita, Hiromi; Hanagata, Nobutaka

    2015-08-01

    In this study, we proposed to modify mesoporous silica nanoparticles (MSNs) with 3-aminopropyltriethoxysilane (NH2-TES), aminoethylaminopropyltriethoxysilane (2NH2-TES) and 3-[2-(2-aminoethylamino)ethylamino] propyl-trimethoxysilane (3NH2-TES) for binding of cytosine-phosphate-guanosine oligodexynucleotides (CpG ODN), and investigated the effect of different amino groups of MSNs on the CpG ODN delivery. Serum stability, in vitro cytotoxicity, and cytokine interleukin-6 (IL-6) induction by MSN-NH2/CpG, MSN-2NH2/CpG and MSN-3NH2/CpG complexes were investigated in detail. The results showed that three kinds of aminated-MSN-based CpG ODN delivery systems had no cytotoxicity to RAW264.7 cells, and binding of CpG ODN to MSN-NH2, MSN-2NH2 and MSN-3NH2 nanoparticles enhanced the serum stability of CpG ODN due to protection by the nanoparticles. However, three aminated MSN-based CpG ODN delivery systems exhibited different CpG ODN delivery efficiency, and MSN-NH2/CpG complexes had the highest ability to induce IL-6 secretion.

  5. Correlation between anthrax lethal toxin neutralizing antibody levels and survival in guinea pigs and nonhuman primates vaccinated with the AV7909 anthrax vaccine candidate.

    PubMed

    Savransky, Vladimir; Shearer, Jeffry D; Gainey, Melicia R; Sanford, Daniel C; Sivko, Gloria S; Stark, Gregory V; Li, Na; Ionin, Boris; Lacy, Michael J; Skiadopoulos, Mario H

    2017-09-05

    The anthrax vaccine candidate AV7909 is being developed as a next generation vaccine for a post-exposure prophylaxis (PEP) indication against anthrax. AV7909 consists of the Anthrax Vaccine Adsorbed (AVA, BioThrax®) bulk drug substance adjuvanted with the immunostimulatory oligodeoxynucleotide (ODN) compound, CPG 7909. The addition of CPG 7909 to AVA enhances both the magnitude and the kinetics of antibody responses in animals and human subjects, making AV7909 a suitable next-generation vaccine for use in a PEP setting. The studies described here provide initial information on AV7909-induced toxin-neutralizing antibody (TNA) levels associated with the protection of animals from lethal Bacillus anthracis challenge. Guinea pigs or nonhuman primates (NHPs) were immunized on Days 0 and 28 with various dilutions of AV7909, AVA or a saline or Alhydrogel+CPG 7909 control. Animals were challenged via the inhalational route with a lethal dose of aerosolized B. anthracis (Ames strain) spores and observed for clinical signs of disease and mortality. The relationship between pre-challenge serum TNA levels and survival following challenge was determined in order to calculate a threshold TNA level associated with protection. Immunisation with AV7909 induced a rapid, highly protective TNA response in guinea pigs and NHPs. Surprisingly, the TNA threshold associated with a 70% probability of survival for AV7909 immunized animals was substantially lower than the threshold which has been established for the licensed AVA vaccine. The results of this study suggest that the TNA threshold of protection against anthrax could be modified by the addition of an immune stimulant such as CPG 7909 and that the TNA levels associated with protection may be vaccine-specific. Copyright © 2017. Published by Elsevier Ltd.

  6. NLRP7 affects trophoblast lineage differentiation, binds to overexpressed YY1 and alters CpG methylation

    USDA-ARS?s Scientific Manuscript database

    Maternal-effect mutations in NLRP7 cause rare biparentally inherited hydatidiform moles (BiHMs), abnormal pregnancies containing hypertrophic vesicular trophoblast but no embryo. BiHM trophoblasts display abnormal DNA methylation patterns affecting maternally methylated germline differentially methy...

  7. GABA-like immunoreactivity in Biomphalaria: Colocalization with tyrosine hydroxylase-like immunoreactivity in the feeding motor systems of panpulmonate snails.

    PubMed

    Vaasjo, Lee O; Quintana, Alexandra M; Habib, Mohamed R; Mendez de Jesus, Paola A; Croll, Roger P; Miller, Mark W

    2018-08-01

    The simpler nervous systems of certain invertebrates provide opportunities to examine colocalized classical neurotransmitters in the context of identified neurons and well defined neural circuits. This study examined the distribution of γ-aminobutyric acid-like immunoreactivity (GABAli) in the nervous system of the panpulmonates Biomphalaria glabrata and Biomphalaria alexandrina, major intermediate hosts for intestinal schistosomiasis. GABAli neurons were localized in the cerebral, pedal, and buccal ganglia of each species. With the exception of a projection to the base of the tentacle, GABAli fibers were confined to the CNS. As GABAli was previously reported to be colocalized with markers for dopamine (DA) in five neurons in the feeding network of the euopisthobranch gastropod Aplysia californica (Díaz-Ríos, Oyola, & Miller, 2002), double-labeling protocols were used to compare the distribution of GABAli with tyrosine hydroxylase immunoreactivity (THli). As in Aplysia, GABAli-THli colocalization was limited to five neurons, all of which were located in the buccal ganglion. Five GABAli-THli cells were also observed in the buccal ganglia of two other intensively studied panpulmonate species, Lymnaea stagnalis and Helisoma trivolvis. These findings indicate that colocalization of the classical neurotransmitters GABA and DA in feeding central pattern generator (CPG) interneurons preceded the divergence of euopisthobranch and panpulmonate taxa. These observations also support the hypothesis that heterogastropod feeding CPG networks exhibit a common universal design. © 2018 Wiley Periodicals, Inc.

  8. Short-term memory of motor network performance via activity-dependent potentiation of Na+/K+ pump function.

    PubMed

    Zhang, Hong-Yan; Sillar, Keith T

    2012-03-20

    Brain networks memorize previous performance to adjust their output in light of past experience. These activity-dependent modifications generally result from changes in synaptic strengths or ionic conductances, and ion pumps have only rarely been demonstrated to play a dynamic role. Locomotor behavior is produced by central pattern generator (CPG) networks and modified by sensory and descending signals to allow for changes in movement frequency, intensity, and duration, but whether or how the CPG networks recall recent activity is largely unknown. In Xenopus frog tadpoles, swim bout duration correlates linearly with interswim interval, suggesting that the locomotor network retains a short-term memory of previous output. We discovered an ultraslow, minute-long afterhyperpolarization (usAHP) in network neurons following locomotor episodes. The usAHP is mediated by an activity- and sodium spike-dependent enhancement of electrogenic Na(+)/K(+) pump function. By integrating spike frequency over time and linking the membrane potential of spinal neurons to network performance, the usAHP plays a dynamic role in short-term motor memory. Because Na(+)/K(+) pumps are ubiquitously expressed in neurons of all animals and because sodium spikes inevitably accompany network activity, the usAHP may represent a phylogenetically conserved but largely overlooked mechanism for short-term memory of neural network function. Copyright © 2012 Elsevier Ltd. All rights reserved.

  9. The CpG island searcher: a new WWW resource.

    PubMed

    Takai, Daiya; Jones, Peter A

    2003-01-01

    Clusters of CpG dinucleotides in GC rich regions of the genome called "CpG islands" frequently occur in the 5' ends of genes. Methylation of CpG islands plays a role in transcriptional silencing in higher organisms in certain situations. We have established a CpG-island-extraction algorithm, which we previously developed [Takai and Jones, 2002], on a web site which has a simple user interface to identify CpG islands from submitted sequences of up to 50kb. The web site determines the locations of CpG islands using parameters (lower limit of %GC, ObsCpG/ExpCpG, length) set by the user, to display the value of parameters on each CpG island, and provides a graphical map of CpG dinucleotide distribution and borders of CpG islands. A command-line version of the CpG islands searcher has also been developed for larger sequences. The CpG Island Searcher was applied to the latest sequence and mapping information of human chromosomes 20, 21 and 22, and a total of 2345 CpG islands were extracted and 534 (23%) of them contained first coding exons and 650 (28%) contained other exons. The CpG Island Searcher is available on the World Wide Web at http://www.cpgislands.com or http://www.uscnorris.com/cpgislands/cpg.cgi.

  10. Comprehensive analysis of MGMT promoter methylation: correlation with MGMT expression and clinical response in GBM.

    PubMed

    Shah, Nameeta; Lin, Biaoyang; Sibenaller, Zita; Ryken, Timothy; Lee, Hwahyung; Yoon, Jae-Geun; Rostad, Steven; Foltz, Greg

    2011-01-07

    O⁶-methylguanine DNA-methyltransferase (MGMT) promoter methylation has been identified as a potential prognostic marker for glioblastoma patients. The relationship between the exact site of promoter methylation and its effect on gene silencing, and the patient's subsequent response to therapy, is still being defined. The aim of this study was to comprehensively characterize cytosine-guanine (CpG) dinucleotide methylation across the entire MGMT promoter and to correlate individual CpG site methylation patterns to mRNA expression, protein expression, and progression-free survival. To best identify the specific MGMT promoter region most predictive of gene silencing and response to therapy, we determined the methylation status of all 97 CpG sites in the MGMT promoter in tumor samples from 70 GBM patients using quantitative bisulfite sequencing. We next identified the CpG site specific and regional methylation patterns most predictive of gene silencing and improved progression-free survival. Using this data, we propose a new classification scheme utilizing methylation data from across the entire promoter and show that an analysis based on this approach, which we call 3R classification, is predictive of progression-free survival (HR  = 5.23, 95% CI [2.089-13.097], p<0.0001). To adapt this approach to the clinical setting, we used a methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA) test based on the 3R classification and show that this test is both feasible in the clinical setting and predictive of progression free survival (HR  = 3.076, 95% CI [1.301-7.27], p = 0.007). We discuss the potential advantages of a test based on this promoter-wide analysis and compare it to the commonly used methylation-specific PCR test. Further prospective validation of these two methods in a large independent patient cohort will be needed to confirm the added value of promoter wide analysis of MGMT methylation in the clinical setting.

  11. Comprehensive Analysis of MGMT Promoter Methylation: Correlation with MGMT Expression and Clinical Response in GBM

    PubMed Central

    Shah, Nameeta; Lin, Biaoyang; Sibenaller, Zita; Ryken, Timothy; Lee, Hwahyung; Yoon, Jae-Geun; Rostad, Steven; Foltz, Greg

    2011-01-01

    O6-methylguanine DNA-methyltransferase (MGMT) promoter methylation has been identified as a potential prognostic marker for glioblastoma patients. The relationship between the exact site of promoter methylation and its effect on gene silencing, and the patient's subsequent response to therapy, is still being defined. The aim of this study was to comprehensively characterize cytosine-guanine (CpG) dinucleotide methylation across the entire MGMT promoter and to correlate individual CpG site methylation patterns to mRNA expression, protein expression, and progression-free survival. To best identify the specific MGMT promoter region most predictive of gene silencing and response to therapy, we determined the methylation status of all 97 CpG sites in the MGMT promoter in tumor samples from 70 GBM patients using quantitative bisulfite sequencing. We next identified the CpG site specific and regional methylation patterns most predictive of gene silencing and improved progression-free survival. Using this data, we propose a new classification scheme utilizing methylation data from across the entire promoter and show that an analysis based on this approach, which we call 3R classification, is predictive of progression-free survival (HR  = 5.23, 95% CI [2.089–13.097], p<0.0001). To adapt this approach to the clinical setting, we used a methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA) test based on the 3R classification and show that this test is both feasible in the clinical setting and predictive of progression free survival (HR  = 3.076, 95% CI [1.301–7.27], p = 0.007). We discuss the potential advantages of a test based on this promoter-wide analysis and compare it to the commonly used methylation-specific PCR test. Further prospective validation of these two methods in a large independent patient cohort will be needed to confirm the added value of promoter wide analysis of MGMT methylation in the clinical setting. PMID:21249131

  12. A Six Months Exercise Intervention Influences the Genome-wide DNA Methylation Pattern in Human Adipose Tissue

    PubMed Central

    Rönn, Tina; Volkov, Petr; Davegårdh, Cajsa; Dayeh, Tasnim; Hall, Elin; Olsson, Anders H.; Nilsson, Emma; Tornberg, Åsa; Dekker Nitert, Marloes; Eriksson, Karl-Fredrik; Jones, Helena A.; Groop, Leif; Ling, Charlotte

    2013-01-01

    Epigenetic mechanisms are implicated in gene regulation and the development of different diseases. The epigenome differs between cell types and has until now only been characterized for a few human tissues. Environmental factors potentially alter the epigenome. Here we describe the genome-wide pattern of DNA methylation in human adipose tissue from 23 healthy men, with a previous low level of physical activity, before and after a six months exercise intervention. We also investigate the differences in adipose tissue DNA methylation between 31 individuals with or without a family history of type 2 diabetes. DNA methylation was analyzed using Infinium HumanMethylation450 BeadChip, an array containing 485,577 probes covering 99% RefSeq genes. Global DNA methylation changed and 17,975 individual CpG sites in 7,663 unique genes showed altered levels of DNA methylation after the exercise intervention (q<0.05). Differential mRNA expression was present in 1/3 of gene regions with altered DNA methylation, including RALBP1, HDAC4 and NCOR2 (q<0.05). Using a luciferase assay, we could show that increased DNA methylation in vitro of the RALBP1 promoter suppressed the transcriptional activity (p = 0.03). Moreover, 18 obesity and 21 type 2 diabetes candidate genes had CpG sites with differences in adipose tissue DNA methylation in response to exercise (q<0.05), including TCF7L2 (6 CpG sites) and KCNQ1 (10 CpG sites). A simultaneous change in mRNA expression was seen for 6 of those genes. To understand if genes that exhibit differential DNA methylation and mRNA expression in human adipose tissue in vivo affect adipocyte metabolism, we silenced Hdac4 and Ncor2 respectively in 3T3-L1 adipocytes, which resulted in increased lipogenesis both in the basal and insulin stimulated state. In conclusion, exercise induces genome-wide changes in DNA methylation in human adipose tissue, potentially affecting adipocyte metabolism. PMID:23825961

  13. The Composite of Bone Marrow Concentrate and PRP as an Alternative to Autologous Bone Grafting

    PubMed Central

    Hakimi, Mohssen; Grassmann, Jan-Peter; Betsch, Marcel; Schneppendahl, Johannes; Gehrmann, Sebastian; Hakimi, Ahmad-Reza; Kröpil, Patric; Sager, Martin; Herten, Monika; Wild, Michael; Windolf, Joachim; Jungbluth, Pascal

    2014-01-01

    One possible alternative to the application of autologous bone grafts represents the use of autologous bone marrow concentrate (BMC). The purpose of our study was to evaluate the potency of autologous platelet-rich plasma (PRP) in combination with BMC. In 32 mini-pigs a metaphyseal critical-size defect was surgically created at the proximal tibia. The animals were allocated to four treatment groups of eight animals each (1. BMC+CPG group, 2. BMC+CPG+PRP group, 3. autograft group, 4. CPG group). In the BMC+CPG group the defect was filled with autologous BMC in combination with calcium phosphate granules (CPG), whereas in the BMC+CPG+PRP group the defect was filled with the composite of autologous BMC, CPG and autologous PRP. In the autograft group the defect was filled with autologous cancellous graft, whereas in the CPG group the defect was filled with CPG solely. After 6 weeks radiological and histomorphometrical analysis showed significantly more new bone formation in the BMC+CPG+PRP group compared to the BMC+CPG group and the CPG group. There were no significant differences between the BMC+CPG+PRP group and the autograft group. In the PRP platelets were enriched significantly about 4.7-fold compared to native blood. In BMC the count of mononuclear cells increased significantly (3.5-fold) compared to the bone marrow aspirate. This study demonstrates that the composite of BMC+CPG+PRP leads to a significantly higher bone regeneration of critical-size defects at the proximal tibia in mini-pigs than the use of BMC+CPG without PRP. Furthermore, within the limits of the present study the composite BMC+CPG+PRP represents a comparable alternative to autologous bone grafting. PMID:24950251

  14. Next-generation sequencing identifies major DNA methylation changes during progression of Ph+ chronic myeloid leukemia

    PubMed Central

    Heller, G; Topakian, T; Altenberger, C; Cerny-Reiterer, S; Herndlhofer, S; Ziegler, B; Datlinger, P; Byrgazov, K; Bock, C; Mannhalter, C; Hörmann, G; Sperr, W R; Lion, T; Zielinski, C C; Valent, P; Zöchbauer-Müller, S

    2016-01-01

    Little is known about the impact of DNA methylation on the evolution/progression of Ph+ chronic myeloid leukemia (CML). We investigated the methylome of CML patients in chronic phase (CP-CML), accelerated phase (AP-CML) and blast crisis (BC-CML) as well as in controls by reduced representation bisulfite sequencing. Although only ~600 differentially methylated CpG sites were identified in samples obtained from CP-CML patients compared with controls, ~6500 differentially methylated CpG sites were found in samples from BC-CML patients. In the majority of affected CpG sites, methylation was increased. In CP-CML patients who progressed to AP-CML/BC-CML, we identified up to 897 genes that were methylated at the time of progression but not at the time of diagnosis. Using RNA-sequencing, we observed downregulated expression of many of these genes in BC-CML compared with CP-CML samples. Several of them are well-known tumor-suppressor genes or regulators of cell proliferation, and gene re-expression was observed by the use of epigenetic active drugs. Together, our results demonstrate that CpG site methylation clearly increases during CML progression and that it may provide a useful basis for revealing new targets of therapy in advanced CML. PMID:27211271

  15. Methylation on the Circadian Gene BMAL1 Is Associated with the Effects of a Weight Loss Intervention on Serum Lipid Levels.

    PubMed

    Samblas, Mirian; Milagro, Fermin I; Gómez-Abellán, Purificación; Martínez, J Alfredo; Garaulet, Marta

    2016-06-01

    The circadian clock system has been linked to the onset and development of obesity and some accompanying comorbidities. Epigenetic mechanisms, such as DNA methylation, are putatively involved in the regulation of the circadian clock system. The aim of this study was to investigate the influence of a weight loss intervention based on an energy-controlled Mediterranean dietary pattern in the methylation levels of 3 clock genes, BMAL1, CLOCK, and NR1D1, and the association between the methylation levels and changes induced in the serum lipid profile with the weight loss treatment. The study sample enrolled 61 women (body mass index = 28.6 ± 3.4 kg/m(2); age: 42.2 ± 11.4 years), who followed a nutritional program based on a Mediterranean dietary pattern. DNA was isolated from whole blood obtained at the beginning and end point. Methylation levels at different CpG sites of BMAL1, CLOCK, and NR1D1 were analyzed by Sequenom's MassArray. The energy-restricted intervention modified the methylation levels of different CpG sites in BMAL1 (CpGs 5, 6, 7, 9, 11, and 18) and NR1D1 (CpGs 1, 10, 17, 18, 19, and 22). Changes in cytosine methylation in the CpG 5 to 9 region of BMAL1 with the intervention positively correlated with the eveningness profile (p = 0.019). The baseline methylation of the CpG 5 to 9 region in BMAL1 positively correlated with energy (p = 0.047) and carbohydrate (p = 0.017) intake and negatively correlated with the effect of the weight loss intervention on total cholesterol (p = 0.032) and low-density lipoprotein cholesterol (p = 0.005). Similar significant and positive correlations were found between changes in methylation levels in the CpG 5 to 9 region of BMAL1 due to the intervention and changes in serum lipids (p < 0.05). This research describes apparently for the first time an association between changes in the methylation of the BMAL1 gene with the intervention and the effects of a weight loss intervention on blood lipids levels. © 2016 The Author(s).

  16. An input-representing interneuron regulates spike timing and thereby phase switching in a motor network.

    PubMed

    Sasaki, Kosei; Jing, Jian; Due, Michael R; Weiss, Klaudiusz R

    2008-02-20

    Despite the importance of spike-timing regulation in network functioning, little is known about this regulation at the cellular level. In the Aplysia feeding network, we show that interneuron B65 regulates the timing of the spike initiation of phase-switch neurons B64 and cerebral-buccal interneuron-5/6 (CBI-5/6), and thereby determines the identity of the neuron that acts as a protraction terminator. Previous work showed that B64 begins to fire before the end of protraction phase and terminates protraction in CBI-2-elicited ingestive, but not in CBI-2-elicited egestive programs, thus indicating that the spike timing and phase-switching function of B64 depend on the type of the central pattern generator (CPG)-elicited response rather than on the input used to activate the CPG. Here, we find that CBI-5/6 is a protraction terminator in egestive programs elicited by the esophageal nerve (EN), but not by CBI-2, thus indicating that, in contrast to B64, the spike timing and protraction-terminating function of CBI-5/6 depends on the input to the CPG rather than the response type. Interestingly, B65 activity also depends on the input in that B65 is highly active in EN-elicited programs, but not in CBI-2-elicited programs independent of whether the programs are ingestive or egestive. Notably, during EN-elicited egestive programs, hyperpolarization of B65 delays the onset of CBI-5/6 firing, whereas in CBI-2-elicited ingestive programs, B65 stimulation simultaneously advances CBI-5/6 firing and delays B64 firing, thereby substituting CBI-5/6 for B64 as the protraction terminator. Thus, we identified a neural mechanism that, in an input-dependent manner, regulates spike timing and thereby the functional role of specific neurons.

  17. Risk Factors Associated with Invasive Fungal Infections in Combat Trauma

    PubMed Central

    Rodriguez, Carlos J.; Weintrob, Amy C.; Shah, Jinesh; Malone, Debra; Dunne, James R.; Weisbrod, Allison B.; Lloyd, Bradley A.; Warkentien, Tyler E.; Murray, Clinton K.; Wilkins, Kenneth; Shaikh, Faraz; Carson, M. Leigh; Aggarwal, Deepak

    2014-01-01

    Abstract Background: In recent years, invasive fungal infections (IFI) have complicated the clinical course of patients with combat-related injuries. Commonalities in injury patterns and characteristics among patients with IFI led to the development of a Joint Trauma System (JTS) clinical practice guideline (CPG) for IFI management. We performed a case-control study to confirm and further delineate risk factors associated with IFI development in combat casualties with the objective of generating data to refine the CPG and promote timelier initiation of treatment. Methods: Data were collected retrospectively for United States (U.S.) military personnel injured during deployment in Afghanistan from June 2009 through August 2011. Cases were identified as IFI based upon wound cultures with fungal growth and/or fungal elements seen on histology, in addition to the presence of recurrent wound necrosis. Controls were matched using date of injury (±3 mo) and injury severity score (±10). Risk factor parameters analyzed included injury circumstances, blood transfusion requirements, amputations after first operative intervention, and associated injuries. Data are expressed as multivariate odds ratios (OR; 95% confidence interval [CI]). Results: Seventy-six IFI cases were identified from 1,133 U.S. military personnel wounded in Afghanistan and matched to 150 controls. Parameters associated significantly with the development of IFI multivariate analysis were blast injuries (OR: 5.7; CI: 1.1–29.6), dismounted at time of injury (OR: 8.5; CI: 1.2–59.8); above the knee amputations (OR: 4.1; CI: 1.3-12.7), and large-volume packed red blood cell (PRBC; >20 U) transfusions within first 24 h (OR: 7.0; CI: 2.5-19.7). Conclusions: Our analysis indicates that dismounted blast injuries, resulting in above the knee amputations, and requirement of large volume PRBC transfusions are independent predictors of IFI development. These data confirm all the preliminary risk factors, except for genitalia/perineal injuries, utilized by JTS in their IFI CPG. Model validation is necessary for further risk factor specification. PMID:24821267

  18. Non-linear patterns in age-related DNA methylation may reflect CD4+ T cell differentiation

    PubMed Central

    Johnson, Nicholas D.; Wiener, Howard W.; Smith, Alicia K.; Nishitani, Shota; Absher, Devin M.; Arnett, Donna K.; Aslibekyan, Stella; Conneely, Karen N.

    2017-01-01

    ABSTRACT DNA methylation (DNAm) is an important epigenetic process involved in the regulation of gene expression. While many studies have identified thousands of loci associated with age, few have differentiated between linear and non-linear DNAm trends with age. Non-linear trends could indicate early- or late-life gene regulatory processes. Using data from the Illumina 450K array on 336 human peripheral blood samples, we identified 21 CpG sites that associated with age (P<1.03E-7) and exhibited changing rates of DNAm change with age (P<1.94E-6). For 2 of these CpG sites (cg07955995 and cg22285878), DNAm increased with age at an increasing rate, indicating that differential DNAm was greatest among elderly individuals. We observed significant replication for both CpG sites (P<5.0E-8) in a second set of peripheral blood samples. In 8 of 9 additional data sets comprising samples of monocytes, T cell subtypes, and brain tissue, we observed a pattern directionally consistent with DNAm increasing with age at an increasing rate, which was nominally significant in the 3 largest data sets (4.3E-15

  19. Genome-wide methylation patterns provide insight into differences in breast tumor biology between American women of African and European ancestry

    PubMed Central

    Ambrosone, Christine B.; Young, Allyson C.; Sucheston, Lara E.; Wang, Dan; Li, Yan; Liu, Song; Tang, Li; Hu, Quang; Freudenheim, Jo L.; Shields, Peter G.; Morrison, Carl D.; Demissie, Kitaw; Higgins, Michael J.

    2014-01-01

    American women of African ancestry (AA) are more likely than European-Americans (EA) to be diagnosed with aggressive, estrogen receptor (ER) negative breast tumors; mechanisms underlying these disparities are poorly understood. We conducted a genome wide (450K loci) methylation analysis to determine if there were differences in DNA methylation patterns between tumors from AA and EA women and if these differences were similar for both ER positive and ER negative breast cancer. Methylation levels at CpG loci within CpG islands (CGI)s and CGI-shores were significantly higher in tumors (n=138) than in reduction mammoplasty samples (n=124). In hierarchical cluster analysis, there was separation between tumor and normal samples, and in tumors, there was delineation by ER status, but not by ancestry. However, differential methylation analysis identified 157 CpG loci with a mean β value difference of at least 0.17 between races, with almost twice as many differences in ER-negative tumors compared to ER-positive cancers. This first genome-wide methylation study to address disparities indicates that there are likely differing etiologic pathways for the development of ER negative breast cancer between AA and EA women. Further investigation of the genes most differentially methylated by race in ER negative tumors can guide new approaches for cancer prevention and targeted therapies, and elucidate the biologic basis of breast cancer disparities. PMID:24368439

  20. A Sustained Dietary Change Increases Epigenetic Variation in Isogenic Mice

    PubMed Central

    Cowley, Mark J.; Preiss, Thomas; Martin, David I. K.; Suter, Catherine M.

    2011-01-01

    Epigenetic changes can be induced by adverse environmental exposures, such as nutritional imbalance, but little is known about the nature or extent of these changes. Here we have explored the epigenomic effects of a sustained nutritional change, excess dietary methyl donors, by assessing genomic CpG methylation patterns in isogenic mice exposed for one or six generations. We find stochastic variation in methylation levels at many loci; exposure to methyl donors increases the magnitude of this variation and the number of variable loci. Several gene ontology categories are significantly overrepresented in genes proximal to these methylation-variable loci, suggesting that certain pathways are susceptible to environmental influence on their epigenetic states. Long-term exposure to the diet (six generations) results in a larger number of loci exhibiting epigenetic variability, suggesting that some of the induced changes are heritable. This finding presents the possibility that epigenetic variation within populations can be induced by environmental change, providing a vehicle for disease predisposition and possibly a substrate for natural selection. PMID:21541011

  1. Pathogenic mechanisms of intracellular bacteria.

    PubMed

    Niller, Hans Helmut; Masa, Roland; Venkei, Annamária; Mészáros, Sándor; Minarovits, Janos

    2017-06-01

    We wished to overview recent data on a subset of epigenetic changes elicited by intracellular bacteria in human cells. Reprogramming the gene expression pattern of various host cells may facilitate bacterial growth, survival, and spread. DNA-(cytosine C5)-methyltransferases of Mycoplasma hyorhinis targeting cytosine-phosphate-guanine (CpG) dinucleotides and a Mycobacterium tuberculosis methyltransferase targeting non-CpG sites methylated the host cell DNA and altered the pattern of gene expression. Gene silencing by CpG methylation and histone deacetylation, mediated by cellular enzymes, also occurred in M. tuberculosis-infected macrophages. M. tuberculosis elicited cell type-specific epigenetic changes: it caused increased DNA methylation in macrophages, but induced demethylation, deposition of euchromatic histone marks and activation of immune-related genes in dendritic cells. A secreted transposase of Acinetobacter baumannii silenced a cellular gene, whereas Mycobacterium leprae altered the epigenotype, phenotype, and fate of infected Schwann cells. The 'keystone pathogen' oral bacterium Porphyromonas gingivalis induced local DNA methylation and increased the level of histone acetylation in host cells. These epigenetic changes at the biofilm-gingiva interface may contribute to the development of periodontitis. Epigenetic regulators produced by intracellular bacteria alter the epigenotype and gene expression pattern of host cells and play an important role in pathogenesis.

  2. Enhanced sensitivity of CpG island search and primer design based on predicted CpG island position.

    PubMed

    Park, Hyun-Chul; Ahn, Eu-Ree; Jung, Ju Yeon; Park, Ji-Hye; Lee, Jee Won; Lim, Si-Keun; Kim, Won

    2018-05-01

    DNA methylation has important biological roles, such as gene expression regulation, as well as practical applications in forensics, such as in body fluid identification and age estimation. DNA methylation often occurs in the CpG site, and methylation within the CpG islands affects various cellular functions and is related to tissue-specific identification. Several programs have been developed to identify CpG islands; however, the size, location, and number of predicted CpG islands are not identical due to different search algorithms. In addition, they only provide structural information for predicted CpG islands without experimental information, such as primer design. We developed an analysis pipeline package, CpGPNP, to integrate CpG island prediction and primer design. CpGPNP predicts CpG islands more accurately and sensitively than other programs, and designs primers easily based on the predicted CpG island locations. The primer design function included standard, bisulfite, and methylation-specific PCR to identify the methylation of particular CpG sites. In this study, we performed CpG island prediction on all chromosomes and compared CpG island search performance of CpGPNP with other CpG island prediction programs. In addition, we compared the position of primers designed for a specific region within the predicted CpG island using other bisulfite PCR primer programs. The primers designed by CpGPNP were used to experimentally verify the amplification of the target region of markers for body fluid identification and age estimation. CpGPNP is freely available at http://forensicdna.kr/cpgpnp/. Copyright © 2018 Elsevier B.V. All rights reserved.

  3. Identification of a boron nitride nanosphere-binding peptide for the intracellular delivery of CpG oligodeoxynucleotides

    NASA Astrophysics Data System (ADS)

    Zhang, Huijie; Yamazaki, Tomohiko; Zhi, Chunyi; Hanagata, Nobutaka

    2012-09-01

    CpG oligonucleotides (CpG ODNs) interact with Toll-like receptor 9 (TLR9), which results in the induction of immunostimulatory cytokines. We delivered CpG ODNs intracellularly using boron nitride nanospheres (BNNS). To enhance the loading capacity of CpG ODNs on BNNS, we used a phage display technique to identify a 12-amino acid peptide designated as BP7, with specific affinity for BNNS, and used it as a linker to load CpG ODNs on BNNS. The tyrosine residue (Y) at the eighth position from the N-terminus played a crucial role in the affinity of BP7 to BNNS. BNNS that bound BP7 (BNNS-BP7) were taken up by cells and showed no cytotoxicity, and CpG ODNs were successfully crosslinked with BP7 to create BP7-CpG ODN conjugates. Using BP7 as a linker, the loading efficiency of CpG ODNs on BNNS increased 5-fold compared to the direct binding of CpG ODNs to BNNS. Furthermore, the BP7-CpG ODN conjugate-loaded BNNS had a greater capacity to induce interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-α) production from peripheral blood mononuclear cells (PBMCs) than that of CpG ODNs directly loaded on BNNS. The higher amount of cytokine induction by BP7-CpG ODN conjugate-loaded BNNS may be attributed to a higher loading capacity and stronger binding to BNNS of the linker BP7. The greater functionality of BP7-conjugated CpG ODNs on BNNS expands the potential of BNNS for drug delivery applications.CpG oligonucleotides (CpG ODNs) interact with Toll-like receptor 9 (TLR9), which results in the induction of immunostimulatory cytokines. We delivered CpG ODNs intracellularly using boron nitride nanospheres (BNNS). To enhance the loading capacity of CpG ODNs on BNNS, we used a phage display technique to identify a 12-amino acid peptide designated as BP7, with specific affinity for BNNS, and used it as a linker to load CpG ODNs on BNNS. The tyrosine residue (Y) at the eighth position from the N-terminus played a crucial role in the affinity of BP7 to BNNS. BNNS that bound BP7 (BNNS-BP7) were taken up by cells and showed no cytotoxicity, and CpG ODNs were successfully crosslinked with BP7 to create BP7-CpG ODN conjugates. Using BP7 as a linker, the loading efficiency of CpG ODNs on BNNS increased 5-fold compared to the direct binding of CpG ODNs to BNNS. Furthermore, the BP7-CpG ODN conjugate-loaded BNNS had a greater capacity to induce interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-α) production from peripheral blood mononuclear cells (PBMCs) than that of CpG ODNs directly loaded on BNNS. The higher amount of cytokine induction by BP7-CpG ODN conjugate-loaded BNNS may be attributed to a higher loading capacity and stronger binding to BNNS of the linker BP7. The greater functionality of BP7-conjugated CpG ODNs on BNNS expands the potential of BNNS for drug delivery applications. Electronic supplementary information (ESI) available. See DOI: 10.1039/c2nr31189e

  4. Healthcare professionals' and policy makers' views on implementing a clinical practice guideline of hypertension management: a qualitative study.

    PubMed

    Lee, Ping Yein; Liew, Su May; Abdullah, Adina; Abdullah, Nurdiana; Ng, Chirk Jenn; Hanafi, Nik Sherina; Chia, Yook Chin; Lai, Pauline S M; Wong, Stalia S L; Khoo, Ee Ming

    2015-01-01

    Most studies have reported barriers to guideline usage mainly from doctors' perspective; few have reported the perspective of other stakeholders. This study aimed to determine the views and barriers to adherence of a national clinical practice guideline (CPG) on management of hypertension from the perspectives of policymakers, doctors and allied healthcare professionals. This study used a qualitative approach with purposive sampling. Seven in depth interviews and six focus group discussions were conducted with 35 healthcare professionals (policy makers, doctors, pharmacists and nurses) at a teaching hospital in Kuala Lumpur, Malaysia, between February and June 2013. All interviews were audio-recorded, transcribed verbatim and checked. Thematic approach was used to analyse the data. Two main themes and three sub-themes emerged from this study. The main themes were (1) variation in the use of CPG and (2) barriers to adherence to CPG. The three sub-themes for barriers were issues inherent to the CPG, systems and policy that is not supportive of CPG use, and attitudes and behaviour of stakeholders. The main users of the CPG were the primary care doctors. Pharmacists only partially use the guidelines, while nurses and policy makers were not using the CPG at all. Participants had suggested few strategies to improve usage and adherence to CPG. First, update the CPG regularly and keep its content simple with specific sections for allied health workers. Second, use technology to facilitate CPG accessibility and provide protected time for implementation of CPG recommendations. Third, incorporate local CPG in professional training, link CPG adherence to key performance indicators and provide incentives for its use. Barriers to the use of CPG hypertension management span across all stakeholders. The development and implementation of CPG focused mainly on doctors with lack of involvement of other healthcare stakeholders. Guidelines should be made simple, current, reliable, accessible, inclusive of all stakeholders and with good policy support.

  5. A Knowledge-Modeling Approach to Integrate Multiple Clinical Practice Guidelines to Provide Evidence-Based Clinical Decision Support for Managing Comorbid Conditions.

    PubMed

    Abidi, Samina

    2017-10-26

    Clinical management of comorbidities is a challenge, especially in a clinical decision support setting, as it requires the safe and efficient reconciliation of multiple disease-specific clinical procedures to formulate a comorbid therapeutic plan that is both effective and safe for the patient. In this paper we pursue the integration of multiple disease-specific Clinical Practice Guidelines (CPG) in order to manage co-morbidities within a computerized Clinical Decision Support System (CDSS). We present a CPG integration framework-termed as COMET (Comorbidity Ontological Modeling & ExecuTion) that manifests a knowledge management approach to model, computerize and integrate multiple CPG to yield a comorbid CPG knowledge model that upon execution can provide evidence-based recommendations for handling comorbid patients. COMET exploits semantic web technologies to achieve (a) CPG knowledge synthesis to translate a paper-based CPG to disease-specific clinical pathways (CP) that include specialized co-morbidity management procedures based on input from domain experts; (b) CPG knowledge modeling to computerize the disease-specific CP using a Comorbidity CPG ontology; (c) CPG knowledge integration by aligning multiple ontologically-modeled CP to develop a unified comorbid CPG knowledge model; and (e) CPG knowledge execution using reasoning engines to derive CPG-mediated recommendations for managing patients with comorbidities. We present a web-accessible COMET CDSS that provides family physicians with CPG-mediated comorbidity decision support to manage Atrial Fibrillation and Chronic Heart Failure. We present our qualitative and quantitative analysis of the knowledge content and usability of COMET CDSS.

  6. Hydrocarbon pyrolysis reactor experimentation and modeling for the production of solar absorbing carbon nanoparticles

    NASA Astrophysics Data System (ADS)

    Frederickson, Lee Thomas

    Much of combustion research focuses on reducing soot particulates in emissions. However, current research at San Diego State University (SDSU) Combustion and Solar Energy Laboratory (CSEL) is underway to develop a high temperature solar receiver which will utilize carbon nanoparticles as a solar absorption medium. To produce carbon nanoparticles for the small particle heat exchange receiver (SPHER), a lab-scale carbon particle generator (CPG) has been built and tested. The CPG is a heated ceramic tube reactor with a set point wall temperature of 1100-1300°C operating at 5-6 bar pressure. Natural gas and nitrogen are fed to the CPG where natural gas undergoes pyrolysis resulting in carbon particles. The gas-particle mixture is met downstream with dilution air and sent to the lab scale solar receiver. To predict soot yield and general trends in CPG performance, a model has been setup in Reaction Design CHEMKIN-PRO software. One of the primary goals of this research is to accurately measure particle properties. Mean particle diameter, size distribution, and index of refraction are calculated using Scanning Electron Microscopy (SEM) and a Diesel Particulate Scatterometer (DPS). Filter samples taken during experimentation are analyzed to obtain a particle size distribution with SEM images processed in ImageJ software. These results are compared with the DPS, which calculates the particle size distribution and the index of refraction from light scattering using Mie theory. For testing with the lab scale receiver, a particle diameter range of 200-500 nm is desired. Test conditions are varied to understand effects of operating parameters on particle size and the ability to obtain the size range. Analysis of particle loading is the other important metric for this research. Particle loading is measured downstream of the CPG outlet and dilution air mixing point. The air-particle mixture flows through an extinction tube where opacity of the mixture is measured with a 532 nm laser and detector. Beer's law is then used to calculate particle loading. The CPG needs to produce a certain particle loading for a corresponding receiver test. By obtaining the particle loading in the system, the reaction conversion to solid carbon in the CPG can be calculated to measure the efficiency of the CPG. To predict trends in reaction conversion and particle size from experimentation, the CHEMKIN-PRO computer model for the CPG is run for various flow rates and wall temperature profiles. These predictions were a reason for testing at higher wall set point temperatures. Based on these research goals, it was shown that the CPG consistently produces a mean particle diameter of 200-400 nm at the conditions tested, fitting perfectly inside the desired range. This led to successful lab scale SPHER testing which produced a 10-point efficiency increase and 150°C temperature difference with particles present. Also, at 3 g/s dilution air flow rate, an efficiency of 80% at an outlet temperature above 800°C was obtained. Promise was shown at higher CPG experimental temperatures to produce higher reaction conversion, both experimentally and in the model. However, based on wall temperature data taken during experimentation, it is apparent that the CPG needs to have multiple heating zones with separate temperature controllers in order to have an isothermal zone rather than a parabolic temperature profile. As for the computer model, it predicted much higher reaction conversion at higher temperature. The mass fraction of fuel in the inlet stream was shown to not affect conversion while increasing residence time led to increasing conversion. Particle size distribution in the model was far off and showed a bimodal distribution for one of the statistical methods. Using the results from experimentation and modeling, a preliminary CPG design is presented that will operate in a 5MWth receiver system.

  7. Analysis and Visualization Tool for Targeted Amplicon Bisulfite Sequencing on Ion Torrent Sequencers

    PubMed Central

    Pabinger, Stephan; Ernst, Karina; Pulverer, Walter; Kallmeyer, Rainer; Valdes, Ana M.; Metrustry, Sarah; Katic, Denis; Nuzzo, Angelo; Kriegner, Albert; Vierlinger, Klemens; Weinhaeusel, Andreas

    2016-01-01

    Targeted sequencing of PCR amplicons generated from bisulfite deaminated DNA is a flexible, cost-effective way to study methylation of a sample at single CpG resolution and perform subsequent multi-target, multi-sample comparisons. Currently, no platform specific protocol, support, or analysis solution is provided to perform targeted bisulfite sequencing on a Personal Genome Machine (PGM). Here, we present a novel tool, called TABSAT, for analyzing targeted bisulfite sequencing data generated on Ion Torrent sequencers. The workflow starts with raw sequencing data, performs quality assessment, and uses a tailored version of Bismark to map the reads to a reference genome. The pipeline visualizes results as lollipop plots and is able to deduce specific methylation-patterns present in a sample. The obtained profiles are then summarized and compared between samples. In order to assess the performance of the targeted bisulfite sequencing workflow, 48 samples were used to generate 53 different Bisulfite-Sequencing PCR amplicons from each sample, resulting in 2,544 amplicon targets. We obtained a mean coverage of 282X using 1,196,822 aligned reads. Next, we compared the sequencing results of these targets to the methylation level of the corresponding sites on an Illumina 450k methylation chip. The calculated average Pearson correlation coefficient of 0.91 confirms the sequencing results with one of the industry-leading CpG methylation platforms and shows that targeted amplicon bisulfite sequencing provides an accurate and cost-efficient method for DNA methylation studies, e.g., to provide platform-independent confirmation of Illumina Infinium 450k methylation data. TABSAT offers a novel way to analyze data generated by Ion Torrent instruments and can also be used with data from the Illumina MiSeq platform. It can be easily accessed via the Platomics platform, which offers a web-based graphical user interface along with sample and parameter storage. TABSAT is freely available under a GNU General Public License version 3.0 (GPLv3) at https://github.com/tadkeys/tabsat/ and http://demo.platomics.com/. PMID:27467908

  8. Distinct genetic profiles in colorectal tumors with or without the CpG island methylator phenotype

    PubMed Central

    Toyota, Minoru; Ohe-Toyota, Mutsumi; Ahuja, Nita; Issa, Jean-Pierre J.

    2000-01-01

    Colorectal cancers (CRCs) are characterized by multiple genetic (mutations) and epigenetic (CpG island methylation) alterations, but it is not known whether these evolve independently through stochastic processes. We have recently described a novel pathway termed CpG island methylator phenotype (CIMP) in CRC, which is characterized by the simultaneous methylation of multiple CpG islands, including several known genes, such as p16, hMLH1, and THBS1. We have now studied mutations in K-RAS, p53, DPC4, and TGFβRII in a panel of colorectal tumors with or without CIMP. We find that CIMP defines two groups of tumors with significantly different genetic lesions: frequent K-RAS mutations were found in CIMP+ CRCs (28/41, 68%) compared with CIMP− cases (14/47, 30%, P = 0.0005). By contrast, p53 mutations were found in 24% (10/41) of CIMP+ CRCs vs. 60% (30/46) of CIMP− cases (P = 0.002). Both of these differences were independent of microsatellite instability. These interactions between CIMP, K-RAS mutations, and p53 mutations were preserved in colorectal adenomas, suggesting that they occur early in carcinogenesis. The distinct combinations of epigenetic and genetic alterations in each group suggest that activation of oncogenes and inactivation of tumor suppressor genes is related to the underlying mechanism of generating molecular diversity in cancer, rather than simply accumulate stochastically during cancer development. PMID:10639144

  9. CpG island mapping by epigenome prediction.

    PubMed

    Bock, Christoph; Walter, Jörn; Paulsen, Martina; Lengauer, Thomas

    2007-06-01

    CpG islands were originally identified by epigenetic and functional properties, namely, absence of DNA methylation and frequent promoter association. However, this concept was quickly replaced by simple DNA sequence criteria, which allowed for genome-wide annotation of CpG islands in the absence of large-scale epigenetic datasets. Although widely used, the current CpG island criteria incur significant disadvantages: (1) reliance on arbitrary threshold parameters that bear little biological justification, (2) failure to account for widespread heterogeneity among CpG islands, and (3) apparent lack of specificity when applied to the human genome. This study is driven by the idea that a quantitative score of "CpG island strength" that incorporates epigenetic and functional aspects can help resolve these issues. We construct an epigenome prediction pipeline that links the DNA sequence of CpG islands to their epigenetic states, including DNA methylation, histone modifications, and chromatin accessibility. By training support vector machines on epigenetic data for CpG islands on human Chromosomes 21 and 22, we identify informative DNA attributes that correlate with open versus compact chromatin structures. These DNA attributes are used to predict the epigenetic states of all CpG islands genome-wide. Combining predictions for multiple epigenetic features, we estimate the inherent CpG island strength for each CpG island in the human genome, i.e., its inherent tendency to exhibit an open and transcriptionally competent chromatin structure. We extensively validate our results on independent datasets, showing that the CpG island strength predictions are applicable and informative across different tissues and cell types, and we derive improved maps of predicted "bona fide" CpG islands. The mapping of CpG islands by epigenome prediction is conceptually superior to identifying CpG islands by widely used sequence criteria since it links CpG island detection to their characteristic epigenetic and functional states. And it is superior to purely experimental epigenome mapping for CpG island detection since it abstracts from specific properties that are limited to a single cell type or tissue. In addition, using computational epigenetics methods we could identify high correlation between the epigenome and characteristics of the DNA sequence, a finding which emphasizes the need for a better understanding of the mechanistic links between genome and epigenome.

  10. Obesity and menopause modify the epigenomic profile of breast cancer.

    PubMed

    Crujeiras, Ana B; Diaz-Lagares, Angel; Stefansson, Olafur A; Macias-Gonzalez, Manuel; Sandoval, Juan; Cueva, Juan; Lopez-Lopez, Rafael; Moran, Sebastian; Jonasson, Jon G; Tryggvadottir, Laufey; Olafsdottir, Elinborg; Tinahones, Francisco J; Carreira, Marcos C; Casanueva, Felipe F; Esteller, Manel

    2017-07-01

    Obesity is a high risk factor for breast cancer. This relationship could be marked by a specific methylome. The current work was aimed to explore the impact of obesity and menopausal status on variation in breast cancer methylomes. Data from Infinium 450K array-based methylomes of 64 breast tumors were coupled with information on BMI and menopausal status. Additionally, DNA methylation results were validated in 18 non-tumor and 81 tumor breast samples. Breast tumors arising in either pre- or postmenopausal women stratified by BMI or menopausal status alone were not associated with a specific DNA methylation pattern. Intriguingly, the DNA methylation pattern identified in association with the high-risk group (postmenopausal women with high BMI (>25) and premenopausal women with normal or low BMI < 25) exclusively characterized by hypermethylation of 1287 CpG sites as compared with the low-risk group. These CpG sites included the promoter region of fourteen protein-coding genes of which CpG methylation over the ZNF577 promoter region represents the top scoring associated event. In an independent cohort, the ZNF577 promoter methylation remained statistically significant in association with the high-risk group. Additionally, the impact of ZNF577 promoter methylation on mRNA expression levels was demonstrated in breast cancer cell lines after treatment with a demethylating agent (5-azacytidine). In conclusion, the epigenome of breast tumors is affected by a complex interaction between BMI and menopausal status. The ZNF577 methylation quantification is clearly relevant for the development of novel biomarkers of precision therapy in breast cancer. © 2017 Society for Endocrinology.

  11. Methylation levels of the "long interspersed nucleotide element-1" repetitive sequences predict survival of melanoma patients.

    PubMed

    Sigalotti, Luca; Fratta, Elisabetta; Bidoli, Ettore; Covre, Alessia; Parisi, Giulia; Colizzi, Francesca; Coral, Sandra; Massarut, Samuele; Kirkwood, John M; Maio, Michele

    2011-05-26

    The prognosis of cutaneous melanoma (CM) differs for patients with identical clinico-pathological stage, and no molecular markers discriminating the prognosis of stage III individuals have been established. Genome-wide alterations in DNA methylation are a common event in cancer. This study aimed to define the prognostic value of genomic DNA methylation levels in stage III CM patients. Overall level of genomic DNA methylation was measured using bisulfite pyrosequencing at three CpG sites (CpG1, CpG2, CpG3) of the Long Interspersed Nucleotide Element-1 (LINE-1) sequences in short-term CM cultures from 42 stage IIIC patients. The impact of LINE-1 methylation on overall survival (OS) was assessed using Cox regression and Kaplan-Meier analysis. Hypomethylation (i.e., methylation below median) at CpG2 and CpG3 sites significantly associated with improved prognosis of CM, CpG3 showing the strongest association. Patients with hypomethylated CpG3 had increased OS (P = 0.01, log-rank = 6.39) by Kaplan-Meyer analysis. Median OS of patients with hypomethylated or hypermethylated CpG3 were 31.9 and 11.5 months, respectively. The 5 year OS for patients with hypomethylated CpG3 was 48% compared to 7% for patients with hypermethylated sequences. Among the variables examined by Cox regression analysis, LINE-1 methylation at CpG2 and CpG3 was the only predictor of OS (Hazard Ratio = 2.63, for hypermethylated CpG3; 95% Confidence Interval: 1.21-5.69; P = 0.01). LINE-1 methylation is identified as a molecular marker of prognosis for CM patients in stage IIIC. Evaluation of LINE-1 promises to represent a key tool for driving the most appropriate clinical management of stage III CM patients.

  12. Methylation Patterns of SOX3, SOX9, and WNT4 Genes in Gonads of Dogs with XX (SRY-Negative) Disorder of Sexual Development.

    PubMed

    Salamon, Sylwia; Flisikowski, Krzysztof; Switonski, Marek

    2017-01-01

    Ovotesticular or testicular disorder of sexual development in dogs with female karyotype and lack of SRY (XX DSD) is a common sexual anomaly diagnosed in numerous breeds. The molecular background, however, remains unclear, and epigenetic mechanisms, including DNA methylation, have not been studied. The aim of our study was comparative methylation analysis of CpG islands in promoters of candidate genes for XX DSD: SOX9, SOX3, and WNT4. Methylation studies were performed on DNA extracted from formalin-fixed/paraffin-embedded or frozen gonads from 2 dogs with ovotesticular and 2 dogs with testicular XX DSD as well as control females (n = 4) and males (n = 2). Bisulfite-converted DNA was used for CpG methylation analysis using quantitative pyrosequencing. Promoter regions of SOX9 and WNT4 showed similar CpG methylation in each group, ranging from 0 to 5.5% and from 39 to 74%, respectively. The SOX3 promoter showed significantly higher methylation in the ovotesticular XX DSD cases and the testicular XX DSD and control males, suggesting that SOX3 methylation may play a role in canine XX DSD pathogenesis. © 2017 S. Karger AG, Basel.

  13. Epigenome-wide association study of fasting measures of glucose, insulin, and HOMA-IR in the Genetics of Lipid Lowering Drugs and Diet Network study.

    PubMed

    Hidalgo, Bertha; Irvin, M Ryan; Sha, Jin; Zhi, Degui; Aslibekyan, Stella; Absher, Devin; Tiwari, Hemant K; Kabagambe, Edmond K; Ordovas, Jose M; Arnett, Donna K

    2014-02-01

    Known genetic susceptibility loci for type 2 diabetes (T2D) explain only a small proportion of heritable T2D risk. We hypothesize that DNA methylation patterns may contribute to variation in diabetes-related risk factors, and this epigenetic variation across the genome can contribute to the missing heritability in T2D and related metabolic traits. We conducted an epigenome-wide association study for fasting glucose, insulin, and homeostasis model assessment of insulin resistance (HOMA-IR) among 837 nondiabetic participants in the Genetics of Lipid Lowering Drugs and Diet Network study, divided into discovery (N = 544) and replication (N = 293) stages. Cytosine guanine dinucleotide (CpG) methylation at ∼470,000 CpG sites was assayed in CD4(+) T cells using the Illumina Infinium HumanMethylation 450 Beadchip. We fit a mixed model with the methylation status of each CpG as the dependent variable, adjusting for age, sex, study site, and T-cell purity as fixed-effects and family structure as a random-effect. A Bonferroni corrected P value of 1.1 × 10(-7) was considered significant in the discovery stage. Significant associations were tested in the replication stage using identical models. Methylation of a CpG site in ABCG1 on chromosome 21 was significantly associated with insulin (P = 1.83 × 10(-7)) and HOMA-IR (P = 1.60 × 10(-9)). Another site in the same gene was significant for HOMA-IR and of borderline significance for insulin (P = 1.29 × 10(-7) and P = 3.36 × 10(-6), respectively). Associations with the top two signals replicated for insulin and HOMA-IR (P = 5.75 × 10(-3) and P = 3.35 × 10(-2), respectively). Our findings suggest that methylation of a CpG site within ABCG1 is associated with fasting insulin and merits further evaluation as a novel disease risk marker.

  14. Amyloid protein-mediated differential DNA methylation status regulates gene expression in Alzheimer's disease model cell line

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sung, Hye Youn; Choi, Eun Nam; Ahn Jo, Sangmee

    2011-11-04

    Highlights: Black-Right-Pointing-Pointer Genome-wide DNA methylation pattern in Alzheimer's disease model cell line. Black-Right-Pointing-Pointer Integrated analysis of CpG methylation and mRNA expression profiles. Black-Right-Pointing-Pointer Identify three Swedish mutant target genes; CTIF, NXT2 and DDR2 gene. Black-Right-Pointing-Pointer The effect of Swedish mutation on alteration of DNA methylation and gene expression. -- Abstract: The Swedish mutation of amyloid precursor protein (APP-sw) has been reported to dramatically increase beta amyloid production through aberrant cleavage at the beta secretase site, causing early-onset Alzheimer's disease (AD). DNA methylation has been reported to be associated with AD pathogenesis, but the underlying molecular mechanism of APP-sw-mediated epigenetic alterationsmore » in AD pathogenesis remains largely unknown. We analyzed genome-wide interplay between promoter CpG DNA methylation and gene expression in an APP-sw-expressing AD model cell line. To identify genes whose expression was regulated by DNA methylation status, we performed integrated analysis of CpG methylation and mRNA expression profiles, and identified three target genes of the APP-sw mutant; hypomethylated CTIF (CBP80/CBP20-dependent translation initiation factor) and NXT2 (nuclear exporting factor 2), and hypermethylated DDR2 (discoidin domain receptor 2). Treatment with the demethylating agent 5-aza-2 Prime -deoxycytidine restored mRNA expression of these three genes, implying methylation-dependent transcriptional regulation. The profound alteration in the methylation status was detected at the -435, -295, and -271 CpG sites of CTIF, and at the -505 to -341 region in the promoter of DDR2. In the promoter region of NXT2, only one CpG site located at -432 was differentially unmethylated in APP-sw cells. Thus, we demonstrated the effect of the APP-sw mutation on alteration of DNA methylation and subsequent gene expression. This epigenetic regulatory mechanism may contribute to the pathogenesis of AD.« less

  15. CpG- and LPS-activated MAPK signaling in in vitro cultured salmon (Salmo salar) mononuclear phagocytes.

    PubMed

    Iliev, Dimitar B; Hansen, Tom; Jørgensen, Sven Martin; Krasnov, Aleksei; Jørgensen, Jorunn B

    2013-10-01

    The Mitogen-activated protein kinases (MAPK) are involved in transmitting intracellular signals downstream of diverse cell surface receptors and mediate the response to ligands such as growth factors, hormones and cytokines. In addition, MAPK are critically involved in the innate immune response to pathogen-derived substances, commonly referred to as pathogen-associated molecular patterns (PAMPs), such as bacterial lipopolysaccharide (LPS) and bacterial DNA rich in CpG dinucleotides. Currently, a great deal of knowledge is available about the involvement of MAPK in the innate immune response to PAMPs in mammals; however, little is known about the role of the different MAPK classes in the immune response to PAMPs in lower vertebrates. In the current study, p38 phosphorylation was induced by CpG oligonucleotides (ODNs) and LPS in primary salmon mononuclear phagocytes. Pre-treatment of the cells with a p38 inhibitor (SB203580) blocked the PAMP-induced p38 activity and suppressed the upregulation of most of the CpG- and LPS-induced transcripts highlighting the role of this kinase in the salmon innate immune response to PAMPs. In contrast to p38, the phosphorylation of extracellular signal-regulated kinase (ERK), a MAPK involved primarily in response to mitogens, was high in resting cells and, surprisingly, incubation with both CpG and control ODNs downregulated the phospho-ERK levels independently of p38 activation. The basal phospho-ERK level and the CpG-inducible p38 phosphorylation were greatly influenced by the length of in vitro incubation. The basal phospho-ERK level increased gradually throughout a 5-day culture period and was PI3K-dependent as demonstrated by its sensitivity to Wortmannin suggesting it is influenced by growth factors. Overall these data indicate that both basal and PAMP-induced activity of MAPKs might be greatly influenced by the differentiation status of salmon mononuclear phagocytes. Copyright © 2013. Published by Elsevier Ltd.

