[Application of decision curve on evaluation of MRI predictive model for early assessing pathological complete response to neoadjuvant therapy in breast cancer].

PubMed

He, Y J; Li, X T; Fan, Z Q; Li, Y L; Cao, K; Sun, Y S; Ouyang, T

2018-01-23

Objective: To construct a dynamic enhanced MR based predictive model for early assessing pathological complete response (pCR) to neoadjuvant therapy in breast cancer, and to evaluate the clinical benefit of the model by using decision curve. Methods: From December 2005 to December 2007, 170 patients with breast cancer treated with neoadjuvant therapy were identified and their MR images before neoadjuvant therapy and at the end of the first cycle of neoadjuvant therapy were collected. Logistic regression model was used to detect independent factors for predicting pCR and construct the predictive model accordingly, then receiver operating characteristic (ROC) curve and decision curve were used to evaluate the predictive model. Results: ΔArea(max) and Δslope(max) were independent predictive factors for pCR, OR =0.942 (95% CI : 0.918-0.967) and 0.961 (95% CI : 0.940-0.987), respectively. The area under ROC curve (AUC) for the constructed model was 0.886 (95% CI : 0.820-0.951). Decision curve showed that in the range of the threshold probability above 0.4, the predictive model presented increased net benefit as the threshold probability increased. Conclusions: The constructed predictive model for pCR is of potential clinical value, with an AUC>0.85. Meanwhile, decision curve analysis indicates the constructed predictive model has net benefit from 3 to 8 percent in the likely range of probability threshold from 80% to 90%.

Evaluation of micro-organism-detaching efficacy from meat samples by spindle or stomacher treatment and quality analysis of suspensions.

PubMed

Kim, S-J; Kim, D-K; Kang, D-H

2016-04-01

We investigated and compared the efficacy of a new apparatus for detaching micro-organisms from meat samples. The efficacy of Spindle and stomacher in detaching micro-organisms from meat samples was evaluated. Also, evaluation of appropriateness of suspensions generated by both methods for carrying out molecular biological analysis was implemented. A nearly identical correlation and high R(2) were obtained between Spindle and stomacher in Aerobic Plate Count (APC), and no significant differences were observed in detachment of three major foodborne pathogens. The suspension generated by the Spindle showed lower turbidity and total protein concentration. Also, significantly different threshold cycles were observed in Real-time PCR analysis using suspensions generated by both methods. The Spindle shows nearly identical efficacy with stomacher treatment in detaching micro-organisms from meat samples. Furthermore, the high quality of suspensions generated by the Spindle, in terms of turbidity and total protein assay, allows for a lower threshold cycle than stomached suspension in Real-time PCR. The Spindle could be an alternative method for detaching micro-organisms, yielding a higher quality of suspensions which may be better suited for further molecular microbiological analysis. © 2016 The Society for Applied Microbiology.

Evaluation of a Chlamydia trachomatis-specific, commercial, real-time PCR for use with ocular swabs.

PubMed

Pickering, Harry; Holland, Martin J; Last, Anna R; Burton, Matthew J; Burr, Sarah E

2018-02-20

Trachoma, the leading infectious cause of blindness worldwide, is caused by conjunctival Chlamydia trachomatis infection. Trachoma is diagnosed clinically by observation of conjunctival inflammation and/or scarring; however, there is evidence that monitoring C. trachomatis infection may be required for elimination programmes. There are many commercial and 'in-house' nucleic acid amplification tests for the detection of C. trachomatis DNA, but the majority have not been validated for use with ocular swabs. This study evaluated a commercial assay, the Fast-Track Vaginal swab kit, using conjunctival samples from trachoma-endemic areas. An objective, biostatistical-based method for binary classification of continuous PCR data was developed, to limit potential user-bias in diagnostic settings. The Fast-Track Vaginal swab assay was run on 210 ocular swab samples from Guinea-Bissau and Tanzania. Fit of individual amplification curves to exponential or sigmoid models, derivative and second derivative of the curves and final fluorescence value were examined for utility in thresholding for determining positivity. The results from the Fast-Track Vaginal swab assay were evaluated against a commercial test (Amplicor CT/NG) and a non-commercial test (in-house droplet digital PCR), both of whose performance has previously been evaluated. Significant evidence of exponential amplification (R 2  > 0.99) and final fluorescence > 0.15 were combined for thresholding. This objective approach identified a population of positive samples, however there were a subset of samples that amplified towards the end of the cycling protocol (at or later than 35 cycles), which were less clearly defined. The Fast-Track Vaginal swab assay showed good sensitivity against the commercial (95.71) and non-commercial (97.18) tests. Specificity was lower against both (90.00 and 96.55, respectively). This study defined a simple, automated protocol for binary classification of continuous, real-time qPCR data, for use in an end-point diagnostic test. This method identified a population of positive samples, however, as with manual thresholding, a subset of samples that amplified towards the end of the cycling program were less easily classified. When used with ocular swabs, the Fast-Track Vaginal swab assay had good sensitivity for C. trachomatis detection, but lower specificity than the commercial and non-commercial assays it was evaluated against, possibly leading to false positives.

Clostridium difficile rates in asymptomatic and symptomatic hospitalized patients using nucleic acid testing.

PubMed

Truong, Cynthia; Schroeder, Lee F; Gaur, Rajiv; Anikst, Victoria Emma; Komo, Ikuko; Watters, Colleen; McCalley, Erin; Kulik, Carole; Pickham, David; Lee, Nancy J; Banaei, Niaz

2017-04-01

The Clostridium difficile rate in symptomatic patients represents both those with C. difficile infection (CDI) and those with colonization. To predict the extent of CDI overdiagnosis, we compared the asymptomatic colonization rate to the symptomatic positivity rate in hospitalized patients using nucleic acid testing. Between July 2014 and April 2015, formed stool samples were collected from asymptomatic patients after admission to 3 hospital wards at the Stanford Hospital. Stool samples from symptomatic patients with suspected CDI in the same wards were collected for testing per provider order. The GeneXpert C. difficile tcdB polymerase chain reaction (PCR) assay (Cepheid, Sunnyvale, CA, USA) was performed on all stool samples and PCR cycle threshold was used as a measure of genomic equivalents. Chart review was performed to obtain clinical history and medication exposure. We found an asymptomatic C. difficile carriage rate of 11.8% (43/365) (95% confidence interval [CI], 8.5-15.1%) and a positivity rate in symptomatic patients of 15.4% (54/351) (95% CI, 11.6-19.2%; P=0.19). The median PCR cycle thresholds was not significantly different between asymptomatic carriers and symptomatic positives (29.5 versus 27.3; P=0.07). Among asymptomatic patients, 11.6% (5/43) of carriers and 8.4% (27/322; P=0.56) of noncarriers subsequently became symptomatic CDI suspects within the same hospitalization. Single and multivariate analysis did not identify any demographic or clinical factors as being significantly associated with C. difficile carriage. Asymptomatic C. difficile carriage rate was similar to symptomatic positivity rate. This suggests the majority of PCR-positive results in symptomatic patients are likely due to C. difficile colonization. Disease-specific biomarkers are needed to accurately diagnose patients with C. difficile disease. Copyright © 2017 Elsevier Inc. All rights reserved.

A 10-Year Retrospective Comparison of Two Target Sequences, REP-529 and B1, for Toxoplasma gondii Detection by Quantitative PCR

PubMed Central

Belaz, Sorya; Gangneux, Jean-Pierre; Dupretz, Peggy; Guiguen, Claude

2015-01-01

This study aimed to evaluate the repeated sequence REP-529 compared to that of the B1 gene in the molecular diagnosis of toxoplasmosis by quantitative PCR (qPCR) in routine diagnosis. Over a 10-year period (2003 to 2013), all patients prospectively diagnosed with a positive REP-529 qPCR result for toxoplasmosis were included. All DNA samples (76 samples from 56 patients) were simultaneously tested using the two qPCR methods (REP-529 and B1). The mean cycle threshold (CT) obtained with the B1 qPCR was significantly higher (+4.71 cycles) than that obtained with REP-529 qPCR (P < 0.0001). Thirty-one out of 69 extracts (45.6%) positive with REP-529 qPCR were not amplified with the B1 qPCR (relative sensitivity of 54.4% compared to that with REP-529), yielding false-negative results with 15/28 placenta, 5 cord blood, 2 amniotic fluid, 4 cerebrospinal fluid, 1 aqueous humor, 2 lymph node puncture, and 1 abortion product sample. This defect in sensitivity would have left 20/56 patients undiagnosed, distributed as follows: 12/40 congenital toxoplasmosis, 4/5 cerebral toxoplasmosis, 2/8 patients with retinochoroiditis, and 2 patients with chronic lymphadenopathy. This poor performance of B1 qPCR might be related to low parasite loads, since the mean Toxoplasma quantification in extracts with B1 false-negative results was 0.4 parasite/reaction. These results clearly show the superiority of the REP-529 sequence in the diagnosis of toxoplasmosis by PCR and suggest that this target should be adopted as part of the standardization of the PCR assay. PMID:25653416

A 10-year retrospective comparison of two target sequences, REP-529 and B1, for Toxoplasma gondii detection by quantitative PCR.

PubMed

Belaz, Sorya; Gangneux, Jean-Pierre; Dupretz, Peggy; Guiguen, Claude; Robert-Gangneux, Florence

2015-04-01

This study aimed to evaluate the repeated sequence REP-529 compared to that of the B1 gene in the molecular diagnosis of toxoplasmosis by quantitative PCR (qPCR) in routine diagnosis. Over a 10-year period (2003 to 2013), all patients prospectively diagnosed with a positive REP-529 qPCR result for toxoplasmosis were included. All DNA samples (76 samples from 56 patients) were simultaneously tested using the two qPCR methods (REP-529 and B1). The mean cycle threshold (CT) obtained with the B1 qPCR was significantly higher (+4.71 cycles) than that obtained with REP-529 qPCR (P<0.0001). Thirty-one out of 69 extracts (45.6%) positive with REP-529 qPCR were not amplified with the B1 qPCR (relative sensitivity of 54.4% compared to that with REP-529), yielding false-negative results with 15/28 placenta, 5 cord blood, 2 amniotic fluid, 4 cerebrospinal fluid, 1 aqueous humor, 2 lymph node puncture, and 1 abortion product sample. This defect in sensitivity would have left 20/56 patients undiagnosed, distributed as follows: 12/40 congenital toxoplasmosis, 4/5 cerebral toxoplasmosis, 2/8 patients with retinochoroiditis, and 2 patients with chronic lymphadenopathy. This poor performance of B1 qPCR might be related to low parasite loads, since the mean Toxoplasma quantification in extracts with B1 false-negative results was 0.4 parasite/reaction. These results clearly show the superiority of the REP-529 sequence in the diagnosis of toxoplasmosis by PCR and suggest that this target should be adopted as part of the standardization of the PCR assay. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

TaqMan probe real-time polymerase chain reaction assay for the quantification of canine DNA in chicken nugget.

PubMed

Rahman, Md Mahfujur; Hamid, Sharifah Bee Abd; Basirun, Wan Jefrey; Bhassu, Subha; Rashid, Nur Raifana Abdul; Mustafa, Shuhaimi; Mohd Desa, Mohd Nasir; Ali, Md Eaqub

2016-01-01

This paper describes a short-amplicon-based TaqMan probe quantitative real-time PCR (qPCR) assay for the quantitative detection of canine meat in chicken nuggets, which are very popular across the world, including Malaysia. The assay targeted a 100-bp fragment of canine cytb gene using a canine-specific primer and TaqMan probe. Specificity against 10 different animals and plants species demonstrated threshold cycles (Ct) of 16.13 ± 0.12 to 16.25 ± 0.23 for canine DNA and negative results for the others in a 40-cycle reaction. The assay was tested for the quantification of up to 0.01% canine meat in deliberately spiked chicken nuggets with 99.7% PCR efficiency and 0.995 correlation coefficient. The analysis of the actual and qPCR predicted values showed a high recovery rate (from 87% ± 28% to 112% ± 19%) with a linear regression close to unity (R(2) = 0.999). Finally, samples of three halal-branded commercial chicken nuggets collected from different Malaysian outlets were screened for canine meat, but no contamination was demonstrated.

Rapid Isolation and Detection for RNA Biomarkers for TBI Diagnostics

DTIC Science & Technology

2016-10-01

address the qualitative result of PCR by choosing the threshold crossover cycle (CT) as a surrogate measure of the RNA/DNA originally in the sample ...include developing DEP techniques for isolation of cell-free (cf) RNA from glioblastoma exosomes and TBI samples (IRB dependent); methods for on... Sample to Answer diagnostics. 15. SUBJECT TERMS 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18. NUMBER OF PAGES 19a. NAME OF

Use of an Internal Positive Control in a Multiplex Reverse Transcription-PCR To Detect West Nile Virus RNA in Mosquito Pools

PubMed Central

Eisler, Diane L.; McNabb, Alan; Jorgensen, Danielle R.; Isaac-Renton, Judith L.

2004-01-01

We report on the use of West Nile virus Armored RNA as an internal positive control (IPC) for the extraction and reverse transcription-PCR (RT-PCR) of RNA extracted from field-collected mosquitoes and on a multiplex real-time Taqman RT-PCR to simultaneously detect the 3′ noncoding region of West Nile virus and the West Nile virus NS5-2 region comprising the IPC. Mosquito pools from the province of British Columbia, Canada (n = 635), were tested in duplicate and found to be negative for West Nile virus and positive for the IPC. Known West Nile virus-positive supernatants from mosquito pools from the provinces of Alberta and Manitoba were tested in duplicate and found to be positive for both regions of the West Nile virus genome. The mean cycle threshold (Ct) value for the IPC in batch extraction controls ± 2 standard deviations was found to be 36.43 ± 1.78 cycles. IPCs of 98.4% (624) of West Nile virus-negative pools fell within this range, indicating the reproducibility of RNA extraction and RT-PCR for pools varying in mosquito genus and number. A comparison of mosquito pool genera revealed no significant genus effect on the Ct value of the IPC. The incorporation of West Nile virus Armored RNA as an IPC allows monitoring of RNA extraction and RT-PCR and detection of false-negative results due to failures in these processes or to PCR inhibition, respectively. PMID:14766868

A technique for setting analytical thresholds in massively parallel sequencing-based forensic DNA analysis

PubMed Central

2017-01-01

Amplicon (targeted) sequencing by massively parallel sequencing (PCR-MPS) is a potential method for use in forensic DNA analyses. In this application, PCR-MPS may supplement or replace other instrumental analysis methods such as capillary electrophoresis and Sanger sequencing for STR and mitochondrial DNA typing, respectively. PCR-MPS also may enable the expansion of forensic DNA analysis methods to include new marker systems such as single nucleotide polymorphisms (SNPs) and insertion/deletions (indels) that currently are assayable using various instrumental analysis methods including microarray and quantitative PCR. Acceptance of PCR-MPS as a forensic method will depend in part upon developing protocols and criteria that define the limitations of a method, including a defensible analytical threshold or method detection limit. This paper describes an approach to establish objective analytical thresholds suitable for multiplexed PCR-MPS methods. A definition is proposed for PCR-MPS method background noise, and an analytical threshold based on background noise is described. PMID:28542338

A technique for setting analytical thresholds in massively parallel sequencing-based forensic DNA analysis.

PubMed

Young, Brian; King, Jonathan L; Budowle, Bruce; Armogida, Luigi

2017-01-01

Amplicon (targeted) sequencing by massively parallel sequencing (PCR-MPS) is a potential method for use in forensic DNA analyses. In this application, PCR-MPS may supplement or replace other instrumental analysis methods such as capillary electrophoresis and Sanger sequencing for STR and mitochondrial DNA typing, respectively. PCR-MPS also may enable the expansion of forensic DNA analysis methods to include new marker systems such as single nucleotide polymorphisms (SNPs) and insertion/deletions (indels) that currently are assayable using various instrumental analysis methods including microarray and quantitative PCR. Acceptance of PCR-MPS as a forensic method will depend in part upon developing protocols and criteria that define the limitations of a method, including a defensible analytical threshold or method detection limit. This paper describes an approach to establish objective analytical thresholds suitable for multiplexed PCR-MPS methods. A definition is proposed for PCR-MPS method background noise, and an analytical threshold based on background noise is described.

Within-herd prevalence thresholds for herd-level detection of mastitis pathogens using multiplex real-time PCR in bulk tank milk samples.

PubMed

Soltau, J B; Einax, E; Klengel, K; Katholm, J; Failing, K; Wehrend, A; Donat, K

2017-10-01

The objective of the study was to assess the value of quantitative multiplex real-time PCR examination of bulk tank milk samples for bovine mastitis pathogens as a tool for herd level diagnosis. Using a logistic regression model, this study is aimed at calculating the threshold level of the apparent within-herd prevalence as determined by quarter milk sample cultivation of all lactating cows, thus allowing the detection of a herd positive for a specific pathogen within certain probability levels. A total of 6,335 quarter milk samples were collected and cultured from 1,615 cows on 51 farms in Germany. Bulk tank milk samples were taken from each farm and tested by bacterial culture as well as the commercial PCR assay Mastit 4A (DNA Diagnostic A/S, Risskov, Denmark) identifying Staphylococcus aureus, Streptococcus dysgalactiae, Streptococcus agalactiae, and Streptococcus uberis. In addition, PCR was performed on pooled herd milk samples containing milk aliquots from all lactating cows in each of the 51 herds. Only 1 out of the 51 herds was found PCR positive for Streptococcus agalactiae in bulk tank and pooled herd milk samples, and cultured quarter milk samples. Spearman's rank correlations between the cycle threshold value of bulk tank milk PCR and the apparent within-herd prevalence were calculated in regard to Staphylococcus aureus, Streptococcus dysgalactiae, and Streptococcus uberis. For these pathogens, significant correlations were found. If 1 bulk tank milk sample per herd was tested, the estimated within-herd prevalence thresholds for 90% probability of detection were 27.6% for Staphylococcus aureus, 9.2% for Streptococcus dysgalactiae, and 13.8% for Streptococcus uberis on the cow level. On the quarter level, the within-herd prevalence had to be at least 32.6% for Staphylococcus aureus, 1.7% for Streptococcus dysgalactiae, and 4.3% for Streptococcus uberis to detect a herd as positive using a single bulk milk sample. The results indicate that mastitis pathogens in bulk tank milk can be identified by the applied PCR assay. Bulk tank milk examination is not a reliable tool for the identification of the named pathogens by single testing, but might be a valuable monitoring tool when used frequently with repeated testing. Furthermore, this approach could be a useful monitoring tool for detecting new pathogen occurrence in the herd. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Comparison of two real-time PCR assays for the detection of malaria parasites from hemolytic blood samples - Short communication.

PubMed

Hagen, Ralf Matthias; Hinz, Rebecca; Tannich, Egbert; Frickmann, Hagen

2015-06-01

We compared the performance of an in-house and a commercial malaria polymerase chain reaction (PCR) assay using freeze-thawed hemolytic blood samples. A total of 116 freeze-thawed ethylenediamine tetraacetic acid (EDTA) blood samples of patients with suspicion of malaria were analyzed by an in-house as well as by a commercially available real-time PCR. Concordant malaria negative PCR results were reported for 39 samples and malaria-positive PCR results for 67 samples. The in-house assay further detected one case of Plasmodium falciparum infection, which was negative in the commercial assay as well as five cases of P. falciparum malaria and three cases of Plasmodium vivax malaria, which showed sample inhibition in the commercial assay. The commercial malaria assay was positive in spite of a negative in-house PCR result in one case. In all concordant results, cycle threshold values of P. falciparum-positive samples were lower in the commercial PCR than in the in-house assay. Although Ct values of the commercial PCR kit suggest higher sensitivity in case of concordant results, it is prone to inhibition if it is applied to hemolytic freeze-thawed blood samples. The number of misidentifications was, however, identical for both real-time PCR assays.

Universal detection of phytoplasmas and Xylella spp. by TaqMan singleplex and multiplex real-time PCR with dual priming oligonucleotides.

PubMed

Ito, Takao; Suzaki, Koichi

2017-01-01

Phytoplasmas and Xylella spp. are bacteria that cause many economically important plant diseases worldwide. TaqMan probe-based quantitative real-time polymerase chain reaction (qPCR) assays have been utilized to universally detect phytoplasmas or Xylella fastidiosa. To develop a superior universal qPCR method, we used a dual priming oligonucleotide (DPO) with two annealing sites as a reverse primer to target the well-conserved bacterial 16S rDNA. The new qPCR assays universally detected various species of phytoplasmas and subspecies of X. fastidiosa as well as Xylella taiwanensis, and generally showed superior threshold cycle values when amplifying specific or non-specific products compared to current universal qPCR assays. The proposed qPCR assays were integrated to develop a multiplex qPCR assay that simultaneously detected phytoplasmas, Xylella spp., and an internal plant DNA positive control within 1 hour. This assay could detect a minimum of ten bacterial cells and was compatible with crude extractions used in the rapid screening of various plants. The amplicons were of sufficient lengths to be directly sequenced for preliminary identification, and the primers could be used in universal conventional PCR assays. Additionally, reverse DPO primers can be utilized to improve other probe-based qPCR assays.

Universal detection of phytoplasmas and Xylella spp. by TaqMan singleplex and multiplex real-time PCR with dual priming oligonucleotides

PubMed Central

Suzaki, Koichi

2017-01-01

Phytoplasmas and Xylella spp. are bacteria that cause many economically important plant diseases worldwide. TaqMan probe-based quantitative real-time polymerase chain reaction (qPCR) assays have been utilized to universally detect phytoplasmas or Xylella fastidiosa. To develop a superior universal qPCR method, we used a dual priming oligonucleotide (DPO) with two annealing sites as a reverse primer to target the well-conserved bacterial 16S rDNA. The new qPCR assays universally detected various species of phytoplasmas and subspecies of X. fastidiosa as well as Xylella taiwanensis, and generally showed superior threshold cycle values when amplifying specific or non-specific products compared to current universal qPCR assays. The proposed qPCR assays were integrated to develop a multiplex qPCR assay that simultaneously detected phytoplasmas, Xylella spp., and an internal plant DNA positive control within 1 hour. This assay could detect a minimum of ten bacterial cells and was compatible with crude extractions used in the rapid screening of various plants. The amplicons were of sufficient lengths to be directly sequenced for preliminary identification, and the primers could be used in universal conventional PCR assays. Additionally, reverse DPO primers can be utilized to improve other probe-based qPCR assays. PMID:28957362

Post-Ebola Syndrome, Sierra Leone.

PubMed

Scott, Janet T; Sesay, Foday R; Massaquoi, Thomas A; Idriss, Baimba R; Sahr, Foday; Semple, Malcolm G

2016-04-01

Thousands of persons have survived Ebola virus disease. Almost all survivors describe symptoms that persist or develop after hospital discharge. A cross-sectional survey of the symptoms of all survivors from the Ebola treatment unit (ETU) at 34th Regimental Military Hospital, Freetown, Sierra Leone (MH34), was conducted after discharge at their initial follow-up appointment within 3 weeks after their second negative PCR result. From its opening on December 1, 2014, through March 31, 2015, the MH34 ETU treated 84 persons (8-70 years of age) with PCR-confirmed Ebola virus disease, of whom 44 survived. Survivors reported musculoskeletal pain (70%), headache (48%), and ocular problems (14%). Those who reported headache had had lower admission cycle threshold Ebola PCR than did those who did not (p<0.03). This complete survivor cohort from 1 ETU enables analysis of the proportion of symptoms of post-Ebola syndrome. The Ebola epidemic is waning, but the effects of the disease will remain.

Enumeration of verocytotoxigenic Escherichia coli (VTEC) O157 and O26 in milk by quantitative PCR.

PubMed

Mancusi, Rocco; Trevisani, Marcello

2014-08-01

Quantitative real-time polymerase chain reaction (qPCR) can be a convenient alternative to the Most Probable Number (MPN) methods to count VTEC in milk. The number of VTEC is normally very low in milk; therefore with the aim of increasing the method sensitivity a qPCR protocol that relies on preliminary enrichment was developed. The growth pattern of six VTEC strains (serogroups O157 and O26) was studied using enrichment in Buffered Peptone Water (BPW) with or without acriflavine for 4-24h. Milk samples were inoculated with these strains over a five Log concentration range between 0.24-0.50 and 4.24-4.50 Log CFU/ml. DNA was extracted from the enriched samples in duplicate and each extract was analysed in duplicate by qPCR using pairs of primers specific for the serogroups O157 and O26. When samples were pre-enriched in BPW at 37°C for 8h, the relationship between threshold cycles (CT values) and VTEC Log numbers was linear over a five Log concentration range. The regression of PCR threshold cycle numbers on VTEC Log CFU/ml had a slope coefficient equal to -3.10 (R(2)=0.96) which is indicative of a 10-fold difference of the gene copy numbers between samples (with a 100 ± 10% PCR efficiency). The same 10-fold proportion used for inoculating the milk samples with VTEC was observed, therefore, also in the enriched samples at 8h. A comparison of the CT values of milk samples and controls revealed that the strains inoculated in milk grew with 3 Log increments in the 8h enrichment period. Regression lines that fitted the qPCR and MPN data revealed that the error of the qPCR estimates is lower than the error of the estimated MPN (r=0.982, R(2)=0.965 vs. r=0.967, R(2)=0.935). The growth rates of VTEC strains isolated from milk should be comparatively assessed before qPCR estimates based on the regression model are considered valid. Comparative assessment of the growth rates can be done using spectrophotometric measurements of standardized cultures of isolates and reference strains cultured in BPW at 37°C for 8h. The method developed for the serogroups O157 and O26 can be easily adapted to the other VTEC serogroups that are relevant for human health. The qPCR method is less laborious and faster than the standard MPN method and has been shown to be a good technique for quantifying VTEC in milk. Copyright © 2014 Elsevier B.V. All rights reserved.

Micro-droplet Digital Polymerase Chain Reaction and Real-Time Quantitative Polymerase Chain Reaction Technologies Provide Highly Sensitive and Accurate Detection of Zika Virus.

PubMed

Hui, Yuan; Wu, Zhiming; Qin, Zhiran; Zhu, Li; Liang, Junhe; Li, Xujuan; Fu, Hanmin; Feng, Shiyu; Yu, Jianhai; He, Xiaoen; Lu, Weizhi; Xiao, Weiwei; Wu, Qinghua; Zhang, Bao; Zhao, Wei

2018-06-01

The establishment of highly sensitive diagnostic methods is critical in the early diagnosis and control of Zika virus (ZIKV) and in preventing serious neurological complications of ZIKV infection. In this study, we established micro-droplet digital polymerase chain reaction (ddPCR) and real-time quantitative PCR (RT-qPCR) protocols for the detection of ZIKV based on the amplification of the NS5 gene. For the ZIKV standard plasmid, the RT-qPCR results showed that the cycle threshold (Ct) value was linear from 10 1 to 10 8  copy/μL, with a standard curve R 2 of 0.999 and amplification efficiency of 92.203%; however, a concentration as low as 1 copy/μL could not be detected. In comparison with RT-qPCR, the ddPCR method resulted in a linear range of 10 1 -10 4  copy/μL and was able to detect concentrations as low as 1 copy/μL. Thus, for detecting ZIKV from clinical samples, RT-qPCR is a better choice for high-concentration samples (above 10 1  copy/μL), while ddPCR has excellent accuracy and sensitivity for low-concentration samples. These results indicate that the ddPCR method should be of considerable use in the early diagnosis, laboratory study, and monitoring of ZIKV.

Microgravity validation of a novel system for RNA isolation and multiplex quantitative real time PCR analysis of gene expression on the International Space Station.

PubMed

Parra, Macarena; Jung, Jimmy; Boone, Travis D; Tran, Luan; Blaber, Elizabeth A; Brown, Mark; Chin, Matthew; Chinn, Tori; Cohen, Jacob; Doebler, Robert; Hoang, Dzung; Hyde, Elizabeth; Lera, Matthew; Luzod, Louie T; Mallinson, Mark; Marcu, Oana; Mohamedaly, Youssef; Ricco, Antonio J; Rubins, Kathleen; Sgarlato, Gregory D; Talavera, Rafael O; Tong, Peter; Uribe, Eddie; Williams, Jeffrey; Wu, Diana; Yousuf, Rukhsana; Richey, Charles S; Schonfeld, Julie; Almeida, Eduardo A C

2017-01-01

The International Space Station (ISS) National Laboratory is dedicated to studying the effects of space on life and physical systems, and to developing new science and technologies for space exploration. A key aspect of achieving these goals is to operate the ISS National Lab more like an Earth-based laboratory, conducting complex end-to-end experimentation, not limited to simple microgravity exposure. Towards that end NASA developed a novel suite of molecular biology laboratory tools, reagents, and methods, named WetLab-2, uniquely designed to operate in microgravity, and to process biological samples for real-time gene expression analysis on-orbit. This includes a novel fluidic RNA Sample Preparation Module and fluid transfer devices, all-in-one lyophilized PCR assays, centrifuge, and a real-time PCR thermal cycler. Here we describe the results from the WetLab-2 validation experiments conducted in microgravity during ISS increment 47/SPX-8. Specifically, quantitative PCR was performed on a concentration series of DNA calibration standards, and Reverse Transcriptase-quantitative PCR was conducted on RNA extracted and purified on-orbit from frozen Escherichia coli and mouse liver tissue. Cycle threshold (Ct) values and PCR efficiencies obtained on-orbit from DNA standards were similar to Earth (1 g) controls. Also, on-orbit multiplex analysis of gene expression from bacterial cells and mammalian tissue RNA samples was successfully conducted in about 3 h, with data transmitted within 2 h of experiment completion. Thermal cycling in microgravity resulted in the trapping of gas bubbles inside septa cap assay tubes, causing small but measurable increases in Ct curve noise and variability. Bubble formation was successfully suppressed in a rapid follow-up on-orbit experiment using standard caps to pressurize PCR tubes and reduce gas release during heating cycles. The WetLab-2 facility now provides a novel operational on-orbit research capability for molecular biology and demonstrates the feasibility of more complex wet bench experiments in the ISS National Lab environment.

Microgravity validation of a novel system for RNA isolation and multiplex quantitative real time PCR analysis of gene expression on the International Space Station

PubMed Central

Boone, Travis D.; Tran, Luan; Blaber, Elizabeth A.; Brown, Mark; Chin, Matthew; Chinn, Tori; Cohen, Jacob; Doebler, Robert; Hoang, Dzung; Hyde, Elizabeth; Lera, Matthew; Luzod, Louie T.; Mallinson, Mark; Marcu, Oana; Mohamedaly, Youssef; Ricco, Antonio J.; Rubins, Kathleen; Sgarlato, Gregory D.; Talavera, Rafael O.; Tong, Peter; Uribe, Eddie; Williams, Jeffrey; Wu, Diana; Yousuf, Rukhsana; Richey, Charles S.; Schonfeld, Julie

2017-01-01

The International Space Station (ISS) National Laboratory is dedicated to studying the effects of space on life and physical systems, and to developing new science and technologies for space exploration. A key aspect of achieving these goals is to operate the ISS National Lab more like an Earth-based laboratory, conducting complex end-to-end experimentation, not limited to simple microgravity exposure. Towards that end NASA developed a novel suite of molecular biology laboratory tools, reagents, and methods, named WetLab-2, uniquely designed to operate in microgravity, and to process biological samples for real-time gene expression analysis on-orbit. This includes a novel fluidic RNA Sample Preparation Module and fluid transfer devices, all-in-one lyophilized PCR assays, centrifuge, and a real-time PCR thermal cycler. Here we describe the results from the WetLab-2 validation experiments conducted in microgravity during ISS increment 47/SPX-8. Specifically, quantitative PCR was performed on a concentration series of DNA calibration standards, and Reverse Transcriptase-quantitative PCR was conducted on RNA extracted and purified on-orbit from frozen Escherichia coli and mouse liver tissue. Cycle threshold (Ct) values and PCR efficiencies obtained on-orbit from DNA standards were similar to Earth (1 g) controls. Also, on-orbit multiplex analysis of gene expression from bacterial cells and mammalian tissue RNA samples was successfully conducted in about 3 h, with data transmitted within 2 h of experiment completion. Thermal cycling in microgravity resulted in the trapping of gas bubbles inside septa cap assay tubes, causing small but measurable increases in Ct curve noise and variability. Bubble formation was successfully suppressed in a rapid follow-up on-orbit experiment using standard caps to pressurize PCR tubes and reduce gas release during heating cycles. The WetLab-2 facility now provides a novel operational on-orbit research capability for molecular biology and demonstrates the feasibility of more complex wet bench experiments in the ISS National Lab environment. PMID:28877184

Improvement in the detection rate of diarrhoeagenic bacteria in human stool specimens by a rapid real-time PCR assay.

PubMed

Iijima, Yoshio; Asako, Nahoko T; Aihara, Masanori; Hayashi, Kozaburo

2004-07-01

A rapid laboratory system has been developed and evaluated that can simultaneously identify major diarrhoeagenic bacteria, including Salmonella enterica, Vibrio parahaemolyticus, Campylobacter jejuni and Shiga toxin-producing Escherichia coli, in stool specimens by real-time PCR. Specific identification was achieved by using selective TaqMan probes, detecting two targets in each pathogen. A positive result was scored only when both targets of a pathogen were amplified and the difference between threshold cycles for detection was less than five. Diagnosis of enteric bacterial infections using this highly sensitive method, including DNA extraction and real-time PCR, requires only 3 h. Forty stool specimens related to suspected food poisoning outbreaks were analysed: 16 (40%) of these samples were found to be positive for diarrhoeagenic bacteria using a conventional culture method; 28 (70%) were positive using the real-time PCR assay. Of the 12 PCR-positive but culture-negative cases, 11 patients had consumed pathogen-contaminated or high-risk food. Analysis of faecal samples from 105 outpatients who complained of diarrhoea and/or abdominal pain identified 19 (18%) patients as being positive for diarrhoeagenic bacteria using the culture method. An additional six (6%) patients were found to be positive by PCR analysis.

Multiplex qPCR for serodetection and serotyping of hepatitis viruses: A brief review.

PubMed

Irshad, Mohammad; Gupta, Priyanka; Mankotia, Dhananjay Singh; Ansari, Mohammad Ahmad

2016-05-28

The present review describes the current status of multiplex quantitative real time polymerase chain reaction (qPCR) assays developed and used globally for detection and subtyping of hepatitis viruses in body fluids. Several studies have reported the use of multiplex qPCR for the detection of hepatitis viruses, including hepatitis A virus (HAV), hepatitis B virus (HBV), hepatitis C virus (HCV), hepatitis D virus (HDV), and hepatitis E virus (HEV). In addition, multiplex qPCR has also been developed for genotyping HBV, HCV, and HEV subtypes. Although a single step multiplex qPCR assay for all six hepatitis viruses, i.e., A to G viruses, is not yet reported, it may be available in the near future as the technologies continue to advance. All studies use a conserved region of the viral genome as the basis of amplification and hydrolysis probes as the preferred chemistries for improved detection. Based on a standard plot prepared using varying concentrations of template and the observed threshold cycle value, it is possible to determine the linear dynamic range and to calculate an exact copy number of virus in the specimen. Advantages of multiplex qPCR assay over singleplex or other molecular techniques in samples from patients with co-infection include fast results, low cost, and a single step investigation process.

A common base method for analysis of qPCR data and the application of simple blocking in qPCR experiments.

PubMed

Ganger, Michael T; Dietz, Geoffrey D; Ewing, Sarah J

2017-12-01

qPCR has established itself as the technique of choice for the quantification of gene expression. Procedures for conducting qPCR have received significant attention; however, more rigorous approaches to the statistical analysis of qPCR data are needed. Here we develop a mathematical model, termed the Common Base Method, for analysis of qPCR data based on threshold cycle values (C q ) and efficiencies of reactions (E). The Common Base Method keeps all calculations in the logscale as long as possible by working with log 10 (E) ∙ C q , which we call the efficiency-weighted C q value; subsequent statistical analyses are then applied in the logscale. We show how efficiency-weighted C q values may be analyzed using a simple paired or unpaired experimental design and develop blocking methods to help reduce unexplained variation. The Common Base Method has several advantages. It allows for the incorporation of well-specific efficiencies and multiple reference genes. The method does not necessitate the pairing of samples that must be performed using traditional analysis methods in order to calculate relative expression ratios. Our method is also simple enough to be implemented in any spreadsheet or statistical software without additional scripts or proprietary components.

Multiplex qPCR for serodetection and serotyping of hepatitis viruses: A brief review

PubMed Central

Irshad, Mohammad; Gupta, Priyanka; Mankotia, Dhananjay Singh; Ansari, Mohammad Ahmad

2016-01-01

The present review describes the current status of multiplex quantitative real time polymerase chain reaction (qPCR) assays developed and used globally for detection and subtyping of hepatitis viruses in body fluids. Several studies have reported the use of multiplex qPCR for the detection of hepatitis viruses, including hepatitis A virus (HAV), hepatitis B virus (HBV), hepatitis C virus (HCV), hepatitis D virus (HDV), and hepatitis E virus (HEV). In addition, multiplex qPCR has also been developed for genotyping HBV, HCV, and HEV subtypes. Although a single step multiplex qPCR assay for all six hepatitis viruses, i.e., A to G viruses, is not yet reported, it may be available in the near future as the technologies continue to advance. All studies use a conserved region of the viral genome as the basis of amplification and hydrolysis probes as the preferred chemistries for improved detection. Based on a standard plot prepared using varying concentrations of template and the observed threshold cycle value, it is possible to determine the linear dynamic range and to calculate an exact copy number of virus in the specimen. Advantages of multiplex qPCR assay over singleplex or other molecular techniques in samples from patients with co-infection include fast results, low cost, and a single step investigation process. PMID:27239109

Feasibility of Xpert Ebola Assay in Médecins Sans Frontières Ebola Program, Guinea

PubMed Central

Chaillet, Pascale; Sow, Mamadou Saliou; Amand, Mathieu; van Vyve, Charlotte; Jonckheere, Sylvie; Crestani, Rosa; Sprecher, Armand; Van Herp, Michel; Chua, Arlene; Piriou, Erwan; Koivogui, Lamine; Antierens, Annick

2016-01-01

Rapid diagnostic methods are essential in control of Ebola outbreaks and lead to timely isolation of cases and improved epidemiologic surveillance. Diagnosis during Ebola outbreaks in West Africa has relied on PCR performed in laboratories outside this region. Because time between sampling and PCR results can be considerable, we assessed the feasibility and added value of using the Xpert Ebola Assay in an Ebola control program in Guinea. A total of 218 samples were collected during diagnosis, treatment, and convalescence of patients. Median time for obtaining results was reduced from 334 min to 165 min. Twenty-six samples were positive for Ebola virus. Xpert cycle thresholds were consistently lower, and 8 (31%) samples were negative by routine PCR. Several logistic and safety issues were identified. We suggest that implementation of the Xpert Ebola Assay under programmatic conditions is feasible and represents a major advance in diagnosis of Ebola virus disease without apparent loss of assay sensitivity. PMID:26812466

Feasibility of Xpert Ebola Assay in Médecins Sans Frontières Ebola Program, Guinea.

PubMed

Van den Bergh, Rafael; Chaillet, Pascale; Sow, Mamadou Saliou; Amand, Mathieu; van Vyve, Charlotte; Jonckheere, Sylvie; Crestani, Rosa; Sprecher, Armand; Van Herp, Michel; Chua, Arlene; Piriou, Erwan; Koivogui, Lamine; Antierens, Annick

2016-02-01

Rapid diagnostic methods are essential in control of Ebola outbreaks and lead to timely isolation of cases and improved epidemiologic surveillance. Diagnosis during Ebola outbreaks in West Africa has relied on PCR performed in laboratories outside this region. Because time between sampling and PCR results can be considerable, we assessed the feasibility and added value of using the Xpert Ebola Assay in an Ebola control program in Guinea. A total of 218 samples were collected during diagnosis, treatment, and convalescence of patients. Median time for obtaining results was reduced from 334 min to 165 min. Twenty-six samples were positive for Ebola virus. Xpert cycle thresholds were consistently lower, and 8 (31%) samples were negative by routine PCR. Several logistic and safety issues were identified. We suggest that implementation of the Xpert Ebola Assay under programmatic conditions is feasible and represents a major advance in diagnosis of Ebola virus disease without apparent loss of assay sensitivity.

Spatiotemporal behavior and nonlinear dynamics in a phase conjugate resonator

NASA Technical Reports Server (NTRS)

Liu, Siuying Raymond

1993-01-01

The work described can be divided into two parts. The first part is an investigation of the transient behavior and stability property of a phase conjugate resonator (PCR) below threshold. The second part is an experimental and theoretical study of the PCR's spatiotemporal dynamics above threshold. The time-dependent coupled wave equations for four-wave mixing (FWM) in a photorefractive crystal, with two distinct interaction regions caused by feedback from an ordinary mirror, was used to model the transient dynamics of a PCR below threshold. The conditions for self-oscillation were determined and the solutions were used to define the PCR's transfer function and analyze its stability. Experimental results for the buildup and decay times confirmed qualitatively the predicted behavior. Experiments were carried out above threshold to study the spatiotemporal dynamics of the PCR as a function of Pragg detuning and the resonator's Fresnel number. The existence of optical vortices in the wavefront were identified by optical interferometry. It was possible to describe the transverse dynamics and the spatiotemporal instabilities by modeling the three-dimensional-coupled wave equations in photorefractive FWM using a truncated modal expansion approach.

Assessment of real-time PCR cycle threshold values in Microsporum canis culture-positive and culture-negative cats in an animal shelter: a field study.

PubMed

Jacobson, Linda S; McIntyre, Lauren; Mykusz, Jenny

2018-02-01

Objectives Real-time PCR provides quantitative information, recorded as the cycle threshold (Ct) value, about the number of organisms detected in a diagnostic sample. The Ct value correlates with the number of copies of the target organism in an inversely proportional and exponential relationship. The aim of the study was to determine whether Ct values could be used to distinguish between culture-positive and culture-negative samples. Methods This was a retrospective analysis of Ct values from dermatophyte PCR results in cats with suspicious skin lesions or suspected exposure to dermatophytosis. Results One hundred and thirty-two samples were included. Using culture as the gold standard, 28 were true positives, 12 were false positives and 92 were true negatives. The area under the curve for the pretreatment time point was 96.8% (95% confidence interval [CI] 94.2-99.5) compared with 74.3% (95% CI 52.6-96.0) for pooled data during treatment. Before treatment, a Ct cut-off of <35.7 (approximate DNA count 300) provided a sensitivity of 92.3% and specificity of 95.2%. There was no reliable cut-off Ct value between culture-positive and culture-negative samples during treatment. Ct values prior to treatment differed significantly between the true-positive and false-positive groups ( P = 0.0056). There was a significant difference between the pretreatment and first and second negative culture time points ( P = 0.0002 and P <0.0001, respectively). However, there was substantial overlap between Ct values for true positives and true negatives, and for pre- and intra-treatment time points. Conclusions and relevance Ct values had limited usefulness for distinguishing between culture-positive and culture-negative cases when field study samples were analyzed. In addition, Ct values were less reliable than fungal culture for determining mycological cure.

Quantitation of human immunodeficiency virus type 1 in breast milk.

PubMed

Ghosh, M K; Kuhn, L; West, J; Semrau, K; Decker, D; Thea, D M; Aldrovandi, G M

2003-06-01

The distribution and stability of human immunodeficiency virus type 1 (HIV-1) in breast milk (BM) components remain largely unknown. Inhibitory effects, if any, of BM on HIV RNA and DNA PCR amplification are poorly understood. We have addressed these issues by using virus-spiked BM samples from HIV-negative women. BM samples from HIV-negative women were spiked with HIV-1 virions or cells containing a single integrated copy of HIV DNA (8E5/LAV). After incubation under different experimental conditions, viral RNA was detected by the Roche Amplicor UltraSensitive assay in whole-milk, skim milk, and lipid fractions. We found excellent correlation between HIV-1 input copy and recovery in whole milk (r = 0.965, P < 0.0001), skim milk (r = 0.972, P < 0.0001), and the lipid fraction (r = 0.905, P < 0.001). PCR inhibition was observed in less than 10% of the spiked samples. Similar levels of inhibition were noted in BM samples collected from HIV-infected women. HIV proviral DNA was detected in BM samples using real-time PCR (linear correlation between the threshold cycle versus log DNA copy number, >0.982). The effects of incubation duration and temperature and repeated freeze-thaw cycles on HIV RNA recovery were analyzed. HIV RNA levels were remarkably stable in whole milk after three freeze-thaw cycles and for up to 30 h at room temperature. Our findings improve the understanding of the dynamics of HIV detection in BM and the conditions for BM sample collection, storage, and processing.

Diagnostic Limitation of Fine-Needle Aspiration (FNA) on Indeterminate Thyroid Nodules Can Be Partially Overcome by Preoperative Molecular Analysis: Assessment of RET/PTC1 Rearrangement in BRAF and RAS Wild-Type Routine Air-Dried FNA Specimens.