  16. The dynamic DNA methylation cycle from egg to sperm in the honey bee Apis mellifera

    PubMed Central

    Drewell, Robert A.; Bush, Eliot C.; Remnant, Emily J.; Wong, Garrett T.; Beeler, Suzannah M.; Stringham, Jessica L.; Lim, Julianne; Oldroyd, Benjamin P.

    2014-01-01

    In honey bees (Apis mellifera), the epigenetic mark of DNA methylation is central to the developmental regulation of caste differentiation, but may also be involved in additional biological functions. In this study, we examine the whole genome methylation profiles of three stages of the haploid honey bee genome: unfertilised eggs, the adult drones that develop from these eggs and the sperm produced by these drones. These methylomes reveal distinct patterns of methylation. Eggs and sperm show 381 genes with significantly different CpG methylation patterns, with the vast majority being more methylated in eggs. Adult drones show greatly reduced levels of methylation across the genome when compared with both gamete samples. This suggests a dynamic cycle of methylation loss and gain through the development of the drone and during spermatogenesis. Although fluxes in methylation during embryogenesis may account for some of the differentially methylated sites, the distinct methylation patterns at some genes suggest parent-specific epigenetic marking in the gametes. Extensive germ line methylation of some genes possibly explains the lower-than-expected frequency of CpG sites in these genes. We discuss the potential developmental and evolutionary implications of methylation in eggs and sperm in this eusocial insect species. PMID:24924193

  17. Genome-wide DNA methylomes from discrete developmental stages reveal the predominance of non-CpG methylation in Tribolium castaneum

    PubMed Central

    Song, Xiaowen; Huang, Fei; Liu, Juanjuan; Li, Chengjun; Gao, Shanshan; Wu, Wei; Zhai, Mengfan; Yu, Xiaojuan; Xiong, Wenfeng; Xie, Jia

    2017-01-01

    Abstract Cytosine DNA methylation is a vital epigenetic regulator of eukaryotic development. Whether this epigenetic modification occurs in Tribolium castaneum has been controversial, its distribution pattern and functions have not been established. Here, using bisulphite sequencing (BS-Seq), we confirmed the existence of DNA methylation and described the methylation profiles of the four life stages of T. castaneum. In the T. castaneum genome, both symmetrical CpG and non-CpG methylcytosines were observed. Symmetrical CpG methylation, which was catalysed by DNMT1 and occupied a small part in T. castaneum methylome, was primarily enriched in gene bodies and was positively correlated with gene expression levels. Asymmetrical non-CpG methylation, which was predominant in the methylome, was strongly concentrated in intergenic regions and introns but absent from exons. Gene body methylation was negatively correlated with gene expression levels. The distribution pattern and functions of this type of methylation were similar only to the methylome of Drosophila melanogaster, which further supports the existence of a novel methyltransferase in the two species responsible for this type of methylation. This first life-cycle methylome of T. castaneum reveals a novel and unique methylation pattern, which will contribute to the further understanding of the variety and functions of DNA methylation in eukaryotes. PMID:28449092

  18. V1 and V2b interneurons secure the alternating flexor-extensor motor activity mice require for limbed locomotion

    PubMed Central

    Zhang, Jingming; Lanuza, Guillermo M.; Britz, Olivier; Wang, Zhi; Siembab, Valerie C.; Zhang, Ying; Velasquez, Tomoko; Alvarez, Francisco J.; Frank, Eric; Goulding, Martyn

    2014-01-01

    SUMMARY The reciprocal activation of flexor and extensor muscles constitutes the fundamental mechanism that tetrapod vertebrates use for locomotion and limb-driven reflex behaviors. This aspect of motor coordination is controlled by inhibitory neurons in the spinal cord; however, the identity of the spinal interneurons that serve this function is not known. Here we show that the production of an alternating flexor-extensor motor rhythm depends on the composite activities of two classes of ventrally-located inhibitory neurons, V1 and V2b interneurons (INs). Abrogating V1 and V2b IN-derived neurotransmission in the isolated spinal cord results in a synchronous pattern of L2 flexor-related and L5 extensor-related locomotor activity. Mice lacking V1 and V2b inhibition are unable to articulate their limb joints and display marked deficits in limb-driven reflex movements. Taken together, these findings identify V1- and V2b-derived neurons as the core interneuronal components of the limb central pattern generator (CPG) that coordinate flexor-extensor motor activity. PMID:24698273

  19. CpG Methylation Analysis of HPV16 in Laser Capture Microdissected Archival Tissue and Whole Tissue Sections from High Grade Anal Squamous Intraepithelial Lesions: A Potential Disease Biomarker

    PubMed Central

    Molano, Monica; Tabrizi, Sepehr N.; Garland, Suzanne M.; Roberts, Jennifer M.; Machalek, Dorothy A.; Phillips, Samuel; Chandler, David; Hillman, Richard J.; Grulich, Andrew E.; Jin, Fengyi; Poynten, I. Mary; Templeton, David J.; Cornall, Alyssa M.

    2016-01-01

    Incidence and mortality rates of anal cancer are increasing globally. More than 90% of anal squamous cell carcinomas (ASCC) are associated with human papillomavirus (HPV). Studies on HPV-related anogenital lesions have shown that patterns of methylation of viral and cellular DNA targets could potentially be developed as disease biomarkers. Lesion-specific DNA isolated from formalin-fixed paraffin-embedded (FFPE) tissues from existing or prospective patient cohorts may constitute a valuable resource for methylation analysis. However, low concentrations of DNA make these samples technically challenging to analyse using existing methods. We therefore set out to develop a sensitive and reproducible nested PCR-pyrosequencing based method to accurately quantify methylation at 10 CpG sites within the E2BS1, E2BS2,3,4 and Sp1 binding sites in the viral upstream regulatory region of HPV16 genome. Methylation analyses using primary and nested PCR-pyrosequencing on 52 FFPE tissue [26 paired whole tissue sections (WTS) and laser capture microdissected (LCM) tissues] from patients with anal squamous intraepithelial lesions was performed. Using nested PCR, methylation results were obtained for the E2BS1, E2BS2,3,4 and Sp1 binding sites in 86.4% of the WTS and 81.8% of the LCM samples. Methylation patterns were strongly correlated within median values of matched pairs of WTS and LCM sections, but overall methylation was higher in LCM samples at different CpG sites. High grade lesions showed low methylation levels in the E2BS1 and E2BS2 regions, with increased methylation detected in the E2BS,3,4/Sp1 regions, showing the highest methylation at CpG site 37. The method developed is highly sensitive in samples with low amounts of DNA and demonstrated to be suitable for archival samples. Our data shows a possible role of specific methylation in the HPV16 URR for detection of HSIL. PMID:27529629

  20. CpG Methylation Analysis of HPV16 in Laser Capture Microdissected Archival Tissue and Whole Tissue Sections from High Grade Anal Squamous Intraepithelial Lesions: A Potential Disease Biomarker.

    PubMed

    Molano, Monica; Tabrizi, Sepehr N; Garland, Suzanne M; Roberts, Jennifer M; Machalek, Dorothy A; Phillips, Samuel; Chandler, David; Hillman, Richard J; Grulich, Andrew E; Jin, Fengyi; Poynten, I Mary; Templeton, David J; Cornall, Alyssa M

    2016-01-01

    Incidence and mortality rates of anal cancer are increasing globally. More than 90% of anal squamous cell carcinomas (ASCC) are associated with human papillomavirus (HPV). Studies on HPV-related anogenital lesions have shown that patterns of methylation of viral and cellular DNA targets could potentially be developed as disease biomarkers. Lesion-specific DNA isolated from formalin-fixed paraffin-embedded (FFPE) tissues from existing or prospective patient cohorts may constitute a valuable resource for methylation analysis. However, low concentrations of DNA make these samples technically challenging to analyse using existing methods. We therefore set out to develop a sensitive and reproducible nested PCR-pyrosequencing based method to accurately quantify methylation at 10 CpG sites within the E2BS1, E2BS2,3,4 and Sp1 binding sites in the viral upstream regulatory region of HPV16 genome. Methylation analyses using primary and nested PCR-pyrosequencing on 52 FFPE tissue [26 paired whole tissue sections (WTS) and laser capture microdissected (LCM) tissues] from patients with anal squamous intraepithelial lesions was performed. Using nested PCR, methylation results were obtained for the E2BS1, E2BS2,3,4 and Sp1 binding sites in 86.4% of the WTS and 81.8% of the LCM samples. Methylation patterns were strongly correlated within median values of matched pairs of WTS and LCM sections, but overall methylation was higher in LCM samples at different CpG sites. High grade lesions showed low methylation levels in the E2BS1 and E2BS2 regions, with increased methylation detected in the E2BS,3,4/Sp1 regions, showing the highest methylation at CpG site 37. The method developed is highly sensitive in samples with low amounts of DNA and demonstrated to be suitable for archival samples. Our data shows a possible role of specific methylation in the HPV16 URR for detection of HSIL.

  1. TLR9-ERK-mTOR signaling is critical for autophagic cell death induced by CpG oligodeoxynucleotide 107 combined with irradiation in glioma cells

    PubMed Central

    Li, Xiaoli; Cen, Yanyan; Cai, Yongqing; Liu, Tao; Liu, Huan; Cao, Guanqun; Liu, Dan; Li, Bin; Peng, Wei; Zou, Jintao; Pang, Xueli; Zheng, Jiang; Zhou, Hong

    2016-01-01

    Synthetic oligodeoxynucleotides containing unmethylated CpG dinucleotides (CpG ODN) function as potential radiosensitizers for glioma treatment, although the underlying mechanism is unclear. It was observed that CpG ODN107, when combined with irradiation, did not induce apoptosis. Herein, the effect of CpG ODN107 + irradiation on autophagy and the related signaling pathways was investigated. In vitro, CpG ODN107 + irradiation induced autophagosome formation, increased the ratio of LC3 II/LC3 I, beclin 1 and decreased p62 expression in U87 cells. Meanwhile, CpG ODN107 also increased LC3 II/LC3 I expression in U251 and CHG-5 cells. In vivo, CpG ODN107 combined with local radiotherapy induced autophagosome formation in orthotopic transplantation tumor. Investigation of the molecular mechanisms demonstrated that CpG ODN107 + irradiation increased the levels of TLR9 and p-ERK, and decreased the level of p-mTOR in glioma cells. Further, TLR9-specific siRNA could affect the expressions of p-ERK and autophagy-related proteins in glioma cells. Taken together, CpG ODN107 combined with irradiation could induce autophagic cell death, and this effect was closely related to the TLR9-ERK-mTOR signaling pathway in glioma cells, providing new insights into the investigation mechanism of CpG ODN. PMID:27251306

  2. Implementation of antibiotic use guidelines for fresh traumatic wound at Siriraj Hospital.

    PubMed

    Sirijatuphat, Rujipas; Choochan, Tanatchon; Siritongtaworn, Preecha; Sripojtham, Vipaporn; Thamlikitkul, Visanu

    2015-03-01

    To determine the effectiveness of implementing a clinical practice guideline (CPG) on antibiotic use for adults with fresh traumatic wounds who attended the trauma center at Siriraj Hospital, Bangkok. A prospective study of 600 adult patients who had fresh traumatic wounds (≤ 6 hours) was conducted at Siriraj Trauma Center from March 2013 to March 2014. The CPG was introduced to physicians, nurses and medical students by posting the CPG at the patient care areas of the trauma center. The outcomes were an appropriate classification of wounds according to the CPG recommendations, prevalence of antibiotic prescribing, incidence of wound infection and compliance with the CPG. Clean-contaminated wounds that did not need antibiotic treatment and clean-contaminated and contaminated wounds that required antibiotics were observed in 63.2, 6.7, and 30.1% ofthe patients, respectively. Antibiotics were given to 512 patients (85.3%). Infections occurred in six patients (1.0%). Antibiotic prescription according to CPG recommendations was observed for 243 patients (40.5%). The prevalence of antibiotic use in the CPG-compliant group (65.8%) was significantly less than that in the CPG-noncompliant group (98.6%) (p < 0.001). The patients in the CPG-compliant group had more contaminated wounds than those in the CPG-noncompliant group (51.4 vs. 15.7%, p < 0.001). The incidences of wound infection were very low in both groups and not significantly different (1.2 vs. 0.8%, p = 0.690). Antibiotic prophylaxis was necessary in less than 36.8% of adults with fresh traumatic wounds who attended Siriraj Trauma Center Compliance to CPG implementation using simple intervention seemed to be low. Adhering to CPG recommendations for antibiotic prophylaxis in adults with fresh traumatic wounds can reduce the unnecessary prescribing of antibiotics without increasing the rate of wound infection.

  3. Depletion of CpG Dinucleotides in Papillomaviruses and Polyomaviruses: A Role for Divergent Evolutionary Pressures.

    PubMed

    Upadhyay, Mohita; Vivekanandan, Perumal

    2015-01-01

    Papillomaviruses and polyomaviruses are small ds-DNA viruses infecting a wide-range of vertebrate hosts. Evidence supporting co-evolution of the virus with the host does not fully explain the evolutionary path of papillomaviruses and polyomaviruses. Studies analyzing CpG dinucleotide frequencies in virus genomes have provided interesting insights on virus evolution. CpG dinucleotide depletion has not been extensively studied among papillomaviruses and polyomaviruses. We sought to analyze the relative abundance of dinucleotides and the relative roles of evolutionary pressures in papillomaviruses and polyomaviruses. We studied 127 full-length sequences from papillomaviruses and 56 full-length sequences from polyomaviruses. We analyzed the relative abundance of dinucleotides, effective codon number (ENC), differences in synonymous codon usage. We examined the association, if any, between the extent of CpG dinucleotide depletion and the evolutionary lineage of the infected host. We also investigated the contribution of mutational pressure and translational selection to the evolution of papillomaviruses and polyomaviruses. All papillomaviruses and polyomaviruses are CpG depleted. Interestingly, the evolutionary lineage of the infected host determines the extent of CpG depletion among papillomaviruses and polyomaviruses. CpG dinucleotide depletion was more pronounced among papillomaviruses and polyomaviruses infecting human and other mammals as compared to those infecting birds. Our findings demonstrate that CpG depletion among papillomaviruses is linked to mutational pressure; while CpG depletion among polyomaviruses is linked to translational selection. We also present evidence that suggests methylation of CpG dinucleotides may explain, at least in part, the depletion of CpG dinucleotides among papillomaviruses but not polyomaviruses. The extent of CpG depletion among papillomaviruses and polyomaviruses is linked to the evolutionary lineage of the infected host. Our results highlight the existence of divergent evolutionary pressures leading to CpG dinucleotide depletion among small ds-DNA viruses infecting vertebrate hosts.

  4. Methylation levels of the "long interspersed nucleotide element-1" repetitive sequences predict survival of melanoma patients

    PubMed Central

    2011-01-01

    Background The prognosis of cutaneous melanoma (CM) differs for patients with identical clinico-pathological stage, and no molecular markers discriminating the prognosis of stage III individuals have been established. Genome-wide alterations in DNA methylation are a common event in cancer. This study aimed to define the prognostic value of genomic DNA methylation levels in stage III CM patients. Methods Overall level of genomic DNA methylation was measured using bisulfite pyrosequencing at three CpG sites (CpG1, CpG2, CpG3) of the Long Interspersed Nucleotide Element-1 (LINE-1) sequences in short-term CM cultures from 42 stage IIIC patients. The impact of LINE-1 methylation on overall survival (OS) was assessed using Cox regression and Kaplan-Meier analysis. Results Hypomethylation (i.e., methylation below median) at CpG2 and CpG3 sites significantly associated with improved prognosis of CM, CpG3 showing the strongest association. Patients with hypomethylated CpG3 had increased OS (P = 0.01, log-rank = 6.39) by Kaplan-Meyer analysis. Median OS of patients with hypomethylated or hypermethylated CpG3 were 31.9 and 11.5 months, respectively. The 5 year OS for patients with hypomethylated CpG3 was 48% compared to 7% for patients with hypermethylated sequences. Among the variables examined by Cox regression analysis, LINE-1 methylation at CpG2 and CpG3 was the only predictor of OS (Hazard Ratio = 2.63, for hypermethylated CpG3; 95% Confidence Interval: 1.21-5.69; P = 0.01). Conclusion LINE-1 methylation is identified as a molecular marker of prognosis for CM patients in stage IIIC. Evaluation of LINE-1 promises to represent a key tool for driving the most appropriate clinical management of stage III CM patients. PMID:21615918

  5. Chitosan-coated boron nitride nanospheres enhance delivery of CpG oligodeoxynucleotides and induction of cytokines

    PubMed Central

    Zhang, Huijie; Chen, Song; Zhi, Chunyi; Yamazaki, Tomohiko; Hanagata, Nobutaka

    2013-01-01

    Background Cytosine-phosphate-guanine (CpG) oligodeoxynucleotides activate Toll-like receptor 9, leading to induction of proinflammatory cytokines, which play an important role in induction and maintenance of innate and adaptive immune responses. Previously, we have used boron nitride nanospheres (BNNS) as a carrier for delivery of unmodified CpG oligodeoxynucleotides to activate Toll-like receptor 9. However, because CpG oligodeoxynucleotides and BNNS are both negatively charged, electrostatic repulsion between them is likely to reduce the loading of CpG oligodeoxynucleotides onto BNNS. Therefore, the efficiency of uptake of CpG oligodeoxynucleotides is also limited and does not result in induction of a robust cytokine response. To ameliorate these problems, we developed a CpG oligodeoxynucleotide delivery system using chitosan-coated BNNS as a carrier. Methods To facilitate attachment of CpG oligodeoxynucleotides onto the BNNS and improve their loading capacity, we prepared positively charged BNNS by coating them with chitosan preparations of three different molecular weights and used them as carriers for delivery of CpG oligodeoxynucleotides. Results The zeta potentials of the BNNS-CS complexes were positive, and chitosan coating improved their dispersity and stability in aqueous solution compared with BNNS. The positive charge of the BNNS-CS complexes greatly improved the loading capacity and cellular uptake efficiency of CpG oligodeoxynucleotides. The loading capacity of the CpG oligodeoxynucleotides depended on the molecular weight of chitosan, which affected the positive charge density on the surface of the BNNS. CpG oligodeoxynucleotides loaded onto BNNS-CS complexes significantly enhanced production of interleukin-6 and tumor necrosis factor-α by peripheral blood mononuclear cells compared with CpG oligodeoxynucleotides directly loaded onto BNNS, or when Lipofectamine™ 2000 was used as the carrier. The molecular weight of the chitosan used to coat the BNNS affected the magnitude of cytokine induction by varying the strength of condensation of the CpG oligodeoxynucleotides. Conclusion Although the loading capacity of BNNS coated with low molecular weight chitosan preparations was the lowest of all the preparations, they induced the highest levels of cytokines. PMID:23674892

  6. Difference Between Adolescent and Collegiate Baseball Pitchers in the Kinematics and Kinetics of the Lower Limbs and Trunk During Pitching Motion

    PubMed Central

    Kageyama, Masahiro; Sugiyama, Takashi; Kanehisa, Hiroaki; Maeda, Akira

    2015-01-01

    The purpose of this study was to clarify the differences between adolescent and collegiate baseball pitchers in the kinematic and kinetic profiles of the trunk and lower limbs during the pitching motion. The subjects were thirty-two adolescent baseball pitchers aged 12-15 years (APG) and thirty collegiate baseball pitchers aged 18-22 years (CPG). Three-dimensional motion analysis with a comprehensive lower-extremity model was used to evaluate kinematic and kinetic parameters during baseball pitching. The ground reaction forces (GRFs) of the pivot and stride legs during pitching were determined using two multicomponent force plates. The joint torques of hip, knee, and ankle were calculated by the inverse-dynamics computation of musculoskeletal human models using motion-capture data. To eliminate any effect of variation in body size, kinetic and GRFs data were normalized by dividing them by body mass. The velocity of a pitched ball was significantly higher (p < 0.01) in CPG (35.2 ± 1.9 m·s-1) than in the APG (30.7 ± 2.7 m·s-1). Most kinematic parameters for the lower limbs were similar between the CPG and the APG. Maximum Fy (toward the throwing direction) on the pivot leg and Fy and resultant forces on the stride leg at ball release were significantly greater in the CPG than in the APG (p < 0.05). Hip and knee joint torques on the lower limbs were significantly greater in the CPG than in the APG (p < 0.05). The present study indicates that the kinematics of lower limbs during baseball pitching are similar between adolescent and collegiate pitchers, but the momentum of the lower limbs during pitching is lower in adolescent pitchers than in collegiate ones, even when the difference in body mass is considered. Key points Collegiate baseball pitchers can generate the hip and knee joint torques on the pivot leg for accelerating the body forward. Collegiate baseball pitchers can generate the hip and knee joint torques to control/stabilize the stride leg in order to increase momentum on the stride leg during the arm acceleration phase. The kinematics of the lower limbs during baseball pitching are similar between adolescent and collegiate pitchers, but the momentum of the lower limbs during pitching is lower in adolescent pitchers than in collegiate ones, even when the difference in body mass is considered. Adolescent baseball pitchers cannot generate the hip and knee joint torques in the pivot and stride leg for transfer of the energy of trunk and the arm. PMID:25983571

  7. B-cell activation with CD40L or CpG measures the function of B-cell subsets and identifies specific defects in immunodeficient patients.

    PubMed

    Marasco, Emiliano; Farroni, Chiara; Cascioli, Simona; Marcellini, Valentina; Scarsella, Marco; Giorda, Ezio; Piano Mortari, Eva; Leonardi, Lucia; Scarselli, Alessia; Valentini, Diletta; Cancrini, Caterina; Duse, Marzia; Grimsholm, Ola; Carsetti, Rita

    2017-01-01

    Around 65% of primary immunodeficiencies are antibody deficiencies. Functional tests are useful tools to study B-cell functions in vitro. However, no accepted guidelines for performing and evaluating functional tests have been issued yet. Here, we report our experience on the study of B-cell functions in infancy and throughout childhood. We show that T-independent stimulation with CpG measures proliferation and differentiation potential of memory B cells. Switched memory B cells respond better than IgM memory B cells. On the other hand, CD40L, a T-dependent stimulus, does not induce plasma cell differentiation, but causes proliferation of naïve and memory B cells. During childhood, the production of plasmablasts in response to CpG increases with age mirroring the development of memory B cells. The response to CD40L does not change with age. In patients with selective IgA deficiency (SIgAD), we observed that switched memory B cells are reduced due to the absence of IgA memory B cells. In agreement, IgA plasma cells are not generated in response to CpG. Unexpectedly, B cells from SIgAD patients show a reduced proliferative response to CD40L. Our results demonstrate that functional tests are an important tool to assess the functions of the humoral immune system. © 2016 The Authors. European Journal of Immunology published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Knowledge discovery from data as a framework to decision support in medical domains

    PubMed Central

    Gibert, Karina

    2009-01-01

    Introduction Knowledge discovery from data (KDD) is a multidisciplinary discipline which appeared in 1996 for “non trivial identifying of valid, novel, potentially useful, ultimately understandable patterns in data”. Pre-treatment of data and post-processing is as important as the data exploitation (Data Mining) itself. Different analysis techniques can be properly combined to produce explicit knowledge from data. Methods Hybrid KDD methodologies combining Artificial Intelligence with Statistics and visualization have been used to identify patterns in complex medical phenomena: experts provide prior knowledge (pK); it biases the search of distinguishable groups of homogeneous objects; support-interpretation tools (CPG) assisted experts in conceptualization and labelling of discovered patterns, consistently with pK. Results Patterns of dependency in mental disabilities supported decision-making on legislation of the Spanish Dependency Law in Catalonia. Relationships between type of neurorehabilitation treatment and patterns of response for brain damage are assessed. Patterns of the perceived QOL along time are used in spinal cord lesion to improve social inclusion. Conclusion Reality is more and more complex and classical data analyses are not powerful enough to model it. New methodologies are required including multidisciplinarity and stressing on production of understandable models. Interaction with the experts is critical to generate meaningful results which can really support decision-making, particularly convenient transferring the pK to the system, as well as interpreting results in close interaction with experts. KDD is a valuable paradigm, particularly when facing very complex domains, not well understood yet, like many medical phenomena.

  9. Polyethyleneimine-functionalized boron nitride nanospheres as efficient carriers for enhancing the immunostimulatory effect of CpG oligodeoxynucleotides

    PubMed Central

    Zhang, Huijie; Feng, Shini; Yan, Ting; Zhi, Chunyi; Gao, Xiao-Dong; Hanagata, Nobutaka

    2015-01-01

    CpG oligodeoxynucleotides (ODNs) stimulate innate and adaptive immune responses. Thus, these molecules are promising therapeutic agents and vaccine adjuvants against various diseases. In this study, we developed a novel CpG ODNs delivery system based on polyethyleneimine (PEI)-functionalized boron nitride nanospheres (BNNS). PEI was coated on the surface of BNNS via electrostatic interactions. The prepared BNNS–PEI complexes had positive zeta potential and exhibited enhanced dispersity and stability in aqueous solution. In vitro cytotoxicity assays revealed that the BNNS–PEI complexes with concentrations up to 100 μg/mL exhibited no obvious cytotoxicity. Furthermore, the positively charged surface of the BNNS–PEI complexes greatly improved the loading capacity and cellular uptake efficiency of CpG ODNs. Class B CpG ODNs loaded on the BNNS–PEI complexes enhanced the production of interleukin-6 and tumor necrosis factor-α from peripheral blood mononuclear cells compared with CpG ODNs directly loaded on BNNS. Contrary to the free CpG ODNs or CpG ODNs directly loaded on BNNS, class B CpG ODNs loaded on the BNNS–PEI complexes induced interferon-α simultaneously. PEI coating may have changed the physical form of class B CpG ODNs on BNNS, which further affected their interaction with Toll-like receptor 9 and induced interferon-α. Therefore, BNNS–PEI complexes can be used to enhance the immunostimulatory effect and therapeutic activity of CpG ODNs and the treatment of diseases requiring interleukin-6, tumor necrosis factor-α, and interferon-α. PMID:26346655

  10. Polyethyleneimine-functionalized boron nitride nanospheres as efficient carriers for enhancing the immunostimulatory effect of CpG oligodeoxynucleotides.

    PubMed

    Zhang, Huijie; Feng, Shini; Yan, Ting; Zhi, Chunyi; Gao, Xiao-Dong; Hanagata, Nobutaka

    2015-01-01

    CpG oligodeoxynucleotides (ODNs) stimulate innate and adaptive immune responses. Thus, these molecules are promising therapeutic agents and vaccine adjuvants against various diseases. In this study, we developed a novel CpG ODNs delivery system based on polyethyleneimine (PEI)-functionalized boron nitride nanospheres (BNNS). PEI was coated on the surface of BNNS via electrostatic interactions. The prepared BNNS-PEI complexes had positive zeta potential and exhibited enhanced dispersity and stability in aqueous solution. In vitro cytotoxicity assays revealed that the BNNS-PEI complexes with concentrations up to 100 μg/mL exhibited no obvious cytotoxicity. Furthermore, the positively charged surface of the BNNS-PEI complexes greatly improved the loading capacity and cellular uptake efficiency of CpG ODNs. Class B CpG ODNs loaded on the BNNS-PEI complexes enhanced the production of interleukin-6 and tumor necrosis factor-α from peripheral blood mononuclear cells compared with CpG ODNs directly loaded on BNNS. Contrary to the free CpG ODNs or CpG ODNs directly loaded on BNNS, class B CpG ODNs loaded on the BNNS-PEI complexes induced interferon-α simultaneously. PEI coating may have changed the physical form of class B CpG ODNs on BNNS, which further affected their interaction with Toll-like receptor 9 and induced interferon-α. Therefore, BNNS-PEI complexes can be used to enhance the immunostimulatory effect and therapeutic activity of CpG ODNs and the treatment of diseases requiring interleukin-6, tumor necrosis factor-α, and interferon-α.

  11. Session 2: Personalised nutrition. Epigenomics: a basis for understanding individual differences?

    PubMed

    Mathers, John C

    2008-11-01

    Epigenetics encompasses changes to marks on the genome that are copied from one cell generation to the next, which may alter gene expression but which do not involve changes in the primary DNA sequence. These marks include DNA methylation (methylation of cytosines within CpG dinucleotides) and post-translational modifications (acetylation, methylation, phosphorylation and ubiquitination) of the histone tails protruding from nucleosome cores. The sum of genome-wide epigenetic patterns is known as the epigenome. It is hypothesised that altered epigenetic marking is a means through which evidence of environmental exposures (including nutritional status and dietary exposure) is received and recorded by the genome. At least some of these epigenetic marks are remembered through multiple cell generations and their effects may be revealed in altered gene expression and cell function. Altered epigenetic marking allows plasticity of phenotype in a fixed genotype. Despite their identical genotypes, monozygotic twins show increasing epigenetic diversity with age and with divergent lifestyles. Differences in epigenetic markings may explain some inter-individual variation in disease risk and in response to nutritional interventions.

  12. Exploration of Planetary Terrains with a Legged Robot as a Scout Adjunct to a Rover

    NASA Technical Reports Server (NTRS)

    Colombano, Silvano; Kirchner, Frank; Spenneberg, Dirk; Hanratty, James

    2004-01-01

    The Scorpion robot is an innovative, biologically inspired 8-legged walking robot. It currently runs a novel approach to control which utilizes a central pattern generator (CPG) and local reflex action for each leg. From this starting point we are proposing to both extend the system's individual capabilities and its capacity to function as a "scout", cooperating with a larger wheeled rover. For this purpose we propose to develop a distributed system architecture that extends the system's capabilities both in the direction of high level planning and execution in collaboration with a rover, and in the direction of force-feedback based low level behaviors that will greatly enhance its ability to walk and climb in rough varied terrains. The final test of this improved ability will be a rappelling experiment where the Scorpion explores a steep cliff side in cooperation with a rover that serves as both anchor and planner/executive.

  13. The dynamic DNA methylation landscape of the mutL homolog 1 shore is altered by MLH1-93G>A polymorphism in normal tissues and colorectal cancer.

    PubMed

    Savio, Andrea J; Mrkonjic, Miralem; Lemire, Mathieu; Gallinger, Steven; Knight, Julia A; Bapat, Bharat

    2017-01-01

    Colorectal cancers (CRCs) undergo distinct genetic and epigenetic alterations. Expression of mutL homolog 1 ( MLH1 ), a mismatch repair gene that corrects DNA replication errors, is lost in up to 15% of sporadic tumours due to mutation or, more commonly, due to DNA methylation of its promoter CpG island. A single nucleotide polymorphism (SNP) in the CpG island of MLH1 ( MLH1 -93G>A or rs1800734) is associated with CpG island hypermethylation and decreased MLH1 expression in CRC tumours. Further, in peripheral blood mononuclear cell (PBMC) DNA of both CRC cases and non-cancer controls, the variant allele of rs1800734 is associated with hypomethylation at the MLH1 shore, a region upstream of its CpG island that is less dense in CpG sites . To determine whether this genotype-epigenotype association is present in other tissue types, including colorectal tumours, we assessed DNA methylation in matched normal colorectal tissue, tumour, and PBMC DNA from 349 population-based CRC cases recruited from the Ontario Familial Colorectal Cancer Registry. Using the semi-quantitative real-time PCR-based MethyLight assay, MLH1 shore methylation was significantly higher in tumour tissue than normal colon or PBMCs ( P  < 0.01). When shore methylation levels were stratified by SNP genotype, normal colorectal DNA and PBMC DNA were significantly hypomethylated in association with variant SNP genotype ( P  < 0.05). However, this association was lost in tumour DNA. Among distinct stages of CRC, metastatic stage IV CRC tumours incurred significant hypomethylation compared to stage I-III cases, irrespective of genotype status. Shore methylation of MLH1 was not associated with MSI status or promoter CpG island hypermethylation, regardless of genotype. To confirm these results, bisulfite sequencing was performed in matched tumour and normal colorectal specimens from six CRC cases, including two cases per genotype (wildtype, heterozygous, and homozygous variant). Bisulfite sequencing results corroborated the methylation patterns found by MethyLight, with significant hypomethylation in normal colorectal tissue of variant SNP allele carriers. These results indicate that the normal tissue types tested (colorectum and PBMC) experience dynamic genotype-associated epigenetic alterations at the MLH1 shore, whereas tumour DNA incurs aberrant hypermethylation compared to normal DNA.

  14. PRKCZ methylation is associated with sunlight exposure in a North American but not a Mediterranean population

    PubMed Central

    Aslibekyan, Stella; Dashti, Hassan S.; Tanaka, Toshiko; Sha, Jin; Ferrucci, Luigi; Zhi, Degui; Bandinelli, Stefania; Borecki, Ingrid B.; Absher, Devin M.; Arnett, Donna K.; Ordovas, Jose M.

    2015-01-01

    Sunlight exposure has been shown to alter DNA methylation patterns across several human cell-types, including T-lymphocytes. Since epigenetic changes establish gene expression profiles, changes in DNA methylation induced by sunlight exposure warrant investigation. The purpose of this study was to assess the effects of sunlight exposure on CD4+ T-cell methylation patterns on an epigenome-wide scale in a North American population of European origin (n = 991). In addition, we investigated the genetic contribution to epigenetic variation (methylQTL). We used linear regression to test the associations between methylation scores at 461 281 cytosine-phosphate-guanine (CpG) sites and sunlight exposure, followed by a genome-wide association analysis (methylQTL) to test for associations between methylation at the top CpG locus and common genetic variants, assuming an additive genetic model. We observed an epigenome-wide significant association between sunlight exposure and methylation status at cg26930596 (p = 9.2 × 10−8), a CpG site located in protein kinase C zeta (PRKCZ), a gene previously shown to be entrained by light. MethylQTL analysis resulted in significant associations between cg26930596 and two intergenic single nucleotide polymorphisms on chromosome 3, rs4574216 (p = 1.5 × 10−10) and rs4405858 (p = 1.9 × 10−9). These common genetic variants reside downstream of WWTR1, a transcriptional co-activator of PRKCZ. Associations observed in the North American population, however, did not replicate in an independent Mediterranean cohort. Our preliminary results support the role of sunlight exposure in epigenetic processes, and lay the groundwork for future studies of the molecular link between sunlight and physiologic processes such as tumorigenesis and metabolism. PMID:25075435

  15. PRKCZ methylation is associated with sunlight exposure in a North American but not a Mediterranean population.

    PubMed

    Aslibekyan, Stella; Dashti, Hassan S; Tanaka, Toshiko; Sha, Jin; Ferrucci, Luigi; Zhi, Degui; Bandinelli, Stefania; Borecki, Ingrid B; Absher, Devin M; Arnett, Donna K; Ordovas, Jose M

    2014-11-01

    Sunlight exposure has been shown to alter DNA methylation patterns across several human cell-types, including T-lymphocytes. Since epigenetic changes establish gene expression profiles, changes in DNA methylation induced by sunlight exposure warrant investigation. The purpose of this study was to assess the effects of sunlight exposure on CD4+ T-cell methylation patterns on an epigenome-wide scale in a North American population of European origin (n=991). In addition, we investigated the genetic contribution to epigenetic variation (methylQTL). We used linear regression to test the associations between methylation scores at 461,281 cytosine-phosphate-guanine (CpG) sites and sunlight exposure, followed by a genome-wide association analysis (methylQTL) to test for associations between methylation at the top CpG locus and common genetic variants, assuming an additive genetic model. We observed an epigenome-wide significant association between sunlight exposure and methylation status at cg26930596 (p=9.2×10(-8)), a CpG site located in protein kinase C zeta (PRKCZ), a gene previously shown to be entrained by light. MethylQTL analysis resulted in significant associations between cg26930596 and two intergenic single nucleotide polymorphisms on chromosome 3, rs4574216 (p=1.5×10(-10)) and rs4405858 (p=1.9×10(-9)). These common genetic variants reside downstream of WWTR1, a transcriptional co-activator of PRKCZ. Associations observed in the North American population, however, did not replicate in an independent Mediterranean cohort. Our preliminary results support the role of sunlight exposure in epigenetic processes, and lay the groundwork for future studies of the molecular link between sunlight and physiologic processes such as tumorigenesis and metabolism.

  16. Differential methylation at the RELN gene promoter in temporal cortex from autistic and typically developing post-puberal subjects.

    PubMed

    Lintas, Carla; Sacco, Roberto; Persico, Antonio M

    2016-01-01

    Reelin plays a pivotal role in neurodevelopment and in post-natal synaptic plasticity and has been implicated in the pathogenesis of autism spectrum disorder (ASD). The reelin (RELN) gene expression is significantly decreased in ASD, both in the brain and peripherally. Methylation at the RELN gene promoter is largely triggered at puberty, and hypermethylation has been found in post-mortem brains of schizophrenic and bipolar patients. In this study, we assessed RELN gene methylation status in post-mortem temporocortical tissue samples (BA41/42 or 22) of six pairs of post-puberal individuals with ASD and typically developing subjects, matched for sex (male:female, M:F = 5:1), age, and post-mortem interval. ASD patients display a significantly higher number of methylated CpG islands and heavier methylation in the 5' region of the RELN gene promoter, spanning from -458 to -223 bp, whereas controls have more methylated CpG positions and greater extent of methylation at the 3' promoter region, spanning from -222 to +1 bp. The most upstream promoter region (-458 to -364 bp) is methylated only in ASD brains, while the most downstream region (-131 to +1 bp) is methylated exclusively in control brains. Within this general framework, three different methylation patterns are discernible, each correlated with different extents of reduction in reelin gene expression among ASD individuals compared to controls. The methylation pattern is different in ASD and control post-mortem brains. ASD-specific CpG positions, located in the most upstream gene promoter region, may exert a functional role potentially conferring ASD risk by blunting RELN gene expression.

  17. Effect of CpG dinucleotides within IgH switch region repeats on immunoglobulin class switch recombination.

    PubMed

    Zhang, Zheng Z; Hsieh, Chih-Lin; Okitsu, Cindy Yen; Han, Li; Yu, Kefei; Lieber, Michael R

    2015-08-01

    Immunoglobulin (Ig) heavy chains undergo class switch recombination (CSR) to change the heavy chain isotype from IgM to IgG, A or E. The switch regions are several kilobases long, repetitive, and G-rich on the nontemplate strand. They are also relatively depleted of CpG (also called CG) sites for unknown reasons. Here we use synthetic switch regions at the IgH switch alpha (Sα) locus to test the effect of CpG sites and to try to understand why the IgH switch sequences evolved to be relatively depleted of CpG. We find that even just two CpG sites within an 80 bp synthetic switch repeat iterated 15 times (total switch region length of 1200 bp containing 30 CpG sites) are sufficient to dramatically reduce both Ig CSR and transcription through the switch region from the upstream Iα sterile transcript promoter, which is the promoter that directs transcripts through the Sα region. De novo DNA methylation occurs at the four CpG sites in and around the Iα promoter when each 80 bp Iα switch repeat contains the two CpG sites. Thus, a relatively low density of CpG sites within the switch repeats can induce upstream CpG methylation at the IgH alpha locus, and cause a substantial decrease in transcription from the sterile transcript promoter. This effect is likely the reason that switch regions evolved to contain very few CpG sites. We discuss these findings as they relate to DNA methylation and to Ig CSR. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Targeted-bisulfite sequence analysis of the methylation of CpG islands in genes encoding PNPLA3, SAMM50, and PARVB of patients with non-alcoholic fatty liver disease.

    PubMed

    Kitamoto, Takuya; Kitamoto, Aya; Ogawa, Yuji; Honda, Yasushi; Imajo, Kento; Saito, Satoru; Yoneda, Masato; Nakamura, Takahiro; Nakajima, Atsushi; Hotta, Kikuko

    2015-08-01

    The pathogenesis of non-alcoholic fatty liver disease (NAFLD) is affected by epigenetic factors as well as by genetic variation. We performed targeted-bisulfite sequencing to determine the levels of DNA methylation of 4 CpG islands (CpG99, CpG71, CpG26, and CpG101) in the regulatory regions of PNPLA3, SAMM50, PARVB variant 1, and PARVB variant 2, respectively. We compared the levels of methylation of DNA in the livers of the first and second sets of patients with mild (fibrosis stages 0 and 1) or advanced (fibrosis stages 2 to 4) NAFLD and in those of patients with mild (F0 to F2) or advanced (F3 and F4) chronic hepatitis C infection. The hepatic mRNA levels of PNPLA3, SAMM50, and PARVB were measured using qPCR. CpG26, which resides in the regulatory region of PARVB variant 1, was markedly hypomethylated in the livers of patients with advanced NAFLD. Conversely, CpG99 in the regulatory region of PNPLA3 was substantially hypermethylated in these patients. These differences in DNA methylation were replicated in a second set of patients with NAFLD or chronic hepatitis C. PNPLA3 mRNA levels in the liver of the same section of a biopsy specimen used for genomic DNA preparation were lower in patients with advanced NAFLD compared with those with mild NAFLD and correlated inversely with CpG99 methylation in liver DNA. Moreover, the levels of CpG99 methylation and PNPLA3 mRNA were affected by the rs738409 genotype. Hypomethylation of CpG26 and hypermethylation of CpG99 may contribute to the severity of fibrosis in patients with NAFLD or chronic hepatitis C infection. Copyright © 2015 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

  19. Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

    PubMed Central

    Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.

    2001-01-01

    Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339

  20. GaussianCpG: a Gaussian model for detection of CpG island in human genome sequences.

    PubMed

    Yu, Ning; Guo, Xuan; Zelikovsky, Alexander; Pan, Yi

    2017-05-24

    As crucial markers in identifying biological elements and processes in mammalian genomes, CpG islands (CGI) play important roles in DNA methylation, gene regulation, epigenetic inheritance, gene mutation, chromosome inactivation and nuclesome retention. The generally accepted criteria of CGI rely on: (a) %G+C content is ≥ 50%, (b) the ratio of the observed CpG content and the expected CpG content is ≥ 0.6, and (c) the general length of CGI is greater than 200 nucleotides. Most existing computational methods for the prediction of CpG island are programmed on these rules. However, many experimentally verified CpG islands deviate from these artificial criteria. Experiments indicate that in many cases %G+C is < 50%, CpG obs /CpG exp varies, and the length of CGI ranges from eight nucleotides to a few thousand of nucleotides. It implies that CGI detection is not just a straightly statistical task and some unrevealed rules probably are hidden. A novel Gaussian model, GaussianCpG, is developed for detection of CpG islands on human genome. We analyze the energy distribution over genomic primary structure for each CpG site and adopt the parameters from statistics of Human genome. The evaluation results show that the new model can predict CpG islands efficiently by balancing both sensitivity and specificity over known human CGI data sets. Compared with other models, GaussianCpG can achieve better performance in CGI detection. Our Gaussian model aims to simplify the complex interaction between nucleotides. The model is computed not by the linear statistical method but by the Gaussian energy distribution and accumulation. The parameters of Gaussian function are not arbitrarily designated but deliberately chosen by optimizing the biological statistics. By using the pseudopotential analysis on CpG islands, the novel model is validated on both the real and artificial data sets.

  1. Accounting for cell lineage and sex effects in the identification of cell-specific DNA methylation using a Bayesian model selection algorithm.

    PubMed

    White, Nicole; Benton, Miles; Kennedy, Daniel; Fox, Andrew; Griffiths, Lyn; Lea, Rodney; Mengersen, Kerrie

    2017-01-01

    Cell- and sex-specific differences in DNA methylation are major sources of epigenetic variation in whole blood. Heterogeneity attributable to cell type has motivated the identification of cell-specific methylation at the CpG level, however statistical methods for this purpose have been limited to pairwise comparisons between cell types or between the cell type of interest and whole blood. We developed a Bayesian model selection algorithm for the identification of cell-specific methylation profiles that incorporates knowledge of shared cell lineage and allows for the identification of differential methylation profiles in one or more cell types simultaneously. Under the proposed methodology, sex-specific differences in methylation by cell type are also assessed. Using publicly available, cell-sorted methylation data, we show that 51.3% of female CpG markers and 61.4% of male CpG markers identified were associated with differential methylation in more than one cell type. The impact of cell lineage on differential methylation was also highlighted. An evaluation of sex-specific differences revealed differences in CD56+NK methylation, within both single and multi- cell dependent methylation patterns. Our findings demonstrate the need to account for cell lineage in studies of differential methylation and associated sex effects.

  2. Cancer Biomarkers from Genome-Scale DNA Methylation: Comparison of Evolutionary and Semantic Analysis Methods

    PubMed Central

    Valavanis, Ioannis; Pilalis, Eleftherios; Georgiadis, Panagiotis; Kyrtopoulos, Soterios; Chatziioannou, Aristotelis

    2015-01-01

    DNA methylation profiling exploits microarray technologies, thus yielding a wealth of high-volume data. Here, an intelligent framework is applied, encompassing epidemiological genome-scale DNA methylation data produced from the Illumina’s Infinium Human Methylation 450K Bead Chip platform, in an effort to correlate interesting methylation patterns with cancer predisposition and, in particular, breast cancer and B-cell lymphoma. Feature selection and classification are employed in order to select, from an initial set of ~480,000 methylation measurements at CpG sites, predictive cancer epigenetic biomarkers and assess their classification power for discriminating healthy versus cancer related classes. Feature selection exploits evolutionary algorithms or a graph-theoretic methodology which makes use of the semantics information included in the Gene Ontology (GO) tree. The selected features, corresponding to methylation of CpG sites, attained moderate-to-high classification accuracies when imported to a series of classifiers evaluated by resampling or blindfold validation. The semantics-driven selection revealed sets of CpG sites performing similarly with evolutionary selection in the classification tasks. However, gene enrichment and pathway analysis showed that it additionally provides more descriptive sets of GO terms and KEGG pathways regarding the cancer phenotypes studied here. Results support the expediency of this methodology regarding its application in epidemiological studies. PMID:27600245

  3. A systematic review of recent clinical practice guidelines and best practice statements for the evaluation of the infertile male.

    PubMed

    Esteves, Sandro C; Chan, Peter

    2015-09-01

    We systematically identified and reviewed the methods and consistency of recommendations of recently developed clinical practice guidelines (CPG) and best practice statements (BPS) on the evaluation of the infertile male. MEDLINE and related engines as well as guidelines' Web sites were searched for CPG and BPS written in English on the general evaluation of male infertility published between January 2008 and April 2015. Four guidelines were identified, all of which reported to have been recently updated. Systematic review was not consistently used in the BPS despite being reported in the CPG. Only one of them reported having a patient representative in its development team. The CPG issued by the European Association of Urology (EAU) graded some recommendations and related that to levels (but not quality) of evidence. Overall, the BPS issued respectively by the American Urological Association and American Society for Reproductive Medicine concurred with each other, but both differed from the EAU guidelines with regard to methods of collection, extraction and interpretation of data. None of the guidelines incorporated health economics. Important specific limitations of conventional semen analysis results were ignored by all guidelines. Besides variation in the methodological quality, implementation strategies were not reported in two out of four guidelines. While the various panels of experts who contributed to the development of the CPG and BPS reviewed should be commended on their tremendous efforts aiming to establish a clinical standard in both the evaluation and management of male infertility, we recognized inconsistencies in the methodology of their synthesis and in the contents of their final recommendations. These discrepancies pose a barrier in the general implementation of these guidelines and may limit their utility in standardizing clinical practice or improving health-related outcomes. Continuous efforts are needed to generate high-quality evidence to allow further development of these important guidelines for the evaluation and management of males suffering from infertility.

  4. A dinucleotide motif in oligonucleotides shows potent immunomodulatory activity and overrides species-specific recognition observed with CpG motif.

    PubMed

    Kandimalla, Ekambar R; Bhagat, Lakshmi; Zhu, Fu-Gang; Yu, Dong; Cong, Yan-Ping; Wang, Daqing; Tang, Jimmy X; Tang, Jin-Yan; Knetter, Cathrine F; Lien, Egil; Agrawal, Sudhir

    2003-11-25

    Bacterial and synthetic DNAs containing CpG dinucleotides in specific sequence contexts activate the vertebrate immune system through Toll-like receptor 9 (TLR9). In the present study, we used a synthetic nucleoside with a bicyclic heterobase [1-(2'-deoxy-beta-d-ribofuranosyl)-2-oxo-7-deaza-8-methyl-purine; R] to replace the C in CpG, resulting in an RpG dinucleotide. The RpG dinucleotide was incorporated in mouse- and human-specific motifs in oligodeoxynucleotides (oligos) and 3'-3-linked oligos, referred to as immunomers. Oligos containing the RpG motif induced cytokine secretion in mouse spleen-cell cultures. Immunomers containing RpG dinucleotides showed activity in transfected-HEK293 cells stably expressing mouse TLR9, suggesting direct involvement of TLR9 in the recognition of RpG motif. In J774 macrophages, RpG motifs activated NF-kappa B and mitogen-activated protein kinase pathways. Immunomers containing the RpG dinucleotide induced high levels of IL-12 and IFN-gamma, but lower IL-6 in time- and concentration-dependent fashion in mouse spleen-cell cultures costimulated with IL-2. Importantly, immunomers containing GTRGTT and GARGTT motifs were recognized to a similar extent by both mouse and human immune systems. Additionally, both mouse- and human-specific RpG immunomers potently stimulated proliferation of peripheral blood mononuclear cells obtained from diverse vertebrate species, including monkey, pig, horse, sheep, goat, rat, and chicken. An immunomer containing GTRGTT motif prevented conalbumin-induced and ragweed allergen-induced allergic inflammation in mice. We show that a synthetic bicyclic nucleotide is recognized in the C position of a CpG dinucleotide by immune cells from diverse vertebrate species without bias for flanking sequences, suggesting a divergent nucleotide motif recognition pattern of TLR9.

  5. Longitudinal study of DNA methylation during the first 5 years of life.

    PubMed

    Urdinguio, Rocio G; Torró, María Isabel; Bayón, Gustavo F; Álvarez-Pitti, Julio; Fernández, Agustín F; Redon, Pau; Fraga, Mario F; Lurbe, Empar

    2016-06-03

    Early life epigenetic programming influences adult health outcomes. Moreover, DNA methylation levels have been found to change more rapidly during the first years of life. Our aim was the identification and characterization of the CpG sites that are modified with time during the first years of life. We hypothesize that these DNA methylation changes would lead to the detection of genes that might be epigenetically modulated by environmental factors during early childhood and which, if disturbed, might contribute to susceptibility to diseases later in life. The study of the DNA methylation pattern of 485577 CpG sites was performed on 30 blood samples from 15 subjects, collected both at birth and at 5 years old, using Illumina(®) Infinium 450 k array. To identify differentially methylated CpG (dmCpG) sites, the methylation status of each probe was examined using linear models and the Empirical Bayes Moderated t test implemented in the limma package of R/Bioconductor. Surogate variable analysis was used to account for batch effects. DNA methylation levels significantly changed from birth to 5 years of age in 6641 CpG sites. Of these, 36.79 % were hypermethylated and were associated with genes related mainly to developmental ontology terms, while 63.21 % were hypomethylated probes and associated with genes related to immune function. Our results suggest that DNA methylation alterations with age during the first years of life might play a significant role in development and the regulation of leukocyte-specific functions. This supports the idea that blood leukocytes experience genome remodeling related to their interaction with environmental factors, underlining the importance of environmental exposures during the first years of life and suggesting that new strategies should be take into consideration for disease prevention.

  6. Genome-wide DNA methylomes from discrete developmental stages reveal the predominance of non-CpG methylation in Tribolium castaneum.

    PubMed

    Song, Xiaowen; Huang, Fei; Liu, Juanjuan; Li, Chengjun; Gao, Shanshan; Wu, Wei; Zhai, Mengfan; Yu, Xiaojuan; Xiong, Wenfeng; Xie, Jia; Li, Bin

    2017-10-01

    Cytosine DNA methylation is a vital epigenetic regulator of eukaryotic development. Whether this epigenetic modification occurs in Tribolium castaneum has been controversial, its distribution pattern and functions have not been established. Here, using bisulphite sequencing (BS-Seq), we confirmed the existence of DNA methylation and described the methylation profiles of the four life stages of T. castaneum. In the T. castaneum genome, both symmetrical CpG and non-CpG methylcytosines were observed. Symmetrical CpG methylation, which was catalysed by DNMT1 and occupied a small part in T. castaneum methylome, was primarily enriched in gene bodies and was positively correlated with gene expression levels. Asymmetrical non-CpG methylation, which was predominant in the methylome, was strongly concentrated in intergenic regions and introns but absent from exons. Gene body methylation was negatively correlated with gene expression levels. The distribution pattern and functions of this type of methylation were similar only to the methylome of Drosophila melanogaster, which further supports the existence of a novel methyltransferase in the two species responsible for this type of methylation. This first life-cycle methylome of T. castaneum reveals a novel and unique methylation pattern, which will contribute to the further understanding of the variety and functions of DNA methylation in eukaryotes. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  7. Carbon nanotubes enhance CpG uptake and potentiate antiglioma immunity.

    PubMed

    Zhao, Dongchang; Alizadeh, Darya; Zhang, Leying; Liu, Wei; Farrukh, Omar; Manuel, Edwin; Diamond, Don J; Badie, Behnam

    2011-02-15

    Stimulation of toll-like receptor-9 (TLR9) by CpG oligodeoxynucleotides (CpG) has been shown to counteract the immunosuppressive microenvironment and to inhibit tumor growth in glioma models. Because TLR9 is located intracellularly, we hypothesized that methods that enhance its internalization may also potentiate its immunostimulatory response. The goal of this study was to evaluate carbon nanotubes (CNT) as a CpG delivery vehicle in brain tumor models. Functionalized single-walled CNTs were conjugated with CpG (CNT-CpG) and evaluated in vitro and in mice bearing intracranial GL261 gliomas. Flow cytometry was used to assess CNT-CpG uptake and antiglioma immune response. Tumor growth was measured by bioluminescent imaging, histology, and animal survival. CNT-CpG was nontoxic and enhanced CpG uptake both in vitro and intracranial gliomas. CNT-mediated CpG delivery also potentiated proinflammatory cytokine production by primary monocytes. Interestingly, a single intracranial injection of low-dose CNT-CpG (but not free CpG or blank CNT) eradicated intracranial GL261 gliomas in half of tumor-bearing mice. Moreover, surviving animals exhibited durable tumor-free remission (>3 months), and were protected from intracranial tumor rechallenge, demonstrating induction of long-term antitumor immunity. These findings suggest that CNTs can potentiate CpG immunopotency by enhancing its delivery into tumor-associated inflammatory cells. ©2010 AACR.

  8. Nanoparticle conjugation enhances the immunomodulatory effects of intranasally delivered CpG in house dust mite-allergic mice

    DOE PAGES

    Ballester, Marie; Jeanbart, Laura; de Titta, Alexandre; ...

    2015-09-21

    An emerging strategy in preventing and treating airway allergy consists of modulating the immune response induced against allergens in the lungs. CpG oligodeoxynucleotides have been investigated in airway allergy studies, but even if promising, efficacy requires further substantiation. We investigated the effect of pulmonary delivery of nanoparticle (NP)-conjugated CpG on lung immunity and found that NP-CpG led to enhanced recruitment of activated dendritic cells and to Th1 immunity compared to free CpG. We then evaluated if pulmonary delivery of NP-CpG could prevent and treat house dust mite-induced allergy by modulating immunity directly in lungs. When CpG was administered as immunomodulatorymore » therapy prior to allergen sensitization, we found that NP-CpG significantly reduced eosinophilia, IgE levels, mucus production and Th2 cytokines, while free CpG had only a moderate effect on these parameters. In a therapeutic setting where CpG was administered after allergen sensitization, we found that although both free CpG and NP-CpG reduced eosinophilia and IgE levels to the same extent, NP conjugation of CpG significantly enhanced reduction of Th2 cytokines in lungs of allergic mice. Taken together, these data highlight benefits of NP conjugation and the relevance of NP-CpG as allergen-free therapy to modulate lung immunity and treat airway allergy.« less

  9. Carbon Nanotubes Enhance CpG Uptake and Potentiate Anti-Glioma Immunity

    PubMed Central

    Zhao, Dongchang; Alizadeh, Darya; Zhang, Leying; Liu, Wei; Farrukh, Omar; Manuel, Edwin; Diamond, Don J.; Badie, Behnam

    2010-01-01

    Purpose Stimulation of toll-like receptor-9 (TLR9) by CpG oligodeoxynucleotides (CpG) has been shown to counteract the immunosuppressive microenvironment and to inhibit tumor growth in glioma models. Since TLR9 is located intracellularly, we hypothesized that methods that enhance its internalization may also potentiate its immunostimulatory response. The goal of this study was to evaluate carbon nanotubes (CNTs) as a CpG delivery vehicle in brain tumor models. Experimental Design Functionalized single-walled CNTs were conjugated with CpG (CNT-CpG) and evaluated in vitro and in mice bearing intracranial GL261 gliomas. Flow cytometry was used to assess CNT-CpG uptake and anti-glioma immune response. Tumor growth was measured by bioluminescent imaging, histology, and animal survival. Results CNT-CpG was nontoxic and enhanced CpG uptake both in vitro and intracranial gliomas. CNT-mediated CpG delivery also potentiated pro-inflammatory cytokine production by primary monocytes. Interestingly, a single intracranial injection of low-dose CNT-CpG (but not free CpG or blank CNT) eradicated intracranial GL261 gliomas in half of tumor-bearing mice. Moreover, surviving animals exhibited durable tumor-free remission (> 3 months), and were protected from intracranial tumor rechallenge, demonstrating induction of long-term anti-tumor immunity. Conclusions These findings suggest that CNTs can potentiate CpG immunopotency by enhancing its delivery into tumor-associated inflammatory cells. PMID:21088258

  10. CpG oligodeoxynucleotide nanomedicines for the prophylaxis or treatment of cancers, infectious diseases, and allergies.

    PubMed

    Hanagata, Nobutaka

    2017-01-01

    Unmethylated cytosine-guanine dinucleotide-containing oligodeoxynucleotides (CpG ODNs), which are synthetic agonists of Toll-like receptor 9 (TLR9), activate humoral and cellular immunity and are being developed as vaccine adjuvants to prevent or treat cancers, infectious diseases, and allergies. Free CpG ODNs have been used in many clinical trials implemented to verify their effects. However, recent research has reported that self-assembled CpG ODNs, protein/peptide-CpG ODN conjugates, and nanomaterial-CpG ODN complexes demonstrate higher adjuvant effects than free CpG ODNs, owing to their improved uptake efficiency into cells expressing TLR9. Moreover, protein/peptide-CpG ODN conjugates and nanomaterial-CpG ODN complexes are able to deliver CpG ODNs and antigens (or allergens) to the same types of cells, which enables a higher degree of prophylaxis or therapeutic effect. In this review, the author describes recent trends in the research and development of CpG ODN nanomedicines containing self-assembled CpG ODNs, protein/peptide-CpG ODN conjugates, and nanomaterial-CpG ODN complexes, focusing mainly on the results of preclinical and clinical studies.

  11. Immunostimulatory Oligodeoxynucleotides Containing the CpG Motif are Effective as Immune Adjuvants in Tumor Antigen Immunization

    NASA Astrophysics Data System (ADS)

    Weiner, George J.; Liu, Hsin-Ming; Wooldridge, James E.; Dahle, Christopher E.; Krieg, Arthur M.

    1997-09-01

    Recent advances in our understanding of the immune response are allowing for the logical design of new approaches to cancer immunization. One area of interest is the development of new immune adjuvants. Immunostimulatory oligodeoxynucleotides containing the CpG motif (CpG ODN) can induce production of a wide variety of cytokines and activate B cells, monocytes, dendritic cells, and NK cells. Using the 38C13 B cell lymphoma model, we assessed whether CpG ODN can function as immune adjuvants in tumor antigen immunization. The idiotype served as the tumor antigen. Select CpG ODN were as effective as complete Freund's adjuvant at inducing an antigen-specific antibody response but were associated with less toxicity. These CpG ODN induced a higher titer of antigen-specific IgG2a than did complete Freund's adjuvant, suggesting an enhanced TH1 response. Mice immunized with CpG ODN as an adjuvant were protected from tumor challenge to a degree similar to that seen in mice immunized with complete Freund's adjuvant. We conclude that CpG ODN are effective as immune adjuvants and are attractive as part of a tumor immunization strategy.

  12. DNA containing CpG motifs induces angiogenesis

    NASA Astrophysics Data System (ADS)

    Zheng, Mei; Klinman, Dennis M.; Gierynska, Malgorzata; Rouse, Barry T.

    2002-06-01

    New blood vessel formation in the cornea is an essential step in the pathogenesis of a blinding immunoinflammatory reaction caused by ocular infection with herpes simplex virus (HSV). By using a murine corneal micropocket assay, we found that HSV DNA (which contains a significant excess of potentially bioactive "CpG" motifs when compared with mammalian DNA) induces angiogenesis. Moreover, synthetic oligodeoxynucleotides containing CpG motifs attract inflammatory cells and stimulate the release of vascular endothelial growth factor (VEGF), which in turn triggers new blood vessel formation. In vitro, CpG DNA induces the J774A.1 murine macrophage cell line to produce VEGF. In vivo CpG-induced angiogenesis was blocked by the administration of anti-mVEGF Ab or the inclusion of "neutralizing" oligodeoxynucleotides that specifically oppose the stimulatory activity of CpG DNA. These findings establish that DNA containing bioactive CpG motifs induces angiogenesis, and suggest that CpG motifs in HSV DNA may contribute to the blinding lesions of stromal keratitis.

  13. [Quality and compliance with Clinical Practice Guidelines of Chronic Noncommunicable Diseases in primary care].

    PubMed

    Poblano-Verástegui, Ofelia; Vieyra-Romero, Waldo I; Galván-García, Ángel F; Fernández-Elorriaga, María; Rodríguez-Martínez, Antonia I; Saturno-Hernández, Pedro J

    2017-01-01

    To assess the quality and compliance of clinical practice guidelines (CPG) applicable to chronic non-communicable diseases (CNCD) in primary healthcare (CS), and views of staff on the barriers, facilitators and their use. 18 valued CPG with AGREEII, 3 are selected to develop indicators and assess compliance using lot quality acceptance sample (LQAS, standard 75 / 95% threshold 40 / 75% respectively, α:0. 05, β:0. 10) on 5 CS. 70 professionals surveyed about knowledge and use of CPG. Average quality of the CPG was 57.2%; low rating in domains: "Applicability" (<25%), "Stakeholder involvement" (43.5%) and "Rigour of development" (55.0%). Compliance in CS ranges from 39 to 53.4%. Professionals show uneven knowledge of CPG; 44 to 45% (according to CPG), they declare that they are not used, they identify as main barriers the lack of training, and their difficult accessibility and management. The quality and implementation of evaluated CPG is deficient constituting an opportunity of improvement in health services.

  14. DNA-inorganic hybrid nanovaccine for cancer immunotherapy

    NASA Astrophysics Data System (ADS)

    Zhu, Guizhi; Liu, Yijing; Yang, Xiangyu; Kim, Young-Hwa; Zhang, Huimin; Jia, Rui; Liao, Hsien-Shun; Jin, Albert; Lin, Jing; Aronova, Maria; Leapman, Richard; Nie, Zhihong; Niu, Gang; Chen, Xiaoyuan

    2016-03-01

    Cancer evolves to evade or compromise the surveillance of the immune system, and cancer immunotherapy aims to harness the immune system in order to inhibit cancer development. Unmethylated CpG dinucleotide-containing oligonucleotides (CpG), a class of potent adjuvants that activate the toll-like receptor 9 (TLR9) located in the endolysosome of many antigen-presenting cells (APCs), are promising for cancer immunotherapy. However, clinical application of synthetic CpG confronts many challenges such as suboptimal delivery into APCs, unfavorable pharmacokinetics caused by limited biostability and short in vivo half-life, and side effects associated with leaking of CpG into the systemic circulation. Here we present DNA-inorganic hybrid nanovaccines (hNVs) for efficient uptake into APCs, prolonged tumor retention, and potent immunostimulation and cancer immunotherapy. hNVs were self-assembled from concatemer CpG analogs and magnesium pyrophosphate (Mg2PPi). Mg2PPi renders hNVs resistant to nuclease degradation and thermal denaturation, both of which are demanding characteristics for effective vaccination and the storage and transportation of vaccines. Fluorophore-labeled hNVs were tracked to be efficiently internalized into the endolysosomes of APCs, where Mg2PPi was dissolved in an acidic environment and thus CpG analogs were exposed to hNVs. Internalized hNVs in APCs led to (1) elevated secretion of proinflammatory factors, and (2) elevated expression of co-stimulatory factors. Compared with molecular CpG, hNVs dramatically prolonged the tissue retention of CpG analogs and reduced splenomegaly, a common side effect of CpG. In a melanoma mouse model, two injections of hNVs significantly inhibited the tumor growth and outperformed the molecular CpG. These results suggest hNVs are promising for cancer immunotherapy.Cancer evolves to evade or compromise the surveillance of the immune system, and cancer immunotherapy aims to harness the immune system in order to inhibit cancer development. Unmethylated CpG dinucleotide-containing oligonucleotides (CpG), a class of potent adjuvants that activate the toll-like receptor 9 (TLR9) located in the endolysosome of many antigen-presenting cells (APCs), are promising for cancer immunotherapy. However, clinical application of synthetic CpG confronts many challenges such as suboptimal delivery into APCs, unfavorable pharmacokinetics caused by limited biostability and short in vivo half-life, and side effects associated with leaking of CpG into the systemic circulation. Here we present DNA-inorganic hybrid nanovaccines (hNVs) for efficient uptake into APCs, prolonged tumor retention, and potent immunostimulation and cancer immunotherapy. hNVs were self-assembled from concatemer CpG analogs and magnesium pyrophosphate (Mg2PPi). Mg2PPi renders hNVs resistant to nuclease degradation and thermal denaturation, both of which are demanding characteristics for effective vaccination and the storage and transportation of vaccines. Fluorophore-labeled hNVs were tracked to be efficiently internalized into the endolysosomes of APCs, where Mg2PPi was dissolved in an acidic environment and thus CpG analogs were exposed to hNVs. Internalized hNVs in APCs led to (1) elevated secretion of proinflammatory factors, and (2) elevated expression of co-stimulatory factors. Compared with molecular CpG, hNVs dramatically prolonged the tissue retention of CpG analogs and reduced splenomegaly, a common side effect of CpG. In a melanoma mouse model, two injections of hNVs significantly inhibited the tumor growth and outperformed the molecular CpG. These results suggest hNVs are promising for cancer immunotherapy. Electronic supplementary information (ESI) available: ESI materials and methods, characterization of hNVs. See DOI: 10.1039/c5nr08821f

  15. Deep sequencing reveals distinct patterns of DNA methylation in prostate cancer.

    PubMed

    Kim, Jung H; Dhanasekaran, Saravana M; Prensner, John R; Cao, Xuhong; Robinson, Daniel; Kalyana-Sundaram, Shanker; Huang, Christina; Shankar, Sunita; Jing, Xiaojun; Iyer, Matthew; Hu, Ming; Sam, Lee; Grasso, Catherine; Maher, Christopher A; Palanisamy, Nallasivam; Mehra, Rohit; Kominsky, Hal D; Siddiqui, Javed; Yu, Jindan; Qin, Zhaohui S; Chinnaiyan, Arul M

    2011-07-01

    Beginning with precursor lesions, aberrant DNA methylation marks the entire spectrum of prostate cancer progression. We mapped the global DNA methylation patterns in select prostate tissues and cell lines using MethylPlex-next-generation sequencing (M-NGS). Hidden Markov model-based next-generation sequence analysis identified ∼68,000 methylated regions per sample. While global CpG island (CGI) methylation was not differential between benign adjacent and cancer samples, overall promoter CGI methylation significantly increased from ~12.6% in benign samples to 19.3% and 21.8% in localized and metastatic cancer tissues, respectively (P-value < 2 × 10(-16)). We found distinct patterns of promoter methylation around transcription start sites, where methylation occurred not only on the CGIs, but also on flanking regions and CGI sparse promoters. Among the 6691 methylated promoters in prostate tissues, 2481 differentially methylated regions (DMRs) are cancer-specific, including numerous novel DMRs. A novel cancer-specific DMR in the WFDC2 promoter showed frequent methylation in cancer (17/22 tissues, 6/6 cell lines), but not in the benign tissues (0/10) and normal PrEC cells. Integration of LNCaP DNA methylation and H3K4me3 data suggested an epigenetic mechanism for alternate transcription start site utilization, and these modifications segregated into distinct regions when present on the same promoter. Finally, we observed differences in repeat element methylation, particularly LINE-1, between ERG gene fusion-positive and -negative cancers, and we confirmed this observation using pyrosequencing on a tissue panel. This comprehensive methylome map will further our understanding of epigenetic regulation in prostate cancer progression.

  16. Exposure to welding fumes is associated with hypomethylation of the F2RL3 gene: a cardiovascular disease marker

    PubMed Central

    Hossain, Mohammad B; Li, Huiqi; Hedmer, Maria; Tinnerberg, Håkan; Albin, Maria; Broberg, Karin

    2015-01-01

    Background Welders are at risk for cardiovascular disease. Recent studies linked tobacco smoke exposure to hypomethylation of the F2RL3 (coagulation factor II (thrombin) receptor-like 3) gene, a marker for cardiovascular disease prognosis and mortality. However, whether welding fumes cause hypomethylation of F2RL3 remains unknown. Methods We investigated 101 welders (median span of working as a welder: 7 years) and 127 unexposed controls (non-welders with no obvious exposure to respirable dust at work), age range 23–60 years, all currently non-smoking, in Sweden. The participants were interviewed about their work history, lifestyle factors and diseases. Personal sampling of respirable dust was performed for the welders. DNA methylation of F2RL3 in blood was assessed by pyrosequencing of four CpG sites, CpG_2 (corresponds to cg03636183) to CpG_5, in F2RL3. Multivariable linear regression analysis was used to assess the association between exposure to welding fumes and F2RL3 methylation. Results Welders had 2.6% lower methylation of CpG_5 than controls (p<0.001). Higher concentrations of measured respirable dust among the welders were associated with hypomethylation of CpG_2, CpG_4 and CpG_5 (β=−0.49 to −1.4, p<0.012); p<0.029 adjusted for age, previous smoking, passive smoking, education, current residence and respirator use. Increasing the number of years working as a welder was associated with hypomethylation of CpG_4 (linear regression analysis, β=−0.11, p=0.039, adjusted for previous smoking). Previous tobacco smokers had 1.5–4.7% (p<0.014) lower methylation of 3 of the 4 CpG sites in F2RL3 (CpG_2, CpG_4 and CpG_5) compared to never-smokers. A non-significant lower risk of cardiovascular disease with more methylation was observed for all CpG sites. Conclusions Welding fumes exposure and previous smoking were associated with F2RL3 hypomethylation. This finding links low-to-moderate exposure to welding fumes to adverse effects on the cardiovascular system, and suggests a potential mechanistic pathway for this link, via epigenetic effects on F2RL3 expression. PMID:26395445

  17. [Comparative evaluation of clinical practice guidelines for the treatment of schizophrenia].

    PubMed

    Delessert, D; Pomini, V; Grasset, F; Baumann, P

    2008-01-01

    Many clinical practice guidelines (CPG) have been published in reply to the development of the concept of "evidence-based medicine" (EBM) and as a solution to the difficulty of synthesizing and selecting relevant medical literature. Taking into account the expansion of new CPG, the question of choice arises: which CPG to consider in a given clinical situation? It is of primary importance to evaluate the quality of the CPG, but until recently, there has been no standardized tool of evaluation or comparison of the quality of the CPG. An instrument of evaluation of the quality of the CPG, called "AGREE" for appraisal of guidelines for research and evaluation was validated in 2002. The six principal CPG concerning the treatment of schizophrenia are compared with the help of the "AGREE" instrument: (1) "the Agence nationale pour le développement de l'évaluation médicale (ANDEM) recommendations"; (2) "The American Psychiatric Association (APA) practice guideline for the treatment of patients with schizophrenia"; (3) "The quick reference guide of APA practice guideline for the treatment of patients with schizophrenia"; (4) "The schizophrenia patient outcomes research team (PORT) treatment recommendations"; (5) "The Texas medication algorithm project (T-MAP)" and (6) "The expert consensus guideline for the treatment of schizophrenia". The results of our study were then compared with those of a similar investigation published in 2005, structured on 24 CPG tackling the treatment of schizophrenia. The "AGREE" tool was also used by two investigators in their study. In general, the scores of the two studies differed little and the two global evaluations of the CPG converged; however, each of the six CPG is perfectible. The rigour of elaboration of the six CPG was in general average. The consideration of the opinion of potential users was incomplete, and an effort made in the presentation of the recommendations would facilitate their clinical use. Moreover, there was little consideration by the authors regarding the applicability of the recommendations. Globally, two CPG are considered as strongly recommended: "the quick reference guide of the APA practice guideline for the treatment of patients with schizophrenia" and "the T-MAP".

  18. DNA methylome profiling identifies novel methylated genes in African American patients with colorectal neoplasia.

    PubMed

    Ashktorab, Hassan; Daremipouran, M; Goel, Ajay; Varma, Sudhir; Leavitt, R; Sun, Xueguang; Brim, Hassan

    2014-04-01

    The identification of genes that are differentially methylated in colorectal cancer (CRC) has potential value for both diagnostic and therapeutic interventions specifically in high-risk populations such as African Americans (AAs). However, DNA methylation patterns in CRC, especially in AAs, have not been systematically explored and remain poorly understood. Here, we performed DNA methylome profiling to identify the methylation status of CpG islands within candidate genes involved in critical pathways important in the initiation and development of CRC. We used reduced representation bisulfite sequencing (RRBS) in colorectal cancer and adenoma tissues that were compared with DNA methylome from a healthy AA subject's colon tissue and peripheral blood DNA. The identified methylation markers were validated in fresh frozen CRC tissues and corresponding normal tissues from AA patients diagnosed with CRC at Howard University Hospital. We identified and validated the methylation status of 355 CpG sites located within 16 gene promoter regions associated with CpG islands. Fifty CpG sites located within CpG islands-in genes ATXN7L1 (2), BMP3 (7), EID3 (15), GAS7 (1), GPR75 (24), and TNFAIP2 (1)-were significantly hypermethylated in tumor vs. normal tissues (P<0.05). The methylation status of BMP3, EID3, GAS7, and GPR75 was confirmed in an independent, validation cohort. Ingenuity pathway analysis mapped three of these markers (GAS7, BMP3 and GPR) in the insulin and TGF-β1 network-the two key pathways in CRC. In addition to hypermethylated genes, our analysis also revealed that LINE-1 repeat elements were progressively hypomethylated in the normal-adenoma-cancer sequence. We conclude that DNA methylome profiling based on RRBS is an effective method for screening aberrantly methylated genes in CRC. While previous studies focused on the limited identification of hypermethylated genes, ours is the first study to systematically and comprehensively identify novel hypermethylated genes, as well as hypomethylated LINE-1 sequences, which may serve as potential biomarkers for CRC in African Americans. Our discovered biomarkers were intimately linked to the insulin/TGF-B1 pathway, further strengthening the association of diabetic disorders with colon oncogenic transformation.

  19. DNA methylation profiling for a confirmatory test for blood, saliva, semen, vaginal fluid and menstrual blood.

    PubMed

    Lee, Hwan Young; Jung, Sang-Eun; Lee, Eun Hee; Yang, Woo Ick; Shin, Kyoung-Jin

    2016-09-01

    The ability to predict the type of tissues or cells from molecular profiles of crime scene samples has important practical implications in forensics. A previously reported multiplex assay using DNA methylation markers could only discriminate between 4 types of body fluids: blood, saliva, semen, and the body fluid which originates from female reproductive organ. In the present study, we selected 15 menstrual blood-specific CpG marker candidates based on analysis of 12 genome-wide DNA methylation profiles of vaginal fluid and menstrual blood. The menstrual blood-specificity of the candidate markers was confirmed by comparison with HumanMethylation450 BeadChip array data obtained for 58 samples including 12 blood, 12 saliva, 12 semen, 3 vaginal fluid, and 19 skin epidermis samples. Among 15CpG marker candidates, 3 were located in the promoter region of the SLC26A10 gene, and 2 of them (cg09696411 and cg18069290) showed high menstrual blood specificity. DNA methylation at the 2CpG markers was further tested by targeted bisulfite sequencing of 461 additional samples including 49 blood, 52 saliva, 34 semen, 125 vaginal fluid, and 201 menstrual blood. Because the 2 markers showed menstrual blood-specific methylation patterns, we modified our previous multiplex methylation SNaPshot reaction to include these 2 markers. In addition, a blood marker cg01543184 with cross reactivity to semen was replaced with cg08792630, and a semen-specific unmethylation marker cg17621389 was removed. The resultant multiplex methylation SNaPshot allowed positive identification of blood, saliva, semen, vaginal fluid and menstrual blood using the 9CpG markers which show a methylation signal only in the target body fluids. Because of the complexity in cell composition, menstrual bloods produced DNA methylation profiles that vary with menstrual cycle and sample collection methods, which are expected to provide more insight into forensic menstrual blood test. Moreover, because the developed multiplex methylation SNaPshot reaction includes the 4CpG markers of which specificities have been confirmed by multiple studies, it will facilitate confirmatory tests for body fluids that are frequently observed in forensic casework. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  20. Clinical practice guidelines (CPGs) reduce costs in the management of isolated splenic injuries at pediatric trauma centers.

    PubMed

    Gutierrez, Ivan M; Zurakowski, David; Chen, Qiaoli; Mooney, David P

    2013-02-01

    The American Pediatric Surgical Association Trauma Committee proposed the use of a clinical practice guideline (CPG) for the non-operative management of isolated splenic injuries in 1998. An analysis was conducted to determine the financial impact of CPGs on the management of these injuries. The Pediatric Health Information System database, which contains data from 44 children's hospitals, was used to identify children who sustained a graded isolated splenic injury between June 2005 and June 2010. Demographics, length of stay (LOS), readmission rates, and laboratory, imaging, procedural, and total cost data were determined for all hospitals verified as a pediatric trauma center by the American College of Surgeons and/or designated by their local authority. Comparisons were made between facilities self-identifying as having a splenic injury management CPG and those without a CPG. Children (1,154) with isolated splenic injuries (grades 1-4) were cared for in 26 pediatric trauma centers: 20 with a CPG and 6 without (non-CPG). Median costs were significantly lower at CPG than non-CPG centers for imaging (US $163 vs. US $641, P < .001), laboratory (US $629 vs. US $1,044, P < .001), and total hospital stay (US $9,868 vs. US $10,830, P < .001). The median LOS for CPG and non-CPG centers were similar (3 vs. 2 days, P = .38), as were readmission rates within 90 days (3.1 vs. 5.1 %, P = .21). Multiple linear regression indicated that LOS (P < .001) and utilization of a CPG (P = .007) are significant independent predictors of total cost. Utilization of a CPG to manage children with isolated splenic injuries at a pediatric trauma center results in significantly reduced imaging, laboratory, and total hospital costs independent of patient age, gender, grade, and LOS.

  1. Comprehensive analysis of CpG islands in human chromosomes 21 and 22

    NASA Astrophysics Data System (ADS)

    Takai, Daiya; Jones, Peter A.

    2002-03-01

    CpG islands are useful markers for genes in organisms containing 5-methylcytosine in their genomes. In addition, CpG islands located in the promoter regions of genes can play important roles in gene silencing during processes such as X-chromosome inactivation, imprinting, and silencing of intragenomic parasites. The generally accepted definition of what constitutes a CpG island was proposed in 1987 by Gardiner-Garden and Frommer [Gardiner-Garden, M. & Frommer, M. (1987) J. Mol. Biol. 196, 261-282] as being a 200-bp stretch of DNA with a C+G content of 50% and an observed CpG/expected CpG in excess of 0.6. Any definition of a CpG island is somewhat arbitrary, and this one, which was derived before the sequencing of mammalian genomes, will include many sequences that are not necessarily associated with controlling regions of genes but rather are associated with intragenomic parasites. We have therefore used the complete genomic sequences of human chromosomes 21 and 22 to examine the properties of CpG islands in different sequence classes by using a search algorithm that we have developed. Regions of DNA of greater than 500 bp with a G+C equal to or greater than 55% and observed CpG/expected CpG of 0.65 were more likely to be associated with the 5' regions of genes and this definition excluded most Alu-repetitive elements. We also used genome sequences to show strong CpG suppression in the human genome and slight suppression in Drosophila melanogaster and Saccharomyces cerevisiae. This finding is compatible with the recent detection of 5-methylcytosine in Drosophila, and might suggest that S. cerevisiae has, or once had, CpG methylation.

  2. Treatment of Tobacco Dependence, a Critical Gap in Czech Clinical Practice Guidelines.

    PubMed

    Zvolská, Kamila; Fraser, Keely; Zvolský, Miroslav; Králíková, Eva

    2017-06-01

    Tobacco related comorbidities and treatment of dependence are relevant to clinicians of all disciplines. Clinicians should provide a brief intervention about tobacco use with smokers at each clinical contact (success rate of 5-10 %). Intensive treatment (success rate >30%) should be available to those who need it. Brief intervention is not yet standard clinical practice. Our aim was to assess clinical practice guidelines (CPG) of selected medical professional societies to determine whether or not tobacco dependence treatment recommendations were included. Between October and December 2013, we conducted a keyword search of CPG for 20 medical professional societies in the Czech Republic. We searched for the keywords "smoking", "tobacco" and "nicotine addiction" in 91 CPG documents, which were freely available on the websites of selected professional societies. We focused specifically on CPG relating to cardiovascular and respiratory diseases as well as cancer. We excluded any CPG focused on acute conditions, diagnostics only, laboratory methods, or administration. There was no mention of smoking in 27.7% (26/94) of CPG documents. Only 16% (15/94) of CPG documents listed smoking as a risk factor. 42.5% (40/94) mentioned smoking related phrases (e.g. "smoking ban"). Only 13.8% (13/94) of CPG included a section on tobacco dependence, referenced tobacco dependence treatment guidelines or mentioned specialized treatment centres where smokers can be referred. Nearly one third of CPG related to cardiovascular and respiratory diseases as well as cancer made no mention of smoking. Despite the clinical significance of smoking, the majority of CPG did not adequately address tobacco dependence and its treatment. Copyright© by the National Institute of Public Health, Prague 2017

  3. DNA-inorganic hybrid nanovaccine for cancer immunotherapy.

    PubMed

    Zhu, Guizhi; Liu, Yijing; Yang, Xiangyu; Kim, Young-Hwa; Zhang, Huimin; Jia, Rui; Liao, Hsien-Shun; Jin, Albert; Lin, Jing; Aronova, Maria; Leapman, Richard; Nie, Zhihong; Niu, Gang; Chen, Xiaoyuan

    2016-03-28

    Cancer evolves to evade or compromise the surveillance of the immune system, and cancer immunotherapy aims to harness the immune system in order to inhibit cancer development. Unmethylated CpG dinucleotide-containing oligonucleotides (CpG), a class of potent adjuvants that activate the toll-like receptor 9 (TLR9) located in the endolysosome of many antigen-presenting cells (APCs), are promising for cancer immunotherapy. However, clinical application of synthetic CpG confronts many challenges such as suboptimal delivery into APCs, unfavorable pharmacokinetics caused by limited biostability and short in vivo half-life, and side effects associated with leaking of CpG into the systemic circulation. Here we present DNA-inorganic hybrid nanovaccines (hNVs) for efficient uptake into APCs, prolonged tumor retention, and potent immunostimulation and cancer immunotherapy. hNVs were self-assembled from concatemer CpG analogs and magnesium pyrophosphate (Mg2PPi). Mg2PPi renders hNVs resistant to nuclease degradation and thermal denaturation, both of which are demanding characteristics for effective vaccination and the storage and transportation of vaccines. Fluorophore-labeled hNVs were tracked to be efficiently internalized into the endolysosomes of APCs, where Mg2PPi was dissolved in an acidic environment and thus CpG analogs were exposed to hNVs. Internalized hNVs in APCs led to (1) elevated secretion of proinflammatory factors, and (2) elevated expression of co-stimulatory factors. Compared with molecular CpG, hNVs dramatically prolonged the tissue retention of CpG analogs and reduced splenomegaly, a common side effect of CpG. In a melanoma mouse model, two injections of hNVs significantly inhibited the tumor growth and outperformed the molecular CpG. These results suggest hNVs are promising for cancer immunotherapy.

  4. A Hybrid Approach for CpG Island Detection in the Human Genome.

    PubMed

    Yang, Cheng-Hong; Lin, Yu-Da; Chiang, Yi-Cheng; Chuang, Li-Yeh

    2016-01-01

    CpG islands have been demonstrated to influence local chromatin structures and simplify the regulation of gene activity. However, the accurate and rapid determination of CpG islands for whole DNA sequences remains experimentally and computationally challenging. A novel procedure is proposed to detect CpG islands by combining clustering technology with the sliding-window method (PSO-based). Clustering technology is used to detect the locations of all possible CpG islands and process the data, thus effectively obviating the need for the extensive and unnecessary processing of DNA fragments, and thus improving the efficiency of sliding-window based particle swarm optimization (PSO) search. This proposed approach, named ClusterPSO, provides versatile and highly-sensitive detection of CpG islands in the human genome. In addition, the detection efficiency of ClusterPSO is compared with eight CpG island detection methods in the human genome. Comparison of the detection efficiency for the CpG islands in human genome, including sensitivity, specificity, accuracy, performance coefficient (PC), and correlation coefficient (CC), ClusterPSO revealed superior detection ability among all of the test methods. Moreover, the combination of clustering technology and PSO method can successfully overcome their respective drawbacks while maintaining their advantages. Thus, clustering technology could be hybridized with the optimization algorithm method to optimize CpG island detection. The prediction accuracy of ClusterPSO was quite high, indicating the combination of CpGcluster and PSO has several advantages over CpGcluster and PSO alone. In addition, ClusterPSO significantly reduced implementation time.

  5. The effect of TLR9 agonist CpG oligodeoxynucleotides on the intestinal immune response of cobia (Rachycentron canadum).

    PubMed

    Byadgi, Omkar; Puteri, Dinda; Lee, Jai-Wei; Chang, Tsung-Chou; Lee, Yan-Horn; Chu, Chun-Yen; Cheng, Ta-Chih

    2014-01-01

    Cytosine-guanine oligodeoxynucleotide (CpG ODN) motifs of bacterial DNA are recognized through toll-like receptor 9 (TLR9) and are potent activators of innate immunity. However, the interaction between TLR9 and CpG ODN in aquatic species has not been well characterized. Hence, cobia TLR9 isoform B (RCTLR9B) was cloned and its expression and induction in intestine were investigated. RCTLR9B cDNA consists of 3113bp encoding 1009 amino acids containing three regions, leucine rich repeats, transmembrane domain, and toll/interleukin-1 receptor (TIR) domain. Intraperitoneal injection of CpG ODN 2395 upregulated RCTLR9 A and B and MyD88 and also induced the expressions of Mx, chemokine CC, and interleukin IL-1 β . Cobia intraperitoneally injected with CpG ODN 1668 and 2395 had increased survival rates after challenge with Photobacterium damselae subsp. piscicida. In addition, formulation of CpG ODN with formalin-killed bacteria (FKB) and aluminum hydroxide gel significantly increased expressions of RCTLR9 A (50 folds) and B (30 folds) isoforms at 10 dpi (CpG ODN 1668) and MyD88 (21 folds) at 6 dpv (CpG ODN 2395). Subsequently, IL-1 β increased at 6 dpv in 1668 group. No histopathological damage and inflammatory responses were observed in the injected cobia. Altogether, these results facilitate CpG ODNs as an adjuvant to increase bacterial disease resistance and efficacy of vaccines in cobia.

  6. The Effect of TLR9 Agonist CpG Oligodeoxynucleotides on the Intestinal Immune Response of Cobia (Rachycentron canadum)

    PubMed Central

    Byadgi, Omkar; Puteri, Dinda; Lee, Jai-Wei; Chang, Tsung-Chou; Lee, Yan-Horn; Chu, Chun-Yen; Cheng, Ta-Chih

    2014-01-01

    Cytosine-guanine oligodeoxynucleotide (CpG ODN) motifs of bacterial DNA are recognized through toll-like receptor 9 (TLR9) and are potent activators of innate immunity. However, the interaction between TLR9 and CpG ODN in aquatic species has not been well characterized. Hence, cobia TLR9 isoform B (RCTLR9B) was cloned and its expression and induction in intestine were investigated. RCTLR9B cDNA consists of 3113bp encoding 1009 amino acids containing three regions, leucine rich repeats, transmembrane domain, and toll/interleukin-1 receptor (TIR) domain. Intraperitoneal injection of CpG ODN 2395 upregulated RCTLR9 A and B and MyD88 and also induced the expressions of Mx, chemokine CC, and interleukin IL-1β. Cobia intraperitoneally injected with CpG ODN 1668 and 2395 had increased survival rates after challenge with Photobacterium damselae subsp. piscicida. In addition, formulation of CpG ODN with formalin-killed bacteria (FKB) and aluminum hydroxide gel significantly increased expressions of RCTLR9 A (50 folds) and B (30 folds) isoforms at 10 dpi (CpG ODN 1668) and MyD88 (21 folds) at 6 dpv (CpG ODN 2395). Subsequently, IL-1β increased at 6 dpv in 1668 group. No histopathological damage and inflammatory responses were observed in the injected cobia. Altogether, these results facilitate CpG ODNs as an adjuvant to increase bacterial disease resistance and efficacy of vaccines in cobia. PMID:24991578

  7. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ballester, Marie; Jeanbart, Laura; de Titta, Alexandre

    An emerging strategy in preventing and treating airway allergy consists of modulating the immune response induced against allergens in the lungs. CpG oligodeoxynucleotides have been investigated in airway allergy studies, but even if promising, efficacy requires further substantiation. We investigated the effect of pulmonary delivery of nanoparticle (NP)-conjugated CpG on lung immunity and found that NP-CpG led to enhanced recruitment of activated dendritic cells and to Th1 immunity compared to free CpG. We then evaluated if pulmonary delivery of NP-CpG could prevent and treat house dust mite-induced allergy by modulating immunity directly in lungs. When CpG was administered as immunomodulatorymore » therapy prior to allergen sensitization, we found that NP-CpG significantly reduced eosinophilia, IgE levels, mucus production and Th2 cytokines, while free CpG had only a moderate effect on these parameters. In a therapeutic setting where CpG was administered after allergen sensitization, we found that although both free CpG and NP-CpG reduced eosinophilia and IgE levels to the same extent, NP conjugation of CpG significantly enhanced reduction of Th2 cytokines in lungs of allergic mice. Taken together, these data highlight benefits of NP conjugation and the relevance of NP-CpG as allergen-free therapy to modulate lung immunity and treat airway allergy.« less

  8. Serum microRNA expression patterns that predict early treatment failure in prostate cancer patients.

    PubMed

    Singh, Prashant K; Preus, Leah; Hu, Qiang; Yan, Li; Long, Mark D; Morrison, Carl D; Nesline, Mary; Johnson, Candace S; Koochekpour, Shahriar; Kohli, Manish; Liu, Song; Trump, Donald L; Sucheston-Campbell, Lara E; Campbell, Moray J

    2014-02-15

    We aimed to identify microRNA (miRNA) expression patterns in the serum of prostate cancer (CaP) patients that predict the risk of early treatment failure following radical prostatectomy (RP). Microarray and Q-RT-PCR analyses identified 43 miRNAs as differentiating disease stages within 14 prostate cell lines and reflectedpublically available patient data. 34 of these miRNA were detectable in the serum of CaP patients. Association with time to biochemical progression was examined in a cohort of CaP patients following RP. A greater than two-fold increase in hazard of biochemical progression associated with altered expression of miR-103, miR-125b and miR-222 (p<.0008) in the serum of CaP patients. Prediction models based on penalized regression analyses showed that the levels of the miRNAs and PSA together were better at detecting false positives than models without miRNAs, for similar level of sensitivity. Analyses of publically available data revealed significant and reciprocal relationships between changes in CpG methylation and miRNA expression patterns suggesting a role for CpG methylation to regulate miRNA. Exploratory validation supported roles for miR-222 and miR-125b to predict progression risk in CaP. The current study established that expression patterns of serum-detectable miRNAs taken at the time of RP are prognostic for men who are at risk of experiencing subsequent early biochemical progression. These non-invasive approaches could be used to augment treatment decisions.

  9. V1 and v2b interneurons secure the alternating flexor-extensor motor activity mice require for limbed locomotion.

    PubMed

    Zhang, Jingming; Lanuza, Guillermo M; Britz, Olivier; Wang, Zhi; Siembab, Valerie C; Zhang, Ying; Velasquez, Tomoko; Alvarez, Francisco J; Frank, Eric; Goulding, Martyn

    2014-04-02

    Reciprocal activation of flexor and extensor muscles constitutes the fundamental mechanism that tetrapod vertebrates use for locomotion and limb-driven reflex behaviors. This aspect of motor coordination is controlled by inhibitory neurons in the spinal cord; however, the identity of the spinal interneurons that serve this function is not known. Here, we show that the production of an alternating flexor-extensor motor rhythm depends on the composite activities of two classes of ventrally located inhibitory neurons, V1 and V2b interneurons (INs). Abrogating V1 and V2b IN-derived neurotransmission in the isolated spinal cord results in a synchronous pattern of L2 flexor-related and L5 extensor-related locomotor activity. Mice lacking V1 and V2b inhibition are unable to articulate their limb joints and display marked deficits in limb-driven reflex movements. Taken together, these findings identify V1- and V2b-derived neurons as the core interneuronal components of the limb central pattern generator (CPG) that coordinate flexor-extensor motor activity. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. FBXL19 recruits CDK-Mediator to CpG islands of developmental genes priming them for activation during lineage commitment

    PubMed Central

    Dimitrova, Emilia; Nakayama, Manabu; Koseki, Yoko; Konietzny, Rebecca; Kessler, Benedikt M; Koseki, Haruhiko

    2018-01-01

    CpG islands are gene regulatory elements associated with the majority of mammalian promoters, yet how they regulate gene expression remains poorly understood. Here, we identify FBXL19 as a CpG island-binding protein in mouse embryonic stem (ES) cells and show that it associates with the CDK-Mediator complex. We discover that FBXL19 recruits CDK-Mediator to CpG island-associated promoters of non-transcribed developmental genes to prime these genes for activation during cell lineage commitment. We further show that recognition of CpG islands by FBXL19 is essential for mouse development. Together this reveals a new CpG island-centric mechanism for CDK-Mediator recruitment to developmental gene promoters in ES cells and a requirement for CDK-Mediator in priming these developmental genes for activation during cell lineage commitment. PMID:29809150

  11. Exposure to welding fumes is associated with hypomethylation of the F2RL3 gene: a cardiovascular disease marker.

    PubMed

    Hossain, Mohammad B; Li, Huiqi; Hedmer, Maria; Tinnerberg, Håkan; Albin, Maria; Broberg, Karin

    2015-12-01

    Welders are at risk for cardiovascular disease. Recent studies linked tobacco smoke exposure to hypomethylation of the F2RL3 (coagulation factor II (thrombin) receptor-like 3) gene, a marker for cardiovascular disease prognosis and mortality. However, whether welding fumes cause hypomethylation of F2RL3 remains unknown. We investigated 101 welders (median span of working as a welder: 7 years) and 127 unexposed controls (non-welders with no obvious exposure to respirable dust at work), age range 23-60 years, all currently non-smoking, in Sweden. The participants were interviewed about their work history, lifestyle factors and diseases. Personal sampling of respirable dust was performed for the welders. DNA methylation of F2RL3 in blood was assessed by pyrosequencing of four CpG sites, CpG_2 (corresponds to cg03636183) to CpG_5, in F2RL3. Multivariable linear regression analysis was used to assess the association between exposure to welding fumes and F2RL3 methylation. Welders had 2.6% lower methylation of CpG_5 than controls (p<0.001). Higher concentrations of measured respirable dust among the welders were associated with hypomethylation of CpG_2, CpG_4 and CpG_5 (β=-0.49 to -1.4, p<0.012); p<0.029 adjusted for age, previous smoking, passive smoking, education, current residence and respirator use. Increasing the number of years working as a welder was associated with hypomethylation of CpG_4 (linear regression analysis, β=-0.11, p=0.039, adjusted for previous smoking). Previous tobacco smokers had 1.5-4.7% (p<0.014) lower methylation of 3 of the 4 CpG sites in F2RL3 (CpG_2, CpG_4 and CpG_5) compared to never-smokers. A non-significant lower risk of cardiovascular disease with more methylation was observed for all CpG sites. Welding fumes exposure and previous smoking were associated with F2RL3 hypomethylation. This finding links low-to-moderate exposure to welding fumes to adverse effects on the cardiovascular system, and suggests a potential mechanistic pathway for this link, via epigenetic effects on F2RL3 expression. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  12. Bisulfite-independent analysis of CpG island methylation enables genome-scale stratification of single cells

    PubMed Central

    Han, Lin; Wu, Hua-Jun; Zhu, Haiying; Kim, Kun-Yong; Marjani, Sadie L.; Riester, Markus; Euskirchen, Ghia; Zi, Xiaoyuan; Yang, Jennifer; Han, Jasper; Snyder, Michael; Park, In-Hyun; Irizarry, Rafael; Weissman, Sherman M.

    2017-01-01

    Abstract Conventional DNA bisulfite sequencing has been extended to single cell level, but the coverage consistency is insufficient for parallel comparison. Here we report a novel method for genome-wide CpG island (CGI) methylation sequencing for single cells (scCGI-seq), combining methylation-sensitive restriction enzyme digestion and multiple displacement amplification for selective detection of methylated CGIs. We applied this method to analyzing single cells from two types of hematopoietic cells, K562 and GM12878 and small populations of fibroblasts and induced pluripotent stem cells. The method detected 21 798 CGIs (76% of all CGIs) per cell, and the number of CGIs consistently detected from all 16 profiled single cells was 20 864 (72.7%), with 12 961 promoters covered. This coverage represents a substantial improvement over results obtained using single cell reduced representation bisulfite sequencing, with a 66-fold increase in the fraction of consistently profiled CGIs across individual cells. Single cells of the same type were more similar to each other than to other types, but also displayed epigenetic heterogeneity. The method was further validated by comparing the CpG methylation pattern, methylation profile of CGIs/promoters and repeat regions and 41 classes of known regulatory markers to the ENCODE data. Although not every minor methylation differences between cells are detectable, scCGI-seq provides a solid tool for unsupervised stratification of a heterogeneous cell population. PMID:28126923

  13. Methylation Analysis of the BMPR2 Gene Promoter Region in Patients With Pulmonary Arterial Hypertension.

    PubMed

    Pousada, Guillermo; Baloira, Adolfo; Valverde, Diana

    2016-06-01

    Pulmonary arterial hypertension is characterizated by obstruction of the pulmonary arteries. The gene mainly related to pathology is the bone morphogenetic protein receptor type II (BMPR2). The aim of this study was to analyze the methylation pattern of the BMPR2 promoter region in patients and controls. We used Methyl Primer Express(®) v.1.0 and MatInspector softwares to analyze this region. Genomic DNA obtained from the peripheral blood of patients and controls was modified with sodium bisulphite. Methylation was analyzed using methylation-specific PCR. DNA treated with CpG methyltransferase was used as a positive control for methylation and H1299 cell culture DNA was used as positive control for gene expression. We identified a CpG island, which may have been methylated, in the BMPR2 promoter region, in addition to NIT-2 (global-acting regulatory protein), sex-determining region Y) and heat shock factor transcription factor binding sites. We found no evidence of methylation in patients and controls. No methylated CpG sites were identified in H1299 cells expressing the BMPR2 gene. The BMPR2 promoter region is the most suitable for study because of the high number of transcription factor binding sites that could alter gene function. No evidence of methylation was detected in this region in patients and controls. Copyright © 2015 SEPAR. Published by Elsevier Espana. All rights reserved.

  14. Improved Prediction of Non-methylated Islands in Vertebrates Highlights Different Characteristic Sequence Patterns

    PubMed Central

    Vingron, Martin

    2016-01-01

    Non-methylated islands (NMIs) of DNA are genomic regions that are important for gene regulation and development. A recent study of genome-wide non-methylation data in vertebrates by Long et al. (eLife 2013;2:e00348) has shown that many experimentally identified non-methylated regions do not overlap with classically defined CpG islands which are computationally predicted using simple DNA sequence features. This is especially true in cold-blooded vertebrates such as Danio rerio (zebrafish). In order to investigate how predictive DNA sequence is of a region’s methylation status, we applied a supervised learning approach using a spectrum kernel support vector machine, to see if a more complex model and supervised learning can be used to improve non-methylated island prediction and to understand the sequence properties of these regions. We demonstrate that DNA sequence is highly predictive of methylation status, and that in contrast to existing CpG island prediction methods our method is able to provide more useful predictions of NMIs genome-wide in all vertebrate organisms that were studied. Our results also show that in cold-blooded vertebrates (Anolis carolinensis, Xenopus tropicalis and Danio rerio) where genome-wide classical CpG island predictions consist primarily of false positives, longer primarily AT-rich DNA sequence features are able to identify these regions much more accurately. PMID:27984582

  15. Microplate array diagonal gel electrophoresis (MADGE), CpG-PCR and temporal thermal ramp-MADGE (Melt-MADGE) for single nucleotide analyses in populations.

    PubMed

    Day, I N; O'Dell, S D; Spanakis, E; Weavind, G P

    1999-02-01

    Important requirements for molecular genetic epidemiological studies are economy, sample parallelism, convenience of setup and accessibility, goals inadequately met by existent approaches. We invented microplate array diagonal gel electrophoresis (MADGE) to gain simultaneously the advantages of simple setup, 96-well microplate compatibility, horizontal electrophoresis, and the resolution of polyacrylamide. At essentially no equipment cost (one simple plastic gel former), 10-100-fold savings on time for sample coding, liquid transfers, and data documentation, in addition to volume reductions and gel re-use, can be achieved. MADGE is compatible with ARMS, restriction analysis and other pattern analyses. CpG-PCR is a general PCR approach to CpG sites (10-20% of all human single base variation): both primers have 3' T, and are abutted to the CpG, forcing a TaqI restriction site if the CpG is intact. Typically, a 52 bp PCR product is then cut in half. CpG-PCR also illustrates that PAGE-MADGE readily permits analysis of 'ultrashort' PCRs. Melt-MADGE employs real-time-variable-temperature electrophoresis to examine duplex mobility during melting, achieving DGGE-like de novo, mutation scanning, but with the conveniences of arbitrary programmability, MADGE compatibility and short run time. This suite of methods enhances our capability to type or scan thousands of samples simultaneously, by 10-100-fold.

  16. Patterns of DNA Methylation Across the Leptin Core Promoter in Four Diverse Asian and North American Populations.

    PubMed

    Mosher, M J; Melton, P E; Stapleton, P; Schanfield, M S; Crawford, M H

    2016-04-01

    DNA methylation is the most widely studied of epigenetic mechanisms, with environmental effects recorded through patterned attachments of methyl groups along the DNA that are capable of modifying gene expression without altering the DNA sequencing. The degree to which these patterns of DNA methylation are heritable, the expected range of normality across populations, and the phenotypic relevance of pattern variation remain unclear. Genes regulating metabolic pathways appear to be vulnerable to ongoing nutritional programming over the life course, as dietary nutrients are significant environmental determinants of DNA methylation, supplying both the methyl groups and energy to generate the methylation process. Here we examine methylation patterns along a region of the metabolic gene leptin (LEP). LEP's putative functions include regulation of energy homeostasis, with its signals affecting energy intake and expenditure, adipogenesis and energy storage, lipid and glucose metabolism, bone metabolism, and reproductive endocrine function. A pattern of differential methylation across CpG sites of the LEP core promoter has been previously identified; however, any consistency of pattern or its phenotypic significance is not fully elucidated among populations. Using DNA extracted from unfractionated white blood cells of peripheral blood samples, our pilot study, divided into two parts, examined the significance of variation in DNA methylation patterns along the leptin core promoter in four populations (phase 1) and used biomarkers reflecting leptin's functional process in two of those populations, western Buryat of Siberia and the Mennonite of central Kansas, to investigate the relevance of the ethnic variation identified in the DNA methylation (phase 2). LEP's core promoter region contains both the binding site for C/EBPα (CCAAT/enhancer binding protein alpha), which tempers the final step in adipocyte maturity and capacity to synthesize leptin, and the TATA motif controlling leptin synthesis. Previous studies report that increased methylation in this region is correlated to decreased gene expression, suggesting tissue-specific methylation variation at this region ( Melzner et al. 2002 ). We hypothesized that evidence of nutritional epigenetic programming would be identified through variation in patterns of DNA methylation and that functional relevance of that variation among populations would be identified through biomarkers that reflect leptin's metabolic signals: serum leptin levels, lipoproteins of the lipid transport system, and anthropometric measures. In phase 1, our combined analyses of 313 individuals documented a distinct and consistent overall pattern of differential DNA methylation across seven CpG sites of LEP core promoter in all ethnicities and both sexes. This pattern replicates those identified in previous studies, suggesting a conserved core promoter region across populations. Phase 2 analyses of two of the four populations (n = 239), correlating methylation at the C/EBPα transcription binding site (TBS) with metabolic and anthropometric biomarkers reflecting LEP roles, showed that stature, which reflects bone growth and remodeling, was significantly and inversely correlated with the percentage of DNA methylation at this site in both sexes. We suggest that variation in DNA methylation along the LEP core promoter plays a substantial role in energy signals affecting both adipogenesis and bone metabolism.

  17. A CpG Oligonucleotide Can Protect Mice from a Low Aerosol Challenge Dose of Burkholderia mallei

    PubMed Central

    Waag, David M.; McCluskie, Michael J.; Zhang, Ningli; Krieg, Arthur M.

    2006-01-01

    Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-γ)-inducible protein 10, interleukin-12 (IL-12), IFN-γ, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders. PMID:16495571

  18. A CpG oligonucleotide can protect mice from a low aerosol challenge dose of Burkholderia mallei.

    PubMed

    Waag, David M; McCluskie, Michael J; Zhang, Ningli; Krieg, Arthur M

    2006-03-01

    Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-gamma)-inducible protein 10, interleukin-12 (IL-12), IFN-gamma, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders.

  19. Methylation analysis of p16, SLIT2, SCARA5, and Runx3 genes in hepatocellular carcinoma

    PubMed Central

    Sun, Gaofeng; Zhang, Chen; Feng, Min; Liu, Wensheng; Xie, Huifang; Qin, Qin; Zhao, E.; Wan, Li

    2017-01-01

    Abstract This study is to investigate the methylation status of multiple tumor suppressor 1 (p16), secreted glycoprotein 2 (SLIT2), scavenger receptor class A, member 5 putative (SCARA5), and human runt-related transcription factor 3 (Runx3) genes in the peripheral blood of hepatocellular carcinoma (HCC). This is a case–control study. The peripheral blood samples were collected from 25 HCC patients, 25 patients with high risk of HCC (defined as “internal control group”), and 25 healthy individuals (defined as “external control group”), respectively. Then the methylation status of p16, SLIT2, SCARA5, and Runx3 genes in the blood samples were analyzed by pyrosequencing. The relationship between the methylation and the clinical features of HCC patients were evaluated. The methylation levels in the 7 CpG loci of p16 gene in HCC patients were low and without statistically significant difference (P > .05) compared to the control groups. Although the methylation levels of CpG3 and CpG4 in SLIT2 gene loci were higher than those of the control groups, there was no statistically significant difference (P > .05). However, the methylation rate of CpG2 locus in SCARA5 gene in HCC patients was significantly higher (P < .05). And the methylation rates of CpG1, CpG2, CpG3, CpG4, CpG5, and CpG8 in Runx3 gene in HCC patients were significantly different to that of control groups (P < .05). We also have analyzed the correlations between the CpG islands methylation of Runx3 or SCARA5 genes and the age, gender, hepatitis B, liver cirrhosis, alpha fetal protein, or hepatitis B surface antigen (HBsAg) of the HCC patients, which all showed no significant correlations (P > .05). The methylation status of SCARA5 and Runx3 genes are abnormal in HCC patients, which may further be used as molecular markers for early auxiliary diagnosis of liver cancer. PMID:29019900

  20. Links between DNA methylation and nucleosome occupancy in the human genome.

    PubMed

    Collings, Clayton K; Anderson, John N

    2017-01-01

    DNA methylation is an epigenetic modification that is enriched in heterochromatin but depleted at active promoters and enhancers. However, the debate on whether or not DNA methylation is a reliable indicator of high nucleosome occupancy has not been settled. For example, the methylation levels of DNA flanking CTCF sites are higher in linker DNA than in nucleosomal DNA, while other studies have shown that the nucleosome core is the preferred site of methylation. In this study, we make progress toward understanding these conflicting phenomena by implementing a bioinformatics approach that combines MNase-seq and NOMe-seq data and by comprehensively profiling DNA methylation and nucleosome occupancy throughout the human genome. The results demonstrated that increasing methylated CpG density is correlated with nucleosome occupancy in the total genome and within nearly all subgenomic regions. Features with elevated methylated CpG density such as exons, SINE-Alu sequences, H3K36-trimethylated peaks, and methylated CpG islands are among the highest nucleosome occupied elements in the genome, while some of the lowest occupancies are displayed by unmethylated CpG islands and unmethylated transcription factor binding sites. Additionally, outside of CpG islands, the density of CpGs within nucleosomes was shown to be important for the nucleosomal location of DNA methylation with low CpG frequencies favoring linker methylation and high CpG frequencies favoring core particle methylation. Prominent exceptions to the correlations between methylated CpG density and nucleosome occupancy include CpG islands marked by H3K27me3 and CpG-poor heterochromatin marked by H3K9me3, and these modifications, along with DNA methylation, distinguish the major silencing mechanisms of the human epigenome. Thus, the relationship between DNA methylation and nucleosome occupancy is influenced by the density of methylated CpG dinucleotides and by other epigenomic components in chromatin.

  1. Prenatal exposure to allergen, DNA methylation, and allergy in grandoffspring mice.

    PubMed

    Niedzwiecki, M; Zhu, H; Corson, L; Grunig, G; Factor, P H; Chu, S; Jiang, H; Miller, R L

    2012-07-01

    Prenatal allergen exposure has been linked to both induction and protection of allergic sensitization in offspring. We hypothesized that prenatal exposure of mice (F0) to Aspergillus fumigatus (A. fumigatus) would be associated with decreased immunoglobulin (Ig) E and airway eosinophilia and alterations in CpG methylation of T-helper genes in third-generation mice (F2). Female BALB/c mice were sensitized to A. fumigatus (62.5, 125, 1250 μg, or saline) and re-exposed to the same dose on days 7 and 14 (early) or days 12 and 17 (late) gestation. Grandoffspring were treated with A. fumigatus (62.5 μg) at 9 weeks. IgE, IgG(1) , and IgG(2a) levels and cell counts from bronchoalveolar lavage fluid were determined. Lung DNA was pyrosequenced at multiple sites in the interferon (IFN)-γ and interleukin (IL)-4 promoters. Grandoffspring of mothers dosed with 1250 μg early during pregnancy developed increased airway eosinophilia (P < 0.05). Grandoffspring of mothers dosed late in pregnancy developed lower IgE (P < 0.05) and airway eosinophilia (P < 0.05). Grandoffspring of mothers dosed early had lower methylation at IL-4 CpG(-408) and CpG(-393) compared to late dosed mice (P < 0.005 across all doses). Few correlations were found between methylation levels and airway eosinophilia and IgE. Prenatal exposure to A. fumigatus late during pregnancy, but not early, was associated with lower IgE and airway eosinophilia in grandoffspring. Prenatal exposure to A. fumigatus was associated with changes in CpG methylation in the IFN-γ and IL-4 promoters that did not correlate consistently with indicators of allergic sensitization. © 2012 John Wiley & Sons A/S.

  2. Clinical practice guideline for Sjögren's syndrome 2017.

    PubMed

    Sumida, Takayuki; Azuma, Naoto; Moriyama, Masafumi; Takahashi, Hiroyuki; Asashima, Hiromitsu; Honda, Fumika; Abe, Saori; Ono, Yuko; Hirota, Tomoya; Hirata, Shintaro; Tanaka, Yoshiya; Shimizu, Toshimasa; Nakamura, Hideki; Kawakami, Atsushi; Sano, Hajime; Ogawa, Yoko; Tsubota, Kazuo; Ryo, Koufuchi; Saito, Ichiro; Tanaka, Akihiko; Nakamura, Seiji; Takamura, Etsuko; Tanaka, Masao; Suzuki, Katsuya; Takeuchi, Tsutomu; Yamakawa, Noriyuki; Mimori, Tsuneyo; Ohta, Akiko; Nishiyama, Susumu; Yoshihara, Toshio; Suzuki, Yasunori; Kawano, Mitsuhiro; Tomiita, Minako; Tsuboi, Hiroto

    2018-05-01

    The objective of this study is to develop clinical practice guideline (CPG) for Sjögren's syndrome (SS) based on recently available clinical and therapeutic evidences. The CPG committee for SS was organized by the Research Team for Autoimmune Diseases, Research Program for Intractable Disease of the Ministry of Health, Labor and Welfare (MHLW), Japan. The committee completed a systematic review of evidences for several clinical questions and developed CPG for SS 2017 according to the procedure proposed by the Medical Information Network Distribution Service (Minds). The recommendations and their strength were checked by the modified Delphi method. The CPG for SS 2017 has been officially approved by both Japan College of Rheumatology and the Japanese Society for SS. The CPG committee set 38 clinical questions for clinical symptoms, signs, treatment, and management of SS in pediatric, adult and pregnant patients, using the PICO (P: patients, problem, population, I: interventions, C: comparisons, controls, comparators, O: outcomes) format. A summary of evidence, development of recommendation, recommendation, and strength for these 38 clinical questions are presented in the CPG. The CPG for SS 2017 should contribute to improvement and standardization of diagnosis and treatment of SS.

  3. Substantial reduction in hospital stay of children and adolescents with diabetic ketoacidosis after implementation of Clinical Practice Guidelines in a university hospital in Saudi Arabia.

    PubMed

    Al Nemri, Abdulrahman; Amer, Yasser Sami; Gasim, Hala; Osman, Mohamed Elfaki; Aleyadhy, Ayman; Al Otaibi, Hessah; Iqbal, Shaikh Mohammed; Aljurayyan, Nasir Abdullah; Assiri, Asaad M; Babiker, Amir; Mohamed, Sarar

    2017-02-01

    We aimed to determine the effect of Clinical Practice Guideline (CPG) implementation on length of hospital stay of children and adolescents with diabetic ketoacidosis (DKA). This was a 6-year (2008-2014) case-control retrospective study conducted at King Khalid University Hospital, Riyadh, that compared patients with DKA managed using CPG with those treated before CPG implementation. There were 63 episodes of DKA in 41 patients managed using CPG compared with 40 episodes in 33 patients treated before implementation of CPG. Baseline characteristics of the 2 groups were similar (age, sex, newly diagnosed patients, recurrent DKA, DKA severity, and mean glycosylated hemoglobin). The mean length of hospital stay (±SD) was 68.6 ± 53.1 hours after implementation of CPG compared with 107.4 ± 65.6 hours before implementation (P < .001). The reduction in length of hospital stay equals to 1700 bed days saved per year per 1000 patients. Implementation of CPG for DKA decreased the length of hospital stay. © 2016 John Wiley & Sons, Ltd.