PubMed

Ko, Young Sin; Hwang, Tae Sook; Kim, Ja Yeon; Choi, Yoon-La; Lee, Seung Eun; Han, Hye Seung; Kim, Wan Seop; Kim, Suk Kyeong; Park, Kyoung Sik

2017-04-12

Molecular markers are helpful diagnostic tools, particularly for cytologically indeterminate thyroid nodules. Preoperative RET/PTC1 rearrangement analysis in BRAF and RAS wild-type indeterminate thyroid nodules would permit the formulation of an unambiguous surgical plan. Cycle threshold values according to the cell count for detection of the RET/PTC1 rearrangement by real-time reverse transcription-polymerase chain reaction (RT-PCR) using fresh and routine air-dried TPC1 cells were evaluated. The correlation of RET/PTC1 rearrangement between fine-needle aspiration (FNA) and paired formalin-fixed paraffin-embedded (FFPE) specimens was analyzed. RET/PTC1 rearrangements of 76 resected BRAF and RAS wild-type classical PTCs were also analyzed. Results of RT-PCR and the Nanostring were compared. When 100 fresh and air-dried TPC1 cells were used, expression of RET/PTC1 rearrangement was detectable after 35 and 33 PCR cycles, respectively. The results of RET/PTC1 rearrangement in 10 FNA and paired FFPE papillary thyroid carcinoma (PTC) specimens showed complete correlation. Twenty-nine (38.2%) of 76 BRAF and RAS wild-type classical PTCs had RET/PTC1 rearrangement. Comparison of RET/PTC1 rearrangement analysis between RT-PCR and the Nanostring showed moderate agreement with a κ value of 0.56 ( p = 0.002). The RET/PTC1 rearrangement analysis by RT-PCR using routine air-dried FNA specimen was confirmed to be technically applicable. A significant proportion (38.2%) of the BRAF and RAS wild-type PTCs harbored RET/PTC1 rearrangements.

Rapid and Accurate Diagnosis Based on Real-Time PCR Cycle Threshold Value for the Identification of Campylobacter jejuni, astA Gene-Positive Escherichia coli, and eae Gene-Positive E. coli.

PubMed

Kawase, Jun; Asakura, Hiroshi; Kurosaki, Morito; Oshiro, Hitoshi; Etoh, Yoshiki; Ikeda, Tetsuya; Watahiki, Masanori; Kameyama, Mitsuhiro; Hayashi, Fumi; Kawakami, Yuta; Murakami, Yoshiko; Tsunomori, Yoshie

2018-01-23

We previously developed a multiplex real-time PCR assay (Rapid Foodborne Bacterial Screening 24 ver.5, [RFBS24 ver.5]) for simultaneous detection of 24 foodborne bacterial targets. Here, to overcome the discrepancy of the results from RFBS24 ver.5 and bacterial culture methods (BC), we analyzed 246 human clinical samples from 49 gastroenteritis outbreaks using RFBS24 ver.5 and evaluated the correlation between the cycle threshold (CT) value of RFBS24 ver.5 and the BC results. The results showed that the RFBS24 ver.5 was more sensitive than BC for Campylobacter jejuni and Escherichia coli harboring astA or eae, with positive predictive values (PPV) of 45.5-87.0% and a kappa coefficient (KC) of 0.60-0.92, respectively. The CTs were significantly different between BC-positive and -negative samples (p ＜ 0.01). All RFBS24 ver.5-positive samples were BC-positive under the lower confidence interval (CI) limit of 95% or 99% for the CT of the BC-negative samples. We set the 95% or 99% CI lower limit to the determination CT (d-CT) to discriminate for assured BC-positive results (d-CTs: 27.42-30.86), and subsequently the PPVs (94.7%-100.0%) and KCs (0.89-0.95) of the 3 targets were increased. Together, we concluded that the implication of a d-CT-based approach would be a valuable tool for rapid and accurate diagnoses using the RFBS24 ver.5 system.

Human genomic DNA quantitation system, H-Quant: development and validation for use in forensic casework.

PubMed

Shewale, Jaiprakash G; Schneida, Elaine; Wilson, Jonathan; Walker, Jerilyn A; Batzer, Mark A; Sinha, Sudhir K

2007-03-01

The human DNA quantification (H-Quant) system, developed for use in human identification, enables quantitation of human genomic DNA in biological samples. The assay is based on real-time amplification of AluYb8 insertions in hominoid primates. The relatively high copy number of subfamily-specific Alu repeats in the human genome enables quantification of very small amounts of human DNA. The oligonucleotide primers present in H-Quant are specific for human DNA and closely related great apes. During the real-time PCR, the SYBR Green I dye binds to the DNA that is synthesized by the human-specific AluYb8 oligonucleotide primers. The fluorescence of the bound SYBR Green I dye is measured at the end of each PCR cycle. The cycle at which the fluorescence crosses the chosen threshold correlates to the quantity of amplifiable DNA in that sample. The minimal sensitivity of the H-Quant system is 7.6 pg/microL of human DNA. The amplicon generated in the H-Quant assay is 216 bp, which is within the same range of the common amplifiable short tandem repeat (STR) amplicons. This size amplicon enables quantitation of amplifiable DNA as opposed to a quantitation of degraded or nonamplifiable DNA of smaller sizes. Development and validation studies were performed on the 7500 real-time PCR system following the Quality Assurance Standards for Forensic DNA Testing Laboratories.

Real-time PCR for simultaneous detection and genotyping of bovine viral diarrhea virus.

PubMed

Letellier, C; Kerkhofs, P

2003-12-01

Since two genotypes of bovine viral diarrhea viruses (BVDV) occur in Belgian herds, their differentiation is important for disease surveillance. A quantitative real-time PCR assay was developed to detect and classify bovine viral diarrhea viruses in genotype I and II. A pair of primers specific for highly conserved regions of the 5'UTR and two TaqMan probes were designed. The FAM and VIC-labeled probe sequences differed by three nucleotides, allowing the differentiation between genotype I and II. The assay detectability of genotype I and II real-time PCR assay was 1000 and 100 copies, respectively. Highly reproducible data were obtained as the coefficients of variation of threshold cycle values in inter-runs were less than 2.2%. The correct classification of genotype I and II viruses was assessed by using reference strains and characterized field isolates of both genotypes. The application to clinical diagnosis was evaluated on pooled blood samples by post run measurement of the FAM- and VIC-associated fluorescence. The 100% agreement with the conventional RT-PCR method confirmed that this new technique could be used for routine detection of persistently infected immunotolerant animals.

[Detection of Plasmodium falciparum by using magnetic nanoparticles separation-based quantitative real-time PCR assay].

PubMed

Wang, Fei; Tian, Yin; Yang, Jing; Sun, Fu-Jun; Sun, Ning; Liu, Bi-Yong; Tian, Rui; Ge, Guang-Lu; Zou, Ming-qiang; Deng, Cong-liang; Liu, Yi

2014-10-01

To establish a magnetic nanoparticles separation-based quantitative real-time PCR (RT-PCR) assay for fast and accurate detection of Plasmodium falciparum and providing a technical support for improving the control and prevention of imported malaria. According to the conserved sequences of the P. falciparum genome 18SrRNA, the species-specific primers and probe were designed and synthetized. The RT-PCR was established by constructing the plasmid standard, fitting the standard curve and using magnetic nanoparticles separation. The sensitivity and specificity of the assay were evaluated. The relationship between the threshold cycle (Ct) and logarithm of initial templates copies was linear over a range of 2.5 x 10(1) to 2.5 x 10(8) copies/μl (R2 = 0.999). Among 13 subjects of entry frontier, a P. falciparum carrier with low load was detected by using the assay and none was detected with the conventional examinations (microscopic examinations and rapid tests). This assay shows a high sensitivity in detection of P. falciparum, with rapid and accurate characteristics, and is especially useful in diagnosis of P. falciparum infectors with low parasitaemia at entry-exit frontier ports.

A quantitative PCR assay for aerobic, vinyl chloride- and ethene-assimilating microorganisms in groundwater.

PubMed

Jin, Yang Oh; Mattes, Timothy E

2010-12-01

Vinyl chloride (VC) is a known human carcinogen that is primarily formed in groundwater via incomplete anaerobic dechlorination of chloroethenes. Aerobic, ethene-degrading bacteria (etheneotrophs), which are capable of both fortuitous and growth-linked VC oxidation, could be important in natural attenuation of VC plumes that escape anaerobic treatment. In this work, we developed a quantitative, real-time PCR (qPCR) assay for etheneotrophs in groundwater. We designed and tested degenerate qPCR primers for two functional genes involved in aerobic, growth-coupled VC- and ethene-oxidation (etnC and etnE). Primer specificity to these target genes was tested by comparison to nucleotide sequence databases, PCR analysis of template DNA extracted from isolates and environmental samples, and sequencing of qPCR products obtained from VC-contaminated groundwater. The assay was made quantitative by constructing standard curves (threshold cycle vs log gene copy number) with DNA amplified from Mycobacterium strain JS60, an etheneotrophic isolate. Analysis of groundwater samples from three different VC-contaminated sites revealed that etnC abundance ranged from 1.6 × 10(3) - 1.0 × 10(5) copies/L groundwater while etnE abundance ranged from 4.3 × 10(3) - 6.3 × 10(5) copies/L groundwater. Our data suggest this novel environmental measurement method will be useful for supporting VC bioremediation strategies, assisting in site closure, and conducting microbial ecology studies involving etheneotrophs.

Comparison of Simplexa HSV 1 & 2 PCR with culture, immunofluorescence, and laboratory-developed TaqMan PCR for detection of herpes simplex virus in swab specimens.

PubMed

Gitman, Melissa R; Ferguson, David; Landry, Marie L

2013-11-01

The Simplexa HSV 1 & 2 direct PCR assay was compared with conventional cell culture, cytospin-enhanced direct fluorescent antibody (DFA), and a laboratory-developed real-time TaqMan PCR (LDT HSV PCR) using extracted nucleic acid for the detection of herpes simplex virus (HSV) in dermal, genital, mouth, ocular, and other swab samples. One hundred seventy-one swabs were tested prospectively, and 58 were positive for HSV (34 HSV-1 and 24 HSV-2). Cytospin-DFA detected 50 (86.2%), conventional cell culture 51 (87.9%), Simplexa direct 55 (94.8%), and LDT HSV PCR 57 (98.3%) of 58 true positives. Simplexa direct detected more positives than DFA and culture, but the differences were not significant (P = 0.0736 and P = 0.3711, respectively, by the McNemar test). Samples that were positive by all methods (n = 48) were strong positives (LDT cycle threshold [CT] value, 14.4 to 26.1). One strongly positive sample was falsely negative by LDT HSV PCR due to a failure of TaqMan probe binding. Three samples falsely negative by Simplexa direct had high CT values by LDT HSV PCR (LDT CT, 35.8 to 38.2). Omission of the DNA extraction step by Simplexa direct led to a drop in sensitivity compared to the sensitivity of LDT HSV PCR using extracted samples (94.8% versus 98.3%, respectively), but the difference was not significant (P = 0.6171). Simplexa HSV 1 & 2 direct PCR was the most expensive but required the least training of the assays used, had the lowest hands-on time and fastest assay time (75 min, versus 3 h by LDT HSV PCR), and provided the HSV type.

Comparison of Simplexa HSV 1 & 2 PCR with Culture, Immunofluorescence, and Laboratory-Developed TaqMan PCR for Detection of Herpes Simplex Virus in Swab Specimens

PubMed Central

Gitman, Melissa R.; Ferguson, David

2013-01-01

The Simplexa HSV 1 & 2 direct PCR assay was compared with conventional cell culture, cytospin-enhanced direct fluorescent antibody (DFA), and a laboratory-developed real-time TaqMan PCR (LDT HSV PCR) using extracted nucleic acid for the detection of herpes simplex virus (HSV) in dermal, genital, mouth, ocular, and other swab samples. One hundred seventy-one swabs were tested prospectively, and 58 were positive for HSV (34 HSV-1 and 24 HSV-2). Cytospin-DFA detected 50 (86.2%), conventional cell culture 51 (87.9%), Simplexa direct 55 (94.8%), and LDT HSV PCR 57 (98.3%) of 58 true positives. Simplexa direct detected more positives than DFA and culture, but the differences were not significant (P = 0.0736 and P = 0.3711, respectively, by the McNemar test). Samples that were positive by all methods (n = 48) were strong positives (LDT cycle threshold [CT] value, 14.4 to 26.1). One strongly positive sample was falsely negative by LDT HSV PCR due to a failure of TaqMan probe binding. Three samples falsely negative by Simplexa direct had high CT values by LDT HSV PCR (LDT CT, 35.8 to 38.2). Omission of the DNA extraction step by Simplexa direct led to a drop in sensitivity compared to the sensitivity of LDT HSV PCR using extracted samples (94.8% versus 98.3%, respectively), but the difference was not significant (P = 0.6171). Simplexa HSV 1 & 2 direct PCR was the most expensive but required the least training of the assays used, had the lowest hands-on time and fastest assay time (75 min, versus 3 h by LDT HSV PCR), and provided the HSV type. PMID:24006008

Quantification of concentrated Chinese medicine granules by quantitative polymerase chain reaction.

PubMed

Lo, Yat-Tung; Shaw, Pang-Chui

2017-10-25

Determination of the amount of constituent in a multi-herb product is important for quality control. In concentrated Chinese medicine granules (CCMG), no dregs are left after dissolution of the CCMG. This study is the first to examine the feasibility of using quantitative polymerase chain reaction (qPCR) to find the amount of CCMG in solution form. DNA was extracted from Hirudo and Zaocys CCMG mixed at different ratios and amplified in qPCR using species-specific primers. The threshold cycle (C T ) obtained was compared with the respective standard curves. Results showed that reproducible quantification results could be obtained (1) for 5-50mg CCMG using a modified DNA extraction protocol, (2) amongst DNA extracted from the same batch of CCMG and (3) amongst different batches of CCMG from the same company. This study demonstrated the constitute amount of CCMG in a mixture could be determined using qPCR. This work has extended the application of DNA techniques for the quantification of herbal products and this approach may be developed for quality assurance in the CCMG industry. Copyright © 2017 Elsevier B.V. All rights reserved.

Effect of ionizing radiation on the quantitative detection of Salmonella using real-time PCR

NASA Astrophysics Data System (ADS)

Lim, Sangyong; Jung, Jinwoo; Kim, Minjeong; Ryu, Sangryeol; Kim, Dongho

2008-09-01

Food irradiation is an economically viable technology for inactivating foodborne pathogens, but irradiation can mask pathogens in unhygienically prepared food. The aim of this study was to investigate the effect of irradiation treatment on the detection of Salmonella using real-time PCR. Three commercially available kits were tested, of which the InstaGene Matrix procedure was most effective in preparing template DNA from Salmonella exposed to radiation in broth culture. The minimum level of detection by real-time PCR combined with InstaGene Matrix was 3 log units of Salmonella per milliliter. However, when pure cultures of Salmonella were irradiated at 3 and 5 kGy, the cycle threshold ( CT) increased 1-1.5-fold compared to irradiation at 0 and 1 kGy. This indicated that irradiation treatment may result in an underestimation of bacterial counts due to radiation-induced DNA lesions. We also compared CT values in inoculated chicken homogenates before and after irradiation, which in this model caused a 1.3-3.3-fold underestimation of bacterial counts with respect to irradiation dose.

Statistical assessment of DNA extraction reagent lot variability in real-time quantitative PCR

USGS Publications Warehouse

Bushon, R.N.; Kephart, C.M.; Koltun, G.F.; Francy, D.S.; Schaefer, F. W.; Lindquist, H.D. Alan

2010-01-01

Aims: The aim of this study was to evaluate the variability in lots of a DNA extraction kit using real-time PCR assays for Bacillus anthracis, Francisella tularensis and Vibrio cholerae. Methods and Results: Replicate aliquots of three bacteria were processed in duplicate with three different lots of a commercial DNA extraction kit. This experiment was repeated in triplicate. Results showed that cycle threshold values were statistically different among the different lots. Conclusions: Differences in DNA extraction reagent lots were found to be a significant source of variability for qPCR results. Steps should be taken to ensure the quality and consistency of reagents. Minimally, we propose that standard curves should be constructed for each new lot of extraction reagents, so that lot-to-lot variation is accounted for in data interpretation. Significance and Impact of the Study: This study highlights the importance of evaluating variability in DNA extraction procedures, especially when different reagent lots are used. Consideration of this variability in data interpretation should be an integral part of studies investigating environmental samples with unknown concentrations of organisms. ?? 2010 The Society for Applied Microbiology.

Development of Quantitative Real-Time PCR Assays for Detection and Quantification of Surrogate Biological Warfare Agents in Building Debris and Leachate▿

PubMed Central

Saikaly, Pascal E.; Barlaz, Morton A.; de los Reyes, Francis L.

2007-01-01

Evaluation of the fate and transport of biological warfare (BW) agents in landfills requires the development of specific and sensitive detection assays. The objective of the current study was to develop and validate SYBR green quantitative real-time PCR (Q-PCR) assays for the specific detection and quantification of surrogate BW agents in synthetic building debris (SBD) and leachate. Bacillus atrophaeus (vegetative cells and spores) and Serratia marcescens were used as surrogates for Bacillus anthracis (anthrax) and Yersinia pestis (plague), respectively. The targets for SYBR green Q-PCR assays were the 16S-23S rRNA intergenic transcribed spacer (ITS) region and recA gene for B. atrophaeus and the gyrB, wzm, and recA genes for S. marcescens. All assays showed high specificity when tested against 5 ng of closely related Bacillus and Serratia nontarget DNA from 21 organisms. Several spore lysis methods that include a combination of one or more of freeze-thaw cycles, chemical lysis, hot detergent treatment, bead beat homogenization, and sonication were evaluated. All methods tested showed similar threshold cycle values. The limit of detection of the developed Q-PCR assays was determined using DNA extracted from a pure bacterial culture and DNA extracted from sterile water, leachate, and SBD samples spiked with increasing quantities of surrogates. The limit of detection for B. atrophaeus genomic DNA using the ITS and B. atrophaeus recA Q-PCR assays was 7.5 fg per PCR. The limits of detection of S. marcescens genomic DNA using the gyrB, wzm, and S. marcescens recA Q-PCR assays were 7.5 fg, 75 fg, and 7.5 fg per PCR, respectively. Quantification of B. atrophaeus vegetative cells and spores was linear (R2 > 0.98) over a 7-log-unit dynamic range down to 101 B. atrophaeus cells or spores. Quantification of S. marcescens (R2 > 0.98) was linear over a 6-log-unit dynamic range down to 102 S. marcescens cells. The developed Q-PCR assays are highly specific and sensitive and can be used for monitoring the fate and transport of the BW surrogates B. atrophaeus and S. marcescens in building debris and leachate. PMID:17720820

Virus detection by PCR following vaccination of naive calves with intranasal or injectable multivalent modified-live viral vaccines.

PubMed

Walz, Paul H; Newcomer, Benjamin W; Riddell, Kay P; Scruggs, Daniel W; Cortese, Victor S

2017-09-01

We evaluated duration of PCR-positive results following administration of modified-live viral (MLV) vaccines to beef calves. Twenty beef calves were randomly assigned to either group 1 and vaccinated intranasally with a MLV vaccine containing bovine alphaherpesvirus 1 (BoHV-1), bovine respiratory syncytial virus (BRSV), and bovine parainfluenza virus 3 (BPIV-3), or to group 2 and vaccinated subcutaneously with a MLV vaccine containing bovine viral diarrhea virus 1 and 2 (BVDV-1, -2), BoHV-1, BRSV, and BPIV-3. Deep nasopharyngeal swabs (NPS) and transtracheal washes (TTW) were collected from all calves, and whole blood was collected from group 2 calves and tested by PCR. In group 1, the proportions of calves that tested PCR-positive to BVDV, BoHV-1, BRSV, and BPIV-3 on any sample at any time were 0%, 100%, 100%, and 10%, respectively. In group 1 calves, 100% of calves became PCR-positive for BoHV-1 by day 3 post-vaccination and 100% of calves became PCR-positive for BRSV by day 7 post-vaccination. In group 2, the proportions of calves that tested positive to BVDV, BoHV-1, BRSV, and BPIV-3 on any sample at any time were 50%, 40%, 10%, and 0%, respectively. All threshold cycle (Ct) values were >30 in group 2 calves, irrespective of virus; however, Ct values <25 were observed in group 1 calves from PCR-positive results for BoHV-1 and BRSV. All calves were PCR-negative for all viruses after day 28. Following intranasal MLV viral vaccination, PCR results and Ct values for BRSV and BoHV-1 suggest that attempts to differentiate vaccine virus from natural infection is unreliable.

Development of defined microbial population standards using fluorescence activated cell sorting for the absolute quantification of S. aureus using real-time PCR.

PubMed

Martinon, Alice; Cronin, Ultan P; Wilkinson, Martin G

2012-01-01

In this article, four types of standards were assessed in a SYBR Green-based real-time PCR procedure for the quantification of Staphylococcus aureus (S. aureus) in DNA samples. The standards were purified S. aureus genomic DNA (type A), circular plasmid DNA containing a thermonuclease (nuc) gene fragment (type B), DNA extracted from defined populations of S. aureus cells generated by Fluorescence Activated Cell Sorting (FACS) technology with (type C) or without purification of DNA by boiling (type D). The optimal efficiency of 2.016 was obtained on Roche LightCycler(®) 4.1. software for type C standards, whereas the lowest efficiency (1.682) corresponded to type D standards. Type C standards appeared to be more suitable for quantitative real-time PCR because of the use of defined populations for construction of standard curves. Overall, Fieller Confidence Interval algorithm may be improved for replicates having a low standard deviation in Cycle Threshold values such as found for type B and C standards. Stabilities of diluted PCR standards stored at -20°C were compared after 0, 7, 14 and 30 days and were lower for type A or C standards compared with type B standards. However, FACS generated standards may be useful for bacterial quantification in real-time PCR assays once optimal storage and temperature conditions are defined.

Development of a SYBR green I based RT-PCR assay for yellow fever virus: application in assessment of YFV infection in Aedes aegypti.

PubMed

Dash, Paban Kumar; Boutonnier, Alain; Prina, Eric; Sharma, Shashi; Reiter, Paul

2012-01-22

Yellow Fever virus (YFV) is an important arboviral pathogen in much of sub-Saharan Africa and the tropical Americas. It is the prototype member of the genus Flavivirus and is transmitted primarily by Aedes (Stegomyia) mosquitoes. The incidence of human infections in endemic areas has risen in recent years. Prompt and dependable identification of YFV is a critical component of response to suspect cases. We developed a one-step SYBR Green I-based real-time quantitative RT-PCR (qRT-PCR) assay targeting the 5'NTR and capsid-gene junction--for rapid detection and quantification of YFV. The detection limit was 1 PFU/mL, 10-fold more sensitive than conventional RT-PCR, and there was no cross-reactivity with closely related flaviviruses or with alphaviruses. Viral load in samples was determined by standard curve plotted from cycle threshold (Ct) values and virus concentration. The efficacy of the assay in mosquitoes was assessed with spiked samples. The utility of the assay for screening of pooled mosquitoes was also confirmed. Replication of a Cameroon isolate of YFV in Ae. aegypti revealed a marked variation in susceptibility among different colonies at different days post infection (pi). The SYBR Green-1 based qRT-PCR assay is a faster, simpler, more sensitive and less expensive procedure for detection and quantification of YFV than other currently used methods.

[Quantitative PCR in the diagnosis of Leishmania].

PubMed

Mortarino, M; Franceschi, A; Mancianti, F; Bazzocchi, C; Genchi, C; Bandi, C

2004-06-01

Polymerase chain reaction (PCR) is a sensitive and rapid method for the diagnosis of canine Leishmania infection and can be performed on a variety of biological samples, including peripheral blood, lymph node, bone marrow and skin. Standard PCR requires electrophoretic analysis of the amplification products and is usually not suitable for quantification of the template DNA (unless competitor-based or other methods are developed), being of reduced usefulness when accurate monitoring of target DNA is required. Quantitative real-time PCR allows the continuous monitoring of the accumulation of PCR products during the amplification reaction. This allows the identification of the cycle of near-logarithmic PCR product generation (threshold cycle) and, by inference, the relative quantification of the template DNA present at the start of the reaction. Since the amplification product are monitored in "real-time" as they form cycle-by-cycle, no post-amplification handling is required. The absolute quantification is performed according either to an internal standard co-amplified with the sample DNA, or to an external standard curve obtained by parallel amplification of serial known concentrations of a reference DNA sequence. From the quantification of the template DNA, an estimation of the relative load of parasites in the different samples can be obtained. The advantages compared to standard and semi-quantitative PCR techniques are reduction of the assay's time and contamination risks, and improved sensitivity. As for standard PCR, the minimal components of the quantitative PCR reaction mixture are the DNA target of the amplification, an oligonucleotide primer pair flanking the target sequence, a suitable DNA polymerase, deoxynucleotides, buffer and salts. Different technologies have been set up for the monitoring of amplification products, generally based on the use of fluorescent probes. For instance, SYBR Green technology is a non-specific detection system based on a fluorescent dsDNA intercalator and it is applicable to all potential targets. TaqMan technology is more specific since performs the direct assessment of the amount of amplified DNA using a fluorescent probe specific for the target sequence flanked by the primer pair. This probe is an oligonucleotide labelled with a reporter dye (fluorescent) and a quencher (which absorbs the fluorescent signal generated by the reporter). The thermic protocol of amplification allows the binding of the fluorescent probe to the target sequence before the binding of the primers and the starting of the polymerization by Taq polymerase. During polymerization, 5'-3' exonuclease activity of Taq polymerase digests the probe and in this way the reporter dye is released from the probe and a fluorescent signal is detected. The intensity of the signal accumulates at the end of each cycle and is related to the amount of the amplification product. In recent years, quantitative PCR methods based either on SYBR Green or TaqMan technology have been set up for the quantification of Leishmania in mouse liver, mouse skin and human peripheral blood, targeting either single-copy chromosomal or multi-copy minicircle sequences with high sensitivity and reproducibility. In particular, real-time PCR seems to be a reliable, rapid and noninvasive method for the diagnosis and follow up of visceral leishmaniasis in humans. At present, the application of real-time PCR for research and clinical diagnosis of Leishmania infection in dogs is still foreseable. As for standard PCR, the high sensitivity of real-time PCR could allow the use of blood sampling that is less invasive and easily performed for monitoring the status of the dogs. The development of a real-time PCR assay for Leishmania infantum infection in dogs could support the standard and optimized serological and PCR methods currenly in use for the diagnosis and follow-up of canine leishmaniasis, and perhaps prediction of recurrences associated with tissue loads of residual pathogens after treatment. At this regard, a TaqMan Real Time PCR method developed for the quantification of Leishmania infantum minicircle DNA in peripheral blood of naturally infected dogs sampled before and at different time points after the beginning of a standard antileishmanial therapy will be illustrated.

Detection of mandarin in orange juice by single-nucleotide polymorphism qPCR assay.

PubMed

Aldeguer, Miriam; López-Andreo, María; Gabaldón, José A; Puyet, Antonio

2014-02-15

A dual-probe real time PCR (qPCR) DNA-based analysis was devised for the identification of mandarin in orange juice. A single nucleotide polymorphism at the trnL-trnF intergenic region of the chloroplast chromosome was confirmed in nine orange (Citrus sinensis) and thirteen commercial varieties of mandarin, including Citrus reticulata and Citrus unshiu species and a mandarin × tangelo hybrid. Two short minor-groove binding fluorescent probes targeting the polymorphic sequence were used in the dual-probe qPCR, which allowed the detection of both species in single-tube reactions. The similarity of PCR efficiencies allowed a simple estimation of the ratio mandarin/orange in the juice samples, which correlated to the measured difference of threshold cycle values for both probes. The limit of detection of the assay was 5% of mandarin in orange juice, both when the juice was freshly prepared (not from concentrate) or reconstituted from concentrate, which would allow the detection of fraudulently added mandarin juice. The possible use of the dual-probe system for quantitative measurements was also tested on fruit juice mixtures. qPCR data obtained from samples containing equal amounts of mandarin and orange juice revealed that the mandarin target copy number was approximately 2.6-fold higher than in orange juice. The use of a matrix-adapted control as calibrator to compensate the resulting C(T) bias allowed accurate quantitative measurements to be obtained. Copyright © 2013 Elsevier Ltd. All rights reserved.

Use of a novel virus inactivation method for a multicenter avian influenza real-time reverse transcriptase-polymerase chain reaction proficiency study.

PubMed

Spackman, Erica; Suarez, David L

2005-01-01

Proficiency assessments are important elements in quality control for diagnostic laboratories. Traditionally, proficiency testing for polymerase chain reaction (PCR)-based assays has involved the use of clinical samples, samples "spiked" with live agents or DNA plasmids. Because of government regulations and biosecurity concerns, distribution of live high-consequence pathogens of livestock and poultry, such as avian influenza, is not possible, and DNA plasmids are not technically suitable for evaluating RNA virus detection. Therefore, a proficiency testing panel using whole avian influenza in a diluent containing a phenolic disinfectant that inactivates the virus while preserving the RNA for at least 8 weeks at -70 C was developed and used in a multicenter proficiency assessment for a type A influenza real-time reverse transcriptase (RT)-PCR test. The test, which was highly standardized, except for variation in the real-time RT-PCR equipment used, was shown to be highly reproducible by proficiency testing in 12 laboratories in the United States, Canada, and Hong Kong. Variation in cycle threshold values among 35 data sets and 490 samples was minimal (CV = 5.19%), and sample identifications were highly accurate (96.7% correct identifications) regardless of real-time PCR instrumentation.

Rapid-viability PCR method for detection of live, virulent Bacillus anthracis in environmental samples.

PubMed

Létant, Sonia E; Murphy, Gloria A; Alfaro, Teneile M; Avila, Julie R; Kane, Staci R; Raber, Ellen; Bunt, Thomas M; Shah, Sanjiv R

2011-09-01

In the event of a biothreat agent release, hundreds of samples would need to be rapidly processed to characterize the extent of contamination and determine the efficacy of remediation activities. Current biological agent identification and viability determination methods are both labor- and time-intensive such that turnaround time for confirmed results is typically several days. In order to alleviate this issue, automated, high-throughput sample processing methods were developed in which real-time PCR analysis is conducted on samples before and after incubation. The method, referred to as rapid-viability (RV)-PCR, uses the change in cycle threshold after incubation to detect the presence of live organisms. In this article, we report a novel RV-PCR method for detection of live, virulent Bacillus anthracis, in which the incubation time was reduced from 14 h to 9 h, bringing the total turnaround time for results below 15 h. The method incorporates a magnetic bead-based DNA extraction and purification step prior to PCR analysis, as well as specific real-time PCR assays for the B. anthracis chromosome and pXO1 and pXO2 plasmids. A single laboratory verification of the optimized method applied to the detection of virulent B. anthracis in environmental samples was conducted and showed a detection level of 10 to 99 CFU/sample with both manual and automated RV-PCR methods in the presence of various challenges. Experiments exploring the relationship between the incubation time and the limit of detection suggest that the method could be further shortened by an additional 2 to 3 h for relatively clean samples.

Clinical application of real-time PCR to screening critically ill and emergency-care surgical patients for methicillin-resistant Staphylococcus aureus: a quantitative analytical study.

PubMed

Herdman, M Trent; Wyncoll, Duncan; Halligan, Eugene; Cliff, Penelope R; French, Gary; Edgeworth, Jonathan D

2009-12-01

The clinical utility of real-time PCR screening assays for methicillin (methicillin)-resistant Staphylococcus aureus (MRSA) colonization is constrained by the predictive values of their results: as MRSA prevalence falls, the assay's positive predictive value (PPV) drops, and a rising proportion of positive PCR assays will not be confirmed by culture. We provide a quantitative analysis of universal PCR screening of critical care and emergency surgical patients using the BD GeneOhm MRSA PCR system, involving 3,294 assays over six months. A total of 248 PCR assays (7.7%) were positive; however, 88 failed to be confirmed by culture, giving a PPV of 65%. Multivariate analysis was performed to compare PCR-positive culture-positive (P+C+) and PCR-positive culture-negative (P+C-) assays. P+C- results were positively associated with a history of methicillin-sensitive Staphylococcus aureus infection or colonization (odds ratio [OR], 3.15; 95% confidence interval [CI], 1.32 to 7.54) and high PCR thresholds of signal intensity, indicative of a low concentration of target DNA (OR, 1.19 per cycle; 95% CI, 1.11 to 1.26). P+C- results were negatively associated with a history of MRSA infection or colonization (OR, 0.19; 95% CI, 0.09 to 0.42) and male sex (OR, 0.40; 95% CI, 0.20 to 0.81). P+C+ patients were significantly more likely to have subsequent positive MRSA culture assays and microbiological evidence of clinical MRSA infection. The risk of subsequent MRSA infection in P+C- patients was not significantly different from that in case-matched PCR-negative controls. We conclude that, given the low PPV and poor correlation between a PCR-positive assay and the clinical outcome, it would be prudent to await culture confirmation before altering infection control measures on the basis of a positive PCR result.

Enhanced low-template DNA analysis conditions and investigation of allele dropout patterns.

PubMed

Hedell, Ronny; Dufva, Charlotte; Ansell, Ricky; Mostad, Petter; Hedman, Johannes

2015-01-01

Forensic DNA analysis applying PCR enables profiling of minute biological samples. Enhanced analysis conditions can be applied to further push the limit of detection, coming with the risk of visualising artefacts and allele imbalances. We have evaluated the consecutive increase of PCR cycles from 30 to 35 to investigate the limitations of low-template (LT) DNA analysis, applying the short tandem repeat (STR) analysis kit PowerPlex ESX 16. Mock crime scene DNA extracts of four different quantities (from around 8-84 pg) were tested. All PCR products were analysed using 5, 10 and 20 capillary electrophoresis (CE) injection seconds. Bayesian models describing allele dropout patterns, allele peak heights and heterozygote balance were developed to assess the overall improvements in EPG quality with altered PCR/CE settings. The models were also used to evaluate the impact of amplicon length, STR marker and fluorescent label on the risk for allele dropout. The allele dropout probability decreased for each PCR cycle increment from 30 to 33 PCR cycles. Irrespective of DNA amount, the dropout probability was not affected by further increasing the number of PCR cycles. For the 42 and 84 pg samples, mainly complete DNA profiles were generated applying 32 PCR cycles. For the 8 and 17 pg samples, the allele dropouts decreased from 100% using 30 cycles to about 75% and 20%, respectively. The results for 33, 34 and 35 PCR cycles indicated that heterozygote balance and stutter ratio were mainly affected by DNA amount, and not directly by PCR cycle number and CE injection settings. We found 32 and 33 PCR cycles with 10 CE injection seconds to be optimal, as 34 and 35 PCR cycles did not improve allele detection and also included CE saturation problems. We find allele dropout probability differences between several STR markers. Markers labelled with the fluorescent dyes CXR-ET (red in electropherogram) and TMR-ET (shown as black) generally have higher dropout risks compared with those labelled with JOE (green) and fluorescein (blue). Overall, the marker D10S1248 has the lowest allele dropout probability and D8S1179 the highest. The marker effect is mainly pronounced for 30-32 PCR cycles. Such effects would not be expected if the amplification efficiencies were identical for all markers. Understanding allele dropout risks and the variability in peak heights and balances is important for correct interpretation of forensic DNA profiles. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Kinetic characterisation of primer mismatches in allele-specific PCR: a quantitative assessment.

PubMed

Waterfall, Christy M; Eisenthal, Robert; Cobb, Benjamin D

2002-12-20

A novel method of estimating the kinetic parameters of Taq DNA polymerase during rapid cycle PCR is presented. A model was constructed using a simplified sigmoid function to represent substrate accumulation during PCR in combination with the general equation describing high substrate inhibition for Michaelis-Menten enzymes. The PCR progress curve was viewed as a series of independent reactions where initial rates were accurately measured for each cycle. Kinetic parameters were obtained for allele-specific PCR (AS-PCR) amplification to examine the effect of mismatches on amplification. A high degree of correlation was obtained providing evidence of substrate inhibition as a major cause of the plateau phase that occurs in the later cycles of PCR.

Life Cycle Evolution and Systematics of Campanulariid Hydrozoans

DTIC Science & Technology

2004-09-01

kit according to manufacturer’s protocol. Purified PCR product was cycle-sequenced using either Big Dye 2 or 3 sequencing chemistry (ABI), following...ethidium bromide and purified with PCR purification kits (Qiagen). Purified products were cycle- sequenced with either Big Dye 2 or 3 sequencing chemistry...PCR purification kit (Qiagen). The purified product was cycle-sequenced using Big Dye 2 sequencing chemistry (ABI) following the manufacturer’s

PCR cycles above routine numbers do not compromise high-throughput DNA barcoding results.

PubMed

Vierna, J; Doña, J; Vizcaíno, A; Serrano, D; Jovani, R

2017-10-01

High-throughput DNA barcoding has become essential in ecology and evolution, but some technical questions still remain. Increasing the number of PCR cycles above the routine 20-30 cycles is a common practice when working with old-type specimens, which provide little amounts of DNA, or when facing annealing issues with the primers. However, increasing the number of cycles can raise the number of artificial mutations due to polymerase errors. In this work, we sequenced 20 COI libraries in the Illumina MiSeq platform. Libraries were prepared with 40, 45, 50, 55, and 60 PCR cycles from four individuals belonging to four species of four genera of cephalopods. We found no relationship between the number of PCR cycles and the number of mutations despite using a nonproofreading polymerase. Moreover, even when using a high number of PCR cycles, the resulting number of mutations was low enough not to be an issue in the context of high-throughput DNA barcoding (but may still remain an issue in DNA metabarcoding due to chimera formation). We conclude that the common practice of increasing the number of PCR cycles should not negatively impact the outcome of a high-throughput DNA barcoding study in terms of the occurrence of point mutations.

Quantitative Real-time Polymerase Chain Reaction for Enteropathogenic Escherichia coli: A Tool for Investigation of Asymptomatic Versus Symptomatic Infections

PubMed Central

Barletta, Francesca; Mercado, Erik; Ruiz, Joaquim; Ecker, Lucie; Lopez, Giovanni; Mispireta, Monica; Gil, Ana I.; Lanata, Claudio F.; Cleary, Thomas G.

2011-01-01

Background. Enteropathogenic Escherichia coli (EPEC) strains are pediatric pathogens commonly isolated from both healthy and sick children with diarrhea in areas of endemicity. The aim of this study was to compare the bacterial load of EPEC isolated from stool samples from children with and without diarrhea to determine whether bacterial load might be a useful tool for further study of this phenomenon. Methods. EPEC was detected by polymerase chain reaction (PCR) of colonies isolated on MacConkey plates from 53 diarrheal and 90 healthy children aged <2 years. DNA was isolated from stool samples by cetyltrimethylammonium bromide extraction. To standardize quantification by quantitative real-time PCR (qRT-PCR), the correlation between fluorescence threshold cycle and copy number of the intimin gene of EPEC E2348/69 was determined. Results. The detection limit of qRT-PCR was 5 bacteria/mg stool. The geometric mean load in diarrhea was 299 bacteria/mg (95% confidence interval [CI], 77–1164 bacteria/mg), compared with 29 bacteria/mg (95% CI, 10–87 bacteria/mg) in control subjects (P = .016). Bacterial load was significantly higher in children with diarrhea than in control subjects among children <12 months of age (178 vs 5 bacteria/mg; P = .006) and among children with EPEC as the sole pathogen (463 vs 24 bacteria/mg; P = .006). Conclusions. EPEC load measured by qRT-PCR is higher in diarrheal than in healthy children. qRT-PCR may be useful to study the relationship between disease and colonization in settings of endemicity. PMID:22028433

Technique for quantitative RT-PCR analysis directly from single muscle fibers.

PubMed

Wacker, Michael J; Tehel, Michelle M; Gallagher, Philip M

2008-07-01

The use of single-cell quantitative RT-PCR has greatly aided the study of gene expression in fields such as muscle physiology. For this study, we hypothesized that single muscle fibers from a biopsy can be placed directly into the reverse transcription buffer and that gene expression data can be obtained without having to first extract the RNA. To test this hypothesis, biopsies were taken from the vastus lateralis of five male subjects. Single muscle fibers were isolated and underwent RNA isolation (technique 1) or placed directly into reverse transcription buffer (technique 2). After cDNA conversion, individual fiber cDNA was pooled and quantitative PCR was performed using primer-probes for beta(2)-microglobulin, glyceraldehyde-3-phosphate dehydrogenase, insulin-like growth factor I receptor, and glucose transporter subtype 4. The no RNA extraction method provided similar quantitative PCR data as that of the RNA extraction method. A third technique was also tested in which we used one-quarter of an individual fiber's cDNA for PCR (not pooled) and the average coefficient of variation between fibers was <8% (cycle threshold value) for all genes studied. The no RNA extraction technique was tested on isolated muscle fibers using a gene known to increase after exercise (pyruvate dehydrogenase kinase 4). We observed a 13.9-fold change in expression after resistance exercise, which is consistent with what has been previously observed. These results demonstrate a successful method for gene expression analysis directly from single muscle fibers.

Ring test evaluation of the detection of influenza A virus in swine oral fluids by real-time reverse-transcription polymerase chain reaction and virus isolation

PubMed Central

Goodell, Christa K.; Zhang, Jianqiang; Strait, Erin; Harmon, Karen; Patnayak, Devi; Otterson, Tracy; Culhane, Marie; Christopher-Hennings, Jane; Clement, Travis; Leslie-Steen, Pamela; Hesse, Richard; Anderson, Joe; Skarbek, Kevin; Vincent, Amy; Kitikoon, Pravina; Swenson, Sabrina; Jenkins-Moore, Melinda; McGill, Jodi; Rauh, Rolf; Nelson, William; O’Connell, Catherine; Shah, Rohan; Wang, Chong; Main, Rodger; Zimmerman, Jeffrey J.

2016-01-01

The probability of detecting influenza A virus (IAV) in oral fluid (OF) specimens was calculated for each of 13 assays based on real-time reverse-transcription polymerase chain reaction (rRT-PCR) and 7 assays based on virus isolation (VI). The OF specimens were inoculated with H1N1 or H3N2 IAV and serially diluted 10-fold (10−1 to 10−8). Eight participating laboratories received 180 randomized OF samples (10 replicates × 8 dilutions × 2 IAV subtypes plus 20 IAV-negative samples) and performed the rRT-PCR and VI procedure(s) of their choice. Analysis of the results with a mixed-effect logistic-regression model identified dilution and assay as variables significant (P < 0.0001) for IAV detection in OF by rRT-PCR or VI. Virus subtype was not significant for IAV detection by either rRT-PCR (P = 0.457) or VI (P = 0.101). For rRT-PCR the cycle threshold (Ct) values increased consistently with dilution but varied widely. Therefore, it was not possible to predict VI success on the basis of Ct values. The success of VI was inversely related to the dilution of the sample; the assay was generally unsuccessful at lower virus concentrations. Successful swine health monitoring and disease surveillance require assays with consistent performance, but significant differences in reproducibility were observed among the assays evaluated. PMID:26733728

Discerning Viable from Nonviable Yersinia pestis pgm- and Bacillus anthracis Sterne using Propidium Monoazide in the Presence of White Powders

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hess, Becky M.; Kaiser, Brooke LD; Sydor, Michael A.

ABSTRACT Aims To develop and optimize an assay to determine viability status of Bacillus anthracis Sterne and Yersinia pestis pgm- strains in the presence of white powders by coupling propidium monoazide (PMA) treatment with real-time PCR (qPCR) analysis. Methods and Results PMA selectively enters nonviable cells and binds DNA, thereby increasing qPCR assay cycle threshold (CT) values compared to untreated samples. Dye concentration, cell number and fitness, incubation time, inactivation methods, and assay buffer were optimized for B. anthracis Sterne and Y. pestis pgm-. Differences in CT values in nonviable cells compared to untreated samples were consistently > 9 formore » both B. anthracis Sterne vegetative cells and Y. pestis pgm- in the presence and absence of three different white powders. Our method eliminates the need for a DNA extraction step prior to detection by qPCR. Conclusions The developed assay enables simultaneous identification and viability assessment for B. anthracis Sterne and Y. pestis pgm- under laboratory conditions, even in the presence of white powders. Eliminating the DNA extraction step that is typically used reduces total assay time and labor requirements for sample analysis. Significance and Impact of the Study The method developed for simultaneous detection and viability assessment for B. anthracis and Y. pestis can be employed in forming decisions about the severity of a biothreat event or the safety of food. Keywords Bacillus anthracis, Yersinia pestis, Propidium Monoazide, qPCR, White Powders, Rapid Viability Detection« less

Development of a SYBR green I based RT-PCR assay for yellow fever virus: application in assessment of YFV infection in Aedes aegypti

PubMed Central

2012-01-01

Background Yellow Fever virus (YFV) is an important arboviral pathogen in much of sub-Saharan Africa and the tropical Americas. It is the prototype member of the genus Flavivirus and is transmitted primarily by Aedes (Stegomyia) mosquitoes. The incidence of human infections in endemic areas has risen in recent years. Prompt and dependable identification of YFV is a critical component of response to suspect cases. Results We developed a one-step SYBR Green I-based real-time quantitative RT-PCR (qRT-PCR) assay targeting the 5'NTR and capsid-gene junction--for rapid detection and quantification of YFV. The detection limit was 1 PFU/mL, 10-fold more sensitive than conventional RT-PCR, and there was no cross-reactivity with closely related flaviviruses or with alphaviruses. Viral load in samples was determined by standard curve plotted from cycle threshold (Ct) values and virus concentration. The efficacy of the assay in mosquitoes was assessed with spiked samples. The utility of the assay for screening of pooled mosquitoes was also confirmed. Replication of a Cameroon isolate of YFV in Ae. aegypti revealed a marked variation in susceptibility among different colonies at different days post infection (pi). Conclusions The SYBR Green-1 based qRT-PCR assay is a faster, simpler, more sensitive and less expensive procedure for detection and quantification of YFV than other currently used methods. PMID:22264275

Clinical sensitivity and specificity of the Check-Points Check-Direct ESBL Screen for BD MAX, a real-time PCR for direct ESBL detection from rectal swabs.