  4. Newly identified CpG ODNs, M5-30 and M6-395, stimulate mouse immune cells to secrete TNF-alpha and enhance Th1-mediated immunity.

    PubMed

    Choi, Sun-Shim; Chung, Eunkyung; Jung, Yu-Jin

    2010-08-01

    Bacterial CpG motifs are known to induce both innate and adaptive immunity in infected hosts via toll-like receptor 9 (TLR9). Because small oligonucleotides (ODNs) mimicking bacterial CpG motifs are easily synthesized, they have found use as immunomodulatory agents in a number of disease models. We have developed a novel bioinformatics approach to identify effective CpG ODN sequences and evaluate their function as TLR9 ligands in a murine system. Among the CpG ODNs we identified, M5-30 and M6-395 showed significant ability to stimulate TNF-alpha and IFN-gamma production in a mouse macrophage cell line and mouse splenocytes, respectively. We also found that these CpG ODNs activated cells through the canonical NF-kappa B signaling pathway. Moreover, both CpG ODNs were able to induce Th1-mediated immunity in Mycobacterium tuberculosis (Mtb)-infected mice. Our results demonstrate that M5-30 and M6-395 function as TLR9-specific ligands, making them useful in the study of TLR9 functionality and signaling in mice.

  5. Dual activation of Toll-like receptors 7 and 9 impairs the efficacy of antitumor vaccines in murine models of metastatic breast cancer.

    PubMed

    Moreno Ayala, Mariela A; Gottardo, María Florencia; Gori, María Soledad; Nicola Candia, Alejandro Javier; Caruso, Carla; De Laurentiis, Andrea; Imsen, Mercedes; Klein, Slobodanka; Bal de Kier Joffé, Elisa; Salamone, Gabriela; Castro, Maria G; Seilicovich, Adriana; Candolfi, Marianela

    2017-09-01

    Since combination of Toll-like receptor (TLR) ligands could boost antitumor immunity, we evaluated the efficacy of dendritic cell (DC) vaccines upon dual activation of TLR9 and TLR7 in breast cancer models. DCs were generated from mouse bone marrow or peripheral blood from healthy human donors and stimulated with CpG1826 (mouse TLR9 agonist), CpG2006 or IMT504 (human TLR9 agonists) and R848 (TLR7 agonist). Efficacy of antitumor vaccines was evaluated in BALB/c mice bearing metastatic mammary adenocarcinomas. CpG-DCs improved the survival of tumor-bearing mice, reduced the development of lung metastases and generated immunological memory. However, dual activation of TLRs impaired the efficacy of DC vaccines. In vitro, we found that R848 inhibited CpG-mediated maturation of murine DCs. A positive feedback loop in TLR9 mRNA expression was observed upon CpG stimulation that was inhibited in the presence of R848. Impaired activation of NF-κB was detected when TLR9 and TLR7 were simultaneously activated. Blockade of nitric oxide synthase (NOS) and indoleamine-pyrrole-2,3-dioxygenase (IDO) improved the activation of CpG-DCs. When we evaluated the effect of combined activation of TLR9 and TLR7 in human DCs, we found that R848 induced robust DC activation that was inhibited by TLR9 agonists. These observations provide insight in the biology of TLR9 and TLR7 crosstalk and suggest caution in the selection of agonists for multiple TLR stimulation. Blockade of NOS and IDO could improve the maturation of antitumor DC vaccines. R848 could prove a useful adjuvant for DC vaccines in human patients.

  6. HIV Gag protein conjugated to a Toll-like receptor 7/8 agonist improves the magnitude and quality of Th1 and CD8+ T cell responses in nonhuman primates

    NASA Astrophysics Data System (ADS)

    Wille-Reece, Ulrike; Flynn, Barbara J.; Loré, Karin; Koup, Richard A.; Kedl, Ross M.; Mattapallil, Joseph J.; Weiss, Walter R.; Roederer, Mario; Seder, Robert A.

    2005-10-01

    Induction and maintenance of antibody and T cell responses will be critical for developing a successful vaccine against HIV. A rational approach for generating such responses is to design vaccines or adjuvants that have the capacity to activate specific antigen-presenting cells. In this regard, dendritic cells (DCs) are the most potent antigen-presenting cells for generating primary T cell responses. Here, we report that Toll-like receptor (TLR) agonists and ligands that activate DCs in vitro influence the magnitude and quality of the cellular immune response in nonhuman primates (NHPs) when administered with HIV Gag protein. NHPs immunized with HIV Gag protein and a TLR7/8 agonist or a TLR9 ligand [CpG oligodeoxynucleotides (CpG ODN)] had significantly increased Gag-specific T helper 1 and antibody responses, compared with animals immunized with HIV Gag protein alone. Importantly, conjugating the HIV Gag protein to the TLR7/8 agonist (Gag-TLR7/8 conjugate) dramatically enhanced the magnitude and altered the quality of the T helper 1 response, compared with animals immunized with HIV Gag protein and the TLR7/8 agonist or CpG ODN. Furthermore, immunization with the Gag-TLR7/8 conjugate vaccine elicited Gag-specific CD8+ T responses. Collectively, our results show that conjugating HIV Gag protein to a TLR7/8 agonist is an effective way to elicit broad-based adaptive immunity in NHPs. This type of vaccine formulation should have utility in preventive or therapeutic vaccines in which humoral and cellular immunity is required. vaccine | dendritic cell | cross-presentation | cellular immunity

  7. Assisted reproduction treatment and epigenetic inheritance

    PubMed Central

    van Montfoort, A.P.A.; Hanssen, L.L.P.; de Sutter, P.; Viville, S.; Geraedts, J.P.M.; de Boer, P.

    2012-01-01

    BACKGROUND The subject of epigenetic risk of assisted reproduction treatment (ART), initiated by reports on an increase of children with the Beckwith–Wiedemann imprinting disorder, is very topical. Hence, there is a growing literature, including mouse studies. METHODS In order to gain information on transgenerational epigenetic inheritance and epigenetic effects induced by ART, literature databases were searched for papers on this topic using relevant keywords. RESULTS At the level of genomic imprinting involving CpG methylation, ART-induced epigenetic defects are convincingly observed in mice, especially for placenta, and seem more frequent than in humans. Data generally provide a warning as to the use of ovulation induction and in vitro culture. In human sperm from compromised spermatogenesis, sequence-specific DNA hypomethylation is observed repeatedly. Transmittance of sperm and oocyte DNA methylation defects is possible but, as deduced from the limited data available, largely prevented by selection of gametes for ART and/or non-viability of the resulting embryos. Some evidence indicates that subfertility itself is a risk factor for imprinting diseases. As in mouse, physiological effects from ART are observed in humans. In the human, indications for a broader target for changes in CpG methylation than imprinted DNA sequences alone have been found. In the mouse, a broader range of CpG sequences has not yet been studied. Also, a multigeneration study of systematic ART on epigenetic parameters is lacking. CONCLUSIONS The field of epigenetic inheritance within the lifespan of an individual and between generations (via mitosis and meiosis, respectively) is growing, driven by the expansion of chromatin research. ART can induce epigenetic variation that might be transmitted to the next generation. PMID:22267841

  8. Prediction of CpG-island function: CpG clustering vs. sliding-window methods

    PubMed Central

    2010-01-01

    Background Unmethylated stretches of CpG dinucleotides (CpG islands) are an outstanding property of mammal genomes. Conventionally, these regions are detected by sliding window approaches using %G + C, CpG observed/expected ratio and length thresholds as main parameters. Recently, clustering methods directly detect clusters of CpG dinucleotides as a statistical property of the genome sequence. Results We compare sliding-window to clustering (i.e. CpGcluster) predictions by applying new ways to detect putative functionality of CpG islands. Analyzing the co-localization with several genomic regions as a function of window size vs. statistical significance (p-value), CpGcluster shows a higher overlap with promoter regions and highly conserved elements, at the same time showing less overlap with Alu retrotransposons. The major difference in the prediction was found for short islands (CpG islets), often exclusively predicted by CpGcluster. Many of these islets seem to be functional, as they are unmethylated, highly conserved and/or located within the promoter region. Finally, we show that window-based islands can spuriously overlap several, differentially regulated promoters as well as different methylation domains, which might indicate a wrong merge of several CpG islands into a single, very long island. The shorter CpGcluster islands seem to be much more specific when concerning the overlap with alternative transcription start sites or the detection of homogenous methylation domains. Conclusions The main difference between sliding-window approaches and clustering methods is the length of the predicted islands. Short islands, often differentially methylated, are almost exclusively predicted by CpGcluster. This suggests that CpGcluster may be the algorithm of choice to explore the function of these short, but putatively functional CpG islands. PMID:20500903

  9. Intratumoral delivery of CpG-conjugated anti-MUC1 antibody enhances NK cell anti-tumor activity.

    PubMed

    Schettini, Jorge; Kidiyoor, Amritha; Besmer, Dahlia M; Tinder, Teresa L; Roy, Lopamudra Das; Lustgarten, Joseph; Gendler, Sandra J; Mukherjee, Pinku

    2012-11-01

    Monoclonal antibodies (mAbs) against tumor-associated antigens are useful anticancer agents. Antibody-dependent cellular cytotoxicity (ADCC) is one of the major mechanisms responsible for initiating natural killer cell (NK)-mediated killing of tumors. However, the regulation of ADCC via NK cells is poorly understood. We have investigated the cytolytic activity of NK cells against pancreatic cancer cells that were coated with an antibody directed against the human tumor antigen, Mucin-1 designated HMFG-2, either alone or conjugated to CpG oligodeoxynucleotide (CpG ODN). Conjugated antibodies were tested for their ability to elicit ADCC in vitro and in vivo against pancreatic cancer cells. NK cells cultured in the presence of immobilized CpG ODN, HMFG-2 Ab, or CpG ODN-conjugated HMFG-2 Ab were able to up-regulate perforin similarly. Interestingly, a significant higher ADCC was observed when CpG ODN-conjugated HMFG-2-coated tumor cells were co-cultured with NK cells compared to unconjugated HMFG-2 Ab or CpG ODN alone. Moreover, MyD88-deficient NK cells can perform ADCC in vitro. Furthermore, intratumoral injections of CpG ODN-conjugated HMFG-2 induced a significant reduction in tumor burden in vivo in an established model of pancreatic tumor in nude mice compared to CpG ODN or the HMFG-2 alone. Depletion of macrophages or NK cells before treatment confirmed that both cells were required for the anti-tumor response in vivo. Results also suggest that CpG ODN and HMFG-2 Ab could be sensed by NK cells on the mAb-coated tumor cells triggering enhanced ADCC in vitro and in vivo.

  10. Intratumoral delivery of CpG-conjugated anti-MUC1 antibody enhances NK cell anti-tumor activity

    PubMed Central

    Schettini, Jorge; Kidiyoor, Amritha; Besmer, Dahlia M.; Tinder, Teresa L.; Roy, Lopamudra Das; Lustgarten, Joseph; Gendler, Sandra J.

    2013-01-01

    Monoclonal antibodies (mAbs) against tumor-associated antigens are useful anticancer agents. Antibody-dependent cellular cytotoxicity (ADCC) is one of the major mechanisms responsible for initiating natural killer cell (NK)-mediated killing of tumors. However, the regulation of ADCC via NK cells is poorly understood. We have investigated the cytolytic activity of NK cells against pancreatic cancer cells that were coated with an antibody directed against the human tumor antigen, Mucin-1 designated HMFG-2, either alone or conjugated to CpG oligodeoxynucleotide (CpG ODN). Conjugated antibodies were tested for their ability to elicit ADCC in vitro and in vivo against pancreatic cancer cells. NK cells cultured in the presence of immobilized CpG ODN, HMFG-2 Ab, or CpG ODN-conjugated HMFG-2 Ab were able to up-regulate perforin similarly. Interestingly, a significant higher ADCC was observed when CpG ODN-conjugated HMFG-2-coated tumor cells were co-cultured with NK cells compared to unconjugated HMFG-2 Ab or CpG ODN alone. Moreover, MyD88-deficient NK cells can perform ADCC in vitro. Furthermore, intratumoral injections of CpG ODN-conjugated HMFG-2 induced a significant reduction in tumor burden in vivo in an established model of pancreatic tumor in nude mice compared to CpG ODN or the HMFG-2 alone. Depletion of macrophages or NK cells before treatment confirmed that both cells were required for the anti-tumor response in vivo. Results also suggest that CpG ODN and HMFG-2 Ab could be sensed by NK cells on the mAb-coated tumor cells triggering enhanced ADCC in vitro and in vivo. PMID:22543528

  11. Cytosine-phosphate-guanine oligodeoxynucleotides containing GACGTT motifs enhance the immune responses elicited by keyhole limpet hemocyanin antigen in dairy cattle.

    PubMed

    Chu, Chun-Yen; Lee, Shang-Chun; Liu, Shyh-Shyan; Lin, Yu-Ming; Shen, Perng-Chi; Yu, Chi; Lee, Kuo-Hua; Zhao, Xin; Lee, Jai-Wei

    2011-10-01

    Adjuvants are important components of vaccine formulations. Effective adjuvants line innate and adaptive immunity by signaling through pathogen recognition receptors. Synthetic cytosine-phosphate-guanine (CpG) oligodeoxynucleotides (ODNs) have been shown to have potentials as adjuvants for vaccines. However, the immunostimulatory effect of CpG is species-specific and depends on the sequence of CpG motifs. A CpG ODN (2135), containing 3 identical copies of GTCGTT motif, was previously reported to have the strongest effects on bovine peripheral blood mononuclear cells (PBMC). Based on the sequence of 2135, we replaced the GTCGTT motif with 11 other sequences containing CG and investigated their effects on bovine lymphocyte proliferation. Results showed that the CpG ODNs containing 3 copies of GACGTT motif had the highest lymphocyte stimulation index (7.91±1.18), which was significantly (P<0.05) higher than that of 2135 (4.25±0.56). The CpG ODNs containing 3 copies of GACGTT motif also significantly increased the mRNA expression of interferon (IFN)-α, interleukin (IL)-12, and IL-21 in bovine PBMC. When dairy cows were immunized with the keyhole limpet hemocyanin (KLH) antigen formulated with CpG ODNs containing 3 copies of GACGTT, production of KLH-specific antibodies in serum and in milk whey was significantly (P<0.05) enhanced. IFN-γ in whole blood stimulated by KLH was also significantly (P<0.05) increased in cows immunized with KLH plus CpG ODNs. Our results indicate that CpG ODNs containing 3 copies of the GACGTT motifs is a potential adjuvant for bovine vaccines.

  12. Assessing the efficacy of Duddingtonia flagrans chlamydospores per gram of faeces to control Haemonchus contortus larvae.

    PubMed

    Ojeda-Robertos, Nadia Florencia; Torres-Acosta, Juan Felipe de Jesus; Aguilar-Caballero, Armando Jacinto; Ayala-Burgos, Armín; Cob-Galera, Ligia Amira; Sandoval-Castro, Carlos Alfredo; Barrientos-Medina, Roberto Carlos; de Gives, Pedro Mendoza

    2008-12-20

    The aims were (a) to quantify the number of Duddingtonia flagrans chlamydospores per gram of faeces (CPG) recovered from sheep administered with different oral doses and, (b) to describe the relationship between CPG and eggs per gram of faeces (EPG) on the efficacy to reduce Haemonchus contortus infective larvae. Three doses of chlamydospores per kg BW were orally administered during seven days: (T1) non treated control group, (T2) 1 x 10(6), (T3) 2.5 x 10(6) and (T4) 5 x 10(6). Three lambs, infected with H. contortus, were used per group. Faeces were obtained from the rectum of each lamb during the fungal administration period (days 0-6) and for six days after that period. Four coproculture replicates were made from each animal in days 2, 4, 6, 8 and 10. A higher chlamydospore dose produced higher CPG in faeces (p < 0.05), but a clear dose dependent effect was not found either in the larvae reduction or in the CPG:EPG ratio. When ratios were re-analyzed, independently of the treatment groups of origin, a better efficacy was obtained with a ratio from 5 to 10 CPG:EPG and a higher ratio (> 10 per egg) showed a lower reduction efficacy (p < 0.05). The binomial analysis showed that for each unit of increment in CPG:EPG ratio there was a reduction of larvae number until a point (between 5 and 10 CPG:EPG) where no further reduction was detected. The surface response test indicated that the number of larvae was reduced by CPG until possible saturation. The highest CPG:EPG ratios did not necessarily improve efficacy of D. flagrans.

  13. Flight and Walking in Locusts–Cholinergic Co-Activation, Temporal Coupling and Its Modulation by Biogenic Amines

    PubMed Central

    Rillich, Jan; Stevenson, Paul A.; Pflueger, Hans-Joachim

    2013-01-01

    Walking and flying in locusts are exemplary rhythmical behaviors generated by central pattern generators (CPG) that are tuned in intact animals by phasic sensory inputs. Although these two behaviors are mutually exclusive and controlled by independent CPGs, leg movements during flight can be coupled to the flight rhythm. To investigate potential central coupling between the underlying CPGs, we used the muscarinic agonist pilocarpine and the amines octopamine and tyramine to initiate fictive flight and walking in deafferented locust preparations. Our data illustrate that fictive walking is readily evoked by comparatively lower concentrations of pilocarpine, whereas higher concentrations are required to elicit fictive flight. Interestingly, fictive flight did not suppress fictive walking so that the two patterns were produced simultaneously. Frequently, leg motor units were temporally coupled to the flight rhythm, so that each spike in a step cycle volley occurred synchronously with wing motor units firing at flight rhythm frequency. Similarly, tyramine also induced fictive walking and flight, but mostly without any coupling between the two rhythms. Octopamine in contrast readily evoked fictive flight but generally failed to elicit fictive walking. Despite this, numerous leg motor units were recruited, whereby each was temporarily coupled to the flight rhythm. Our results support the notion that the CPGs for walking and flight are largely independent, but that coupling can be entrained by aminergic modulation. We speculate that octopamine biases the whole motor machinery of a locust to flight whereas tyramine primarily promotes walking. PMID:23671643

  14. Interaction of DRD4 Methylation and Phthalate Metabolites Affects Continuous Performance Test Performance in ADHD.

    PubMed

    Kim, Johanna Inhyang; Kim, Jae-Won; Shin, Inkyung; Kim, Bung-Nyun

    2018-05-01

    We investigated the interaction effect between the methylation of dopamine receptor D4 (DRD4) and phthalate exposure in ADHD on continuous performance test (CPT) variables. Urine concentrations of mono-(2-ethyl-5-hydroxyhexyl) phthalate (MEHHP), mono-(2-ethyl-5-oxohexyl) phthalate (MEOHP), and mono-n-butyl phthalate (MBP) were tested. The methylation status was analyzed for CpG sites of DRD4. Multivariable linear regression models were applied to investigate the interaction effects of methylation and phthalate levels. There was a significant interaction effect of the methylation of CpG26 and CpG28 with the MEHHP level on omission errors in ADHD patients, but not in controls. The post hoc analysis revealed a significant correlation between the MEHHP concentration and omission errors in the methylated group, but not in the unmethylated group. The interaction between the methylation status of CpG sites of DRD4, particularly CpG26 and CpG28, and phthalate metabolite levels affects the attention level in ADHD patients.

  15. The digastric muscle is less involved in pharyngeal swallowing in rabbits.

    PubMed

    Tsujimura, Takanori; Yamada, Aki; Nakamura, Yuki; Fukuhara, Takako; Yamamura, Kensuke; Inoue, Makoto

    2012-06-01

    The swallowing reflex is centrally programmed by the lower brain stem, the so-called swallowing central pattern generator (CPG), and once the reflex is initiated, many muscles in the oral, pharyngeal, laryngeal, and esophageal regions are systematically activated. The mylohyoid (MH) muscle has been considered to be a "leading muscle" according to previous studies, but the functional role of the digastric (DIG) muscle in the swallowing reflex remains unclear. In the present study, therefore, the activities of single units of MH and DIG neurons were recorded extracellularly, and the functional involvement of these neurons in the swallowing reflex was investigated. The experiments were carried out on eight adult male Japanese white rabbits anesthetized with urethane. To identify DIG and MH neurons, the peripheral nerve (either DIG or MH) was stimulated to evoke action potentials of single motoneurons. Motoneurons were identified as such if they either (1) responded to antidromic nerve stimulation of DIG or MH in an all-or-none manner at threshold intensities and (2) followed stimulation frequencies of up to 0.5 kHz. As a result, all 11 MH neurons recorded were synchronously activated during the swallowing reflex, while there was no activity in any of the 7 DIG neurons recorded during the swallowing reflex. All neurons were anatomically localized ventromedially at the level of the caudal portion of the trigeminal motor nucleus, and there were no differences between the MH and DIG neuron sites. The present results strongly suggest that at least in the rabbit, DIG motoneurons are not tightly controlled by the swallowing CPG and, hence, the DIG muscle is less involved in the swallowing reflex.

  16. DNA motifs associated with aberrant CpG island methylation.

    PubMed

    Feltus, F Alex; Lee, Eva K; Costello, Joseph F; Plass, Christoph; Vertino, Paula M

    2006-05-01

    Epigenetic silencing involving the aberrant methylation of promoter region CpG islands is widely recognized as a tumor suppressor silencing mechanism in cancer. However, the molecular pathways underlying aberrant DNA methylation remain elusive. Recently we showed that, on a genome-wide level, CpG island loci differ in their intrinsic susceptibility to aberrant methylation and that this susceptibility can be predicted based on underlying sequence context. These data suggest that there are sequence/structural features that contribute to the protection from or susceptibility to aberrant methylation. Here we use motif elicitation coupled with classification techniques to identify DNA sequence motifs that selectively define methylation-prone or methylation-resistant CpG islands. Motifs common to 28 methylation-prone or 47 methylation-resistant CpG island-containing genomic fragments were determined using the MEME and MAST algorithms (). The five most discriminatory motifs derived from methylation-prone sequences were found to be associated with CpG islands in general and were nonrandomly distributed throughout the genome. In contrast, the eight most discriminatory motifs derived from the methylation-resistant CpG islands were randomly distributed throughout the genome. Interestingly, this latter group tended to associate with Alu and other repetitive sequences. Used together, the frequency of occurrence of these motifs successfully discriminated methylation-prone and methylation-resistant CpG island groups with an accuracy of 87% after 10-fold cross-validation. The motifs identified here are candidate methylation-targeting or methylation-protection DNA sequences.

  17. EG-13GENOME-WIDE METHYLATION ANALYSIS IDENTIFIES GENOMIC DNA DEMETHYLATION DURING MALIGNANT PROGRESSION OF GLIOMAS

    PubMed Central

    Saito, Kuniaki; Mukasa, Akitake; Nagae, Genta; Aihara, Koki; Otani, Ryohei; Takayanagi, Shunsaku; Omata, Mayu; Tanaka, Shota; Shibahara, Junji; Takahashi, Miwako; Momose, Toshimitsu; Shimamura, Teppei; Miyano, Satoru; Narita, Yoshitaka; Ueki, Keisuke; Nishikawa, Ryo; Nagane, Motoo; Aburatani, Hiroyuki; Saito, Nobuhito

    2014-01-01

    Low-grade gliomas often undergo malignant progression, and these transformations are a leading cause of death in patients with low-grade gliomas. However, the molecular mechanisms underlying malignant tumor progression are still not well understood. Recent evidence indicates that epigenetic deregulation is an important cause of gliomagenesis; therefore, we examined the impact of epigenetic changes during malignant progression of low-grade gliomas. Specifically, we used the Illumina Infinium Human Methylation 450K BeadChip to perform genome-wide DNA methylation analysis of 120 gliomas and four normal brains. This study sample included 25 matched-pairs of initial low-grade gliomas and recurrent tumors (temporal heterogeneity) and 20 of the 25 recurring tumors recurred as malignant progressions, and one matched-pair of newly emerging malignant lesions and pre-existing lesions (spatial heterogeneity). Analyses of methylation profiles demonstrated that most low-grade gliomas in our sample (43/51; 84%) had a CpG island methylator phenotype (G-CIMP). Remarkably, approximately 50% of secondary glioblastomas that had progressed from low-grade tumors with the G-CIMP status exhibited a characteristic partial demethylation of genomic DNA during malignant progression, but other recurrent gliomas showed no apparent change in DNA methylation pattern. Interestingly, we found that most loci that were demethylated during malignant progression were located outside of CpG islands. The information of histone modifications patterns in normal human astrocytes and embryonal stem cells also showed that the ratio of active marks at the site corresponding to DNA demethylated loci in G-CIMP-demethylated tumors was significantly lower; this finding indicated that most demethylated loci in G-CIMP-demethylated tumors were likely transcriptionally inactive. A small number of the genes that were upregulated and had demethylated CpG islands were associated with cell cycle-related pathway. In summary, we demonstrated that characteristic DNA demethylation occurred during malignant progression of a subset of low-grade gliomas. The mechanisms underlying and consequences of such DNA demethylation should be studied further.

  18. Computationally expanding infinium HumanMethylation450 BeadChip array data to reveal distinct DNA methylation patterns of rheumatoid arthritis

    PubMed Central

    Li, Chengzhe; Ai, Rizi; Wang, Mengchi; Firestein, Gary S.; Wang, Wei

    2016-01-01

    Motivation: DNA methylation signatures in rheumatoid arthritis (RA) have been identified in fibroblast-like synoviocytes (FLS) with Illumina HumanMethylation450 array. Since <2% of CpG sites are covered by the Illumina 450K array and whole genome bisulfite sequencing is still too expensive for many samples, computationally predicting DNA methylation levels based on 450K data would be valuable to discover more RA-related genes. Results: We developed a computational model that is trained on 14 tissues with both whole genome bisulfite sequencing and 450K array data. This model integrates information derived from the similarity of local methylation pattern between tissues, the methylation information of flanking CpG sites and the methylation tendency of flanking DNA sequences. The predicted and measured methylation values were highly correlated with a Pearson correlation coefficient of 0.9 in leave-one-tissue-out cross-validations. Importantly, the majority (76%) of the top 10% differentially methylated loci among the 14 tissues was correctly detected using the predicted methylation values. Applying this model to 450K data of RA, osteoarthritis and normal FLS, we successfully expanded the coverage of CpG sites 18.5-fold and accounts for about 30% of all the CpGs in the human genome. By integrative omics study, we identified genes and pathways tightly related to RA pathogenesis, among which 12 genes were supported by triple evidences, including 6 genes already known to perform specific roles in RA and 6 genes as new potential therapeutic targets. Availability and implementation: The source code, required data for prediction, and demo data for test are freely available at: http://wanglab.ucsd.edu/star/LR450K/. Contact: wei-wang@ucsd.edu or gfirestein@ucsd.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:26883487

  19. Targeted and genome-scale methylomics reveals gene body signatures in human cell lines

    PubMed Central

    Ball, Madeleine Price; Li, Jin Billy; Gao, Yuan; Lee, Je-Hyuk; LeProust, Emily; Park, In-Hyun; Xie, Bin; Daley, George Q.; Church, George M.

    2012-01-01

    Cytosine methylation, an epigenetic modification of DNA, is a target of growing interest for developing high throughput profiling technologies. Here we introduce two new, complementary techniques for cytosine methylation profiling utilizing next generation sequencing technology: bisulfite padlock probes (BSPPs) and methyl sensitive cut counting (MSCC). In the first method, we designed a set of ~10,000 BSPPs distributed over the ENCODE pilot project regions to take advantage of existing expression and chromatin immunoprecipitation data. We observed a pattern of low promoter methylation coupled with high gene body methylation in highly expressed genes. Using the second method, MSCC, we gathered genome-scale data for 1.4 million HpaII sites and confirmed that gene body methylation in highly expressed genes is a consistent phenomenon over the entire genome. Our observations highlight the usefulness of techniques which are not inherently or intentionally biased in favor of only profiling particular subsets like CpG islands or promoter regions. PMID:19329998

  20. Associative Learning in Invertebrates

    PubMed Central

    Hawkins, Robert D.; Byrne, John H.

    2015-01-01

    This work reviews research on neural mechanisms of two types of associative learning in the marine mollusk Aplysia, classical conditioning of the gill- and siphon-withdrawal reflex and operant conditioning of feeding behavior. Basic classical conditioning is caused in part by activity-dependent facilitation at sensory neuron–motor neuron (SN–MN) synapses and involves a hybrid combination of activity-dependent presynaptic facilitation and Hebbian potentiation, which are coordinated by trans-synaptic signaling. Classical conditioning also shows several higher-order features, which might be explained by the known circuit connections in Aplysia. Operant conditioning is caused in part by a different type of mechanism, an intrinsic increase in excitability of an identified neuron in the central pattern generator (CPG) for feeding. However, for both classical and operant conditioning, adenylyl cyclase is a molecular site of convergence of the two signals that are associated. Learning in other invertebrate preparations also involves many of the same mechanisms, which may contribute to learning in vertebrates as well. PMID:25877219

  1. Intrinsic neuromodulation in the Tritonia swim CPG: serotonin mediates both neuromodulation and neurotransmission by the dorsal swim interneurons.

    PubMed

    Katz, P S; Frost, W N

    1995-12-01

    1. Neuromodulation has previously been shown to be intrinsic to the central pattern generator (CPG) circuit that generates the escape swim of the nudibranch mollusk Tritonia diomedea; the dorsal swim interneurons (DSIs) make conventional monosynaptic connections and evoke neuromodulatory effects within the swim motor circuit. The conventional synaptic potentials evoked by a DSI onto cerebral neuron 2 (C2) and onto the dorsal flexion neurons (DFNs) consist of a fast excitatory postsynaptic potential (EPSP) followed by a prolonged slow EPSP. In their neuromodulatory role, the DSIs produce an enhancement of the monosynaptic connections made by C2 onto other CPG circuit interneurons and onto efferent flexion neurons. Previous work showed that the DSIs are immunoreactive for serotonin. Here we provide evidence that both the neurotransmission and the neuromodulation evoked by the DSIs are produced by serotonin, and that these effects may be pharmacologically separable. 2. Previously it was shown that bath-applied serotonin both mimics and occludes the modulation of the C2 synapses by the DSIs. Here we find that pressure-applied puffs of serotonin mimic both the fast and slow EPSPs evoked by a DSI onto a DFN, whereas high concentrations of bath-applied serotonin occlude both of these synaptic components. 3. Consistent with the hypothesis that serotonin mediates the actions of the DSIs, the serotonin reuptake inhibitor imipramine prolongs the duration of the fast DSI-DFN EPSP, increases the amplitude of the slow DSI-DFN EPSP, and increases both the amplitude and duration of the modulation of the C2-DFN synapse by the DSIs. 4. Two serotonergic antagonists were found that block the actions of the DSIs. Gramine blocks the fast DSI-DFN EPSP, and has far less of an effect on the slow EPSP and the modulation. Gramine also diminishes the depolarization evoked by pressure-applied serotonin, showing that it is a serotonin antagonist in this system. In contrast, methysergide greatly reduces both the slow EPSP and the modulation evoked by the DSIs, but has mixed effects on the fast EPSP. Methysergide also blocks the ability of exogenous serotonin to enhance the C2-DFN EPSP, demonstrating that it antagonizes the serotonin receptors responsible for this modulation. 5. Taken together with previous work, these results indicate that serotonin is likely to be responsible for all three actions of the DSIs that were examined: the fast and slow DSI-DFN EPSPs and the neuromodulation of the C2-DFN synapse. These results also indicate that the conventional and neuromodulatory effects of the DSIs may be pharmacologically separable. In future work it may be possible to determine the functional role of each in the swim circuit.

  2. Distributed recurrent neural forward models with synaptic adaptation and CPG-based control for complex behaviors of walking robots

    PubMed Central

    Dasgupta, Sakyasingha; Goldschmidt, Dennis; Wörgötter, Florentin; Manoonpong, Poramate

    2015-01-01

    Walking animals, like stick insects, cockroaches or ants, demonstrate a fascinating range of locomotive abilities and complex behaviors. The locomotive behaviors can consist of a variety of walking patterns along with adaptation that allow the animals to deal with changes in environmental conditions, like uneven terrains, gaps, obstacles etc. Biological study has revealed that such complex behaviors are a result of a combination of biomechanics and neural mechanism thus representing the true nature of embodied interactions. While the biomechanics helps maintain flexibility and sustain a variety of movements, the neural mechanisms generate movements while making appropriate predictions crucial for achieving adaptation. Such predictions or planning ahead can be achieved by way of internal models that are grounded in the overall behavior of the animal. Inspired by these findings, we present here, an artificial bio-inspired walking system which effectively combines biomechanics (in terms of the body and leg structures) with the underlying neural mechanisms. The neural mechanisms consist of (1) central pattern generator based control for generating basic rhythmic patterns and coordinated movements, (2) distributed (at each leg) recurrent neural network based adaptive forward models with efference copies as internal models for sensory predictions and instantaneous state estimations, and (3) searching and elevation control for adapting the movement of an individual leg to deal with different environmental conditions. Using simulations we show that this bio-inspired approach with adaptive internal models allows the walking robot to perform complex locomotive behaviors as observed in insects, including walking on undulated terrains, crossing large gaps, leg damage adaptations, as well as climbing over high obstacles. Furthermore, we demonstrate that the newly developed recurrent network based approach to online forward models outperforms the adaptive neuron forward models, which have hitherto been the state of the art, to model a subset of similar walking behaviors in walking robots. PMID:26441629

  3. Orphan and gene related CpG Islands follow power-law-like distributions in several genomes: evidence of function-related and taxonomy-related modes of distribution.

    PubMed

    Tsiagkas, Giannis; Nikolaou, Christoforos; Almirantis, Yannis

    2014-12-01

    CpG Islands (CGIs) are compositionally defined short genomic stretches, which have been studied in the human, mouse, chicken and later in several other genomes. Initially, they were assigned the role of transcriptional regulation of protein-coding genes, especially the house-keeping ones, while more recently there is found evidence that they are involved in several other functions as well, which might include regulation of the expression of RNA genes, DNA replication etc. Here, an investigation of their distributional characteristics in a variety of genomes is undertaken for both whole CGI populations as well as for CGI subsets that lie away from known genes (gene-unrelated or "orphan" CGIs). In both cases power-law-like linearity in double logarithmic scale is found. An evolutionary model, initially put forward for the explanation of a similar pattern found in gene populations is implemented. It includes segmental duplication events and eliminations of most of the duplicated CGIs, while a moderate rate of non-duplicated CGI eliminations is also applied in some cases. Simulations reproduce all the main features of the observed inter-CGI chromosomal size distributions. Our results on power-law-like linearity found in orphan CGI populations suggest that the observed distributional pattern is independent of the analogous pattern that protein coding segments were reported to follow. The power-law-like patterns in the genomic distributions of CGIs described herein are found to be compatible with several other features of the composition, abundance or functional role of CGIs reported in the current literature across several genomes, on the basis of the proposed evolutionary model. Copyright © 2014 Elsevier Ltd. All rights reserved.

  4. 75 FR 13555 - Compliance Policy Guide Sec. 540.375 Canned Salmon - Adulteration Involving Decomposition (CPG...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-03-22

    ...] (Formerly Docket No. 1998N-0046) Compliance Policy Guide Sec. 540.375 Canned Salmon -- Adulteration... of Compliance Policy Guide Sec. 540.375 Canned Salmon -- Adulteration Involving Decomposition (CPG... relating to decomposition in fish and fishery products, including canned salmon, is provided in CPG Sec...

  5. Distinct Effects of Monophosphoryl Lipid A, Oligodeoxynucleotide CpG, and Combination Adjuvants on Modulating Innate and Adaptive Immune Responses to Influenza Vaccination.

    PubMed

    Ko, Eun-Ju; Lee, Young-Tae; Lee, Youri; Kim, Ki-Hye; Kang, Sang-Moo

    2017-10-01

    Monophosphoryl lipid A (MPL) and oligodeoxynucleotide CpG are toll-like receptor (TLR) 4 and 9 agonist, respectively. Here, we investigated the effects of MPL, CpG, and combination adjuvants on stimulating in vitro dendritic cells (DCs), in vivo innate and adaptive immune responses, and protective efficacy of influenza vaccination. Combination of MPL and CpG was found to exhibit distinct effects on stimulating DCs in vitro to secrete IL-12p70 and tumor necrosis factor (TNF)-α and proliferate allogeneic CD8 T cells. Prime immunization of mice with inactivated split influenza vaccine in the presence of low dose MPL+CpG adjuvants increased the induction of virus-specific IgG and IgG2a isotype antibodies. MPL and CpG adjuvants contribute to improving the efficacy of prime influenza vaccination against lethal influenza challenge as determined by body weight monitoring, lung function, viral titers, and histology. A combination of MPL and CpG adjuvants was effective in improving vaccine efficacy as well as in reducing inflammatory immune responses locally and in inducing cellular immune responses upon lethal influenza virus challenge. This study demonstrates unique adjuvant effects of MPL, CpG, and combination adjuvants on modulating innate and adaptive immune responses to influenza prime vaccination.

  6. Role of Replication and CpG Methylation in Fragile X Syndrome CGG Deletions in Primate Cells

    PubMed Central

    Nichol Edamura, Kerrie; Leonard, Michelle R.; Pearson, Christopher E.

    2005-01-01

    Instability of the fragile X CGG repeat involves both maternally derived expansions and deletions in the gametes of full-mutation males. It has also been suggested that the absence of aberrant CpG methylation may enhance repeat deletions through an unknown process. The effect of CGG tract length, DNA replication direction, location of replication initiation, and CpG methylation upon CGG stability were investigated using an SV40 primate replication system. Replication-dependant deletions with 53 CGG repeats were observed when replication was initiated proximal to the repeat, with CGG as the lagging-strand template. When we initiated replication further from the repeat, while maintaining CGG as the lagging-strand template or using CCG as the lagging-strand template, significant instability was not observed. CpG methylation of the unstable template stabilized the repeat, decreasing both the frequency and the magnitude of deletion events. Furthermore, CpG methylation slowed the efficiency of replication for all templates. Interestingly, replication forks displayed no evidence of a block at the CGG repeat tract, regardless of replication direction or CpG methylation status. Templates with 20 CGG repeats were stable under all circumstances. These results reveal that CGG deletions occur during replication and are sensitive to replication-fork dynamics, tract length, and CpG methylation. PMID:15625623

  7. CpG oligodeoxynucleotides augment the murine immune response to the Yersinia pestis F1-V vaccine in bubonic and pneumonic models of plague.

    PubMed

    Amemiya, Kei; Meyers, Jennifer L; Rogers, Taralyn E; Fast, Randy L; Bassett, Anthony D; Worsham, Patricia L; Powell, Bradford S; Norris, Sarah L; Krieg, Arthur M; Adamovicz, Jeffrey J

    2009-04-06

    The current U.S. Department of Defense candidate plague vaccine is a fusion between two Yersinia pestis proteins: the F1 capsular protein, and the low calcium response (Lcr) V-protein. We hypothesized that an immunomodulator, such as CpG oligodeoxynucleotide (ODN)s, could augment the immune response to the plague F1-V vaccine in a mouse model for plague. CpG ODNs significantly augmented the antibody response and efficacy of a single dose of the plague vaccine in murine bubonic and pneumonic models of plague. In the latter study, we also found an overall significant augmentation the immune response to the individual subunits of the plague vaccine by CpG ODN 2006. In a long-term, prime-boost study, CpG ODN induced a significant early augmentation of the IgG response to the vaccine. The presence of CpG ODN induced a significant increase in the IgG2a subclass response to the vaccine up to 5 months after the boost. Our studies showed that CpG ODNs significantly augmented the IgG antibody response to the plague vaccine, which increased the probability of survival in murine models of plague (P<0.0001).

  8. A UML approach to process modelling of clinical practice guidelines for enactment.

    PubMed

    Knape, T; Hederman, L; Wade, V P; Gargan, M; Harris, C; Rahman, Y

    2003-01-01

    Although clinical practice guidelines (CPGs) have been suggested as a means of encapsulating best practice in evidence-based medical treatment, their usage in clinical environments has been disappointing. Criticisms of guideline representations have been that they are predominantly narrative and are difficult to incorporate into clinical information systems. This paper analyses the use of UML process modelling techniques for guideline representation and proposes the automated generation of executable guidelines using XMI. This hybrid UML-XMI approach provides flexible authoring of guideline decision and control structures whilst integrating appropriate data flow. It also uses an open XMI standard interface to allow the use of authoring tools and process control systems from multiple vendors. The paper first surveys CPG modelling formalisms followed by a brief introduction to process modelling in UMI. Furthermore, the modelling of CPGs in UML is presented leading to a case study of encoding a diabetes mellitus CPG using UML.

  9. Integrated Multiregional Analysis Proposing a New Model of Colorectal Cancer Evolution.

    PubMed

    Uchi, Ryutaro; Takahashi, Yusuke; Niida, Atsushi; Shimamura, Teppei; Hirata, Hidenari; Sugimachi, Keishi; Sawada, Genta; Iwaya, Takeshi; Kurashige, Junji; Shinden, Yoshiaki; Iguchi, Tomohiro; Eguchi, Hidetoshi; Chiba, Kenichi; Shiraishi, Yuichi; Nagae, Genta; Yoshida, Kenichi; Nagata, Yasunobu; Haeno, Hiroshi; Yamamoto, Hirofumi; Ishii, Hideshi; Doki, Yuichiro; Iinuma, Hisae; Sasaki, Shin; Nagayama, Satoshi; Yamada, Kazutaka; Yachida, Shinichi; Kato, Mamoru; Shibata, Tatsuhiro; Oki, Eiji; Saeki, Hiroshi; Shirabe, Ken; Oda, Yoshinao; Maehara, Yoshihiko; Komune, Shizuo; Mori, Masaki; Suzuki, Yutaka; Yamamoto, Ken; Aburatani, Hiroyuki; Ogawa, Seishi; Miyano, Satoru; Mimori, Koshi

    2016-02-01

    Understanding intratumor heterogeneity is clinically important because it could cause therapeutic failure by fostering evolutionary adaptation. To this end, we profiled the genome and epigenome in multiple regions within each of nine colorectal tumors. Extensive intertumor heterogeneity is observed, from which we inferred the evolutionary history of the tumors. First, clonally shared alterations appeared, in which C>T transitions at CpG site and CpG island hypermethylation were relatively enriched. Correlation between mutation counts and patients' ages suggests that the early-acquired alterations resulted from aging. In the late phase, a parental clone was branched into numerous subclones. Known driver alterations were observed frequently in the early-acquired alterations, but rarely in the late-acquired alterations. Consistently, our computational simulation of the branching evolution suggests that extensive intratumor heterogeneity could be generated by neutral evolution. Collectively, we propose a new model of colorectal cancer evolution, which is useful for understanding and confronting this heterogeneous disease.

  10. Towards symbiosis in knowledge representation and natural language processing for structuring clinical practice guidelines.

    PubMed

    Weng, Chunhua; Payne, Philip R O; Velez, Mark; Johnson, Stephen B; Bakken, Suzanne

    2014-01-01

    The successful adoption by clinicians of evidence-based clinical practice guidelines (CPGs) contained in clinical information systems requires efficient translation of free-text guidelines into computable formats. Natural language processing (NLP) has the potential to improve the efficiency of such translation. However, it is laborious to develop NLP to structure free-text CPGs using existing formal knowledge representations (KR). In response to this challenge, this vision paper discusses the value and feasibility of supporting symbiosis in text-based knowledge acquisition (KA) and KR. We compare two ontologies: (1) an ontology manually created by domain experts for CPG eligibility criteria and (2) an upper-level ontology derived from a semantic pattern-based approach for automatic KA from CPG eligibility criteria text. Then we discuss the strengths and limitations of interweaving KA and NLP for KR purposes and important considerations for achieving the symbiosis of KR and NLP for structuring CPGs to achieve evidence-based clinical practice.

  11. Sex differences in DNA methylation and expression in zebrafish brain: a test of an extended 'male sex drive' hypothesis.

    PubMed

    Chatterjee, Aniruddha; Lagisz, Malgorzata; Rodger, Euan J; Zhen, Li; Stockwell, Peter A; Duncan, Elizabeth J; Horsfield, Julia A; Jeyakani, Justin; Mathavan, Sinnakaruppan; Ozaki, Yuichi; Nakagawa, Shinichi

    2016-09-30

    The sex drive hypothesis predicts that stronger selection on male traits has resulted in masculinization of the genome. Here we test whether such masculinizing effects can be detected at the level of the transcriptome and methylome in the adult zebrafish brain. Although methylation is globally similar, we identified 914 specific differentially methylated CpGs (DMCs) between males and females (435 were hypermethylated and 479 were hypomethylated in males compared to females). These DMCs were prevalent in gene body, intergenic regions and CpG island shores. We also discovered 15 distinct CpG clusters with striking sex-specific DNA methylation differences. In contrast, at transcriptome level, more female-biased genes than male-biased genes were expressed, giving little support for the male sex drive hypothesis. Our study provides genome-wide methylome and transcriptome assessment and sheds light on sex-specific epigenetic patterns and in zebrafish for the first time. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Whole-genome fingerprint of the DNA methylome during human B cell differentiation.

    PubMed

    Kulis, Marta; Merkel, Angelika; Heath, Simon; Queirós, Ana C; Schuyler, Ronald P; Castellano, Giancarlo; Beekman, Renée; Raineri, Emanuele; Esteve, Anna; Clot, Guillem; Verdaguer-Dot, Néria; Duran-Ferrer, Martí; Russiñol, Nuria; Vilarrasa-Blasi, Roser; Ecker, Simone; Pancaldi, Vera; Rico, Daniel; Agueda, Lidia; Blanc, Julie; Richardson, David; Clarke, Laura; Datta, Avik; Pascual, Marien; Agirre, Xabier; Prosper, Felipe; Alignani, Diego; Paiva, Bruno; Caron, Gersende; Fest, Thierry; Muench, Marcus O; Fomin, Marina E; Lee, Seung-Tae; Wiemels, Joseph L; Valencia, Alfonso; Gut, Marta; Flicek, Paul; Stunnenberg, Hendrik G; Siebert, Reiner; Küppers, Ralf; Gut, Ivo G; Campo, Elías; Martín-Subero, José I

    2015-07-01

    We analyzed the DNA methylome of ten subpopulations spanning the entire B cell differentiation program by whole-genome bisulfite sequencing and high-density microarrays. We observed that non-CpG methylation disappeared upon B cell commitment, whereas CpG methylation changed extensively during B cell maturation, showing an accumulative pattern and affecting around 30% of all measured CpG sites. Early differentiation stages mainly displayed enhancer demethylation, which was associated with upregulation of key B cell transcription factors and affected multiple genes involved in B cell biology. Late differentiation stages, in contrast, showed extensive demethylation of heterochromatin and methylation gain at Polycomb-repressed areas, and genes with apparent functional impact in B cells were not affected. This signature, which has previously been linked to aging and cancer, was particularly widespread in mature cells with an extended lifespan. Comparing B cell neoplasms with their normal counterparts, we determined that they frequently acquire methylation changes in regions already undergoing dynamic methylation during normal B cell differentiation.

  13. Identification of methylation haplotype blocks aids in deconvolution of heterogeneous tissue samples and tumor tissue-of-origin mapping from plasma DNA.

    PubMed

    Guo, Shicheng; Diep, Dinh; Plongthongkum, Nongluk; Fung, Ho-Lim; Zhang, Kang; Zhang, Kun

    2017-04-01

    Adjacent CpG sites in mammalian genomes can be co-methylated owing to the processivity of methyltransferases or demethylases, yet discordant methylation patterns have also been observed, which are related to stochastic or uncoordinated molecular processes. We focused on a systematic search and investigation of regions in the full human genome that show highly coordinated methylation. We defined 147,888 blocks of tightly coupled CpG sites, called methylation haplotype blocks, after analysis of 61 whole-genome bisulfite sequencing data sets and validation with 101 reduced-representation bisulfite sequencing data sets and 637 methylation array data sets. Using a metric called methylation haplotype load, we performed tissue-specific methylation analysis at the block level. Subsets of informative blocks were further identified for deconvolution of heterogeneous samples. Finally, using methylation haplotypes we demonstrated quantitative estimation of tumor load and tissue-of-origin mapping in the circulating cell-free DNA of 59 patients with lung or colorectal cancer.

  14. The impact of methylation quantitative trait loci (mQTLs) on active smoking-related DNA methylation changes.

    PubMed

    Gao, Xu; Thomsen, Hauke; Zhang, Yan; Breitling, Lutz Philipp; Brenner, Hermann

    2017-01-01

    Methylation quantitative trait loci (mQTLs) are the genetic variants that may affect the DNA methylation patterns of CpG sites. However, their roles in influencing the disturbances of smoking-related epigenetic changes have not been well established. This study was conducted to address whether mQTLs exist in the vicinity of smoking-related CpG sites (± 50 kb) and to examine their associations with smoking exposure and all-cause mortality in older adults. We obtained DNA methylation profiles in whole blood samples by Illumina Infinium Human Methylation 450 BeadChip array of two independent subsamples of the ESTHER study (discovery set, n  = 581; validation set, n  = 368) and their corresponding genotyping data using the Illumina Infinium OncoArray BeadChip. After correction for multiple testing (FDR), we successfully identified that 70 out of 151 previously reported smoking-related CpG sites were significantly associated with 192 SNPs within the 50 kb search window of each locus. The 192 mQTLs significantly influenced the active smoking-related DNA methylation changes, with percentage changes ranging from 0.01 to 18.96%, especially for the weakly/moderately smoking-related CpG sites. However, these identified mQTLs were not directly associated with active smoking exposure or all-cause mortality. Our findings clearly demonstrated that if not dealt with properly, the mQTLs might impair the power of epigenetic-based models of smoking exposure to a certain extent. In addition, such genetic variants could be the key factor to distinguish between the heritable and smoking-induced impact on epigenome disparities. These mQTLs are of special importance when DNA methylation markers measured by Illumina Infinium assay are used for any comparative population studies related to smoking-related cancers and chronic diseases.

  15. Modification of Epigenetic Patterns in Low Birth Weight Children: Importance of Hypomethylation of the ACE Gene Promoter

    PubMed Central

    Rangel, Marina; dos Santos, Jéssica Cassilla; Ortiz, Paula Helena Lima; Hirata, Mario; Jasiulionis, Miriam Galvonas; Araujo, Ronaldo C.; Ierardi, Daniela Filippini; Franco, Maria do Carmo

    2014-01-01

    There is a growing body of evidence that epigenetic alterations are involved in the pathological mechanisms of many chronic disorders linked to fetal programming. Angiotensin-converting enzyme (ACE) appears as one candidate gene that brings new insights into the epigenetic control and later development of diseases. In this view, we have postulated that epigenetic modifications in the ACE gene might show different interactions between birth weight (BW), blood pressure levels, plasma ACE activity and ACE I/D polymorphism. To explore this hypothesis, we performed a cross-sectional study to evaluate the DNA methylation of 3 CpG sites using pyrosequencing within the ACE gene promoter of peripheral blood leukocytes from 45 LBW children compared with 70 NBW children. Our results have revealed that LBW children have lower methylation levels (P<0.001) in parallel with a higher ACE activity (P = 0.001). Adjusting for prematurity, gender, age, body mass index, and family history of cardiovascular disease did not alter these findings. We have also performed analyses of individual CpG sites. The frequency of DNA methylation was significantly different at two CpG sites (site 1: nucleotide position +555; and site 3: nucleotide position +563). In addition, we have found a significant inverse correlation between degree of DNA methylation and both ACE activity (P<0.001) and systolic blood pressure levels (P<0.001). We also observed that the methylation level was significantly lower in LBW children who are carriers of the DD genotype compared to NBW children with DD genotype (P<0.024). In conclusion, we are able to demonstrate that the hypomethylation in the 3 CpG sites of ACE gene promoter is associated with LBW in 6 to 12 year-old children. The magnitude of these epigenetic changes appears to be clinically important, which is supported by the observation that discrete changes in DNA methylation can affect systolic blood pressure and ACE protein activity levels. PMID:25170764

  16. Modification of epigenetic patterns in low birth weight children: importance of hypomethylation of the ACE gene promoter.

    PubMed

    Rangel, Marina; dos Santos, Jéssica Cassilla; Ortiz, Paula Helena Lima; Hirata, Mario; Jasiulionis, Miriam Galvonas; Araujo, Ronaldo C; Ierardi, Daniela Filippini; Franco, Maria do Carmo

    2014-01-01

    There is a growing body of evidence that epigenetic alterations are involved in the pathological mechanisms of many chronic disorders linked to fetal programming. Angiotensin-converting enzyme (ACE) appears as one candidate gene that brings new insights into the epigenetic control and later development of diseases. In this view, we have postulated that epigenetic modifications in the ACE gene might show different interactions between birth weight (BW), blood pressure levels, plasma ACE activity and ACE I/D polymorphism. To explore this hypothesis, we performed a cross-sectional study to evaluate the DNA methylation of 3 CpG sites using pyrosequencing within the ACE gene promoter of peripheral blood leukocytes from 45 LBW children compared with 70 NBW children. Our results have revealed that LBW children have lower methylation levels (P<0.001) in parallel with a higher ACE activity (P = 0.001). Adjusting for prematurity, gender, age, body mass index, and family history of cardiovascular disease did not alter these findings. We have also performed analyses of individual CpG sites. The frequency of DNA methylation was significantly different at two CpG sites (site 1: nucleotide position +555; and site 3: nucleotide position +563). In addition, we have found a significant inverse correlation between degree of DNA methylation and both ACE activity (P<0.001) and systolic blood pressure levels (P<0.001). We also observed that the methylation level was significantly lower in LBW children who are carriers of the DD genotype compared to NBW children with DD genotype (P<0.024). In conclusion, we are able to demonstrate that the hypomethylation in the 3 CpG sites of ACE gene promoter is associated with LBW in 6 to 12 year-old children. The magnitude of these epigenetic changes appears to be clinically important, which is supported by the observation that discrete changes in DNA methylation can affect systolic blood pressure and ACE protein activity levels.

  17. Whole Genome DNA Methylation Analysis of Obstructive Sleep Apnea: IL1R2, NPR2, AR, SP140 Methylation and Clinical Phenotype.

    PubMed

    Chen, Yung-Che; Chen, Ting-Wen; Su, Mao-Chang; Chen, Chung-Jen; Chen, Kuang-Den; Liou, Chia-Wei; Tang, Petrus; Wang, Ting-Ya; Chang, Jen-Chieh; Wang, Chin-Chou; Lin, Hsin-Ching; Chin, Chien-Hung; Huang, Kuo-Tung; Lin, Meng-Chih; Hsiao, Chang-Chun

    2016-04-01

    We hypothesized that DNA methylation patterns may contribute to disease severity or the development of hypertension and excessive daytime sleepiness (EDS) in patients with obstructive sleep apnea (OSA). Illumina's (San Diego, CA, USA) DNA methylation 27-K assay was used to identify differentially methylated loci (DML). DNA methylation levels were validated by pyrosequencing. A discovery cohort of 15 patients with OSA and 6 healthy subjects, and a validation cohort of 72 patients with sleep disordered breathing (SDB). Microarray analysis identified 636 DMLs in patients with OSA versus healthy subjects, and 327 DMLs in patients with OSA and hypertension versus those without hypertension. In the validation cohort, no significant difference in DNA methylation levels of six selected genes was found between the primary snoring subjects and OSA patients (primary outcome). However, a secondary outcome analysis showed that interleukin-1 receptor 2 (IL1R2) promoter methylation (-114 cytosine followed by guanine dinucleotide sequence [CpG] site) was decreased and IL1R2 protein levels were increased in the patients with SDB with an oxygen desaturation index > 30. Androgen receptor (AR) promoter methylation (-531 CpG site) and AR protein levels were both increased in the patients with SDB with an oxygen desaturation index > 30. Natriuretic peptide receptor 2 (NPR2) promoter methylation (-608/-618 CpG sites) were decreased, whereas levels of both NPR2 and serum C type natriuretic peptide protein were increased in the SDB patients with EDS. Speckled protein 140 (SP140) promoter methylation (-194 CpG site) was increased, and SP140 protein levels were decreased in the patients with SDB and EDS. IL1R2 hypomethylation and AR hypermethylation may constitute an important determinant of disease severity, whereas NPR2 hypomethylation and SP140 hypermethylation may provide a biomarker for vulnerability to EDS in OSA. A commentary on this article appears in this issue on page 723. © 2016 Associated Professional Sleep Societies, LLC.

  18. DNA methylation profiles of ovarian epithelial carcinoma tumors and cell lines.

    PubMed

    Houshdaran, Sahar; Hawley, Sarah; Palmer, Chana; Campan, Mihaela; Olsen, Mari N; Ventura, Aviva P; Knudsen, Beatrice S; Drescher, Charles W; Urban, Nicole D; Brown, Patrick O; Laird, Peter W

    2010-02-22

    Epithelial ovarian carcinoma is a significant cause of cancer mortality in women worldwide and in the United States. Epithelial ovarian cancer comprises several histological subtypes, each with distinct clinical and molecular characteristics. The natural history of this heterogeneous disease, including the cell types of origin, is poorly understood. This study applied recently developed methods for high-throughput DNA methylation profiling to characterize ovarian cancer cell lines and tumors, including representatives of three major histologies. We obtained DNA methylation profiles of 1,505 CpG sites (808 genes) in 27 primary epithelial ovarian tumors and 15 ovarian cancer cell lines. We found that the DNA methylation profiles of ovarian cancer cell lines were markedly different from those of primary ovarian tumors. Aggregate DNA methylation levels of the assayed CpG sites tended to be higher in ovarian cancer cell lines relative to ovarian tumors. Within the primary tumors, those of the same histological type were more alike in their methylation profiles than those of different subtypes. Supervised analyses identified 90 CpG sites (68 genes) that exhibited 'subtype-specific' DNA methylation patterns (FDR<1%) among the tumors. In ovarian cancer cell lines, we estimated that for at least 27% of analyzed autosomal CpG sites, increases in methylation were accompanied by decreases in transcription of the associated gene. The significant difference in DNA methylation profiles between ovarian cancer cell lines and tumors underscores the need to be cautious in using cell lines as tumor models for molecular studies of ovarian cancer and other cancers. Similarly, the distinct methylation profiles of the different histological types of ovarian tumors reinforces the need to treat the different histologies of ovarian cancer as different diseases, both clinically and in biomarker studies. These data provide a useful resource for future studies, including those of potential tumor progenitor cells, which may help illuminate the etiology and natural history of these cancers.

  19. Genome-Wide DNA Methylation Analysis of Human Pancreatic Islets from Type 2 Diabetic and Non-Diabetic Donors Identifies Candidate Genes That Influence Insulin Secretion

    PubMed Central

    Dayeh, Tasnim; Volkov, Petr; Salö, Sofia; Hall, Elin; Nilsson, Emma; Olsson, Anders H.; Kirkpatrick, Clare L.; Wollheim, Claes B.; Eliasson, Lena; Rönn, Tina; Bacos, Karl; Ling, Charlotte

    2014-01-01

    Impaired insulin secretion is a hallmark of type 2 diabetes (T2D). Epigenetics may affect disease susceptibility. To describe the human methylome in pancreatic islets and determine the epigenetic basis of T2D, we analyzed DNA methylation of 479,927 CpG sites and the transcriptome in pancreatic islets from T2D and non-diabetic donors. We provide a detailed map of the global DNA methylation pattern in human islets, β- and α-cells. Genomic regions close to the transcription start site showed low degrees of methylation and regions further away from the transcription start site such as the gene body, 3′UTR and intergenic regions showed a higher degree of methylation. While CpG islands were hypomethylated, the surrounding 2 kb shores showed an intermediate degree of methylation, whereas regions further away (shelves and open sea) were hypermethylated in human islets, β- and α-cells. We identified 1,649 CpG sites and 853 genes, including TCF7L2, FTO and KCNQ1, with differential DNA methylation in T2D islets after correction for multiple testing. The majority of the differentially methylated CpG sites had an intermediate degree of methylation and were underrepresented in CpG islands (∼7%) and overrepresented in the open sea (∼60%). 102 of the differentially methylated genes, including CDKN1A, PDE7B, SEPT9 and EXOC3L2, were differentially expressed in T2D islets. Methylation of CDKN1A and PDE7B promoters in vitro suppressed their transcriptional activity. Functional analyses demonstrated that identified candidate genes affect pancreatic β- and α-cells as Exoc3l silencing reduced exocytosis and overexpression of Cdkn1a, Pde7b and Sept9 perturbed insulin and glucagon secretion in clonal β- and α-cells, respectively. Together, our data can serve as a reference methylome in human islets. We provide new target genes with altered DNA methylation and expression in human T2D islets that contribute to perturbed insulin and glucagon secretion. These results highlight the importance of epigenetics in the pathogenesis of T2D. PMID:24603685

  20. In ovo CpG DNA delivery increases innate and adaptive immune cells in respiratory, gastrointestinal and immune systems post-hatch correlating with lower infectious laryngotracheitis virus infection.

    PubMed

    Abdul-Cader, Mohamed Sarjoon; Amarasinghe, Aruna; Palomino-Tapia, Victor; Ahmed-Hassan, Hanaa; Bakhtawar, Khawaja; Nagy, Eva; Sharif, Shayan; Gomis, Susantha; Abdul-Careem, Mohamed Faizal

    2018-01-01

    Cytosine-guanosine deoxynucleotides (CpG) DNA can be delivered in ovo at embryo day (ED)18 for the stimulation of toll-like receptor (TLR)21 signaling pathway that ultimately protects chickens against a number of bacterial and viral infections. There is a dearth of information understanding the mechanisms of protection induced by in ovo delivered CpG DNA. The objective of this study was to determine the immune cell changes post-hatch following in ovo delivery of the TLR21 ligand, CpG DNA. In order to quantify changes of percentage of KUL01+, IgM+ B, cluster of differentiation (CD)4+ and CD8α+ cells, trachea, lung, duodenum, large intestine, spleen and bursa of Fabricius were collected on day 1 post-hatch. We found increased recruitments of KUL01+ cells, in organs of these body systems post-hatch following in ovo delivery of CpG DNA. Although IgM+ B cells, CD4+ and CD8α+ cells were increased in lungs and immune system organs, these cells were not quantifiable from the trachea, duodenum and large intestine immediately following the hatch. Furthermore, when CpG DNA is delivered in ovo and subsequently infected with infectious laryngotracheitis virus (ILTV) post-hatch on day 1, CpG DNA reduces morbidity and mortality resulting from ILTV infection. This study provides insights into the mechanisms of host responses elicited following in ovo delivery of CpG DNA in avian species.

  1. Guideline-Driven Care Improves Outcomes in Patients with Traumatic Rib Fractures.

    PubMed

    Flarity, Kathleen; Rhodes, Whitney C; Berson, Andrew J; Leininger, Brian E; Reckard, Paul E; Riley, Keyan D; Shahan, Charles P; Schroeppel, Thomas J

    2017-09-01

    There is no established national standard for rib fracture management. A clinical practice guideline (CPG) for rib fractures, including monitoring of pulmonary function, early initiation of aggressive loco-regional analgesia, and early identification of deteriorating respiratory function, was implemented in 2013. The objective of the study was to evaluate the effect of the CPG on hospital length of stay. Hospital length of stay (LOS) was compared for adult patients admitted to the hospital with rib fracture(s) two years before and two years after CPG implementation. A separate analysis was done for the patients admitted to the intensive care unit (ICU). Over the 48-month study period, 571 patients met inclusion criteria for the study. Pre-CPG and CPG study groups were well matched with few differences. Multivariable regression did not demonstrate a difference in LOS (B = -0.838; P = 0.095) in the total study cohort. In the ICU cohort (n = 274), patients in the CPG group were older (57 vs 52 years; P = 0.023) and had more rib fractures (4 vs 3; P = 0.003). Multivariable regression identified a significant decrease in LOS for those patients admitted in the CPG period (B = -2.29; P = 0.019). Despite being significantly older with more rib fractures in the ICU cohort, patients admitted after implementation of the CPG had a significantly reduced LOS on multivariable analysis, reducing LOS by over two days. This structured intervention can limit narcotic usage, improve pulmonary function, and decrease LOS in the most injured patients with chest trauma.

  2. Energetic study of cardioplegic hearts under ischaemia/reperfusion and [Ca(2+)] changes in cardiomyocytes of guinea-pig: mitochondrial role.

    PubMed

    Ragone, M I; Torres, N S; Consolini, A E

    2013-02-01

    To study the role of mitochondria in the recovery of guinea-pig hearts exposed to high-K(+)-cardioplegia (CPG) and ischaemia/reperfusion (I/R) METHODS: We measured contractility and heat release in perfused guinea-pig hearts and cytosolic and mitochondrial Ca(2+) by epifluorescence and confocal microscopy in isolated cardiomyocytes loaded with Fluo-4 or Rhod-2. In hearts, CPG increased the postischaemic contractile recovery, and this was potentiated by the mNCX blocker clonazepam and the mKATP opener diazoxide, which also prevented the fall in muscle economy. Moreover, CPG prevented the stunning induced by ouabain, which was reduced by clonazepam. In cardiomyocytes, CPG increased fluorescent signals of cytosolic and mitochondrial Ca(2+), while the addition of a mNCX blocker (CGP37157) increased cytosolic but reduced mitochondrial [Ca(2+)]. Ouabain in CPG increased cytosolic Ca(2+) and resting heat, but the addition of CGP37157 reduced them, as well as mitochondrial Ca(2+). CPG, diazoxide and clonazepam improve postischaemic recovery, respectively, by increasing the Ca(2+) cycling and by reducing the mitochondrial Ca(2+) uptake either by uniporter or by mNCX. The mitochondria compete with the leaky sarcoplasmic reticulum (SR) as sink of Ca(2+) in guinea-pig hearts, affecting the postischaemic contractility. CPG also prevented the ouabain-induced dysfunction by avoiding the Ca(2+) overload. Ouabain reduced the synergism between CPG and clonazepam suggesting that [Na(+)]i and SR load influence the mNCX role. © 2012 The Authors Acta Physiologica © 2012 Scandinavian Physiological Society.

  3. 75 FR 60761 - Government-Owned Inventions; Availability for Licensing

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-01

    ... cells conjugated to a K-type CpG oligodeoxynucleotide (ODN) to a subject. Methods for treating a tumor... therapeutically effective amount of apoptotic tumor cells conjugated to a K-type CpG oligodeoxynucleotide (ODN) to... the prevention of cancer and other indications Use of CpG oligonucleotides for prophylaxis and/or...

  4. 78 FR 46594 - Prospective Grant of Start-up Exclusive License: Topical Antibiotic With Immune Stimulating...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-08-01

    ... Speed Wound Healing; and Use of CpG Oligodeoxynucleotides To Induce Epithelial Cell Growth AGENCY... CpG Oligodeoxynucleotides to Induce Epithelial Cell Growth'' to Tollgene having a place of business... 37 CFR part 404. These technologies relate to relate to use of CpG oligodeoxynucleotides (ODNs) to...

  5. Methylation detection oligonucleotide microarray analysis: a high-resolution method for detection of CpG island methylation

    PubMed Central

    Kamalakaran, Sitharthan; Kendall, Jude; Zhao, Xiaoyue; Tang, Chunlao; Khan, Sohail; Ravi, Kandasamy; Auletta, Theresa; Riggs, Michael; Wang, Yun; Helland, Åslaug; Naume, Bjørn; Dimitrova, Nevenka; Børresen-Dale, Anne-Lise; Hicks, Jim; Lucito, Robert

    2009-01-01

    Methylation of CpG islands associated with genes can affect the expression of the proximal gene, and methylation of non-associated CpG islands correlates to genomic instability. This epigenetic modification has been shown to be important in many pathologies, from development and disease to cancer. We report the development of a novel high-resolution microarray that detects the methylation status of over 25 000 CpG islands in the human genome. Experiments were performed to demonstrate low system noise in the methodology and that the array probes have a high signal to noise ratio. Methylation measurements between different cell lines were validated demonstrating the accuracy of measurement. We then identified alterations in CpG islands, both those associated with gene promoters, as well as non-promoter-associated islands in a set of breast and ovarian tumors. We demonstrate that this methodology accurately identifies methylation profiles in cancer and in principle it can differentiate any CpG methylation alterations and can be adapted to analyze other species. PMID:19474344

  6. The Use of Chlorhexidine/n-Propyl Gallate (CPG) as an Ambient-Temperature Urine Preservative

    NASA Technical Reports Server (NTRS)

    Nillen, Jeannie L.; Smith, Scott M.

    2003-01-01

    A safe, effective ambient temperature urine preservative, chlorhexidine/n-propyl gallate (CPG), has been formulated for use during spacefli ght that reduces the effects of oxidation and bacterial contamination on sample integrity while maintaining urine pH. The ability of this preservative to maintain stability of nine key analytes was evaluated for a period of one year. CPG effectively maintained stability of a mmonia, total nitrogen, 3-methylhistidine, chloride, sodium, potassiu m, and urea; however, creatinine and osmolality were not preserved by CPG. These data indicate that CPG offers prolonged room-temperature storage for multiple urine analytes, reducing the requirements for f rozen urine storage on future spaceflights. Iii medical applications on Earth, this technology can allow urine samples to be collected in remote settings and eliminate the need to ship frozen samples.

  7. Cadmium exposure and the epigenome

    PubMed Central

    Sanders, Alison P; Smeester, Lisa; Rojas, Daniel; DeBussycher, Tristan; Wu, Michael C; Wright, Fred A; Zhou, Yi-Hui; Laine, Jessica E; Rager, Julia E; Swamy, Geeta K; Ashley-Koch, Allison; Lynn Miranda, Marie; Fry, Rebecca C

    2014-01-01

    Cadmium (Cd) is prevalent in the environment yet understudied as a developmental toxicant. Cd partially crosses the placental barrier from mother to fetus and is linked to detrimental effects in newborns. Here we examine the relationship between levels of Cd during pregnancy and 5-methylcytosine (5mC) levels in leukocyte DNA collected from 17 mother-newborn pairs. The methylation of cytosines is an epigenetic mechanism known to impact transcriptional signaling and influence health endpoints. A methylated cytosine-guanine (CpG) island recovery assay was used to assess over 4.6 million sites spanning 16,421 CpG islands. Exposure to Cd was classified for each mother-newborn pair according to maternal blood levels and compared with levels of cotinine. Subsets of genes were identified that showed altered DNA methylation levels in their promoter regions in fetal DNA associated with levels of Cd (n = 61), cotinine (n = 366), or both (n = 30). Likewise, in maternal DNA, differentially methylated genes were identified that were associated with Cd (n = 92) or cotinine (n = 134) levels. While the gene sets were largely distinct between maternal and fetal DNA, functional similarities at the biological pathway level were identified including an enrichment of genes that encode for proteins that control transcriptional regulation and apoptosis. Furthermore, conserved DNA motifs with sequence similarity to specific transcription factor binding sites were identified within the CpG islands of the gene sets. This study provides evidence for distinct patterns of DNA methylation or “footprints” in fetal and maternal DNA associated with exposure to Cd. PMID:24169490

  8. Bisulfite-independent analysis of CpG island methylation enables genome-scale stratification of single cells.

    PubMed

    Han, Lin; Wu, Hua-Jun; Zhu, Haiying; Kim, Kun-Yong; Marjani, Sadie L; Riester, Markus; Euskirchen, Ghia; Zi, Xiaoyuan; Yang, Jennifer; Han, Jasper; Snyder, Michael; Park, In-Hyun; Irizarry, Rafael; Weissman, Sherman M; Michor, Franziska; Fan, Rong; Pan, Xinghua

    2017-06-02

    Conventional DNA bisulfite sequencing has been extended to single cell level, but the coverage consistency is insufficient for parallel comparison. Here we report a novel method for genome-wide CpG island (CGI) methylation sequencing for single cells (scCGI-seq), combining methylation-sensitive restriction enzyme digestion and multiple displacement amplification for selective detection of methylated CGIs. We applied this method to analyzing single cells from two types of hematopoietic cells, K562 and GM12878 and small populations of fibroblasts and induced pluripotent stem cells. The method detected 21 798 CGIs (76% of all CGIs) per cell, and the number of CGIs consistently detected from all 16 profiled single cells was 20 864 (72.7%), with 12 961 promoters covered. This coverage represents a substantial improvement over results obtained using single cell reduced representation bisulfite sequencing, with a 66-fold increase in the fraction of consistently profiled CGIs across individual cells. Single cells of the same type were more similar to each other than to other types, but also displayed epigenetic heterogeneity. The method was further validated by comparing the CpG methylation pattern, methylation profile of CGIs/promoters and repeat regions and 41 classes of known regulatory markers to the ENCODE data. Although not every minor methylation differences between cells are detectable, scCGI-seq provides a solid tool for unsupervised stratification of a heterogeneous cell population. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Epigenetic inactivation of CHFR in human tumors

    PubMed Central

    Toyota, Minoru; Sasaki, Yasushi; Satoh, Ayumi; Ogi, Kazuhiro; Kikuchi, Takefumi; Suzuki, Hiromu; Mita, Hiroaki; Tanaka, Nobuyuki; Itoh, Fumio; Issa, Jean-Pierre J.; Jair, Kam-Wing; Schuebel, Kornel E.; Imai, Kohzoh; Tokino, Takashi

    2003-01-01

    Cell-cycle checkpoints controlling the orderly progression through mitosis are frequently disrupted in human cancers. One such checkpoint, entry into metaphase, is regulated by the CHFR gene encoding a protein possessing forkhead-associated and RING finger domains as well as ubiquitin–ligase activity. Although defects in this checkpoint have been described, the molecular basis and prevalence of CHFR inactivation in human tumors are still not fully understood. To address this question, we analyzed the pattern of CHFR expression in a number of human cancer cell lines and primary tumors. We found CpG methylation-dependent silencing of CHFR expression in 45% of cancer cell lines, 40% of primary colorectal cancers, 53% of colorectal adenomas, and 30% of primary head and neck cancers. Expression of CHFR was precisely correlated with both CpG methylation and deacetylation of histones H3 and H4 in the CpG-rich regulatory region. Moreover, CpG methylation and thus silencing of CHFR depended on the activities of two DNA methyltransferases, DNMT1 and DNMT3b, as their genetic inactivation restored CHFR expression. Finally, cells with CHFR methylation had an intrinsically high mitotic index when treated with microtubule inhibitor. This means that cells in which CHFR was epigenetically inactivated constitute loss-of-function alleles for mitotic checkpoint control. Taken together, these findings shed light on a pathway by which mitotic checkpoint is bypassed in cancer cells and suggest that inactivation of checkpoint genes is much more widespread than previously suspected. PMID:12810945

  10. Identification of Inhibitory Premotor Interneurons Activated at a Late Phase in a Motor Cycle during Drosophila Larval Locomotion

    PubMed Central

    Itakura, Yuki; Kohsaka, Hiroshi; Ohyama, Tomoko; Zlatic, Marta

    2015-01-01

    Rhythmic motor patterns underlying many types of locomotion are thought to be produced by central pattern generators (CPGs). Our knowledge of how CPG networks generate motor patterns in complex nervous systems remains incomplete, despite decades of work in a variety of model organisms. Substrate borne locomotion in Drosophila larvae is driven by waves of muscular contraction that propagate through multiple body segments. We use the motor circuitry underlying crawling in larval Drosophila as a model to try to understand how segmentally coordinated rhythmic motor patterns are generated. Whereas muscles, motoneurons and sensory neurons have been well investigated in this system, far less is known about the identities and function of interneurons. Our recent study identified a class of glutamatergic premotor interneurons, PMSIs (period-positive median segmental interneurons), that regulate the speed of locomotion. Here, we report on the identification of a distinct class of glutamatergic premotor interneurons called Glutamatergic Ventro-Lateral Interneurons (GVLIs). We used calcium imaging to search for interneurons that show rhythmic activity and identified GVLIs as interneurons showing wave-like activity during peristalsis. Paired GVLIs were present in each abdominal segment A1-A7 and locally extended an axon towards a dorsal neuropile region, where they formed GRASP-positive putative synaptic contacts with motoneurons. The interneurons expressed vesicular glutamate transporter (vGluT) and thus likely secrete glutamate, a neurotransmitter known to inhibit motoneurons. These anatomical results suggest that GVLIs are premotor interneurons that locally inhibit motoneurons in the same segment. Consistent with this, optogenetic activation of GVLIs with the red-shifted channelrhodopsin, CsChrimson ceased ongoing peristalsis in crawling larvae. Simultaneous calcium imaging of the activity of GVLIs and motoneurons showed that GVLIs’ wave-like activity lagged behind that of motoneurons by several segments. Thus, GVLIs are activated when the front of a forward motor wave reaches the second or third anterior segment. We propose that GVLIs are part of the feedback inhibition system that terminates motor activity once the front of the motor wave proceeds to anterior segments. PMID:26335437

  11. Identification of Inhibitory Premotor Interneurons Activated at a Late Phase in a Motor Cycle during Drosophila Larval Locomotion.

    PubMed

    Itakura, Yuki; Kohsaka, Hiroshi; Ohyama, Tomoko; Zlatic, Marta; Pulver, Stefan R; Nose, Akinao

    2015-01-01

    Rhythmic motor patterns underlying many types of locomotion are thought to be produced by central pattern generators (CPGs). Our knowledge of how CPG networks generate motor patterns in complex nervous systems remains incomplete, despite decades of work in a variety of model organisms. Substrate borne locomotion in Drosophila larvae is driven by waves of muscular contraction that propagate through multiple body segments. We use the motor circuitry underlying crawling in larval Drosophila as a model to try to understand how segmentally coordinated rhythmic motor patterns are generated. Whereas muscles, motoneurons and sensory neurons have been well investigated in this system, far less is known about the identities and function of interneurons. Our recent study identified a class of glutamatergic premotor interneurons, PMSIs (period-positive median segmental interneurons), that regulate the speed of locomotion. Here, we report on the identification of a distinct class of glutamatergic premotor interneurons called Glutamatergic Ventro-Lateral Interneurons (GVLIs). We used calcium imaging to search for interneurons that show rhythmic activity and identified GVLIs as interneurons showing wave-like activity during peristalsis. Paired GVLIs were present in each abdominal segment A1-A7 and locally extended an axon towards a dorsal neuropile region, where they formed GRASP-positive putative synaptic contacts with motoneurons. The interneurons expressed vesicular glutamate transporter (vGluT) and thus likely secrete glutamate, a neurotransmitter known to inhibit motoneurons. These anatomical results suggest that GVLIs are premotor interneurons that locally inhibit motoneurons in the same segment. Consistent with this, optogenetic activation of GVLIs with the red-shifted channelrhodopsin, CsChrimson ceased ongoing peristalsis in crawling larvae. Simultaneous calcium imaging of the activity of GVLIs and motoneurons showed that GVLIs' wave-like activity lagged behind that of motoneurons by several segments. Thus, GVLIs are activated when the front of a forward motor wave reaches the second or third anterior segment. We propose that GVLIs are part of the feedback inhibition system that terminates motor activity once the front of the motor wave proceeds to anterior segments.

  12. DNA methylation profiles of long- and short-term glioblastoma survivors

    PubMed Central

    Shinawi, Thoraia; Hill, Victoria K.; Krex, Dietmar; Schackert, Gabriele; Gentle, Dean; Morris, Mark R.; Wei, Wenbin; Cruickshank, Garth; Maher, Eamonn R.; Latif, Farida

    2013-01-01

    Glioblastoma (GBM) is the most common and malignant type of primary brain tumor in adults and prognosis of most GBM patients is poor. However, a small percentage of patients show a long term survival of 36 mo or longer after diagnosis. Epigenetic profiles can provide molecular markers for patient prognosis: recently, a G-CIMP positive phenotype associated with IDH1 mutations has been described for GBMs with good prognosis. In the present analysis we performed genome-wide DNA methylation profiling of short-term survivors (STS; overall survival < 1 y) and long-term survivors (LTS; overall survival > 3 y) by utilizing the HumanMethylation450K BeadChips to assess quantitative methylation at > 480,000 CpG sites. Cluster analysis has shown that a subset of LTS showed a G-CIMP positive phenotype that was tightly associated with IDH1 mutation status and was confirmed by analysis of the G-CIMP signature genes. Using high stringency criteria for differential hypermethylation between non-cancer brain and tumor samples, we identified 2,638 hypermethylated CpG loci (890 genes) in STS GBMs, 3,101 hypermethylated CpG loci (1,062 genes) in LTS (wild type IDH1) and 11,293 hypermethylated CpG loci in LTS (mutated for IDH1), reflecting the CIMP positive phenotype. The location of differentially hypermethylated CpG loci with respect to CpG content, neighborhood context and functional genomic distribution was similar in our sample set, with the majority of CpG loci residing in CpG islands and in gene promoters. Our preliminary study also identified a set of CpG loci differentially hypermethylated between STS and LTS cases, including members of the homeobox gene family (HOXD8, HOXD13 and HOXC4), the transcription factors NR2F2 and TFAP2A, and Dickkopf 2, a negative regulator of the wnt/β-catenin signaling pathway. PMID:23291739

  13. Vitamin D dose response is underestimated by Endocrine Society's Clinical Practice Guideline.

    PubMed

    McKenna, Malachi J; Murray, Barbara F

    2013-06-01

    The recommended daily intakes of vitamin D according to the recent Clinical Practice Guideline (CPG) of the Endocrine Society are three- to fivefold higher than the Institute of Medicine (IOM) report. We speculated that these differences could be explained by different mathematical approaches to the vitamin D dose response. Studies were selected if the daily dose was ≤2000 IU/day, the duration exceeded 3 months, and 25-hydroxyvitamin D (25OHD) concentrations were measured at baseline and post-therapy. The rate constant was estimated according to the CPG approach. The achieved 25OHD result was estimated according to the following: i) the regression equation approach of the IOM; ii) the regression approach of the Vitamin D Supplementation in Older Subjects (ViDOS) study; and iii) the CPG approach using a rate constant of 2.5 (CPG2.5) and a rate constant of 5.0 (CPG5.0). The difference between the expected and the observed 25OHD result was expressed as a percentage of observed and analyzed for significance against a value of 0% for the four groups. Forty-one studies were analyzed. The mean (95% CI) rate constant was 5.3 (4.4-6.2) nmol/l per 100 IU per day, on average twofold higher than the CPG rate constant. The mean (95% CI) for the difference between the expected and observed expressed as a percentage of observed was as follows: i) IOM, -7 (-16,+2)% (t=1.64, P=0.110); ii) ViDOS, +2 (-8,+12)% (t=0.40, P=0.69); iii) CPG2.5, -21 (-27,-15)% (t=7.2, P<0.0001); and iv) CPG5.0+3 (-4,+10)% (t=0.91, P=0.366). The CPG 'rule of thumb' should be doubled to 5.0 nmol/l (2.0 ng/ml) per 100 IU per day, adopting a more risk-averse position.

  14. Distinct Effects of Monophosphoryl Lipid A, Oligodeoxynucleotide CpG, and Combination Adjuvants on Modulating Innate and Adaptive Immune Responses to Influenza Vaccination

    PubMed Central

    Ko, Eun-Ju; Lee, Young-Tae; Lee, Youri; Kim, Ki-Hye

    2017-01-01

    Monophosphoryl lipid A (MPL) and oligodeoxynucleotide CpG are toll-like receptor (TLR) 4 and 9 agonist, respectively. Here, we investigated the effects of MPL, CpG, and combination adjuvants on stimulating in vitro dendritic cells (DCs), in vivo innate and adaptive immune responses, and protective efficacy of influenza vaccination. Combination of MPL and CpG was found to exhibit distinct effects on stimulating DCs in vitro to secrete IL-12p70 and tumor necrosis factor (TNF)-α and proliferate allogeneic CD8 T cells. Prime immunization of mice with inactivated split influenza vaccine in the presence of low dose MPL+CpG adjuvants increased the induction of virus-specific IgG and IgG2a isotype antibodies. MPL and CpG adjuvants contribute to improving the efficacy of prime influenza vaccination against lethal influenza challenge as determined by body weight monitoring, lung function, viral titers, and histology. A combination of MPL and CpG adjuvants was effective in improving vaccine efficacy as well as in reducing inflammatory immune responses locally and in inducing cellular immune responses upon lethal influenza virus challenge. This study demonstrates unique adjuvant effects of MPL, CpG, and combination adjuvants on modulating innate and adaptive immune responses to influenza prime vaccination. PMID:29093654

  15. Dopamine receptor D4 promoter hypermethylation increases the risk of drug addiction.

    PubMed

    Ji, Huihui; Xu, Xuting; Liu, Guili; Liu, Huifen; Wang, Qinwen; Shen, Wenwen; Li, Longhui; Xie, Xiaohu; Hu, Haochang; Xu, Lei; Zhou, Wenhua; Duan, Shiwei

    2018-02-01

    Heroin and methylamphetamine (METH) are two addictive drugs that cause serious problems for society. Dopamine receptor D4 (DRD4), a key receptor in the dopaminergic system, may facilitate the development of drug addiction. The aim of the present study was to investigate the association between the promoter methylation level of DRD4 gene and drug addiction. Bisulfite pyrosequencing technology was used to measure the methylation levels of DRD4 promoter in 60 drug addicts and 52 matched controls. Significantly higher levels of DRD4 CpG1 and CpG4 methylation were detected in METH and heroin drug addicts compared with controls (P<0.05). Male METH addicts exhibited significantly higher DRD4 CpG1, CpG2 and CpG4 methylation levels compared with sex-matched controls (P<0.05). In heroin addicts, a positive correlation was observed between depression-dejection and DRD4 CpG5 methylation (r=0.537, P=0.039) whereas there was a negative correlation between drug usage frequency and CpG1 methylation (r=-0.632, P=0.011). In METH addicts, methylation levels were not significantly associated with depression-dejection and drug usage frequency. In addition, luciferase assays demonstrated that the target sequence of the DRD4 promoter upregulates gene expression. The results of the present study suggest that DNA methylation of DRD4 may be responsible for the pathophysiology of drug addiction.

  16. ampliMethProfiler: a pipeline for the analysis of CpG methylation profiles of targeted deep bisulfite sequenced amplicons.

    PubMed

    Scala, Giovanni; Affinito, Ornella; Palumbo, Domenico; Florio, Ermanno; Monticelli, Antonella; Miele, Gennaro; Chiariotti, Lorenzo; Cocozza, Sergio

    2016-11-25

    CpG sites in an individual molecule may exist in a binary state (methylated or unmethylated) and each individual DNA molecule, containing a certain number of CpGs, is a combination of these states defining an epihaplotype. Classic quantification based approaches to study DNA methylation are intrinsically unable to fully represent the complexity of the underlying methylation substrate. Epihaplotype based approaches, on the other hand, allow methylation profiles of cell populations to be studied at the single molecule level. For such investigations, next-generation sequencing techniques can be used, both for quantitative and for epihaplotype analysis. Currently available tools for methylation analysis lack output formats that explicitly report CpG methylation profiles at the single molecule level and that have suited statistical tools for their interpretation. Here we present ampliMethProfiler, a python-based pipeline for the extraction and statistical epihaplotype analysis of amplicons from targeted deep bisulfite sequencing of multiple DNA regions. ampliMethProfiler tool provides an easy and user friendly way to extract and analyze the epihaplotype composition of reads from targeted bisulfite sequencing experiments. ampliMethProfiler is written in python language and requires a local installation of BLAST and (optionally) QIIME tools. It can be run on Linux and OS X platforms. The software is open source and freely available at http://amplimethprofiler.sourceforge.net .

  17. Association between DNA methylation in cord blood and maternal smoking: The Hokkaido Study on Environment and Children's Health.

    PubMed

    Miyake, Kunio; Kawaguchi, Akio; Miura, Ryu; Kobayashi, Sachiko; Tran, Nguyen Quoc Vuong; Kobayashi, Sumitaka; Miyashita, Chihiro; Araki, Atsuko; Kubota, Takeo; Yamagata, Zentaro; Kishi, Reiko

    2018-04-04

    Maternal smoking is reported to cause adverse effects on the health of the unborn child, the underlying mechanism for which is thought to involve alterations in DNA methylation. We examined the effects of maternal smoking on DNA methylation in cord blood, in 247 mother-infant pairs in the Sapporo cohort of the Hokkaido Study, using the Infinium HumanMethylation 450K BeadChip. We first identified differentially methylated CpG sites with a false discovery rate (FDR) of <0.05 and the magnitude of DNA methylation changes (|β| >0.02) from the pairwise comparisons of never-smokers (Ne-S), sustained-smokers (Su-S), and stopped-smokers (St-S). Subsequently, secondary comparisons between St-S and Su-S revealed nine common sites that mapped to ACSM3, AHRR, CYP1A1, GFI1, SHANK2, TRIM36, and the intergenic region between ANKRD9 and RCOR1 in Ne-S vs. Su-S, and one common CpG site mapping to EVC2 in Ne-S vs. St-S. Further, we verified these CpG sites and examined neighbouring sites using bisulfite next-generation sequencing, except for AHRR cg21161138. These changes in DNA methylation implicate the effect of smoking cessation. Our findings add to the current knowledge of the association between DNA methylation and maternal smoking and suggest future studies for clarifying this relationship in disease development.

  18. Breast tumor DNA methylation patterns associated with smoking in the Carolina Breast Cancer Study.

    PubMed

    Conway, Kathleen; Edmiston, Sharon N; Parrish, Eloise; Bryant, Christopher; Tse, Chiu-Kit; Swift-Scanlan, Theresa; McCullough, Lauren E; Kuan, Pei Fen

    2017-06-01

    Tobacco smoking is a risk factor in several cancers, yet its roles as a putative etiologic exposure or poor prognostic factor in breast cancer are less clear. Altered DNA methylation contributes to breast cancer development and may provide a mechanistic link between smoking and gene expression changes leading to cancer development or progression. Using a cancer-focused array, we examined methylation at 933 CpGs in 517 invasive breast tumors in the Carolina Breast Cancer Study to determine whether methylation patterns differ by exposure to tobacco smoke. Multivariable generalized linear regression models were used to compare tumor methylation profiles between smokers and never smokers, overall, or stratified on hormone receptor (HR) status. Modest differences in CpG methylation were detected at p < 0.05 in breast tumors from current or ever smokers compared with never smokers. In stratified analyses, HR- tumors from smokers exhibited primarily hypomethylation compared with tumors from never smokers; hypomethylation was similarly detected within the more homogeneous basal-like subtype. Most current smoking-associated CpG loci exhibited methylation levels in former smokers that were intermediate between those in current and never smokers and exhibited progressive changes in methylation with increasing duration of smoking. Among former smokers, restoration of methylation toward baseline (never smoking) levels was observed with increasing time since quitting. Moreover, smoking-related hypermethylation was stronger in HR+ breast tumors from blacks than in whites. Our results suggest that breast tumor methylation patterns differ with tobacco smoke exposure; however, additional studies are needed to confirm these findings.

  19. Effect of alcohol consumption on CpG methylation in the differentially methylated regions of H19 and IG-DMR in male gametes: implications for fetal alcohol spectrum disorders.

    PubMed

    Ouko, Lillian A; Shantikumar, Katpaham; Knezovich, Jaysen; Haycock, Philip; Schnugh, Desmond J; Ramsay, Michèle

    2009-09-01

    Exposure to alcohol in utero is the main attributable cause of fetal alcohol spectrum disorders (FASD) which in its most severe form is characterized by irreversible behavioral and cognitive disability. Paternal preconception drinking is not considered to be a significant risk factor, even though animal studies have demonstrated that chronic paternal alcohol consumption has a detrimental effect on the physical and mental development of offspring even in the absence of in utero alcohol exposure. It has been documented that alcohol can reduce the levels and activity of DNA methyltransferases resulting in DNA hypomethylation and that reduced methyltransferase activity can cause activation of normally silenced genes. The aim of this study was to establish a link between alcohol use in men and hypomethylation of paternally imprinted loci in sperm DNA in genomic regions critical for embryonic development, thus providing a mechanism for paternal effects in the aetiology of FASD. Sperm DNA from male volunteers was bisulfite treated and the methylation patterns of 2 differentially methylated regions (DMRs), H19 and IG-DMR, analyzed following sequencing of individual clones. The methylation patterns were correlated with the alcohol consumption levels of the volunteer males. There was a pattern of increased demethylation with alcohol consumption at the 2 imprinted loci with a significant difference observed at the IG-DMR between the nondrinking and heavy alcohol consuming groups. Greater inter-individual variation in average methylation was observed at the H19 DMR and individual clones were more extensively demethylated than those of the IG-DMR. CpG site #4 in the IG-DMR was preferentially demethylated among all individuals and along with the H19 DMR CpG site #7 located within the CTCF binding site 6 showed significant demethylation in the alcohol consuming groups compared with the control group. This study demonstrates a correlation between chronic alcohol use and demethylation of normally hypermethylated imprinted regions in sperm DNA. We hypothesize that, should these epigenetic changes in imprinted genes be transmitted through fertilization, they would alter the critical gene expression dosages required for normal prenatal development resulting in offspring with features of FASD.

  20. Reconstruction of Toll-like receptor 9-mediated responses in HEK-Blue hTLR9 cells by transfection of human macrophage scavenger receptor 1 gene.

    PubMed

    Ohtsuki, Shozo; Takahashi, Yuki; Inoue, Takao; Takakura, Yoshinobu; Nishikawa, Makiya

    2017-10-20

    We used human Toll-like receptor 9 (hTLR9)-expressing HEK-Blue hTLR9 cells, which release secreted embryonic alkaline phosphatase (SEAP) upon response to CpG DNA, to evaluate the immunological properties of nucleic acid drug candidates. Our preliminary studies showed that phosphodiester CpG DNA hardly induced any SEAP secretion in HEK-Blue hTLR9 cells. In the current study, therefore, we developed HEK-Blue hTLR9 cells transduced with human macrophage scavenger receptor-1 (hMSR1), a cell-surface DNA receptor, and determined whether HEK-Blue hTLR9/hMSR1 cells respond to phosphorothioate (PS) CpG DNA and phosphodiester (PO) CpG DNA. We selected PS CpG2006, a single-stranded PO CpG DNA (ssCpG), and a tetrapod-like structured DNA (tetrapodna) containing ssCpG (tetraCpG) as model TLR9 ligands. Alexa Fluor 488-labeled ligands were used for flow cytometry. Unlike the mock-transfected HEK-Blue hTLR9 cells, the HEK-Blue hTLR9/hMSR1 cells efficiently took up all three CpG DNAs. SEAP release was almost proportional to the uptake. Treatment of HEK-Blue hTLR9/hMSR1 cells with an anti-hMSR1 antibody significantly reduced the uptake of ssCpG and tetraCpG. Collectively, reconstruction of TLR9-mediated responses to CpG DNA in HEK-Blue hTLR9 cells can be used to evaluate the toxicity of nucleic acid drug candidates with diverse physicochemical properties.

  1. Extended Plasticity of Visual Cortex in Dark-Reared Animals May Result from Prolonged Expression of cpg15-Like Genes

    PubMed Central

    Lee, Wei-Chung Allen; Nedivi, Elly

    2011-01-01

    cpg15 is an activity-regulated gene that encodes a membrane-bound ligand that coordinately regulates growth of apposing dendritic and axonal arbors and the maturation of their synapses. These properties make it an attractive candidate for participating in plasticity of the mammalian visual system. Here we compare cpg15 expression during normal development of the rat visual system with that seen in response to dark rearing, monocular blockade of retinal action potentials, or monocular deprivation. Our results show that the onset of cpg15 expression in the visual cortex is coincident with eye opening, and it increases until the peak of the critical period at postnatal day 28 (P28). This early expression is independent of both retinal activity and visual experience. After P28, a component of cpg15 expression in the visual cortex, lateral geniculate nucleus (LGN), and superior colliculus (SC) develops a progressively stronger dependence on retinally driven action potentials. Dark rearing does not affect cpg15 mRNA expression in the LGN and SC at any age, but it does significantly affect its expression in the visual cortex from the peak of the critical period and into adulthood. In dark-reared rats, the peak level of cpg15 expression in the visual cortex at P28 is lower than in controls. Rather than showing the normal decline with maturation, these levels are maintained in dark-reared animals. We suggest that the prolonged plasticity in the visual cortex that is seen in dark-reared animals may result from failure to downregulate genes such as cpg15 that could promote structural remodeling and synaptic maturation. PMID:11880509

  2. Evidence-based clinical practice guideline for adult Still's disease.

    PubMed

    Mimura, Toshihide; Kondo, Yuya; Ohta, Akihide; Iwamoto, Masahiro; Ota, Akiko; Okamoto, Nami; Kawaguchi, Yasushi; Kono, Hajime; Takasaki, Yoshinari; Takei, Shuji; Nishimoto, Norihiro; Fujimoto, Manabu; Asanuma, Yu Funakubo; Mimori, Akio; Okiyama, Naoko; Kaneko, Shunta; Takahashi, Hiroyuki; Yokosawa, Masahiro; Sumida, Takayuki

    2018-05-09

    Using an expert- and data-driven methodology, we have constructed the first clinical practice guidelines (CPGs) for adult Still's disease (ASD) after complete systematic review (SR) of the literature based upon the Medical Information Network Distribution Service (Minds) procedure. The CPG committee for ASD organized by the Research Team for Autoimmune Diseases, the Research Program for Intractable Disease of the Japanese Ministry of Health, Labour, and Welfare has developed CPG for ASD 2017, according to the procedure proposed by Minds. The CPG development process includes (1) clarification of the purpose of CPG, (2) organization of the steering committee, (3) organization of the CPG committee and secretariat, (4) defining the scope (setting of clinical questions (CQs)), (5) SR, (6) development of recommendations, (7) drafting the CPG, (8) external evaluation and public comments, and (9) release. Because we wanted to construct CPG for ASD to encompass both adult-onset Still's disease (AOSD) and adult patients with systemic juvenile idiopathic arthritis (sJIA), we also included SR data from sJIA in this study. Twenty-six CQs were selected and roughly divided into the following items: (1) clinical findings (CQs 1-4), (2) laboratory findings (CQs 5-8), (3) complications (CQs 9-13), (4) treatment with oral medicine (CQs 14-19), (5) treatment with biological reagents (CQs 20-23), and (6) treatments for sJIA (CQs 25-26). Recommendations and the strength of the recommendations for these CQs were decided by a modified Delphi method. We have developed the first published CPG for ASD including AOSD and sJIA, which includes 26 CQs and recommendations. This guideline will help rheumatologists, non-specialized physicians, other healthcare providers, medical and health-related students, and patients and their family members to understand and treat ASD.

  3. Provider Adherence to Implementation of Clinical Practice Guidelines for Neurogenic Bowel in Adults With Spinal Cord Injury

    PubMed Central

    Goetz, Lance L; Nelson, Audrey L; Guihan, Marylou; Bosshart, Helen T; Harrow, Jeffrey J; Gerhart, Kevin D; Krasnicka, Barbara; Burns, Stephen P

    2005-01-01

    Background/Objectives: Clinical Practice Guidelines (CPGs) have been published on a number of topics in spinal cord injury (SCI) medicine. Research in the general medical literature shows that the distribution of CPGs has a minimal effect on physician practice without targeted implementation strategies. The purpose of this study was to determine (a) whether dissemination of an SCI CPG improved the likelihood that patients would receive CPG recommended care and (b) whether adherence to CPG recommendations could be improved through a targeted implementation strategy. Specifically, this study addressed the “Neurogenic Bowel Management in Adults with Spinal Cord Injury” Clinical Practice Guideline published in March 1998 by the Consortium for Spinal Cord Medicine Methods: CPG adherence was determined from medical record review at 6 Veterans Affairs SCI centers for 3 time periods: before guideline publication (T1), after guideline publication but before CPG implementation (T2), and after targeted CPG implementation (T3). Specific implementation strategies to enhance guideline adherence were chosen to address the barriers identified by SCI providers in focus groups before the intervention. Results: Overall adherence to recommendations related to neurogenic bowel did not change between T1 and T2 (P = not significant) but increased significantly between T2 and T3 (P < 0.001) for 3 of 6 guideline recommendations. For the other 3 guideline recommendations, adherence rates were noted to be high at T1. Conclusions: While publication of the CPG alone did not alter rates of provider adherence, the use of a targeted implementation plan resulted in increases in adherence rates with some (3 of 6) CPG recommendations for neurogenic bowel management. PMID:16869086

  4. The Genomic Impact of DNA CpG Methylation on Gene Expression; Relationships in Prostate Cancer.

    PubMed

    Long, Mark D; Smiraglia, Dominic J; Campbell, Moray J

    2017-02-14

    The process of DNA CpG methylation has been extensively investigated for over 50 years and revealed associations between changing methylation status of CpG islands and gene expression. As a result, DNA CpG methylation is implicated in the control of gene expression in developmental and homeostasis processes, as well as being a cancer-driver mechanism. The development of genome-wide technologies and sophisticated statistical analytical approaches has ushered in an era of widespread analyses, for example in the cancer arena, of the relationships between altered DNA CpG methylation, gene expression, and tumor status. The remarkable increase in the volume of such genomic data, for example, through investigators from the Cancer Genome Atlas (TCGA), has allowed dissection of the relationships between DNA CpG methylation density and distribution, gene expression, and tumor outcome. In this manner, it is now possible to test that the genome-wide correlations are measurable between changes in DNA CpG methylation and gene expression. Perhaps surprisingly is that these associations can only be detected for hundreds, but not thousands, of genes, and the direction of the correlations are both positive and negative. This, perhaps, suggests that CpG methylation events in cancer systems can act as disease drivers but the effects are possibly more restricted than suspected. Additionally, the positive and negative correlations suggest direct and indirect events and an incomplete understanding. Within the prostate cancer TCGA cohort, we examined the relationships between expression of genes that control DNA methylation, known targets of DNA methylation and tumor status. This revealed that genes that control the synthesis of S -adenosyl-l-methionine (SAM) associate with altered expression of DNA methylation targets in a subset of aggressive tumors.

  5. Is Serotonin Transporter Genotype Associated with Epigenetic Susceptibility or Vulnerability? Examination of the Impact of SES Risk on African American Youth

    PubMed Central

    Beach, S. R. H.; Brody, G. H.; Lei, M.K.; Kim, S.; Cui, J.

    2014-01-01

    We hypothesized that presence of the s allele in the promoter region of the serotonin transporter (5-HTTLR) would moderate the effect of early cumulative SES risk on epigenetic change among African American youth. Contrasting hypotheses regarding the shape of the interaction effect were generated using vulnerability and susceptibility frameworks and applied to data from a sample of 388 African American youth. Early, cumulative SES risk assessed at 11–13 years based on parent report interacted with presence of the s allele to predict differential methylation assessed at age 19. Across multiple tests, a differential susceptibility perspective rather than a diathesis stress framework best fit the data for genes associated with depression, consistently demonstrating greater epigenetic response to early cumulative SES risk among s allele carriers. A pattern consistent with greater impact among s allele carriers also was observed using all CpG sites across the genome that were differentially affected by early cumulative SES risk. We conclude that the s allele is associated with increased responsiveness to early cumulative SES risk among African American youth, leading to epigenetic divergence for depression-related genes in response to exposure to heightened SES risk among s allele carriers in a “for better” or “for worse” pattern. PMID:24438855

  6. Structural impact of complete CpG methylation within target DNA on specific complex formation of the inducible transcription factor Egr-1.

    PubMed

    Zandarashvili, Levani; White, Mark A; Esadze, Alexandre; Iwahara, Junji

    2015-07-08

    The inducible transcription factor Egr-1 binds specifically to 9-bp target sequences containing two CpG sites that can potentially be methylated at four cytosine bases. Although it appears that complete CpG methylation would make an unfavorable steric clash in the previous crystal structures of the complexes with unmethylated or partially methylated DNA, our affinity data suggest that DNA recognition by Egr-1 is insensitive to CpG methylation. We have determined, at a 1.4-Å resolution, the crystal structure of the Egr-1 zinc-finger complex with completely methylated target DNA. Structural comparison of the three different methylation states reveals why Egr-1 can recognize the target sequences regardless of CpG methylation. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  7. A terahertz EO detector with large dynamical range, high modulation depth and signal-noise ratio

    NASA Astrophysics Data System (ADS)

    Pan, Xinjian; Cai, Yi; Zeng, Xuanke; Zheng, Shuiqin; Li, Jingzhen; Xu, Shixiang

    2017-05-01

    The paper presents a novel design for terahertz (THz) free-space time domain electro-optic (EO) detection where the static birefringent phases of the two balanced arms are set close to zero but opposite to each other. Our theoretical and numerical analyses show this design has much stronger ability to cancel the optical background noise than both THz ellipsometer and traditional crossed polarizer geometry (CPG). Its optical modulation depth is about twice as high as that of traditional CPG, but about ten times as high as that of THz ellipsometer. As for the dynamical range, our improved design is comparable to the THz ellipsometer but obviously larger than the traditional CPG. Some experiments for comparing our improved CPG with traditional CPG agree well with the corresponding theoretical predictions. Our experiments also show that the splitting ratio of the used non-polarization beam splitter is critical for the performance of our design.

  8. CpG oligodeoxyribonucleotides protect mice from Burkholderia pseudomallei but not Francisella tularensis Schu S4 aerosols

    PubMed Central

    2010-01-01

    Studies have shown that CpG oligodeoxyribonucleotides (ODN) protect mice from various bacterial pathogens, including Burkholderia pseudomallei and Francisella tularensis live vaccine strain (LVS), when administered before parenteral challenge. Given the potential to develop CpG ODN as a pre-treatment for multiple bacterial biological warfare agents, we examined survival, histopathology, and cytokine data from CpG ODN-treated C57BL/6 mice to determine whether previously-reported protection extended to aerosolized B. pseudomallei 1026b and highly virulent F. tularensis Schu S4 infections. We found that, although CpG ODN protected mice from aerosolized B. pseudomallei challenges, the immunostimulant failed to benefit the animals exposed to F. tularensis Schu S4 aerosols. Our results, which contrast with earlier F. tularensis LVS studies, highlight potential differences in Francisella species pathogenesis and underscore the need to evaluate immunotherapies against human pathogenic species. PMID:20181102

  9. CpG oligodeoxyribonucleotides protect mice from Burkholderia pseudomallei but not Francisella tularensis Schu S4 aerosols.

    PubMed

    Rozak, David A; Gelhaus, Herbert C; Smith, Mark; Zadeh, Mojgan; Huzella, Louis; Waag, David; Adamovicz, Jeffrey J

    2010-02-05

    Studies have shown that CpG oligodeoxyribonucleotides (ODN) protect mice from various bacterial pathogens, including Burkholderia pseudomallei and Francisella tularensis live vaccine strain (LVS), when administered before parenteral challenge. Given the potential to develop CpG ODN as a pre-treatment for multiple bacterial biological warfare agents, we examined survival, histopathology, and cytokine data from CpG ODN-treated C57BL/6 mice to determine whether previously-reported protection extended to aerosolized B. pseudomallei 1026b and highly virulent F. tularensis Schu S4 infections. We found that, although CpG ODN protected mice from aerosolized B. pseudomallei challenges, the immunostimulant failed to benefit the animals exposed to F. tularensis Schu S4 aerosols. Our results, which contrast with earlier F. tularensis LVS studies, highlight potential differences in Francisella species pathogenesis and underscore the need to evaluate immunotherapies against human pathogenic species.

  10. Modeling, Simulation, and Analysis of a Decoy State Enabled Quantum Key Distribution System

    DTIC Science & Technology

    2015-03-26

    through the fiber , we assume Alice and Bob have correct basis alignment and timing control for reference frame correction and precise photon detection...optical components ( laser , polarization modulator, electronic variable optical attenuator, fixed optical attenuator, fiber channel, beamsplitter...generated by the laser in the CPG propagate through multiple optical components, each with a unique propagation delay before reaching the OPM. Timing

  11. DNA activates human immune cells through a CpG sequence-dependent manner

    PubMed Central

    Bauer, M; Heeg, K; Wagner, H; Lipford, G B

    1999-01-01

    While bacterial DNA and cytosine–guanosine-dinucleotide-containing oligonucleotides (CpG ODN) are well described activators of murine immune cells, their effect on human cells is inconclusive. We investigated their properties on human peripheral blood mononuclear cells (PBMC) and subsets thereof, such as purified monocytes, T and B cells. Here we demonstrate that bacterial DNA and CpG ODN induce proliferation of B cells, while other subpopulations, such as monocytes and T cells, did not proliferate. PBMC mixed cell cultures, as well as purified monocytes, produced interleukin-6 (IL-6), IL-12 and tumour necrosis factor-α upon stimulation with bacterial DNA; however, only IL-6 and IL-12 secretion became induced upon CpG ODN stimulation. We conclude that monocytes, but not B or T cells, represent the prime source of cytokines. Monocytes up-regulated expression of antigen-presenting, major histocompatibility complex class I and class II molecules in response to CpG DNA. In addition, both monocytes and B cells up-regulate costimulatory CD86 and CD40 molecules. The activation by CpG ODN depended on sequence motifs containing the core dinucleotide CG since destruction of the motif strongly reduced immunostimulatory potential. PMID:10457226

  12. [Evaluation of the quality of clinical practice guidelines published in the Annales de Biologie Clinique with the help of the EFLM checklist].

    PubMed

    Wils, Julien; Fonfrède, Michèle; Augereau, Christine; Watine, Joseph

    2014-01-01

    Several tools are available to help evaluate the quality of clinical practice guidelines (CPG). The AGREE instrument (Appraisal of guidelines for research & evaluation) is the most consensual tool but it has been designed to assess CPG methodology only. The European federation of laboratory medicine (EFLM) recently designed a check-list dedicated to laboratory medicine which is supposed to be comprehensive and which therefore makes it possible to evaluate more thoroughly the quality of CPG in laboratory medicine. In the present work we test the comprehensiveness of this check-list on a sample of CPG written in French and published in Annales de biologie clinique (ABC). Thus we show that some work remains to be achieved before a truly comprehensive check-list is designed. We also show that there is some room for improvement for the CPG published in ABC, for example regarding the fact that some of these CPG do not provide any information about allowed durations of transport and of storage of biological samples before analysis, or about standards of minimal analytical performance, or about the sensitivities or the specificities of the recommended tests.

  13. Regulation of glutamate receptor internalization by the spine cytoskeleton is mediated by its PKA-dependent association with CPG2

    PubMed Central

    Loebrich, Sven; Djukic, Biljana; Tong, Zachary J.; Cottrell, Jeffrey R.; Turrigiano, Gina G.; Nedivi, Elly

    2013-01-01

    A key neuronal mechanism for adjusting excitatory synaptic strength is clathrin-mediated endocytosis of postsynaptic glutamate receptors (GluRs). The actin cytoskeleton is critical for clathrin-mediated endocytosis, yet we lack a mechanistic understanding of its interaction with the endocytic process and how it may be regulated. Here we show that F-actin in dendritic spines physically binds the synaptic nuclear envelope 1 gene product candidate plasticity gene 2 (CPG2) in a PKA-dependent manner, and that this association is required for synaptic GluR internalization. Mutating two PKA sites on CPG2 disrupts its cytoskeletal association, attenuating GluR endocytosis and affecting the efficacy of synaptic transmission in vivo. These results identify CPG2 as an F-actin binding partner that functionally mediates interaction of the spine cytoskeleton with postsynaptic endocytosis. Further, the regulation of CPG2/F-actin association by PKA provides a gateway for cellular control of synaptic receptor internalization through second messenger signaling pathways. Recent identification of human synaptic nuclear envelope 1 as a risk locus for bipolar disorder suggests that CPG2 could play a role in synaptic dysfunction underlying neuropsychiatric disease. PMID:24191017

  14. CpG methylation increases the DNA binding of 9-aminoacridine carboxamide Pt analogues.

    PubMed

    Kava, Hieronimus W; Murray, Vincent

    2016-10-01

    This study investigated the effect of CpG methylation on the DNA binding of cisplatin analogues with an attached aminoacridine intercalator. DNA-targeted 9-aminoacridine carboxamide Pt complexes are known to bind at 5'-CpG sequences. Their binding to methylated and non-methylated 5'-CpG sequences was determined and compared with cisplatin. The damage profiles of each platinum compound were quantified via a polymerase stop assay with fluorescently labelled primers and capillary electrophoresis. Methylation at 5'-CpG was shown to significantly increase the binding intensity for the 9-aminoacridine carboxamide compounds, whereas no significant increase was found for cisplatin. 5'-CpG methylation had the largest effect on the 9-ethanolamine-acridine carboxamide Pt complex, followed by the 9-aminoacridine carboxamide Pt complex and the 7-fluoro complex. The methylation state of a cell's genome is important in maintaining normal gene expression, and is often aberrantly altered in cancer cells. An analogue of cisplatin which differentially targets methylated DNA may be able to improve its therapeutic activity, or alter its range of targets and evade the chemoresistance which hampers cisplatin efficacy in clinical use. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. CpG Oligodeoxynucleotide and Montanide ISA 51 Adjuvant Combination Enhanced the Protective Efficacy of a Subunit Malaria Vaccine

    PubMed Central

    Kumar, Sanjai; Jones, Trevor R.; Oakley, Miranda S.; Zheng, Hong; Kuppusamy, Shanmuga P.; Taye, Alem; Krieg, Arthur M.; Stowers, Anthony W.; Kaslow, David C.; Hoffman, Stephen L.

    2004-01-01

    Unmethylated CpG dinucleotide motifs present in bacterial genomes or synthetic oligodeoxynucleotides (ODNs) serve as strong immunostimulatory agents in mice, monkeys and humans. We determined the adjuvant effect of murine CpG ODN 1826 on the immunogenicity and protective efficacy of the Saccharomyces cerevisiae-expressed 19-kDa C-terminal region of merozoite surface protein 1 (yMSP119) of the murine malaria parasite Plasmodium yoelii. We found that in C57BL/6 mice, following sporozoite challenge, the degree of protective immunity against malaria induced by yMSP119 in a formulation of Montanide ISA 51 (ISA) plus CpG ODN 1826 was similar or superior to that conferred by yMSP119 emulsified in complete Freund's adjuvant (CFA/incomplete Freund's adjuvant). In total, among mice immunized with yMSP119, 22 of 32 (68.7%) with ISA plus CpG 1826, 0 of 4 (0%) with CFA/incomplete Freund’s adjuvant, 0 of 4 (0%) with CpG 1826 mixed with ISA (no yMSP119), and 0 of 11 (0%) with CpG 1826 alone were completely protected against development of erythrocytic stage infection after sporozoite challenge. The adjuvant effect of CpG ODN 1826 was manifested as both significantly improved complete protection from malaria (defined as the absence of detectable erythrocytic form parasites) (P = 0.007, chi square) and reduced parasite burden in infected mice. In vivo depletions of interleukin-12 and gamma interferon cytokines and CD4+ and CD8+ T cells in vaccinated mice had no significant effect on immunity. On the other hand, immunoglobulin G (IgG) isotype levels appeared to correlate with protection. Inclusion of CpG ODN 1826 in the yMSP119 plus ISA vaccine contributed towards the induction of higher levels of IgG2a and IgG2b (Th1 type) antibodies, suggesting that CpG ODN 1826 caused a shift towards a Th1 type of immune response that could be responsible for the higher degree of protective immunity. Our results indicate that this potent adjuvant formulation should be further evaluated for use in clinical trials of recombinant malarial vaccine candidates. PMID:14742540

  16. Molecular characterization and transcriptional analysis of the female-enriched chondroitin proteoglycan 2 of Toxocara canis.