PubMed

Souverein, Dennis; Euser, Sjoerd M; van der Reijden, Wil A; Herpers, Bjorn L; Kluytmans, Jan; Rossen, John W A; Den Boer, Jeroen W

2017-09-01

To determine the diagnostic accuracy of the Check-Direct ESBL Screen for BD MAX (ESBL qPCR) and an ESBL culture method to identify ESBLs directly from rectal swabs. Rectal swabs were obtained from clinical patients by performing cross-sectional (point)prevalence measurements in three regional hospitals. Rectal swabs were analysed by direct culture (ChromID ESBL agar) and with the ESBL qPCR. Suspected ESBL-producing isolates were confirmed with the combination disc method and analysed by WGS. Out of 354 rectal swabs and 351 patients, 21 rectal swabs and 20 patients were positive for ESBL-producing isolates, resulting in a regional ESBL colonization prevalence of 5.7%. One rectal swab was false negative with the ESBL qPCR (blaTEM-12) and not covered by the ESBL qPCR. Eight ESBL qPCR-positive rectal swabs could not be confirmed by culture and were classified as false ESBL qPCR positive. The sensitivity and specificity of the ESBL qPCR were 95.2% (n = 20) and 97.6% (n = 323), respectively. When an optimal cycle threshold cut-off value of 37 was used, the ESBL qPCR displayed a sensitivity and specificity of 95.2% (n = 20) and 98.8% (n = 327), respectively (AUC = 0.975, 95% CI = 0.922-1). This ESBL qPCR offers rapid direct detection of the most prevalent ESBL types (blaCTX-M group and blaSHV group) from rectal swabs. The relatively high false-positive rate renders this test the most suitable as a screening test in high-prevalence regions or in an outbreak setting where a fast result is essential. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Real-time PCR quantification of Vibrio parahaemolyticus in oysters using an alternative matrix.

PubMed

Kaufman, G E; Blackstone, G M; Vickery, M C L; Bej, A K; Bowers, J; Bowen, Michael D; Meyer, Richard F; DePaola, A

2004-11-01

This study examined the relationship between levels of total Vibrio parahaemolyticus found in oyster tissues and mantle fluid with the goal of using mantle fluid as a template matrix in a new quantitative real-time PCR assay targeting the thermolabile hemolysin (tlh) gene for the enumeration of total V. parahaemolyticus in oysters. Oysters were collected near Mobile Bay, Ala., in June, July, and September and tested immediately after collection and storage at 26 degrees C for 24 h. Initial experiments using DNA colony hybridization targeting tlh demonstrated that natural V. parahaemolyticus levels in the mantle fluid of individual oysters were strongly correlated (r = 0.85, P < 0.05) with the levels found in their tissues. When known quantities of cultured V. parahaemolyticus cells were added to real-time PCR reactions that contained mantle fluid and oyster tissue matrices separately pooled from multiple oysters, a strong linear correlation was observed between the real-time PCR cycle threshold and the log concentration of cells inoculated into each PCR reaction (mantle fluid: r = 0.98, P < 0.05; and oyster: r = 0.99, P < 0.05). However, the mantle fluid exhibited less inhibition of the PCR amplification than the homogenized oyster tissue. Analysis of natural V. parahaemolyticus populations in mantle fluids using both colony hybridization and real-time PCR demonstrated a significant (P < 0.05) but reduced correlation (r = -0.48) between the two methods. Reductions in the efficiency of the real-time PCR that resulted from low population densities of V. parahaemolyticus and PCR inhibitors present in the mantle fluid of some oysters (with significant oyster-to-oyster variation) contributed to the reduction in correlation between the methods that was observed when testing natural V. parahaemolyticus populations. The V. parahaemolyticus-specific real-time PCR assay used for this study could estimate elevated V. parahaemolyticus levels in oyster mantle fluid within 1 h from sampling time.

Rapid-Viability PCR Method for Detection of Live, Virulent Bacillus anthracis in Environmental Samples ▿

PubMed Central

Létant, Sonia E.; Murphy, Gloria A.; Alfaro, Teneile M.; Avila, Julie R.; Kane, Staci R.; Raber, Ellen; Bunt, Thomas M.; Shah, Sanjiv R.

2011-01-01

In the event of a biothreat agent release, hundreds of samples would need to be rapidly processed to characterize the extent of contamination and determine the efficacy of remediation activities. Current biological agent identification and viability determination methods are both labor- and time-intensive such that turnaround time for confirmed results is typically several days. In order to alleviate this issue, automated, high-throughput sample processing methods were developed in which real-time PCR analysis is conducted on samples before and after incubation. The method, referred to as rapid-viability (RV)-PCR, uses the change in cycle threshold after incubation to detect the presence of live organisms. In this article, we report a novel RV-PCR method for detection of live, virulent Bacillus anthracis, in which the incubation time was reduced from 14 h to 9 h, bringing the total turnaround time for results below 15 h. The method incorporates a magnetic bead-based DNA extraction and purification step prior to PCR analysis, as well as specific real-time PCR assays for the B. anthracis chromosome and pXO1 and pXO2 plasmids. A single laboratory verification of the optimized method applied to the detection of virulent B. anthracis in environmental samples was conducted and showed a detection level of 10 to 99 CFU/sample with both manual and automated RV-PCR methods in the presence of various challenges. Experiments exploring the relationship between the incubation time and the limit of detection suggest that the method could be further shortened by an additional 2 to 3 h for relatively clean samples. PMID:21764960

A nested polymerase chain reaction for the detection of genomic DNA of Myxobolus cerebralis in rainbow trout Oncorhynchus mykiss.

PubMed

Andree, K B; MacConnell, E; Hedrick, R P

1998-10-08

A nested polymerase chain reaction (PCR) test was developed to amplify a segment of the 18S rRNA gene from Myxobolus cerebralis, the agent causing whirling disease in salmonid fish. The PCR amplifies a 415 bp amplicon that was identified by dideoxynucleotide terminated sequencing to be identical to the known 18S rDNA sequence of M. cerebralis. There was no amplification of genomic DNA from 4 other myxosporean parasites of salmonid fish from the genus Myxobolus including M. arcticus, M. insidiosus, M. neurobius, and M. squamalis. The efficacy of the PCR test to detect early infections was demonstrated by amplification of the 415 bp fragment from experimentally exposed rainbow trout Oncorhynchus mykiss at 2 h and at 1, 2, and 3 wk postexposure to actinosporean stages (triactinomyxons) of M. cerebralis. In contrast, standard microscopic examinations of stained tissue sections of the same fish used for PCR were less reliable in detecting the presence of the parasite. Additional examinations of fish 5 mo postexposure, after sporogenesis had occurred, found the PCR to be a more reliable indicator of infection than pepsin-trypsin digest (PTD) method, particularly when trout were experimentally exposed to low levels of the infectious stages of the parasite. The PCR was able to amplify to detectable levels the equivalent of a single sporoplasm of M. cerebralis as found in a tissue sample. This test improves the detection of M. cerebralis because it can detect the presence of the parasite: (1) in both hosts, (2) in all known stages of its life cycle, and (3) at lower thresholds than currently used diagnostic methods. Lastly, the PCR test is less susceptible to morphological misidentifications of the spores that can occur with current microscopic procedures.

Nitrogen Cycle Evaluation (NiCE) Chip for the Simultaneous Analysis of Multiple N-Cycle Associated Genes.

PubMed

Oshiki, Mamoru; Segawa, Takahiro; Ishii, Satoshi

2018-02-02

Various microorganisms play key roles in the Nitrogen (N) cycle. Quantitative PCR (qPCR) and PCR-amplicon sequencing of the N cycle functional genes allow us to analyze the abundance and diversity of microbes responsible in the N transforming reactions in various environmental samples. However, analysis of multiple target genes can be cumbersome and expensive. PCR-independent analysis, such as metagenomics and metatranscriptomics, is useful but expensive especially when we analyze multiple samples and try to detect N cycle functional genes present at relatively low abundance. Here, we present the application of microfluidic qPCR chip technology to simultaneously quantify and prepare amplicon sequence libraries for multiple N cycle functional genes as well as taxon-specific 16S rRNA gene markers for many samples. This approach, named as N cycle evaluation (NiCE) chip, was evaluated by using DNA from pure and artificially mixed bacterial cultures and by comparing the results with those obtained by conventional qPCR and amplicon sequencing methods. Quantitative results obtained by the NiCE chip were comparable to those obtained by conventional qPCR. In addition, the NiCE chip was successfully applied to examine abundance and diversity of N cycle functional genes in wastewater samples. Although non-specific amplification was detected on the NiCE chip, this could be overcome by optimizing the primer sequences in the future. As the NiCE chip can provide high-throughput format to quantify and prepare sequence libraries for multiple N cycle functional genes, this tool should advance our ability to explore N cycling in various samples. Importance. We report a novel approach, namely Nitrogen Cycle Evaluation (NiCE) chip by using microfluidic qPCR chip technology. By sequencing the amplicons recovered from the NiCE chip, we can assess diversities of the N cycle functional genes. The NiCE chip technology is applicable to analyze the temporal dynamics of the N cycle gene transcriptions in wastewater treatment bioreactors. The NiCE chip can provide high-throughput format to quantify and prepare sequence libraries for multiple N cycle functional genes. While there is a room for future improvement, this tool should significantly advance our ability to explore the N cycle in various environmental samples. Copyright © 2018 American Society for Microbiology.

Evaluation of quantification methods for real-time PCR minor groove binding hybridization probe assays.

PubMed

Durtschi, Jacob D; Stevenson, Jeffery; Hymas, Weston; Voelkerding, Karl V

2007-02-01

Real-time PCR data analysis for quantification has been the subject of many studies aimed at the identification of new and improved quantification methods. Several analysis methods have been proposed as superior alternatives to the common variations of the threshold crossing method. Notably, sigmoidal and exponential curve fit methods have been proposed. However, these studies have primarily analyzed real-time PCR with intercalating dyes such as SYBR Green. Clinical real-time PCR assays, in contrast, often employ fluorescent probes whose real-time amplification fluorescence curves differ from those of intercalating dyes. In the current study, we compared four analysis methods related to recent literature: two versions of the threshold crossing method, a second derivative maximum method, and a sigmoidal curve fit method. These methods were applied to a clinically relevant real-time human herpes virus type 6 (HHV6) PCR assay that used a minor groove binding (MGB) Eclipse hybridization probe as well as an Epstein-Barr virus (EBV) PCR assay that used an MGB Pleiades hybridization probe. We found that the crossing threshold method yielded more precise results when analyzing the HHV6 assay, which was characterized by lower signal/noise and less developed amplification curve plateaus. In contrast, the EBV assay, characterized by greater signal/noise and amplification curves with plateau regions similar to those observed with intercalating dyes, gave results with statistically similar precision by all four analysis methods.

Matrix-normalised quantification of species by threshold-calibrated competitive real-time PCR: allergenic peanut in food as one example.

PubMed

Holzhauser, Thomas; Kleiner, Kornelia; Janise, Annabella; Röder, Martin

2014-11-15

A novel method to quantify species or DNA on the basis of a competitive quantitative real-time polymerase chain reaction (cqPCR) was developed. Potentially allergenic peanut in food served as one example. Based on an internal competitive DNA sequence for normalisation of DNA extraction and amplification, the cqPCR was threshold-calibrated against 100mg/kg incurred peanut in milk chocolate. No external standards were necessary. The competitive molecule successfully served as calibrator for quantification, matrix normalisation, and inhibition control. Although designed for verification of a virtual threshold of 100mg/kg, the method allowed quantification of 10-1,000 mg/kg peanut incurred in various food matrices and without further matrix adaption: On the basis of four PCR replicates per sample, mean recovery of 10-1,000 mg/kg peanut in chocolate, vanilla ice cream, cookie dough, cookie, and muesli was 87% (range: 39-147%) in comparison to 199% (range: 114-237%) by three commercial ELISA kits. Copyright © 2014 Elsevier Ltd. All rights reserved.

Selection of suitable endogenous reference genes for qPCR in kidney and hypothalamus of rats under testosterone influence

PubMed Central

2017-01-01

Real-time quantitative PCR (qPCR) is the most reliable and accurate technique for analyses of gene expression. Endogenous reference genes are being used to normalize qPCR data even though their expression may vary under different conditions and in different tissues. Nonetheless, verification of expression of reference genes in selected studied tissue is essential in order to accurately assess the level of expression of target genes of interest. Therefore, in this study, we attempted to examine six commonly used reference genes in order to identify the gene being expressed most constantly under the influence of testosterone in the kidneys and hypothalamus. The reference genes include glyceraldehyde-3-phosphate dehydrogenase (GAPDH), actin beta (ACTB), beta-2 microglobulin (B2m), hypoxanthine phosphoribosyltransferase 1 (HPRT), peptidylprolylisomerase A (Ppia) and hydroxymethylbilane synthase (Hmbs). The cycle threshold (Ct) value for each gene was determined and data obtained were analyzed using the software programs NormFinder, geNorm, BestKeeper, and rank aggregation. Results showed that Hmbs and Ppia genes were the most stably expressed in the hypothalamus. Meanwhile, in kidneys, Hmbs and GAPDH appeared to be the most constant genes. In conclusion, variations in expression levels of reference genes occur in kidneys and hypothalamus under similar conditions; thus, it is important to verify reference gene levels in these tissues prior to commencing any studies. PMID:28591185

Development and validation of a real-time quantitative PCR assay to detect Xanthomonas axonopodis pv. allii from onion seed.

PubMed

Robène, Isabelle; Perret, Marion; Jouen, Emmanuel; Escalon, Aline; Maillot, Marie-Véronique; Chabirand, Aude; Moreau, Aurélie; Laurent, Annie; Chiroleu, Frédéric; Pruvost, Olivier

2015-07-01

Bacterial blight of onion is an emerging disease threatening world onion production. The causal agent Xanthomonas axonopodis pv. allii is seed transmitted and a reliable and sensitive tool is needed to monitor seed exchanges. A triplex quantitative real-time PCR assay was developed targeting two X. axonopodis pv. allii-specific markers and an internal control chosen in 5.8S rRNA gene from Alliaceae. Amplification of at least one marker indicates the presence of the bacterium in seed extracts. This real-time PCR assay detected all the 79 X. axonopodis pv. allii strains tested and excluded 85.2% of the 135 non-target strains and particularly all 39 saprophytic and pathogenic bacteria associated with onion. Cross-reactions were mainly obtained for strains assigned to nine phylogenetically related X. axonopodis pathovars. The cycle cut-off was estimated statistically at 36.3 considering a risk of false positive of 1%. The limit of detection obtained in at least 95% of the time (LOD 95%) was 5×10(3) CFU/g (colony forming unit/g). The sensitivity threshold was found to be 1 infected seed in 32,790 seeds. This real-time PCR assay should be useful for preventing the long-distance spread of X. axonopodis pv. allii via contaminated seed lots and determining the epidemiology of the bacterium. Copyright © 2015 Elsevier B.V. All rights reserved.

Whole Genome Amplification of Day 3 or Day 5 Human Embryos Biopsies Provides a Suitable DNA Template for PCR-Based Techniques for Genotyping, a Complement of Preimplantation Genetic Testing.

PubMed

Schaeffer, Elizabeth; López-Bayghen, Bruno; Neumann, Adina; Porchia, Leonardo M; Camacho, Rafael; Garrido, Efraín; Gómez, Rocío; Camargo, Felipe; López-Bayghen, Esther

2017-01-01

Our objective was to determine if whole genome amplification (WGA) provides suitable DNA for qPCR-based genotyping for human embryos. Single blastomeres (Day 3) or trophoblastic cells (Day 5) were isolated from 342 embryos for WGA. Comparative Genomic Hybridization determined embryo sex as well as Trisomy 18 or Trisomy 21. To determine the embryo's sex, qPCR melting curve analysis for SRY and DYS14 was used. Logistic regression indicated a 4.4%, 57.1%, or 98.8% probability of a male embryo when neither gene, SRY only, or both genes were detected, respectively (accuracy = 94.1%, kappa = 0.882, and p < 0.001). Fluorescent Capillary Electrophoresis for the amelogenin genes (AMEL) was also used to determine sex. AMELY peak's height was higher and this peak's presence was highly predictive of male embryos (AUC = 0.93, accuracy = 81.7%, kappa = 0.974, and p < 0.001). Trisomy 18 and Trisomy 21 were determined using the threshold cycle difference for RPL17 and TTC3, respectively, which were significantly lower in the corresponding embryos. The Ct difference for TTC3 specifically determined Trisomy 21 (AUC = 0.89) and RPL17 for Trisomy 18 (AUC = 0.94). Here, WGA provides adequate DNA for PCR-based techniques for preimplantation genotyping.

Nested PCR Biases in Interpreting Microbial Community Structure in 16S rRNA Gene Sequence Datasets

PubMed Central

Yu, Guoqin; Fadrosh, Doug; Goedert, James J.; Ravel, Jacques; Goldstein, Alisa M.

2015-01-01

Background Sequencing of the PCR-amplified 16S rRNA gene has become a common approach to microbial community investigations in the fields of human health and environmental sciences. This approach, however, is difficult when the amount of DNA is too low to be amplified by standard PCR. Nested PCR can be employed as it can amplify samples with DNA concentration several-fold lower than standard PCR. However, potential biases with nested PCRs that could affect measurement of community structure have received little attention. Results In this study, we used 17 DNAs extracted from vaginal swabs and 12 DNAs extracted from stool samples to study the influence of nested PCR amplification of the 16S rRNA gene on the estimation of microbial community structure using Illumina MiSeq sequencing. Nested and standard PCR methods were compared on alpha- and beta-diversity metrics and relative abundances of bacterial genera. The effects of number of cycles in the first round of PCR (10 vs. 20) and microbial diversity (relatively low in vagina vs. high in stool) were also investigated. Vaginal swab samples showed no significant difference in alpha diversity or community structure between nested PCR and standard PCR (one round of 40 cycles). Stool samples showed significant differences in alpha diversity (except Shannon’s index) and relative abundance of 13 genera between nested PCR with 20 cycles in the first round and standard PCR (P<0.01), but not between nested PCR with 10 cycles in the first round and standard PCR. Operational taxonomic units (OTUs) that had low relative abundance (sum of relative abundance <0.167) accounted for most of the distortion (>27% of total OTUs in stool). Conclusions Nested PCR introduced bias in estimated diversity and community structure. The bias was more significant for communities with relatively higher diversity and when more cycles were applied in the first round of PCR. We conclude that nested PCR could be used when standard PCR does not work. However, rare taxa detected by nested PCR should be validated by other technologies. PMID:26196512

Nested PCR Biases in Interpreting Microbial Community Structure in 16S rRNA Gene Sequence Datasets.

PubMed

Yu, Guoqin; Fadrosh, Doug; Goedert, James J; Ravel, Jacques; Goldstein, Alisa M

2015-01-01

Sequencing of the PCR-amplified 16S rRNA gene has become a common approach to microbial community investigations in the fields of human health and environmental sciences. This approach, however, is difficult when the amount of DNA is too low to be amplified by standard PCR. Nested PCR can be employed as it can amplify samples with DNA concentration several-fold lower than standard PCR. However, potential biases with nested PCRs that could affect measurement of community structure have received little attention. In this study, we used 17 DNAs extracted from vaginal swabs and 12 DNAs extracted from stool samples to study the influence of nested PCR amplification of the 16S rRNA gene on the estimation of microbial community structure using Illumina MiSeq sequencing. Nested and standard PCR methods were compared on alpha- and beta-diversity metrics and relative abundances of bacterial genera. The effects of number of cycles in the first round of PCR (10 vs. 20) and microbial diversity (relatively low in vagina vs. high in stool) were also investigated. Vaginal swab samples showed no significant difference in alpha diversity or community structure between nested PCR and standard PCR (one round of 40 cycles). Stool samples showed significant differences in alpha diversity (except Shannon's index) and relative abundance of 13 genera between nested PCR with 20 cycles in the first round and standard PCR (P<0.01), but not between nested PCR with 10 cycles in the first round and standard PCR. Operational taxonomic units (OTUs) that had low relative abundance (sum of relative abundance <0.167) accounted for most of the distortion (>27% of total OTUs in stool). Nested PCR introduced bias in estimated diversity and community structure. The bias was more significant for communities with relatively higher diversity and when more cycles were applied in the first round of PCR. We conclude that nested PCR could be used when standard PCR does not work. However, rare taxa detected by nested PCR should be validated by other technologies.

Variation in the Hearing Threshold in Women during the Menstrual Cycle

PubMed Central

Souza, Dayse da Silva; Luckwu, Brunna; Andrade, Wagner Teobaldo Lopes de; Pessoa, Luciane Spinelli de Figueiredo; Nascimento, João Agnaldo do; Rosa, Marine Raquel Diniz da

2017-01-01

Introduction  The hormonal changes that occur during the menstrual cycle and their relationship with hearing problems have been studied. However, they have not been well explained. Objective  The objective of our study is to investigate the variation in hearing thresholds in women during the menstrual cycle. Method  We conducted a cohort and longitudinal study. It was composed of 30 volunteers, aged 18–39 years old, of which 20 were women during the phases of the menstrual cycle and 10 were men (control group) who underwent audiometry and impedance exams, to correlate the possible audiological changes in each phase of the menstrual cycle. Results  There were significant changes in hearing thresholds observed during the menstrual cycle phases in the group of women who used hormonal contraceptives and the group who did not use such contraceptives. Improved hearing thresholds were observed in the late follicular phase in the group who did not use hormonal contraceptives and the hearing thresholds at high frequencies were better. Throughout the menstrual cycle phases, the mean variation was 3.6 db HL between weeks in the group who used hormonal contraceptives and 4.09 db HL in the group who did not use them. Conclusions  The present study found that there may be a relationship between hearing changes and hormonal fluctuations during the menstrual cycle based on changes in the hearing thresholds of women. In addition, this study suggests that estrogen has an otoprotective effect on hearing, since the best hearing thresholds were found when estrogen was at its maximum peak. PMID:29018493

Variation in the Hearing Threshold in Women during the Menstrual Cycle.

PubMed

Souza, Dayse da Silva; Luckwu, Brunna; Andrade, Wagner Teobaldo Lopes de; Pessoa, Luciane Spinelli de Figueiredo; Nascimento, João Agnaldo do; Rosa, Marine Raquel Diniz da

2017-10-01

Introduction  The hormonal changes that occur during the menstrual cycle and their relationship with hearing problems have been studied. However, they have not been well explained. Objective  The objective of our study is to investigate the variation in hearing thresholds in women during the menstrual cycle. Method  We conducted a cohort and longitudinal study. It was composed of 30 volunteers, aged 18-39 years old, of which 20 were women during the phases of the menstrual cycle and 10 were men (control group) who underwent audiometry and impedance exams, to correlate the possible audiological changes in each phase of the menstrual cycle. Results  There were significant changes in hearing thresholds observed during the menstrual cycle phases in the group of women who used hormonal contraceptives and the group who did not use such contraceptives. Improved hearing thresholds were observed in the late follicular phase in the group who did not use hormonal contraceptives and the hearing thresholds at high frequencies were better. Throughout the menstrual cycle phases, the mean variation was 3.6 db HL between weeks in the group who used hormonal contraceptives and 4.09 db HL in the group who did not use them. Conclusions  The present study found that there may be a relationship between hearing changes and hormonal fluctuations during the menstrual cycle based on changes in the hearing thresholds of women. In addition, this study suggests that estrogen has an otoprotective effect on hearing, since the best hearing thresholds were found when estrogen was at its maximum peak.

Selection and evaluation of reference genes for expression studies with quantitative PCR in the model fungus Neurospora crassa under different environmental conditions in continuous culture.

PubMed

Cusick, Kathleen D; Fitzgerald, Lisa A; Pirlo, Russell K; Cockrell, Allison L; Petersen, Emily R; Biffinger, Justin C

2014-01-01

Neurospora crassa has served as a model organism for studying circadian pathways and more recently has gained attention in the biofuel industry due to its enhanced capacity for cellulase production. However, in order to optimize N. crassa for biotechnological applications, metabolic pathways during growth under different environmental conditions must be addressed. Reverse-transcription quantitative PCR (RT-qPCR) is a technique that provides a high-throughput platform from which to measure the expression of a large set of genes over time. The selection of a suitable reference gene is critical for gene expression studies using relative quantification, as this strategy is based on normalization of target gene expression to a reference gene whose expression is stable under the experimental conditions. This study evaluated twelve candidate reference genes for use with N. crassa when grown in continuous culture bioreactors under different light and temperature conditions. Based on combined stability values from NormFinder and Best Keeper software packages, the following are the most appropriate reference genes under conditions of: (1) light/dark cycling: btl, asl, and vma1; (2) all-dark growth: btl, tbp, vma1, and vma2; (3) temperature flux: btl, vma1, act, and asl; (4) all conditions combined: vma1, vma2, tbp, and btl. Since N. crassa exists as different cell types (uni- or multi-nucleated), expression changes in a subset of the candidate genes was further assessed using absolute quantification. A strong negative correlation was found to exist between ratio and threshold cycle (CT) values, demonstrating that CT changes serve as a reliable reflection of transcript, and not gene copy number, fluctuations. The results of this study identified genes that are appropriate for use as reference genes in RT-qPCR studies with N. crassa and demonstrated that even with the presence of different cell types, relative quantification is an acceptable method for measuring gene expression changes during growth in bioreactors.

Harmonization of Bordetella pertussis real-time PCR diagnostics in the United States in 2012.

PubMed

Williams, Margaret M; Taylor, Thomas H; Warshauer, David M; Martin, Monte D; Valley, Ann M; Tondella, M Lucia

2015-01-01

Real-time PCR (rt-PCR) is an important diagnostic tool for the identification of Bordetella pertussis, Bordetella holmesii, and Bordetella parapertussis. Most U.S. public health laboratories (USPHLs) target IS481, present in 218 to 238 copies in the B. pertussis genome and 32 to 65 copies in B. holmesii. The CDC developed a multitarget PCR assay to differentiate B. pertussis, B. holmesii, and B. parapertussis and provided protocols and training to 19 USPHLs. The 2012 performance exercise (PE) assessed the capability of USPHLs to detect these three Bordetella species in clinical samples. Laboratories were recruited by the Wisconsin State Proficiency Testing program through the Association of Public Health Laboratories, in partnership with the CDC. Spring and fall PE panels contained 12 samples each of viable Bordetella and non-Bordetella species in saline. Fifty and 53 USPHLs participated in the spring and fall PEs, respectively, using a variety of nucleic acid extraction methods, PCR platforms, and assays. Ninety-six percent and 94% of laboratories targeted IS481 in spring and fall, respectively, in either singleplex or multiplex assays. In spring and fall, respectively, 72% and 79% of USPHLs differentiated B. pertussis and B. holmesii and 68% and 72% identified B. parapertussis. IS481 cycle threshold (CT) values for B. pertussis samples had coefficients of variation (CV) ranging from 10% to 28%. Of the USPHLs that differentiated B. pertussis and B. holmesii, sensitivity was 96% and specificity was 95% for the combined panels. The 2012 PE demonstrated increased harmonization of rt-PCR Bordetella diagnostic protocols in USPHLs compared to that of the previous survey. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

16S pan-bacterial PCR can accurately identify patients with ventilator-associated pneumonia.

PubMed

Conway Morris, Andrew; Gadsby, Naomi; McKenna, James P; Hellyer, Thomas P; Dark, Paul; Singh, Suveer; Walsh, Timothy S; McAuley, Danny F; Templeton, Kate; Simpson, A John; McMullan, Ronan

2017-11-01

Ventilator-associated pneumonia (VAP) remains a challenge to intensive care units, with secure diagnosis relying on microbiological cultures that take up to 72 hours to provide a result. We sought to derive and validate a novel, real-time 16S rRNA gene PCR for rapid exclusion of VAP. Bronchoalveolar lavage (BAL) was obtained from two independent cohorts of patients with suspected VAP. Patients were recruited in a 2-centre derivation cohort and a 12-centre confirmation cohort. Confirmed VAP was defined as growth of >10 4 colony forming units/ml on semiquantitative culture and compared with a 16S PCR assay. Samples were tested from 67 patients in the derivation cohort, 10 (15%) of whom had confirmed VAP. Using cycles to cross threshold (C t ) values as the result of the 16S PCR test, the area under the receiver operating characteristic (ROC) curve (AUROC) was 0.94 (95% CI 0.86 to 1.0, p<0.0001). Samples from 92 patients were available from the confirmation cohort, 26 (28%) of whom had confirmed VAP. The AUROC for C t in this cohort was 0.89 (95% CI 0.83 to 0.95, p<0.0001). This study has derived and assessed the diagnostic accuracy of a novel application for 16S PCR. This suggests that 16S PCR in BAL could be used as a rapid test in suspected VAP and may allow better stewardship of antibiotics. VAPRAPID trial ref NCT01972425. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

Quantitative Estimation of the Viability of Toxoplasma gondii Oocysts in Soil

PubMed Central

Villena, Isabelle; Dardé, Marie-Laure; Aubert, Dominique; Geers, Régine; Dupuis, Emilie; Marnef, Francine; Poulle, Marie-Lazarine; Gotteland, Cécile; Dumètre, Aurélien

2012-01-01

Toxoplasma gondii oocysts spread in the environment are an important source of toxoplasmosis for humans and animal species. Although the life expectancy of oocysts has been studied through the infectivity of inoculated soil samples, the survival dynamics of oocysts in the environment are poorly documented. The aim of this study was to quantify oocyst viability in soil over time under two rain conditions. Oocysts were placed in 54 sentinel chambers containing soil and 18 sealed water tubes, all settled in two containers filled with soil. Containers were watered to simulate rain levels of arid and wet climates and kept at stable temperature for 21.5 months. At nine sampling dates during this period, we sampled six chambers and two water tubes. Three methods were used to measure oocyst viability: microscopic counting, quantitative PCR (qPCR), and mouse inoculation. In parallel, oocysts were kept refrigerated during the same period to analyze their detectability over time. Microscopic counting, qPCR, and mouse inoculation all showed decreasing values over time and highly significant differences between the decreases under dry and damp conditions. The proportion of oocysts surviving after 100 days was estimated to be 7.4% (95% confidence interval [95% CI] = 5.1, 10.8) under dry conditions and 43.7% (5% CI = 35.6, 53.5) under damp conditions. The detectability of oocysts by qPCR over time decreased by 0.5 cycle threshold per 100 days. Finally, a strong correlation between qPCR results and the dose infecting 50% of mice was found; thus, qPCR results may be used as an estimate of the infectivity of soil samples. PMID:22582074

Studies of plant colonisation by closely related Bacillus amyloliquefaciens biocontrol agents using strain specific quantitative PCR assays.

PubMed

Johansson, Anna H; Bejai, Sarosh; Niazi, Adnan; Manzoor, Shahid; Bongcam-Rudloff, Erik; Meijer, Johan

2014-12-01

Certain strains of Bacillus amyloliquefaciens can colonize plants and improve growth and stress management. In order to study these effects, bacterial growth dynamics on plants and in the rhizosphere are of interest calling for specific analytical tools. For that purpose, quantitative real-time PCR (qPCR) assays were developed in order to differentiate among three closely related B. amyloliquefaciens subsp. plantarum strains (UCMB5033, UCMB5036, UCMB5113) and to determine their levels with high accuracy. Oligonucleotide primers were designed for strain unique gene sequences and used for SYBR green based qPCR analysis. Standard curves covered a wide linear range (10(6)) of DNA amounts with the lowest detection level at 50 fg. Post-reaction melting curve analysis showed only a single product. Accurate threshold cycles were obtained, even in the presence of high excess of related Bacillus strains and total bacterial DNA from soil. Analysis of Bacillus colonisation after seed treatment of two oilseed rape cultivars (Oase and Ritz) grown on agar support showed a time dependent effect but that the bacteria mostly were found on root tissues and little on green tissues. The colonisation on plants grown in soil varied among the Bacillus strains where Oase seemed to house more bacteria than Ritz. Applied as a mixture, all three Bacillus strains co-existed on the roots of plants grown in soil. The qPCR assay in combination with other techniques will be a powerful tool to study plant interactions of these B. amyloliquefaciens biocontrol agents to further understand the requirements for successful interactions and improvement of plant properties.

The quantification of spermatozoa by real-time quantitative PCR, spectrophotometry, and spermatophore cap size.

PubMed

Doyle, Jacqueline M; McCormick, Cory R; DeWoody, J Andrew

2011-01-01

Many animals, such as crustaceans, insects, and salamanders, package their sperm into spermatophores, and the number of spermatozoa contained in a spermatophore is relevant to studies of sexual selection and sperm competition. We used two molecular methods, real-time quantitative polymerase chain reaction (RT-qPCR) and spectrophotometry, to estimate sperm numbers from spermatophores. First, we designed gene-specific primers that produced a single amplicon in four species of ambystomatid salamanders. A standard curve generated from cloned amplicons revealed a strong positive relationship between template DNA quantity and cycle threshold, suggesting that RT-qPCR could be used to quantify sperm in a given sample. We then extracted DNA from multiple Ambystoma maculatum spermatophores, performed RT-qPCR on each sample, and estimated template copy numbers (i.e. sperm number) using the standard curve. Second, we used spectrophotometry to determine the number of sperm per spermatophore by measuring DNA concentration relative to the genome size. We documented a significant positive relationship between the estimates of sperm number based on RT-qPCR and those based on spectrophotometry. When these molecular estimates were compared to spermatophore cap size, which in principle could predict the number of sperm contained in the spermatophore, we also found a significant positive relationship between sperm number and spermatophore cap size. This linear model allows estimates of sperm number strictly from cap size, an approach which could greatly simplify the estimation of sperm number in future studies. These methods may help explain variation in fertilization success where sperm competition is mediated by sperm quantity. © 2010 Blackwell Publishing Ltd.

Quantification and determinants of the amount of respiratory syncytial virus (RSV) shed using real time PCR data from a longitudinal household study.

PubMed

Wathuo, Miriam; Medley, Graham F; Nokes, D James; Munywoki, Patrick K

2016-12-14

Background A better understanding of respiratory syncytial virus (RSV) epidemiology requires realistic estimates of RSV shedding patterns, quantities shed, and identification of the related underlying factors. Methods RSV infection data arise from a cohort study of 47 households with 493 occupants, in coastal Kenya, during the 2009/2010 RSV season. Nasopharyngeal swabs were taken every 3 to 4 days and screened for RSV using a real time polymerase chain reaction (PCR) assay. The amount of virus shed was quantified by calculating the 'area under the curve' using the trapezoidal rule applied to rescaled PCR cycle threshold output. Multivariable linear regression was used to identify correlates of amount of virus shed. Results The median quantity of virus shed per infection episode was 29.4 (95% CI: 15.2, 54.2) log 10 ribonucleic acid (RNA) copies. Young age (<1 year), presence of upper respiratory symptoms, intra-household acquisition of infection, an individual's first infection episode in the RSV season, and having a co-infection of RSV group A and B were associated with increased amount of virus shed. Conclusions The findings provide insight into which groups of individuals have higher potential for transmission, information which may be useful in designing RSV prevention strategies.

Validation of the β-amy1 transcription profiling assay and selection of reference genes suited for a RT-qPCR assay in developing barley caryopsis.

PubMed

Ovesná, Jaroslava; Kučera, Ladislav; Vaculová, Kateřina; Štrymplová, Kamila; Svobodová, Ilona; Milella, Luigi

2012-01-01

Reverse transcription coupled with real-time quantitative PCR (RT-qPCR) is a frequently used method for gene expression profiling. Reference genes (RGs) are commonly employed to normalize gene expression data. A limited information exist on the gene expression and profiling in developing barley caryopsis. Expression stability was assessed by measuring the cycle threshold (Ct) range and applying both the GeNorm (pair-wise comparison of geometric means) and Normfinder (model-based approach) principles for the calculation. Here, we have identified a set of four RGs suitable for studying gene expression in the developing barley caryopsis. These encode the proteins GAPDH, HSP90, HSP70 and ubiquitin. We found a correlation between the frequency of occurrence of a transcript in silico and its suitability as an RG. This set of RGs was tested by comparing the normalized level of β-amylase (β-amy1) transcript with directly measured quantities of the BMY1 gene product in the developing barley caryopsis. This panel of genes could be used for other gene expression studies, as well as to optimize β-amy1 analysis for study of the impact of β-amy1 expression upon barley end-use quality.

Detection of exogenous gene doping of IGF-I by a real-time quantitative PCR assay.

PubMed

Zhang, Jin-Ju; Xu, Jing-Feng; Shen, Yong-Wei; Ma, Shi-Jiao; Zhang, Ting-Ting; Meng, Qing-Lin; Lan, Wen-Jun; Zhang, Chun; Liu, Xiao-Mei

2017-07-01

Gene doping can be easily concealed since its product is similar to endogenous protein, making its effective detection very challenging. In this study, we selected insulin-like growth factor I (IGF-I) exogenous gene for gene doping detection. First, the synthetic IGF-I gene was subcloned to recombinant adeno-associated virus (rAAV) plasmid to produce recombinant rAAV2/IGF-I-GFP vectors. Second, in an animal model, rAAV2/IGF-I-GFP vectors were injected into the thigh muscle tissue of mice, and then muscle and blood specimens were sampled at different time points for total DNA isolation. Finally, real-time quantitative PCR was employed to detect the exogenous gene doping of IGF-I. In view of the characteristics of endogenous IGF-I gene sequences, a TaqMan probe was designed at the junction of exons 2 and 3 of IGF-I gene to distinguish it from the exogenous IGF-I gene. In addition, an internal reference control plasmid and its probe were used in PCR to rule out false-positive results through comparison of their threshold cycle (Ct) values. Thus, an accurate exogenous IGF-I gene detection approach was developed in this study. © 2016 International Union of Biochemistry and Molecular Biology, Inc.

Product differentiation during continuous-flow thermal gradient PCR.

PubMed

Crews, Niel; Wittwer, Carl; Palais, Robert; Gale, Bruce

2008-06-01

A continuous-flow PCR microfluidic device was developed in which the target DNA product can be detected and identified during its amplification. This in situ characterization potentially eliminates the requirement for further post-PCR analysis. Multiple small targets have been amplified from human genomic DNA, having sizes of 108, 122, and 134 bp. With a DNA dye in the PCR mixture, the amplification and unique melting behavior of each sample is observed from a single fluorescent image. The melting behavior of the amplifying DNA, which depends on its molecular composition, occurs spatially in the thermal gradient PCR device, and can be observed with an optical resolution of 0.1 degrees C pixel(-1). Since many PCR cycles are within the field of view of the CCD camera, melting analysis can be performed at any cycle that contains a significant quantity of amplicon, thereby eliminating the cycle-selection challenges typically associated with continuous-flow PCR microfluidics.

Bayesian estimation of test characteristics of real-time PCR, bacteriological culture and California mastitis test for diagnosis of intramammary infections with Staphylococcus aureus in dairy cattle at routine milk recordings.

PubMed

Mahmmod, Yasser S; Toft, Nils; Katholm, Jørgen; Grønbæk, Carsten; Klaas, Ilka C

2013-11-01

Danish farmers can order a real-time PCR mastitis diagnostic test on routinely taken cow-level samples from milk recordings. Validation of its performance in comparison to conventional mastitis diagnostics under field conditions is essential for efficient control of intramammary infections (IMI) with Staphylococcus aureus (S. aureus). Therefore, the objective of this study was to estimate the sensitivity (Se) and specificity (Sp) of real-time PCR, bacterial culture (BC) and California mastitis test (CMT) for the diagnosis of the naturally occurring IMI with S. aureus in routinely collected milk samples using latent class analysis (LCA) to avoid the assumption of a perfect reference test. Using systematic random sampling, a total of 609 lactating dairy cows were selected from 6 dairy herds with bulk tank milk PCR cycle threshold (Ct) value ≤39 for S. aureus. At routine milk recordings, automatically obtained cow-level (composite) milk samples were analyzed by PCR and at the same milking, 2436 quarter milk samples were collected aseptically for BC and CMT. Results showed that 140 cows (23%) were positive for S. aureus IMI by BC while 170 cows (28%) were positive by PCR. Estimates of Se and Sp for PCR were higher than test estimates of BC and CMT. SeCMT was higher than SeBC however, SpBC was higher than SpCMT. SePCR was 91%, while SeBC was 53%, and SeCMT was 61%. SpPCR was 99%, while SpBC was 89%, and SpCMT was 65%. In conclusion, PCR has a higher performance than the conventional diagnostic tests (BC and CMT) suggesting its usefulness as a routine test for accurate diagnosis of S. aureus IMI from dairy cows at routine milk recordings. The use of LCA provided estimates of the test characteristics for two currently diagnostic tests (BC, CMT) and a novel technique (real-time PCR) for diagnosing S. aureus IMI under field conditions at routine milk recordings in Denmark. Copyright © 2013 Elsevier B.V. All rights reserved.

Latent class analysis of real time qPCR and bacteriological culturing for the diagnosis of Streptococcus agalactiae in cow composite milk samples.

PubMed

Holmøy, Ingrid H; Toft, Nils; Jørgensen, Hannah J; Mørk, Tormod; Sølverød, Liv; Nødtvedt, Ane

2018-06-01

Streptococcus agalactiae (S. agalactiae) has re-emerged as a mastitis pathogen among Norwegian dairy cows. The Norwegian cattle health services recommend that infected herds implement measures to eradicate S. agalactiae, this includes a screening of milk samples from all lactating cows. The performance of the qPCR-test currently in use for this purpose has not been evaluated under field conditions. The objective of this study was to estimate the sensitivity and specificity of the real-time qPCR assay in use in Norway (Mastitis 4 qPCR, DNA Diagnostics A/S, Risskov, Denmark) and compare it to conventional bacteriological culturing for detection of S. agalactiae in milk samples. Because none of these tests are considered a perfect reference test, the evaluation was performed using latent class models in a Bayesian analysis. Aseptically collected cow-composite milk samples from 578 cows belonging to 6 herds were cultured and tested by qPCR. While 37 (6.4%) samples were positive for S. agalactiae by bacteriological culture, 66 (11.4%) samples were positive by qPCR. The within-herd prevalence in the six herds, as estimated by the latent class models ranged from 7.7 to 50.8%. At the recommended cut-off (cycle threshold 37), the sensitivity of the qPCR was significantly higher at 95.3 (95% posterior probability interval [PPI] [84.2; 99.6]) than that of bacteriological culture at 58.2 (95% PPI [43.8; 74.4]). However, bacterial culture had a higher specificity of 99.7 (95% PPI [98.5; 100.0]) compared to the qPCR at 98.5 (95% PPI [94.6; 99.9]). The median estimated negative predictive values of qPCR was consistently higher than those of the BC at all estimated prevalences, and the superiority of the qPCR increased with increasing within-herd prevalence. The median positive predictive values of BC was in general higher than the estimates for the qPCR, however, at the highest prevalence the predictive ability of both tests were similar. Copyright © 2018 Elsevier B.V. All rights reserved.

Gene transcription in sea otters (Enhydra lutris); development of a diagnostic tool for sea otter and ecosystem health

USGS Publications Warehouse

Bowen, Lizabeth; Miles, A. Keith; Murray, Michael; Haulena, Martin; Tuttle, Judy; van Bonn, William; Adams, Lance; Bodkin, James L.; Ballachey, Brenda E.; Estes, James A.; Tinker, M. Tim; Keister, Robin; Stott, Jeffrey L.

2012-01-01

Gene transcription analysis for diagnosing or monitoring wildlife health requires the ability to distinguish pathophysiological change from natural variation. Herein, we describe methodology for the development of quantitative real-time polymerase chain reaction (qPCR) assays to measure differential transcript levels of multiple immune function genes in the sea otter (Enhydra lutris); sea otter-specific qPCR primer sequences for the genes of interest are defined. We establish a ‘reference’ range of transcripts for each gene in a group of clinically healthy captive and free-ranging sea otters. The 10 genes of interest represent multiple physiological systems that play a role in immuno-modulation, inflammation, cell protection, tumour suppression, cellular stress response, xenobiotic metabolizing enzymes, antioxidant enzymes and cell–cell adhesion. The cycle threshold (CT) measures for most genes were normally distributed; the complement cytolysis inhibitor was the exception. The relative enumeration of multiple gene transcripts in simple peripheral blood samples expands the diagnostic capability currently available to assess the health of sea otters in situ and provides a better understanding of the state of their environment.