    PubMed

    Ma, G X; Zhou, R Q; Hu, L; Luo, Y L; Luo, Y F; Zhu, H H

    2018-03-01

    Toxocara canis is an important but neglected zoonotic parasite, and is the causative agent of human toxocariasis. Chondroitin proteoglycans are biological macromolecules, widely distributed in extracellular matrices, with a great diversity of functions in mammals. However, there is limited information regarding chondroitin proteoglycans in nematode parasites. In the present study, a female-enriched chondroitin proteoglycan 2 gene of T. canis (Tc-cpg-2) was cloned and characterized. Quantitative real-time polymerase chain reaction (qRT-PCR) was employed to measure the transcription levels of Tc-cpg-2 among tissues of male and female adult worms. A 485-amino-acid (aa) polypeptide was predicted from a continuous 1458-nuleotide open reading frame and designated as TcCPG2, which contains a 21-aa signal peptide. Conserved domain searching indicated three chitin-binding peritrophin-A (CBM_14) domains in the amino acid sequence of TcCPG2. Multiple alignment with the inferred amino acid sequences of Caenorhabditis elegans and Ascaris suum showed that CBM_14 domains were well conserved among these species. Phylogenetic analysis suggested that TcCPG2 was closely related to the sequence of chondroitin proteoglycan 2 of A. suum. Interestingly, a high level of Tc-cpg-2 was detected in female germline tissues, particularly in the oviduct, suggesting potential roles of this gene in reproduction (e.g. oogenesis and embryogenesis) of adult T. canis. The functional roles of Tc-cpg-2 in reproduction and development in this parasite and related parasitic nematodes warrant further functional studies.

  17. Validation of DAB2IP methylation and its relative significance in predicting outcome in renal cell carcinoma

    PubMed Central

    Zhao, Liang-Yun; Kapur, Payal; Wu, Kai-Jie; Wang, Bin; Yu, Yan-Hong; Liao, Bing; He, Da-Lin; Chen, Wei; Margulis, Vitaly; Hsieh, Jer-Tsong; Luo, Jun-Hang

    2016-01-01

    We have recently reported tumor suppressive role of DAB2IP in RCC development. In this study, We identified one CpG methylation biomarker (DAB2IP CpG1) located UTSS of DAB2IP that was associated with poor overall survival in a cohort of 318 ccRCC patients from the Cancer Genome Atlas (TCGA). We further validated the prognostic accuracy of DAB2IP CpG methylation by pyrosequencing quantitative methylation assay in 224 ccRCC patients from multiple Chinese centers (MCHC set), and 239 patients from University of Texas Southwestern Medical Center at Dallas (UTSW set) by using FFPE samples. DAB2IP CpG1 can predict the overall survival of patients in TCGA, MCHC, and UTSW sets independent of patient age, Fuhrman grade and TNM stage (all p<0.05). DAB2IP CpG1 successfully categorized patients into high-risk and low-risk groups with significant differences of clinical outcome in respective clinical subsets, regardless of age, sex, grade, stage, or race (HR: 1.63-7.83; all p<0.05). The detection of DAB2IP CpG1 methylation was minimally affected by ITH in ccRCC. DAB2IP mRNA expression was regulated by DNA methylation in vitro. DAB2IP CpG1 methylation is a practical and repeatable biomarker for ccRCC, which can provide prognostic value that complements the current staging system. PMID:27129174

  18. Coordination of Fictive Motor Activity in the Larval Zebrafish Is Generated by Non-Segmental Mechanisms

    PubMed Central

    Wiggin, Timothy D.; Peck, Jack H.; Masino, Mark A.

    2014-01-01

    The cellular and network basis for most vertebrate locomotor central pattern generators (CPGs) is incompletely characterized, but organizational models based on known CPG architectures have been proposed. Segmental models propose that each spinal segment contains a circuit that controls local coordination and sends longer projections to coordinate activity between segments. Unsegmented/continuous models propose that patterned motor output is driven by gradients of neurons and synapses that do not have segmental boundaries. We tested these ideas in the larval zebrafish, an animal that swims in discrete episodes, each of which is composed of coordinated motor bursts that progress rostrocaudally and alternate from side to side. We perturbed the spinal cord using spinal transections or strychnine application and measured the effect on fictive motor output. Spinal transections eliminated episode structure, and reduced both rostrocaudal and side-to-side coordination. Preparations with fewer intact segments were more severely affected, and preparations consisting of midbody and caudal segments were more severely affected than those consisting of rostral segments. In reduced preparations with the same number of intact spinal segments, side-to-side coordination was more severely disrupted than rostrocaudal coordination. Reducing glycine receptor signaling with strychnine reversibly disrupted both rostrocaudal and side-to-side coordination in spinalized larvae without disrupting episodic structure. Both spinal transection and strychnine decreased the stability of the motor rhythm, but this effect was not causal in reducing coordination. These results are inconsistent with a segmented model of the spinal cord and are better explained by a continuous model in which motor neuron coordination is controlled by segment-spanning microcircuits. PMID:25275377

  19. Protective immunity against Megalocytivirus infection in rock bream (Oplegnathus fasciatus) following CpG ODN administration.

    PubMed

    Jung, Myung-Hwa; Lee, Jehee; Ortega-Villaizan, M; Perez, Luis; Jung, Sung-Ju

    2017-06-27

    Rock bream iridovirus (RBIV) disease in rock bream (Oplegnathus fasciatus) remains an unsolved problem in Korea aquaculture farms. CpG ODNs are known as immunostimulant, can improve the innate immune system of fish providing resistance to diseases. In this study, we evaluated the potential of CpG ODNs to induce anti-viral status protecting rock bream from different RBIV infection conditions. We found that, when administered into rock bream, CpG ODN 1668 induces better antiviral immune responses compared to other 5 CpG ODNs (2216, 1826, 2133, 2395 and 1720). All CpG ODN 1668 administered fish (1/5µg) at 2days before infection (1.1×10 7 ) held at 26°C died even though mortality was delayed from 8days (1µg) and 4days (5µg). Similarly, CpG ODN 1668 administered (5µg) at 2days before infection (1.2×10 6 ) held at 23/20°C had 100% mortality; the mortality was delayed from 9days (23°C) and 11days (20°C). Moreover, when CpG ODN 1668 administered (1/5/10µg) at 2/4/7days before infection or virus concentration was decreased to 1.1×10 4 and held at 20°C had mortality rates of 20/60/30% (2days), 30/40/60% (4days) and 60/60/20% (7days), respectively, for the respective administration dose, through 100 dpi. To investigate the development of a protective immune response, survivors were re-infected with RBIV (1.1×10 7 ) at 100 and 400 dpi, respectively. While 100% of the previously unexposed fish died, 100% of the previously infected fish survived. The high survival rate of fish following re-challenge with RBIV indicates that protective immunity was established in the surviving rock bream. Our results showed the possibility of developing preventive measures against RBIV using CpG ODN 1668 by reducing RBIV replication speed (i.e. water temperature of 20°C and infection dose of 1.1×10 4 ). Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Enhanced early innate and T cell-mediated responses in subjects immunized with Anthrax Vaccine Adsorbed Plus CPG 7909 (AV7909).

    PubMed

    Minang, Jacob T; Inglefield, Jon R; Harris, Andrea M; Lathey, Janet L; Alleva, David G; Sweeney, Diane L; Hopkins, Robert J; Lacy, Michael J; Bernton, Edward W

    2014-11-28

    NuThrax™ (Anthrax Vaccine Adsorbed with CPG 7909 Adjuvant) (AV7909) is in development. Samples obtained in a phase Ib clinical trial were tested to confirm biomarkers of innate immunity and evaluate effects of CPG 7909 (PF-03512676) on adaptive immunity. Subjects received two intramuscular doses of commercial BioThrax(®) (Anthrax Vaccine Adsorbed, AVA), or two intramuscular doses of one of four formulations of AV7909. IP-10, IL-6, and C-reactive protein (CRP) levels were elevated 24-48 h after administration of AV7909 formulations, returning to baseline by Day 7. AVA (no CPG 7909) resulted in elevated IL-6 and CRP, but not IP-10. Another marker of CpG, transiently decreased absolute lymphocyte counts (ALCs), correlated with transiently increased IP-10. Cellular recall responses to anthrax protective antigen (PA) or PA peptides were assessed by IFN-γ ELISpot assay performed on cryopreserved PBMCs obtained from subjects prior to immunization and 7 days following the second immunization (study day 21). One-half of subjects that received AV7909 with low-dose (0.25mg/dose) CPG 7909 possessed positive Day 21 T cell responses to PA. In contrast, positive T cell responses occurred at an 11% average rate (1/9) for AVA-treated subjects. Differences in cellular responses due to dose level of CPG 7909 were not associated with differences in humoral anti-PA IgG responses, which were elevated for recipients of AV7909 compared to recipients of AVA. Serum markers at 24 or 48 h (i.e. % ALC decrease, or increase in IL-6, IP-10, or CRP) correlated with the humoral (antibody) responses 1 month later, but did not correlate with cellular ELISpot responses. In summary, biomarkers of early responses to CPG 7909 were confirmed, and adding a CpG adjuvant to a vaccine administered twice resulted in increased T cell effects relative to vaccine alone. Changes in early biomarkers correlated with subsequent adaptive humoral immunity but not cellular immunity. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  1. 10 kW SOFC Power System Commercialization

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dan Norrick; Brad Palmer; Charles Vesely

    2006-02-01

    Cummins Power Generation (CPG) as the prime contractor and SOFCo-EFS Holdings LLC (SOFCo), as their subcontractor, teamed under the Solid-state Energy Conversion Alliance (SECA) program to develop 3-10kW solid oxide fuel cell systems for use in recreational vehicles, commercial work trucks and stand-by telecommunications applications. The program goal is demonstration of power systems that meet commercial performance requirements and can be produced in volume at a cost of $400/kW. This report summarizes the team's activities during the seventh six-month period (July-December 2005) of the four-year Phase I effort. While there has been significant progress in the development of the SOFCmore » subsystems that can support meeting the program Phase 1 goals, the SOFCo ceramic stack technology has progressed significantly slower than plan and CPG consider it unlikely that the systemic problems encountered will be overcome in the near term. SOFCo has struggled with a series of problems associated with inconsistent manufacturing, inadequate cell performance, and the achievement of consistent, durable, low resistance inter-cell connections with reduced or no precious materials. A myriad of factors have contributed to these problems, but the fact remains that progress has not kept pace with the SECA program. A contributing factor in SOFCo's technical difficulties is attributed to their significantly below plan industry cost share spending over the last four years. This has resulted in a much smaller SOFC stack development program, has contributed to SOFCo not being able to aggressively resolve core issues, and clouds their ability to continue into a commercialization phase. In view of this situation, CPG has conducted an independent assessment of the state-of-the-art in planar SOFC's stacks and have concluded that alternative technology exists offering the specific performance, durability, and low cost needed to meet the SECA objectives. We have further concluded that there is insufficient evidence to reliably predict that SOFCo will be able to achieve the SECA performance and cost goals on a schedule consistent with SECA or CPG commercialization goals. CPG believes SOFCo have made a good faith effort consistent with the available resources, but have repeatedly fallen short of achieving the programs scheduled targets. CPG has therefore initiated a process of application for extension of Phase 1 of our SECA program with the intent of transitioning to an alternative stack supplier with more mature SOFC technology, and demonstrating a system meeting the SECA Phase 1 goals by the end of calendar 2006. We have identified an alternative supplier and will be reporting the progress on transition and program planning in monthly technical reports, reviews, and in the next semiannual report.« less

  2. Epicutaneous immunization with ovalbumin and CpG induces TH1/TH17 cytokines, which regulate IgE and IgG2a production

    PubMed Central

    Majewska-Szczepanik, Monika; Askenase, Philip W.; Lobo, Francis M.; Marcińska, Katarzyna; Wen, Li; Szczepanik, Marian

    2017-01-01

    Background Subcutaneous allergen-specific immunotherapy is a standard route for the immunotherapy of allergic diseases. It modulates the course of allergy and can generate long-term remission. However, subcutaneous allergen-specific immunotherapy can also induce anaphylaxis in some patients, and therefore additional routes of administration should be investigated to improve the safety and tolerability of immunotherapy. Objective We sought to determine whether epicutaneous treatment with antigen in the presence of a Toll-like receptor 9 agonist can suppress TH2-mediated responses in an antigen-specific manner. Methods Epicutaneous immunization was performed by applying a skin patch soaked with ovalbumin (OVA) plus CpG, and its suppressor activity was determined by using the mouse model of atopic dermatitis. Finally, adoptive cell transfers were implemented to characterize the regulatory cells that are induced by epicutaneous immunization. Results Epicutaneous immunization with OVA and CpG reduces the production of OVA-specific IgE and increases the synthesis of OVA-specific IgG2a antibodies in an antigen-specific manner. Moreover, eosinophil peroxidase activity in the skin and production of IL-4, IL-5, IL-10, and IL-13 are suppressed. The observed reduction of IgE synthesis is transferable with T-cell receptor (TCR) αβ+CD4+CD25− cells, whereas IgG2a production is dependent on both TCRαβ+ and TCRγδ+ T cells. Further experiments show that the described phenomenon is myeloid differentiation primary response 88, IFN-γ, and IL-17A dependent. Finally, the results suggest that epicutaneous immunization with OVA and CpG decreases the synthesis of OVA-specific IgE and skin eosinophil peroxidase activity in mice with ongoing skin allergy. Conclusion Epicutaneous application of protein antigen in the presence of adjuvant could be an attractive needle-free and self-administered immunotherapy for allergic diseases. PMID:26810716

  3. Construction and characterization of normalized cDNA libraries by 454 pyrosequencing and estimation of DNA methylation levels in three distantly related termite species.

    PubMed

    Hayashi, Yoshinobu; Shigenobu, Shuji; Watanabe, Dai; Toga, Kouhei; Saiki, Ryota; Shimada, Keisuke; Bourguignon, Thomas; Lo, Nathan; Hojo, Masaru; Maekawa, Kiyoto; Miura, Toru

    2013-01-01

    In termites, division of labor among castes, categories of individuals that perform specialized tasks, increases colony-level productivity and is the key to their ecological success. Although molecular studies on caste polymorphism have been performed in termites, we are far from a comprehensive understanding of the molecular basis of this phenomenon. To facilitate future molecular studies, we aimed to construct expressed sequence tag (EST) libraries covering wide ranges of gene repertoires in three representative termite species, Hodotermopsis sjostedti, Reticulitermes speratus and Nasutitermes takasagoensis. We generated normalized cDNA libraries from whole bodies, except for guts containing microbes, of almost all castes, sexes and developmental stages and sequenced them with the 454 GS FLX titanium system. We obtained >1.2 million quality-filtered reads yielding >400 million bases for each of the three species. Isotigs, which are analogous to individual transcripts, and singletons were produced by assembling the reads and annotated using public databases. Genes related to juvenile hormone, which plays crucial roles in caste differentiation of termites, were identified from the EST libraries by BLAST search. To explore the potential for DNA methylation, which plays an important role in caste differentiation of honeybees, tBLASTn searches for DNA methyltransferases (dnmt1, dnmt2 and dnmt3) and methyl-CpG binding domain (mbd) were performed against the EST libraries. All four of these genes were found in the H. sjostedti library, while all except dnmt3 were found in R. speratus and N. takasagoensis. The ratio of the observed to the expected CpG content (CpG O/E), which is a proxy for DNA methylation level, was calculated for the coding sequences predicted from the isotigs and singletons. In all of the three species, the majority of coding sequences showed depletion of CpG O/E (less than 1), and the distributions of CpG O/E were bimodal, suggesting the presence of DNA methylation.

  4. Construction and Characterization of Normalized cDNA Libraries by 454 Pyrosequencing and Estimation of DNA Methylation Levels in Three Distantly Related Termite Species

    PubMed Central

    Hayashi, Yoshinobu; Shigenobu, Shuji; Watanabe, Dai; Toga, Kouhei; Saiki, Ryota; Shimada, Keisuke; Bourguignon, Thomas; Lo, Nathan; Hojo, Masaru; Maekawa, Kiyoto; Miura, Toru

    2013-01-01

    In termites, division of labor among castes, categories of individuals that perform specialized tasks, increases colony-level productivity and is the key to their ecological success. Although molecular studies on caste polymorphism have been performed in termites, we are far from a comprehensive understanding of the molecular basis of this phenomenon. To facilitate future molecular studies, we aimed to construct expressed sequence tag (EST) libraries covering wide ranges of gene repertoires in three representative termite species, Hodotermopsis sjostedti , Reticulitermessperatus and Nasutitermestakasagoensis . We generated normalized cDNA libraries from whole bodies, except for guts containing microbes, of almost all castes, sexes and developmental stages and sequenced them with the 454 GS FLX titanium system. We obtained >1.2 million quality-filtered reads yielding >400 million bases for each of the three species. Isotigs, which are analogous to individual transcripts, and singletons were produced by assembling the reads and annotated using public databases. Genes related to juvenile hormone, which plays crucial roles in caste differentiation of termites, were identified from the EST libraries by BLAST search. To explore the potential for DNA methylation, which plays an important role in caste differentiation of honeybees, tBLASTn searches for DNA methyltransferases (dnmt1, dnmt2 and dnmt3) and methyl-CpG binding domain (mbd) were performed against the EST libraries. All four of these genes were found in the H . sjostedti library, while all except dnmt3 were found in R . speratus and N . takasagoensis . The ratio of the observed to the expected CpG content (CpG O/E), which is a proxy for DNA methylation level, was calculated for the coding sequences predicted from the isotigs and singletons. In all of the three species, the majority of coding sequences showed depletion of CpG O/E (less than 1), and the distributions of CpG O/E were bimodal, suggesting the presence of DNA methylation. PMID:24098800

  5. Transcultural Endocrinology: Adapting Type-2 Diabetes Guidelines on a Global Scale.

    PubMed

    Nieto-Martínez, Ramfis; González-Rivas, Juan P; Florez, Hermes; Mechanick, Jeffrey I

    2016-12-01

    Type-2 diabetes (T2D) needs to be prevented and treated effectively to reduce its burden and consequences. White papers, such as evidence-based clinical practice guidelines (CPG) and their more portable versions, clinical practice algorithms and clinical checklists, may improve clinical decision-making and diabetes outcomes. However, CPG are underused and poorly validated. Protocols that translate and implement these CPG are needed. This review presents the global dimension of T2D, details the importance of white papers in the transculturalization process, compares relevant international CPG, analyzes cultural variables, and summarizes translation strategies that can improve care. Specific protocols and algorithmic tools are provided. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Transcutaneous immunization with tetanus toxoid and mutants of Escherichia coli heat-labile enterotoxin as adjuvants elicits strong protective antibody responses.

    PubMed

    Tierney, Rob; Beignon, Anne-Sophie; Rappuoli, Rino; Muller, Sylviane; Sesardic, Dorothea; Partidos, Charalambos D

    2003-09-01

    In this study, the adjuvanticity of 2 nontoxic derivatives (LTK63 and LTR72) of heat-labile enterotoxin of Escherichia coli (LT) was evaluated and was compared with that of a cytosine phosphodiester-guanine (CpG) motif, after transcutaneous immunization with tetanus toxoid (TT). TT plus LTR72 elicited the strongest antibody responses, compared with those elicited by the other vaccines (TT, TT plus LTK63, TT plus CpG, and TT plus LTK63 plus CpG); it neutralized the toxin and conferred full protection after passive transfer in mice. Preexisting immunity to LT mutants did not adversely affect their adjuvant potency. Both LTK63 and LTR72 promoted the induction of IgG1 antibodies. In contrast, mice receiving either CpG motif alone or CpG motif plus LTK63 produced strong IgG2a anti-TT antibody responses. Overall, these findings demonstrate that mutants of enterotoxins with reduced toxicity are effective adjuvants for transcutaneous immunization.

  7. [The effect of entrapment of CpG sequence with cationic PLG nanoparticles on the immune responses of mice to pig paratyphoid vaccine].

    PubMed

    Wu, Mei; Shi, Ling; Liu, Shigui; Li, Jiangling; Wu, Kaiyuan; Wang, Lihuan; Shen, Yi; Liu, Kun; Zheng, Yong; Zhang, Xinshen; Gao, Rong

    2005-10-01

    Cationic PLG nanoparticles and liposome were prepared and used as package molecules to pack up pUC18-CpG. The effects of the packed pUC18-CpG on the cellular and humoral immune responses were detected in the mice that were inoculated with pig paratyphoid vaccine. The results showed that compared with the control, the amount of IgG and the titre of specific antibody were significantly increased in the sera of mice immunized with the CpG plasmid entrapped by cationic PLG nanoparticles; the proliferation and induced IL-2 bioactivity of lymphocytes were significantly enhanced in the spleen of the immunized mice; the stimulatory effect of cationic PLG nanoparticles was similar to or stronger than that of cationic liposome. These indicated that cationic PLG nanoparticle could be employed as an effective package molecule to promote the immunostimulatory effect of pUC18-CpG.

  8. Identification of body fluid-specific DNA methylation markers for use in forensic science.

    PubMed

    Park, Jong-Lyul; Kwon, Oh-Hyung; Kim, Jong Hwan; Yoo, Hyang-Sook; Lee, Han-Chul; Woo, Kwang-Man; Kim, Seon-Young; Lee, Seung-Hwan; Kim, Yong Sung

    2014-11-01

    DNA methylation, which occurs at the 5'-position of the cytosine in CpG dinucleotides, has great potential for forensic identification of body fluids, because tissue-specific patterns of DNA methylation have been demonstrated, and DNA is less prone to degradation than proteins or RNA. Previous studies have reported several body fluid-specific DNA methylation markers, but DNA methylation differences are sometimes low in saliva and vaginal secretions. Moreover, specific DNA methylation markers in four types of body fluids (blood, saliva, semen, and vaginal secretions) have not been investigated with genome-wide profiling. Here, we investigated novel DNA methylation markers for identification of body fluids for use in forensic science using the Illumina HumanMethylation 450K bead array, which contains over 450,000 CpG sites. Using methylome data from 16 samples of blood, saliva, semen, and vaginal secretions, we first selected 2986 hypermethylated or hypomethylated regions that were specific for each type of body fluid. We then selected eight CpG sites as novel, forensically relevant DNA methylation markers: cg06379435 and cg08792630 for blood, cg26107890 and cg20691722 for saliva, cg23521140 and cg17610929 for semen, and cg01774894 and cg14991487 for vaginal secretions. These eight selected markers were evaluated in 80 body fluid samples using pyrosequencing, and all showed high sensitivity and specificity for identification of the target body fluid. We suggest that these eight DNA methylation markers may be good candidates for developing an effective molecular assay for identification of body fluids in forensic science. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  9. CpG island methylation phenotype (CIMP) in oral cancer: associated with a marked inflammatory response and less aggressive tumour biology.

    PubMed

    Shaw, Richard J; Hall, Gillian L; Lowe, Derek; Bowers, Naomi L; Liloglou, Triantafillos; Field, John K; Woolgar, Julia A; Risk, Janet M

    2007-10-01

    Studies in several tumour sites highlight the significance of the CpG island methylation phenotype (CIMP), with distinct features of histology, biological aggression and outcome. We utilise pyrosequencing techniques of quantitative methylation analysis to investigate the presence of CIMP in oral squamous cell carcinoma (OSCC) for the first time, and evaluate its correlation with allelic imbalance, pathology and clinical behaviour. Tumour tissue, control tissue and PBLs were obtained from 74 patients with oral squamous cell carcinoma. Pyrosequencing was used to analyse methylation patterns in 75-200 bp regions of the CpG rich gene promoters of 10 genes with a broad range of cellular functions. Allelic imbalance was investigated using a multiplexed panel of 11 microsatellite markers. Corresponding variables, histopathological staging and grading were correlated with these genetic and epigenetic aberrations. A cluster of tumours with a greater degree of promoter methylation than would be predicted by chance alone (P=0.001) were designated CIMP+ve. This group had less aggressive tumour biology in terms of tumour thickness (p=0.015) and nodal metastasis (P=0.012), this being apparently independent of tumour diameter. Further, it seems that these CIMP+ve tumours excited a greater host inflammatory response (P=0.019). The exact mechanisms underlying CIMP remain obscure but the association with a greater inflammatory host response supports existing theories relating these features in other tumour sites. As CIMP has significant associations with other well documented prognostic indicators, it may prove beneficial to include methylation analyses in molecular risk modelling of tumours.

  10. DNA Methylation of Gene Expression in Acanthamoeba castellanii Encystation.

    PubMed

    Moon, Eun-Kyung; Hong, Yeonchul; Lee, Hae-Ahm; Quan, Fu-Shi; Kong, Hyun-Hee

    2017-04-01

    Encystation mediating cyst specific cysteine proteinase (CSCP) of Acanthamoeba castellanii is expressed remarkably during encystation. However, the molecular mechanism involved in the regulation of CSCP gene expression remains unclear. In this study, we focused on epigenetic regulation of gene expression during encystation of Acanthamoeba . To evaluate methylation as a potential mechanism involved in the regulation of CSCP expression, we first investigated the correlation between promoter methylation status of CSCP gene and its expression. A 2,878 bp of promoter sequence of CSCP gene was amplified by PCR. Three CpG islands (island 1-3) were detected in this sequence using bioinformatics tools. Methylation of CpG island in trophozoites and cysts was measured by bisulfite sequence PCR. CSCP promoter methylation of CpG island 1 (1,633 bp) was found in 8.2% of trophozoites and 7.3% of cysts. Methylation of CpG island 2 (625 bp) was observed in 4.2% of trophozoites and 5.8% of cysts. Methylation of CpG island 3 (367 bp) in trophozoites and cysts was both 3.6%. These results suggest that DNA methylation system is present in CSCP gene expression of Acanthamoeba . In addition, the expression of encystation mediating CSCP is correlated with promoter CpG island 1 hypomethylation.

  11. Methylation pattern of fish lymphocystis disease virus DNA.

    PubMed

    Wagner, H; Simon, D; Werner, E; Gelderblom, H; Darai, C; Flügel, R M

    1985-03-01

    The content and distribution of 5-methylcytosine in DNA from fish lymphocystis disease virus was analyzed by high-pressure liquid chromatography, nearest-neighbor analysis, and with restriction endonucleases. We found that 22% of all C residues were methylated, including methylation of the following dinucleotide sequences: CpG to 75%, CpC to ca. 1%, and CpA to 2 to 5%. Comparison of relative digestion of viral DNA with MspI and HpaII indicated that CCGG sequences were almost completely methylated at the inner C. The degree of methylation of GCGC was much lower. The methylation pattern of fish lymphocystis disease virus DNA differed from that of the host cell DNA.

  12. Methylation pattern of fish lymphocystis disease virus DNA.

    PubMed Central

    Wagner, H; Simon, D; Werner, E; Gelderblom, H; Darai, C; Flügel, R M

    1985-01-01

    The content and distribution of 5-methylcytosine in DNA from fish lymphocystis disease virus was analyzed by high-pressure liquid chromatography, nearest-neighbor analysis, and with restriction endonucleases. We found that 22% of all C residues were methylated, including methylation of the following dinucleotide sequences: CpG to 75%, CpC to ca. 1%, and CpA to 2 to 5%. Comparison of relative digestion of viral DNA with MspI and HpaII indicated that CCGG sequences were almost completely methylated at the inner C. The degree of methylation of GCGC was much lower. The methylation pattern of fish lymphocystis disease virus DNA differed from that of the host cell DNA. Images PMID:3973962

  13. Exosome-based tumor antigens-adjuvant co-delivery utilizing genetically engineered tumor cell-derived exosomes with immunostimulatory CpG DNA.

    PubMed

    Morishita, Masaki; Takahashi, Yuki; Matsumoto, Akihiro; Nishikawa, Makiya; Takakura, Yoshinobu

    2016-12-01

    For cancer immunotherapy via tumor antigen vaccination in combination with an adjuvant, major challenges include the identification of a particular tumor antigen and efficient delivery of the antigen as well as adjuvant to antigen-presenting cells. In this study, we proposed an efficient exosome-based tumor antigens-adjuvant co-delivery system using genetically engineered tumor cell-derived exosomes containing endogenous tumor antigens and immunostimulatory CpG DNA. Murine melanoma B16BL6 cells were transfected with a plasmid vector encoding a fusion streptavidin (SAV; a protein that binds to biotin with high affinity)-lactadherin (LA; an exosome-tropic protein) protein, yielding genetically engineered SAV-LA-expressing exosomes (SAV-exo). SAV-exo were combined with biotinylated CpG DNA to prepare CpG DNA-modified exosomes (CpG-SAV-exo). Fluorescent microscopic observation revealed the successful modification of exosomes with CpG DNA by SAV-biotin interaction. CpG-SAV-exo showed efficient and simultaneous delivery of exosomes with CpG DNA to murine dendritic DC2.4 cells in culture. Treatment with CpG-SAV-exo effectively activated DC2.4 cells and enhanced tumor antigen presentation capacity. Immunization with CpG-SAV-exo exhibited stronger in vivo antitumor effects in B16BL6 tumor-bearing mice than simple co-administration of exosomes and CpG DNA. Thus, genetically engineered CpG-SAV-exo is an effective exosome-based tumor antigens-adjuvant co-delivery system that will be useful for cancer immunotherapy. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Topical CpG Adjuvantation of a Protein-Based Vaccine Induces Protective Immunity to Listeria monocytogenes

    PubMed Central

    Cheng, Wing Ki; Wee, Kathleen; Kollmann, Tobias R.

    2014-01-01

    Robust CD8+ T cell responses are essential for immune protection against intracellular pathogens. Using parenteral administration of ovalbumin (OVA) protein as a model antigen, the effect of the Toll-like receptor 9 (TLR9) agonist, CpG oligodeoxynucleotide (ODN) 1826, as an adjuvant delivered either topically, subcutaneously, or intramuscularly on antigen-specific CD8+ T cell responses in a mouse model was evaluated. Topical CpG adjuvant increased the frequency of OVA-specific CD8+ T cells in the peripheral blood and in the spleen. The more effective strategy to administer topical CpG adjuvant to enhance CD8+ T cell responses was single-dose administration at the time of antigen injection with a prime-boost regimen. Topical CpG adjuvant conferred both rapid and long-lasting protection against systemic challenge with recombinant Listeria monocytogenes expressing the cytotoxic T lymphocyte (CTL) epitope of OVA257–264 (strain Lm-OVA) in a TLR9-dependent manner. Topical CpG adjuvant induced a higher proportion of CD8+ effector memory T cells than parenteral administration of the adjuvant. Although traditional vaccination strategies involve coformulation of antigen and adjuvant, split administration using topical adjuvant is effective and has advantages of safety and flexibility. Split administration of topical CpG ODN 1826 with parenteral protein antigen is superior to other administration strategies in enhancing both acute and memory protective CD8+ T cell immune responses to subcutaneous protein vaccines. This vaccination strategy induces rapid and persistent protective immune responses against the intracellular organism L. monocytogenes. PMID:24391136

  15. Synergy of anti-CD40, CpG and MPL in activation of mouse macrophages

    PubMed Central

    Shi, Yongyu; Felder, Mildred A.R.; Sondel, Paul M.; Rakhmilevich, Alexander L.

    2015-01-01

    Activation of macrophages is a prerequisite for their antitumor effects. Several reagents, including agonistic anti-CD40 monoclonal antibody (anti-CD40), CpG oligodeoxynucleotides (CpG) and monophosphoryl lipid A (MPL), can stimulate activation of macrophages. Our previous studies showed synergy between anti-CD40 and CpG and between anti-CD40 and MPL in macrophage activation and antitumor efficacy in mice. In the present study, we asked whether there was synergy among these three reagents. The activation of adherent peritoneal exudate cells (PEC) obtained from mice injected with anti-CD40 and then treated with CpG and/or MPL in vitro was determined by their ability to suppress proliferation of tumor cells and to produce various cytokines and chemokines in vitro. Cell sorting and histology followed by functional testing showed that macrophages were the main cell population in PEC activated by CD40 ligation in vivo. A combination of anti-CD40, CpG or MPL activated PEC to suppress proliferation of B16 cells and produce nitric oxide far greater than the single reagents or any of the double combinations of these reagents. In addition, the combination of all three reagents activated PEC to secrete IL-12, IFN-γ and MCP-1 to a greater degree than any single reagent or any two combined reagents. These results demonstrate that macrophages can be synergistically activated by anti-CD40, CpG and MPL, suggesting that this novel combined approach might be further investigated as potential cancer therapy. PMID:25829245

  16. Synergy of anti-CD40, CpG and MPL in activation of mouse macrophages.

    PubMed

    Shi, Yongyu; Felder, Mildred A R; Sondel, Paul M; Rakhmilevich, Alexander L

    2015-08-01

    Activation of macrophages is a prerequisite for their antitumor effects. Several reagents, including agonistic anti-CD40 monoclonal antibody (anti-CD40), CpG oligodeoxynucleotides (CpG) and monophosphoryl lipid A (MPL), can stimulate activation of macrophages. Our previous studies showed synergy between anti-CD40 and CpG and between anti-CD40 and MPL in macrophage activation and antitumor efficacy in mice. In the present study, we asked whether there was synergy among these three reagents. The activation of adherent peritoneal exudate cells (PEC) obtained from mice injected with anti-CD40 and then treated with CpG and/or MPL in vitro was determined by their ability to suppress proliferation of tumor cells and to produce various cytokines and chemokines in vitro. Cell sorting and histology followed by functional testing showed that macrophages were the main cell population in PEC activated by CD40 ligation in vivo. A combination of anti-CD40, CpG or MPL activated PEC to suppress proliferation of B16 cells and produce nitric oxide far greater than the single reagents or any of the double combinations of these reagents. In addition, the combination of all three reagents activated PEC to secrete IL-12, IFN-γ and MCP-1 to a greater degree than any single reagent or any two combined reagents. These results demonstrate that macrophages can be synergistically activated by anti-CD40, CpG and MPL, suggesting that this novel combined approach might be further investigated as potential cancer therapy. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Use of DNA from human stools to detect aberrant CpG island methylation of genes implicated in colorectal cancer.

    PubMed

    Belshaw, Nigel J; Elliott, Giles O; Williams, Elizabeth A; Bradburn, David M; Mills, Sarah J; Mathers, John C; Johnson, Ian T

    2004-09-01

    Hypermethylation of cytosine residues in the CpG islands of tumor suppressor genes is a key mechanism of colorectal carcinogenesis. Detection and quantification of CpG island methylation in human DNA isolated from stools might provide a novel strategy for the detection and investigation of colorectal neoplasia. To explore the feasibility of this approach, colorectal biopsies and fecal samples were obtained from 32 patients attending for colonoscopy or surgery, who were found to have adenomatous polyps, colorectal cancer, or no evidence of neoplasia. A further 18 fecal samples were obtained from healthy volunteers, with no bowel symptoms. Isolated DNA was modified with sodium bisulfite and analyzed by methylation-specific PCR and combined bisulfite restriction analysis for CpG island methylation of ESR1, MGMT, HPP1, p16(INK4a), APC, and MLH1. CpG island methylation was readily detectable in both mucosal and fecal DNA with methylation-specific PCR. Using combined bisulfite restriction analysis, it was established that, in volunteers from whom biopsies were available, the levels of methylation at two CpG sites within ESR1 assayed using fecal DNA were significantly correlated with methylation in DNA from colorectal mucosa. Thus, noninvasive techniques can be used to obtain quantitative information about the level of CpG island methylation in human colorectal mucosa. The methods described here could be applied to a much expanded range of genes and may be valuable both for screening purposes and to provide greater insight into the functional consequences of epigenetic changes in the colorectal mucosa of free-living individuals.

  18. Sexual epigenetic dimorphism in the human placenta: implications for susceptibility during the prenatal period.

    PubMed

    Martin, Elizabeth; Smeester, Lisa; Bommarito, Paige A; Grace, Matthew R; Boggess, Kim; Kuban, Karl; Karagas, Margaret R; Marsit, Carmen J; O'Shea, T Michael; Fry, Rebecca C

    2017-03-01

    Sex-based differences in response to adverse prenatal environments and infant outcomes have been observed, yet the underlying mechanisms for this are unclear. The placental epigenome may be a driver of these differences. Placental DNA methylation was assessed at more than 480,000 CpG sites from male and female infants enrolled in the extremely low gestational age newborns cohort (ELGAN) and validated in a separate US-based cohort. The impact of gestational age on placental DNA methylation was further examined using the New Hampshire Birth Cohort Study for a total of n = 467 placentas. A total of n = 2745 CpG sites, representing n = 587 genes, were identified as differentially methylated (p < 1 × 10 -7 ). The majority (n = 582 or 99%) of these were conserved among the New Hampshire Birth Cohort. The identified genes encode proteins related to immune function, growth/transcription factor signaling and transport across cell membranes. These data highlight sex-dependent epigenetic patterning in the placenta and provide insight into differences in infant outcomes and responses to the perinatal environment.

  19. Genome-wide CpG island methylation and intergenic demethylation propensities vary among different tumor sites.

    PubMed

    Lee, Seung-Tae; Wiemels, Joseph L

    2016-02-18

    The epigenetic landscape of cancer includes both focal hypermethylation and broader hypomethylation in a genome-wide manner. By means of a comprehensive genomic analysis on 6637 tissues of 21 tumor types, we here show that the degrees of overall methylation in CpG island (CGI) and demethylation in intergenic regions, defined as 'backbone', largely vary among different tumors. Depending on tumor type, both CGI methylation and backbone demethylation are often associated with clinical, epidemiological and biological features such as age, sex, smoking history, anatomic location, histological type and grade, stage, molecular subtype and biological pathways. We found connections between CGI methylation and hypermutability, microsatellite instability, IDH1 mutation, 19p gain and polycomb features, and backbone demethylation with chromosomal instability, NSD1 and TP53 mutations, 5q and 19p loss and long repressive domains. These broad epigenetic patterns add a new dimension to our understanding of tumor biology and its clinical implications. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Dietary vitamin E deficiency does not affect global and specific DNA methylation patterns in rat liver.

    PubMed

    Fischer, Alexandra; Gaedicke, Sonja; Frank, Jan; Döring, Frank; Rimbach, Gerald

    2010-10-01

    The aim of the present study was to determine the effects of a 6-month dietary vitamin E (VE) deficiency on DNA methylation and gene expression in rat liver. Two enzymes, 5-α-steroid reductase type 1 (SRD5A1) and the regulatory subunit of γ-glutamylcysteinyl synthetase (GCLM), which are differentially expressed on the mRNA level, were analysed for promoter methylation in putative cytosine-phospho-guanine (CpG) island regions located at the 5' end using base-specific cleavage and matrix-assisted laser desorption ionisation time-of-flight MS. A twofold increase in the mRNA level of SRD5A1 gene and a twofold decrease in the mRNA level of GCLM gene in VE-deficient animals were not associated with different CpG methylation of the analysed promoter region. Furthermore, global DNA methylation was not significantly different in these two groups. Thus, the present results indicate that the VE-induced regulation of SRD5A1 and GCLM in rat liver is not directly mediated by changes in promoter DNA methylation.

  1. Genetic recombination is targeted towards gene promoter regions in dogs.

    PubMed

    Auton, Adam; Rui Li, Ying; Kidd, Jeffrey; Oliveira, Kyle; Nadel, Julie; Holloway, J Kim; Hayward, Jessica J; Cohen, Paula E; Greally, John M; Wang, Jun; Bustamante, Carlos D; Boyko, Adam R

    2013-01-01

    The identification of the H3K4 trimethylase, PRDM9, as the gene responsible for recombination hotspot localization has provided considerable insight into the mechanisms by which recombination is initiated in mammals. However, uniquely amongst mammals, canids appear to lack a functional version of PRDM9 and may therefore provide a model for understanding recombination that occurs in the absence of PRDM9, and thus how PRDM9 functions to shape the recombination landscape. We have constructed a fine-scale genetic map from patterns of linkage disequilibrium assessed using high-throughput sequence data from 51 free-ranging dogs, Canis lupus familiaris. While broad-scale properties of recombination appear similar to other mammalian species, our fine-scale estimates indicate that canine highly elevated recombination rates are observed in the vicinity of CpG rich regions including gene promoter regions, but show little association with H3K4 trimethylation marks identified in spermatocytes. By comparison to genomic data from the Andean fox, Lycalopex culpaeus, we show that biased gene conversion is a plausible mechanism by which the high CpG content of the dog genome could have occurred.

  2. Integrated Multiregional Analysis Proposing a New Model of Colorectal Cancer Evolution

    PubMed Central

    Niida, Atsushi; Shimamura, Teppei; Hirata, Hidenari; Sugimachi, Keishi; Sawada, Genta; Iwaya, Takeshi; Kurashige, Junji; Shinden, Yoshiaki; Iguchi, Tomohiro; Eguchi, Hidetoshi; Chiba, Kenichi; Shiraishi, Yuichi; Nagae, Genta; Yoshida, Kenichi; Nagata, Yasunobu; Haeno, Hiroshi; Yamamoto, Hirofumi; Ishii, Hideshi; Doki, Yuichiro; Iinuma, Hisae; Sasaki, Shin; Nagayama, Satoshi; Yamada, Kazutaka; Yachida, Shinichi; Kato, Mamoru; Shibata, Tatsuhiro; Oki, Eiji; Saeki, Hiroshi; Shirabe, Ken; Oda, Yoshinao; Maehara, Yoshihiko; Komune, Shizuo; Mori, Masaki; Suzuki, Yutaka; Yamamoto, Ken; Aburatani, Hiroyuki; Ogawa, Seishi; Miyano, Satoru; Mimori, Koshi

    2016-01-01

    Understanding intratumor heterogeneity is clinically important because it could cause therapeutic failure by fostering evolutionary adaptation. To this end, we profiled the genome and epigenome in multiple regions within each of nine colorectal tumors. Extensive intertumor heterogeneity is observed, from which we inferred the evolutionary history of the tumors. First, clonally shared alterations appeared, in which C>T transitions at CpG site and CpG island hypermethylation were relatively enriched. Correlation between mutation counts and patients’ ages suggests that the early-acquired alterations resulted from aging. In the late phase, a parental clone was branched into numerous subclones. Known driver alterations were observed frequently in the early-acquired alterations, but rarely in the late-acquired alterations. Consistently, our computational simulation of the branching evolution suggests that extensive intratumor heterogeneity could be generated by neutral evolution. Collectively, we propose a new model of colorectal cancer evolution, which is useful for understanding and confronting this heterogeneous disease. PMID:26890883

  3. Diesel Fueled SOFC for Class 7/Class 8 On-Highway Truck Auxiliary Power

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vesely, Charles John-Paul; Fuchs, Benjamin S.; Booten, Chuck W.

    2010-03-31

    The following report documents the progress of the Cummins Power Generation (CPG) Diesel Fueled SOFC for Class 7/Class 8 On-Highway Truck Auxiliary Power (SOFC APU) development and final testing under the U.S. Department of Energy (DOE) Energy Efficiency and Renewable Energy (EERE) contract DE-FC36-04GO14318. This report overviews and summarizes CPG and partner development leading to successful demonstration of the SOFC APU objectives and significant progress towards SOFC commercialization. Significant SOFC APU Milestones: Demonstrated: Operation meeting SOFC APU requirements on commercial Ultra Low Sulfur Diesel (ULSD) fuel. SOFC systems operating on dry CPOX reformate. Successful start-up and shut-down of SOFC APUmore » system without inert gas purge. Developed: Low cost balance of plant concepts and compatible systems designs. Identified low cost, high volume components for balance of plant systems. Demonstrated efficient SOFC output power conditioning. Demonstrated SOFC control strategies and tuning methods.« less

  4. Marked enhancement of the immune response to BioThrax® (Anthrax Vaccine Adsorbed) by the TLR9 agonist CPG 7909 in healthy volunteers.

    PubMed

    Rynkiewicz, Dianna; Rathkopf, Melinda; Sim, Iain; Waytes, A Thomas; Hopkins, Robert J; Giri, Lallan; DeMuria, Deborah; Ransom, Janet; Quinn, James; Nabors, Gary S; Nielsen, Carl J

    2011-08-26

    Immunization with BioThrax(®) (Anthrax Vaccine Adsorbed) is a safe and effective means of preventing anthrax. Animal studies have demonstrated that the addition of CpG DNA adjuvants to BioThrax can markedly increase the immunogenicity of the vaccine, increasing both serum anti-protective antigen (PA) antibody and anthrax toxin-neutralizing antibody (TNA) concentrations. The immune response to CpG-adjuvanted BioThrax in animals was not only stronger, but was also more rapid and led to higher levels of protection in spore challenge models. The B-class CpG DNA adjuvant CPG 7909, a 24-base synthetic, single-strand oligodeoxynucleotide, was evaluated for its safety profile and adjuvant properties in a Phase 1 clinical trial. A double-blind study was performed in which 69 healthy subjects, age 18-45 years, were randomized to receive three doses of either: (1) BioThrax alone, (2) 1 mg of CPG 7909 alone or (3) BioThrax plus 1 mg of CPG 7909, all given intramuscularly on study days 0, 14 and 28. Subjects were monitored for IgG to PA by ELISA and for TNA titers through study day 56 and for safety through month 6. CPG 7909 increased the antibody response by 6-8-fold at peak, and accelerated the response by 3 weeks compared to the response seen in subjects vaccinated with BioThrax alone. No serious adverse events related to study agents were reported, and the combination was considered to be reasonably well tolerated. The marked acceleration and enhancement of the immune response seen by combining BioThrax and CPG 7909 offers the potential to shorten the course of immunization and reduce the time to protection, and may be particularly useful in the setting of post-exposure prophylaxis. Copyright © 2011 Elsevier Ltd. All rights reserved.

  5. Maternal treatment with a high dose of CpG ODN during gestation alters fetal craniofacial and distal limb development in C57BL/6 mice.

    PubMed

    Prater, M Renee; Johnson, Victor J; Germolec, Dori R; Luster, Michael I; Holladay, Steven D

    2006-01-16

    Synthetic oligodeoxynucleotides (ODN) containing CpG motifs, characteristic of bacterial DNA, are currently being evaluated as vaccine adjuvants for inducing protective immunity. Recently, there is increasing pressure to vaccinate pregnant women against maternally transmitted diseases including AIDS and tetanus, as well as against potential bio-weapons such as anthrax. CpG vaccines are effective because they trigger transient increases in T(H)1 cytokine production. Recent literature suggests, however, that a shift toward a T(H)1 cytokine profile during pregnancy may increase the risk of fetal morphologic defects. On this basis, we hypothesized that exposure to CpG motifs during pregnancy could result in T(H)1 inflammation leading to adverse effects on fetal development. To address this hypothesis, pregnant C57BL/6 mice were injected with CpG ODN (0-300 microg/dam) and maternal and fetal outcomes were determined. Injection of dams with the highest dose of CpG ODN resulted in markedly increased fetal resorptions and craniofacial/limb defects, while lower doses had little, if any effects. Histological examination of placentas revealed cellular necrosis with mixed inflammation and calcification in the spongiotrophoblast layer and dysregulation of labyrinthine vascular development. Concomitant elevations in maternal serum cytokine levels were observed including interleukin (IL)-2, IL-10 and IL-12. Treatment with 300 microg of non-CpG ODN did not cause any adverse effects. The 300 microg dose of CpG ODN used in the present study is 30-fold higher than the highest dose that has been administered to humans during clinical trials. These results suggest that the induction of T(H)1 cytokines during pregnancy by CpG motifs may potentially increase the risk of fetal loss and morphologic defects in mice, at least at high doses, and support the need for further investigation of teratogenesis that may result from exposure to vaccine adjuvants designed to produce T(H)1 cytokine profile shifts.

  6. Prognostication of patients with clear cell renal cell carcinomas based on quantification of DNA methylation levels of CpG island methylator phenotype marker genes.

    PubMed

    Tian, Ying; Arai, Eri; Gotoh, Masahiro; Komiyama, Motokiyo; Fujimoto, Hiroyuki; Kanai, Yae

    2014-10-20

    The CpG island methylator phenotype (CIMP) of clear cell renal cell carcinomas (ccRCCs) is characterized by accumulation of DNA methylation at CpG islands and poorer patient outcome. The aim of this study was to establish criteria for prognostication of patients with ccRCCs using the ccRCC-specific CIMP marker genes. DNA methylation levels at 299 CpG sites in the 14 CIMP marker genes were evaluated quantitatively in tissue specimens of 88 CIMP-negative and 14 CIMP-positive ccRCCs in a learning cohort using the MassARRAY system. An additional 100 ccRCCs were also analyzed as a validation cohort. Receiver operating characteristic curve analysis showed that area under the curve values for the 23 CpG units including the 32 CpG sites in the 7 CIMP-marker genes, i.e. FAM150A, ZNF540, ZNF671, ZNF154, PRAC, TRH and SLC13A5, for discrimination of CIMP-positive from CIMP-negative ccRCCs were larger than 0.95. Criteria combining the 23 CpG units discriminated CIMP-positive from CIMP-negative ccRCCs with 100% sensitivity and specificity in the learning cohort. Cancer-free and overall survival rates of patients with CIMP-positive ccRCCs diagnosed using the criteria combining the 23 CpG units in a validation cohort were significantly lower than those of patients with CIMP-negative ccRCCs (P = 1.41 × 10-5 and 2.43 × 10-13, respectively). Patients with CIMP-positive ccRCCs in the validation cohort had a higher likelihood of disease-related death (hazard ratio, 75.8; 95% confidence interval, 7.81 to 735; P = 1.89 × 10-4) than those with CIMP-negative ccRCCs. The established criteria are able to reproducibly diagnose CIMP-positive ccRCCs and may be useful for personalized medicine for patients with ccRCCs.

  7. Parvovirus B19 DNA CpG Dinucleotide Methylation and Epigenetic Regulation of Viral Expression

    PubMed Central

    Bonvicini, Francesca; Manaresi, Elisabetta; Di Furio, Francesca; De Falco, Luisa; Gallinella, Giorgio

    2012-01-01

    CpG DNA methylation is one of the main epigenetic modifications playing a role in the control of gene expression. For DNA viruses whose genome has the ability to integrate in the host genome or to maintain as a latent episome, a correlation has been found between the extent of DNA methylation and viral quiescence. No information is available for Parvovirus B19, a human pathogenic virus, which is capable of both lytic and persistent infections. Within Parvovirus B19 genome, the inverted terminal regions display all the characteristic signatures of a genomic CpG island; therefore we hypothesised a role of CpG dinucleotide methylation in the regulation of viral genome expression. The analysis of CpG dinucleotide methylation of Parvovirus B19 DNA was carried out by an aptly designed quantitative real-time PCR assay on bisulfite-modified DNA. The effects of CpG methylation on the regulation of viral genome expression were first investigated by transfection of either unmethylated or in vitro methylated viral DNA in a model cell line, showing that methylation of viral DNA was correlated to lower expression levels of the viral genome. Then, in the course of in vitro infections in different cellular environments, it was observed that absence of viral expression and genome replication were both correlated to increasing levels of CpG methylation of viral DNA. Finally, the presence of CpG methylation was documented in viral DNA present in bioptic samples, indicating the occurrence and a possible role of this epigenetic modification in the course of natural infections. The presence of an epigenetic level of regulation of viral genome expression, possibly correlated to the silencing of the viral genome and contributing to the maintenance of the virus in tissues, can be relevant to the balance and outcome of the different types of infection associated to Parvovirus B19. PMID:22413013

  8. A CpG Oligonucleotide Can Protect Mice From a Low Aerosol Challenge Dose of Burkholderia mallei

    DTIC Science & Technology

    2006-03-01

    may protect victims of a biological attack from glanders . Burkholderia mallei , the causative agent of glanders , natu- rally infects equines, but it can...attack from glanders . 15. SUBJECT TERMS Burkholderia mallei , glanders , oligonucleotides, CpG motif, efficacy, laboratory animals, mice 16...Society for Microbiology. All Rights Reserved. A CpG Oligonucleotide Can Protect Mice from a Low Aerosol Challenge Dose of Burkholderia mallei David M

  9. [Similarity of cycloprolylglycine to piracetam in antihypoxic and neuroprotective effects].

    PubMed

    Kolisnikova, K N; Gudasheva, T A; Nazarova, G A; Antipov, T A; Voronina, T A; Seredenin, S B

    2012-01-01

    The antihypoxic activity of the endogenous cyclic dipeptide cycloprolylglycine (CPG) has been studied on a model of normobaric hypoxia with hypercapnia and its neuroprotective activity has been studied on a model of human neuroblastoma SH-SY5Y cell damage by 6-hydroxydopamine. It is established that CPG exhibits the antihypoxic activity at doses of 0.5 and 1.0 mg/kg (i.p.) on outbred and BALB/c mice, but not on C57B1/6 mice. The neuroprotective activity of CPG was detected in 10(-5) - 10(-8) M concentration range only when the treatment was carried out 24h before toxin introduction. The obtained data confirm the hypothesis that piracetam is a mimetic of the endogenous CPG neuropeptide.

  10. CpG oligodeoxynucleotides containing GACGTT motifs enhance the immune responses elicited by a goose parvovirus vaccine in ducks.

    PubMed

    Lee, Jai-Wei; Lin, Yu-Ming; Yen, Ting-Ying; Yang, Wen-Jen; Chu, Chun-Yen

    2010-11-23

    Recombinant parvovirus VP2 (rVP2) was formulated with different types of adjuvant, including aluminum adjuvant and CpG oligodeoxynucleotides (ODNs), and the immunological responses after vaccination in ducks were examined. In comparison with the control group, production of rVP2-specific antibodies, expression of cytokines in peripheral blood mononuclear cells (PBMC) stimulated by rVP2, and percentage of CD4(+)/CD8(+) cells in PBMC were significantly increased in ducks immunized with rVP2 formulated with CpG ODNs containing 3 copies of GACGTT motif. CpG ODNs with GACGTT motifs might be used to improve the efficacy of vaccines for ducks. Copyright © 2010 Elsevier Ltd. All rights reserved.

  11. Whole-Genome and Epigenomic Landscapes of Etiologically Distinct Subtypes of Cholangiocarcinoma

    PubMed Central

    Jusakul, Apinya; Cutcutache, Ioana; Yong, Chern Han; Lim, Jing Quan; Huang, Mi Ni; Padmanabhan, Nisha; Nellore, Vishwa; Kongpetch, Sarinya; Ng, Alvin Wei Tian; Ng, Ley Moy; Choo, Su Pin; Myint, Swe Swe; Thanan, Raynoo; Nagarajan, Sanjanaa; Lim, Weng Khong; Ng, Cedric Chuan Young; Boot, Arnoud; Liu, Mo; Ong, Choon Kiat; Rajasegaran, Vikneswari; Lie, Stefanus; Lim, Alvin Soon Tiong; Lim, Tse Hui; Tan, Jing; Loh, Jia Liang; McPherson, John R.; Khuntikeo, Narong; Bhudhisawasdi, Vajaraphongsa; Yongvanit, Puangrat; Wongkham, Sopit; Totoki, Yasushi; Nakamura, Hiromi; Arai, Yasuhito; Yamasaki, Satoshi; Chow, Pierce Kah-Hoe; Chung, Alexander Yaw Fui; Ooi, London Lucien Peng Jin; Lim, Kiat Hon; Dima, Simona; Duda, Dan G.; Popescu, Irinel; Broet, Philippe; Hsieh, Sen-Yung; Yu, Ming-Chin; Scarpa, Aldo; Lai, Jiaming; Luo, Di-Xian; Carvalho, André Lopes; Vettore, André Luiz; Rhee, Hyungjin; Park, Young Nyun; Alexandrov, Ludmil B.; Gordân, Raluca; Rozen, Steven G.; Shibata, Tatsuhiro; Pairojkul, Chawalit; Teh, Bin Tean; Tan, Patrick

    2017-01-01

    Cholangiocarcinoma (CCA) is a hepatobiliary malignancy exhibiting high incidence in countries with endemic liver-fluke infection. We analysed 489 CCAs from 10 countries, combining whole-genome (71 cases), targeted/exome, copy-number, gene expression, and DNA methylation information. Integrative clustering defined four CCA clusters – Fluke-Positive CCAs (Clusters 1/2) are enriched in ERBB2 amplifications and TP53 mutations, conversely Fluke-Negative CCAs (Clusters 3/4) exhibit high copy-number alterations and PD-1/PD-L2 expression, or epigenetic mutations (IDH1/2, BAP1) and FGFR/PRKA-related gene rearrangements. Whole-genome analysis highlighted FGFR2 3′UTR deletion as a mechanism of FGFR2 upregulation. Integration of non-coding promoter mutations with protein-DNA binding profiles demonstrates pervasive modulation of H3K27me3-associated sites in CCA. Clusters 1 and 4 exhibit distinct DNA hypermethylation patterns targeting either CpG islands or shores – mutation signature and subclonality analysis suggests that these reflect different mutational pathways. Our results exemplify how genetics, epigenetics and environmental carcinogens can interplay across different geographies to generate distinct molecular subtypes of cancer. PMID:28667006

  12. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jusakul, Apinya; Cutcutache, Ioana; Yong, Chern Han

    Cholangiocarcinoma (CCA) is a hepatobiliary malignancy exhibiting high incidence in countries with endemic liver-fluke infection. We analysed 489 CCAs from 10 countries, combining whole-genome (71 cases), targeted/exome, copy-number, gene expression, and DNA methylation information. Integrative clustering defined four CCA clusters - Fluke- Positive CCAs (Clusters 1/2) are enriched in ERBB2 amplifications and TP53 mutations, conversely Fluke-Negative CCAs (Clusters 3/4) exhibit high copy-number alterations and PD-1/PD-L2 expression, or epigenetic mutations (IDH1/2, BAP1) and FGFR/PRKA-related gene rearrangements. Whole-genome analysis highlighted FGFR2 3’UTR deletion as a mechanism of FGFR2 upregulation. Integration of non-coding promoter mutations with protein-DNA binding profiles demonstrates pervasive modulation ofmore » H3K27me3-associated sites in CCA. Clusters 1 and 4 exhibit distinct DNA hypermethylation patterns targeting either CpG islands or shores - mutation signature and subclonality analysis suggests that these reflect different mutational pathways. Lastly, our results exemplify how genetics, epigenetics and environmental carcinogens can interplay across different geographies to generate distinct molecular subtypes of cancer.« less

  13. A role for neuronal piRNAs in the epigenetic control of memory-related synaptic plasticity.

    PubMed

    Rajasethupathy, Priyamvada; Antonov, Igor; Sheridan, Robert; Frey, Sebastian; Sander, Chris; Tuschl, Thomas; Kandel, Eric R

    2012-04-27

    Small RNA-mediated gene regulation during development causes long-lasting changes in cellular phenotypes. To determine whether small RNAs of the adult brain can regulate memory storage, a process that requires stable and long-lasting changes in the functional state of neurons, we generated small RNA libraries from the Aplysia CNS. In these libraries, we discovered an unexpectedly abundant expression of a 28 nucleotide sized class of piRNAs in brain, which had been thought to be germline specific. These piRNAs have unique biogenesis patterns, predominant nuclear localization, and robust sensitivity to serotonin, a modulatory transmitter that is important for memory. We find that the Piwi/piRNA complex facilitates serotonin-dependent methylation of a conserved CpG island in the promoter of CREB2, the major inhibitory constraint of memory in Aplysia, leading to enhanced long-term synaptic facilitation. These findings provide a small RNA-mediated gene regulatory mechanism for establishing stable long-term changes in neurons for the persistence of memory. Copyright © 2012 Elsevier Inc. All rights reserved.