Detection of Streptococcus mutans Genomic DNA in Human DNA Samples Extracted from Saliva and Blood

PubMed Central

Vieira, Alexandre R.; Deeley, Kathleen B.; Callahan, Nicholas F.; Noel, Jacqueline B.; Anjomshoaa, Ida; Carricato, Wendy M.; Schulhof, Louise P.; DeSensi, Rebecca S.; Gandhi, Pooja; Resick, Judith M.; Brandon, Carla A.; Rozhon, Christopher; Patir, Asli; Yildirim, Mine; Poletta, Fernando A.; Mereb, Juan C.; Letra, Ariadne; Menezes, Renato; Wendell, Steven; Lopez-Camelo, Jorge S.; Castilla, Eduardo E.; Orioli, Iêda M.; Seymen, Figen; Weyant, Robert J.; Crout, Richard; McNeil, Daniel W.; Modesto, Adriana; Marazita, Mary L.

2011-01-01

Caries is a multifactorial disease, and studies aiming to unravel the factors modulating its etiology must consider all known predisposing factors. One major factor is bacterial colonization, and Streptococcus mutans is the main microorganism associated with the initiation of the disease. In our studies, we have access to DNA samples extracted from human saliva and blood. In this report, we tested a real-time PCR assay developed to detect copies of genomic DNA from Streptococcus mutans in 1,424 DNA samples from humans. Our results suggest that we can determine the presence of genomic DNA copies of Streptococcus mutans in both DNA samples from caries-free and caries-affected individuals. However, we were not able to detect the presence of genomic DNA copies of Streptococcus mutans in any DNA samples extracted from peripheral blood, which suggests the assay may not be sensitive enough for this goal. Values of the threshold cycle of the real-time PCR reaction correlate with higher levels of caries experience in children, but this correlation could not be detected for adults. PMID:21731912

A new QRT-PCR assay designed for the differentiation between elements provided from Agrobacterium sp. in GMOs plant events and natural Agrobacterium sp. bacteria.

PubMed

Nabi, Nesrine; Chaouachi, Maher; Zellama, Mohamed Salem; Ben Hafsa, Ahmed; Mrabet, Besma; Saïd, Khaled; Fathia, Harzallah Skhiri

2016-04-01

The question asked in the present work was how to differentiate between contamination of field samples with and GM plants contained sequences provided from this bacterium in order to avoid false positives in the frame of the detection and the quantification of GMO. For this, new set of primers and corresponding TaqMan Minor Groove Binder (MGB) probes were designed to target Agrobacterium sp. using the tumor-morphology-shooty gene (TMS1). Final standard curves were calculated for each pathogen by plotting the threshold cycle value against the bacterial number (log (colony forming units) per milliliter) via linear regression. The method designed was highly specific and sensitive, with a detection limit of 10CFU/ml. No significant cross-reaction was observed. Results from this study showed that TaqMan real-time PCR, is potentially an effective method for the rapid and reliable quantification of Agrobacterium sp. in samples containing GMO or non GMO samples. Copyright © 2015 Elsevier Ltd. All rights reserved.

Enhanced analysis of real-time PCR data by using a variable efficiency model: FPK-PCR

PubMed Central

Lievens, Antoon; Van Aelst, S.; Van den Bulcke, M.; Goetghebeur, E.

2012-01-01

Current methodology in real-time Polymerase chain reaction (PCR) analysis performs well provided PCR efficiency remains constant over reactions. Yet, small changes in efficiency can lead to large quantification errors. Particularly in biological samples, the possible presence of inhibitors forms a challenge. We present a new approach to single reaction efficiency calculation, called Full Process Kinetics-PCR (FPK-PCR). It combines a kinetically more realistic model with flexible adaptation to the full range of data. By reconstructing the entire chain of cycle efficiencies, rather than restricting the focus on a ‘window of application’, one extracts additional information and loses a level of arbitrariness. The maximal efficiency estimates returned by the model are comparable in accuracy and precision to both the golden standard of serial dilution and other single reaction efficiency methods. The cycle-to-cycle changes in efficiency, as described by the FPK-PCR procedure, stay considerably closer to the data than those from other S-shaped models. The assessment of individual cycle efficiencies returns more information than other single efficiency methods. It allows in-depth interpretation of real-time PCR data and reconstruction of the fluorescence data, providing quality control. Finally, by implementing a global efficiency model, reproducibility is improved as the selection of a window of application is avoided. PMID:22102586

Exposure to arsenic at levels found inU.S. drinking water modifies expression in the mouse lung.

PubMed

Andrew, Angeline S; Bernardo, Viviane; Warnke, Linda A; Davey, Jennifer C; Hampton, Thomas; Mason, Rebecca A; Thorpe, Jessica E; Ihnat, Michael A; Hamilton, Joshua W

2007-11-01

The mechanisms of action of drinking water arsenic in the lung and the threshold for biologic effects remain controversial. Our study utilizes Affymetrix 22,690 transcript oligonucleotide microarrays to assess the long-term effects of increasing doses of drinking water arsenic on expression levels in the mouse lung. Mice were exposed at levels commonly found in contaminated drinking water wells in the United States (0, 0.1, 1 ppb), as well as the 50 ppb former maximum contaminant level, for 5 weeks. The expression profiles revealed modification of a number of important signaling pathways, many with corroborating evidence of arsenic responsiveness. We observed statistically significant expression changes for transcripts involved in angiogenesis, lipid metabolism, oxygen transport, apoptosis, cell cycle, and immune response. Validation by reverse transcription-PCR and immunoblot assays confirmed expression changes for a subset of transcripts. These data identify arsenic-modified signaling pathways that will help guide investigations into mechanisms of arsenic's health effects and clarify the threshold for biologic effects and potential disease risk.

Real-time PCR evaluation of Strongylus vulgaris in horses on farms in Denmark and Central Kentucky.

PubMed

Nielsen, M K; Olsen, S N; Lyons, E T; Monrad, J; Thamsborg, S M

2012-12-21

Strongyle parasites are ubiquitous in grazing horses, and the large strongyle Strongylus vulgaris is considered the most pathogenic helminth parasite of horses. Recent investigations have suggested an association between occurrence of this parasite and usage of selective therapy based on regular fecal egg counts. The established diagnostic method for S. vulgaris involves larval culture and subsequent morphological identification of third stage larvae under the microscope. Recently, a real-time PCR assay was developed and validated for the detection and semi-quantification of S. vulgaris eggs in equine fecal samples. The purposes of the present study were (a) to determine the presence of S. vulgaris by real-time PCR in Danish and American horses on farms using vastly different anthelmintic treatment regimens and (b) to evaluate the association between larval culture results and the PCR. A total of 991 horses representing 53 different horse farms in Denmark and Central Kentucky were studied. Fresh fecal samples were collected from all horses, and strongyle eggs retrieved for DNA extraction and subsequent real-time PCR analysis. Individual larval cultures were performed on the Danish part of the data set (663 horses on 42 farms). On the Danish farms, the S. vulgaris PCR prevalence was found to be 9.2% on farms not basing parasite control on fecal egg counts, and 14.1% on farms using selective therapy. No horses were PCR positive in the American part of the study (328 horses on 11 farms). Kappa-values indicated a moderate agreement between PCR and larval culture results, while McNemar tests revealed no statistical difference between the paired proportions. Significant associations were found between PCR cycle of threshold (Ct) value groups and larval culture counts. Results indicate that both diagnostic methods can be useful for determining the occurrence of S. vulgaris on horse farms, but that they both are affected by potential sources of error. The PCR results confirmed previous findings suggesting that S. vulgaris can reemerge under selective therapy regimens. Copyright © 2012 Elsevier B.V. All rights reserved.

[Influence of PCR cycle number on microbial diversity analysis through next generation sequencing].

PubMed

An, Yunhe; Gao, Lijuan; Li, Junbo; Tian, Yanjie; Wang, Jinlong; Zheng, Xuejuan; Wu, Huijuan

2016-08-25

Using of high throughput sequencing technology to study the microbial diversity in complex samples has become one of the hottest issues in the field of microbial diversity research. In this study, the soil and sheep rumen chyme samples were used to extract DNA, respectively. Then the 25 ng total DNA was used to amplify the 16S rRNA V3 region with 20, 25, 30 PCR cycles, and the final sequencing library was constructed by mixing equal amounts of purified PCR products. Finally, the operational taxonomic unit (OUT) amount, rarefaction curve, microbial number and species were compared through data analysis. It was found that at the same amount of DNA template, the proportion of the community composition was not the best with more numbers of PCR cycle, although the species number was much more. In all, when the PCR cycle number is 25, the number of species and proportion of the community composition were the most optimal both in soil or chyme samples.

Development of a Real-Time PCR Protocol Requiring Minimal Handling for Detection of Vancomycin-Resistant Enterococci with the Fully Automated BD Max System.

PubMed

Dalpke, Alexander H; Hofko, Marjeta; Zimmermann, Stefan

2016-09-01

Vancomycin-resistant enterococci (VRE) are an important cause of health care-associated infections, resulting in significant mortality and a significant economic burden in hospitals. Active surveillance for at-risk populations contributes to the prevention of infections with VRE. The availability of a combination of automation and molecular detection procedures for rapid screening would be beneficial. Here, we report on the development of a laboratory-developed PCR for detection of VRE which runs on the fully automated Becton Dickinson (BD) Max platform, which combines DNA extraction, PCR setup, and real-time PCR amplification. We evaluated two protocols: one using a liquid master mix and the other employing commercially ordered dry-down reagents. The BD Max VRE PCR was evaluated in two rounds with 86 and 61 rectal elution swab (eSwab) samples, and the results were compared to the culture results. The sensitivities of the different PCR formats were 84 to 100% for vanA and 83.7 to 100% for vanB; specificities were 96.8 to 100% for vanA and 81.8 to 97% for vanB The use of dry-down reagents and the ExK DNA-2 kit for extraction showed that the samples were less inhibited (3.3%) than they were by the use of the liquid master mix (14.8%). Adoption of a cutoff threshold cycle of 35 for discrimination of vanB-positive samples allowed an increase of specificity to 87.9%. The performance of the BD Max VRE assay equaled that of the BD GeneOhm VanR assay, which was run in parallel. The use of dry-down reagents simplifies the assay and omits any need to handle liquid PCR reagents. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Comparison of the Idaho Technology FilmArray System to Real-Time PCR for Detection of Respiratory Pathogens in Children

PubMed Central

Pierce, Virginia M.; Elkan, Michael; Leet, Marilyn; McGowan, Karin L.

2012-01-01

The FilmArray Respiratory Panel (RP) multiplexed nucleic acid amplification test (Idaho Technology, Inc., Salt Lake City, UT) was compared to laboratory-developed real-time PCR assays for the detection of various respiratory viruses and certain bacterial pathogens. A total of 215 frozen archived pediatric respiratory specimens previously characterized as either negative or positive for one or more pathogens by real-time PCR were examined using the FilmArray RP system. Overall agreement between the FilmArray RP and corresponding real-time PCR assays for shared analytes was 98.6% (kappa = 0.92 [95% confidence interval (CI), 0.89 to 0.94]). The combined positive percent agreement was 89.4% (95% CI, 85.4 to 92.6); the negative percent agreement was 99.6% (95% CI, 99.2 to 99.8). The mean real-time PCR threshold cycle (CT) value for specimens with discordant results was 36.46 ± 4.54. Detection of coinfections and correct identification of influenza A virus subtypes were comparable to those of real-time PCR when using the FilmArray RP. The greatest comparative difference in sensitivity was observed for adenovirus; only 11 of 24 (45.8%; 95% CI, 27.9 to 64.9) clinical specimens positive for adenovirus by real-time PCR were also positive by the FilmArray RP. In addition, upon testing 20 characterized adenovirus serotypes prepared at high and low viral loads, the FilmArray RP did not detect serotypes 6 and 41 at either level and failed to detect serotypes 2, 20, 35, and 37 when viral loads were low. The FilmArray RP system is rapid and extremely user-friendly, with results available in just over 1 h with almost no labor involved. Its low throughput is a significant drawback for laboratories receiving large numbers of specimens, as only a single sample can be processed at a time with one instrument. PMID:22116144

Real-time PCR detection of Vibrio vulnificus in oysters: comparison of oligonucleotide primers and probes targeting vvhA.

PubMed

Panicker, Gitika; Bej, Asim K

2005-10-01

We compared three sets of oligonucleotide primers and two probes designed for Vibrio vulnificus hemolysin A gene (vvhA) for TaqMan-based real-time PCR method enabling specific detection of Vibrio vulnificus in oysters. Two of three sets of primers with a probe were specific for the detection of all 81 V. vulnificus isolates by TaqMan PCR. The 25 nonvibrio and 12 other vibrio isolates tested were negative. However, the third set of primers, F-vvh1059 and R-vvh1159, with the P-vvh1109 probe, although positive for all V. vulnificus isolates, also exhibited positive cycle threshold (C(T)) values for other Vibrio spp. Optimization of the TaqMan PCR assay using F-vvh785/R-vvh990 or F-vvh731/R-vvh1113 primers and the P-vvh874 probe detected 1 pg of purified DNA and 10(3) V. vulnificus CFU/ml in pure cultures. The enriched oyster tissue homogenate did not exhibit detectable inhibition to the TaqMan PCR amplification of vvhA. Detection of 3 x 10(3) CFU V. vulnificus, resulting from a 5-h enrichment of an initial inoculum of 1 CFU/g of oyster tissue homogenate, was achieved with F-vvh785/R-vvh990 or F-vvh731/R-vvh1113 primers and P-vvh875 probe. The application of the TaqMan PCR using these primers and probe, exhibited detection of V. vulnificus on 5-h-enriched natural oysters harvested from the Gulf of Mexico. Selection of appropriate primers and a probe on vvhA for TaqMan-PCR-based detection of V. vulnificus in post-harvest-treated oysters would help avoid false-positive results, thus ensuring a steady supply of safe oysters to consumers and reducing V. vulnificus-related illnesses and deaths.

Improvement of In Situ PCR by Optimization of PCR Cycle Number and Proteinase K Concentration: Localization of X Chromosome-Linked Phosphoglycerate Kinase-1 Gene in Mouse Reproductive Organs

PubMed Central

Hishikawa, Yoshitaka; An, Shucai; Yamamoto-Fukuda, Tomomi; Shibata, Yasuaki; Koji, Takehiko

2009-01-01

In situ polymerase chain reaction (in situ PCR), which can detect a few copies of genes within a cell by amplifying the target gene, was developed to better understand the biological functions of tissues. In this study, we optimized the protocol conditions for the detection of X chromosome-linked phosphoglycerate kinase-1 (pgk-1) gene in paraffin-embedded sections of mouse reproductive organs. The effects of various concentrations of proteinase K (PK) and PCR cycle numbers were examined. To label the amplified DNA, we used digoxigenin-dUTP (Dig), Cy-3-dUTP (Cy-3), or FluorX-dCTP (FluorX). The optimal concentration of PK was 50 µg/ml for the ovary and 10 µg/ml for the testis. Ten PCR cycles were optimal for Dig and 25 cycles were optimal for FluorX and Cy-3 in the ovary and testis. The signal-to-noise ratio of FluorX and Cy-3 for ovarian tissue was better than that of Dig. Using the above conditions, we detected 1–4 and 1–2 spots of pgk-1 in the nuclei of granulosa and germ cells, respectively. Our results indicate that in situ PCR is useful for detecting a specific gene in paraffin-embedded sections under optimized conditions of both PCR cycle number and PK concentration. PMID:19492023

Compartmentalized self-replication under fast PCR cycling conditions yields Taq DNA polymerase mutants with increased DNA-binding affinity and blood resistance.

PubMed

Arezi, Bahram; McKinney, Nancy; Hansen, Connie; Cayouette, Michelle; Fox, Jeffrey; Chen, Keith; Lapira, Jennifer; Hamilton, Sarah; Hogrefe, Holly

2014-01-01

Faster-cycling PCR formulations, protocols, and instruments have been developed to address the need for increased throughput and shorter turn-around times for PCR-based assays. Although run times can be cut by up to 50%, shorter cycle times have been correlated with lower detection sensitivity and increased variability. To address these concerns, we applied Compartmentalized Self Replication (CSR) to evolve faster-cycling mutants of Taq DNA polymerase. After five rounds of selection using progressively shorter PCR extension times, individual mutations identified in the fastest-cycling clones were randomly combined using ligation-based multi-site mutagenesis. The best-performing combinatorial mutants exhibit 35- to 90-fold higher affinity (lower Kd ) for primed template and a moderate (2-fold) increase in extension rate compared to wild-type Taq. Further characterization revealed that CSR-selected mutations provide increased resistance to inhibitors, and most notably, enable direct amplification from up to 65% whole blood. We discuss the contribution of individual mutations to fast-cycling and blood-resistant phenotypes.

Increased sensitivity of RT-PCR for Potato virus Y detection using RNA isolated by a procedure with differential centrifugation.

PubMed

Zhang, Jianhua; Nie, Xianzhou; Boquel, Sébastien; Al-Daoud, Fadi; Pelletier, Yvan

2015-12-01

The sensitivity of reverse transcription-polymerase chain reaction (RT-PCR) for virus detection is influenced by many factors such as specificity of primers and quality of templates. These factors become extremely important for successful detection when virus concentration is low. Total RNA isolated from Potato virus Y (PVY)-infected potato plants using the sodium sulfite RNA isolation method or RNeasy plant mini kit contains a high proportion of host RNA and may also contain trace amount of phenolic and polysaccharide residues, which may inhibit RT-PCR. The goal of this study was to enhance the sensitivity of PVY detection by reducing host RNA in the extract by differential centrifugation followed by extraction using an RNeasy mini kit (DCR method). One-step RT-PCR had relatively low amplification efficiency for PVY RNA when a high proportion of plant RNA was present. SYBR Green-based real time RT-PCR showed that the RNA isolated by the DCR method had a higher cycle threshold value (Ct) for the elongation factor 1-α mRNA (Ef1α) of potato than the Ct value of the RNA extracted using the RNeasy plant mini kit, indicating that the DCR method significantly reduced the proportion of potato RNA in the extract. The detectable amount of RNA extracted using the DCR method was <0.001ng when plant sap from 10 PVY-infected and PVY-free potato leaflets in a 1.5:100 fresh weight ratio was extracted, compared with 0.01 and 0.02ng of RNA using the RNeasy plant mini kit and sodium sulfite RNA isolation methods, respectively. Copyright © 2015. Published by Elsevier B.V.

Tools to minimize interlaboratory variability in vitellogenin gene expression monitoring programs

USGS Publications Warehouse

Jastrow, Aaron; Gordon, Denise A.; Auger, Kasie M.; Punska, Elizabeth C.; Arcaro, Kathleen F.; Keteles, Kristen; Winkelman, Dana L.; Lattier, David; Biales, Adam; Lazorchak, James M.

2017-01-01

The egg yolk precursor protein vitellogenin is widely used as a biomarker of estrogen exposure in male fish. However, standardized methodology is lacking and little is known regarding the reproducibility of results among laboratories using different equipment, reagents, protocols, and data analysis programs. To address this data gap we tested the reproducibility across laboratories to evaluate vitellogenin gene (vtg) expression and assessed the value of using a freely available software data analysis program. Samples collected from studies of male fathead minnows (Pimephales promelas) exposed to 17α-ethinylestradiol (EE2) and minnows exposed to processed wastewater effluent were evaluated for vtg expression in 4 laboratories. Our results indicate reasonable consistency among laboratories if the free software for expression analysis LinRegPCR is used, with 3 of 4 laboratories detecting vtg in fish exposed to 5 ng/L EE2 (n = 5). All 4 laboratories detected significantly increased vtg levels in 15 male fish exposed to wastewater effluent compared with 15 male fish held in a control stream. Finally, we were able to determine that the source of high interlaboratory variability from complementary deoxyribonucleic acid (cDNA) to quantitative polymerase chain reaction (qPCR) analyses was the expression analysis software unique to each real-time qPCR machine. We successfully eliminated the interlaboratory variability by reanalyzing raw fluorescence data with independent freeware, which yielded cycle thresholds and polymerase chain reaction (PCR) efficiencies that calculated results independently of proprietary software. Our results suggest that laboratories engaged in monitoring programs should validate their PCR protocols and analyze their gene expression data following the guidelines established in the present study for all gene expression biomarkers. 

Evaluation of the performance of C. DIFF QUIK CHEK COMPLETE and its usefulness in a hospital setting with a high prevalence of Clostridium difficile infection.

PubMed

Chung, Hae-Sun; Lee, Miae

2017-01-01

Rapid and accurate diagnosis of Clostridium difficile infection (CDI) is crucial for patient care, infection control, and efficient surveillance. We evaluated C. DIFF QUIK CHEK COMPLETE (QCC; TechLab), which detects glutamate dehydrogenase (GDH) antigen (QCC-Ag) and toxin A/B (QCC-Tox) simultaneously, and compared it to the laboratory diagnostics for CDI currently in use in a tertiary hospital setting with a high prevalence of CDI. QCC, RIDASCREEN C. difficile toxin A/B assay (Toxin EIA; R-Biopharm AG), chromID C. difficile agar (bioMérieux) culture (ChromID culture), and Xpert C. difficile PCR assay (Xpert PCR; Cepheid) were performed according to the manufacturers' instructions. Performances of the assays were compared against that of Xpert PCR as a reference. Of the 231 loose stool specimens, 83 (35.9%) were positive by Xpert PCR. The sensitivity, specificity, and positive and negative predictive values were 97.6%, 93.9%, 90.0%, and 98.6%, respectively, for QCC-Ag and 55.4%, 100%, 100%, and 80.0%, respectively, for QCC-Tox. The median threshold cycle values of the QCC-Tox(+) specimens were lower than those of the QCC-Tox(-) specimens. Results of QCC as an initial screening test were confirmed in 81.0% (187/231) of samples; these specimens did not require further testing. QCC is a rapid, easy, and cost-effective method that would be a useful first-line screening assay for laboratory diagnosis of CDI in a tertiary hospital with a high prevalence of CDI. A two-step algorithm using QCC as an initial screening tool, followed by Xpert PCR as a confirmatory test, is a practical and cost-effective approach. Copyright © 2016 American Federation for Medical Research.

Fusobacterium nucleatum in gastroenterological cancer: Evaluation of measurement methods using quantitative polymerase chain reaction and a literature review.

PubMed

Yamamura, Kensuke; Baba, Yoshifumi; Miyake, Keisuke; Nakamura, Kenichi; Shigaki, Hironobu; Mima, Kosuke; Kurashige, Junji; Ishimoto, Takatsugu; Iwatsuki, Masaaki; Sakamoto, Yasuo; Yamashita, Yoichi; Yoshida, Naoya; Watanabe, Masayuki; Baba, Hideo

2017-12-01

The human microbiome Fusobacterium nucleatum , which primarily inhabits the oral cavity, causes periodontal disease and has also been implicated in the development of colorectal cancer. However, whether F. nucleatum is present in other gastroenterological cancer tissues remains to be elucidated. The present study evaluated whether quantitative polymerase chain reaction (qPCR) assays were able to detect F. nucleatum DNA and measure the quantity of F. nucleatum DNA in esophageal, gastric, pancreatic and liver cancer tissues. The accuracy of the qPCR assay was determined from a calibration curve using DNA extracted from cells from the oral cavity. Formalin-fixed paraffin-embedded (FFPE) tumor tissues from 20 patients with gastroenterological [esophageal (squamous cell carcinoma), gastric, colorectal, pancreatic and liver] cancer and 20 matched normal tissues were evaluated for F. nucleatum DNA content. The cycle threshold values in the qPCR assay for F. nucleatum and solute carrier organic anion transporter family member 2A1 (reference sample) decreased linearly with the quantity of input DNA ( r 2 >0.99). The F. nucleatum detection rate in esophageal, gastric and colorectal cancer tissues were 20% (4/20), 10% (2/20) and 45% (9/20), respectively. F. nucleatum was not detected in liver and pancreatic cancer tissues. The qPCR results from the frozen and FFPE tissues were consistent. Notably, F. nucleatum was detected at a higher level in superficial areas compared with the invasive areas. F. nucleatum in esophageal, gastric and colorectal cancer tissues was evaluated by qPCR using FFPE tissues. F. nucleatum may be involved in the development of esophageal, gastric and colorectal cancer.

Comparison of one commercial and two in-house TaqMan multiplex real-time PCR assays for detection of enteropathogenic, enterotoxigenic and enteroaggregative Escherichia coli.

PubMed

Hahn, Andreas; Luetgehetmann, Marc; Landt, Olfert; Schwarz, Norbert Georg; Frickmann, Hagen

2017-11-01

Enteropathogenic, enterotoxigenic and enteroaggregative Escherichia coli (EPEC, ETEC, EAEC) are among the most frequent causes of diarrhoea during travel or on military deployments. Cost-efficient and reliable real-time multiplex PCR (mPCR) assays are desirable for surveillance or point prevalence studies in remote and resource-limited tropical settings. We compared one commercial PCR kit and two in-house assays without using a gold standard to estimate sensitivity and specificity of each assay. Residual materials from nucleic acid extractions of stool samples from two groups with presumably different prevalences and increased likelihood of being infected or colonised by diarrhoeagenic E. coli were included in the assessment. One group comprised samples from returnees from tropical deployments, the second group was of migrants and study participants from high-endemicity settings. Each sample was assessed with all of the PCR assays. Cycle threshold (Ct) values were descriptively compared. The calculated sensitivities for the commercial test vs. the in-house tests were for EPEC 0.84 vs. 0.89 and 0.96, for ETEC 0.83 vs. 0.76 and 0.61, and for EAEC 0.69 vs. 0.54 and 0.69. False positive results were rare - specificity was 0.94 and 0.97 for two EPEC tests and 1.0 for all other tests. Most positive samples had late Ct values corresponding to low quantities of pathogens. Discordant test results were associated with late Ct values. As commercial and in-house assays showed comparable results, in-house tests can be assumed to be safe while affording considerable savings, making them a valuable alternative for surveillance testing in resource-limited tropical areas. © 2017 John Wiley & Sons Ltd.

Mathematical Model of Naive T Cell Division and Survival IL-7 Thresholds.

PubMed

Reynolds, Joseph; Coles, Mark; Lythe, Grant; Molina-París, Carmen

2013-01-01

We develop a mathematical model of the peripheral naive T cell population to study the change in human naive T cell numbers from birth to adulthood, incorporating thymic output and the availability of interleukin-7 (IL-7). The model is formulated as three ordinary differential equations: two describe T cell numbers, in a resting state and progressing through the cell cycle. The third is introduced to describe changes in IL-7 availability. Thymic output is a decreasing function of time, representative of the thymic atrophy observed in aging humans. Each T cell is assumed to possess two interleukin-7 receptor (IL-7R) signaling thresholds: a survival threshold and a second, higher, proliferation threshold. If the IL-7R signaling strength is below its survival threshold, a cell may undergo apoptosis. When the signaling strength is above the survival threshold, but below the proliferation threshold, the cell survives but does not divide. Signaling strength above the proliferation threshold enables entry into cell cycle. Assuming that individual cell thresholds are log-normally distributed, we derive population-average rates for apoptosis and entry into cell cycle. We have analyzed the adiabatic change in homeostasis as thymic output decreases. With a parameter set representative of a healthy individual, the model predicts a unique equilibrium number of T cells. In a parameter range representative of persistent viral or bacterial infection, where naive T cell cycle progression is impaired, a decrease in thymic output may result in the collapse of the naive T cell repertoire.

Assessment of free fetal DNA concentration in maternal plasma during the first trimester of pregnancy: comparative study between EDTA and PPT tubes - pilot study.

PubMed

Chadud, Carolina Schneider; Araujo Júnior, Edward; Martinhago, Ciro Dresh; Andari, Viviane Cristina Mello; Tedesco, Giselle Darahem; Bussamra, Luiz Claudio Silva; Aoki, Tsutomu

2015-01-01

To compare ethylenediamine tetraacetic acid (EDTA) tubes and plasma preparation tubes (PPT) for evaluating maternal plasma during the first trimester of pregnancy. A cross-sectional study was conducted on 24 male fetuses in women between 6 and 14 weeks of pregnancy. Blood samples (10 mL) were collected and stored in EDTA and PPT tubes. Subsequently, the samples were centrifuged and sent for free fetal DNA extraction by means of the polymerase chain reaction (PCR) technique. The reactions were performed in a real time PCR machine for detecting the amplification products. The genome region chosen for performing the PCR reactions was a target specific for the Y chromosome, in which the DYS-14 marker was amplified only when the DNA was of male sex. The free fetal DNA concentration was given by the threshold cycle (TC). To compare the tubes, the paired Student t-test was used. The mean gestational age was 11.08 ± 2.30 weeks (range: 6-14). The mean TC for PPT was 30.08 ± 1.05 (range: 27.08-32.61) and for EDTA, 30.23 ± 0.96 (range: 28.01-32.09), but without statistical significance (p=0.357). We did not observe any statistically significant difference in free fetal DNA concentration between the EDTA and PPT tubes.

Quantitative analysis of SMN1 gene and estimation of SMN1 deletion carrier frequency in Korean population based on real-time PCR.

PubMed

Lee, Tae-Mi; Kim, Sang-Wun; Lee, Kwang-Soo; Jin, Hyun-Seok; Koo, Soo Kyung; Jo, Inho; Kang, Seongman; Jung, Sung-Chul

2004-12-01

Spinal muscular atrophy (SMA) is an autosomal recessive disorder, caused by homozygous absence of the survival motor neuron gene (SMN1) in approximately 94% of patients. Since most carriers have only one SMN1 gene copy, several SMN1 quantitative analyses have been used for the SMA carrier detection. We developed a reliable quantitative real-time PCR with SYBR Green I dye and studied 13 patients with SMA and their 24 parents, as well as 326 healthy normal individuals. The copy number of the SMN1 gene was determined by the comparative threshold cycle (Ct) method and albumin was used as a reference gene. The homozygous SMN1 deletion ratio of patients was 0.00 and the hemizygous SMN1 deletion ratio of parents ranged from 0.39 to 0.59. The deltadelta Ct ratios of 7 persons among 326 normal individuals were within the carrier range, 0.41-0.57. According to these data, we estimated the carrier and disease prevalence of SMA at 1/47 and 1/8,496 in Korean population, respectively. These data indicated that there would be no much difference in disease prevalence of SMA compared with western countries. Since the prevalence of SMA is higher than other autosomal recessive disorders, the carrier detection method using real-time PCR could be a useful tool for genetic counseling.

Optimization of PCR Condition: The First Study of High Resolution Melting Technique for Screening of APOA1 Variance.

PubMed

Wahyuningsih, Hesty; K Cayami, Ferdy; Bahrudin, Udin; A Sobirin, Mochamad; Ep Mundhofir, Farmaditya; Mh Faradz, Sultana; Hisatome, Ichiro

2017-03-01

High resolution melting (HRM) is a post-PCR technique for variant screening and genotyping based on the different melting points of DNA fragments. The advantages of this technique are that it is fast, simple, and efficient and has a high output, particularly for screening of a large number of samples. APOA1 encodes apolipoprotein A1 (apoA1) which is a major component of high density lipoprotein cholesterol (HDL-C). This study aimed to obtain an optimal quantitative polymerase chain reaction (qPCR)-HRM condition for screening of APOA1 variance. Genomic DNA was isolated from a peripheral blood sample using the salting out method. APOA1 was amplified using the RotorGeneQ 5Plex HRM. The PCR product was visualized with the HRM amplification curve and confirmed using gel electrophoresis. The melting profile was confirmed by looking at the melting curve. Five sets of primers covering the translated region of APOA1 exons were designed with expected PCR product size of 100-400 bps. The amplified segments of DNA were amplicons 2, 3, 4A, 4B, and 4C. Amplicons 2, 3 and 4B were optimized at an annealing temperature of 60 °C at 40 PCR cycles. Amplicon 4A was optimized at an annealing temperature of 62 °C at 45 PCR cycles. Amplicon 4C was optimized at an annealing temperature of 63 °C at 50 PCR cycles. In addition to the suitable procedures of DNA isolation and quantification, primer design and an estimated PCR product size, the data of this study showed that appropriate annealing temperature and PCR cycles were important factors in optimization of HRM technique for variant screening in APOA1 .

Optimization of PCR Condition: The First Study of High Resolution Melting Technique for Screening of APOA1 Variance

PubMed Central

Wahyuningsih, Hesty; K Cayami, Ferdy; Bahrudin, Udin; A Sobirin, Mochamad; EP Mundhofir, Farmaditya; MH Faradz, Sultana; Hisatome, Ichiro

2017-01-01

Background High resolution melting (HRM) is a post-PCR technique for variant screening and genotyping based on the different melting points of DNA fragments. The advantages of this technique are that it is fast, simple, and efficient and has a high output, particularly for screening of a large number of samples. APOA1 encodes apolipoprotein A1 (apoA1) which is a major component of high density lipoprotein cholesterol (HDL-C). This study aimed to obtain an optimal quantitative polymerase chain reaction (qPCR)-HRM condition for screening of APOA1 variance. Methods Genomic DNA was isolated from a peripheral blood sample using the salting out method. APOA1 was amplified using the RotorGeneQ 5Plex HRM. The PCR product was visualized with the HRM amplification curve and confirmed using gel electrophoresis. The melting profile was confirmed by looking at the melting curve. Results Five sets of primers covering the translated region of APOA1 exons were designed with expected PCR product size of 100–400 bps. The amplified segments of DNA were amplicons 2, 3, 4A, 4B, and 4C. Amplicons 2, 3 and 4B were optimized at an annealing temperature of 60 °C at 40 PCR cycles. Amplicon 4A was optimized at an annealing temperature of 62 °C at 45 PCR cycles. Amplicon 4C was optimized at an annealing temperature of 63 °C at 50 PCR cycles. Conclusion In addition to the suitable procedures of DNA isolation and quantification, primer design and an estimated PCR product size, the data of this study showed that appropriate annealing temperature and PCR cycles were important factors in optimization of HRM technique for variant screening in APOA1. PMID:28331418

RT-PCR analysis of RNA extracted from Bouin-fixed and paraffin-embedded lymphoid tissues.

PubMed

Gloghini, Annunziata; Canal, Barbara; Klein, Ulf; Dal Maso, Luigino; Perin, Tiziana; Dalla-Favera, Riccardo; Carbone, Antonino

2004-11-01

In the present study, we have investigated whether RNA can be efficiently isolated from Bouin-fixed or formalin-fixed, paraffin-embedded lymphoid tissue specimens. To this aim, we applied a new and simple method that includes the combination of proteinase K digestion and column purification. By this method, we demonstrated that the amplification of long fragments could be accomplished after a pre-heating step before cDNA synthesis associated with the use of enzymes that work at high temperature. By means of PCR using different primers for two examined genes (glyceraldehyde-3-phosphate dehydrogenase [GAPDH]- and CD40), we amplified segments of cDNA obtained by reverse transcription of the isolated RNA extracted from Bouin-fixed or formalin-fixed paraffin-embedded tissues. Amplified fragments of the expected sizes were obtained for both genes tested indicating that this method is suitable for the isolation of high-quality RNA. To explore the possibility for giving accurate real time quantitative RT-PCR results, cDNA obtained from matched frozen, Bouin-fixed and formalin-fixed neoplastic samples (two diffuse large cell lymphomas, one plasmacytoma) was tested for the following target genes: CD40, Aquaporin-3, BLIMP1, IRF4, Syndecan-1. Delta threshold cycle (DeltaC(T)) values for Bouin-fixed and formalin-fixed paraffin-embedded tissues and their correlation with those for frozen samples showed an extremely high correlation (r > 0.90) for all of the tested genes. These results show that the method of RNA extraction we propose is suitable for giving accurate real time quantitative RT-PCR results.

Real-Time PCR Detection of Paenibacillus spp. in Raw Milk To Predict Shelf Life Performance of Pasteurized Fluid Milk Products

PubMed Central

Ranieri, Matthew L.; Ivy, Reid A.; Mitchell, W. Robert; Call, Emma; Masiello, Stephanie N.; Wiedmann, Martin

2012-01-01

Psychrotolerant sporeformers, specifically Paenibacillus spp., are important spoilage bacteria for pasteurized, refrigerated foods such as fluid milk. While Paenibacillus spp. have been isolated from farm environments, raw milk, processing plant environments, and pasteurized fluid milk, no information on the number of Paenibacillus spp. that need to be present in raw milk to cause pasteurized milk spoilage was available. A real-time PCR assay targeting the 16S rRNA gene was designed to detect Paenibacillus spp. in fluid milk and to discriminate between Paenibacillus and other closely related spore-forming bacteria. Specificity was confirmed using 16 Paenibacillus and 17 Bacillus isolates. All 16 Paenibacillus isolates were detected with a mean cycle threshold (CT) of 19.14 ± 0.54. While 14/17 Bacillus isolates showed no signal (CT > 40), 3 Bacillus isolates showed very weak positive signals (CT = 38.66 ± 0.65). The assay provided a detection limit of approximately 3.25 × 101 CFU/ml using total genomic DNA extracted from raw milk samples inoculated with Paenibacillus. Application of the TaqMan PCR to colony lysates obtained from heat-treated and enriched raw milk provided fast and accurate detection of Paenibacillus. Heat-treated milk samples where Paenibacillus (≥1 CFU/ml) was detected by this colony TaqMan PCR showed high bacterial counts (>4.30 log CFU/ml) after refrigerated storage (6°C) for 21 days. We thus developed a tool for rapid detection of Paenibacillus that has the potential to identify raw milk with microbial spoilage potential as a pasteurized product. PMID:22685148

Muscle metabolic and neuromuscular determinants of fatigue during cycling in different exercise intensity domains

PubMed Central

Black, Matthew I.; Jones, Andrew M.; Blackwell, Jamie R.; Bailey, Stephen J.; Wylie, Lee J.; McDonagh, Sinead T. J.; Thompson, Christopher; Kelly, James; Sumners, Paul; Mileva, Katya N.; Bowtell, Joanna L.

2017-01-01

Lactate or gas exchange threshold (GET) and critical power (CP) are closely associated with human exercise performance. We tested the hypothesis that the limit of tolerance (Tlim) during cycle exercise performed within the exercise intensity domains demarcated by GET and CP is linked to discrete muscle metabolic and neuromuscular responses. Eleven men performed a ramp incremental exercise test, 4–5 severe-intensity (SEV; >CP) constant-work-rate (CWR) tests until Tlim, a heavy-intensity (HVY; GET) CWR test until Tlim, and a moderate-intensity (MOD; 0.05) muscle metabolic milieu (i.e., low pH and [PCr] and high [lactate]) was attained at Tlim (approximately 2–14 min) for all SEV exercise bouts. The muscle metabolic perturbation was greater at Tlim following SEV compared with HVY, and also following SEV and HVY compared with MOD (all P < 0.05). The normalized M-wave amplitude for the vastus lateralis (VL) muscle decreased to a similar extent following SEV (−38 ± 15%), HVY (−68 ± 24%), and MOD (−53 ± 29%), (P > 0.05). Neural drive to the VL increased during SEV (4 ± 4%; P < 0.05) but did not change during HVY or MOD (P > 0.05). During SEV and HVY, but not MOD, the rates of change in M-wave amplitude and neural drive were correlated with changes in muscle metabolic ([PCr], [lactate]) and blood ionic/acid-base status ([lactate], [K+]) (P < 0.05). The results of this study indicate that the metabolic and neuromuscular determinants of fatigue development differ according to the intensity domain in which the exercise is performed. NEW & NOTEWORTHY The gas exchange threshold and the critical power demarcate discrete exercise intensity domains. For the first time, we show that the limit of tolerance during whole-body exercise within these domains is characterized by distinct metabolic and neuromuscular responses. Fatigue development during exercise greater than critical power is associated with the attainment of consistent “limiting” values of muscle metabolites, whereas substrate availability and limitations to muscle activation may constrain performance at lower intensities. PMID:28008101

A robust internal control for high-precision DNA methylation analyses by droplet digital PCR.

PubMed

Pharo, Heidi D; Andresen, Kim; Berg, Kaja C G; Lothe, Ragnhild A; Jeanmougin, Marine; Lind, Guro E

2018-01-01

Droplet digital PCR (ddPCR) allows absolute quantification of nucleic acids and has potential for improved non-invasive detection of DNA methylation. For increased precision of the methylation analysis, we aimed to develop a robust internal control for use in methylation-specific ddPCR. Two control design approaches were tested: (a) targeting a genomic region shared across members of a gene family and (b) combining multiple assays targeting different pericentromeric loci on different chromosomes. Through analyses of 34 colorectal cancer cell lines, the performance of the control assay candidates was optimized and evaluated, both individually and in various combinations, using the QX200™ droplet digital PCR platform (Bio-Rad). The best-performing control was tested in combination with assays targeting methylated CDO1 , SEPT9 , and VIM . A 4Plex panel consisting of EPHA3 , KBTBD4 , PLEKHF1 , and SYT10 was identified as the best-performing control. The use of the 4Plex for normalization reduced the variability in methylation values, corrected for differences in template amount, and diminished the effect of chromosomal aberrations. Positive Droplet Calling (PoDCall), an R-based algorithm for standardized threshold determination, was developed, ensuring consistency of the ddPCR results. Implementation of a robust internal control, i.e., the 4Plex, and an algorithm for automated threshold determination, PoDCall, in methylation-specific ddPCR increase the precision of DNA methylation analysis.

Development and inter-laboratory assessment of droplet digital PCR assays for multiplex quantification of 15 genetically modified soybean lines.

PubMed

Košir, Alexandra Bogožalec; Spilsberg, Bjørn; Holst-Jensen, Arne; Žel, Jana; Dobnik, David

2017-08-17

Quantification of genetically modified organisms (GMOs) in food and feed products is often required for their labelling or for tolerance thresholds. Standard-curve-based simplex quantitative polymerase chain reaction (qPCR) is the prevailing technology, which is often combined with screening analysis. With the rapidly growing number of GMOs on the world market, qPCR analysis becomes laborious and expensive. Innovative cost-effective approaches are therefore urgently needed. Here, we report the development and inter-laboratory assessment of multiplex assays to quantify GMO soybean using droplet digital PCR (ddPCR). The assays were developed to facilitate testing of foods and feed for compliance with current GMO regulations in the European Union (EU). Within the EU, the threshold for labelling is 0.9% for authorised GMOs per ingredient. Furthermore, the EU has set a technical zero tolerance limit of 0.1% for certain unauthorised GMOs. The novel multiplex ddPCR assays developed target 11 GMO soybean lines that are currently authorised, and four that are tolerated, pending authorisation in the EU. Potential significant improvements in cost efficiency are demonstrated. Performance was assessed for the critical parameters, including limits of detection and quantification, and trueness, repeatability, and robustness. Inter-laboratory performance was also determined on a number of proficiency programme and real-life samples.

Detection of Nanophyetus salmincola in water, snails, and fish tissues by quantitative polymerase chain reaction

USGS Publications Warehouse

Purcell, Maureen K.; Powers, Rachel L.; Besijn, Bonnie; Hershberger, Paul K.

2017-01-01

We report the development and validation of two quantitative PCR (qPCR) assays to detect Nanophyetus salmincola DNA in water samples and in fish and snail tissues. Analytical and diagnostic validation demonstrated good sensitivity, specificity, and repeatability of both qPCR assays. The N. salmincola DNA copy number in kidney tissue was significantly correlated with metacercaria counts based on microscopy. Extraction methods were optimized for the sensitive qPCR detection of N. salmincola DNA in settled water samples. Artificially spiked samples suggested that the 1-cercaria/L threshold corresponded to an estimated log10 copies per liter ≥ 6.0. Significant correlation of DNA copy number per liter and microscopic counts indicated that the estimated qPCR copy number was a good predictor of the number of waterborne cercariae. However, the detection of real-world samples below the estimated 1-cercaria/L threshold suggests that the assays may also detect other N. salmincola life stages, nonintact cercariae, or free DNA that settles with the debris. In summary, the qPCR assays reported here are suitable for identifying and quantifying all life stages of N. salmincola that occur in fish tissues, snail tissues, and water.

Validation of a new algorithm for a quick and easy RT-PCR-based ALK test in a large series of lung adenocarcinomas: Comparison with FISH, immunohistochemistry and next generation sequencing assays.