  14. Pan-cancer stratification of solid human epithelial tumors and cancer cell lines reveals commonalities and tissue-specific features of the CpG island methylator phenotype.

    PubMed

    Sánchez-Vega, Francisco; Gotea, Valer; Margolin, Gennady; Elnitski, Laura

    2015-01-01

    The term CpG island methylator phenotype (CIMP) has been used to describe widespread DNA hypermethylation at CpG-rich genomic regions affecting clinically distinct subsets of cancer patients. Even though there have been numerous studies of CIMP in individual cancer types, a uniform analysis across tissues is still lacking. We analyze genome-wide patterns of CpG island hypermethylation in 5,253 solid epithelial tumors from 15 cancer types from TCGA and 23 cancer cell lines from ENCODE. We identify differentially methylated loci that define CIMP+ and CIMP- samples, and we use unsupervised clustering to provide a robust molecular stratification of tumor methylomes for 12 cancer types and all cancer cell lines. With a minimal set of 89 discriminative loci, we demonstrate accurate pan-cancer separation of the 12 CIMP+/- subpopulations, based on their average levels of methylation. Tumor samples in different CIMP subclasses show distinctive correlations with gene expression profiles and recurrence of somatic mutations, copy number variations, and epigenetic silencing. Enrichment analyses indicate shared canonical pathways and upstream regulators for CIMP-targeted regions across cancer types. Furthermore, genomic alterations showing consistent associations with CIMP+/- status include genes involved in DNA repair, chromatin remodeling genes, and several histone methyltransferases. Associations of CIMP status with specific clinical features, including overall survival in several cancer types, highlight the importance of the CIMP+/- designation for individual tumor evaluation and personalized medicine. We present a comprehensive computational study of CIMP that reveals pan-cancer commonalities and tissue-specific differences underlying concurrent hypermethylation of CpG islands across tumors. Our stratification of solid tumors and cancer cell lines based on CIMP status is data-driven and agnostic to tumor type by design, which protects against known biases that have hindered classic methods previously used to define CIMP. The results that we provide can be used to refine existing molecular subtypes of cancer into more homogeneously behaving subgroups, potentially leading to more uniform responses in clinical trials.

  15. Detection and evaluation of DNA methylation markers found at SCGN and KLF14 loci to estimate human age.

    PubMed

    Alghanim, Hussain; Antunes, Joana; Silva, Deborah Soares Bispo Santos; Alho, Clarice Sampaio; Balamurugan, Kuppareddi; McCord, Bruce

    2017-11-01

    Recent developments in the analysis of epigenetic DNA methylation patterns have demonstrated that certain genetic loci show a linear correlation with chronological age. It is the goal of this study to identify a new set of epigenetic methylation markers for the forensic estimation of human age. A total number of 27 CpG sites at three genetic loci, SCGN, DLX5 and KLF14, were examined to evaluate the correlation of their methylation status with age. These sites were evaluated using 72 blood samples and 91 saliva samples collected from volunteers with ages ranging from 5 to 73 years. DNA was bisulfite modified followed by PCR amplification and pyrosequencing to determine the level of DNA methylation at each CpG site. In this study, certain CpG sites in SCGN and KLF14 loci showed methylation levels that were correlated with chronological age, however, the tested CpG sites in DLX5 did not show a correlation with age. Using a 52-saliva sample training set, two age-predictor models were developed by means of a multivariate linear regression analysis for age prediction. The two models performed similarly with a single-locus model explaining 85% of the age variance at a mean absolute deviation of 5.8 years and a dual-locus model explaining 84% of the age variance with a mean absolute deviation of 6.2 years. In the validation set, the mean absolute deviation was measured to be 8.0 years and 7.1 years for the single- and dual-locus model, respectively. Another age predictor model was also developed using a 40-blood sample training set that accounted for 71% of the age variance. This model gave a mean absolute deviation of 6.6 years for the training set and 10.3years for the validation set. The results indicate that specific CpGs in SCGN and KLF14 can be used as potential epigenetic markers to estimate age using saliva and blood specimens. These epigenetic markers could provide important information in cases where the determination of a suspect's age is critical in developing investigative leads. Copyright © 2017. Published by Elsevier B.V.

  16. Dietary Patterns and Risk of Colorectal Cancer: Analysis by Tumor Location and Molecular Subtypes.

    PubMed

    Mehta, Raaj S; Song, Mingyang; Nishihara, Reiko; Drew, David A; Wu, Kana; Qian, Zhi Rong; Fung, Teresa T; Hamada, Tsuyoshi; Masugi, Yohei; da Silva, Annacarolina; Shi, Yan; Li, Wanwan; Gu, Mancang; Willett, Walter C; Fuchs, Charles S; Giovannucci, Edward L; Ogino, Shuji; Chan, Andrew T

    2017-06-01

    Western and prudent dietary patterns have been associated with higher and lower risks of colorectal cancer (CRC), respectively. However, little is known about the associations between dietary patterns and specific anatomic subsites or molecular subtypes of CRC. We used multivariable Cox proportional hazards models to examine the associations between Western and prudent dietary patterns and CRC risk in the Health Professionals Follow-up Study and Nurses' Health Study. After up to 32 years of follow-up of 137,217 men and women, we documented 3260 cases of CRC. Among individuals from whom subsite data were available, we observed 1264 proximal colon, 866 distal colon, and 670 rectal tumors. Western diet was associated with an increased incidence of CRC (P trend < .0001), with a relative risk (RR) of 1.31 (95% CI, 1.15-1.48, comparing the highest to lowest quartile). The association of Western diet with CRC was evident for tumors of the distal colon (RR, 1.55; 95% CI, 1.22-1.96; P trend  = .0004) and rectum (RR, 1.35; 95% CI, 1.03-1.77; P trend  = .01) but not proximal colon (RR, 1.11; 95% CI, 0.91-1.35; P trend  = .51) when we comparing extreme quartiles. In contrast, for the prudent pattern, we observed a RR of 0.86 for overall CRC (95% CI, 0.77-0.95; P trend  = .01), with similar trends at anatomic subsites. However, the trend appeared stronger among men than women. Among 1285 cases (39%) with tissue available for molecular profiling, Western diet appeared to be more strongly associated with some CRC molecular subtypes (no mutations in KRAS [KRAS wildtype] or BRAF [BRAF wildtype], no or a low CpG island methylator phenotype, and microsatellite stability), although formal tests for heterogeneity did not produce statistically significant results. Western dietary patterns are associated with an increased risk of CRC, particularly distal colon and rectal tumors. Western dietary patterns also appear more strongly associated with tumors that are KRAS wildtype, BRAF wildtype, have no or a low CpG island methylator phenotype, and microsatellite stability. In contrast, prudent dietary patterns are associated with a lower risk of CRC that does not vary according to anatomic subsite or molecular subtype. Copyright © 2017 AGA Institute. Published by Elsevier Inc. All rights reserved.

  17. Improvement of the Immunogenicity of Porcine Circovirus Type 2 DNA Vaccine by Recombinant ORF2 Gene and CpG Motifs.

    PubMed

    Li, Jun; Shi, Jian-Li; Wu, Xiao-Yan; Fu, Fang; Yu, Jiang; Yuan, Xiao-Yuan; Peng, Zhe; Cong, Xiao-Yan; Xu, Shao-Jian; Sun, Wen-Bo; Cheng, Kai-Hui; Du, Yi-Jun; Wu, Jia-Qiang; Wang, Jin-Bao; Huang, Bao-Hua

    2015-06-01

    Nowadays, adjuvant is still important for boosting immunity and improving resistance in animals. In order to boost the immunity of porcine circovirus type 2 (PCV2) DNA vaccine, CpG motifs were inserted. In this study, the dose-effect was studied, and the immunity of PCV2 DNA vaccines by recombinant open reading frame 2 (ORF2) gene and CpG motifs was evaluated. Three-week-old Changbai piglets were inoculated intramuscularly with 200 μg, 400 μg, and 800 μg DNA vaccines containing 14 and 18 CpG motifs, respectively. Average gain and rectum temperature were recorded everyday during the experiments. Blood was collected from the piglets after vaccination to detect the changes of specific antibodies, interleukin-2, and immune cells every week. Tissues were collected for histopathology and polymerase chain reaction. The results indicated that compared to those of the control piglets, all concentrations of two DNA vaccines could induce PCV2-specific antibodies. A cellular immunity test showed that PCV2-specific lymphocytes proliferated the number of TH, TC, and CD3+ positive T-cells raised in the blood of DNA vaccine immune groups. There was no distinct pathological damage and viremia occurring in pigs that were inoculated with DNA vaccines, but there was some minor pathological damage in the control group. The results demonstrated that CpG motifs as an adjuvant could boost the humoral and cellular immunity of pigs to PCV2, especially in terms of cellular immunity. Comparing two DNA vaccines that were constructed, the one containing 18 CpG motifs was more effective. This is the first report that CpG motifs as an adjuvant insert to the PCV2 DNA vaccine could boost immunity.

  18. Potential for diagnosis versus therapy monitoring of attention deficit hyperactivity disorder: a new epigenetic biomarker interacting with both genotype and auto-immunity.

    PubMed

    Adriani, Walter; Romano, Emilia; Pucci, Mariangela; Pascale, Esterina; Cerniglia, Luca; Cimino, Silvia; Tambelli, Renata; Curatolo, Paolo; Granstrem, Oleg; Maccarrone, Mauro; Laviola, Giovanni; D'Addario, Claudio

    2018-02-01

    In view of the need for easily accessible biomarkers, we evaluated in ADHD children the epigenetic status of the 5'-untranslated region (UTR) in the SLC6A3 gene, coding for human dopamine transporter (DAT). We analysed buccal swabs and sera from 30 children who met DSM-IV-TR criteria for ADHD, assigned to treatment according to severity. Methylation levels at six-selected CpG sites (among which, a CGGCGGCGG and a CGCG motif), alone or in combination with serum titers in auto-antibodies against dopamine transporter (DAT aAbs), were analysed for correlation with CGAS scores (by clinicians) and Conners' scales (by parents), collected at recruitment and after 6 weeks. In addition, we characterized the DAT genotype, i.e., the variable number tandem repeat (VNTR) polymorphisms at the 3'-UTR of the gene. DAT methylation levels were greatly reduced in ADHD patients compared to control, healthy children. Within patients carrying at least one DAT 9 allele (DAT 9/x), methylation at positions CpG2 and/or CpG6 correlated with recovery, as evident from delta-CGAS scores as well as delta Conners' scales ('inattentive' and 'hyperactive' subscales). Moreover, hypermethylation at CpG1 position denoted severity, specifically for those patients carrying a DAT 10/10 genotype. Intriguingly, high serum DAT-aAbs titers appeared to corroborate indications from high CpG1 versus high CpG2/CpG6 levels, likewise denoting severity versus recovery in DAT 10/10 versus 9/x patients, respectively. These profiles suggest that DAT 5'UTR epigenetics plus serum aAbs can serve as suitable biomarkers, to confirm ADHD diagnosis and/or to predict the efficacy of treatment.

  19. Perception, attitude, and satisfaction of paediatric physicians and nurses towards clinical practice guidelines at a university teaching hospital.

    PubMed

    Amer, Yasser Sami; Al Nemri, Abdulrahman; Osman, Mohamed Elfaki; Saeed, Elshazaly; Assiri, Asaad Mohamed; Mohamed, Sarar

    2018-04-03

    To explore perception, attitude, and satisfaction of paediatric clinicians, trainees, and nurses at King Khalid University Hospital towards clinical practice guidelines (CPGs) including the locally adapted diabetic ketoacidosis CPG (DKA-CPG). A cross-sectional survey was distributed to 260 doctors and nurses working in the paediatrics department. The response rate was 95.4%. The respondents had a positive perception and attitude towards general CPGs and specifically for the DKA-CPG; 98.7% thought CPGs were useful sources of advice, improved safety, and decreased risk, and reduced variation in practice. A total of 99.2% thought CPGs were good clinical tools, 98.3% satisfied with, had confidence in well-developed CPGs, and would recommend them to their colleagues to use, and 94.6% agreed they were cost-effective. The preferred format for CPGs was paper (46.6%) and electronic (42.9%). The DKA-CPG helped in managing patients and respondents were all satisfied and had confidence with it (100%). The rationale and objectives of the DKA-CPG were clear for 99.25%; 98.5% thought the layout was clear and well organized and user-friendly (96.2%). Compared with nurses, physicians had a higher perception towards CPGs in general (P < .05) and the DKA-CPG (P < .05). The paediatric doctors, and nurses have a great perception and satisfaction and positive attitude towards CPGs in general, towards the paediatric diabetic ketoacidosis CPG in particular, which in turn had a positive impact on the acceptability and implementation of the CPGs. These findings could help in sustaining a safe and high-quality health care environment through implementation of evidence-based CPGs. © 2018 John Wiley & Sons, Ltd.

  20. CpG island methylator phenotype-low (CIMP-low) colorectal cancer shows not only few methylated CIMP-high-specific CpG islands, but also low-level methylation at individual loci.

    PubMed

    Kawasaki, Takako; Ohnishi, Mutsuko; Nosho, Katsuhiko; Suemoto, Yuko; Kirkner, Gregory J; Meyerhardt, Jeffrey A; Fuchs, Charles S; Ogino, Shuji

    2008-03-01

    The CpG island methylator phenotype (CIMP or CIMP-high) with widespread promoter methylation is a distinct phenotype in colorectal cancer. However, the concept of CIMP-low with less extensive CpG island methylation is still evolving. Our aim is to examine whether density of methylation in individual CpG islands was different between CIMP-low and CIMP-high tumors. Utilizing MethyLight technology and 889 population-based colorectal cancers, we quantified DNA methylation (methylation index, percentage of methylated reference) at 14 CpG islands, including 8 CIMP-high-specific loci (CACNA1G, CDKN2A (p16), CRABP1, IGF2, MLH1, NEUROG1, RUNX3 and SOCS1). Methylation positivity in each locus was defined as methylation index>4. Low-level methylation (methylation index>0, <20) in each CIMP-high-specific locus was significantly more common in 340 CIMP-low tumors (1/8-5/8 methylation-positive loci) than 133 CIMP-high tumors (> or =6/8 methylation-positive loci) and 416 CIMP-0 tumors (0/8 methylation-positive loci) (P< or =0.002). In the other six loci (CHFR, HIC1, IGFBP3, MGMT, MINT31 and WRN), which were not highly specific for CIMP-high, low-level methylation, was not persistently more prevalent in CIMP-low tumors. In conclusion, compared to CIMP-high and CIMP-0 tumors, CIMP-low colorectal cancers show not only few methylated CIMP-high-specific CpG islands, but also more frequent low-level methylation at individual loci. Our data may provide supporting evidence for a difference in pathogenesis of DNA methylation between CIMP-low and CIMP-high tumors.

  1. [Comparative analysis of methylation profiles in tissues of oral leukoplakia and oral squamous cell carcinoma].

    PubMed

    Fu, J; Su, Y; Liu, Y; Zhang, X Y

    2018-04-09

    Objective: To compare the methylation profiles in tissues of oral leukoplakia (OLK) and oral squamous cell carcinoma (OSCC) with healthy tissues of oral mucosa, in order to identify the role of DNA methylation played in tumorigenesis. Methods: DNA samples extracted from tissues of 4 healthy oral mucosa, 4 OSCC and 4 OLK collected from patients of the Department of Oral Medicine, Capital Medical University School of Stomatology were examined and compared using Methylation 450 Bead Chip. The genes associated with differentially methylated CpG sites were selected for gene ontology (GO) analysis and Kyoto encyclopedia of genes and genomes (KEGG) pathway enrichment. Results: Multiple differentially methylated CpG sites were identified by using the above mentioned assay. Hypermethylation constitutes 86.18% (23 290/27 025) of methylation changes in OLK and hypomethylation accounts for 13.82% (3 734/27 025) of methylation changes. Both hypermethylated and hypomethylated CpG sites were markedly increased in OSCC tissue compared with OLK tissue. The majority of differentially methylated CpG sites were located outside CpG islands, with approximately one-fourth in CpG shores flanking the islands, which were considered highly important for gene regulation and tumorigenesis. Pathway analysis revealed that differentially methylated CpG sites in both OLK and OSCC patients shared the same pathway enrichments, most of which were correlated with carcinogenesis and cancer progression (e.g., DNA repair, cell cycle, and apoptosis). Conclusions: In the present study, methylation-associated alterations affect almost all pathways in the cellular network in both OLK and OSCC. OLK and OSCC shared similar methylation changes whether in pathways or genes, indicating that epigenetically they might have the same molecular basis for disease progression.

  2. The Antimalarial Artemisinin Synergizes with Antibiotics To Protect against Lethal Live Escherichia coli Challenge by Decreasing Proinflammatory Cytokine Release

    PubMed Central

    Wang, Jun; Zhou, Hong; Zheng, Jiang; Cheng, Juan; Liu, Wei; Ding, Guofu; Wang, Liangxi; Luo, Ping; Lu, Yongling; Cao, Hongwei; Yu, Shuangjiang; Li, Bin; Zhang, Lezhi

    2006-01-01

    In the present study artemisinin (ART) was found to have potent anti-inflammatory effects in animal models of sepsis induced by CpG-containing oligodeoxy-nucleotides (CpG ODN), lipopolysaccharide (LPS), heat-killed Escherichia coli 35218 or live E. coli. Furthermore, we found that ART protected mice from a lethal challenge by CpG ODN, LPS, or heat-killed E. coli in a dose-dependent manner and that the protection was related to a reduction in serum tumor necrosis factor alpha (TNF-α). More significantly, the administration of ART together with ampicillin or unasyn (a complex of ampicillin and sulbactam) decreased mortality from 100 to 66.7% or 33.3%, respectively, in mice subjected to a lethal live E. coli challenge. Together with the observation that ART alone does not inhibit bacterial growth, this result suggests that ART protection is achieved as a result of its anti-inflammatory activity rather than an antimicrobial effect. In RAW264.7 cells, pretreatment with ART potently inhibited TNF-α and interleukin-6 release induced by CpG ODN, LPS, or heat-killed E. coli in a dose- and time-dependent manner. Experiments utilizing affinity sensor technology revealed no direct binding of ART with CpG ODN or LPS. Flow cytometry further showed that ART did not alter binding of CpG ODN to cell surfaces or the internalization of CpG ODN. In addition, upregulated levels of TLR9 and TLR4 mRNA were not attenuated by ART treatment. ART treatment did, however, block the NF-κB activation induced by CpG ODN, LPS, or heat-killed E. coli. These findings provide compelling evidence that ART may be an important potential drug for sepsis treatment. PMID:16801421

  3. Intraperitoneal prophylaxis with CpG oligodeoxynucleotides protects neutropenic mice against intracerebral Escherichia coli K1 infection.

    PubMed

    Ribes, Sandra; Meister, Tanja; Ott, Martina; Redlich, Sandra; Janova, Hana; Hanisch, Uwe-Karsten; Nessler, Stefan; Nau, Roland

    2014-01-23

    Prophylaxis with unmethylated cytosine phosphate guanidine (CpG) oligodeoxynucleotides (ODN) protects against several systemic experimental infections. Escherichia coli is a major cause of Gram-negative neonatal bacterial meningitis and also causes meningitis and meningoencephalitis in older and immunocompromised patients. Wild-type (wt) and Toll-like receptor 9 (TLR9)-deficient mice were rendered neutropenic by intraperitoneal administration of the anti-Ly-6G monoclonal antibody. Immunocompetent and neutropenic mice received intraperitoneal CpG ODN or vehicle 72 h prior to induction of E. coli K1 meningoencephalitis. Pre-treatment with CpG ODN significantly increased survival of neutropenic wt mice from 33% to 75% (P = 0.0003) but did not protect neutropenic TLR9-/- mice. The protective effect of CpG ODN was associated with an enhanced production of interleukin (IL)-12/IL-23p40 with sustained increased levels in serum and spleen at least for 17 days after conditioning compared to buffer-treated animals. CpG-treated neutropenic wt mice showed reduced bacterial concentrations and increased recruitment of Ly6ChighCCR2+ monocytes in brain and spleen 42 h after infection. The levels of macrophage inflammatory protein 1α (MIP-1α) and interferon gamma (IFN-γ) in spleen were higher 42 h after infection in CpG-treated compared to buffer-treated neutropenic animals. In immunocompetent mice, prophylaxis with CpG ODN did not significantly increase survival compared to the buffer group (60% vs. 45%, P = 0.2). These findings suggest that systemic administration of CpG ODN may help to prevent bacterial CNS infections in immunocompromised individuals.

  4. Complete Chloroplast Genome of Pinus massoniana (Pinaceae): Gene Rearrangements, Loss of ndh Genes, and Short Inverted Repeats Contraction, Expansion.

    PubMed

    Ni, ZhouXian; Ye, YouJu; Bai, Tiandao; Xu, Meng; Xu, Li-An

    2017-09-11

    The chloroplast genome (CPG) of Pinus massoniana belonging to the genus Pinus (Pinaceae), which is a primary source of turpentine, was sequenced and analyzed in terms of gene rearrangements, ndh genes loss, and the contraction and expansion of short inverted repeats (IRs). P. massoniana CPG has a typical quadripartite structure that includes large single copy (LSC) (65,563 bp), small single copy (SSC) (53,230 bp) and two IRs (IRa and IRb, 485 bp). The 108 unique genes were identified, including 73 protein-coding genes, 31 tRNAs, and 4 rRNAs. Most of the 81 simple sequence repeats (SSRs) identified in CPG were mononucleotides motifs of A/T types and located in non-coding regions. Comparisons with related species revealed an inversion (21,556 bp) in the LSC region; P. massoniana CPG lacks all 11 intact ndh genes (four ndh genes lost completely; the five remained truncated as pseudogenes; and the other two ndh genes remain as pseudogenes because of short insertions or deletions). A pair of short IRs was found instead of large IRs, and size variations among pine species were observed, which resulted from short insertions or deletions and non-synchronized variations between "IRa" and "IRb". The results of phylogenetic analyses based on whole CPG sequences of 16 conifers indicated that the whole CPG sequences could be used as a powerful tool in phylogenetic analyses.

  5. Multi-step aberrant CpG island hyper-methylation is associated with the progression of adult T-cell leukemia/lymphoma.

    PubMed

    Sato, Hiaki; Oka, Takashi; Shinnou, Yoko; Kondo, Takami; Washio, Kana; Takano, Masayuki; Takata, Katsuyoshi; Morito, Toshiaki; Huang, Xingang; Tamura, Maiko; Kitamura, Yuta; Ohara, Nobuya; Ouchida, Mamoru; Ohshima, Koichi; Shimizu, Kenji; Tanimoto, Mitsune; Takahashi, Kiyoshi; Matsuoka, Masao; Utsunomiya, Atae; Yoshino, Tadashi

    2010-01-01

    Aberrant CpG island methylation contributes to the pathogenesis of various malignancies. However, little is known about the association of epigenetic abnormalities with multistep tumorigenic events in adult T cell leukemia/lymphoma (ATLL). To determine whether epigenetic abnormalities induce the progression of ATLL, we analyzed the methylation profiles of the SHP1, p15, p16, p73, HCAD, DAPK, hMLH-1, and MGMT genes by methylation specific PCR assay in 65 cases with ATLL patients. The number of CpG island methylated genes increased with disease progression and aberrant hypermethylation in specific genes was detected even in HTLV-1 carriers and correlated with progression to ATLL. The CpG island methylator phenotype (CIMP) was observed most frequently in lymphoma type ATLL and was also closely associated with the progression and crisis of ATLL. The high number of methylated genes and increase of CIMP incidence were shown to be unfavorable prognostic factors and correlated with a shorter overall survival by Kaplan-Meyer analysis. The present findings strongly suggest that the multistep accumulation of aberrant CpG methylation in specific target genes and the presence of CIMP are deeply involved in the crisis, progression, and prognosis of ATLL, as well as indicate the value of CpG methylation and CIMP for new diagnostic and prognostic biomarkers.

  6. Multi-Step Aberrant CpG Island Hyper-Methylation Is Associated with the Progression of Adult T–Cell Leukemia/Lymphoma

    PubMed Central

    Sato, Hiaki; Oka, Takashi; Shinnou, Yoko; Kondo, Takami; Washio, Kana; Takano, Masayuki; Takata, Katsuyoshi; Morito, Toshiaki; Huang, Xingang; Tamura, Maiko; Kitamura, Yuta; Ohara, Nobuya; Ouchida, Mamoru; Ohshima, Koichi; Shimizu, Kenji; Tanimoto, Mitsune; Takahashi, Kiyoshi; Matsuoka, Masao; Utsunomiya, Atae; Yoshino, Tadashi

    2010-01-01

    Aberrant CpG island methylation contributes to the pathogenesis of various malignancies. However, little is known about the association of epigenetic abnormalities with multistep tumorigenic events in adult T cell leukemia/lymphoma (ATLL). To determine whether epigenetic abnormalities induce the progression of ATLL, we analyzed the methylation profiles of the SHP1, p15, p16, p73, HCAD, DAPK, hMLH-1, and MGMT genes by methylation specific PCR assay in 65 cases with ATLL patients. The number of CpG island methylated genes increased with disease progression and aberrant hypermethylation in specific genes was detected even in HTLV-1 carriers and correlated with progression to ATLL. The CpG island methylator phenotype (CIMP) was observed most frequently in lymphoma type ATLL and was also closely associated with the progression and crisis of ATLL. The high number of methylated genes and increase of CIMP incidence were shown to be unfavorable prognostic factors and correlated with a shorter overall survival by Kaplan-Meyer analysis. The present findings strongly suggest that the multistep accumulation of aberrant CpG methylation in specific target genes and the presence of CIMP are deeply involved in the crisis, progression, and prognosis of ATLL, as well as indicate the value of CpG methylation and CIMP for new diagnostic and prognostic biomarkers. PMID:20019193

  7. Immunostimulatory CpG on Carbon Nanotubes Selectively Inhibits Migration of Brain Tumor Cells.

    PubMed

    Alizadeh, Darya; White, Ethan E; Sanchez, Teresa C; Liu, Shunan; Zhang, Leying; Badie, Behnam; Berlin, Jacob M

    2018-05-16

    Even when treated with aggressive current therapies, patients with glioblastoma usually survive less than two years and exhibit a high rate of recurrence. CpG is an oligonucleotide that activates the innate immune system via Toll-like receptor 9 (TLR9) activation. Injection of CpG into glioblastoma tumors showed promise as an immunotherapy in mouse models but proved disappointing in human trials. One aspect of glioma that is not addressed by CpG therapy alone is the highly invasive nature of glioma cells, which is associated with resistance to radiation and chemotherapy. Here, we demonstrate that single-walled carbon nanotubes noncovalently functionalized with CpG (SWNT/CpG), which retain the immunostimulatory property of the CpG, selectively inhibit the migration of glioma cells and not macrophages without affecting cell viability or proliferation. SWNT/CpG also selectively decreased NF-κB activation in glioma cells, while activating macrophages by induction of the TLR9/NF-κB pathway, as we have previously reported. The migration inhibition of glioma cells was correlated with selective reduction of intracellular levels of reactive oxygen species (ROS), suggesting that an antioxidant-based mechanism mediates the observed effects. To the best of our knowledge, SWNT/CpG is the first nanomaterial that inhibits the migration of cancer cells while stimulating the immune system.

  8. DNA Methylation of T1R1 Gene in the Vegetarian Adaptation of Grass Carp Ctenopharyngodon idella.

    PubMed

    Cai, Wenjing; He, Shan; Liang, Xu-Fang; Yuan, Xiaochen

    2018-05-02

    Although previous studies have indicated importance of taste receptors in food habits formation in mammals, little is known about those in fish. Grass carp is an excellent model for studying vegetarian adaptation, as it shows food habit transition from carnivore to herbivore. In the present study, pseudogenization or frameshift mutations of the umami receptors that hypothesized related to dietary switch in vertebrates, were not found in grass carp, suggesting other mechanisms for vegetarian adaptation in grass carp. T1R1 and T1R3 strongly responded to L-Arg and L-Lys, differing from those of zebrafish and medaka, contributing to high species specificity in amino acid preferences and diet selection of grass carp. After food habit transition of grass carp, DNA methylation levels were higher in CPG1 and CPG3 islands of upstream control region of T1R1 gene. Luciferase activity assay of upstream regulatory region of T1R1 (-2500-0 bp) without CPG1 or CPG3 indicated that CPG1 and CPG3 might be involved in transcriptional regulation of T1R1 gene. Subsequently, high DNA methylation decreased expression of T1R1 in intestinal tract. It could be a new mechanism to explain, at least partially, the vegetarian adaptation of grass carp by regulation of expression of umami receptor via epigenetic modification.

  9. Continuous Positive Airway Pressure During Exercise Improves Walking Time in Patients Undergoing Inpatient Cardiac Rehabilitation After Coronary Artery Bypass Graft Surgery: A RANDOMIZED CONTROLLED TRIAL.

    PubMed

    Pantoni, Camila Bianca Falasco; Di Thommazo-Luporini, Luciana; Mendes, Renata Gonçalves; Caruso, Flávia Cristina Rossi; Mezzalira, Daniel; Arena, Ross; Amaral-Neto, Othon; Catai, Aparecida Maria; Borghi-Silva, Audrey

    2016-01-01

    Continuous positive airway pressure (CPAP) has been used as an effective support to decrease the negative pulmonary effects of coronary artery bypass graft (CABG) surgery. However, it is unknown whether CPAP can positively influence patients undergoing CABG during exercise. This study evaluated the effectiveness of CPAP on the first day of ambulation after CABG in patients undergoing inpatient cardiac rehabilitation (CR). Fifty-four patients after CABG surgery were randomly assigned to receive either inpatient CR and CPAP (CPG) or standard CR without CPAP (CG). Cardiac rehabilitation included walking and CPAP pressures were set between 10 to 12 cmH2O. Participants were assessed on the first day of walking at rest and during walking. Outcome measures included breathing pattern variables, exercise time in seconds (ETs), dyspnea/leg effort ratings, and peripheral oxygen saturation (SpO2). Twenty-seven patients (13 CPG vs 14 CG) completed the study. Compared with walking without noninvasive ventilation assistance, CPAP increased ETs by 43.4 seconds (P = .040) during walking, promoted better thoracoabdominal coordination, increased ventilation during walking by 12.5 L/min (P = .001), increased SpO2 values at the end of walking by 2.6% (P = .016), and reduced dyspnea ratings by 1 point (P = .008). Continuous positive airway pressure can positively influence exercise tolerance, ventilatory function, and breathing pattern in response to a single bout of exercise after CABG.

  10. Comparative in vitro toll-like receptor ligand induced cytokine profiles of Toda and Murrah buffaloes-Identification of tumour necrosis factor alpha promoter polymorphism.

    PubMed

    Vignesh, A R; Dhinakar Raj, G; Dhanasekaran, S; Tirumurugaan, K G; Raja, A

    2012-12-15

    The objective of this study was to assess cytokine production upon activation of pattern recognition receptors responsible for sensing bacterial and viral pathogen associated molecular patterns in two genetically diverse buffalo breeds, Toda and Murrah. A very limited molecular-epidemiological analysis showed a higher prevalence of Anaplasma and Theileria in Murrah than Toda buffaloes. Toda buffalo peripheral blood mononuclear cells (PBMC) produced significantly higher levels of IFN γ and/or TNF α mRNAs in response to peptidoglycan, poly I:C, lipopolysaccharide, imiquimod and CpG. Flagellin stimulation did not result in any significant differences in the expression levels of the cytokines tested between these breeds. The levels of ligand induced IFN γ and TNF α mRNA and proteins also correlated except when induced with CpG. The proximal promoter region of TNF α across these two breeds were also sequenced to detect SNPs and promoter assay performed to determine their role in altering the transcriptional activity. Two polymorphisms were identified at -737 (T/A) and -1092 (G/T) positions in Toda buffalo TNF α promoter and promoter assay revealed higher transcription activity in Toda buffalos than in Murrah. This suggests that disease tolerance of these buffalo breeds could be due to the differences in their cytokine transcription levels in response to the respective PAMPs that may be at least in part determined by polymorphisms in the cytokine promoter regions. Copyright © 2012 Elsevier B.V. All rights reserved.

  11. A crucial role for plasmacytoid dendritic cells in antiviral protection by CpG ODN–based vaginal microbicide

    PubMed Central

    Shen, Hong; Iwasaki, Akiko

    2006-01-01

    Topical microbicides represent a promising new approach to preventing HIV and other sexually transmitted infections. TLR agonists are ideal candidates for microbicides, as they trigger a multitude of antiviral genes effective against a broad range of viruses. Although vaginal application of CpG oligodeoxynucleotides (ODNs) and poly I:C has been shown to protect mice from genital herpes infection, the mechanism by which these agents provide protection remains unclear. Here, we show that plasmacytoid DCs (pDCs) are required for CpG ODN–mediated protection against lethal vaginal challenge with herpes simplex virus type 2 (HSV-2). Moreover, we demonstrate that cells of both the hematopoietic and stromal compartments must respond to CpG ODN via TLR9 and to type I IFNs through IFN-αβ receptor (IFN-αβR) for protection. Thus, crosstalk between pDCs and vaginal stromal cells provides for optimal microbicide efficacy. Our results imply that temporally and spatially controlled targeting of CpG ODN to pDCs and epithelial cells can potentially maximize their effectiveness as microbicides while minimizing the associated inflammatory responses. PMID:16878177

  12. Global Epigenetic Changes May Underlie Ethnic Differences and susceptibility to Prostate Cancer

    DTIC Science & Technology

    2012-09-01

    tissues; in the prostate, hypermethylation of the GSTP1 CpG has been detected in PIA lesions [8]. DNA methylation occurs at CpG sites in the human...that the GSTP1 CpG island was frequently hypermethylated in PCa, more than 40 genes have been reported to be targets of DNA hypermethylation-associated...One study demonstrated that GSTP1 hypermethylation was significantly higher in PCa samples from AA men in comparison with EA and Asians [12]. Another

  13. Electrical stimulation and motor recovery.

    PubMed

    Young, Wise

    2015-01-01

    In recent years, several investigators have successfully regenerated axons in animal spinal cords without locomotor recovery. One explanation is that the animals were not trained to use the regenerated connections. Intensive locomotor training improves walking recovery after spinal cord injury (SCI) in people, and >90% of people with incomplete SCI recover walking with training. Although the optimal timing, duration, intensity, and type of locomotor training are still controversial, many investigators have reported beneficial effects of training on locomotor function. The mechanisms by which training improves recovery are not clear, but an attractive theory is available. In 1949, Donald Hebb proposed a famous rule that has been paraphrased as "neurons that fire together, wire together." This rule provided a theoretical basis for a widely accepted theory that homosynaptic and heterosynaptic activity facilitate synaptic formation and consolidation. In addition, the lumbar spinal cord has a locomotor center, called the central pattern generator (CPG), which can be activated nonspecifically with electrical stimulation or neurotransmitters to produce walking. The CPG is an obvious target to reconnect after SCI. Stimulating motor cortex, spinal cord, or peripheral nerves can modulate lumbar spinal cord excitability. Motor cortex stimulation causes long-term changes in spinal reflexes and synapses, increases sprouting of the corticospinal tract, and restores skilled forelimb function in rats. Long used to treat chronic pain, motor cortex stimuli modify lumbar spinal network excitability and improve lower extremity motor scores in humans. Similarly, epidural spinal cord stimulation has long been used to treat pain and spasticity. Subthreshold epidural stimulation reduces the threshold for locomotor activity. In 2011, Harkema et al. reported lumbosacral epidural stimulation restores motor control in chronic motor complete patients. Peripheral nerve or functional electrical stimulation (FES) has long been used to activate sacral nerves to treat bladder and pelvic dysfunction and to augment motor function. In theory, FES should facilitate synaptic formation and motor recovery after regenerative therapies. Upcoming clinical trials provide unique opportunities to test the theory.

  14. DNA methylation levels at chromosome 8q24 in peripheral blood are associated with 8q24 cancer susceptibility loci.

    PubMed

    Barry, Kathryn Hughes; Moore, Lee E; Sampson, Joshua; Yan, Liying; Meyer, Ann; Oler, Andrew J; Chung, Charles C; Wang, Zhaoming; Yeager, Meredith; Amundadottir, Laufey; Berndt, Sonja I

    2014-12-01

    Chromosome 8q24 has emerged as an important region for genetic susceptibility to various cancers, but little is known about the contribution of DNA methylation at 8q24. To evaluate variability in DNA methylation levels at 8q24 and the relationship with cancer susceptibility single nucleotide polymorphisms (SNPs) in this region, we quantified DNA methylation levels in peripheral blood at 145 CpG sites nearby 8q24 cancer susceptibility SNPs or MYC using pyrosequencing among 80 Caucasian men in the Prostate, Lung, Colorectal, and Ovarian Cancer Screening Trial. For the 60 CpG sites meeting quality control, which also demonstrated temporal stability over a 5-year period, we calculated pairwise Spearman correlations for DNA methylation levels at each CpG site with 42 8q24 cancer susceptibility SNPs. To account for multiple testing, we adjusted P values into q values reflecting the false discovery rate (FDR). In contrast to the MYC CpG sites, most sites nearby the SNPs demonstrated good reproducibility, high methylation levels, and moderate-high between-individual variation. We observed 10 statistically significant (FDR < 0.05) CpG site-SNP correlations. These included correlations between an intergenic CpG site at Chr8:128393157 and the prostate cancer SNP rs16902094 (ρ = -0.54; P = 9.7 × 10(-7); q = 0.002), a PRNCR1 CpG site at Chr8:128167809 and the prostate cancer SNP rs1456315 (ρ = 0.52; P = 1.4 × 10(-6); q = 0.002), and two POU5F1B CpG sites and several prostate/colorectal cancer SNPs (for Chr8:128498051 and rs6983267, ρ = 0.46; P = 2.0 × 10(-5); q = 0.01). This is the first report of correlations between blood DNA methylation levels and cancer susceptibility SNPs at 8q24, suggesting that DNA methylation at this important susceptibility locus may contribute to cancer risk. ©2014 American Association for Cancer Research.

  15. Primary care clinical practice guidelines in South Africa: qualitative study exploring perspectives of national stakeholders.

    PubMed

    Kredo, Tamara; Abrams, Amber; Young, Taryn; Louw, Quinette; Volmink, Jimmy; Daniels, Karen

    2017-08-29

    Clinical practice guidelines (CPGs) are common tools in policy and clinical practice informing clinical decisions at the bedside, governance of health facilities, health insurer and government spending, and patient choices. South Africa's health sector is transitioning to a national health insurance system, aiming to build on other primary health care initiatives to transform the previously segregated, inequitable services. Within these plans CPGs are an integral tool for delivering standardised and cost effective care. Currently, there is no accepted standard approach to developing, adapting or implementing CPGs efficiently or effectively in South Africa. We explored the current players; drivers; and the context and processes of primary care CPG development from the perspective of stakeholders operating at national level. We used a qualitative approach. Sampling was initially purposeful, followed by snowballing and further sampling to reach representivity of primary care service providers. Individual in-depth interviews were recorded and transcribed verbatim. We used thematic content analysis to analyse the data. We conducted 37 in-depth interviews from June 2014-July 2015. We found CPG development and implementation were hampered by lack of human and funding resources for technical and methodological work; fragmentation between groups, and between national and provincial health sectors; and lack of agreed systems for CPG development and implementation. Some CPG contributors steadfastly work to improve processes aiming to enhance communication, use of evidence, and transparency to ensure credible guidance is produced. Many interviewed had shared values, and were driven to address inequity, however, resource gaps were perceived to create an enabling environment for commercial interests or personal agendas to drive the CPG development process. Our findings identified strengths and gaps in CPG development processes, and a need for national standards to guide CPG development and implementation. Based on our findings and suggestions from participants, a possible way forward would be for South Africa to have a centrally coordinated CPG unit to address these needs and aspects of fragmentation by devising processes that support collaboration, transparency and credibility across sectors and disciplines. Such an initiative will require adequate resourcing to build capacity and ensure support for the delivery of high quality CPGs for South African primary care.

  16. A rhythmic modulatory gating system in the stomatogastric nervous system of Homarus gammarus. III. Rhythmic control of the pyloric CPG.

    PubMed

    Cardi, P; Nagy, F

    1994-06-01

    1. Two modulatory neurons, P and commissural pyloric (CP), known to be involved in the long-term maintenance of pyloric central pattern generator operation in the rock lobster Homarus gammarus, are members of the commissural pyloric oscillator (CPO), a higher-order oscillator influencing the pyloric network. 2. The CP neuron was endogenously oscillating in approximately 30% of the preparations in which its cell body was impaled. Rhythmic inhibitory feedback from the pyloric pacemaker anterior burster (AB) neuron stabilized the CP neuron's endogenous rhythm. 3. The organization of the CPO is described. Follower commissural neurons, the F cells, and the CP neuron receive a common excitatory postsynaptic potential from another commissural neuron, the large exciter (LE). When in oscillatory state, CP in turn excites the LE neuron. This positive feedback may maintain long episodes of CP oscillations. 4. The pyloric pacemaker neurons follow the CPO rhythm with variable coordination modes (i.e., 1:1, 1:2) and switch among these modes when their membrane potential is modified. The CPO inputs strongly constrain the pyloric period, which as a result may adopt only a few discrete values. This effect is based on mechanisms of entrainment between the CPO and the pyloric oscillator. 5. Pyloric constrictor neurons show differential sensitivity from the pyloric pacemaker neurons with respect to the CPO inputs. Consequently, their bursting period can be a shorter harmonic of the bursting period of the pyloric pacemakers neurons. 6. The CPO neurons seem to be the first example of modulatory gating neurons that also give timing cues to a rhythmic pattern generating network.

  17. Deregulation of RB1 expression by loss of imprinting in human hepatocellular carcinoma.

    PubMed

    Anwar, Sumadi Lukman; Krech, Till; Hasemeier, Britta; Schipper, Elisa; Schweitzer, Nora; Vogel, Arndt; Kreipe, Hans; Lehmann, Ulrich

    2014-08-01

    The tumour suppressor gene RB1 is frequently silenced in many different types of human cancer, including hepatocellular carcinoma (HCC). However, mutations of the RB1 gene are relatively rare in HCC. A systematic screen for the identification of imprinted genes deregulated in human HCC revealed that RB1 shows imprint abnormalities in a high proportion of primary patient samples. Altogether, 40% of the HCC specimens (16/40) showed hyper- or hypomethylation at the CpG island in intron 2 of the RB1 gene. Re-analysis of publicly available genome-wide DNA methylation data confirmed these findings in two independent HCC cohorts. Loss of correct DNA methylation patterns at the RB1 locus leads to the aberrant expression of an alternative RB1-E2B transcript, as measured by quantitative real-time PCR. Demethylation at the intron 2 CpG island by DNMT1 knock-down or aza-deoxycytidine (DAC) treatment stimulated expression of the RB1-E2B transcript, accompanied by diminished RB1 main transcript expression. No aberrant DNA methylation was found at the RB1 locus in hepatocellular adenoma (HCA, n = 10), focal nodular hyperplasia (FNH, n = 5) and their corresponding adjacent liver tissue specimens. Deregulated RB1 expression due to hyper- or hypomethylation in intron 2 of the RB1 gene is found in tumours without loss of heterozygosity and is associated with a decrease in overall survival (p = 0.032) if caused by hypermethylation of CpG85. This unequivocally demonstrates that loss of imprinting represents an important additional mechanism for RB1 pathway inactivation in human HCC, complementing well-described molecular defects. Copyright © 2014 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  18. Epigenetic profiling of cutaneous T-cell lymphoma: promoter hypermethylation of multiple tumor suppressor genes including BCL7a, PTPRG, and p73.

    PubMed

    van Doorn, Remco; Zoutman, Willem H; Dijkman, Remco; de Menezes, Renee X; Commandeur, Suzan; Mulder, Aat A; van der Velden, Pieter A; Vermeer, Maarten H; Willemze, Rein; Yan, Pearlly S; Huang, Tim H; Tensen, Cornelis P

    2005-06-10

    To analyze the occurrence of promoter hypermethylation in primary cutaneous T-cell lymphoma (CTCL) on a genome-wide scale, focusing on epigenetic alterations with pathogenetic significance. DNA isolated from biopsy specimens of 28 patients with CTCL, including aggressive CTCL entities (transformed mycosis fungoides and CD30-negative large T-cell lymphoma) and an indolent entity (CD30-positive large T-cell lymphoma), were investigated. For genome-wide DNA methylation screening, differential methylation hybridization using CpG island microarrays was applied, which allows simultaneous detection of the methylation status of 8640 CpG islands. Bisulfite sequence analysis was applied for confirmation and detection of hypermethylation of eight selected tumor suppressor genes. The DNA methylation patterns of CTCLs emerging from differential methylation hybridization analysis included 35 CpG islands hypermethylated in at least four of the 28 studied CTCL samples when compared with benign T-cell samples. Hypermethylation of the putative tumor suppressor genes BCL7a (in 48% of CTCL samples), PTPRG (27%), and thrombospondin 4 (52%) was confirmed and demonstrated to be associated with transcriptional downregulation. BCL7a was hypermethylated at a higher frequency in aggressive (64%) than in indolent (14%) CTCL entities. In addition, the promoters of the selected tumor suppressor genes p73 (48%), p16 (33%), CHFR (19%), p15 (10%), and TMS1 (10%) were hypermethylated in CTCL. Malignant T cells of patients with CTCL display widespread promoter hypermethylation associated with inactivation of several tumor suppressor genes involved in DNA repair, cell cycle, and apoptosis signaling pathways. In view of this, CTCL may be amenable to treatment with demethylating agents.

  19. Bacterial DNA induces pulmonary damage via TLR-9 through cross-talk with neutrophils.

    PubMed

    Itagaki, Kiyoshi; Adibnia, Yasaman; Sun, Shiqin; Zhao, Cong; Sursal, Tolga; Chen, Yu; Junger, Wolfgang; Hauser, Carl J

    2011-12-01

    Bacterial DNA (bDNA) contains hypomethylated "CpG" repeats that can be recognized by Toll-like receptor 9 (TLR-9) as a pathogen-associated molecular pattern. The ability of bDNA to initiate lung injury via TLR-9 has been inferred on the basis of studies using artificial CpG DNA. But the role of authentic bDNA in lung injury is still unknown. Moreover, the mechanisms by which CpG DNA species can lead to pulmonary injury are unknown, although neutrophils (PMNs) are thought to play a key role in the genesis of septic acute lung injury. We evaluated the effects of bDNA on PMN-endothelial cell (EC) interactions thought critical for initiation of acute lung injury. Using a biocapacitance system to monitor real-time changes in endothelial permeability, we demonstrate here that bDNA causes EC permeability in a dose-dependent manner uniquely in the presence of PMNs. These permeability changes are inhibited by chloroquine, suggesting TLR-9 dependency. When PMNs were preincubated with bDNA and applied to ECs or when bDNA was applied to ECs without PMNs, no permeability changes were detected. To study the underlying mechanisms, we evaluated the effects of bDNA on PMN-EC adherence. Bacterial DNA significantly increased PMN adherence to ECs in association with upregulated adhesion molecules in both cell types. Taken together, our results strongly support the conclusion that bDNA can initiate lung injury by stimulating PMN-EC adhesive interactions predisposing to endothelial permeability. Bacterial DNA stimulation of TLR-9 appears to promote enhanced gene expression of adhesion molecules in both cell types. This leads to PMN-EC cross-talk, which is required for injury to occur.

  20. The causal effect of red blood cell folate on genome-wide methylation in cord blood: a Mendelian randomization approach.

    PubMed

    Binder, Alexandra M; Michels, Karin B

    2013-12-04

    Investigation of the biological mechanism by which folate acts to affect fetal development can inform appraisal of expected benefits and risk management. This research is ethically imperative given the ubiquity of folic acid fortified products in the US. Considering that folate is an essential component in the one-carbon metabolism pathway that provides methyl groups for DNA methylation, epigenetic modifications provide a putative molecular mechanism mediating the effect of folic acid supplementation on neonatal and pediatric outcomes. In this study we use a Mendelian Randomization Unnecessary approach to assess the effect of red blood cell (RBC) folate on genome-wide DNA methylation in cord blood. Site-specific CpG methylation within the proximal promoter regions of approximately 14,500 genes was analyzed using the Illumina Infinium Human Methylation27 Bead Chip for 50 infants from the Epigenetic Birth Cohort at Brigham and Women's Hospital in Boston. Using methylenetetrahydrofolate reductase genotype as the instrument, the Mendelian Randomization approach identified 7 CpG loci with a significant (mostly positive) association between RBC folate and methylation level. Among the genes in closest proximity to this significant subset of CpG loci, several enriched biologic processes were involved in nucleic acid transport and metabolic processing. Compared to the standard ordinary least squares regression method, our estimates were demonstrated to be more robust to unmeasured confounding. To the authors' knowledge, this is the largest genome-wide analysis of the effects of folate on methylation pattern, and the first to employ Mendelian Randomization to assess the effects of an exposure on epigenetic modifications. These results can help guide future analyses of the causal effects of periconceptional folate levels on candidate pathways.

  1. Genetic polymorphisms in one-carbon metabolism: associations with CpG island methylator phenotype (CIMP) in colon cancer and the modifying effects of diet

    PubMed Central

    Curtin, Karen; Slattery, Martha L.; Ulrich, Cornelia M.; Bigler, Jeannette; Levin, Theodore R.; Wolff, Roger K.; Albertsen, Hans; Potter, John D.; Samowitz, Wade S.

    2008-01-01

    This study investigated associations between CpG island methylator phenotype (CIMP) colon cancer and genetic polymorphisms relevant to one-carbon metabolism and thus, potentially the provision of methyl groups and risk of colon cancer. Data from a large, population-based case–control study (916 incident colon cancer cases and 1972 matched controls) were used. Candidate polymorphisms in methylenetetrahydrofolate reductase (MTHFR), thymidylate synthase (TS), transcobalamin II (TCNII), methionine synthase (MTR), reduced folate carrier (RFC), methylene-tetrahydrofolate dehydrogenase 1 (MTHFD1), dihydrofolate reductase (DHFR) and alcohol dehydrogenase 3 (ADH3) were evaluated. CIMP− or CIMP+ phenotype was based on five CpG island markers: MINT1, MINT2, MINT31, p16 and MLH1. The influence of specific dietary factors (folate, methionine, vitamin B12 and alcohol) on these associations was also analyzed. We hypothesized that polymorphisms involved in the provision of methyl groups would be associated with CIMP+ tumors (two or more of five markers methylated), potentially modified by diet. Few associations specific to CIMP+ tumors were observed overall, which does not support the hypothesis that the provision of methyl groups is important in defining a methylator phenotype. However, our data suggest that genetic polymorphisms in MTHFR 1298A > C, interacting with diet, may be involved in the development of highly CpG-methylated colon cancers. AC and CC genotypes in conjunction with a high-risk dietary pattern (low folate and methionine intake and high alcohol use) were associated with CIMP+ (OR = 2.1, 95% CI = 1.3–3.4 versus AA/high risk; P-interaction = 0.03). These results provide only limited support for a role of polymorphisms in one-carbon metabolism in the etiology of CIMP colon cancer. PMID:17449906

  2. Genetic polymorphisms in one-carbon metabolism: associations with CpG island methylator phenotype (CIMP) in colon cancer and the modifying effects of diet.

    PubMed

    Curtin, Karen; Slattery, Martha L; Ulrich, Cornelia M; Bigler, Jeannette; Levin, Theodore R; Wolff, Roger K; Albertsen, Hans; Potter, John D; Samowitz, Wade S

    2007-08-01

    This study investigated associations between CpG island methylator phenotype (CIMP) colon cancer and genetic polymorphisms relevant to one-carbon metabolism and thus, potentially the provision of methyl groups and risk of colon cancer. Data from a large, population-based case-control study (916 incident colon cancer cases and 1,972 matched controls) were used. Candidate polymorphisms in methylenetetrahydrofolate reductase (MTHFR), thymidylate synthase (TS), transcobalamin II (TCNII), methionine synthase (MTR), reduced folate carrier (RFC), methylenetetrahydrofolate dehydrogenase 1 (MTHFD1), dihydrofolate reductase (DHFR) and alcohol dehydrogenase 3 (ADH3) were evaluated. CIMP- or CIMP+ phenotype was based on five CpG island markers: MINT1, MINT2, MINT31, p16 and MLH1. The influence of specific dietary factors (folate, methionine, vitamin B(12) and alcohol) on these associations was also analyzed. We hypothesized that polymorphisms involved in the provision of methyl groups would be associated with CIMP+ tumors (two or more of five markers methylated), potentially modified by diet. Few associations specific to CIMP+ tumors were observed overall, which does not support the hypothesis that the provision of methyl groups is important in defining a methylator phenotype. However, our data suggest that genetic polymorphisms in MTHFR 1,298A > C, interacting with diet, may be involved in the development of highly CpG-methylated colon cancers. AC and CC genotypes in conjunction with a high-risk dietary pattern (low folate and methionine intake and high alcohol use) were associated with CIMP+ (OR = 2.1, 95% CI = 1.3-3.4 versus AA/high risk; P-interaction = 0.03). These results provide only limited support for a role of polymorphisms in one-carbon metabolism in the etiology of CIMP colon cancer.

  3. Immune stimulation by a CpG-containing oligodeoxynucleotide is enhanced when encapsulated and delivered in lipid particles.

    PubMed

    Mui, B; Raney, S G; Semple, S C; Hope, M J

    2001-09-01

    The therapeutic benefit from phosphorothioate oligodeoxynucleotides (PS ODN) containing immune stimulatory sequences (ISS) has been demonstrated in animal models of cancer and infection. In particular, when CpG-containing PS ODN are administered to mice, activation of macrophages and dendritic, NK, T, and B cells occurs, resulting in the release of an array of cytokines, including interleukin-12 (IL-12), interferon-gamma (IFN-gamma), and tumor necrosis factor-alpha (TNF-alpha). We have previously described stabilized antisense-lipid particles (SALP) for the i.v. administration of antisense ODN [Biochim Biophys Acta (2001) 1510:152--166]. Given the propensity for SALP to target macrophages in vivo it was of interest to determine whether they could enhance the potency of CpG ODN to induce an immune response. In this report we show that when CpG-containing SALP are administered intravenously to ICR mice the plasma concentrations of IL-12, IFN-gamma, IL-6, monocyte chemoattractant protein-1, and TNF-alpha are greatly increased compared with the same dose of free ODN. The pattern of cytokine induction indicates that the immune response is T helper cell type 1-biased, similar to that observed for PS CpG ODN ISS in general. Furthermore, when phosphodiester (PO) ODN is substituted for PS ODN in the SALP formulation cytokine induction is even greater at the early time points, in marked contrast to free PO ODN, which is inactive. These results demonstrate that the immunogenicity of ISS is not only enhanced by encapsulation in lipid particles, which more closely mimic the way ISS DNA would normally be presented to antigen presenting cells by pathogens in vivo, but also SALP enable unmodified PO CpG ODN to be used as immune stimulants.

  4. The association of serotonin receptor 3A methylation with maternal violence exposure, neural activity, and child aggression.