PubMed

Marchetti, Antonio; Pace, Maria Vittoria; Di Lorito, Alessia; Canarecci, Sara; Felicioni, Lara; D'Antuono, Tommaso; Liberatore, Marcella; Filice, Giampaolo; Guetti, Luigi; Mucilli, Felice; Buttitta, Fiamma

2016-09-01

Anaplastic Lymphoma Kinase (ALK) gene rearrangements have been described in 3-5% of lung adenocarcinomas (ADC) and their identification is essential to select patients for treatment with ALK tyrosine kinase inhibitors. For several years, fluorescent in situ hybridization (FISH) has been considered as the only validated diagnostic assay. Currently, alternative methods are commercially available as diagnostic tests. A series of 217 ADC comprising 196 consecutive resected tumors and 21 ALK FISH-positive cases from an independent series of 702 ADC were investigated. All specimens were screened by IHC (ALK-D5F3-CDx-Ventana), FISH (Vysis ALK Break-Apart-Abbott) and RT-PCR (ALK RGQ RT-PCR-Qiagen). Results were compared and discordant cases subjected to Next Generation Sequencing. Thirty-nine of 217 samples were positive by the ALK RGQ RT-PCR assay, using a threshold cycle (Ct) cut-off ≤35.9, as recommended. Of these positive samples, 14 were negative by IHC and 12 by FISH. ALK RGQ RT-PCR/FISH discordant cases were analyzed by the NGS assay with results concordant with FISH data. In order to obtain the maximum level of agreement between FISH and ALK RGQ RT-PCR data, we introduced a new scoring algorithm based on the ΔCt value. A ΔCt cut-off level ≤3.5 was used in a pilot series. Then the algorithm was tested on a completely independent validation series. By using the new scoring algorithm and FISH as reference standard, the sensitivity and the specificity of the ALK RGQ RT-PCR(ΔCt) assay were 100% and 100%, respectively. Our results suggest that the ALK RGQ RT-PCR test could be useful in clinical practice as a complementary assay in multi-test diagnostic algorithms or even, if our data will be confirmed in independent studies, as a standalone or screening test for the selection of patients to be treated with ALK inhibitors. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Clinical Validation of Multiplex Real-Time PCR Assays for Detection of Bacterial Meningitis Pathogens

PubMed Central

Theodore, M. Jordan; Mair, Raydel; Trujillo-Lopez, Elizabeth; du Plessis, Mignon; Wolter, Nicole; Baughman, Andrew L.; Hatcher, Cynthia; Vuong, Jeni; Lott, Lisa; von Gottberg, Anne; Sacchi, Claudio; McDonald, J. Matthew; Messonnier, Nancy E.; Mayer, Leonard W.

2012-01-01

Neisseria meningitidis, Haemophilus influenzae, and Streptococcus pneumoniae are important causes of meningitis and other infections, and rapid, sensitive, and specific laboratory assays are critical for effective public health interventions. Singleplex real-time PCR assays have been developed to detect N. meningitidis ctrA, H. influenzae hpd, and S. pneumoniae lytA and serogroup-specific genes in the cap locus for N. meningitidis serogroups A, B, C, W135, X, and Y. However, the assay sensitivity for serogroups B, W135, and Y is low. We aimed to improve assay sensitivity and develop multiplex assays to reduce time and cost. New singleplex real-time PCR assays for serogroup B synD, W135 synG, and Y synF showed 100% specificity for detecting N. meningitidis species, with high sensitivity (serogroup B synD, 99% [75/76]; W135 synG, 97% [38/39]; and Y synF, 100% [66/66]). The lower limits of detection (LLD) were 9, 43, and 10 copies/reaction for serogroup B synD, W135 synG, and Y synF assays, respectively, a significant improvement compared to results for the previous singleplex assays. We developed three multiplex real-time PCR assays for detection of (i) N. meningitidis ctrA, H. influenzae hpd, and S. pneumoniae lytA (NHS assay); (ii) N. meningitidis serogroups A, W135, and X (AWX assay); and (iii) N. meningitidis serogroups B, C, and Y (BCY assay). Each multiplex assay was 100% specific for detecting its target organisms or serogroups, and the LLD was similar to that for the singleplex assay. Pairwise comparison of real-time PCR between multiplex and singleplex assays showed that cycle threshold values of the multiplex assay were similar to those for the singleplex assay. There were no substantial differences in sensitivity and specificity between these multiplex and singleplex real-time PCR assays. PMID:22170919

Clinical validation of multiplex real-time PCR assays for detection of bacterial meningitis pathogens.

PubMed

Wang, Xin; Theodore, M Jordan; Mair, Raydel; Trujillo-Lopez, Elizabeth; du Plessis, Mignon; Wolter, Nicole; Baughman, Andrew L; Hatcher, Cynthia; Vuong, Jeni; Lott, Lisa; von Gottberg, Anne; Sacchi, Claudio; McDonald, J Matthew; Messonnier, Nancy E; Mayer, Leonard W

2012-03-01

Neisseria meningitidis, Haemophilus influenzae, and Streptococcus pneumoniae are important causes of meningitis and other infections, and rapid, sensitive, and specific laboratory assays are critical for effective public health interventions. Singleplex real-time PCR assays have been developed to detect N. meningitidis ctrA, H. influenzae hpd, and S. pneumoniae lytA and serogroup-specific genes in the cap locus for N. meningitidis serogroups A, B, C, W135, X, and Y. However, the assay sensitivity for serogroups B, W135, and Y is low. We aimed to improve assay sensitivity and develop multiplex assays to reduce time and cost. New singleplex real-time PCR assays for serogroup B synD, W135 synG, and Y synF showed 100% specificity for detecting N. meningitidis species, with high sensitivity (serogroup B synD, 99% [75/76]; W135 synG, 97% [38/39]; and Y synF, 100% [66/66]). The lower limits of detection (LLD) were 9, 43, and 10 copies/reaction for serogroup B synD, W135 synG, and Y synF assays, respectively, a significant improvement compared to results for the previous singleplex assays. We developed three multiplex real-time PCR assays for detection of (i) N. meningitidis ctrA, H. influenzae hpd, and S. pneumoniae lytA (NHS assay); (ii) N. meningitidis serogroups A, W135, and X (AWX assay); and (iii) N. meningitidis serogroups B, C, and Y (BCY assay). Each multiplex assay was 100% specific for detecting its target organisms or serogroups, and the LLD was similar to that for the singleplex assay. Pairwise comparison of real-time PCR between multiplex and singleplex assays showed that cycle threshold values of the multiplex assay were similar to those for the singleplex assay. There were no substantial differences in sensitivity and specificity between these multiplex and singleplex real-time PCR assays.

Detection of tumor markers in prostate cancer and comparison of sensitivity between real time and nested PCR.

PubMed

Matsuoka, Takayuki; Shigemura, Katsumi; Yamamichi, Fukashi; Fujisawa, Masato; Kawabata, Masato; Shirakawa, Toshiro

2012-06-27

The objective of this study is to investigate and compare the sensitivity in conventional PCR, quantitative real time PCR, nested PCR and western blots for detection of prostate cancer tumor markers using prostate cancer (PCa) cells. We performed conventional PCR, quantitative real time PCR, nested PCR, and western blots using 5 kinds of PCa cells. Prostate specific antigen (PSA), prostate specific membrane antigen (PSMA), and androgen receptor (AR) were compared for their detection sensitivity by real time PCR and nested PCR. In real time PCR, there was a significant correlation between cell number and the RNA concentration obtained (R(2)=0.9944) for PSA, PSMA, and AR. We found it possible to detect these markers from a single LNCaP cell in both real time and nested PCR. By comparison, nested PCR reached a linear curve in fewer PCR cycles than real time PCR, suggesting that nested PCR may offer PCR results more quickly than real time PCR. In conclusion, nested PCR may offer tumor maker detection in PCa cells more quickly (with fewer PCR cycles) with the same high sensitivity as real time PCR. Further study is necessary to establish and evaluate the best tool for PCa tumor marker detection.

Effect of Short-Term, High-Intensity Exercise on Anaerobic Threshold in Women.

ERIC Educational Resources Information Center

Evans, Blanche W.

This study investigated the effects of a six-week, high-intensity cycling program on anaerobic threshold (AT) in ten women. Subjects trained four days a week using high-intensity interval-type cycle exercises. Workouts included six 4-minute intervals cycling at 85 percent maximal oxygen uptake (VO sub 2 max), separated by 3-minute intervals of…

Successful Validation of Sample Processing and Quantitative Real-Time PCR Capabilities on the International Space Station

NASA Technical Reports Server (NTRS)

Parra, Macarena; Jung, Jimmy; Almeida, Eduardo; Boone, Travis; Schonfeld, Julie; Tran, Luan

2016-01-01

The WetLab-2 system was developed by NASA Ames Research Center to offer new capabilities to researchers. The system can lyse cells and extract RNA (Ribonucleic Acid) on-orbit from different sample types ranging from microbial cultures to animal tissues. The purified RNA can then either be stabilized for return to Earth or can be used to conduct on-orbit quantitative Reverse Transcriptase PCR (Polymerase Chain Reaction) (qRT-PCR) analysis without the need for sample return. The qRT-PCR results can be downlinked to the ground a few hours after the completion of the run. The validation flight of the WetLab-2 system launched on SpaceX-8 on April 8, 2016. On orbit operations started on April 15th with system setup and was followed by three quantitative PCR runs using an E. coli genomic DNA template pre-loaded at three different concentrations. These runs were designed to discern if quantitative PCR functions correctly in microgravity and if the data is comparable to that from the ground control runs. The flight data showed no significant differences compared to the ground data though there was more variability in the values, this was likely due to the numerous small bubbles observed. The capability of the system to process samples and purify RNA was then validated using frozen samples prepared on the ground. The flight data for both E. coli and mouse liver clearly shows that RNA was successfully purified by our system. The E. coli qRT-PCR run showed successful singleplex, duplex and triplex capability. Data showed high variability in the resulting Cts (Cycle Thresholds [for the PCR]) likely due to bubble formation and insufficient mixing during the procedure run. The mouse liver qRT-PCR run had successful singleplex and duplex reactions and the variability was slightly better as the mixing operation was improved. The ability to purify and stabilize RNA and to conduct qRT-PCR on-orbit is an important step towards utilizing the ISS as a National Laboratory facility. The ability to get on-orbit data will provide investigators with the opportunity to adjust experimental parameters in real time without the need for sample return and re-flight. The WetLab-2 Project is supported by the Research Integration Office in the ISS Program.

Latent class analysis of the diagnostic characteristics of PCR and conventional bacteriological culture in diagnosing intramammary infections caused by Staphylococcus aureus in dairy cows at dry off

PubMed Central

2012-01-01

Background Staphylococcus aureus is one of the most common causes of intramammary infections in dairy cows at dry off. Reliable identification is important for disease management on herd level and for antimicrobial treatment of infected animals. Our objective was to evaluate the test characteristics of PathoProof ™ Mastitis PCR Assay and bacteriological culture (BC) in diagnosing bovine intramammary infections caused by S. aureus at dry off at different PCR cycle threshold (Ct)-value cut-offs. Methods Sterile quarter samples and non-sterile composite samples from 140 animals in seven herds were collected in connection with the dairy herd improvement (DHI) milk recording. All quarter samples were analyzed using BC whereas all composite samples were analyzed with PathoProof ™ Mastitis PCR Assay. Latent class analysis was used to estimate test properties for PCR and BC in the absence of a perfect reference test. The population was divided into two geographically divided subpopulations and the Hui-Walter 2-test 2-populations model applied to estimate Se, Sp for the two tests, and prevalence for the two subpopulations. Results The Se for PCR increased with increasing Ct-value cut-off, accompanied by a small decrease in Sp. For BC the Se decreased and Sp increased with increasing Ct-value cut-off. Most optimal test estimates for the real-time PCR assay were at a Ct-value cut-off of 37; 0.93 [95% posterior probability interval (PPI) 0.60-0.99] for Se and 0.95 [95% PPI 0.95-0.99] for Sp. At the same Ct-value cut-off, Se and Sp for BC were 0.83 [95% PPI 0.66-0.99] and 0.97 [95% PPI 0.91-0.99] respectively. Depending on the chosen PCR Ct-value cut-off, the prevalence in the subpopulations varied; the prevalence increased with increasing PCR Ct-value cut-offs. Conclusion Neither BC nor real-time PCR is a perfect test in detecting IMI in dairy cows at dry off. The changes in sensitivity and prevalence at different Ct-value cut-offs for both PCR and BC may indicate a change in the underlying disease definition. At low PCR Ct-value cut-offs the underlying disease definition may be a truly/heavily infected cow, whereas at higher PCR Ct-value cut-offs the disease definition may be a S. aureus positive cow. PMID:23164432

L-Arginine Affects Aerobic Capacity and Muscle Metabolism in MELAS (Mitochondrial Encephalomyopathy, Lactic Acidosis and Stroke-Like Episodes) Syndrome.

PubMed

Rodan, Lance H; Wells, Greg D; Banks, Laura; Thompson, Sara; Schneiderman, Jane E; Tein, Ingrid

2015-01-01

To study the effects of L-arginine (L-Arg) on total body aerobic capacity and muscle metabolism as assessed by (31)Phosphorus Magnetic Resonance Spectroscopy ((31)P-MRS) in patients with MELAS (Mitochondrial Encephalomyopathy with Lactic Acidosis and Stroke-like episodes) syndrome. We performed a case control study in 3 MELAS siblings (m.3243A>G tRNA(leu(UUR)) in MTTL1 gene) with different % blood mutant mtDNA to evaluate total body maximal aerobic capacity (VO(2peak)) using graded cycle ergometry and muscle metabolism using 31P-MRS. We then ran a clinical trial pilot study in MELAS sibs to assess response of these parameters to single dose and a 6-week steady-state trial of oral L-Arginine. At baseline (no L-Arg), MELAS had lower serum Arg (p = 0.001). On 3(1)P-MRS muscle at rest, MELAS subjects had increased phosphocreatine (PCr) (p = 0.05), decreased ATP (p = 0.018), and decreased intracellular Mg(2+) (p = 0.0002) when compared to matched controls. With L-arginine therapy, the following trends were noted in MELAS siblings on cycle ergometry: (1) increase in mean % maximum work at anaerobic threshold (AT) (2) increase in % maximum heart rate at AT (3) small increase in VO(2peak). On (31)P-MRS the following mean trends were noted: (1) A blunted decrease in pH after exercise (less acidosis) (2) increase in Pi/PCr ratio (ADP) suggesting increased work capacity (3) a faster half time of PCr recovery (marker of mitochondrial activity) following 5 minutes of moderate intensity exercise (4) increase in torque. These results suggest an improvement in aerobic capacity and muscle metabolism in MELAS subjects in response to supplementation with L-Arg. Intramyocellular hypomagnesemia is a novel finding that warrants further study. Class III evidence that L-arginine improves aerobic capacity and muscle metabolism in MELAS subjects. ClinicalTrials.gov NCT01603446.

Real-Time PCR Quantification Using A Variable Reaction Efficiency Model

PubMed Central

Platts, Adrian E.; Johnson, Graham D.; Linnemann, Amelia K.; Krawetz, Stephen A.

2008-01-01

Quantitative real-time PCR remains a cornerstone technique in gene expression analysis and sequence characterization. Despite the importance of the approach to experimental biology the confident assignment of reaction efficiency to the early cycles of real-time PCR reactions remains problematic. Considerable noise may be generated where few cycles in the amplification are available to estimate peak efficiency. An alternate approach that uses data from beyond the log-linear amplification phase is explored with the aim of reducing noise and adding confidence to efficiency estimates. PCR reaction efficiency is regressed to estimate the per-cycle profile of an asymptotically departed peak efficiency, even when this is not closely approximated in the measurable cycles. The process can be repeated over replicates to develop a robust estimate of peak reaction efficiency. This leads to an estimate of the maximum reaction efficiency that may be considered primer-design specific. Using a series of biological scenarios we demonstrate that this approach can provide an accurate estimate of initial template concentration. PMID:18570886

Essential strategies to optimize asymmetric PCR conditions as a reliable method to generate large amount of ssDNA aptamers.

PubMed

Heiat, Mohammad; Ranjbar, Reza; Latifi, Ali Mohammad; Rasaee, Mohammad Javad; Farnoosh, Gholamreza

2017-07-01

Asymmetric PCR, a simple method to generate single-stranded DNA (ssDNA) aptamers in systematic evaluation of ligand by exponential enrichments rounds, is coupled with limitations. We investigated the essential strategies for optimization of conditions to perform a high-quality asymmetric PCR. Final concentrations of primers and template, the number of PCR cycles, and annealing temperature were selected as optimizing variables. The qualities of visualized PCR products were analyzed by ImageJ software. The highest proportion of interested DNA than unwanted products was considered as optimum conditions. Results revealed that the best values for primers ratio, final template concentration, annealing temperature, and PCR cycles were, respectively, 30:1, 1 ng/μL, 55 °C, and 20 cycles for the first and 50:1, 2 ng/μL, 59 °C, and 20 cycles for other rounds. No significant difference was found between optimized asymmetric PCR results in the rounds of two to eight (P > 0.05). The ssDNA quality in round 10 was significantly better than other rounds (P < 0.05). Generally, the ssDNA product with less dimers, double-stranded DNA (dsDNA), and smear are preferable. The dsDNA contamination is the worst, because it can act as antidote and inhibits aptameric performance. Therefore, to choose the best conditions, the lower amount of dsDNA is more important than other unwanted products. © 2016 International Union of Biochemistry and Molecular Biology, Inc.

Gold Nanorod-based Photo-PCR System for One-Step, Rapid Detection of Bacteria

PubMed Central

Kim, Jinjoo; Kim, Hansol; Park, Ji Ho; Jon, Sangyong

2017-01-01

The polymerase chain reaction (PCR) has been an essential tool for diagnosis of infectious diseases, but conventional PCR still has some limitations with respect to applications to point-of-care (POC) diagnostic systems that require rapid detection and miniaturization. Here we report a light-based PCR method, termed as photo-PCR, which enables rapid detection of bacteria in a single step. In the photo-PCR system, poly(enthylene glycol)-modified gold nanorods (PEG-GNRs), used as a heat generator, are added into the PCR mixture, which is subsequently periodically irradiated with a 808-nm laser to create thermal cycling. Photo-PCR was able to significantly reduce overall thermal cycling time by integrating bacterial cell lysis and DNA amplification into a single step. Furthermore, when combined with KAPA2G fast polymerase and cooling system, the entire process of bacterial genomic DNA extraction and amplification was further shortened, highlighting the potential of photo-PCR for use in a portable, POC diagnostic system. PMID:29071186

Carbon cycling at the tipping point: Does ecosystem structure predict resistance to disturbance?

NASA Astrophysics Data System (ADS)

Gough, C. M.; Bond-Lamberty, B. P.; Stuart-Haentjens, E.; Atkins, J.; Haber, L.; Fahey, R. T.

2017-12-01

Ecosystems worldwide are subjected to disturbances that reshape their physical and biological structure and modify biogeochemical processes, including carbon storage and cycling rates. Disturbances, including those from insect pests, pathogens, and extreme weather, span a continuum of severity and, accordingly, may have different effects on carbon cycling processes. Some ecosystems resist biogeochemical changes following disturbance, until a critical threshold of severity is exceeded. The ecosystem properties underlying such functional resistance, and signifying when a tipping point will occur, however, are almost entirely unknown. Here, we present observational and experimental results from forests in the Great Lakes region, showing ecosystem structure is closely coupled with carbon cycling responses to disturbance, with shifts in structure predicting thresholds of and, in some cases, increases in carbon storage. We find, among forests in the region, that carbon storage regularly exhibits a non-linear threshold response to increasing disturbance levels, but the severity at which a threshold is reached varies among disturbed forests. More biologically and structurally complex forest ecosystems sometimes exhibit greater functional resistance than simpler forests, and consequently may have a higher disturbance severity threshold. Counter to model predictions but consistent with some theoretical frameworks, empirical data show moderate levels of disturbance may increase ecosystem complexity to a point, thereby increasing rates of carbon storage. Disturbances that increase complexity therefore may stimulate carbon storage, while severe disturbances at or beyond thresholds may simplify structure, leading to carbon storage declines. We conclude that ecosystem structural attributes are closely coupled with biogeochemical thresholds across disturbance severity gradients, suggesting that improved predictions of disturbance-related changes in the carbon cycle require better representation of ecosystem structure in models.

A temperature control method for shortening thermal cycling time to achieve rapid polymerase chain reaction (PCR) in a disposable polymer microfluidic device

NASA Astrophysics Data System (ADS)

Bu, Minqiang; Perch-Nielsen, Ivan R.; Sørensen, Karen S.; Skov, Julia; Sun, Yi; Duong Bang, Dang; Pedersen, Michael E.; Hansen, Mikkel F.; Wolff, Anders

2013-07-01

We present a temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with an external heater and a temperature sensor. The method employs optimized temperature overshooting and undershooting steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature-dependent fluorescence signal from Rhodamine B. The method was validated with the PCR amplification of mecA gene (162 bp) from methicillin-resistant Staphylococcus aureus bacterium (MRSA), where the time for 30 cycles was reduced from 50 min (without over- and undershooting) to 20 min.

A simple device using magnetic transportation for droplet-based PCR.

PubMed

Ohashi, Tetsuo; Kuyama, Hiroki; Hanafusa, Nobuhiro; Togawa, Yoshiyuki

2007-10-01

The Polymerase chain reaction (PCR) was successfully and rapidly performed in a simple reaction device devoid of channels, pumps, valves, or other control elements used in conventional lab-on-a-chip technology. The basic concept of this device is the transportation of aqueous droplets containing hydrophilic magnetic beads in a flat-bottomed, tray-type reactor filled with silicone oil. The whole droplets sink to the bottom of the reactor because their specific gravity is greater than that of the silicone oil used here. The droplets follow the movement of a magnet located underneath the reactor. The notable advantage of the droplet-based PCR is the ability to switch rapidly the proposed reaction temperature by moving the droplets to the required temperature zones in the temperature gradient. The droplet-based reciprocative thermal cycling was performed by moving the droplets composed of PCR reaction mixture to the designated temperature zones on a linear temperature gradient from 50 degrees C to 94 degrees C generated on the flat bottom plate of the tray reactor. Using human-derived DNA containing the mitochondria genes as the amplification targets, the droplet-based PCR with magnetic reciprocative thermal cycling successfully provided the five PCR products ranging from 126 to 1,219 bp in 11 min with 30 cycles. More remarkably, the human genomic gene amplification targeting glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene was accomplished rapidly in 3.6 min with 40 cycles.

Tracking heterotrophic and autotrophic carbon cycling by magnetotactic bacteria in freshwater sediments using DNA stable isotope probing

NASA Astrophysics Data System (ADS)

Kürşat Coşkun, Ömer; Roud, Sophie; He, Kuang; Petersen, Nikolai; Gilder, Stuart; Orsi, William D.

2017-04-01

Magnetotactic bacteria (MTB) are diverse, widespread, motile prokaryotes which biomineralize nanosize magnetic minerals, either magnetite or gregite, under highly conserved genetic control and have magnetotaxis to align their position in aquatic environment according to Earth's magnetic field. They play important roles on some geobiological cycle of important minerals such as iron, sulphur, nitrogen and carbon. Yet, to date, their importance in carbon cycle and carbon source in their natural environment have not been previously studied. In this study, we focused on freshwater benthic carbon cycling of MTB and total bacteria using DNA stable isotope probing (DNA-SIP) technique coupled with quantitative PCR (qPCR). Pond sediments from Unterlippach (Germany) were amended with 13C-labelled sodium bicarbonate and 13C-labelled organic matter, and incubated in the dark over a two week time period. Applying separate qPCR assays specific for total bacteria and MTB, respectively, allowed us to estimate the contribution of MTB to total heterotrophic and autotrophic carbon cycling via DNA-SIP. After one week, there was a slight degree of autotrophic activity which increased markedly after two weeks. Comparing total DNA to the qPCR data revealed that changes in the buoyant density of DNA was due mainly to autotrophic bacterial production. DNA-SIP also identified heterotrophic utilization of 13C-labelled organic matter by MTB after 1 week. The qPCR data also allowed us to estimate uptake rates based on the incubation times for heterotrophic and autotrophic MTB. High-throughput DNA sequencing of 16S rRNA genes showed that most of the MTB involved in carbon cycling were related to the Magnetococcus genus. This study sheds light on the carbon sources for MTB in a natural environment and helps unravel their ecological role in the carbon cycle.

Development and Validation of a Quantitative PCR Assay Using Multiplexed Hydrolysis Probes for Detection and Quantification of Theileria orientalis Isolates and Differentiation of Clinically Relevant Subtypes

PubMed Central

Bogema, D. R.; Deutscher, A. T.; Fell, S.; Collins, D.; Eamens, G. J.

2015-01-01

Theileria orientalis is an emerging pathogen of cattle in Asia, Australia, and New Zealand. This organism is a vector-borne hemoprotozoan that causes clinical disease characterized by anemia, abortion, and death, as well as persistent subclinical infections. Molecular methods of diagnosis are preferred due to their sensitivity and utility in differentiating between pathogenic and apathogenic genotypes. Conventional PCR (cPCR) assays for T. orientalis detection and typing are laborious and do not provide an estimate of parasite load. Current real-time PCR assays cannot differentiate between clinically relevant and benign genotypes or are only semiquantitative without a defined clinical threshold. Here, we developed and validated a hydrolysis probe quantitative PCR (qPCR) assay which universally detects and quantifies T. orientalis and identifies the clinically associated Ikeda and Chitose genotypes (UIC assay). Comparison of the UIC assay results with previously validated universal and genotype-specific cPCR results demonstrated that qPCR detects and differentiates T. orientalis with high sensitivity and specificiy. Comparison of quantitative results based on percent parasitemia, determined via blood film analysis and packed cell volume (PCV) revealed significant positive and negative correlations, respectively. One-way analysis of variance (ANOVA) indicated that blood samples from animals with clinical signs of disease contained statistically higher concentrations of T. orientalis DNA than animals with subclinical infections. We propose clinical thresholds to assist in classifying high-, moderate-, and low-level infections and describe how parasite load and the presence of the Ikeda and Chitose genotypes relate to disease. PMID:25588653

Effect of exposure cycle on hot salt stress corrosion of a titanium alloy

NASA Technical Reports Server (NTRS)

Gray, H. R.; Johnston, J. R.

1974-01-01

The influence of exposure cycle on the hot-salt stress-corrosion cracking resistance of the Ti-8Al-1Mo-1V alloy was determined. Both temperature and stress were cycled simultaneously to simulate turbine-powered aircraft service cycles. Temperature and stress were also cycled independently to determine their individual effects. Substantial increases in crack threshold stresses were observed for cycles in which both temperature and stress or temperature alone were applied for 1 hour and removed for 3 hours. The crack threshold stresses for these cyclic exposures were twice those determined for continuous exposure for the same total time of 96 hours.

Quantitative polymerase chain reaction based quantification of Brucella DNA in serum of pre- and post-therapeutic occupationally exposed infected human population.

PubMed

Thakur, Shalini; Bedi, Jasbir S; Singh, Randhir; Gill, Jatinder P S; Arora, Anil K; Kashyap, Neeraj

Brucellosis is one of the neglected zoonotic diseases in humans. The serological methods based on antibody detections are unable to detect the effectiveness of treatment in humans as antibodies persist for long time in humans even after therapy. Therefore, we developed qPCR technique to overcome such discrepancy and device a rapid and efficient test for both diagnosis and follow up of the brucellosis affected individuals. High risk suspected individuals with positive serology (RBPT, STAT and iELISA) and PCR were mainly analyzed for DNA quantification by qPCR assay. The bcsp-31 gene, a shared gene of Brucella species was amplified by genus specific primers and cloned to pGEMT™ easy vector and the cloned plasmid were used to construct a standard curve (R 2 =0.99, efficiency=1.98) over 7 orders of magnitude with sensitivity of ≈10 copy number. The assay was found 100% specific. Overall 85 individuals were found positive out of 188. Out of them, 23 serological, PCR and qPCR positive individuals were recommended for 45days therapy according to WHO regimen (Doxycycline and Rifampin) and each case was further followed by qPCR. The mean threshold cycle (C q ) before treatment was 26.05±0.347 (3940.5copies/μl), which increased significantly to 32.7±0.66 (259.13copies/μl) on 4th week during treatment, 35.12±3.12 (38.52copies/μl) at 6th week on day of treatment completion, 35.6±0.66 (34.21copies/μl) on 21st day after treatment depicting a significant reduction in DNA load over the course of treatment. Serological follow up showed that only 3 individuals had decreased STAT titre but no change in RBPT results. Out of 17 symptomatic individuals under therapy, 10 improved clinically, 5 improved clinically with persistent weakness and 2 had no effect of therapy. The study suggests that qPCR is more useful and rapid test to follow treated individuals than serology. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

Application of a Receptor-Binding Capture Quantitative Reverse Transcription-PCR Assay To Concentrate Human Norovirus from Sewage and To Study the Distribution and Stability of the Virus

PubMed Central

Yang, David; Pan, Liangwen; Mandrell, Robert

2012-01-01

Water is an important route for human norovirus (HuNoV) transmission. Using magnetic beads conjugated with blood group-like antigens (HuNoV receptors), we developed a simple and rapid receptor-binding capture and magnetic sequestration (RBCMS) method and compared it to the existing negatively charged membrane absorption/elution (NCMAE) method for concentrating HuNoV from sewage effluent. RBCMS required 6-fold-less sample volume than the NCMAE method and also resulted in a significantly higher yield of HuNoV. The NCMAE and RBCMS concentrations of genogroup I (GI) HuNoV measured by quantitative reverse transcription-PCR (qRT-PCR) resulted in average threshold cycle (CT) values of 34.68 (8.68 copies, 252-fold concentration) versus 34.07 (13.05 copies, 477-fold concentration), respectively; the NCMAE and RBCMS concentrations of genogroup II (GII) HuNoV were measured as average CT values of 33.32 (24.7 copies, 239-fold concentration) versus 32.38 (46.9 copies, 333-fold concentration), respectively. The specificity of qRT-PCR was confirmed by traditional RT-PCR and an RNase I protection assay. The qRT-PCR signal from RBCMS-concentrated HuNoV treated with RNase I indicated that it was from encapsidated RNA and, probably, viable virus. In contrast, the qRT-PCR signal from NCMAE-concentrated HuNoV was not protected from RNase I and, likely, degradation. Both GI and GII HuNoV were detected from sewage effluent samples collected between April and July with average concentrations of 7.8 × 103 genomic copies per liter (gc/liter) and 4.3 × 104 gc/liter, respectively. No GI and <2% GII HuNoV were detected in sewage samples stored at room temperature for 4 weeks. We conclude that RBCMS requires less sample volume, has better recovery and sensitivity, and is faster than NCMAE for detection of HuNoV in sewage. PMID:22101044

Nanofluidic Digital PCR and Extended Genotyping of RAS and BRAF for Improved Selection of Metastatic Colorectal Cancer Patients for Anti-EGFR Therapies.

PubMed

Azuara, Daniel; Santos, Cristina; Lopez-Doriga, Adriana; Grasselli, Julieta; Nadal, Marga; Sanjuan, Xavier; Marin, Fátima; Vidal, Joana; Montal, Robert; Moreno, Victor; Bellosillo, Beatriz; Argiles, Guillem; Elez, Elena; Dienstmann, Rodrigo; Montagut, Clara; Tabernero, Josep; Capellá, Gabriel; Salazar, Ramon

2016-05-01

The clinical significance of low-frequent RAS pathway-mutated alleles and the optimal sensitivity cutoff value in the prediction of response to anti-EGFR therapy in metastatic colorectal cancer (mCRC) patients remains controversial. We aimed to evaluate the added value of genotyping an extended RAS panel using a robust nanofluidic digital PCR (dPCR) approach. A panel of 34 hotspots, including RAS (KRAS and NRAS exons 2/3/4) and BRAF (V600E), was analyzed in tumor FFPE samples from 102 mCRC patients treated with anti-EGFR therapy. dPCR was compared with conventional quantitative PCR (qPCR). Response rates, progression-free survival (PFS), and overall survival (OS) were correlated to the mutational status and the mutated allele fraction. Tumor response evaluations were not available in 9 patients and were excluded for response rate analysis. Twenty-two percent of patients were positive for one mutation with qPCR (mutated alleles ranged from 2.1% to 66.6%). Analysis by dPCR increased the number of positive patients to 47%. Mutated alleles for patients only detected by dPCR ranged from 0.04% to 10.8%. An inverse correlation between the fraction of mutated alleles and radiologic response was observed. ROC analysis showed that a fraction of 1% or higher of any mutated alleles offered the best predictive value for all combinations of RAS and BRAF analysis. In addition, this threshold also optimized prediction both PFS and OS. We conclude that mutation testing using an extended gene panel, including RAS and BRAF with a threshold of 1% improved prediction of response to anti-EGFR therapy. Mol Cancer Ther; 15(5); 1106-12. ©2016 AACR. ©2016 American Association for Cancer Research.

Portable low-power thermal cycler with dual thin-film Pt heaters for a polymeric PCR chip.

PubMed

Jeong, Sangdo; Lim, Juhun; Kim, Mi-Young; Yeom, JiHye; Cho, Hyunmin; Lee, Hyunjung; Shin, Yong-Beom; Lee, Jong-Hyun

2018-01-29

Polymerase chain reaction (PCR) has been widely used for major definite diagnostic tool, but very limited its place used only indoor such as hospital or diagnosis lab. For the rapid on-site detection of pathogen in an outdoor environment, a low-power cordless polymerase chain reaction (PCR) thermal cycler is crucial module. At this point of view, we proposed a low-power PCR thermal cycler that could be operated in an outdoor anywhere. The disposable PCR chip was made of a polymeric (PI/PET) film to reduce the thermal mass. A dual arrangement of the Pt heaters, which were positioned on the top and bottom of the PCR chip, improved the temperature uniformity. The temperature sensor, which was made of the same material as the heater, utilized the temperature dependence of the Pt resistor to ensure simple fabrication of the temperature sensor. Cooling the PCR chip using dual blower fans enabled thermal cycling to operate with a lower power than that of a Peltier element with a high power consumption. The PCR components were electrically connected to a control module that could be operated with a Li-ion battery (12 V), and the PCR conditions (temperature, time, cycle, etc.) were inputted on a touch screen. For 30 PCR cycles, the accumulated power consumption of heating and cooling was 7.3 Wh, which is easily available from a compact battery. Escherichia coli genomic DNA (510 bp) was amplified using the proposed PCR thermal cycler and the disposable PCR chip. A similar DNA amplification capability was confirmed using the proposed portable and low-power thermal cycler compared with a conventional thermal cycler.

Next-generation sequencing can reveal in vitro-generated PCR crossover products: some artifactual sequences correspond to HLA alleles in the IMGT/HLA database.

PubMed

Holcomb, C L; Rastrou, M; Williams, T C; Goodridge, D; Lazaro, A M; Tilanus, M; Erlich, H A

2014-01-01

The high-resolution human leukocyte antigen (HLA) genotyping assay that we developed using 454 sequencing and Conexio software uses generic polymerase chain reaction (PCR) primers for DRB exon 2. Occasionally, we observed low abundance DRB amplicon sequences that resulted from in vitro PCR 'crossing over' between DRB1 and DRB3/4/5. These hybrid sequences, revealed by the clonal sequencing property of the 454 system, were generally observed at a read depth of 5%-10% of the true alleles. They usually contained at least one mismatch with the IMGT/HLA database, and consequently, were easily recognizable and did not cause a problem for HLA genotyping. Sometimes, however, these artifactual sequences matched a rare allele and the automatic genotype assignment was incorrect. These observations raised two issues: (1) could PCR conditions be modified to reduce such artifacts? and (2) could some of the rare alleles listed in the IMGT/HLA database be artifacts rather than true alleles? Because PCR crossing over occurs during late cycles of PCR, we compared DRB genotypes resulting from 28 and (our standard) 35 cycles of PCR. For all 21 cell line DNAs amplified for 35 cycles, crossover products were detected. In 33% of the cases, these hybrid sequences corresponded to named alleles. With amplification for only 28 cycles, these artifactual sequences were not detectable. To investigate whether some rare alleles in the IMGT/HLA database might be due to PCR artifacts, we analyzed four samples obtained from the investigators who submitted the sequences. In three cases, the sequences were generated from true alleles. In one case, our 454 sequencing revealed an error in the previously submitted sequence. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Evaluation of Fast Technology Analysis (FTA) Cards as an improved method for specimen collection and shipment targeting viruses associated with Bovine Respiratory Disease Complex.

PubMed

Liang, Xiao; Chigerwe, Munashe; Hietala, Sharon K; Crossley, Beate M

2014-06-01

In order to improve the analytic quality of respiratory specimens collected from cattle for nucleic acid-based diagnosis, a study was undertaken to verify realtime PCR efficiency of specimens collected and stabilized on FTA Cards™, filter paper which is treated chemically. Nucleic acids collected using FTA Cards without the need for a cold-chain or special liquid media handling provided realtime PCR results consistent (96.8% agreement, kappa 0.923 [95% CI=0.89-0.96]) with the same specimens collected using traditional viral transport media and shipped on ice using the U.S. Department of Transportation mandated liquid handling requirements. Nucleic acid stabilization on FTA Cards was evaluated over a temperature range (-27 °C to +46 °C) for up to 14 days to mimic environmental conditions for diagnostic sample handling between collection and processing in a routine veterinary laboratory. No significant difference (P≥0.05) was observed in realtime PCR cycle threshold values over the temperature range and time storage conditions for Bovine Viral Diarrhea virus, Bovine Respiratory Syncytial virus, Bovine Coronavirus, and Bovine Herpesvirus I. The four viruses evaluated in the study are associated with Bovine Respiratory Disease Complex where improvements in ease and reliability of specimen collection and shipping would enhance the diagnostic quality of specimens collected in the field, and ultimately improve diagnostic efficiency. Copyright © 2014 Elsevier B.V. All rights reserved.

Design and validation of a real-time RT-PCR for the simultaneous detection of enteroviruses and parechoviruses in clinical samples.

PubMed

Cabrerizo, María; Calvo, Cristina; Rabella, Nuria; Muñoz-Almagro, Carmen; del Amo, Eva; Pérez-Ruiz, Mercedes; Sanbonmatsu-Gámez, Sara; Moreno-Docón, Antonio; Otero, Almudena; Trallero, Gloria

2014-11-01

Human enteroviruses (EVs) and parechoviruses (HPeVs) are important etiological agents causing infections such as meningitis, encephalitis and sepsis-like disease in neonates and young children. We have developed a real-time RT-PCR for simultaneous detection of EV and HPeV in clinical samples. Primers and probe sets were designed from the conserved 5'-noncoding region of the genomes. The sensitivity, specificity and reproducibility of the technique were measured using a set of 25 EV and 6 HPeV types. All EVs but no HPeVs were detected with the EV primers-probe set. The HPeV primers-probe set detected only the 6 HPeV types. The lower detection limit was found to be 4 and 40CCID50/ml for HPeV and EV respectively, demonstrating high sensitivity of the technique for both viruses. The threshold cycle values were highly reproducible on repeat testing of positive controls among assay runs. The assay was evaluated in 53 clinical samples of suspected meningitis, sepsis or febrile syndromes from children under 3 years. In 11 of these (21%) EVs were detected, while 4, i.e. 7.5%, were HPeV positive. Molecular typing was carried out for 73% of the viruses. In summary, the RT-PCR method developed demonstrated effectively both EV and HPeV detection, which can cause similar clinical symptoms in infants. Copyright © 2014 Elsevier B.V. All rights reserved.

Evaluation of Nucleic Acid Preservation Cards for West Nile Virus Testing in Dead Birds

PubMed Central

Foss, Leslie; Reisen, William K.; Fang, Ying; Kramer, Vicki; Padgett, Kerry

2016-01-01

The California West Nile virus (WNV) Dead Bird Surveillance Program (DBSP) is an important component of WNV surveillance in the state. We evaluated FTA™ and RNASound™ cards as an alternative method for sampling dead birds for WNV molecular testing as these cards allow for more cost effective, rapid, and safer diagnostic sampling than the shipment of bird carcasses. To evaluate accuracy of results among avian sampling regimes, Reverse-Transcription Polymerase Chain Reaction (RT-PCR) results from FTA™ and RNASound™ cards were compared with results from kidney tissue, brain tissue, or oral swabs in lysis buffer in 2012–2013. In addition, RT-PCR results were compared with results from oral swabs tested by rapid antigen tests (RAMP™ and VecTOR™). While test results from the cards were not as sensitive as kidney tissue testing, they were more likely to provide accurate results than rapid antigen tests, and detected WNV in corvids as well as in other passerines, raptors, and waterfowl. Overall, WNV RT-PCR cycle threshold (Ct) scores from the cards were higher than those from tissue testing, but both card products displayed high sensitivity and specificity. American Crow samples provided the highest sensitivity. The cards also proved to be easier and more convenient vehicles for collecting and shipping samples, and in 2014 our program launched use of RNASound™ cards in the DBSP. Both FTA™ and RNASound™ products displayed 96% agreement with tissue results and are an adequate alternative sampling method for WNV dead bird testing. PMID:27341492

New design, development, and optimization of an in-house quantitative TaqMan Real-time PCR assay for HIV-1 viral load measurement.

PubMed

Noorbazargan, Hassan; Nadji, Seyed Alireza; Samiee, Siamak Mirab; Paryan, Mahdi; Mohammadi-Yeganeh, Samira

2018-04-01

Background Viral load measurement is commonly applicable to monitor HIV infection in patients to determine the number of HIV-RNA in serum samples of individuals. The aim of the present study was to set up a highly specific, sensitive, and reproducible home-brewed Real-time PCR assay based on TaqMan chemistry to quantify HIV-1 RNA genome. Methods In this study, three sets of primer pairs and a TaqMan probe were designed for HIV subtypes conserved sequences. An internal control was included in this assay to evaluate the presence of inhibition. Standard curve and threshold cycle values were determined using in vitro transcribed RNA from int region of HIV-1. A serial dilution of RNA standards was generated by in vitro transcription, from 10 to 10 9 copies/ml to find the sensitivity and the limit of detection (LOD) of the assay and to evaluate its performance in a quantitative RT-PCR assay. Results The assay has a low LOD equivalent to 33.13 copies/ml of HIV-1 RNA and a linear range of detection from 10 to 10 9 copies/ml. The coefficient of variation (CV) for Inter and Intra-assay precision of this in-house HIV Real-time RT-PCR ranged from 0.28 to 2.49% and 0.72 to 4.47%, respectively. The analytical and clinical specificity was 100%. Conclusions The results indicate that the developed method has a suitable specificity and sensitivity and is highly reproducible and cost-benefit. Therefore, it will be useful to monitor HIV infection in plasma samples of individuals.

Comparative Evaluation of Three Homogenization Methods for Isolating Middle East Respiratory Syndrome Coronavirus Nucleic Acids From Sputum Samples for Real-Time Reverse Transcription PCR.

PubMed

Sung, Heungsup; Yong, Dongeun; Ki, Chang Seok; Kim, Jae Seok; Seong, Moon Woo; Lee, Hyukmin; Kim, Mi Na

2016-09-01

Real-time reverse transcription PCR (rRT-PCR) of sputum samples is commonly used to diagnose Middle East respiratory syndrome coronavirus (MERS-CoV) infection. Owing to the difficulty of extracting RNA from sputum containing mucus, sputum homogenization is desirable prior to nucleic acid isolation. We determined optimal homogenization methods for isolating viral nucleic acids from sputum. We evaluated the following three sputum-homogenization methods: proteinase K and DNase I (PK-DNase) treatment, phosphate-buffered saline (PBS) treatment, and N-acetyl-L-cysteine and sodium citrate (NALC) treatment. Sputum samples were spiked with inactivated MERS-CoV culture isolates. RNA was extracted from pretreated, spiked samples using the easyMAG system (bioMérieux, France). Extracted RNAs were then subjected to rRT-PCR for MERS-CoV diagnosis (DiaPlex Q MERS-coronavirus, SolGent, Korea). While analyzing 15 spiked sputum samples prepared in technical duplicate, false-negative results were obtained with five (16.7%) and four samples (13.3%), respectively, by using the PBS and NALC methods. The range of threshold cycle (Ct) values observed when detecting upE in sputum samples was 31.1-35.4 with the PK-DNase method, 34.7-39.0 with the PBS method, and 33.9-38.6 with the NALC method. Compared with the control, which were prepared by adding a one-tenth volume of 1:1,000 diluted viral culture to PBS solution, the ranges of Ct values obtained by the PBS and NALC methods differed significantly from the mean control Ct of 33.2 (both P<0.0001). The PK-DNase method is suitable for homogenizing sputum samples prior to RNA extraction.