    PubMed

    Schechter, Daniel S; Moser, Dominik A; Pointet, Virginie C; Aue, Tatjana; Stenz, Ludwig; Paoloni-Giacobino, Ariane; Adouan, Wafae; Manini, Aurélia; Suardi, Francesca; Vital, Marylene; Sancho Rossignol, Ana; Cordero, Maria I; Rothenberg, Molly; Ansermet, François; Rusconi Serpa, Sandra; Dayer, Alexandre G

    2017-05-15

    Methylation of the serotonin 3A receptor gene (HTR3A) has been linked to child maltreatment and adult psychopathology. The present study examined whether HTR3A methylation might be associated with mothers' lifetime exposure to interpersonal violence (IPV), IPV-related psychopathology, child disturbance of attachment, and maternal neural activity. Number of maternal lifetime IPV exposures and measures of maternal psychopathology including posttraumatic stress disorder (PTSD), major depression and aggressive behavior (AgB), and a measure of child attachment disturbance known as "secure base distortion" (SBD) were assessed in a sample of 35 mothers and children aged 12-42 months. Brain fMRI activation was assessed in mothers using 30-s silent film excerpts depicting menacing adult male-female interactions versus prosocial and neutral interactions. Group and continuous analyses were performed to test for associations between clinical and fMRI variables with DNA methylation. Maternal IPV exposure-frequency was associated with maternal PTSD; and maternal IPV-PTSD was in turn associated with child SBD. Methylation status of several CpG sites in the HTR3A gene was associated with maternal IPV and IPV-PTSD severity, AgB and child SBD, in particular, self-endangering behavior. Methylation status at a specific CpG site (CpG2_III) was associated with decreased medial prefrontal cortical (mPFC) activity in response to film-stimuli of adult male-female interactions evocative of violence as compared to prosocial and neutral interactions. Methylation status of the HTR3A gene in mothers is linked to maternal IPV-related psychopathology, trauma-induced brain activation patterns, and child attachment disturbance in the form of SBD during a sensitive period in the development of self-regulation. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  5. Year 2000 (Y2K) computer compliance guide; guidance for FDA personnel. Food and Drug Administration. Notice.

    PubMed

    1999-05-14

    The Food and Drug Administration (FDA) is announcing the availability of a new compliance policy guide (CPG) entitled "Year 2000 (Y2K) Computer Compliance" (section 160-800). This guidance document represents the agency's current thinking on the manufacturing and distribution of domestic and imported products regulated by FDA using computer systems that may not perform properly before, or during, the transition to the year 2000 (Y2K). The text of the CPG is included in this notice. This compliance guidance document is an update to the Compliance Policy Guides Manual (August 1996 edition). It is a new CPG, and it will be included in the next printing of the Compliance Policy Guides Manual. This CPG is intended for FDA personnel, and it is available electronically to the public.

  6. CPG2 Recruits Endophilin B2 to the Cytoskeleton for Activity-Dependent Endocytosis of Synaptic Glutamate Receptors.

    PubMed

    Loebrich, Sven; Benoit, Marc Robert; Konopka, Jaclyn Aleksandra; Cottrell, Jeffrey Richard; Gibson, Joanne; Nedivi, Elly

    2016-02-08

    Internalization of glutamate receptors at the postsynaptic membrane via clathrin-mediated endocytosis (CME) is a key mechanism for regulating synaptic strength. A role for the F-actin cytoskeleton in CME is well established, and recently, PKA-dependent association of candidate plasticity gene 2 (CPG2) with the spine-cytoskeleton has been shown to mediate synaptic glutamate receptor internalization. Yet, how the endocytic machinery is physically coupled to the actin cytoskeleton to facilitate glutamate receptor internalization has not been demonstrated. Moreover, there has been no distinction of endocytic-machinery components that are specific to activity-dependent versus constitutive glutamate receptor internalization. Here, we show that CPG2, through a direct physical interaction, recruits endophilin B2 (EndoB2) to F-actin, thus anchoring the endocytic machinery to the spine cytoskeleton and facilitating glutamate receptor internalization. Regulation of CPG2 binding to the actin cytoskeleton by protein kinase A directly impacts recruitment of EndoB2 and clathrin. Specific disruption of EndoB2 or the CPG2-EndoB2 interaction impairs activity-dependent, but not constitutive, internalization of both NMDA- and AMPA-type glutamate receptors. These results demonstrate that, through direct interactions with F-actin and EndoB2, CPG2 physically bridges the spine cytoskeleton and the endocytic machinery, and this tripartite association is critical specifically for activity-dependent CME of synaptic glutamate receptors. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. A distinct group of CpG islands shows differential DNA methylation between replicas of the same cell line in vitro

    PubMed Central

    2013-01-01

    Background CpG dinucleotide-rich genomic DNA regions, known as CpG islands (CGIs), can be methylated at their cytosine residues as an epigenetic mark that is stably inherited during cell mitosis. Differentially methylated regions (DMRs) are genomic regions showing different degrees of DNA methylation in multiple samples. In this study, we focused our attention on CGIs showing different DNA methylation between two culture replicas of the same cell line. Results We used methylation data of 35 cell lines from the Encyclopedia of DNA Elements (ENCODE) consortium to identify CpG islands that were differentially methylated between replicas of the same cell line and denoted them Inter Replicas Differentially Methylated CpG islands (IRDM-CGIs). We identified a group of IRDM-CGIs that was consistently shared by different cell lines, and denoted it common IRDM-CGIs. X chromosome CGIs were overrepresented among common IRDM-CGIs. Autosomal IRDM-CGIs were preferentially located in gene bodies and intergenic regions had a lower G + C content, a smaller mean length, and a reduced CpG percentage. Functional analysis of the genes associated with autosomal IRDM-CGIs showed that many of them are involved in DNA binding and development. Conclusions Our results show that several specific functional and structural features characterize common IRDM-CGIs. They may represent a specific subset of CGIs that are more prone to being differentially methylated for their intrinsic characteristics. PMID:24106769

  8. The role of system Xc- in methamphetamine-induced dopaminergic neurotoxicity in mice.

    PubMed

    Dang, Duy-Khanh; Shin, Eun-Joo; Tran, Hai-Quyen; Kim, Dae-Joong; Jeong, Ji Hoon; Jang, Choon-Gon; Nah, Seung-Yeol; Sato, Hideyo; Nabeshima, Toshitaka; Yoneda, Yukio; Kim, Hyoung-Chun

    2017-09-01

    The cystine/glutamate antiporter (system Xc - , Sxc) transports cystine into cell in exchange for glutamate. Since xCT is a specific subunit of Sxc, we employed xCT knockout mice and investigated whether this antiporter affected methamphetamine (MA)-induced dopaminergic neurotoxicity. MA treatment significantly increased striatal oxidative burdens in wild type mice. xCT inhibitor [i.e., S-4-carboxy-phenylglycine (CPG), sulfasalazine] or an xCT knockout significantly protected against these oxidative burdens. MA-induced increases in Iba-1 expression and Iba-1-labeled microglial immunoreactivity (Iba-1-IR) were significantly attenuated by CPG or sulfasalazine administration or xCT knockout. CPG or sulfasalazine significantly attenuated MA-induced TUNEL-positive cell populations in the striatum of Taconic ICR mice. The decrease in excitatory amino acid transporter-2 (or glutamate transporter-1) expression and increase in glutamate release were attenuated by CPG, sulfasalazine or xCT knockout. In addition, CPG, sulfasalazine or xCT knockout significantly protected against dopaminergic loss (i.e., decreases in tyrosine hydroxylase expression and immunoreactivity, and an increase in dopamine turnover rate) induced by MA. However, CPG, sulfasalazine or xCT knockout did not significantly affect the impaired glutathione system [i.e., decrease in reduced glutathione (GSH) and increase in oxidized glutathione (GSSG)] induced by MA. Our results suggest that Sxc mediates MA-induced neurotoxicity via facilitating oxidative stress, microgliosis, proapoptosis, and glutamate-related toxicity. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. The Cambridge Prognostic Groups for improved prediction of disease mortality at diagnosis in primary non-metastatic prostate cancer: a validation study.

    PubMed

    Gnanapragasam, V J; Bratt, O; Muir, K; Lee, L S; Huang, H H; Stattin, P; Lophatananon, A

    2018-02-28

    The purpose of this study is to validate a new five-tiered prognostic classification system to better discriminate cancer-specific mortality in men diagnosed with primary non-metastatic prostate cancer. We applied a recently described five-strata model, the Cambridge Prognostic Groups (CPGs 1-5), in two international cohorts and tested prognostic performance against the current standard three-strata classification of low-, intermediate- or high-risk disease. Diagnostic clinico-pathological data for men obtained from the Prostate Cancer data Base Sweden (PCBaSe) and the Singapore Health Study were used. The main outcome measure was prostate cancer mortality (PCM) stratified by age group and treatment modality. The PCBaSe cohort included 72,337 men, of whom 7162 died of prostate cancer. The CPG model successfully classified men with different risks of PCM with competing risk regression confirming significant intergroup distinction (p < 0.0001). The CPGs were significantly better at stratified prediction of PCM compared to the current three-tiered system (concordance index (C-index) 0.81 vs. 0.77, p < 0.0001). This superiority was maintained for every age group division (p < 0.0001). Also in the ethnically different Singapore cohort of 2550 men with 142 prostate cancer deaths, the CPG model outperformed the three strata categories (C-index 0.79 vs. 0.76, p < 0.0001). The model also retained superior prognostic discrimination in the treatment sub-groups: radical prostatectomy (n = 20,586), C-index 0.77 vs. 074; radiotherapy (n = 11,872), C-index 0.73 vs. 0.69; and conservative management (n = 14,950), C-index 0.74 vs. 0.73. The CPG groups that sub-divided the old intermediate-risk (CPG2 vs. CPG3) and high-risk categories (CPG4 vs. CPG5) significantly discriminated PCM outcomes after radical therapy or conservative management (p < 0.0001). This validation study of nearly 75,000 men confirms that the CPG five-tiered prognostic model has superior discrimination compared to the three-tiered model in predicting prostate cancer death across different age and treatment groups. Crucially, it identifies distinct sub-groups of men within the old intermediate-risk and high-risk criteria who have very different prognostic outcomes. We therefore propose adoption of the CPG model as a simple-to-use but more accurate prognostic stratification tool to help guide management for men with newly diagnosed prostate cancer.

  10. Genome-wide site-specific differential methylation in the blood of individuals with Klinefelter Syndrome

    PubMed Central

    Wan, Emily S.; Qiu, Weiliang; Morrow, Jarrett; Beaty, Terri H.; Hetmanski, Jacqueline; Make, Barry J.; Lomas, David A.; Silverman, Edwin K.; DeMeo, Dawn L.

    2015-01-01

    Klinefelter syndrome (KS) (47 XXY) is a common sex-chromosome aneuploidy with an estimated prevalence of 1 in every 660 male births. Investigations into the associations between DNA methylation and the highly variable clinical manifestations of KS have largely focused on the supernumerary X chromosome; systematic investigations of the epigenome have been limited. We obtained genome-wide DNA methylation data from peripheral blood using the Illumina HumanMethylation450K platform in 5 KS (47 XXY), 102 male (46 XY), and 113 female (46 XX) control subjects participating in the chronic obstructive pulmonary disease (COPD) Gene Study. Empirical Bayes-mediated models were used to test for differential methylation by KS status. CpG sites with a false-discovery rate <0.05 from the first-generation HumanMethylation27K platform were further examined in an independent replication cohort of 2 KS subjects, 590 male, and 495 female controls drawn from the International COPD Genetics Network (ICGN). Differential methylation at sites throughout the genome were identified, including 86 CpG sites that were differentially methylated in KS subjects relative to both male and female controls. CpG sites annotated to the HEN1 methyltransferase homolog 1 (HENMT1), calcyclin-binding protein (CACYBP), and GTPase-activating protein (SH3 domain)-binding protein 1 (G3BP1) genes were among the “KS-specific” loci that were replicated in ICGN. We therefore conclude that site-specific differential methylation exists throughout the genome in KS. The functional impact and clinical relevance of these differentially methylated loci should be explored in future studies. PMID:25988574

  11. DNA methylation of ANKK1 and response to aripiprazole in patients with acute schizophrenia: A preliminary study.

    PubMed

    Miura, Itaru; Kunii, Yasuto; Hino, Mizuki; Hoshino, Hiroshi; Matsumoto, Junya; Kanno-Nozaki, Keiko; Horikoshi, Sho; Kaneko, Haruka; Bundo, Miki; Iwamoto, Kazuya; Yabe, Hirooki

    2018-05-01

    Epigenetic modification including DNA methylation may affect pathophysiology and the response to antipsychotic drugs in patients with schizophrenia. The objective of the present study was to investigate the effect of the DNA methylation of ANKK1 (ankyrin repeat and kinase domain containing 1) on the response to aripiprazole and plasma levels of monoamine metabolites in antipsychotic-free acute schizophrenia patients. The subjects were 34 Japanese patients with schizophrenia who had been treated with aripiprazole for 6 weeks. Comprehensive DNA methylation of ANKK1 was determined using a next-generation sequencer. DNA methylation levels at CpG site 387 of ANKK1 were higher in responders to treatment with aripiprazole and correlated with the changes in Positive and Negative Syndrome Scale scores, although the associations did not remain significant after Bonferroni correction. In responders, methylation at all CpG sites was significantly correlated with plasma levels of homovanillic acid (r = 0.587, p = 0.035) and 3-methoxy-4hydroxyphenylglycol (r = 0.684, p = 0.010) at baseline. Despite our non-significant results after multiple correction, our preliminary findings suggest that methylation levels at CpG site 387 of ANKK1 may be associated with treatment response to aripiprazole. Furthermore, methylation of ANKK1 may affect dopaminergic neural transmission in the treatment of schizophrenia, and may influence treatment response. Caution is needed in interpreting these findings because of the small sample size, and further studies are needed to confirm and expand our preliminary results. Copyright © 2018. Published by Elsevier Ltd.

  12. Influential factors on thermoacoustic efficiency of multilayered graphene film loudspeakers for optimal design

    NASA Astrophysics Data System (ADS)

    Xing, Qianhe; Li, Shuang; Fan, Xueliang; Bian, Anhua; Cao, Shi-Jie; Li, Cheng

    2017-09-01

    Graphene thermoacoustic loudspeakers, composed of a graphene film on a substrate, generate sound with heat. Improving thermoacoustic efficiency of graphene speakers is a goal for optimal design. In this work, we first modified the existing TA model with respect to small thermal wavelengths, and then built an acoustic platform for model validation. Additionally, sensitivity analyses for influential factors on thermoacoustic efficiency were performed, including the thickness of multilayered graphene films, the thermal effusivity of substrates, and the characteristics of inserted gases. The higher sensitivity coefficients result in the stronger effects on thermoacoustic efficiency. We find that the thickness (5 nm-15 nm) of graphene films plays a trivial role in efficiency, resulting in the sensitivity coefficient less than 0.02. The substrate thermal effusivity, however, has significant effects on efficiency, with the sensitivity coefficient around 1.7. Moreover, substrates with a lower thermal effusivity show better acoustic performances. For influences of ambient gases, the sensitivity coefficients of density ρg, thermal conductivity κg, and specific heat cp,g are 2.7, 0.98, and 0.8, respectively. Furthermore, large magnitudes of both ρg and κg lead to a higher efficiency and the sound pressure level generated by graphene films is approximately proportional to the inverse of cp,g. These findings can refer to the optimal design for graphene thermoacoustic speakers.

  13. Developing prehospital clinical practice guidelines for resource limited settings: why re-invent the wheel?

    PubMed

    McCaul, Michael; de Waal, Ben; Hodkinson, Peter; Pigoga, Jennifer L; Young, Taryn; Wallis, Lee A

    2018-02-05

    Methods on developing new (de novo) clinical practice guidelines (CPGs) have received substantial attention. However, the volume of literature is not matched by research into alternative methods of CPG development using existing CPG documents-a specific issue for guideline development groups in low- and middle-income countries. We report on how we developed a context specific prehospital CPG using an alternative guideline development method. Difficulties experienced and lessons learnt in applying existing global guidelines' recommendations to a national context are highlighted. The project produced the first emergency care CPG for prehospital providers in Africa. It included > 270 CPGs and produced over 1000 recommendations for prehospital emergency care. We encountered various difficulties, including (1) applicability issues: few pre-hospital CPGs applicable to Africa, (2) evidence synthesis: heterogeneous levels of evidence classifications and (3) guideline quality. Learning points included (1) focusing on key CPGs and evidence mapping, (2) searching other resources for CPGs, (3) broad representation on CPG advisory boards and (4) transparency and knowledge translation. Re-inventing the wheel to produce CPGs is not always feasible. We hope this paper will encourage further projects to use existing CPGs in developing guidance to improve patient care in resource-limited settings.

  14. Decreased interferon-α production in response to CpG DNA dysregulates cytokine responses in patients with multiple sclerosis.

    PubMed

    Hirotani, Makoto; Niino, Masaaki; Fukazawa, Toshiyuki; Yaguchi, Hiroaki; Nakamura, Masakazu; Kikuchi, Seiji; Sasaki, Hidenao

    2012-05-01

    Type I interferons (IFNs), represented by IFN-α and β, activate immune effector cells belonging to the innate and adaptive immune systems. Plasmacytoid dendritic cells (pDCs) produce IFN-α in response to CpG DNA. We aimed to examine the impact of pDC-produced IFN-α on the adaptive immune system in Multiple Sclerosis (MS). Our results demonstrated that CpG DNA-induced IFN-α production was significantly decreased in PBMCs from MS patients. Decreased levels of IL-12 p70, IFN-γ, and IL-17 and increased level of IL-10 were found in CpG DNA-treated PBMCs of healthy subjects unlike in those from MS patients. In samples pre-treated with IFN-α and IFN-β, decreased levels of IL-12 p70, IFN-γ, and IL-17 and increased level of IL-10 were detected in PBMCs from MS patients. These results suggest that CpG DNA-induced decreased IFN-α production causes pro-inflammatory cytokine secretion, and either IFN-α or IFN-β induces anti-inflammatory cytokine secretion in the adaptive immune system in MS. Copyright © 2012 Elsevier Inc. All rights reserved.

  15. Simulation design of high reverse blocking high-K/low-K compound passivation AlGaN/GaN Schottky barrier diode with gated edge termination

    NASA Astrophysics Data System (ADS)

    Bai, Zhiyuan; Du, Jiangfeng; Xin, Qi; Li, Ruonan; Yu, Qi

    2017-11-01

    In this paper, a novel high-K/low-K compound passivation AlGaN/GaN Schottky Barrier Diode (CPG-SBD) is proposed to improve the off-state characteristics of AlGaN/GaN schottky barrier diode with gated edge termination (GET-SBD) by adding low-K blocks in to the high-K passivation layer. The reverse leakage current of CPG-SBD can be reduced to 1.6 nA/mm by reducing the thickness of high-K dielectric under GET region to 5 nm, while the forward voltage and on-state resistance keep 1 V and 3.8 Ω mm, respectively. Breakdown voltage of CPG-SBDs can be improved by inducing discontinuity of the electric field at the high-K/low-K interface. The breakdown voltage of the optimized CPG-SBD with 4 blocks of low-K can reach 1084 V with anode to cathode distance of 5 μm yielding a high FOM of 5.9 GW/cm2. From the C-V simulation results, CPG-SBDs induce no parasitic capacitance by comparison of the GET-SBDs.

  16. Hypermethylation of brain natriuretic peptide gene is associated with the risk of rheumatic heart disease

    PubMed Central

    Li, Ni; Zheng, Dawei; Sun, Lebo; Shi, Huoshun; Zhu, Xiuying; Xu, Guodong; Wang, Qinning; Zhu, Caimin

    2016-01-01

    To investigate the contribution of brain natriuretic peptide (BNP) promoter DNA methylation to the risk of rheumatic heart disease (RHD) and the influence of warfarin anticoagulant therapy on BNP methylation levels for RHD patients after surgery. BNP methylation levels were determined by bisulfite pyrosequencing from plasma samples of RHD patients compared with healthy controls. Several factors influencing the RHD patients were included like age, smoking and cholesterol levels. A fragment of five CG sites (CpG1–5) in the promoter region of BNP gene was measured. BNP gene hypermethylation was found in CpG4 and CpG5 in RHD patients compared with non-RHD controls. A significant difference was also observed between RHD patients with long-term administration of warfarin and RHD patients who had recently undergone an operation. Moreover, single CpG4 and CpG5 analysis revealed a significant increase in methylation levels in men. BNP gene body hypermethylation is associated with the risk of RHD, and also influenced by the warfarin anticoagulant therapy of RHD patients after surgery, which could represent novel and promising targets for therapeutic development. PMID:27920275

  17. Compositional searching of CpG islands in the human genome

    NASA Astrophysics Data System (ADS)

    Luque-Escamilla, Pedro Luis; Martínez-Aroza, José; Oliver, José L.; Gómez-Lopera, Juan Francisco; Román-Roldán, Ramón

    2005-06-01

    We report on an entropic edge detector based on the local calculation of the Jensen-Shannon divergence with application to the search for CpG islands. CpG islands are pieces of the genome related to gene expression and cell differentiation, and thus to cancer formation. Searching for these CpG islands is a major task in genetics and bioinformatics. Some algorithms have been proposed in the literature, based on moving statistics in a sliding window, but its size may greatly influence the results. The local use of Jensen-Shannon divergence is a completely different strategy: the nucleotide composition inside the islands is different from that in their environment, so a statistical distance—the Jensen-Shannon divergence—between the composition of two adjacent windows may be used as a measure of their dissimilarity. Sliding this double window over the entire sequence allows us to segment it compositionally. The fusion of those segments into greater ones that satisfy certain identification criteria must be achieved in order to obtain the definitive results. We find that the local use of Jensen-Shannon divergence is very suitable in processing DNA sequences for searching for compositionally different structures such as CpG islands, as compared to other algorithms in literature.

  18. The Influence of Hydroxylation on Maintaining CpG Methylation Patterns: A Hidden Markov Model Approach.

    PubMed

    Giehr, Pascal; Kyriakopoulos, Charalampos; Ficz, Gabriella; Wolf, Verena; Walter, Jörn

    2016-05-01

    DNA methylation and demethylation are opposing processes that when in balance create stable patterns of epigenetic memory. The control of DNA methylation pattern formation by replication dependent and independent demethylation processes has been suggested to be influenced by Tet mediated oxidation of 5mC. Several alternative mechanisms have been proposed suggesting that 5hmC influences either replication dependent maintenance of DNA methylation or replication independent processes of active demethylation. Using high resolution hairpin oxidative bisulfite sequencing data, we precisely determine the amount of 5mC and 5hmC and model the contribution of 5hmC to processes of demethylation in mouse ESCs. We develop an extended hidden Markov model capable of accurately describing the regional contribution of 5hmC to demethylation dynamics. Our analysis shows that 5hmC has a strong impact on replication dependent demethylation, mainly by impairing methylation maintenance.

  19. Genome-Wide Locations of Potential Epimutations Associated with Environmentally Induced Epigenetic Transgenerational Inheritance of Disease Using a Sequential Machine Learning Prediction Approach.

    PubMed

    Haque, M Muksitul; Holder, Lawrence B; Skinner, Michael K

    2015-01-01

    Environmentally induced epigenetic transgenerational inheritance of disease and phenotypic variation involves germline transmitted epimutations. The primary epimutations identified involve altered differential DNA methylation regions (DMRs). Different environmental toxicants have been shown to promote exposure (i.e., toxicant) specific signatures of germline epimutations. Analysis of genomic features associated with these epimutations identified low-density CpG regions (<3 CpG / 100bp) termed CpG deserts and a number of unique DNA sequence motifs. The rat genome was annotated for these and additional relevant features. The objective of the current study was to use a machine learning computational approach to predict all potential epimutations in the genome. A number of previously identified sperm epimutations were used as training sets. A novel machine learning approach using a sequential combination of Active Learning and Imbalance Class Learner analysis was developed. The transgenerational sperm epimutation analysis identified approximately 50K individual sites with a 1 kb mean size and 3,233 regions that had a minimum of three adjacent sites with a mean size of 3.5 kb. A select number of the most relevant genomic features were identified with the low density CpG deserts being a critical genomic feature of the features selected. A similar independent analysis with transgenerational somatic cell epimutation training sets identified a smaller number of 1,503 regions of genome-wide predicted sites and differences in genomic feature contributions. The predicted genome-wide germline (sperm) epimutations were found to be distinct from the predicted somatic cell epimutations. Validation of the genome-wide germline predicted sites used two recently identified transgenerational sperm epimutation signature sets from the pesticides dichlorodiphenyltrichloroethane (DDT) and methoxychlor (MXC) exposure lineage F3 generation. Analysis of this positive validation data set showed a 100% prediction accuracy for all the DDT-MXC sperm epimutations. Observations further elucidate the genomic features associated with transgenerational germline epimutations and identify a genome-wide set of potential epimutations that can be used to facilitate identification of epigenetic diagnostics for ancestral environmental exposures and disease susceptibility.

  20. Technical adequacy of bisulfite sequencing and pyrosequencing for detection of mitochondrial DNA methylation: Sources and avoidance of false-positive detection.

    PubMed

    Owa, Chie; Poulin, Matthew; Yan, Liying; Shioda, Toshi

    2018-01-01

    The existence of cytosine methylation in mammalian mitochondrial DNA (mtDNA) is a controversial subject. Because detection of DNA methylation depends on resistance of 5'-modified cytosines to bisulfite-catalyzed conversion to uracil, examined parameters that affect technical adequacy of mtDNA methylation analysis. Negative control amplicons (NCAs) devoid of cytosine methylation were amplified to cover the entire human or mouse mtDNA by long-range PCR. When the pyrosequencing template amplicons were gel-purified after bisulfite conversion, bisulfite pyrosequencing of NCAs did not detect significant levels of bisulfite-resistant cytosines (brCs) at ND1 (7 CpG sites) or CYTB (8 CpG sites) genes (CI95 = 0%-0.94%); without gel-purification, significant false-positive brCs were detected from NCAs (CI95 = 4.2%-6.8%). Bisulfite pyrosequencing of highly purified, linearized mtDNA isolated from human iPS cells or mouse liver detected significant brCs (~30%) in human ND1 gene when the sequencing primer was not selective in bisulfite-converted and unconverted templates. However, repeated experiments using a sequencing primer selective in bisulfite-converted templates almost completely (< 0.8%) suppressed brC detection, supporting the false-positive nature of brCs detected using the non-selective primer. Bisulfite-seq deep sequencing of linearized, gel-purified human mtDNA detected 9.4%-14.8% brCs for 9 CpG sites in ND1 gene. However, because all these brCs were associated with adjacent non-CpG brCs showing the same degrees of bisulfite resistance, DNA methylation in this mtDNA-encoded gene was not confirmed. Without linearization, data generated by bisulfite pyrosequencing or deep sequencing of purified mtDNA templates did not pass the quality control criteria. Shotgun bisulfite sequencing of human mtDNA detected extremely low levels of CpG methylation (<0.65%) over non-CpG methylation (<0.55%). Taken together, our study demonstrates that adequacy of mtDNA methylation analysis using methods dependent on bisulfite conversion needs to be established for each experiment, taking effects of incomplete bisulfite conversion and template impurity or topology into consideration.

  1. Genome-Wide Assessment of Differential DNA Methylation Associated with Autoantibody Production in Systemic Lupus Erythematosus.

    PubMed

    Chung, Sharon A; Nititham, Joanne; Elboudwarej, Emon; Quach, Hong L; Taylor, Kimberly E; Barcellos, Lisa F; Criswell, Lindsey A

    2015-01-01

    Systemic lupus erythematosus (SLE) is characterized by the development of autoantibodies associated with specific clinical manifestations. Previous studies have shown an association between differential DNA methylation and SLE susceptibility, but have not investigated SLE-related autoantibodies. Our goal was to determine whether DNA methylation is associated with production of clinically relevant SLE-related autoantibodies, with an emphasis on the anti-dsDNA autoantibody. In this study, we characterized the methylation status of 467,314 CpG sites in 326 women with SLE. Using a discovery and replication study design, we identified and replicated significant associations between anti-dsDNA autoantibody production and the methylation status of 16 CpG sites (pdiscovery<1.07E-07 and preplication<0.0029) in 11 genes. Associations were further investigated using multivariable regression to adjust for estimated leukocyte cell proportions and population substructure. The adjusted mean DNA methylation difference between anti-dsDNA positive and negative cases ranged from 1.2% to 19%, and the adjusted odds ratio for anti-dsDNA autoantibody production comparing the lowest and highest methylation tertiles ranged from 6.8 to 18.2. Differential methylation for these CpG sites was also associated with anti-SSA, anti-Sm, and anti-RNP autoantibody production. Overall, associated CpG sites were hypomethylated in autoantibody positive compared to autoantibody negative cases. Differential methylation of CpG sites within the major histocompatibility region was not strongly associated with autoantibody production. Genes with differentially methylated CpG sites represent multiple biologic pathways, and have not been associated with autoantibody production in genetic association studies. In conclusion, hypomethylation of CpG sites within genes from different pathways is associated with anti-dsDNA, anti-SSA, anti-Sm, and anti-RNP production in SLE, and these associations are not explained by genetic variation. Thus, studies of epigenetic mechanisms such as DNA methylation represent a complementary method to genetic association studies to identify biologic pathways that may contribute to the clinical heterogeneity of autoimmune diseases.

  2. Nullomers and High Order Nullomers in Genomic Sequences

    PubMed Central

    Vergni, Davide; Santoni, Daniele

    2016-01-01

    A nullomer is an oligomer that does not occur as a subsequence in a given DNA sequence, i.e. it is an absent word of that sequence. The importance of nullomers in several applications, from drug discovery to forensic practice, is now debated in the literature. Here, we investigated the nature of nullomers, whether their absence in genomes has just a statistical explanation or it is a peculiar feature of genomic sequences. We introduced an extension of the notion of nullomer, namely high order nullomers, which are nullomers whose mutated sequences are still nullomers. We studied different aspects of them: comparison with nullomers of random sequences, CpG distribution and mean helical rise. In agreement with previous results we found that the number of nullomers in the human genome is much larger than expected by chance. Nevertheless antithetical results were found when considering a random DNA sequence preserving dinucleotide frequencies. The analysis of CpG frequencies in nullomers and high order nullomers revealed, as expected, a high CpG content but it also highlighted a strong dependence of CpG frequencies on the dinucleotide position, suggesting that nullomers have their own peculiar structure and are not simply sequences whose CpG frequency is biased. Furthermore, phylogenetic trees were built on eleven species based on both the similarities between the dinucleotide frequencies and the number of nullomers two species share, showing that nullomers are fairly conserved among close species. Finally the study of mean helical rise of nullomers sequences revealed significantly high mean rise values, reinforcing the hypothesis that those sequences have some peculiar structural features. The obtained results show that nullomers are the consequence of the peculiar structure of DNA (also including biased CpG frequency and CpGs islands), so that the hypermutability model, also taking into account CpG islands, seems to be not sufficient to explain nullomer phenomenon. Finally, high order nullomers could emphasize those features that already make simple nullomers useful in several applications. PMID:27906971

  3. Design and pilot evaluation of a system to develop computer-based site-specific practice guidelines from decision models.

    PubMed

    Sanders, G D; Nease, R F; Owens, D K

    2000-01-01

    Local tailoring of clinical practice guidelines (CPGs) requires experts in medicine and evidence synthesis unavailable in many practice settings. The authors' computer-based system enables developers and users to create, disseminate, and tailor CPGs, using normative decision models (DMs). ALCHEMIST, a web-based system, analyzes a DM, creates a CPG in the form of an annotated algorithm, and displays for the guideline user the optimal strategy. ALCHEMIST'S interface enables remote users to tailor the guideline by changing underlying input variables and observing the new annotated algorithm that is developed automatically. In a pilot evaluation of the system, a DM was used to evaluate strategies for staging non-small-cell lung cancer. Subjects (n = 15) compared the automatically created CPG with published guidelines for this staging and critiqued both using a previously developed instrument to rate the CPGs' usability, accountability, and accuracy on a scale of 0 (worst) to 2 (best), with higher scores reflecting higher quality. The mean overall score for the ALCHEMIST CPG was 1.502, compared with the published-CPG score of 0.987 (p = 0.002). The ALCHEMIST CPG scores for usability, accountability, and accuracy were 1.683, 1.393, and 1.430, respectively; the published CPG scores were 1.192, 0.941, and 0.830 (each comparison p < 0.05). On a scale of 1 (worst) to 5 (best), users' mean ratings of ALCHEMIST'S ease of use, usefulness of content, and presentation format were 4.76, 3.98, and 4.64, respectively. The results demonstrate the feasibility of a web-based system that automatically analyzes a DM and creates a CPG as an annotated algorithm, enabling remote users to develop site-specific CPGs. In the pilot evaluation, the ALCHEMIST guidelines met established criteria for quality and compared favorably with national CPGs. The high usability and usefulness ratings suggest that such systems can be a good tool for guideline development.

  4. DNA Methylation at the DAT Promoter and Risk for Psychopathology: Intergenerational Transmission between School-Age Youths and Their Parents in a Community Sample.

    PubMed

    Cimino, Silvia; Cerniglia, Luca; Ballarotto, Giulia; Marzilli, Eleonora; Pascale, Esterina; D'Addario, Claudio; Adriani, Walter; Tambelli, Renata

    2017-01-01

    The effect of gene polymorphisms and promoter methylation, associated with maladaptive developmental outcomes, vary depending on environmental factors (e.g., parental psychopathology). Most studies have focused on 0- to 5-year-old children, adolescents, or adults, whereas there is dearth of research on school-age youths and pre-adolescents. In a sample of 21 families recruited at schools, we addressed parents' psychopathological symptoms (through SCL-90-R); offspring emotional-behavioral functioning (through CBCL-6-18); dopamine transporter gene (DAT1) for epigenetic status of the 5'-untranslated region (UTR) and for genotype, i.e., variable number of tandem repeats polymorphism at the 3'-UTR. Possible associations were explored between bio-genetic and psychological characteristics within the same individual and between triplets of children, mothers, and fathers. DAT methylation of CpG at positions M1, M6, and M7 in mothers was correlated with maternal (phobic) anxiety, whereas in fathers' position M6 was related to paternal depression, anxiety, hostility, psychoticism, and higher Global Severity Index (GSI). No significant correlations were found between maternal and offspring DAT methylation. Significant correlations were found between fathers' methylation at CpG M1 and children's methylation at CpG M6. Linear regressions showed that mothers and fathers' GSI predicted children's methylation at CpG sites M2, M3, and M6, whereas fathers' GSI predicted children's methylation at CpG sites, particularly M1, M2, and M6. Moreover, offspring methylation of DAT at CpG M2 predicted somatic complaint, internalizing and attention problems; methylation of DAT at CpG M6 predicted withdraw. This study may have important clinical implication for the prevention and treatment of emotional-behavioral difficulties in children, as it adds to previous knowledge about the role of genetic and environmental factors in predicting psychopathological symptoms within non-clinical populations.

  5. Production and quality of clinical practice guidelines in Argentina (1994–2004): a cross-sectional study

    PubMed Central

    Esandi, María Eugenia; Ortiz, Zulma; Chapman, Evelina; Dieguez, Marcelo García; Mejía, Raúl; Bernztein, Ricardo

    2008-01-01

    Background In the last decades, a sustained increment of Clinical Practice Guidelines (CPG) production in the world has been accompanied by a growing concern about their quality. Many studies related to quality assessment of guidelines produced in High Income Countries were published; however, evidence on this topic is scarce in Low and Middle Income Countries (LMIC). The objectives of this research were: a) to describe guideline production in Argentina at different levels of the health system (macro, meso and micro) from 1994 to 2004; and b) to assess their quality by using the AGREE instrument. Methods A cross-sectional study was undertaken to describe guidelines production in Argentina between 1994 and 2004. CPG were identified through Internet and electronic databases (MEDLINE and LILACS). Explicit inclusion and exclusion criteria were used to select guidelines. Each CPG was independently assessed by two reviewers using the AGREE instrument. Domain scores were calculated as recommended by the AGREE Collaboration. The internal consistency of each domain was evaluated using Cronbach's alpha and inter-observer agreement by the Intraclass Correlation Coefficient (ICC). Results A total amount of 431 potential CPG were identified, but only 144 were considered CPG. At the end, 101 CPG were included for further assessment. Median standardized score for each domain were: scope = 39%; stakeholder involvement = 13%; rigour of development = 10%; clarity = 42%; applicability = 6%; editorial independence = 0%. Only 22 CPG were recommended with modifications by both appraisers. ICC and Cronbach's alpha for each domain were in all cases moderate or high (greater than 0.40), except for editorial independence. Conclusion This study has systematically employed the AGREE instrument for the critical assessment of guidelines produced in a LMIC. Guideline development and diffusion in Argentina from 1994 to 2004 shows a constant increment, although quality of reporting did not improve; moreover, in some aspects it seemed to decline. Much room for improvement of the guideline development process was found at all levels of the health system. PMID:18851739

  6. Immunization of Aged Pigs with Attenuated Pseudorabies Virus Vaccine Combined with CpG Oligodeoxynucleotide Restores Defective Th1 Immune Responses

    PubMed Central

    Chu, Pinpin; Ma, Miaopeng; Shi, Juqing; Cai, Haiming; Huang, Chaoyuan; Li, Huazhou; Jiang, Zhenggu; Wang, Houguang; Wang, Weifang; Zhang, Shuiqing; Zhang, Linghua

    2013-01-01

    Background and Aims Attempts to immunize aged subjects often result in the failure to elicit a protective immune response. Murine model studies have shown that oligonucleotides containing CpG motifs (CpG ODN) can stimulate immune system in aged mice as effectively as in young mice. Since many physiological and pathophysiological data of pigs can be transferred to humans, research in pigs is important to confirm murine data. Here we investigated whether immunization of aged pig model with attenuated pseudorabies virus vaccine (PRV vaccine) formulated with CpG ODN could promote a successful development of immune responses that were comparable to those induced in young pigs in a similar manner. Methodology Young and aged pigs were immunized IM with PRV vaccine alone, or in combination with CpG ODN respectively. At days 3, 7, 14 post immunization sera were assayed by ELISA for IgG titres, at day 7 for IgG1 and IgG2 subtypes titres. All blood samples collected in evacuated test tubes with K-EDTA at day 7 were analyzed for flow cytometer assay. Blood samples at day 7 collected in evacuated test tubes with heparin were analysed for antigen-specific cytokines production and peripheral blood mononuclear cells (PBMCs) proliferative responses. Results CpG ODN could enhance Th1 responses (PRV-specific IgG2/IgG1 ratio, proliferative responses, Th1 cytokines production) when used as an adjuvant for the vaccination of aged pigs, which were correlated with enhanced CD4+ T cells percentage, decreased CD4+CD8+CD45RO+ T cells percentage and improved PRV-specific CD4+ T cells activation. Conclusions Our results demonstrate a utility for CpG ODN, as a safe vaccine adjuvant for promoting effective systemic immune responses in aged pig model. This agent could have important clinical uses in overcoming some of age-associated depressions in immune function that occur in response to vaccination. PMID:23785433

  7. DNA methylation of intragenic CpG islands depends on their transcriptional activity during differentiation and disease

    PubMed Central

    Jeziorska, Danuta M.; Murray, Robert J. S.; De Gobbi, Marco; Gaentzsch, Ricarda; Garrick, David; Ayyub, Helena; Chen, Taiping; Li, En; Telenius, Jelena; Lynch, Magnus; Graham, Bryony; Smith, Andrew J. H.; Lund, Jonathan N.; Hughes, Jim R.; Higgs, Douglas R.

    2017-01-01

    The human genome contains ∼30,000 CpG islands (CGIs). While CGIs associated with promoters nearly always remain unmethylated, many of the ∼9,000 CGIs lying within gene bodies become methylated during development and differentiation. Both promoter and intragenic CGIs may also become abnormally methylated as a result of genome rearrangements and in malignancy. The epigenetic mechanisms by which some CGIs become methylated but others, in the same cell, remain unmethylated in these situations are poorly understood. Analyzing specific loci and using a genome-wide analysis, we show that transcription running across CGIs, associated with specific chromatin modifications, is required for DNA methyltransferase 3B (DNMT3B)-mediated DNA methylation of many naturally occurring intragenic CGIs. Importantly, we also show that a subgroup of intragenic CGIs is not sensitive to this process of transcription-mediated methylation and that this correlates with their individual intrinsic capacity to initiate transcription in vivo. We propose a general model of how transcription could act as a primary determinant of the patterns of CGI methylation in normal development and differentiation, and in human disease. PMID:28827334

  8. Differential methylation of tissue- and cancer-specific CpG island shores distinguishes human induced pluripotent stem cells, embryonic stem cells and fibroblasts

    PubMed Central

    Doi, Akiko; Park, In-Hyun; Wen, Bo; Murakami, Peter; Aryee, Martin J; Irizarry, Rafael; Herb, Brian; Ladd-Acosta, Christine; Rho, Junsung; Loewer, Sabine; Miller, Justine; Schlaeger, Thorsten; Daley, George Q; Feinberg, Andrew P

    2010-01-01

    Induced pluripotent stem (iPS) cells are derived by epigenetic reprogramming, but their DNA methylation patterns have not yet been analyzed on a genome-wide scale. Here, we find substantial hypermethylation and hypomethylation of cytosine-phosphate-guanine (CpG) island shores in nine human iPS cell lines as compared to their parental fibroblasts. The differentially methylated regions (DMRs) in the reprogrammed cells (denoted R-DMRs) were significantly enriched in tissue-specific (T-DMRs; 2.6-fold, P < 10−4) and cancer-specific DMRs (C-DMRs; 3.6-fold, P < 10−4). Notably, even though the iPS cells are derived from fibroblasts, their R-DMRs can distinguish between normal brain, liver and spleen cells and between colon cancer and normal colon cells. Thus, many DMRs are broadly involved in tissue differentiation, epigenetic reprogramming and cancer. We observed colocalization of hypomethylated R-DMRs with hypermethylated C-DMRs and bivalent chromatin marks, and colocalization of hypermethylated R-DMRs with hypomethylated C-DMRs and the absence of bivalent marks, suggesting two mechanisms for epigenetic reprogramming in iPS cells and cancer. PMID:19881528

  9. Environment, diet and CpG island methylation: epigenetic signals in gastrointestinal neoplasia.

    PubMed

    Johnson, Ian T; Belshaw, Nigel J

    2008-04-01

    The epithelial surfaces of the mammalian alimentary tract are characterised by very high rates of cell proliferation and DNA synthesis, and in humans they are highly susceptible to cancer. The role of somatic mutations as drivers of carcinogenesis in the alimentary tract is well established, but the importance of gene silencing by epigenetic mechanisms is increasingly recognised. Methylation of CpG islands is an important component of the epigenetic code that regulates gene expression during development and normal cellular differentiation, and a number of genes are well known to become abnormally methylated during the development of tumours of the oesophagus, stomach and colorectum. Aberrant patterns of DNA methylation develop as a result of pathological processes such as chronic inflammation, and in response to various dietary factors, including imbalances in the supply of methyl donors, particularly folates, and exposure to DNA methyltransferase inhibitors, which include polyphenols and possibly isothiocyanates from plant foods. However the importance of these environmental interactions in human health and disease remains to be established. Recent moves to modify the exposure of human populations to folate, by mandatory supplementation of cereal foods, emphasise the importance of understanding the susceptibility of the human epigenome to dietary and other environmental effects.

  10. A novel optical probe for pH sensing in gastro-esophageal apparatus

    NASA Astrophysics Data System (ADS)

    Baldini, F.; Ghini, G.; Giannetti, A.; Senesi, F.; Trono, C.

    2011-03-01

    Monitoring gastric pH for long periods, usually 24 h, may be essential in analyzing the physiological pattern of acidity, in obtaining information on changes in activity during peptic ulcer disease, and in assessing the effect of antisecretory drugs. Gastro-esophageal reflux, which causes a pH decrease in the esophagus content from pH 7 even down to pH 2, can determine esophagitis with possible strictures and Barrett's esophagus. One of the difficulties of the optical measurement of pH in the gastro-esophageal apparatus lies in the required extended working range from 1 to 8 pH units. The present paper deals with a novel optical pH sensor, using methyl red as optical pH indicator. Contrary to all acidbase indicators characterized by working ranges limited to 2-3 pH units, methyl red, after its covalent immobilization on controlled pore glass (CPG), is characterized by a wide working range which fits with the clinical requirements. The novel probe design here described is suitable for gastro-esophageal applications and allows the optimization of the performances of the CPG with the immobilised indicator. This leads to a very simple configuration characterized by a very fast response time.

  11. Genetic Recombination Is Targeted towards Gene Promoter Regions in Dogs

    PubMed Central

    Auton, Adam; Rui Li, Ying; Kidd, Jeffrey; Oliveira, Kyle; Nadel, Julie; Holloway, J. Kim; Hayward, Jessica J.; Cohen, Paula E.; Greally, John M.; Wang, Jun; Bustamante, Carlos D.; Boyko, Adam R.

    2013-01-01

    The identification of the H3K4 trimethylase, PRDM9, as the gene responsible for recombination hotspot localization has provided considerable insight into the mechanisms by which recombination is initiated in mammals. However, uniquely amongst mammals, canids appear to lack a functional version of PRDM9 and may therefore provide a model for understanding recombination that occurs in the absence of PRDM9, and thus how PRDM9 functions to shape the recombination landscape. We have constructed a fine-scale genetic map from patterns of linkage disequilibrium assessed using high-throughput sequence data from 51 free-ranging dogs, Canis lupus familiaris. While broad-scale properties of recombination appear similar to other mammalian species, our fine-scale estimates indicate that canine highly elevated recombination rates are observed in the vicinity of CpG rich regions including gene promoter regions, but show little association with H3K4 trimethylation marks identified in spermatocytes. By comparison to genomic data from the Andean fox, Lycalopex culpaeus, we show that biased gene conversion is a plausible mechanism by which the high CpG content of the dog genome could have occurred. PMID:24348265

  12. Changes in the Coding and Non-coding Transcriptome and DNA Methylome that Define the Schwann Cell Repair Phenotype after Nerve Injury.

    PubMed

    Arthur-Farraj, Peter J; Morgan, Claire C; Adamowicz, Martyna; Gomez-Sanchez, Jose A; Fazal, Shaline V; Beucher, Anthony; Razzaghi, Bonnie; Mirsky, Rhona; Jessen, Kristjan R; Aitman, Timothy J

    2017-09-12

    Repair Schwann cells play a critical role in orchestrating nerve repair after injury, but the cellular and molecular processes that generate them are poorly understood. Here, we perform a combined whole-genome, coding and non-coding RNA and CpG methylation study following nerve injury. We show that genes involved in the epithelial-mesenchymal transition are enriched in repair cells, and we identify several long non-coding RNAs in Schwann cells. We demonstrate that the AP-1 transcription factor C-JUN regulates the expression of certain micro RNAs in repair Schwann cells, in particular miR-21 and miR-34. Surprisingly, unlike during development, changes in CpG methylation are limited in injury, restricted to specific locations, such as enhancer regions of Schwann cell-specific genes (e.g., Nedd4l), and close to local enrichment of AP-1 motifs. These genetic and epigenomic changes broaden our mechanistic understanding of the formation of repair Schwann cell during peripheral nervous system tissue repair. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  13. Automating Guidelines for Clinical Decision Support: Knowledge Engineering and Implementation.

    PubMed

    Tso, Geoffrey J; Tu, Samson W; Oshiro, Connie; Martins, Susana; Ashcraft, Michael; Yuen, Kaeli W; Wang, Dan; Robinson, Amy; Heidenreich, Paul A; Goldstein, Mary K

    2016-01-01

    As utilization of clinical decision support (CDS) increases, it is important to continue the development and refinement of methods to accurately translate the intention of clinical practice guidelines (CPG) into a computable form. In this study, we validate and extend the 13 steps that Shiffman et al. 5 identified for translating CPG knowledge for use in CDS. During an implementation project of ATHENA-CDS, we encoded complex CPG recommendations for five common chronic conditions for integration into an existing clinical dashboard. Major decisions made during the implementation process were recorded and categorized according to the 13 steps. During the implementation period, we categorized 119 decisions and identified 8 new categories required to complete the project. We provide details on an updated model that outlines all of the steps used to translate CPG knowledge into a CDS integrated with existing health information technology.

  14. The Healthy Weight Commitment Foundation Pledge

    PubMed Central

    Ng, Shu Wen; Slining, Meghan M.; Popkin, Barry M.

    2014-01-01

    Corporate voluntary pledges to improve the health of Americans have not been held to either explicit measurable outcomes or a framework for independent evaluation. The Healthy Weight Commitment Foundation (HWCF), whose members include 16 of the nation’s leading consumer packaged goods (CPG) food and beverage manufacturers, voluntarily pledged to collectively sell 1 trillion fewer calories in the U.S. marketplace by 2012 (against a 2007 baseline), and sell 1.5 trillion fewer calories by 2015. This paper presents the findings of an independent evaluation of the 2012 HWCF marketplace pledge, conducted in 2013. The 16 HWCF companies collectively sold approximately 6.4 trillion fewer calories (−10.6%) in 2012 than in the baseline year of 2007. Taking into account population changes over the 5-year period of 2007–2012, CPG caloric sales from brands included in the HWCF pledge declined by an average of 78 kcals/capita/day. CPG caloric sales from non-HWCF national brands during the same period declined by 11 kcals/capita/day, but there was little change in calories from private label products. Thus, the total reduction in CPG caloric sales between 2007 and 2012 was 87 kcals/capita/day. This independent evaluation is the first to evaluate food industry compliance with its calorie reduction pledges and to assess how sales from the CPG food and beverage sector are changing. An accompanying paper investigates the extent to which the HWCF pledge affected household-level changes in CPG calories purchased, controlling for important economic and sociodemographic factors affecting household food purchases over this period. PMID:25240967

  15. Ancestry Dependent DNA Methylation and Influence of Maternal Nutrition

    PubMed Central

    Mozhui, Khyobeni; Smith, Alicia K.; Tylavsky, Frances A.

    2015-01-01

    There is extensive variation in DNA methylation between individuals and ethnic groups. These differences arise from a combination of genetic and non-genetic influences and potential modifiers include nutritional cues, early life experience, and social and physical environments. Here we compare genome-wide DNA methylation in neonatal cord blood from African American (AA; N = 112) and European American (EA; N = 91) participants of the CANDLE Study (Conditions Affecting Neurocognitive Development and Learning in Early Childhood). Our goal is to determine if there are replicable ancestry-specific methylation patterns that may implicate risk factors for diseases that have differential prevalence between populations. To identify the most robust ancestry-specific CpG sites, we replicate our results in lymphoblastoid cell lines from Yoruba African and CEPH European panels of HapMap. We also evaluate the influence of maternal nutrition—specifically, plasma levels of vitamin D and folate during pregnancy—on methylation in newborns. We define stable ancestry-dependent methylation of genes that include tumor suppressors and cell cycle regulators (e.g., APC, BRCA1, MCC). Overall, there is lower global methylation in African ancestral groups. Plasma levels of 25-hydroxy vitamin D are also considerably lower among AA mothers and about 60% of AA and 40% of EA mothers have concentrations below 20 ng/ml. Using a weighted correlation analysis, we define a network of CpG sites that is jointly modulated by ancestry and maternal vitamin D. Our results show that differences in DNA methylation patterns are remarkably stable and maternal micronutrients can exert an influence on the child epigenome. PMID:25742137

  16. An epigenome-wide study of body mass index and DNA methylation in blood using participants from the Sister Study cohort.

    PubMed

    Wilson, L E; Harlid, S; Xu, Z; Sandler, D P; Taylor, J A

    2017-01-01

    The relationship between obesity and chronic disease risk is well-established; the underlying biological mechanisms driving this risk increase may include obesity-related epigenetic modifications. To explore this hypothesis, we conducted a genome-wide analysis of DNA methylation and body mass index (BMI) using data from a subset of women in the Sister Study. The Sister Study is a cohort of 50 884 US women who had a sister with breast cancer but were free of breast cancer themselves at enrollment. Study participants completed examinations which included measurements of height and weight, and provided blood samples. Blood DNA methylation data generated with the Illumina Infinium HumanMethylation27 BeadChip array covering 27,589 CpG sites was available for 871 women from a prior study of breast cancer and DNA methylation. To identify differentially methylated CpG sites associated with BMI, we analyzed this methylation data using robust linear regression with adjustment for age and case status. For those CpGs passing the false discovery rate significance level, we examined the association in a replication set comprised of a non-overlapping group of 187 women from the Sister Study who had DNA methylation data generated using the Infinium HumanMethylation450 BeadChip array. Analysis of this expanded 450 K array identified additional BMI-associated sites which were investigated with targeted pyrosequencing. Four CpG sites reached genome-wide significance (false discovery rate (FDR) q<0.05) in the discovery set and associations for all four were significant at strict Bonferroni correction in the replication set. An additional 23 sites passed FDR in the replication set and five were replicated by pyrosequencing in the discovery set. Several of the genes identified including ANGPT4, RORC, SOCS3, FSD2, XYLT1, ABCG1, STK39, ASB2 and CRHR2 have been linked to obesity and obesity-related chronic diseases. Our findings support the hypothesis that obesity-related epigenetic differences are detectable in blood and may be related to risk of chronic disease.

  17. 76 FR 28308 - Compliance Policy Guide: Surgeons' Gloves and Patient Examination Gloves; Defects-Criteria for...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-05-17

    ... quality levels (AQLs) for leaks and visual defects observed during FDA testing of medical gloves. The CPG... practices regulation (21 CFR 10.115). The CPG represents FDA's current thinking on the criteria for direct...

  18. Adjuvant-Loaded Spiky Gold Nanoparticles for Activation of Innate Immune Cells.

    PubMed

    Nam, Jutaek; Son, Sejin; Moon, James J

    2017-10-01

    Gold nanoparticles are versatile carriers for delivery of biomacromolecules. Here, we have developed spiky gold nanoparticles (SGNPs) that can efficiently deliver immunostimulatory agents. Our goal was to develop a platform technology for co-delivery of multiple adjuvant molecules for synergistic stimulation and maturation of innate immune cells. SGNPs were synthesized by a seed-mediated, surfactant-free synthesis method and incorporated with polyinosinic-polycytidylic acid (pIC) and DNA oligonucleotide containing unmethylated CpG motif (CpG) by an electrostatic layer-by-layer approach. Adjuvant-loaded SGNP nano-complexes were examined for their biophysical and biochemical properties and studied for immune activation using bone marrow-derived dendritic cells (BMDCs). We have synthesized SGNPs with branched nano-spikes layered with pIC and/or CpG. Adjuvant-loaded SGNP nano-complexes promoted cellular uptake of the adjuvants. Importantly, we achieved spatio-temporal control over co-delivery of pIC and CpG via SGNPs, which produced synergistic enhancement in cytokine release (IL-6, TNF-α) and upregulation of co-stimulatory markers (CD40, CD80, CD86) in BMDCs, compared with pIC, CpG, or their admixtures. SGNPs serve as a versatile delivery platform that allows flexible and on-demand cargo fabrication for strong activation of innate immune cells.

  19. A multifaceted knowledge translation strategy can increase compliance with guideline recommendations for mechanical bowel preparation.

    PubMed

    Eskicioglu, Cagla; Pearsall, Emily; Victor, J Charles; Aarts, Mary-Anne; Okrainec, Allan; McLeod, Robin S

    2015-01-01

    The successful transfer of evidence into clinical practice is a slow and haphazard process. We report the outcome of a 5-year knowledge translation (KT) strategy to increase adherence with a clinical practice guideline (CPG) for mechanical bowel preparation (MBP) for elective colorectal surgery patients. A locally tailored CPG recommending MBP practices was developed. Data on MBP practices were collected at six University of Toronto hospitals before CPG implementation as well as after two separate KT strategies. KT strategy #1 included development of the CPG, education by opinion leaders, reminder cards, and presentations of data. KT strategy #2 included selection of hospital champions, development of communities of practice, education, reminder cards, electronic updates, pre-printed standardized orders, and audit and feedback. A total of 744 patients (400 males, 344 females, mean age 57.0) were included. Compliance increased from 58.6 to 70.4% after KT strategy #1 and to 81.1% after KT strategy #2 (p < 0.001). Using a tailored KT strategy, increased compliance was observed with CPG recommendations over time suggesting that a longitudinal KT strategy is required to increase and sustain compliance with recommendations. Furthermore, different strategies may be required at different times (i.e., educational sessions initially and reminders and standardized orders to maintain adherence).

  20. Length of paternal lifespan is manifested in the DNA methylome of their nonagenarian progeny

    PubMed Central

    Marttila, Saara; Kananen, Laura; Jylhävä, Juulia; Nevalainen, Tapio; Hervonen, Antti; Jylhä, Marja; Hurme, Mikko

    2015-01-01

    The heritability of lifespan is 20-30%, but only a few genes associated with longevity have been identified. To explain this discrepancy, the inheritance of epigenetic features, such as DNA methylation, have been proposed to contribute to the heritability of lifespan. We investigated whether parental lifespan is associated with DNA methylation profile in nonagenarians. A regression model, adjusted for differences in blood cell proportions, identified 659 CpG sites where the level of methylation was associated with paternal lifespan. However, no association was observed between maternal lifespan and DNA methylation. The 659 CpG sites associated with paternal lifespan were enriched outside of CpG islands and were located in genes associated with development and morphogenesis, as well as cell signaling. The largest difference in the level of methylation between the progeny of the shortest-lived and longest-lived fathers was identified for CpG sites mapping to CXXC5. In addition, the level of methylation in three Notch-genes (NOTCH1, NOTCH3 and NOTCH4) was also associated with paternal lifespan. There are implications for the inheritance of acquired traits via epigenetic mechanisms in mammals. Here we describe DNA methylation features that are associated with paternal lifespan, and we speculate that the identified CpG sites may represent intergenerational epigenetic inheritance. PMID:26436701

Top