Comparative Evaluation of Three Homogenization Methods for Isolating Middle East Respiratory Syndrome Coronavirus Nucleic Acids From Sputum Samples for Real-Time Reverse Transcription PCR

PubMed Central

Yong, Dongeun; Ki, Chang-Seok; Kim, Jae-Seok; Seong, Moon-Woo; Lee, Hyukmin

2016-01-01

Background Real-time reverse transcription PCR (rRT-PCR) of sputum samples is commonly used to diagnose Middle East respiratory syndrome coronavirus (MERS-CoV) infection. Owing to the difficulty of extracting RNA from sputum containing mucus, sputum homogenization is desirable prior to nucleic acid isolation. We determined optimal homogenization methods for isolating viral nucleic acids from sputum. Methods We evaluated the following three sputum-homogenization methods: proteinase K and DNase I (PK-DNase) treatment, phosphate-buffered saline (PBS) treatment, and N-acetyl-L-cysteine and sodium citrate (NALC) treatment. Sputum samples were spiked with inactivated MERS-CoV culture isolates. RNA was extracted from pretreated, spiked samples using the easyMAG system (bioMérieux, France). Extracted RNAs were then subjected to rRT-PCR for MERS-CoV diagnosis (DiaPlex Q MERS-coronavirus, SolGent, Korea). Results While analyzing 15 spiked sputum samples prepared in technical duplicate, false-negative results were obtained with five (16.7%) and four samples (13.3%), respectively, by using the PBS and NALC methods. The range of threshold cycle (Ct) values observed when detecting upE in sputum samples was 31.1–35.4 with the PK-DNase method, 34.7–39.0 with the PBS method, and 33.9–38.6 with the NALC method. Compared with the control, which were prepared by adding a one-tenth volume of 1:1,000 diluted viral culture to PBS solution, the ranges of Ct values obtained by the PBS and NALC methods differed significantly from the mean control Ct of 33.2 (both P<0.0001). Conclusions The PK-DNase method is suitable for homogenizing sputum samples prior to RNA extraction. PMID:27374711

Evaluation of Targeted Next-Generation Sequencing for Detection of Bovine Pathogens in Clinical Samples.

PubMed

Anis, Eman; Hawkins, Ian K; Ilha, Marcia R S; Woldemeskel, Moges W; Saliki, Jeremiah T; Wilkes, Rebecca P

2018-07-01

The laboratory diagnosis of infectious diseases, especially those caused by mixed infections, is challenging. Routinely, it requires submission of multiple samples to separate laboratories. Advances in next-generation sequencing (NGS) have provided the opportunity for development of a comprehensive method to identify infectious agents. This study describes the use of target-specific primers for PCR-mediated amplification with the NGS technology in which pathogen genomic regions of interest are enriched and selectively sequenced from clinical samples. In the study, 198 primers were designed to target 43 common bovine and small-ruminant bacterial, fungal, viral, and parasitic pathogens, and a bioinformatics tool was specifically constructed for the detection of targeted pathogens. The primers were confirmed to detect the intended pathogens by testing reference strains and isolates. The method was then validated using 60 clinical samples (including tissues, feces, and milk) that were also tested with other routine diagnostic techniques. The detection limits of the targeted NGS method were evaluated using 10 representative pathogens that were also tested by quantitative PCR (qPCR), and the NGS method was able to detect the organisms from samples with qPCR threshold cycle ( C T ) values in the 30s. The method was successful for the detection of multiple pathogens in the clinical samples, including some additional pathogens missed by the routine techniques because the specific tests needed for the particular organisms were not performed. The results demonstrate the feasibility of the approach and indicate that it is possible to incorporate NGS as a diagnostic tool in a cost-effective manner into a veterinary diagnostic laboratory. Copyright © 2018 Anis et al.

Development of a high-speed real-time PCR system for rapid and precise nucleotide recognition

NASA Astrophysics Data System (ADS)

Terazono, Hideyuki; Takei, Hiroyuki; Hattori, Akihiro; Yasuda, Kenji

2010-04-01

Polymerase chain reaction (PCR) is a common method used to create copies of a specific target region of a DNA sequence and to produce large quantities of DNA. A few DNA molecules, which act as templates, are rapidly amplified by PCR into many billions of copies. PCR is a key technology in genome-based biological analysis, revolutionizing many life science fields such as medical diagnostics, food safety monitoring, and countermeasures against bioterrorism. Thus, many applications have been developed with the thermal cycling. For these PCR applications, one of the most important key factors is reduction in the data acquisition time. To reduce the acquisition time, it is necessary to decrease the temperature transition time between the high and low ends as much as possible. We have developed a novel rapid real-time PCR system based on rapid exchange of media maintained at different temperatures. This system consists of two thermal reservoirs and a reaction chamber for PCR observation. The temperature transition was achieved within 0.3 sec, and good thermal stability was achieved during thermal cycling with rapid exchange of circulating media. This system allows rigorous optimization of the temperatures required for each stage of the PCR processes. Resulting amplicons were confirmed by electrophoresis. Using the system, rapid DNA amplification was accomplished within 3.5 min, including initial heating and complete 50 PCR cycles. It clearly shows that the device could allow us faster temperature switching than the conventional conduction-based heating systems based on Peltier heating/cooling.

Inhibition mechanisms of hemoglobin, immunoglobulin G, and whole blood in digital and real-time PCR.

PubMed

Sidstedt, Maja; Hedman, Johannes; Romsos, Erica L; Waitara, Leticia; Wadsö, Lars; Steffen, Carolyn R; Vallone, Peter M; Rådström, Peter

2018-04-01

Blood samples are widely used for PCR-based DNA analysis in fields such as diagnosis of infectious diseases, cancer diagnostics, and forensic genetics. In this study, the mechanisms behind blood-induced PCR inhibition were evaluated by use of whole blood as well as known PCR-inhibitory molecules in both digital PCR and real-time PCR. Also, electrophoretic mobility shift assay was applied to investigate interactions between inhibitory proteins and DNA, and isothermal titration calorimetry was used to directly measure effects on DNA polymerase activity. Whole blood caused a decrease in the number of positive digital PCR reactions, lowered amplification efficiency, and caused severe quenching of the fluorescence of the passive reference dye 6-carboxy-X-rhodamine as well as the double-stranded DNA binding dye EvaGreen. Immunoglobulin G was found to bind to single-stranded genomic DNA, leading to increased quantification cycle values. Hemoglobin affected the DNA polymerase activity and thus lowered the amplification efficiency. Hemoglobin and hematin were shown to be the molecules in blood responsible for the fluorescence quenching. In conclusion, hemoglobin and immunoglobulin G are the two major PCR inhibitors in blood, where the first affects amplification through a direct effect on the DNA polymerase activity and quenches the fluorescence of free dye molecules, and the latter binds to single-stranded genomic DNA, hindering DNA polymerization in the first few PCR cycles. Graphical abstract PCR inhibition mechanisms of hemoglobin and immunoglobulin G (IgG). Cq quantification cycle, dsDNA double-stranded DNA, ssDNA single-stranded DNA.

Simultaneous genotyping of single-nucleotide polymorphisms in alcoholism-related genes using duplex and triplex allele-specific PCR with two-step thermal cycles.

PubMed

Shirasu, Naoto; Kuroki, Masahide

2014-01-01

We developed a time- and cost-effective multiplex allele-specific polymerase chain reaction (AS-PCR) method based on the two-step PCR thermal cycles for genotyping single-nucleotide polymorphisms in three alcoholism-related genes: alcohol dehydrogenase 1B, aldehyde dehydrogenase 2 and μ-opioid receptor. Applying MightyAmp(®) DNA polymerase with optimized AS-primers and PCR conditions enabled us to achieve effective and selective amplification of the target alleles from alkaline lysates of a human hair root, and simultaneously to determine the genotypes within less than 1.5 h using minimal lab equipment.

Exploring the microbially-mediated soil H2 sink: A lab-based study of the physiology and related H2 consumption of isolates from the Harvard Forest

NASA Astrophysics Data System (ADS)

Rao, D.; Meredith, L. K.; Bosak, T.; Hansel, C. M.; Ono, S.; Prinn, R. G.

2012-12-01

Atmospheric hydrogen (H2) is a secondary greenhouse gas because it attenuates the removal of methane (CH4) from the atmosphere. The largest and most uncertain term in the H2 biogeochemical cycle, microbe-mediated soil uptake, is responsible for about 80% of Earth's tropospheric H2 sink. Recently, the first H2-oxidizing soil microorganisms were discovered (genus Streptomyces) whose low-threshold, high-affinity NiFe-hydrogenase functions at ambient H2 levels (approx. 530 ppb). To better understand the ecological function of this hydrogenase, we conducted a controlled laboratory study of the H2 uptake behavior in accordance with the complex life cycle development of the streptomycetes. Several strains of the genus Streptomyces containing a high-affinity NiFe- hydrogenase were isolated from soil at the Harvard Forest. The presence of this hydrogenase, detected by PCR amplification of the hydrogenase large subunit, predicted H2 uptake behavior in wild-type streptomycetes and in phylogenetically different organisms containing more distantly related versions of the gene. H2 uptake depended on the streptomyces' life cycle, reaching a maximum during spore formation. These findings reveal connections between environmental conditions, organismal life cycle, and H2 uptake. With the rise of H2-based energy sources and a potential change in the tropospheric concentration of H2, understanding the sources and sinks of this trace gas is important for the future.

A Randomized, Controlled Trial of ZMapp for Ebola Virus Infection

PubMed Central

2016-01-01

BACKGROUND Data from studies in nonhuman primates suggest that the triple monoclonal antibody cocktail ZMapp is a promising immune-based treatment for Ebola virus disease (EVD). METHODS Beginning in March 2015, we conducted a randomized, controlled trial of ZMapp plus the current standard of care as compared with the current standard of care alone in patients with EVD that was diagnosed in West Africa by polymerase-chain-reaction (PCR) assay. Eligible patients of any age were randomly assigned in a 1:1 ratio to receive either the current standard of care or the current standard of care plus three intravenous infusions of ZMapp (50 mg per kilogram of body weight, administered every third day). Patients were stratified according to baseline PCR cycle-threshold value for the virus (≤22 vs. >22) and country of enrollment. Oral favipiravir was part of the current standard of care in Guinea. The primary end point was mortality at 28 days. RESULTS A total of 72 patients were enrolled at sites in Liberia, Sierra Leone, Guinea, and the United States. Of the 71 patients who could be evaluated, 21 died, representing an overall case fatality rate of 30%. Death occurred in 13 of 35 patients (37%) who received the current standard of care alone and in 8 of 36 patients (22%) who received the current standard of care plus ZMapp. The observed posterior probability that ZMapp plus the current standard of care was superior to the current standard of care alone was 91.2%, falling short of the prespecified threshold of 97.5%. Frequentist analyses yielded similar results (absolute difference in mortality with ZMapp, −15 percentage points; 95% confidence interval, −36 to 7). Baseline viral load was strongly predictive of both mortality and duration of hospitalization in all age groups. CONCLUSIONS In this randomized, controlled trial of a putative therapeutic agent for EVD, although the estimated effect of ZMapp appeared to be beneficial, the result did not meet the prespecified statistical threshold for efficacy. (Funded by the National Institute of Allergy and Infectious Diseases and others; PREVAIL II ClinicalTrials.gov number, NCT02363322.) PMID:27732819

Impact of treatment characteristics on response of different breast cancer phenotypes: pooled analysis of the German neo-adjuvant chemotherapy trials.

PubMed

von Minckwitz, Gunter; Untch, Michael; Nüesch, Eveline; Loibl, Sibylle; Kaufmann, Manfred; Kümmel, Sherko; Fasching, Peter A; Eiermann, Wolfgang; Blohmer, Jens-Uwe; Costa, Serban Dan; Mehta, Keyur; Hilfrich, Jörn; Jackisch, Christian; Gerber, Bernd; du Bois, Andreas; Huober, Jens; Hanusch, Claus; Konecny, Gottfried; Fett, Werner; Stickeler, Elmar; Harbeck, Nadia; Müller, Volkmar; Jüni, Peter

2011-01-01

Pathological complete response (pCR) to neoadjuvant treatment correlates with outcome in breast cancer. We determined whether characteristics of neoadjuvant therapy are associated with pCR. We used multi-level models, which accounted for heterogeneity in pCR across trials and trial arms, to analyze individual patient data from 3332 women included in 7 German neoadjuvant trials with uniform protocols. PCR was associated with an increase in number of chemotherapy cycles (odds ratio [OR] 1.2 for every two additional cycles; P = 0.009), with higher cumulative anthracycline doses (OR 1.6; P = 0.002), higher cumulative taxane doses (OR 1.6; P = 0.009), and with capecitabine containing regimens (OR 1.62; P = 0.022). Association of pCR with increase in number of cycles appeared more pronounced in hormone receptor (HR)-positive tumors (OR 1.35) than in HR-negative tumors (OR 1.04; P for interaction = 0.046). Effect of anthracycline dose was particularly pronounced in HER2-negative tumors (OR 1.61), compared to HER2-positive tumors (OR 0.83; P for interaction = 0.14). Simultaneous trastuzumab treatment in HER2-positive tumors increased odds of pCR 3.2-fold (P < 0.001). No association of pCR and number of trastuzumab cycles was found (OR 1.20, P = 0.39). Dosing characteristics appear important for successful treatment of breast cancer. Longer treatment, higher cumulative doses of anthracyclines and taxanes, and the addition of capecitabine and trastuzumab are associated with better response. Tailoring according to breast cancer phenotype might be possible: longer treatment in HR-positive tumors, higher cumulative anthracycline doses for HER2-negative tumors, shorter treatment at higher cumulative doses for triple-negative tumors, and limited number of preoperative trastuzumab cycles in HER2-positive tumors.

Development of a sensitive and quantitative diagnostic assay for fish nervous necrosis virus based on two-target real-time PCR.

PubMed

Dalla Valle, L; Toffolo, V; Lamprecht, M; Maltese, C; Bovo, G; Belvedere, P; Colombo, L

2005-10-31

The aim of the present work was to develop two new independent SYBR Green I-based real-time PCR assays for both detection and quantification of betanodavirus, an RNA virus that infects several species of marine teleost fish causing massive mortalities in larvae and juveniles. The assays utilized two pairs of primers targeting highly conserved regions of both the RNA molecules forming the betanodavirus genome: RNA1 encoding the RNA-dependent RNA polymerase (RdRP) and RNA2 encoding the coat protein (CP). The specificity of amplifications was monitored by the melting analysis and agarose gel electrophoresis of the amplified products. The applicability of these assays was confirmed with 21 betanodavirus strains, covering all the four main clades. In addition, a BLAST (NCBI) search with the primer sequences showed no genomic cross-reactivity with other viruses. The new assays were able to quantify concentrations of betanodavirus genes ranging from 10(1) to 10(8) copies per reaction. The intra-assay coefficients of variation (CV) of threshold cycle (Ct) values of the assays were 1.5% and 1.4% for CP and RdRP RNAs, respectively. The inter-assay CVs of Ct values were 2.3% and 2.4% for CP and RdRP RNAs, respectively. Moreover, regression analysis showed a significant correlation (R2>0.97) between genome number, as determined by real-time PCR assays and the corresponding virus titer expressed as TCID50/ml of two different betanodavirus strains propagated in cell culture. The two assays were compared with a previously established one-step RT-PCR assay and with the classical virus isolation test and found to be more sensitive. In conclusion, the developed real-time RT-PCR assays are a reliable, specific and sensitive tool for the quantitative diagnosis of betanodavirus.

Detection and semi-quantification of Strongylus vulgaris DNA in equine faeces by real-time quantitative PCR.

PubMed

Nielsen, Martin K; Peterson, David S; Monrad, Jesper; Thamsborg, Stig M; Olsen, Susanne N; Kaplan, Ray M

2008-03-01

Strongylus vulgaris is an important strongyle nematode with high pathogenic potential infecting horses world-wide. Several decades of intensive anthelmintic use has virtually eliminated clinical disease caused by S. vulgaris, but has also caused high levels of anthelmintic resistance in equine small strongyle (cyathostomin) nematodes. Recommendations aimed at limiting the development of anthelmintic resistance by reducing treatment intensity raises a simultaneous demand for reliable and accurate diagnostic tools for detecting important parasitic pathogens. Presently, the only means available to differentiate among strongyle species in a faecal sample is by identifying individual L3 larvae following a two week coproculture procedure. The aim of the present study is to overcome this diagnostic obstacle by developing a fluorescence-based quantitative PCR assay capable of identifying S. vulgaris eggs in faecal samples from horses. Species-specific primers and a TaqMan probe were designed by alignment of published ribosomal DNA sequences of the second internal transcribed spacer of cyathostomin and Strongylus spp. nematodes. The assay was tested for specificity and optimized using genomic DNA extracted from identified male worms of Strongylus and cyathostomin species. In addition, eggs were collected from adult female worms and used to evaluate the quantitative potential of the assay. Statistically significant linear relationships were found between egg numbers and cycle of threshold (Ct) values. PCR results were unaffected by the presence of cyathostomin DNA in the sample and there was no indication of PCR inhibition by faecal sources. A field evaluation on faecal samples obtained from four Danish horse farms revealed a good agreement with the traditional larval culture (kappa-value=0.78), but with a significantly higher performance of the PCR assay. An association between Ct values and S. vulgaris larval counts was statistically significant. The present assay can reliably and semi-quantitatively detect minute quantities of S. vulgaris eggs in faecal samples.

Free circulating nucleic acids in plasma and serum as a novel approach to the use of internal controls in real time PCR based detection.

PubMed

Karataylı, Ersin; Altunoğlu, Yasemin Çelik; Karataylı, Senem Ceren; Yurdaydın, Cihan; Bozdayı, A Mithat

2014-10-01

Internal controls (ICs), are the main components of any real-time PCR based amplification methods, which are co-purified and co-amplified with the actual target. The existence of free circulating nucleic acids in plasma and serum (CNAPS) has been known for many years. The aim of this study was to verify whether CNAPS can be used as ICs in real-time PCR based detection and quantification of DNA or RNA targets in plasma and serum samples. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a housekeeping gene, was chosen at random as CNAPS to serve as an intrinsic internal control in two different real-time PCR based quantification models in plasma and serum. Viral loads of hepatitis B virus (HBV) DNA and hepatitis delta virus (HDV) RNA were quantified as actual targets in parallel to GAPDH as IC in a total of 519 serum or plasma samples including 21 healthy controls, 202 positive chronic hepatitis delta patients, 37 chronic hepatitis C patients, 168 chronic hepatitis B patients, 52 patients with hepatocellular carcinoma, and 39 patients with non-alcoholic steatohepatitis/non-alcoholic fatty liver disease. GAPDH levels did not show significant variance in different patient groups and yielded positive signals in all 519 patients with persistent cycle threshold (CT) values 27.85±1.57 (mean±standard deviation (SD)). Reproducibility of the GAPDH amplification in HDV RNA and HBV DNA quantifications was shown with a SD value of CT ranging from 0.42 to 2.14 (mean SD; 1.18) and 0.24 to 1.75 (mean SD; 1.03), respectively. In conclusion, the freely circulating nucleic acids can clearly be used as internal controls for real-time PCR based detection and quantification of any RNA and mainly DNA targets (pathogens) in serum or plasma and this simply excludes the compulsory external addition of any IC molecules into the reaction. Copyright © 2014 Elsevier B.V. All rights reserved.

Detection of Pneumocystis jirovecii by Quantitative PCR To Differentiate Colonization and Pneumonia in Immunocompromised HIV-Positive and HIV-Negative Patients

PubMed Central

Hasseine, L.; Gari-Toussaint, M.; Casanova, V.; Marty, P. M.; Pomares, C.

2016-01-01

Pneumocystis jirovecii pneumonia (PCP) is an acute and life-threatening lung disease caused by the fungus Pneumocystis jirovecii. The presentation of PCP in HIV-positive patients is well-known and consists of a triad of dyspnea, fever, and cough, whereas the presentation of PCP in HIV-negative patients is atypical and consists of a sudden outbreak, O2 desaturation, and a rapid lethal outcome without therapy. Despite the availability of direct and indirect identification methods, the diagnosis of PCP remains difficult. The cycle threshold (CT) values obtained by quantitative PCR (qPCR) allow estimation of the fungal burden. The more elevated that the fungal burden is, the higher the probability that the diagnosis is pneumonia. The purposes of the present study were to evaluate the CT values to differentiate colonization and pneumonia in a population of immunocompromised patients overall and patients stratified on the basis of their HIV infection status. Testing of bronchoalveolar lavage (BAL) fluid samples from the whole population of qPCR-positive patients showed a mean CT value for patients with PCP of 28 (95% confidence interval [CI], 26 to 30) and a mean CT value for colonized patients of 35 (95% CI, 34 to 36) (P < 10−3). For the subgroup of HIV-positive patients, we demonstrated that a CT value below 27 excluded colonization and a CT value above 30 excluded PCP with a specificity of 100% and a sensitivity of 80%, respectively. In the subgroup of HIV-negative patients, we demonstrated that a CT value below 31 excluded colonization and a CT value above 35 excluded PCP with a specificity of 80% and a sensitivity of 80%, respectively. Thus, qPCR of BAL fluid samples is an important tool for the differentiation of colonization and pneumonia in P. jirovecii-infected immunocompromised patients and patients stratified on the basis of HIV infection status with different CT values. PMID:27008872

Detection of Pneumocystis jirovecii by Quantitative PCR To Differentiate Colonization and Pneumonia in Immunocompromised HIV-Positive and HIV-Negative Patients.

PubMed

Fauchier, T; Hasseine, L; Gari-Toussaint, M; Casanova, V; Marty, P M; Pomares, C

2016-06-01

Pneumocystis jirovecii pneumonia (PCP) is an acute and life-threatening lung disease caused by the fungus Pneumocystis jirovecii The presentation of PCP in HIV-positive patients is well-known and consists of a triad of dyspnea, fever, and cough, whereas the presentation of PCP in HIV-negative patients is atypical and consists of a sudden outbreak, O2 desaturation, and a rapid lethal outcome without therapy. Despite the availability of direct and indirect identification methods, the diagnosis of PCP remains difficult. The cycle threshold (CT) values obtained by quantitative PCR (qPCR) allow estimation of the fungal burden. The more elevated that the fungal burden is, the higher the probability that the diagnosis is pneumonia. The purposes of the present study were to evaluate the CT values to differentiate colonization and pneumonia in a population of immunocompromised patients overall and patients stratified on the basis of their HIV infection status. Testing of bronchoalveolar lavage (BAL) fluid samples from the whole population of qPCR-positive patients showed a mean CT value for patients with PCP of 28 (95% confidence interval [CI], 26 to 30) and a mean CT value for colonized patients of 35 (95% CI, 34 to 36) (P < 10(-3)). For the subgroup of HIV-positive patients, we demonstrated that a CT value below 27 excluded colonization and a CT value above 30 excluded PCP with a specificity of 100% and a sensitivity of 80%, respectively. In the subgroup of HIV-negative patients, we demonstrated that a CT value below 31 excluded colonization and a CT value above 35 excluded PCP with a specificity of 80% and a sensitivity of 80%, respectively. Thus, qPCR of BAL fluid samples is an important tool for the differentiation of colonization and pneumonia in P. jirovecii-infected immunocompromised patients and patients stratified on the basis of HIV infection status with different CT values. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Characterization of neuroendocrine tumors of the pancreas by real-time quantitative polymerase chain reaction. A methodological approach.

PubMed

Annaratone, Laura; Volante, Marco; Asioli, Sofia; Rangel, Nelson; Bussolati, Gianni

2013-06-01

The aim of this study was to assess the suitability of using real-time quantitative PCR (RT-qPCR) to characterize neuroendocrine (NE) tumors of the pancreas. For a series of tumors, we evaluated several genes of interest, and the data were matched with the "classical" immunohistochemical (IHC) features. In 21 cases, we extracted RNA from formalin-fixed paraffin-embedded (FFPE) blocks, and in nine cases, we also extracted RNA from fresh-frozen tissue. The RT-qPCR procedure was performed using two sets of customized arrays. The test using the first set, covering 96 genes of interest, was focused on assessing the feasibility of the procedure, and the results were used to select 18 genes indicative of NE differentiation, clinical behavior, and therapeutic responsiveness for use in the second set of arrays. Threshold cycle (Ct) values were used to calculate the fold-changes in gene expression using the 2-∆∆Ct method. Statistical procedures were used to analyze the results, which were matched with the IHC and follow-up data. Material from fresh-frozen samples performed better in terms of the level of amplification, but acceptable and concordant results were also obtained from FFPE samples. In addition, high concordance was observed between the mRNA and protein expression levels of somatostatin receptor type 2A (R = 0.52, p = 0.016). Genes associated with NE differentiation, as well as the gastrin-releasing peptide receptor and O-6-methylguanine-DNA methyltransferase genes, were underexpressed, whereas angiogenesis-associated markers (CDH13 and SLIT2) were overexpressed in tissues with malignant behavior. The RT-qPCR procedure is practical and feasible in economic terms for the characterization of NE tumors of the pancreas and can complement morphological and IHC-based evaluations. Thus, the results of the RT-qPCR procedure might offer an objective basis for therapeutic choices.

[Analysis of the mRNA expression of the S100β protein in adipocytes of patients with diabetes mellitus, type 2].

PubMed

Hamasaki, Mike Yoshio; Hirata, Mario Hiroyuki; Hirata, Rosario Dominguez Crespo; Himelfarb, Silvia Tchernin; Campos, Leila Maria Guissoni; Nogueira, Maria Inês

2012-10-01

This study aims to explore the possible relationship between the expression level of S100β protein mRNA with diabetes mellitus type 2 in adipocytes from patients with this disease in comparison with normoglycemic individuals. Samples of adipose tissue of eight patients from the coronary section of the Institute Dante Pazzanese of Cardiology (IDPC), four in Group Diabetes and four of Normoglycemic group, were evaluated by RT-PCR real time. An increase around 15 times values, between the threshold cycle (ΔCt), of mRNA expression of S100β protein in adipocytes of the diabetes group was observed in comparison to the control group (p = 0.015). Our results indicate, for the first time, that there is coexistence of increased expression of the S100β and the type 2 diabetes mellitus gene.

Detection of West Nile virus lineage 2 in the urine of acute human infections.

PubMed

Papa, Anna; Testa, Theodolinda; Papadopoulou, Elpida

2014-12-01

West Nile virus (WNV) lineage 2 emerged in Greece in 2010 and since then outbreaks in humans have been reported for four consecutive years. Laboratory diagnosis is based mainly on serology. A real-time RT-PCR was applied on urine samples obtained from 35 patients with acute WNV infection. WNV RNA was detected in 40% of the samples with cycle threshold (CT) values ranging from 26.95 to 39.89 (mean 33.11). WNV was isolated from two of four urine samples with low CT (<30). Viral load was not associated with patients' age, sex, day of illness, presence of WNV antibodies, and neurological symptoms. However, it seems that sample shipment and storage conditions are very important for virus detection and isolation. The usefulness of the WNV RNA detection in urine as a diagnostic tool of acute WNV infections is discussed. © 2014 Wiley Periodicals, Inc.

On-chip isothermal, chemical cycling polymerase chain reaction (ccPCR)

NASA Astrophysics Data System (ADS)

Persat, Alexandre; Santiago, Juan

2008-11-01

We demonstrate a novel ccPCR technique for microfluidic DNA amplification where temperature is held constant in space and time. The polymerase chain reaction is a platform of choice for biological assays and typically based on a three-step thermal cycling: DNA denaturation, primers annealing and extension by an enzyme. We here demonstrate a novel technique where high concentration chemical denaturants (solvents) denature DNA. We leverage the high electrophoretic mobility of DNA and the electrical neutrality of denaturants to achieve chemical cycling. We focus DNA with isotachophoresis (ITP); a robust electrophoretic preconcentration technique which generates strong electric field gradients and protects the sample from dispersion. We apply a pressure-driven flow to balance electromigration velocity and keep the DNA sample stationary in a microchannel. We drive the DNA through a series of high denaturant concentration zones. DNA denatures at high denaturant concentration. At low denaturant concentration, the enzyme creates complementary strands. DNA reaction kinetics are slower than buffer reactions involved in ITP. We demonstrate successful ccPCR amplification for detection of E. Coli. The ccPCR has the potential for simpler chemistry than traditional PCR.

MAMMALIAN DNA IN PCR REAGENTS

EPA Science Inventory

Ancient DNA analysis is becoming widespread. These studies use polymerase chain reaction (PCR) to amplify minute quantities of heavily damaged template. Unusual steps are taken to achieve the sensitivity necessary to detect ancient DNA, including high- cycle PCR amplification t...

Simultaneous detection of multiple HPV DNA via bottom-well microfluidic chip within an infra-red PCR platform.

PubMed

Liu, Wenjia; Warden, Antony; Sun, Jiahui; Shen, Guangxia; Ding, Xianting

2018-03-01

Portable Polymerase Chain Reaction (PCR) devices combined with microfluidic chips or lateral flow stripes have shown great potential in the field of point-of-need testing (PoNT) as they only require a small volume of patient sample and are capable of presenting results in a short time. However, the detection for multiple targets in this field leaves much to be desired. Herein, we introduce a novel PCR platform by integrating a bottom-well microfluidic chip with an infra-red (IR) excited temperature control method and fluorescence co-detection of three PCR products. Microfluidic chips are utilized to partition different samples into individual bottom-wells. The oil phase in the main channel contains multi-walled carbon nanotubes which were used as a heat transfer medium that absorbs energy from the IR-light-emitting diode (LED) and transfers heat to the water phase below. Cyclical rapid heating and cooling necessary for PCR are achieved by alternative power switching of the IR-LED and Universal Serial Bus (USB) mini-fan with a pulse width modulation scheme. This design of the IR-LED PCR platform is economic, compact, and fully portable, making it a promising application in the field of PoNT. The bottom-well microfluidic chip and IR-LED PCR platform were combined to fulfill a three-stage thermal cycling PCR for 40 cycles within 90 min for Human Papilloma Virus (HPV) detection. The PCR fluorescent signal was successfully captured at the end of each cycle. The technique introduced here has broad applications in nucleic acid amplification and PoNT devices.

Quantification of Agrobacterium tumefaciens C58 attachment to Arabidopsis thaliana roots.

PubMed

Petrovicheva, Anna; Joyner, Jessica; Muth, Theodore R

2017-10-02

Agrobacterium tumefaciens is the causal agent of crown gall disease and is a vector for DNA transfer in transgenic plants. The transformation process by A. tumefaciens has been widely studied, but the attachment stage has not been well characterized. Most measurements of attachment have used microscopy and colony counting, both of which are labor and time intensive. To reduce the time and effort required to analyze bacteria attaching to plant tissues, we developed a quantitative real-time PCR (qPCR) assay to quantify attached A. tumefaciens using the chvE gene as marker for the presence of the bacteria. The qPCR detection threshold of A. tumefaciens from pure culture was 104 cell equivalents/ml. The A. tumefaciens minimum threshold concentration from root-bound populations was determined to be 105 cell equivalents/ml inoculum to detect attachment above background. The qPCR assay can be used for measuring A. tumefaciens attachment in applications such as testing the effects of mutations on bacterial adhesion molecules or biofilm formation, comparing attachment across various plant species and ecotypes, and detecting mutations in putative attachment receptors expressed in plant roots. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Lethal infection thresholds of Paenibacillus larvae for honeybee drone and worker larvae (Apis mellifera).

PubMed

Behrens, Dieter; Forsgren, Eva; Fries, Ingemar; Moritz, Robin F A

2010-10-01

We compared the mortality of honeybee (Apis mellifera) drone and worker larvae from a single queen under controlled in vitro conditions following infection with Paenibacillus larvae, a bacterium causing the brood disease American Foulbrood (AFB). We also determined absolute P. larvae cell numbers and lethal titres in deceased individuals of both sexes up to 8 days post infection using quantitative real-time PCR (qPCR). Our results show that in drones the onset of infection induced mortality is delayed by 1 day, the cumulative mortality is reduced by 10% and P. larvae cell numbers are higher than in worker larvae. Since differences in bacterial cell titres between sexes can be explained by differences in body size, larval size appears to be a key parameter for a lethal threshold in AFB tolerance. Both means and variances for lethal thresholds are similar for drone and worker larvae suggesting that drone resistance phenotypes resemble those of related workers. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.

Technical note: development of a quantitative PCR method for monitoring strain dynamics during yogurt manufacture.

PubMed

Miller, D M; Dudley, E G; Roberts, R F

2012-09-01

Yogurt starter cultures may consist of multiple strains of Lactobacillus delbrueckii ssp. bulgaricus (LB) and Streptococcus thermophilus (ST). Conventional plating methods for monitoring LB and ST levels during yogurt manufacture do not allow for quantification of individual strains. The objective of the present work was to develop a quantitative PCR method for quantification of individual strains in a commercial yogurt starter culture. Strain-specific primers were designed for 2 ST strains (ST DGCC7796 and ST DGCC7710), 1 LB strain (DGCC4078), and 1 Lactobacillus delbrueckii ssp. lactis strain (LL; DGCC4550). Primers for the individual ST and LB strains were designed to target unique DNA sequences in clustered regularly interspersed short palindromic repeats. Primers for LL were designed to target a putative mannitol-specific IIbC component of the phosphotransferase system. Following evaluation of primer specificity, standard curves relating cell number to cycle threshold were prepared for each strain individually and in combination in yogurt mix, and no significant differences in the slopes were observed. Strain balance data was collected for yogurt prepared at 41 and 43°C to demonstrate the potential application of this method. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Presence of Borrelia spp. DNA in ticks, but absence of Borrelia spp. and of Leptospira spp. DNA in blood of fever patients in Madagascar.

PubMed

Hagen, Ralf Matthias; Frickmann, Hagen; Ehlers, Julian; Krüger, Andreas; Margos, Gabriele; Hizo-Teufel, Cecilia; Fingerle, Volker; Rakotozandrindrainy, Raphael; Kalckreuth, Vera von; Im, Justin; Pak, Gi Deok; Jeon, Hyon Jin; Rakotondrainiarivelo, Jean Philibert; Heriniaina, Jean Noël; Razafindrabe, Tsiry; Konings, Frank; May, Jürgen; Hogan, Benedikt; Ganzhorn, Jörg; Panzner, Ursula; Schwarz, Norbert Georg; Dekker, Denise; Marks, Florian; Poppert, Sven

2018-01-01

The occurrence of tick-borne relapsing fever and leptospirosis in humans in Madagascar remains unclear despite the presence of their potential vectors and reservoir hosts. We screened 255 Amblyomma variegatum ticks and 148 Rhipicephalus microplus ticks from Zebu cattle in Madagascar for Borrelia-specific DNA. Borrelia spp. DNA was detected in 21 Amblyomma variegatum ticks and 2 Rhipicephalus microplus ticks. One Borrelia found in one Rhipicephalus microplus showed close relationship to Borrelia theileri based on genetic distance and phylogenetic analyses on 16S rRNA and flaB sequences. The borreliae from Amblyomma variegatum could not be identified due to very low quantities of present DNA reflected by high cycle threshold values in real-time-PCR. It is uncertain whether these low numbers of Borrelia spp. are sufficient for transmission of infection from ticks to humans. In order to determine whether spirochaete infections are relevant in humans, blood samples of 1009 patients from the highlands of Madagascar with fever of unknown origin were screened for Borrelia spp. - and in addition for Leptospira spp. - by real-time PCR. No target DNA was detected, indicating a limited relevance of these pathogens for humans in the highlands of Madagascar. Copyright © 2017 Elsevier B.V. All rights reserved.

Selection of Reference Genes for Quantitative Gene Expression in Porcine Mesenchymal Stem Cells Derived from Various Sources along with Differentiation into Multilineages

PubMed Central

Lee, Won-Jae; Jeon, Ryoung-Hoon; Jang, Si-Jung; Park, Ji-Sung; Lee, Seung-Chan; Baregundi Subbarao, Raghavendra; Lee, Sung-Lim; Park, Bong-Wook; King, William Allan; Rho, Gyu-Jin

2015-01-01

The identification of stable reference genes is a prerequisite for ensuring accurate validation of gene expression, yet too little is known about stable reference genes of porcine MSCs. The present study was, therefore, conducted to assess the stability of reference genes in porcine MSCs derived from bone marrow (BMSCs), adipose (AMSCs), and skin (SMSCs) with their in vitro differentiated cells into mesenchymal lineages such as adipocytes, osteocytes, and chondrocytes. Twelve commonly used reference genes were investigated for their threshold cycle (Ct) values by qRT-PCR. The Ct values of candidate reference genes were analyzed by geNorm software to clarify stable expression regardless of experimental conditions. Thus, Pearson's correlation was applied to determine correlation between the three most stable reference genes (NF3) and optimal number of reference genes (NFopt). In assessment of stability of reference gene across experimental conditions by geNorm analysis, undifferentiated MSCs and each differentiated status into mesenchymal lineages showed slightly different results but similar patterns about more or less stable rankings. Furthermore, Pearson's correlation revealed high correlation (r > 0.9) between NF3 and NFopt. Overall, the present study showed that HMBS, YWHAZ, SDHA, and TBP are suitable reference genes for qRT-PCR in porcine MSCs. PMID:25972899

Cutaneous lesions in pet rabbits following subcutaneous administration of a novel bivalent vaccine against myxomatosis and rabbit haemorrhagic disease.

PubMed

Selleri, Paolo; Di Girolamo, Nicola; Vögtlin, Andrea; Fileccia, Ivan; Hoop, Richard; Bongiovanni, Laura

2014-12-01

A novel bivalent vaccine to protect against myxomatosis and rabbit haemorrhagic disease is commercially available for pet rabbits. To describe the appearance of cutaneous lesions arising in pet rabbits positive for myxoma virus (MV) by RT-PCR evaluation shortly after vaccination. Four pet rabbits presenting with papular, crusting skin lesions ~10 days after vaccination. Histological evaluation of formalin-fixed skin biopsies obtained from lesional skin (case 1). Real-time polymerase chain reaction (RT-PCR) evaluation of paraffin-embedded tissue from skin biopsies (case 1) and crusts obtained from the lesion surface (cases 2-4) for myxoma virus are reported as cycle threshold (Ct ) values. Lesions affecting the ear pinna, dorsal aspect of the nose, vulva and/or conjunctiva are reported. Histopathological findings included severe ulcerative, necrotizing dermatitis and intralesional cytoplasmic inclusion bodies in myxoma cells. DNA was amplified from all the paraffin-embedded skin biopsies (Ct  = 34-35) and crusts (Ct  = 20-24). Although a wild virus challenge cannot be definitively excluded, veterinarians and pet-owners should be aware that cutaneous lesions have been observed after vaccination with this novel vaccine in low numbers of rabbits. © 2014 ESVD and ACVD.

Development of duplex real-time PCR for the detection of WSSV and PstDV1 in cultivated shrimp.

PubMed

Leal, Carlos A G; Carvalho, Alex F; Leite, Rômulo C; Figueiredo, Henrique C P

2014-07-05

The White spot syndrome virus (WSSV) and Penaeus stylirostris penstyldensovirus 1 (previously named Infectious hypodermal and hematopoietic necrosis virus-IHHNV) are two of the most important viral pathogens of penaeid shrimp. Different methods have been applied for diagnosis of these viruses, including Real-time PCR (qPCR) assays. A duplex qPCR method allows the simultaneous detection of two viruses in the same sample, which is more cost-effective than assaying for each virus separately. Currently, an assay for the simultaneous detection of the WSSV and the PstDV1 in shrimp is unavailable. The aim of this study was to develop and standardize a duplex qPCR assay for the simultaneous detection of the WSSV and the PstDV1 in clinical samples of diseased L. vannamei. In addition, to evaluate the performance of two qPCR master mixes with regard to the clinical sensitivity of the qPCR assay, as well as, different methods for qPCR results evaluation. The duplex qPCR assay for detecting WSSV and PstDV1 in clinical samples was successfully standardized. No difference in the amplification of the standard curves was observed between the duplex and singleplex assays. Specificities and sensitivities similar to those of the singleplex assays were obtained using the optimized duplex qPCR. The analytical sensitivities of duplex qPCR were two copies of WSSV control plasmid and 20 copies of PstDV1 control plasmid. The standardized duplex qPCR confirmed the presence of viral DNA in 28 from 43 samples tested. There was no difference for WSSV detection using the two kits and the distinct methods for qPCR results evaluation. High clinical sensitivity for PstDV1 was obtained with TaqMan Universal Master Mix associated with relative threshold evaluation. Three cases of simultaneous infection by the WSSV and the PstDV1 were identified with duplex qPCR. The standardized duplex qPCR was shown to be a robust, highly sensitive, and feasible diagnostic tool for the simultaneous detection of the WSSV and the PstDV1 in whiteleg shrimp. The use of the TaqMan Universal Master Mix and the relative threshold method of data analysis in our duplex qPCR method provided optimal levels of sensitivity and specificity.

Effects of bacterial contamination of media on the diagnosis of Tritrichomonas foetus by culture and real-time PCR.

PubMed

Clothier, Kristin A; Villanueva, Michelle; Torain, Andrea; Hult, Cynthia; Wallace, Rachel

2015-03-15

The venereal pathogen Tritrichomonas foetus causes early embryonic death and abortion in cattle. With no approved treatment, control involves detection of infected animals and their removal from the herd. Culture is the traditional diagnostic method; standard media are formulated to support protozoal growth while suppressing competing organisms which may prevent microscopic recognition of T. foetus. Real-time PCR increases diagnostic sensitivity and specificity over culture but requires intact T. foetus DNA for detection. The purposes of this study were 1) to evaluate the effects of resident preputial bacteria that are not suppressed by antimicrobials in a commercial culture medium (InPouch™) on T. foetus detection by culture and PCR, and 2) to determine the performance of a laboratory-prepared culture medium on T. foetus detection by culture and PCR in samples with and without this bacterial contamination. A known concentration of one of three different strains of T. foetus inoculated into InPouch™ (IP) or modified Diamonds-Plastridge media (DPM) were co-incubated with a smegma culture media (CONTAM) for 24h and examined microscopically for the presence of identifiable T. foetus. PCR was performed on IP samples to determine if CONTAM also affected T. foetus DNA detection. A PCR protocol was then validated in DPM that performed similarly to the established IP PCR method. IP and DPM with CONTAM were spiked with serial dilutions that mimic field infections of one of four T. foetus strains and evaluated by real-time PCR; cycles to threshold (Ct) values and "positive" classification were compared between media. T. foetus motility and morphology as well as media pH were severely altered in IP samples with CONTAM compared to those without as well as to DPM medium with and without CONTAM (P<0.0001). PCR testing demonstrated significantly greater Ct values were for T. foetus DNA (P<0.001) in IP contaminated with smegma bacteria compared to those without. When using T foetus concentrations that mimic field infections, IP samples with CONTAM had significantly higher Ct values (P<0.001) than DPM with CONTAM. Using the laboratory cut-off for "positive" on mean Ct values from these samples, significantly (P<0.01) more bulls would be identified using DPM than with IP if CONTAM was present. Results of this study indicate that bacteria which are not inhibited in media interfere with T. foetus identification by culture and PCR and adversely affect diagnostic sensitivity for this fastidious pathogen. Copyright © 2015 Elsevier B.V. All rights reserved.

High preservation of DNA standards diluted in 50% glycerol.

PubMed

Schaudien, Dirk; Baumgärtner, Wolfgang; Herden, Christiane

2007-09-01

Standard curves are important tools in real-time quantitative polymerase chain reaction (PCR) to precisely analyze gene expression patterns under physiologic and pathologic conditions. Handling of DNA standards often implies multiple cycles of freezing and thawing that might affect DNA stability and integrity. This in turn might influence the reliability and reproducibility of quantitative measurements in real-time PCR assays. In this study, 3 DNA standards such as murine tumor necrosis factor (TNF) alpha, interferon (IFN) gamma, and kainat-1 receptor were diluted in 50% glycerol or water after 1, 4, and 16 cycles of freezing and thawing and amplified copy numbers after real-time PCR were compared. The standards diluted in water showed a reduction to 83%, 55%, and 50% after 4 cycles, to 24%, 5%, and 4% after 16 cycles for kainat-1 receptor, TNFalpha, and IFNgamma standards, respectively, when compared with a single cycle of freezing and thawing. Interestingly, all cDNA samples diluted in 50% glycerol were amplified in comparable copy numbers even after 16 cycles of freezing and thawing. The effect of the standards undergoing different cycles of freezing and thawing on sample values was demonstrated by amplifying cDNA obtained from Borna disease virus infected and noninfected TNF-transgenic mice brain. This revealed significant differences of measured cDNA copy numbers using water-diluted DNA standards. In contrast, sample values did not vary using glycerol-diluted standards that were frozen and thawed for 16 times. In conclusion, glycerol storage of DNA standards represents a suitable tool for the accurate and reproducible quantification of cDNA samples in real-time PCR analysis.

ANIMAL DNA IN PCR REAGENTS PLAGUES ANCIENT DNA RESEARCH

EPA Science Inventory

Ancient DNA analysis is becoming widespread. These studies use polymerase chain reaction (PCR) to amplify minute quantities of heavily damaged template. Unusual steps are taken to achieve the sensitivity necessary to detect ancient DNA, including high-cycle PCR amplification targ...

Molecular sensitivity threshold of wet mount and an immunochromatographic assay evaluated by quantitative real-time PCR for diagnosis of Trichomonas vaginalis infection in a low-risk population of childbearing women.

PubMed

Leli, Christian; Castronari, Roberto; Levorato, Lucia; Luciano, Eugenio; Pistoni, Eleonora; Perito, Stefano; Bozza, Silvia; Mencacci, Antonella

2016-06-01

Vaginal trichomoniasis is a sexually transmitted infection caused by Trichomonas vaginalis, a flagellated protozoan. Diagnosis of T. vaginalis infection is mainly performed by wet mount microscopy, with a sensitivity ranging from 38% to 82%, compared to culture, still considered the gold standard. Commercial immunochromatographic tests for monoclonal-antibody-based detection have been introduced as alternative methods for diagnosis of T. vaginalis infection and have been reported in some studies to be more sensitive than wet mount. Real-time PCR methods have been recently developed, with optimal sensitivity and specificity. The aim of this study was to evaluate whether there is a molecular sensitivity threshold for both wet mount and imunochromatographic assays. To this aim, a total of 1487 low-risk childbearing women (median age 32 years, interquartile range 27-37) were included in the study, and underwent vaginal swab for T. vaginalis detection by means of a quantitative real-time PCR assay, wet mount and an immunochromatographic test. Upon comparing the results, prevalence values observed were 1.3% for real-time PCR, 0.5% for microscopic examination, and 0.8% for the immunochromatographic test. Compared to real-time PCR, wet mount sensitivity was 40% (95% confidence interval 19.1% to 63.9%) and specificity was 100% (95% CI 99.7% to 100%). The sensitivity and specificity of the immunochromatographic assay were 57.9% (95% CI 33.5% to 79.8%) and 99.9% (95% CI 99.6% to 100%), respectively. Evaluation of the wet mount results and those of immunochromatographic assay detection in relation to the number of T. vaginalis DNA copies detected in vaginal samples showed that the lower identification threshold for both wet mount (chi-square 6.1; P = 0.016) and the immunochromatographic assay (chi-square 10.7; P = 0.002) was ≥100 copies of T. vaginalis DNA/5 mcl of eluted DNA.

Rapid Identification of Shiga Toxin-Producing Escherichia coli O Serogroups from Fresh Produce and Raw Milk Enrichment Cultures by Luminex Bead-Based Suspension Array.

PubMed

Kase, Julie A; Maounounen-Laasri, Anna; Lin, Andrew

2016-09-01

The U.S. Food and Drug Administration's Bacteriological Analytical Manual (BAM) Chapter 4a describes a Luminex microbead-based suspension array used to screen colonies for 11 clinically relevant Shiga toxin-producing Escherichia coli (STEC) serogroups: O26, O45, O91, O103, O104, O111, O113, O121, O128, O145, and O157. We evaluated the usefulness of this method to identify STEC-positive enrichment samples before agar plating. Twelve E. coli strains were added to three types of fresh produce (bagged baby spinach, alfalfa sprouts, and cilantro) at levels near the detection limit of the test. A subset of these strains (six O serogroups) was similarly evaluated in raw milk. For comparison, portions of each of the 168 enrichment cultures were analyzed for serogroup by a real-time PCR assay and a Bio-Plex 200 assay with the bead-based suspensions. No false-positive results were obtained. Of the 112 samples with a reported cycle threshold (C T ) value, 101 undiluted, diluted, or extracted enrichment cultures also produced ratios above 5.0 in the Bio-Plex assay. When PCR C T values approached or were greater than 35, Bio-Plex detection became less reliable. Using undiluted or extracted enrichment cultures resulted in a significantly larger number of positive results. With the same enrichment material prepared for real-time PCR analysis as described in the BAM Chapter 4a, the STEC microbead-based suspension array can accurately screen food enrichment cultures.

Comparative performance of Aspergillus galactomannan ELISA and PCR in sputum from patients with ABPA and CPA.

PubMed

Fayemiwo, Samuel; Moore, Caroline B; Foden, Philip; Denning, David W; Richardson, Malcolm D

2017-09-01

Galactomannan (GM) and Aspergillus DNA detection are useful tools for the diagnosis of invasive pulmonary aspergillosis (IPA), primarily in blood and bronchoscopy samples. This study aimed to evaluate the utility of both markers for detection of Aspergillus in sputum from patients with allergic bronchopulmonary aspergillosis (ABPA) and chronic pulmonary aspergillosis (CPA). ABPA or CPA demographic patient data were retrieved. This retrospective observational audit included 159 patients with at least one sputum pair. 223 sputum sample pairs were analysed, as well as six control samples for GM only. Real time PCR was performed following sputum DNA extraction using the MycAssay™ Aspergillus kit and cycle thresholds were subtracted from 38 to give positive values (transformed Ct, TCt). The mean age of the patients was 61.81years (SD: ±11.06; range 29-100). One hundred and twenty-six (79.2%) had CPA. Cultures were positive for fungi in 13.1% of the samples, and A. fumigatus was the commonest (11.9%) fungus isolated. Receiver operating characteristic (ROC curve) analysis of sputum GM comparing TCt of >0.0, and >2.0 to derive GMI cut-off values showed a cut-off of 6.5. About 50% of sputa with strongly positive PCR values had GM values>6.5. Two of six (33%) control samples had GM indices>6.5. It is not clear that GM determinations in sputum are useful for diagnosis of either CPA or ABPA, or following therapy. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

Allee effect in the selection for prime-numbered cycles in periodical cicadas.

PubMed

Tanaka, Yumi; Yoshimura, Jin; Simon, Chris; Cooley, John R; Tainaka, Kei-ichi

2009-06-02

Periodical cicadas are well known for their prime-numbered life cycles (17 and 13 years) and their mass periodical emergences. The origination and persistence of prime-numbered cycles are explained by the hybridization hypothesis on the basis of their lower likelihood of hybridization with other cycles. Recently, we showed by using an integer-based numerical model that prime-numbered cycles are indeed selected for among 10- to 20-year cycles. Here, we develop a real-number-based model to investigate the factors affecting the selection of prime-numbered cycles. We include an Allee effect in our model, such that a critical population size is set as an extinction threshold. We compare the real-number models with and without the Allee effect. The results show that in the presence of an Allee effect, prime-numbered life cycles are most likely to persist and to be selected under a wide range of extinction thresholds.

COLD-PCR enriches low-level variant DNA sequences and increases the sensitivity of genetic testing.

PubMed

Castellanos-Rizaldos, Elena; Milbury, Coren A; Guha, Minakshi; Makrigiorgos, G Mike

2014-01-01

Detection of low-level mutations is important for cancer biomarker and therapy targets discovery, but reliable detection remains a technical challenge. The newly developed method of CO-amplification at Lower Denaturation temperature PCR (COLD-PCR) helps to circumvent this issue. This PCR-based technology preferentially enriches minor known or unknown variants present in samples with a high background of wild type DNA which often hampers the accurate identification of these minority alleles. This is a simple process that consists of lowering the temperature at the denaturation step during the PCR-cycling protocol (critical denaturation temperature, T c) and inducing DNA heteroduplexing during an intermediate step. COLD-PCR in its simplest forms does not need additional reagents or specific instrumentation and thus, can easily replace conventional PCR and at the same time improve the mutation detection sensitivity limit of downstream technologies. COLD-PCR can be applied in two basic formats: fast-COLD-PCR that can enrich T m-reducing mutations and full-COLD-PCR that can enrich all mutations, though it requires an intermediate cross-hybridization step that lengthens the thermocycling program. An improved version of full-COLD-PCR (improved and complete enrichment, ice-COLD-PCR) has also been described. Finally, most recently, we developed yet another form of COLD-PCR, temperature-tolerant-COLD-PCR, which gradually increases the denaturation temperature during the COLD-PCR reaction, enriching diverse targets using a single cycling program. This report describes practical considerations for application of fast-, full-, ice-, and temperature-tolerant-COLD-PCR for enrichment of mutations prior to downstream screening.

Optical implementation of inner product neural associative memory

NASA Technical Reports Server (NTRS)

Liu, Hua-Kuang (Inventor)

1995-01-01

An optical implementation of an inner-product neural associative memory is realized with a first spatial light modulator for entering an initial two-dimensional N-tuple vector and for entering a thresholded output vector image after each iteration until convergence is reached, and a second spatial light modulator for entering M weighted vectors of inner-product scalars multiplied with each of the M stored vectors, where the inner-product scalars are produced by multiplication of the initial input vector in the first iterative cycle (and thresholded vectors in subsequent iterative cycles) with each of the M stored vectors, and the weighted vectors are produced by multiplication of the scalars with corresponding ones of the stored vectors. A Hughes liquid crystal light valve is used for the dual function of summing the weighted vectors and thresholding the sum vector. The thresholded vector is then entered through the first spatial light modulator for reiteration of the process cycle until convergence is reached.

A Systematic Investigation of Parameters Influencing Droplet Rain in the Listeria monocytogenes prfA Assay - Reduction of Ambiguous Results in ddPCR

PubMed Central

Witte, Anna Kristina; Mester, Patrick; Fister, Susanne; Witte, Matthias; Schoder, Dagmar; Rossmanith, Peter

2016-01-01

The droplet digital polymerase chain reaction (ddPCR) determines DNA amounts based upon the pattern of positive and negative droplets, according to Poisson distribution, without the use of external standards. However, division into positive and negative droplets is often not clear because a part of the droplets has intermediate fluorescence values, appearing as “rain” in the plot. Despite the droplet rain, absolute quantification with ddPCR is possible, as shown previously for the prfA assay in quantifying Listeria monocytogenes. Nevertheless, reducing the rain, and thus ambiguous results, promotes the accuracy and credibility of ddPCR. In this study, we extensively investigated chemical and physical parameters for optimizing the prfA assay for ddPCR. While differences in the concentration of all chemicals and the dye, quencher and supplier of the probe did not alter the droplet pattern, changes in the PCR cycling program, such as prolonged times and increased cycle numbers, improved the assay. PMID:27992475

A Systematic Investigation of Parameters Influencing Droplet Rain in the Listeria monocytogenes prfA Assay - Reduction of Ambiguous Results in ddPCR.

PubMed

Witte, Anna Kristina; Mester, Patrick; Fister, Susanne; Witte, Matthias; Schoder, Dagmar; Rossmanith, Peter

2016-01-01

The droplet digital polymerase chain reaction (ddPCR) determines DNA amounts based upon the pattern of positive and negative droplets, according to Poisson distribution, without the use of external standards. However, division into positive and negative droplets is often not clear because a part of the droplets has intermediate fluorescence values, appearing as "rain" in the plot. Despite the droplet rain, absolute quantification with ddPCR is possible, as shown previously for the prfA assay in quantifying Listeria monocytogenes. Nevertheless, reducing the rain, and thus ambiguous results, promotes the accuracy and credibility of ddPCR. In this study, we extensively investigated chemical and physical parameters for optimizing the prfA assay for ddPCR. While differences in the concentration of all chemicals and the dye, quencher and supplier of the probe did not alter the droplet pattern, changes in the PCR cycling program, such as prolonged times and increased cycle numbers, improved the assay.

Uncoupling of sgRNAs from their associated barcodes during PCR amplification of combinatorial CRISPR screens

PubMed Central

2018-01-01

Many implementations of pooled screens in mammalian cells rely on linking an element of interest to a barcode, with the latter subsequently quantitated by next generation sequencing. However, substantial uncoupling between these paired elements during lentiviral production has been reported, especially as the distance between elements increases. We detail that PCR amplification is another major source of uncoupling, and becomes more pronounced with increased amounts of DNA template molecules and PCR cycles. To lessen uncoupling in systems that use paired elements for detection, we recommend minimizing the distance between elements, using low and equal template DNA inputs for plasmid and genomic DNA during PCR, and minimizing the number of PCR cycles. We also present a vector design for conducting combinatorial CRISPR screens that enables accurate barcode-based detection with a single short sequencing read and minimal uncoupling. PMID:29799876

Theory and applications of the polymerase chain reaction.

PubMed

Remick, D G; Kunkel, S L; Holbrook, E A; Hanson, C A

1990-04-01

The polymerase chain reaction (PCR) is a newly developed molecular biology technique that can significantly amplify DNA or RNA. The process consists of repetitive cycles of specific DNA synthesis, defined by short stretches of preselected DNA. With each cycle, there is a doubling of the final, desired DNA product such that a million-fold amplification is possible. This powerful method has numerous applications in diagnostic pathology, especially in the fields of microbiology, forensic science, and hematology. The PCR may be used to directly detect viral DNA, which may facilitate the diagnosis of acquired immune deficiency syndrome (AIDS) or other viral diseases. PCR amplification of DNA allows detection of specific sequences from extremely small samples, such as with forensic material. In hematology, PCR may help in the diagnosis of hemoglobinopathies or of neoplastic disorders by documenting chromosomal translocations. The new PCR opens exciting new avenues for diagnostic pathology using this new technology.

L-Arginine Affects Aerobic Capacity and Muscle Metabolism in MELAS (Mitochondrial Encephalomyopathy, Lactic Acidosis and Stroke-Like Episodes) Syndrome

PubMed Central

Rodan, Lance H.; Wells, Greg D.; Banks, Laura; Thompson, Sara; Schneiderman, Jane E.; Tein, Ingrid

2015-01-01

Objective To study the effects of L-arginine (L-Arg) on total body aerobic capacity and muscle metabolism as assessed by 31Phosphorus Magnetic Resonance Spectroscopy (31P-MRS) in patients with MELAS (Mitochondrial Encephalomyopathy with Lactic Acidosis and Stroke-like episodes) syndrome. Methods We performed a case control study in 3 MELAS siblings (m.3243A>G tRNAleu(UUR) in MTTL1 gene) with different % blood mutant mtDNA to evaluate total body maximal aerobic capacity (VO2peak) using graded cycle ergometry and muscle metabolism using 31P-MRS. We then ran a clinical trial pilot study in MELAS sibs to assess response of these parameters to single dose and a 6-week steady-state trial of oral L-Arginine. Results At baseline (no L-Arg), MELAS had lower serum Arg (p = 0.001). On 31P-MRS muscle at rest, MELAS subjects had increased phosphocreatine (PCr) (p = 0.05), decreased ATP (p = 0.018), and decreased intracellular Mg2+ (p = 0.0002) when compared to matched controls. With L-arginine therapy, the following trends were noted in MELAS siblings on cycle ergometry: (1) increase in mean % maximum work at anaerobic threshold (AT) (2) increase in % maximum heart rate at AT (3) small increase in VO2peak. On 31P-MRS the following mean trends were noted: (1) A blunted decrease in pH after exercise (less acidosis) (2) increase in Pi/PCr ratio (ADP) suggesting increased work capacity (3) a faster half time of PCr recovery (marker of mitochondrial activity) following 5 minutes of moderate intensity exercise (4) increase in torque. Significance These results suggest an improvement in aerobic capacity and muscle metabolism in MELAS subjects in response to supplementation with L-Arg. Intramyocellular hypomagnesemia is a novel finding that warrants further study. Classification of Evidence Class III evidence that L-arginine improves aerobic capacity and muscle metabolism in MELAS subjects. Trial Registration ClinicalTrials.gov NCT01603446. PMID:25993630

High occurrence of Blastocystis sp. subtypes 1-3 and Giardia intestinalis assemblage B among patients in Zanzibar, Tanzania.

PubMed

Forsell, Joakim; Granlund, Margareta; Samuelsson, Linn; Koskiniemi, Satu; Edebro, Helén; Evengård, Birgitta

2016-06-29

Blastocystis is a common intestinal parasite with worldwide distribution but the distribution of Blastocystis and its subtypes in East Africa is largely unknown. In this study, we investigate the distribution of Blastocystis subtypes in Zanzibar, Tanzania and report the prevalence of intestinal parasites using both molecular methods and microscopy. Stool samples were collected from both diarrhoeic and non-diarrhoeic outpatients in Zanzibar. In addition to microscopy, real-time PCR for Blastocystis, Entamoeba histolytica and E. dispar, Giardia intestinalis, Cryptosporidium spp., and Dientamoeba fragilis was used. Blastocystis subtypes were determined by a conventional PCR followed by partial sequencing of the SSU-rRNA gene. Genetic assemblages of Giardia were determined by PCR with assemblage specific primers. Intestinal parasites were detected in 85 % of the 174 participants, with two or more parasites present in 56 %. Blastocystis sp. and Giardia intestinalis were the most common parasites, identified by PCR in 61 and 53 % of the stool samples respectively, but no correlation between carriage of Blastocystis and Giardia was found. The Blastocystis subtype distribution was ST1 34.0 %, ST2 26.4 %, ST3 25.5 %, ST7 0.9 %, and 13.2 % were positive only by qPCR (non-typable). The Giardia genetic assemblages identified were A 6.5 %, B 85 %, A + B 4.3 %, and non-typable 4.3 %. The detection rate with microscopy was substantially lower than with PCR, 20 % for Blastocystis and 13.8 % for Giardia. The prevalence of Blastocystis increased significantly with age while Giardia was most prevalent in children two to five years old. No correlation between diarrhoea and the identification of Giardia, Blastocystis, or their respective genetic subtypes could be shown and, as a possible indication of parasite load, the mean cycle threshold values in the qPCR for Giardia were equal in diarrhoeic and non-diarrhoeic patients. Carriage of intestinal parasites was very common in the studied population in Zanzibar. The most commonly detected parasites, Blastocystis and Giardia, had different age distributions, possibly indicating differences in transmission routes, immunity, and/or other host factors for these two species. In the Blastocystis subtype analysis ST1-3 were common, but ST4, a subtype quite common in Europe, was completely absent, corroborating the geographical differences in subtype distributions previously reported.

Estimation of test characteristics of real-time PCR and bacterial culture for diagnosis of subclinical intramammary infections with Streptococcus agalactiae in Danish dairy cattle in 2012 using latent class analysis.

PubMed

Mahmmod, Yasser S; Toft, Nils; Katholm, Jørgen; Grønbæk, Carsten; Klaas, Ilka C

2013-05-01

The misdiagnosis of intramammary infections (IMI) with Streptococcus agalactiae (S. agalactiae) could lead farmers to treat or cull animals unnecessarily. The objective of this field study was to estimate the sensitivity (Se) and specificity (Sp) of real-time PCR at different cut-offs for cycle threshold (Ct) values against bacterial culture (BC) for diagnosis of S. agalactiae IMI using latent class analysis to avoid the assumption of a perfect reference test. A total of 614 dairy cows were randomly selected from 6 herds with bulk tank PCR Ct value ≤ 39 for S. agalactiae and S. aureus. At milk recording, 2456 quarter milk samples were taken aseptically for BC and the routinely taken cow level milk samples were analyzed by PCR. Results showed that 53 cows (8.6%) were positive for S. agalactiae IMI by BC. Sensitivity of PCR at cut-offs; ≤ 39, ≤ 37, ≤ 34, and ≤ 32, was 96.2%, 91.9%, 87.2% and 73.9%, while Se of BC was 25.7%, 29.9%, 59.9% and 72.1%. Specificity of PCR at cut-offs; ≤ 39, ≤ 37, ≤ 34, and ≤ 32, was 96.8%, 96.9%, 96.7%, and 97.22%, while Sp of BC was 99.7%, 99.5%, 99.2%, and 98.9%. The estimated prevalence of S. agalactiae IMI by PCR was higher than the apparent prevalence at the tested cut-offs, indicating under estimation of S. agalactiae IMI in the examined dairy cows. In conclusion, Se of PCR is always higher than Se of BC at all tested cut-offs. The lower cut-off, the more comparable becomes Se of PCR and Se of BC. The changes in Se in both PCR and BC at different Ct-value cut-offs may indicate a change in the definition of the latent infection. The similar Se of both tests at cut-off ≤ 32 may indicate high concentrations of S. agalactiae viable cells, representing a cow truly/heavily infected with S. agalactiae and thus easier to detect with BC. At cut-off ≤ 39 the latent definition of infection may reflect a more general condition of cows being positive for S. agalactiae. Our findings indicate that PCR Ct-value cut-offs should be chosen according to the underlying latent infection definition of interest. Latent class analysis proposes a useful alternative to classic test evaluation of diagnostic tests used for detection of S. agalactiae IMI in milk. Copyright © 2012 Elsevier B.V. All rights reserved.

Integrated Semiconductor-based Diagnostics System for Multiplexed Genomic Amplification and Electrochemical Detection of Biothreat Agents

DTIC Science & Technology

2009-01-01

microporous disc with adhesive backing. Figure 6. Illustration of the bottom polypropylene layer with the PCR chamber. PCR Chamber UNCLASSIFIED...consistent heating in the PCR chamber. Using insulation and a modified commercial temperature sensor, consistent thermal cycling was achieved with this

Use of real-time PCR to detect canine parvovirus in feces of free-ranging wolves.

PubMed

Mech, L David; Almberg, Emily S; Smith, Douglas; Goyal, Sagar; Singer, Randall S

2012-04-01

Using real-time PCR, we tested 15 wolf (Canis lupus) feces from the Superior National Forest (SNF), Minnesota, USA, and 191 from Yellowstone National Park (YNP), USA, collected during summer and 13 during winter for canine parvovirus (CPV)-2 DNA. We also tested 20 dog feces for CPV-2 DNA. The PCR assay was 100% sensitive and specific with a minimum detection threshold of 10(4) 50% tissue culture infective dose. Virus was detected in two winter specimens but none of the summer specimens. We suggest applying the technique more broadly especially with winter feces.

Use of real-time PCR to detect canine parvovirus in feces of free-ranging wolves

USGS Publications Warehouse

Mech, L. David; Almberg, Emily S.; Smith, Douglas; Goyal, Sagar; Singer, Randall S.

2012-01-01

Using real-time PCR, we tested 15 wolf (Canis lupus) feces from the Superior National Forest (SNF), Minnesota, USA, and 191 from Yellowstone National Park (YNP), USA, collected during summer and 13 during winter for canine parvovirus (CPV)-2 DNA. We also tested 20 dog feces for CPV-2 DNA. The PCR assay was 100% sensitive and specific with a minimum detection threshold of 104 50% tissue culture infective dose. Virus was detected in two winter specimens but none of the summer specimens. We suggest applying the technique more broadly especially with winter feces.

Optimization of digital droplet polymerase chain reaction for quantification of genetically modified organisms

PubMed Central

Gerdes, Lars; Iwobi, Azuka; Busch, Ulrich; Pecoraro, Sven

2016-01-01

Digital PCR in droplets (ddPCR) is an emerging method for more and more applications in DNA (and RNA) analysis. Special requirements when establishing ddPCR for analysis of genetically modified organisms (GMO) in a laboratory include the choice between validated official qPCR methods and the optimization of these assays for a ddPCR format. Differentiation between droplets with positive reaction and negative droplets, that is setting of an appropriate threshold, can be crucial for a correct measurement. This holds true in particular when independent transgene and plant-specific reference gene copy numbers have to be combined to determine the content of GM material in a sample. Droplets which show fluorescent units ranging between those of explicit positive and negative droplets are called ‘rain’. Signals of such droplets can hinder analysis and the correct setting of a threshold. In this manuscript, a computer-based algorithm has been carefully designed to evaluate assay performance and facilitate objective criteria for assay optimization. Optimized assays in return minimize the impact of rain on ddPCR analysis. We developed an Excel based ‘experience matrix’ that reflects the assay parameters of GMO ddPCR tests performed in our laboratory. Parameters considered include singleplex/duplex ddPCR, assay volume, thermal cycler, probe manufacturer, oligonucleotide concentration, annealing/elongation temperature, and a droplet separation evaluation. We additionally propose an objective droplet separation value which is based on both absolute fluorescence signal distance of positive and negative droplet populations and the variation within these droplet populations. The proposed performance classification in the experience matrix can be used for a rating of different assays for the same GMO target, thus enabling employment of the best suited assay parameters. Main optimization parameters include annealing/extension temperature and oligonucleotide concentrations. The droplet separation value allows for easy and reproducible assay performance evaluation. The combination of separation value with the experience matrix simplifies the choice of adequate assay parameters for a given GMO event. PMID:27077048

Optimization of digital droplet polymerase chain reaction for quantification of genetically modified organisms.

PubMed

Gerdes, Lars; Iwobi, Azuka; Busch, Ulrich; Pecoraro, Sven

2016-03-01

Digital PCR in droplets (ddPCR) is an emerging method for more and more applications in DNA (and RNA) analysis. Special requirements when establishing ddPCR for analysis of genetically modified organisms (GMO) in a laboratory include the choice between validated official qPCR methods and the optimization of these assays for a ddPCR format. Differentiation between droplets with positive reaction and negative droplets, that is setting of an appropriate threshold, can be crucial for a correct measurement. This holds true in particular when independent transgene and plant-specific reference gene copy numbers have to be combined to determine the content of GM material in a sample. Droplets which show fluorescent units ranging between those of explicit positive and negative droplets are called 'rain'. Signals of such droplets can hinder analysis and the correct setting of a threshold. In this manuscript, a computer-based algorithm has been carefully designed to evaluate assay performance and facilitate objective criteria for assay optimization. Optimized assays in return minimize the impact of rain on ddPCR analysis. We developed an Excel based 'experience matrix' that reflects the assay parameters of GMO ddPCR tests performed in our laboratory. Parameters considered include singleplex/duplex ddPCR, assay volume, thermal cycler, probe manufacturer, oligonucleotide concentration, annealing/elongation temperature, and a droplet separation evaluation. We additionally propose an objective droplet separation value which is based on both absolute fluorescence signal distance of positive and negative droplet populations and the variation within these droplet populations. The proposed performance classification in the experience matrix can be used for a rating of different assays for the same GMO target, thus enabling employment of the best suited assay parameters. Main optimization parameters include annealing/extension temperature and oligonucleotide concentrations. The droplet separation value allows for easy and reproducible assay performance evaluation. The combination of separation value with the experience matrix simplifies the choice of adequate assay parameters for a given GMO event.

Evaluation of Aspergillus PCR protocols for testing serum specimens.

PubMed

White, P Lewis; Mengoli, Carlo; Bretagne, Stéphane; Cuenca-Estrella, Manuel; Finnstrom, Niklas; Klingspor, Lena; Melchers, Willem J G; McCulloch, Elaine; Barnes, Rosemary A; Donnelly, J Peter; Loeffler, Juergen

2011-11-01

A panel of human serum samples spiked with various amounts of Aspergillus fumigatus genomic DNA was distributed to 23 centers within the European Aspergillus PCR Initiative to determine analytical performance of PCR. Information regarding specific methodological components and PCR performance was requested. The information provided was made anonymous, and meta-regression analysis was performed to determine any procedural factors that significantly altered PCR performance. Ninety-seven percent of protocols were able to detect a threshold of 10 genomes/ml on at least one occasion, with 83% of protocols reproducibly detecting this concentration. Sensitivity and specificity were 86.1% and 93.6%, respectively. Positive associations between sensitivity and the use of larger sample volumes, an internal control PCR, and PCR targeting the internal transcribed spacer (ITS) region were shown. Negative associations between sensitivity and the use of larger elution volumes (≥100 μl) and PCR targeting the mitochondrial genes were demonstrated. Most Aspergillus PCR protocols used to test serum generate satisfactory analytical performance. Testing serum requires less standardization, and the specific recommendations shown in this article will only improve performance.

Evaluation of Aspergillus PCR Protocols for Testing Serum Specimens▿†

PubMed Central

White, P. Lewis; Mengoli, Carlo; Bretagne, Stéphane; Cuenca-Estrella, Manuel; Finnstrom, Niklas; Klingspor, Lena; Melchers, Willem J. G.; McCulloch, Elaine; Barnes, Rosemary A.; Donnelly, J. Peter; Loeffler, Juergen

2011-01-01

A panel of human serum samples spiked with various amounts of Aspergillus fumigatus genomic DNA was distributed to 23 centers within the European Aspergillus PCR Initiative to determine analytical performance of PCR. Information regarding specific methodological components and PCR performance was requested. The information provided was made anonymous, and meta-regression analysis was performed to determine any procedural factors that significantly altered PCR performance. Ninety-seven percent of protocols were able to detect a threshold of 10 genomes/ml on at least one occasion, with 83% of protocols reproducibly detecting this concentration. Sensitivity and specificity were 86.1% and 93.6%, respectively. Positive associations between sensitivity and the use of larger sample volumes, an internal control PCR, and PCR targeting the internal transcribed spacer (ITS) region were shown. Negative associations between sensitivity and the use of larger elution volumes (≥100 μl) and PCR targeting the mitochondrial genes were demonstrated. Most Aspergillus PCR protocols used to test serum generate satisfactory analytical performance. Testing serum requires less standardization, and the specific recommendations shown in this article will only improve performance. PMID:21940479

Effects of arc current on the life in burner rig thermal cycling of plasma sprayed ZrOsub2-Ysub2Osub3

NASA Technical Reports Server (NTRS)

Hendricks, R. C.; Mcdonald, G.

1982-01-01

An analysis of thermal cycle life data for four sets of eight thermal barrier coated specimens representing arc currents (plasma gun power) of 525, 600, 800, or 950 amps is presented. The ZrO2-8Y2O3/NiCrAlY plasma spray coated Rene 41 rods were thermal cycled to 1040 C in a Mach 0.3-Jet A/air burner flame. The experimental results indicate the existance of a minimum or threshold power level which coating life expectancy is less than 500 cycles. Above the threshold power level, coating life expectancy more than doubles and increases with arc current.

Effects of arc current on the life in burner rig thermal cycling of plasma sprayed ZrOsub2-Ysub2Osub3

NASA Astrophysics Data System (ADS)

Hendricks, R. C.; McDonald, G.

1982-02-01

An analysis of thermal cycle life data for four sets of eight thermal barrier coated specimens representing arc currents (plasma gun power) of 525, 600, 800, or 950 amps is presented. The ZrO2-8Y2O3/NiCrAlY plasma spray coated Rene 41 rods were thermal cycled to 1040 C in a Mach 0.3-Jet A/air burner flame. The experimental results indicate the existance of a minimum or threshold power level which coating life expectancy is less than 500 cycles. Above the threshold power level, coating life expectancy more than doubles and increases with arc current.

Determination of the rate of photoreduction of O2 in the water-water cycle in watermelon leaves and enhancement of the rate by limitation of photosynthesis.

PubMed

Miyake, C; Yokota, A

2000-03-01

A study was performed to determine how the electron fluxes for the photosynthetic carbon reduction (PCR) and the photorespiratory carbon oxidation (PCO) cycles affect the photoreduction of O2 at PSI, which is the limiting step in the water-water cycle. Simultaneous measurements were made of CO2-gas exchange, transpiration and quantum yield of PSII [phi(PSII)] using leaves of watermelon (Citrullus lanatus). The total electron flux in PSII[Je(PSII)], as estimated from phi(PSII), was always larger than the total electron flux required for the PCR and PCO cycles at various partial pressures of CO2 and O2 and 1,100 micromol photons m(-2)s(-1). This observation suggested the existence of an alternative electron flux (Ja). Ja was divided into O2-dependent [Ja(O2-depend)] and O2-independent [Ja(O2-independ)] components. The magnitude of half Ja(O2-depend), 7.5 to 9.5 micromol e- m(-2)s(-1), and its apparent Km for O2, about 8.0 kPa, could be accounted for by the photoreduction of O2 at PSI either mediated by ferredoxin or catalyzed by monodehydroascorbate reductase. The results indicated that Ja(O2-depend) was driven by the water-water cycle. A decrease in the intercellular partial pressure of CO2 from 23 to 5.0 Pa at 21 kPa O2 enhanced Ja(O2-depend) by a factor of 1.3. Saturation of the activities of both the PCR and PCO cycles by increasing the photon flux density induced Ja. These results indicate the electron flux in PSII that exceeds the flux required for the PCR and PCO cycles induces the photoreduction of O2 in the water-water cycle.

Detecting fatigue thresholds from electromyographic signals: A systematic review on approaches and methodologies.

PubMed

Ertl, Peter; Kruse, Annika; Tilp, Markus

2016-10-01

The aim of the current paper was to systematically review the relevant existing electromyographic threshold concepts within the literature. The electronic databases MEDLINE and SCOPUS were screened for papers published between January 1980 and April 2015 including the keywords: neuromuscular fatigue threshold, anaerobic threshold, electromyographic threshold, muscular fatigue, aerobic-anaerobictransition, ventilatory threshold, exercise testing, and cycle-ergometer. 32 articles were assessed with regard to their electromyographic methodologies, description of results, statistical analysis and test protocols. Only one article was of very good quality. 21 were of good quality and two articles were of very low quality. The review process revealed that: (i) there is consistent evidence of one or two non-linear increases of EMG that might reflect the additional recruitment of motor units (MU) or different fiber types during fatiguing cycle ergometer exercise, (ii) most studies reported no statistically significant difference between electromyographic and metabolic thresholds, (iii) one minute protocols with increments between 10 and 25W appear most appropriate to detect muscular threshold, (iv) threshold detection from the vastus medialis, vastus lateralis, and rectus femoris is recommended, and (v) there is a great variety in study protocols, measurement techniques, and data processing. Therefore, we recommend further research and standardization in the detection of EMGTs. Copyright © 2016 Elsevier Ltd. All rights reserved.

CHANGES IN THE ANAEROBIC THRESHOLD IN AN ANNUAL CYCLE OF SPORT TRAINING OF YOUNG SOCCER PLAYERS

PubMed Central

Andrzejewski, M.; Wieczorek, A.; Barinow-Wojewódzki, A.; Jadczak, Ł.; Adrian, S.; Pietrzak, M.; Wieczorek, S.

2013-01-01

The aim of the study was to assess changes in the anaerobic threshold of young soccer players in an annual training cycle. A group of highly trained 15-18 year old players of KKS Lech Poznań were tested. The tests included an annual training macrocycle, and its individual stages resulted from the time structure of the sports training. In order to assess the level of exercise capacities of the players, a field exercise test of increasing intensity was carried out on a soccer pitch. The test made it possible to determine the 4 millimolar lactate threshold (T LA 4 mmol · l-1) on the basis of the lactate concentration in blood [LA], to establish the threshold running speed and the threshold heart rate [HR]. The threshold running speed at the level of the 4 millimolar lactate threshold was established using the two-point form of the equation of a straight line. The obtained indicators of the threshold running speed allowed for precise establishment of effort intensity used in individual training in developing aerobic endurance. In order to test the significance of differences in mean values between four dates of tests, a non-parametric Friedman ANOVA test was used. The significance of differences between consecutive dates of tests was determined using a post-hoc Friedman ANOVA test. The tests showed significant differences in values of selected indicators determined at the anaerobic threshold in various stages of an annual training cycle of young soccer players. The most beneficial changes in terms of the threshold running speed were noted on the fourth date of tests, when the participants had the highest values of 4.01 m · s-1 for older juniors, and 3.80 m · s-1 for younger juniors. This may be indicative of effective application of an individualized programme of training loads and of good preparation of teams for competition in terms of players’ aerobic endurance. PMID:24744480

Changes in the anaerobic threshold in an annual cycle of sport training of young soccer players.

PubMed

Sliwowski, R; Andrzejewski, M; Wieczorek, A; Barinow-Wojewódzki, A; Jadczak, L; Adrian, S; Pietrzak, M; Wieczorek, S

2013-06-01

The aim of the study was to assess changes in the anaerobic threshold of young soccer players in an annual training cycle. A group of highly trained 15-18 year old players of KKS Lech Poznań were tested. The tests included an annual training macrocycle, and its individual stages resulted from the time structure of the sports training. In order to assess the level of exercise capacities of the players, a field exercise test of increasing intensity was carried out on a soccer pitch. The test made it possible to determine the 4 millimolar lactate threshold (T LA 4 mmol · l(-1)) on the basis of the lactate concentration in blood [LA], to establish the threshold running speed and the threshold heart rate [HR]. The threshold running speed at the level of the 4 millimolar lactate threshold was established using the two-point form of the equation of a straight line. The obtained indicators of the threshold running speed allowed for precise establishment of effort intensity used in individual training in developing aerobic endurance. In order to test the significance of differences in mean values between four dates of tests, a non-parametric Friedman ANOVA test was used. The significance of differences between consecutive dates of tests was determined using a post-hoc Friedman ANOVA test. The tests showed significant differences in values of selected indicators determined at the anaerobic threshold in various stages of an annual training cycle of young soccer players. The most beneficial changes in terms of the threshold running speed were noted on the fourth date of tests, when the participants had the highest values of 4.01 m · s(-1) for older juniors, and 3.80 m · s(-1) for younger juniors. This may be indicative of effective application of an individualized programme of training loads and of good preparation of teams for competition in terms of players' aerobic endurance.

Histotripsy beyond the “Intrinsic” Cavitation Threshold using Very Short Ultrasound Pulses: “Microtripsy”

PubMed Central

Lin, Kuang-Wei; Kim, Yohan; Maxwell, Adam D.; Wang, Tzu-Yin; Hall, Timothy L.; Xu, Zhen; Fowlkes, J. Brian; Cain, Charles A.

2014-01-01

Histotripsy produces tissue fractionation through dense energetic bubble clouds generated by short, high-pressure, ultrasound pulses. Conventional histotripsy treatments have used longer pulses from 3 to 10 cycles wherein the lesion-producing bubble cloud generation depends on the pressure-release scattering of very high peak positive shock fronts from previously initiated, sparsely distributed bubbles (the “shock-scattering” mechanism). In our recent work, the peak negative pressure (P−) for generation of dense bubble clouds directly by a single negative half cycle, the “intrinsic threshold,” was measured. In this paper, the dense bubble clouds and resulting lesions (in RBC phantoms and canine tissues) generated by these supra-intrinsic threshold pulses were studied. A 32-element, PZT-8, 500 kHz therapy transducer was used to generate very short (< 2 cycles) histotripsy pulses at a pulse repetition frequency (PRF) of 1 Hz and P− from 24.5 to 80.7 MPa. The results showed that the spatial extent of the histotripsy-induced lesions increased as the applied P− increased, and the sizes of these lesions corresponded well to the estimates of the focal regions above the intrinsic cavitation threshold, at least in the lower pressure regime (P− = 26–35 MPa). The average sizes for the smallest reproducible lesions were approximately 0.9 × 1.7 mm (lateral × axial), significantly smaller than the −6dB beamwidth of the transducer (1.8 × 4.0 mm). These results suggest that, using the intrinsic threshold mechanism, well-confined and microscopic lesions can be precisely generated and their spatial extent can be estimated based on the fraction of the focal region exceeding the intrinsic cavitation threshold. Since the supra-threshold portion of the negative half cycle can be precisely controlled, lesions considerably less than a wavelength are easily produced, hence the term “microtripsy.” PMID:24474132

High Incidence of Preharvest Colonization of Huanglongbing-Symptomatic Citrus sinensis Fruit by Lasiodiplodia theobromae (Diplodia natalensis) and Exacerbation of Postharvest Fruit Decay by That Fungus

PubMed Central

Zhao, Wei; Bai, Jinhe; McCollum, Greg

2014-01-01

Huanglongbing (HLB), presumably caused by the bacterium “Candidatus Liberibacter asiaticus,” is a devastating citrus disease associated with excessive preharvest fruit drop. Lasiodiplodia theobromae (diplodia) is the causal organism of citrus stem end rot (SER). The pathogen infects citrus fruit under the calyx abscission zone (AZ-C) and is associated with cell wall hydrolytic enzymes similar to plant enzymes involved in abscission. By means of DNA sequencing, diplodia was found in “Ca. Liberibacter asiaticus”-positive juice from HLB-symptomatic fruit (S) but not in “Ca. Liberibacter asiaticus”-negative juice. Therefore, the incidence of diplodia in fruit tissues, the impact on HLB-related postharvest decay, and the implications for HLB-related preharvest fruit drop were investigated in Hamlin and Valencia oranges. Quantitative PCR results (qPCR) revealed a significantly (P < 0.001) greater incidence of diplodia in the AZ-C of HLB-symptomatic (S; “Ca. Liberibacter asiaticus” threshold cycle [CT] of <30) than in the AZ-C of in asymptomatic (AS; “Ca. Liberibacter asiaticus” CT of ≥30) fruit. In agreement with the qPCR results, 2 weeks after exposure to ethylene, the incidences of SER in S fruit were 66.7% (Hamlin) and 58.7% (Valencia), whereas for AS fruit the decay rates were 6.7% (Hamlin) and 5.3% (Valencia). Diplodia colonization of S fruit AZ-C was observed by scanning electron microscopy and confirmed by PCR test and morphology of conidia in isolates from the AZ-C after surface sterilization. Diplodia CT values were negatively correlated with ethylene production (R = −0.838 for Hamlin; R = −0.858 for Valencia) in S fruit, and positively correlated with fruit detachment force (R = 0.855 for Hamlin; R = 0.850 for Valencia), suggesting that diplodia colonization in AZ-C may exacerbate HLB-associated preharvest fruit drop. PMID:25344245

Quantitative PCR measurement of tRNA 2-methylthio modification for assessing type 2 diabetes risk.

PubMed

Xie, Peiyu; Wei, Fan-Yan; Hirata, Shoji; Kaitsuka, Taku; Suzuki, Tsutomu; Suzuki, Takeo; Tomizawa, Kazuhito

2013-11-01

Genetic variants in the human CDKAL1 (CDK5 regulatory subunit associated protein 1-like 1) gene have been associated with reduced insulin secretion and type 2 diabetes (T2D). CDKAL1 is a methylthiotransferase that catalyzes 2-methylthio (ms(2)) modification of the adenine at position 37 (A37) of cytoplasmic tRNA(Lys)(UUU). We investigated the ms(2)-modification level of tRNA(Lys)(UUU) as a direct readout of CDKAL1 enzyme activity in human samples. We developed a quantitative PCR (qPCR)-based method to measure ms(2) modification. tRNA(Lys)(UUU) was reverse-transcribed with 2 unique primers: Reverse primer r1 was designed to anneal to the middle of this tRNA, including the nucleotide at A37, and reverse primer r2 was designed to anneal to the region downstream (3') of A37. Subsequent qPCR was performed to detect the corresponding transcribed cDNAs. The efficiency of reverse transcription of tRNA(Lys)(UUU) was ms(2)-modification dependent. The relative difference in threshold cycle number obtained with the r1 or r2 primer yielded the ms(2)-modification level in tRNA(Lys)(UUU) precisely as predicted by an original mathematical model. The method was capable of measuring ms(2)-modification levels in tRNA(Lys)(UUU) in total RNA isolated from human peripheral blood samples, revealing that the ms(2)-modification rate in tRNA(Lys)(UUU) was decreased in individuals carrying the CDKAL1 genotype associated with T2D. In addition, the ms(2)-modification level was correlated with insulin secretion. The results point to the critical role of ms(2) modification in T2D and to a potential clinical use of a simple and high-throughput method for assessing T2D risk.

Design and Application of a Circuit for Measuring Frequency and Duty Cycle of Stimulated Bioelectrical Signal

NASA Astrophysics Data System (ADS)

Tang, Li-Ming; Chang, Ben-Kang; Liu, Tie-Bing; Wu, Min; Ling, Gang

2002-12-01

To design a new type of circuit for measuring frequency & duty cycle of stimulated bioelectrical signal for the project of 'the map of neuron-threshold in human brain and its clinical application'. This circuit was designed according to the character of stimulated bioelectrical signals. It was tested and improved and then used in the neuron -threshold stimulator. The circuit was found to be very accurate for measuring frequency and the error for measuring duty cycle was below 0.2%. This circuit is well-designed, simple, easy to use, and can be applied in many systems.

Biogeochemical cycling at the aquatic-terrestrial interface is linked to parafluvial hyporheic zone inundation history

NASA Astrophysics Data System (ADS)

Goldman, Amy E.; Graham, Emily B.; Crump, Alex R.; Kennedy, David W.; Romero, Elvira B.; Anderson, Carolyn G.; Dana, Karl L.; Resch, Charles T.; Fredrickson, Jim K.; Stegen, James C.

2017-09-01

The parafluvial hyporheic zone combines the heightened biogeochemical and microbial interactions indicative of a hyporheic region with direct atmospheric/terrestrial inputs and the effects of wet-dry cycles. Therefore, understanding biogeochemical cycling and microbial interactions in this ecotone is fundamental to understanding biogeochemical cycling at the aquatic-terrestrial interface and to creating robust hydrobiogeochemical models of dynamic river corridors. We aimed to (i) characterize biogeochemical and microbial differences in the parafluvial hyporheic zone across a small spatial domain (6 lateral meters) that spans a breadth of inundation histories and (ii) examine how parafluvial hyporheic sediments respond to laboratory-simulated re-inundation. Surface sediment was collected at four elevations along transects perpendicular to flow of the Columbia River, eastern WA, USA. The sediments were inundated by the river 0, 13, 127, and 398 days prior to sampling. Spatial variation in environmental variables (organic matter, moisture, nitrate, glucose, % C, % N) and microbial communities (16S and internal transcribed spacer (ITS) rRNA gene sequencing, qPCR) were driven by differences in inundation history. Microbial respiration did not differ significantly across inundation histories prior to forced inundation in laboratory incubations. Forced inundation suppressed microbial respiration across all histories, but the degree of suppression was dramatically different between the sediments saturated and unsaturated at the time of sample collection, indicating a binary threshold response to re-inundation. We present a conceptual model in which irregular hydrologic fluctuations facilitate microbial communities adapted to local conditions and a relatively high flux of CO2. Upon rewetting, microbial communities are initially suppressed metabolically, which results in lower CO2 flux rates primarily due to suppression of fungal respiration. Following prolonged inundation, the microbial community adapts to saturation by shifting composition, and the CO2 flux rebounds to prior levels due to the subsequent change in respiration. Our results indicate that the time between inundation events can push the system into alternate states: we suggest (i) that, above some threshold of inundation interval, re-inundation suppresses respiration to a consistent, low rate and (ii) that, below some inundation interval, re-inundation has a minor effect on respiration. Extending reactive transport models to capture processes that govern such dynamics will provide more robust predictions of river corridor biogeochemical function under altered surface water flow regimes in both managed and natural watersheds.

Determination of Anaerobic Threshold by Heart Rate or Heart Rate Variability using Discontinuous Cycle Ergometry.

PubMed

Park, Sung Wook; Brenneman, Michael; Cooke, William H; Cordova, Alberto; Fogt, Donovan

The purpose was to determine if heart rate (HR) and heart rate variability (HRV) responses would reflect anaerobic threshold (AT) using a discontinuous, incremental, cycle test. AT was determined by ventilatory threshold (VT). Cyclists (30.6±5.9y; 7 males, 8 females) completed a discontinuous cycle test consisting of 7 stages (6 min each with 3 min of rest between). Three stages were performed at power outputs (W) below those corresponding to a previously established AT, one at W corresponding to AT, and 3 at W above those corresponding to AT. The W at the intersection of the trend lines was considered each metric's "threshold". The averaged stage data for Ve, HR, and time- and frequency-domain HRV metrics were plotted versus W. The W at the "threshold" for the metrics of interest were compared using correlation analysis and paired-sample t -test. In all, several heart rate-related parameters accurately reflected AT with significant correlations (p≤0.05) were observed between AT W and HR, mean RR interval (MRR), low and high frequency spectral energy (LF and HR, respectively), high frequency peak (fHF), and HFxfHF metrics' threshold W (i.e., MRRTW, etc.). Differences in HR or HRV metric threshold W and AT for all subjects were less than 14 W. The steady state data from discontinuous protocols may allow for a true indication of steady-state physiologic stress responses and corresponding W at AT, compared to continuous protocols using 1-2 min exercise stages.

Electrolyte and Metabolic Disturbances in Ebola Patients during a Clinical Trial, Guinea, 2015

PubMed Central

Bah, Elhadj Ibrahima; Haba, Nyankoye; Delamou, Alexandre; Camara, Bienvenu Salim; Olivier, Kadio Jean-Jacques; De Clerck, Hilde; Nordenstedt, Helena; Semple, Malcolm G.; Van Herp, Michel; Buyze, Jozefien; De Crop, Maaike; Van Den Broucke, Steven; Lynen, Lutgarde; De Weggheleire, Anja

2016-01-01

By using data from a 2015 clinical trial on Ebola convalescent-phase plasma in Guinea, we assessed the prevalence of electrolyte and metabolic abnormalities at admission and their predictive value to stratify patients into risk groups. Patients underwent testing with a point-of-care device. We used logistic regression to construct a prognostic model and summarized the predictive value with the area under the receiver operating curve. Abnormalities were common among patients, particularly hypokalemia, hypocalcemia, hyponatremia, raised creatinine, high anion gap, and anemia. Besides age and PCR cycle threshold value, renal dysfunction, low calcium levels, and low hemoglobin levels were independently associated with increased risk for death. A prognostic model using all 5 factors was highly discriminatory (area under the receiver operating curve 0.95; 95% CI 0.90–0.99) and enabled the definition of risk criteria to guide targeted care. Most patients had a very low (<5%) or very high (>80%) risk for death. PMID:27869610

Electrolyte and Metabolic Disturbances in Ebola Patients during a Clinical Trial, Guinea, 2015.

PubMed

van Griensven, Johan; Bah, Elhadj Ibrahima; Haba, Nyankoye; Delamou, Alexandre; Camara, Bienvenu Salim; Olivier, Kadio Jean-Jacques; De Clerck, Hilde; Nordenstedt, Helena; Semple, Malcolm G; Van Herp, Michel; Buyze, Jozefien; De Crop, Maaike; Van Den Broucke, Steven; Lynen, Lutgarde; De Weggheleire, Anja

2016-12-01

By using data from a 2015 clinical trial on Ebola convalescent-phase plasma in Guinea, we assessed the prevalence of electrolyte and metabolic abnormalities at admission and their predictive value to stratify patients into risk groups. Patients underwent testing with a point-of-care device. We used logistic regression to construct a prognostic model and summarized the predictive value with the area under the receiver operating curve. Abnormalities were common among patients, particularly hypokalemia, hypocalcemia, hyponatremia, raised creatinine, high anion gap, and anemia. Besides age and PCR cycle threshold value, renal dysfunction, low calcium levels, and low hemoglobin levels were independently associated with increased risk for death. A prognostic model using all 5 factors was highly discriminatory (area under the receiver operating curve 0.95; 95% CI 0.90-0.99) and enabled the definition of risk criteria to guide targeted care. Most patients had a very low (<5%) or very high (>80%) risk for death.

Rapid concentration and sensitive detection of hookworm ova from wastewater matrices using a real-time PCR method.

PubMed

Gyawali, P; Sidhu, J P S; Ahmed, W; Jagals, P; Toze, S

2015-12-01

The risk of human hookworm infections from land application of wastewater matrices could be high in regions with high hookworm prevalence. A rapid, sensitive and specific hookworm detection method from wastewater matrices is required in order to assess human health risks. Currently available methods used to identify hookworm ova to the species level are time consuming and lack accuracy. In this study, a real-time PCR method was developed for the rapid, sensitive and specific detection of canine hookworm (Ancylostoma caninum) ova from wastewater matrices. A. caninum was chosen because of its morphological similarity to the human hookworm (Ancylostoma duodenale and Necator americanus). The newly developed PCR method has high detection sensitivity with the ability to detect less than one A. caninum ova from 1 L of secondary treated wastewater at the mean threshold cycle (CT) values ranging from 30.1 to 34.3. The method is also able to detect four A. caninum ova from 1 L of raw wastewater and from ∼4 g of treated sludge with mean CT values ranging from 35.6 to 39.8 and 39.8 to 39.9, respectively. The better detection sensitivity obtained for secondary treated wastewater compared to raw wastewater and sludge samples could be attributed to sample turbidity. The proposed method appears to be rapid, sensitive and specific compared to traditional methods and has potential to aid in the public health risk assessment associated with land application of wastewater matrices. Furthermore, the method can be adapted to detect other helminth ova of interest from wastewater matrices. Crown Copyright © 2015. Published by Elsevier Inc. All rights reserved.

Dynamics of Escherichia coli Virulence Factors in Dairy Herds and Farm Environments in a Longitudinal Study in the United States

PubMed Central

Lambertini, Elisabetta; Karns, Jeffrey S.; Van Kessel, Jo Ann S.; Cao, Huilin; Schukken, Ynte H.; Wolfgang, David R.; Smith, Julia M.

2015-01-01

Pathogenic Escherichia coli or its associated virulence factors have been frequently detected in dairy cow manure, milk, and dairy farm environments. However, it is unclear what the long-term dynamics of E. coli virulence factors are and which farm compartments act as reservoirs. This study assessed the occurrence and dynamics of four E. coli virulence factors (eae, stx1, stx2, and the gamma allele of the tir gene [γ-tir]) on three U.S. dairy farms. Fecal, manure, water, feed, milk, and milk filter samples were collected from 2004 to 2012. Virulence factors were measured by postenrichment quantitative PCR (qPCR). All factors were detected in most compartments on all farms. Fecal and manure samples showed the highest prevalence, up to 53% for stx and 21% for γ-tir in fecal samples and up to 84% for stx and 44% for γ-tir in manure. Prevalence was low in milk (up to 1.9% for stx and 0.7% for γ-tir). However, 35% of milk filters were positive for stx and 20% were positive for γ-tir. All factors were detected in feed and water. Factor prevalence and levels, expressed as qPCR cycle threshold categories, fluctuated significantly over time, with no clear seasonal signal independent from year-to-year variability. Levels were correlated between fecal and manure samples, and in some cases autocorrelated, but not between manure and milk filters. Shiga toxins were nearly ubiquitous, and 10 to 18% of the lactating cows were potential shedders of E. coli O157 at least once during their time in the herds. E. coli virulence factors appear to persist in many areas of the farms and therefore contribute to transmission dynamics. PMID:25911478

A novel multiplex real-time PCR assay for the concurrent detection of hepatitis A, B and C viruses in patients with acute hepatitis.

PubMed

Park, Yongjung; Kim, Beom Seok; Choi, Kyu Hun; Shin, Dong Ho; Lee, Mi Jung; Cho, Yonggeun; Kim, Hyon-Suk

2012-01-01

A novel multiplex real-time PCR assay for concurrent detection of hepatitis viruses was evaluated for its clinical performance in screening patients with acute hepatitis. A total of 648 serum samples were collected from patients with acute symptoms of hepatitis. Concurrent detection of nucleic acids of HAV, HBV and HCV was performed using the Magicplex™ HepaTrio Real-time Detection test. Serum nucleic acid levels of HBV and HCV were also quantified by the Cobas® AmpliPrep/Cobas® TaqMan® (CAP/CTM) HBV and HCV tests. Patients' medical records were also reviewed. Concordance rates between the results from the HepaTrio and the CAP/CTM tests for the detection of HBV and HCV were 94.9% (k = 0.88) and 99.2% (k = 0.98), respectively. The cycle threshold values with the HepaTrio test were also correlated well with the levels of HBV DNA (r = -0.9230) and HCV RNA (r = -0.8458). The sensitivity and specificity of the HepaTrio test were 93.8% and 98.2%, respectively, for detecting HBV infection, and 99.1% and 100.0%, respectively, for HCV infection. For the HepaTrio test, 21 (3.2%) cases were positive for both HBV and HCV. Among the positive cases, 6 (0.9%) were true coinfections. This test also detected 18 (2.8%) HAV positives. The HepaTrio test demonstrated good clinical performance and produced results that agreed well with those of the CAP/CTM assays, especially for the detection of HCV. This assay was also able to detect HAV RNA from anti-HAV IgM-positive individuals. Therefore, this new multiplex PCR assay could be useful for the concurrent detection of the three hepatitis viruses.

Comparative Evaluation of the Diagnostic Performance of the Prototype Cepheid GeneXpert Ebola Assay

PubMed Central

Jansen van Vuren, Petrus; Grobbelaar, Antoinette; Storm, Nadia; Conteh, Ousman; Konneh, Kelfala; Kamara, Abdul; Sanne, Ian

2015-01-01

The Ebola virus disease (EVD) outbreak in West Africa has highlighted an urgent need for point-of-care (POC) assays for the diagnosis of this devastating disease in resource-limited African countries. The diagnostic performance characteristics of a prototype Cepheid GeneXpert Ebola POC used to detect Ebola virus (EBOV) in stored serum and plasma samples collected from suspected EVD cases in Sierra Leone in 2014 and 2015 was evaluated. The GeneXpert Ebola POC is a self-contained single-cartridge automated system that targets the glycoprotein (GP) and nucleoprotein (NP) genes of EBOV and yields results within 90 min. Results from 281 patient samples were compared to the results of a TaqMan real-time reverse transcription-PCR (RT-PCR) targeting the polymerase gene and performed on two real-time PCR machines. Agreement between the three platforms was 100% at cycle threshold (CT) values of ≤34.99, but discordant results were noted between CT values of 35 and 45.The diagnostic sensitivity of the three platforms was 100% in 91 patient samples that were confirmed to be infectious by virus isolation. All three molecular platforms detected viral EBOV RNA in additional samples that did not contain viable EBOV. The analytical sensitivity of the GeneXpert Ebola POC for the detection of NP was higher, and comparable to that of polymerase gene detection, than that for the detection of GP when using a titrated laboratory stock of EBOV. There was no detectable cross-reactivity with other hemorrhagic fever viruses or arboviruses. The GeneXpert Ebola POC offers an easy to operate and sensitive diagnostic tool that can be used for the rapid screening of suspected EVD cases in treatment or in holding centers during EVD outbreaks. PMID:26637383

Clinical evaluation of the Abbott RealTime MTB Assay for direct detection of Mycobacterium tuberculosis-complex from respiratory and non-respiratory samples.

PubMed

Hinić, Vladimira; Feuz, Kinga; Turan, Selda; Berini, Andrea; Frei, Reno; Pfeifer, Karin; Goldenberger, Daniel

2017-05-01

Rapid and reliable diagnosis is crucial for correct management of tuberculosis. The Abbott RealTime MTB Assay represents a novel qualitative real-time PCR assay for direct detection of M. tuberculosis-complex (MTB) DNA from respiratory samples. The test targets two highly conserved sequences, the multi-copy insertion element IS6110 and the protein antigen B (PAB) gene of MTB, allowing even the detection of IS6610-deficient strains. We evaluated this commercial diagnostic test by analyzing 200 respiratory and, for the first time, 87 non-respiratory clinical specimens from our tertiary care institution and compared its results to our IS6110-based in-house real-time PCR for MTB as well as MTB culture. Overall sensitivity for Abbott RealTime MTB was 100% (19/19) in smear positive and 87.5% (7/8) in smear negative specimens, while the specificity of the assay was 100% (260/260). For both non-respiratory smear positive and smear negative specimens Abbott RealTime MTB tests showed 100% (8/8) sensitivity and 100% (8/8) specificity. Cycle threshold (Ct) value analysis of 16 MTB positive samples showed a slightly higher Ct value of the Abbott RealTime MTB test compared to our in-house MTB assay (mean delta Ct = 2.55). In conclusion, the performance of the new Abbott RealTime MTB Assay was highly similar to culture and in-house MTB PCR. We document successful analysis of 87 non-respiratory samples with the highly automated Abbott RealTime MTB test with no inhibition observed. Copyright © 2017 Elsevier Ltd. All rights reserved.

ELISA versus PCR for diagnosis of chronic Chagas disease: systematic review and meta-analysis

PubMed Central

2010-01-01

Background Most current guidelines recommend two serological tests to diagnose chronic Chagas disease. When serological tests are persistently inconclusive, some guidelines recommend molecular tests. The aim of this investigation was to review chronic Chagas disease diagnosis literature and to summarize results of ELISA and PCR performance. Methods A systematic review was conducted searching remote databases (MEDLINE, LILACS, EMBASE, SCOPUS and ISIWeb) and full texts bibliography for relevant abstracts. In addition, manufacturers of commercial tests were contacted. Original investigations were eligible if they estimated sensitivity and specificity, or reliability -or if their calculation was possible - of ELISA or PCR tests, for chronic Chagas disease. Results Heterogeneity was high within each test (ELISA and PCR) and threshold effect was detected only in a particular subgroup. Reference standard blinding partially explained heterogeneity in ELISA studies, and pooled sensitivity and specificity were 97.7% [96.7%-98.5%] and 96.3% [94.6%-97.6%] respectively. Commercial ELISA with recombinant antigens studied in phase three investigations partially explained heterogeneity, and pooled sensitivity and specificity were 99.3% [97.9%-99.9%] and 97.5% [88.5%-99.5%] respectively. ELISA's reliability was seldom studied but was considered acceptable. PCR heterogeneity was not explained, but a threshold effect was detected in three groups created by using guanidine and boiling the sample before DNA extraction. PCR sensitivity is likely to be between 50% and 90%, while its specificity is close to 100%. PCR reliability was never studied. Conclusions Both conventional and recombinant based ELISA give useful information, however there are commercial tests without technical reports and therefore were not included in this review. Physicians need to have access to technical reports to understand if these serological tests are similar to those included in this review and therefore correctly order and interpret test results. Currently, PCR should not be used in clinical practice for chronic Chagas disease diagnosis and there is no PCR test commercially available for this purpose. Tests limitations and directions for future research are discussed. PMID:21108793

Fatigue Crack Growth Threshold Testing of Metallic Rotorcraft Materials

NASA Technical Reports Server (NTRS)

Newman, John A.; James, Mark A.; Johnson, William M.; Le, Dy D.

2008-01-01

Results are presented for a program to determine the near-threshold fatigue crack growth behavior appropriate for metallic rotorcraft alloys. Four alloys, all commonly used in the manufacture of rotorcraft, were selected for study: Aluminum alloy 7050, 4340 steel, AZ91E Magnesium, and Titanium alloy Ti-6Al-4V (beta-STOA). The Federal Aviation Administration (FAA) sponsored this research to advance efforts to incorporate damage tolerance design and analysis as requirements for rotorcraft certification. Rotorcraft components are subjected to high cycle fatigue and are typically subjected to higher stresses and more stress cycles per flight hour than fixed-wing aircraft components. Fatigue lives of rotorcraft components are generally spent initiating small fatigue cracks that propagate slowly under near-threshold cracktip loading conditions. For these components, the fatigue life is very sensitive to the near-threshold characteristics of the material.

Multiplex Real-Time PCR Assays that Measure the Abundance of Extremely Rare Mutations Associated with Cancer

PubMed Central

Vargas, Diana Y.; Kramer, Fred Russell; Tyagi, Sanjay; Marras, Salvatore A. E.

2016-01-01

We describe the use of “SuperSelective” primers that enable the detection and quantitation of somatic mutations whose presence relates to cancer diagnosis, prognosis, and therapy, in real-time PCR assays that can potentially analyze rare DNA fragments present in blood samples (liquid biopsies). The design of these deoxyribonucleotide primers incorporates both a relatively long “5' anchor sequence” that hybridizes strongly to target DNA fragments, and a very short, physically and functionally separate, “3' foot sequence” that is perfectly complementary to the mutant target sequence, but mismatches the wild-type sequence. As few as ten mutant fragments can reliably be detected in the presence of 1,000,000 wild-type fragments, even when the difference between the mutant and the wild type is only a single nucleotide polymorphism. Multiplex PCR assays employing a set of SuperSelective primers, and a corresponding set of differently colored molecular beacon probes, can be used in situations where the different mutations, though occurring in different cells, are located in the same codon. These non-symmetric real-time multiplex PCR assays contain limited concentrations of each SuperSelective primer, thereby enabling the simultaneous determination of each mutation’s abundance by comparing its threshold value to the threshold value of a reference gene present in the sample. PMID:27244445

Response of pMOS dosemeters on gamma-ray irradiation during its re-use.

PubMed

Pejovic, Milic M; Pejovic, Momcilo M; Jaksic, Aleksandar B

2013-08-01

Response of pMOS dosemeters during two successive irradiations with gamma-ray irradiation to a dose of 35 Gy and annealing at room and elevated temperature has been studied. The response was followed on the basis of threshold voltage shift, determined from transfer characteristics, as a function of absorbed dose or annealing time. It was shown that the threshold voltage shifts during first and second irradiation for the gate bias during irradiation of 5 and 2.5 V insignificantly differ although complete fading was not achieved after the first cycle of annealing. In order to analyse the defects formed in oxide and at the interface during irradiation and annealing, which are responsible for threshold voltage shift, midgap and charge-pumping techniques were used. It was shown that during first irradiation and annealing a dominant influence to threshold voltage shift is made by fixed oxide traps, while at the beginning of the second annealing cycle, threshold voltage shift is a consequence of both fixed oxide traps and slow switching traps.

[A quantitative real time polymerase chain reaction for detection of HBV covalently closed circular DNA in livers of the HBV infected patients].

PubMed

Wang, Mei-Rong; Qiu, Ning; Lu, Shi-Chun; Xiu, Dian-Rong; Yu, Jian-Guo; Li, Tong; Liu, Xue-En; Zhuang, Hui

2011-05-01

To establish and optimize a sensitive and specific quantitative real-time polymerase chain reaction (PCR) method for detection of hepatitis B virus covalently closed circular DNA (HBV cccDNA) in liver tissue. Specific primers and probes were designed to detect HBV DNA (tDNA) and cccDNA. A series of plasmids (3.44 × 10(0) - 3.44 × 10(9) copies/µl) containing a full double-stranded copies of HBV genome (genotype C) were used to establish the standard curve of real-time PCR. Liver samples of 33 patients with HBV related hepatocellular carcinoma (HCC), 13 Chronic hepatitis B patients (CHB) and 10 non-HBV patients were collected to verify the sensitivity and specificity of the assay. A fraction of extracted DNA was digested with a Plasmid-Safe ATP-dependent Dnase (PSAD) for HBV cccDNA detection and the remaining was used for tDNA and β-globin detection. The amount (copies/cell) of HBV cccDNA and tDNA were measured by a real-time PCR, using β-globin housekeeping gene as a quantitation standard. The standard curves of real-time PCR with a linear range of 3.44 × 10(0) to 3.44 × 10(9) copies/µl were established for detecting HBV cccDNA and tDNA, and both of the lowest detection limits of HBV cccDNA and tDNA were 3.44 × 10(0) copies/µl. The lowest quantitation levels of HBV cccDNA in liver tissues tested in 33 HBV related HCC patients and 13 CHB patients were 0.003 copies/cell and 0.031 copies/cell, respectively. HBV cccDNA and tDNA in liver tissue of 10 non-HBV patient appeared to be negative. The true positive rate was increasing through the digestion of HBV DNA by PSAD, and the analytic specificity of cccDNA detection improved by 7.24 × 10(2) times. Liver tissues of 2 patients were retested 5 times in the PCR for detecting cccDNA and the coefficient of variations on cycle threshold (Ct) were between 0.224% - 0.609%. A highly sensitive and specific quantitative real time PCR method for the detection of HBV cccDNA in liver tissue was established and could be used for clinical and epidemiological studies.

Development of chemiluminescent probe hybridization, RT-PCR and nucleic acid cycle sequencing assays of Sabin type 3 isolates to identify base pair 472 Sabin type 3 mutants associated with vaccine associated paralytic poliomyelitis.

PubMed

Old, M O; Logan, L H; Maldonado, Y A

1997-11-01

Sabin type 3 polio vaccine virus is the most common cause of poliovaccine associated paralytic poliomyelitis. Vaccine associated paralytic poliomyelitis cases have been associated with Sabin type 3 revertants containing a single U to C substitution at bp 472 of Sabin type 3. A rapid method of identification of Sabin type 3 bp 472 mutants is described. An enterovirus group-specific probe for use in a chemiluminescent dot blot hybridization assay was developed to identify enterovirus positive viral lysates. A reverse transcription-polymerase chain reaction (RT-PCR) assay producing a 319 bp PCR product containing the Sabin type 3 bp 472 mutation site was then employed to identify Sabin type 3 isolates. Chemiluminescent nucleic acid cycle sequencing of the purified 319 bp PCR product was then employed to identify nucleic acid sequences at bp 472. The enterovirus group probe hybridization procedure and isolation of the Sabin type 3 PCR product were highly sensitive and specific; nucleic acid cycle sequencing corresponded to the known sequence of stock Sabin type 3 isolates. These methods will be used to identify the Sabin type 3 reversion rate from sequential stool samples of infants obtained after the first and second doses of oral poliovirus vaccine.

Microhematuria Associated With a Special Operations Craft Mission

DTIC Science & Technology

2004-09-22

proteinuria at 5 minutes and 1 hour following three 60-second Wingate tests, a 60-minute treadmill run at 90% of anaerobic threshold , a 60-minute cycle...ergometer ride at 90% of anaerobic threshold , and three 400-meter sprints. Of these only the sprints produced microhematuria on average. All ten...Ulmer, H., et al. (2003). The effect of marathon cycling on renal function. Int J Sports Med, 24(2), 131-137. [7] Alvarez, C., Mir, J., Obaya, S

A Climatology of dust emission in northern Africa using surface observations from 1984-2012

NASA Astrophysics Data System (ADS)

Cowie, Sophie; Knippertz, Peter; Marsham, John

2014-05-01

The huge quantity of mineral dust emitted annually from northern Africa makes this area crucial to the global dust cycle. Once in the atmosphere, dust aerosols have a significant impact on the global radiation budget, clouds, the carbon cycle and can even act as a fertilizer to rain forests in South America. Current model estimates of dust production from northern Africa are uncertain. At the heart of this problem is insufficient understanding of key dust emitting processes such as haboobs (cold pools generated through evaporation of convective precipitation), low-level jets (LLJs) and dry convection (dust devils and dust plumes). Scarce observations in this region, in particular in the Sahara, make model evaluation difficult. This work uses long-term surface observations from 70 stations situated in the Sahara and Sahel to explore the diurnal, seasonal and geographical variations in dust emission events and thresholds. Quality flags are applied to each station to indicate a day-time bias or gaps in the time period 1984-2012. The frequency of dust emission (FDE) is calculated using the present weather codes (WW) of SYNOP reports, where WW = 07,08,09,30-35 and 98. Thresholds are investigated by estimating the wind speeds for which there is a 25%, 50% and 75% probability of dust emission. The 50% threshold is used to calculate strong wind frequency (SWF) and the diagnostic parameter dust uplift potential (DUP); a thresholded cubic function of wind-speed which quantifies the dust generating power of winds. Stations are grouped into 6 areas (North Algeria, Central Sahara, Egypt, West Sahel, Central Sahel and Sudan) for more in-depth analysis of these parameters. Spatially, thresholds are highest in northern Algeria and lowest in the Sahel around the latitude band 16N-21N. Annual mean FDE is anti-correlated with the threshold, showing the importance of spatial variations in thresholds for mean dust emission. The annual cycles of FDE and SWF for the 6 grouped areas are highly correlated (0.95 to 0.99). These correlations are barely reduced when annual-mean thresholds are used, showing that seasonal variations in thresholds are not the main control on the seasonal variations in FDE. Relationships between annual cycles in FDE and DUP are more complex than between FDE and SWF, reflecting the seasonal variations in the types and intensities of dust events. FDE is highest in spring north of 23N. South of this, where stations are directly influenced by the summer monsoon, the annual cycle in FDE is much more variable. Half of the total DUP occurs at wind-speeds greater than ~ 28 ms-1, which highlights the importance of rare high-energy wind events. The likely meteorological mechanisms generating these patterns are discussed.

Physiological differences between cycling and running: lessons from triathletes.

PubMed

Millet, Gregoire P; Vleck, V E; Bentley, D J

2009-01-01

The purpose of this review was to provide a synopsis of the literature concerning the physiological differences between cycling and running. By comparing physiological variables such as maximal oxygen consumption (V O(2max)), anaerobic threshold (AT), heart rate, economy or delta efficiency measured in cycling and running in triathletes, runners or cyclists, this review aims to identify the effects of exercise modality on the underlying mechanisms (ventilatory responses, blood flow, muscle oxidative capacity, peripheral innervation and neuromuscular fatigue) of adaptation. The majority of studies indicate that runners achieve a higher V O(2max) on treadmill whereas cyclists can achieve a V O(2max) value in cycle ergometry similar to that in treadmill running. Hence, V O(2max) is specific to the exercise modality. In addition, the muscles adapt specifically to a given exercise task over a period of time, resulting in an improvement in submaximal physiological variables such as the ventilatory threshold, in some cases without a change in V O(2max). However, this effect is probably larger in cycling than in running. At the same time, skill influencing motor unit recruitment patterns is an important influence on the anaerobic threshold in cycling. Furthermore, it is likely that there is more physiological training transfer from running to cycling than vice versa. In triathletes, there is generally no difference in V O(2max) measured in cycle ergometry and treadmill running. The data concerning the anaerobic threshold in cycling and running in triathletes are conflicting. This is likely to be due to a combination of actual training load and prior training history in each discipline. The mechanisms surrounding the differences in the AT together with V O(2max) in cycling and running are not largely understood but are probably due to the relative adaptation of cardiac output influencing V O(2max) and also the recruitment of muscle mass in combination with the oxidative capacity of this mass influencing the AT. Several other physiological differences between cycling and running are addressed: heart rate is different between the two activities both for maximal and submaximal intensities. The delta efficiency is higher in running. Ventilation is more impaired in cycling than in running. It has also been shown that pedalling cadence affects the metabolic responses during cycling but also during a subsequent running bout. However, the optimal cadence is still debated. Central fatigue and decrease in maximal strength are more important after prolonged exercise in running than in cycling.

Ebola RNA Persistence in Semen of Ebola Virus Disease Survivors - Final Report.

PubMed

Deen, Gibrilla F; Broutet, Nathalie; Xu, Wenbo; Knust, Barbara; Sesay, Foday R; McDonald, Suzanna L R; Ervin, Elizabeth; Marrinan, Jaclyn E; Gaillard, Philippe; Habib, Ndema; Liu, Hongtu; Liu, William; Thorson, Anna E; Yamba, Francis; Massaquoi, Thomas A; James, Faustin; Ariyarajah, Archchun; Ross, Christine; Bernstein, Kyle; Coursier, Antoine; Klena, John; Carino, Marylin; Wurie, Alie H; Zhang, Yong; Dumbuya, Marion S; Abad, Neetu; Idriss, Baimba; Wi, Teodora; Bennett, Sarah D; Davies, Tina; Ebrahim, Faiqa K; Meites, Elissa; Naidoo, Dhamari; Smith, Samuel J; Ongpin, Patricia; Malik, Tasneem; Banerjee, Anshu; Erickson, Bobbie R; Liu, Yongjian; Liu, Yang; Xu, Ke; Brault, Aaron; Durski, Kara N; Winter, Jörn; Sealy, Tara; Nichol, Stuart T; Lamunu, Margaret; Bangura, James; Landoulsi, Sihem; Jambai, Amara; Morgan, Oliver; Wu, Guizhen; Liang, Mifang; Su, Qiudong; Lan, Yu; Hao, Yanzhe; Formenty, Pierre; Ströher, Ute; Sahr, Foday

2017-10-12

Ebola virus has been detected in the semen of men after their recovery from Ebola virus disease (EVD). We report the presence of Ebola virus RNA in semen in a cohort of survivors of EVD in Sierra Leone. We enrolled a convenience sample of 220 adult male survivors of EVD in Sierra Leone, at various times after discharge from an Ebola treatment unit (ETU), in two phases (100 participants were in phase 1, and 120 in phase 2). Semen specimens obtained at baseline were tested by means of a quantitative reverse-transcriptase-polymerase-chain-reaction (RT-PCR) assay with the use of the target sequences of NP and VP40 (in phase 1) or NP and GP (in phase 2). This study did not evaluate directly the risk of sexual transmission of EVD. Of 210 participants who provided an initial semen specimen for analysis, 57 (27%) had positive results on quantitative RT-PCR. Ebola virus RNA was detected in the semen of all 7 men with a specimen obtained within 3 months after ETU discharge, in 26 of 42 (62%) with a specimen obtained at 4 to 6 months, in 15 of 60 (25%) with a specimen obtained at 7 to 9 months, in 4 of 26 (15%) with a specimen obtained at 10 to 12 months, in 4 of 38 (11%) with a specimen obtained at 13 to 15 months, in 1 of 25 (4%) with a specimen obtained at 16 to 18 months, and in no men with a specimen obtained at 19 months or later. Among the 46 participants with a positive result in phase 1, the median baseline cycle-threshold values (higher values indicate lower RNA values) for the NP and VP40 targets were lower within 3 months after ETU discharge (32.4 and 31.3, respectively; in 7 men) than at 4 to 6 months (34.3 and 33.1; in 25), at 7 to 9 months (37.4 and 36.6; in 13), and at 10 to 12 months (37.7 and 36.9; in 1). In phase 2, a total of 11 participants had positive results for NP and GP targets (samples obtained at 4.1 to 15.7 months after ETU discharge); cycle-threshold values ranged from 32.7 to 38.0 for NP and from 31.1 to 37.7 for GP. These data showed the long-term presence of Ebola virus RNA in semen and declining persistence with increasing time after ETU discharge. (Funded by the World Health Organization and others.).

Detection of Bordetella pertussis by rapid-cycle PCR and colorimetric microwell hybridization.

PubMed Central

Buck, G E

1996-01-01

The use of rapid-cycle PCR combined with colorimetric microwell hybridization for detecting Bordetella pertussis was investigated. Rapid cycling was performed with an air thermocycler (model 1605; Idaho Technology, Idaho Falls, Idaho). Although the instrument was originally designed to be used with capillary tubes, an adapter that allows this instrument to be used with PCR tubes has recently been introduced. Because of the low heat capacity of air, the thermocycler has rapid transition rates between temperatures. The combination of a rapid temperature transition rate, small sample volume (10 microliters), and overshooting or undershooting of the temperature set points allowed the cycles to be reduced to 5 s for denaturation and 10 s for extension and annealing. Thus, the amplification could be completed in a total of approximately 35 min. Amplified DNA was detected with biotin-labeled primers and by hybridization to a capture probe immobilized in microwell plates. When simulated clinical specimens consisting of pooled nasopharyngeal washes with known numbers of B. pertussis organisms were examined by this procedure, as little as one organism per 5 microliters of sample could be detected. Six nasopharyngeal aspirates or washes from culture-positive patients were positive by PCR, as were two of seven specimens obtained from patients that were negative by culture and direct fluorescent-antibody assay. The two patients who were PCR positive but culture and direct fluorescent-antibody assay negative had clinical disease compatible with pertussis. This method appears to be a sensitive, convenient means of detecting B. pertussis in clinical specimens. The total time required for specimen processing, amplification, and detection is about 2.5 h. PMID:8735080

Development and Interlaboratory Validation of a Simple Screening Method for Genetically Modified Maize Using a ΔΔC(q)-Based Multiplex Real-Time PCR Assay.

PubMed

Noguchi, Akio; Nakamura, Kosuke; Sakata, Kozue; Sato-Fukuda, Nozomi; Ishigaki, Takumi; Mano, Junichi; Takabatake, Reona; Kitta, Kazumi; Teshima, Reiko; Kondo, Kazunari; Nishimaki-Mogami, Tomoko

2016-04-19

A number of genetically modified (GM) maize events have been developed and approved worldwide for commercial cultivation. A screening method is needed to monitor GM maize approved for commercialization in countries that mandate the labeling of foods containing a specified threshold level of GM crops. In Japan, a screening method has been implemented to monitor approved GM maize since 2001. However, the screening method currently used in Japan is time-consuming and requires generation of a calibration curve and experimental conversion factor (C(f)) value. We developed a simple screening method that avoids the need for a calibration curve and C(f) value. In this method, ΔC(q) values between the target sequences and the endogenous gene are calculated using multiplex real-time PCR, and the ΔΔC(q) value between the analytical and control samples is used as the criterion for determining analytical samples in which the GM organism content is below the threshold level for labeling of GM crops. An interlaboratory study indicated that the method is applicable independently with at least two models of PCR instruments used in this study.

Threshold Level and Traceability of Roundup Ready® Soybeans in Tofu Production

PubMed Central

2017-01-01

Summary The aim of this study is to assess DNA degradation, DNA amplification, and GMO quantity during tofu production. Soybean seeds were spiked with Roundup Ready® soybeans (RRS) at 0.9, 2, 3 and 5% (by mass), to assess the level of RSS that would be of practical interest for threshold labelling. Real-time polymerase chain reaction (PCR) was more effective than conventional PCR in the analysis of raw soymilk, okara, boiled soymilk and tofu. The negative effect of grinding and mechanical manipulation was obvious in the okara sample prepared with 3 and 5% RRS, where GMO content was reduced to (2.28±0.23) and (2.74±0.26) %, respectively. However, heating at 100 °C for 10 min did not cause significant degradation of DNA in all samples. The content of RRS in the final product, tofu, was reduced tenfold during processing, ranging from 0.07 to 0.46%, which was below the labelling threshold level. The results are discussed in terms of global harmonization of GMO standards, which could have the positive effect on the trade of lightly processed foodstuffs such as tofu, especially regarding the labelling policies. PMID:29540978

Threshold Level and Traceability of Roundup Ready® Soybeans in Tofu Production.

PubMed

Nikolić, Zorica; Petrović, Gordana; Panković, Dejana; Ignjatov, Maja; Marinković, Dragana; Stojanović, Milan; Đorđević, Vuk

2017-12-01

The aim of this study is to assess DNA degradation, DNA amplification, and GMO quantity during tofu production. Soybean seeds were spiked with Roundup Ready ® soybeans (RRS) at 0.9, 2, 3 and 5% (by mass), to assess the level of RSS that would be of practical interest for threshold labelling. Real-time polymerase chain reaction (PCR) was more effective than conventional PCR in the analysis of raw soymilk, okara, boiled soymilk and tofu. The negative effect of grinding and mechanical manipulation was obvious in the okara sample prepared with 3 and 5% RRS, where GMO content was reduced to (2.28±0.23) and (2.74±0.26) %, respectively. However, heating at 100 °C for 10 min did not cause significant degradation of DNA in all samples. The content of RRS in the final product, tofu, was reduced tenfold during processing, ranging from 0.07 to 0.46%, which was below the labelling threshold level. The results are discussed in terms of global harmonization of GMO standards, which could have the positive effect on the trade of lightly processed foodstuffs such as tofu, especially regarding the labelling policies.

Optimization of RAS/BRAF Mutational Analysis Confirms Improvement in Patient Selection for Clinical Benefit to Anti-EGFR Treatment in Metastatic Colorectal Cancer.

PubMed

Santos, Cristina; Azuara, Daniel; Garcia-Carbonero, Rocio; Alfonso, Pilar Garcia; Carrato, Alfredo; Elez, Mª Elena; Gomez, Auxiliadora; Losa, Ferran; Montagut, Clara; Massuti, Bartomeu; Navarro, Valenti; Varela, Mar; Lopez-Doriga, Adriana; Moreno, Victor; Valladares, Manuel; Manzano, Jose Luis; Vieitez, Jose Maria; Aranda, Enrique; Sanjuan, Xavier; Tabernero, Josep; Capella, Gabriel; Salazar, Ramon

2017-09-01

In metastatic colorectal cancer (mCRC), recent studies have shown the importance to accurately quantify low-abundance mutations of the RAS pathway because anti-EGFR therapy may depend on certain mutation thresholds. We aimed to evaluate the added predictive value of an extended RAS panel testing using two commercial assays and a highly sensitive and quantitative digital PCR (dPCR). Tumor samples from 583 mCRC patients treated with anti-EGFR- ( n = 255) or bevacizumab- ( n = 328) based therapies from several clinical trials and retrospective series from the TTD/RTICC Spanish network were analyzed by cobas, therascreen , and dPCR. We evaluated concordance between techniques using the Cohen kappa index. Response rate, progression-free survival (PFS), and overall survival (OS) were correlated to the mutational status and the mutant allele fraction (MAF). Concordance between techniques was high when analyzing RAS and BRAF (Cohen kappa index around 0.75). We observed an inverse correlation between MAF and response in the anti-EGFR cohort ( P < 0.001). Likelihood ratio analysis showed that a fraction of 1% or higher of any mutated alleles offered the best predictive value. PFS and OS were significantly longer in RAS / BRAF wild-type patients, independently of the technique. However, the predictability of both PFS and OS were higher when we considered a threshold of 1% in the RAS scenario (HR = 1.53; CI 95%, 1.12-2.09 for PFS, and HR = 1.9; CI 95%, 1.33-2.72 for OS). Although the rate of mutations observed among techniques is different, RAS and BRAF mutational analysis improved prediction of response to anti-EGFR therapy. Additionally, dPCR with a threshold of 1% outperformed the other platforms. Mol Cancer Ther; 16(9); 1999-2007. ©2017 AACR . ©2017 American Association for Cancer Research.

A Point-of-Need infrared mediated PCR platform with compatible lateral flow strip for HPV detection.

PubMed

Liu, Wenjia; Zhang, Mingfang; Liu, Xiaoyan; Sharma, Alok; Ding, Xianting

2017-10-15

With the increasing need of monitoring the epidemiology of serious infectious diseases, food hygiene, food additives and pesticide residues, it is urgent to develop portable, easy-to-use, inexpensive and rapid molecular diagnostic tools. Herein, we demonstrate a prototype of IR mediated Conducting Oil and CarbOn Nanotube circUlaTing PCR (IR-COCONUT PCR) platform for nucleic acid amplification. The presented platform offers a new solution for miniaturized PCR instruments with non-contact heaters by using conducting oil and carbon nanotube as a medium in IR mediated PCR. This novel platform offers accurate and flexible control of temperature through the integration of PID (proportional-integral-derivative) algorithms to manipulate the duty cycle of the voltage signals of IR LED and a peristaltic pump. The ramping rate of the introduced platform in current study is 1.5°C/s for heating speed and -2.0°C/s for cooling speed. This platform fulfills 30 thermal cycles within 50min which is a match to the conventional bench-top PCR thermo cyclers. For demonstration purpose, human papillomavirus (HPV) patient cervical swab specimens were examined. Downstream lateral flow strip (LFS) was also developed to quantity the PCR products from the IR-COCONUT PCR device within 25min. This PCR platform together with the compatible LFS shows great potential for in-field and Point-of-Need (PoN) testing of genetic or contagious diseases. Copyright © 2017 Elsevier B.V. All rights reserved.

Enhancing robustness and immunization in geographical networks

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huang Liang; Department of Physics, Lanzhou University, Lanzhou 730000; Yang Kongqing

2007-03-15

We find that different geographical structures of networks lead to varied percolation thresholds, although these networks may have similar abstract topological structures. Thus, strategies for enhancing robustness and immunization of a geographical network are proposed. Using the generating function formalism, we obtain an explicit form of the percolation threshold q{sub c} for networks containing arbitrary order cycles. For three-cycles, the dependence of q{sub c} on the clustering coefficients is ascertained. The analysis substantiates the validity of the strategies with analytical evidence.

The Purpose of Generating Fatigue Crack Growth Threshold Data

NASA Technical Reports Server (NTRS)

Forth, Scott

2006-01-01

Test data shows that different width and thickness C(T), M(T) and ESE(T) specimens generate different thresholds Structures designed for "infinite life" are being re-evaluated: a) Threshold changes from 6 to 3 ksi in(sup 1/2); b) Computational life changes from infinite to 4 missions. Multi-million dollar test programs required to substantiate operation. Using ASTM E647 as standard guidance to generate threshold data is not practical. A threshold test approach needs to be standardized that will provide positive margin for high cycle fatigue applications.

Simple and rapid method for the detection of Filobasidiella neoformans in a probiotic dairy product by using loop-mediated isothermal amplification.

PubMed

Ishikawa, Hiroshi; Kasahara, Kohei; Sato, Sumie; Shimakawa, Yasuhisa; Watanabe, Koichi

2014-05-16

Yeast contamination is a serious problem in the food industry and a major cause of food spoilage. Several yeasts, such as Filobasidiella neoformans, which cause cryptococcosis in humans, are also opportunistic pathogens, so a simple and rapid method for monitoring yeast contamination in food is essential. Here, we developed a simple and rapid method that utilizes loop-mediated isothermal amplification (LAMP) for the detection of F. neoformans. A set of five specific LAMP primers was designed that targeted the 5.8S-26S rDNA internal transcribed spacer 2 region of F. neoformans, and the primer set's specificity was confirmed. In a pure culture of F. neoformans, the LAMP assay had a lower sensitivity threshold of 10(2)cells/mL at a runtime of 60min. In a probiotic dairy product artificially contaminated with F. neoformans, the LAMP assay also had a lower sensitivity threshold of 10(2)cells/mL, which was comparable to the sensitivity of a quantitative PCR (qPCR) assay. We also developed a simple two-step method for the extraction of DNA from a probiotic dairy product that can be performed within 15min. This method involves initial protease treatment of the test sample at 45°C for 3min followed by boiling at 100°C for 5min under alkaline conditions. In a probiotic dairy product artificially contaminated with F. neoformans, analysis by means of our novel DNA extraction method followed by LAMP with our specific primer set had a lower sensitivity threshold of 10(3)cells/mL at a runtime of 60min. In contrast, use of our novel method of DNA extraction followed by qPCR assay had a lower sensitivity threshold of only 10(5)cells/mL at a runtime of 3 to 4h. Therefore, unlike the PCR assay, our LAMP assay can be used to quickly evaluate yeast contamination and is sensitive even for crude samples containing bacteria or background impurities. Our study provides a powerful tool for the primary screening of large numbers of food samples for yeast contamination. Copyright © 2014 Elsevier B.V. All rights reserved.

Lumbopelvic Core Stabilization Exercise and Pain Modulation Among Individuals with Chronic Nonspecific Low Back Pain.

PubMed

Paungmali, Aatit; Joseph, Leonard H; Sitilertpisan, Patraporn; Pirunsan, Ubon; Uthaikhup, Sureeporn

2017-11-01

Lumbopelvic stabilization training (LPST) may provide therapeutic benefits on pain modulation in chronic nonspecific low back pain conditions. This study aimed to examine the effects of LPST on pain threshold and pain intensity in comparison with the passive automated cycling intervention and control intervention among patients with chronic nonspecific low back pain. A within-subject, repeated-measures, crossover randomized controlled design was conducted among 25 participants (7 males and 18 females) with chronic nonspecific low back pain. All the participants received 3 different types of experimental interventions, which included LPST, the passive automated cycling intervention, and the control intervention randomly, with 48 hours between the sessions. The pressure pain threshold (PPT), hot-cold pain threshold, and pain intensity were estimated before and after the interventions. Repeated-measures analysis of variance showed that LPST provided therapeutic effects as it improved the PPT beyond the placebo and control interventions (P < 0.01). The pain intensity under the LPST condition was significantly better than that under the passive automated cycling intervention and controlled intervention (P < 0.001). Heat pain threshold under the LPST condition also showed a significant trend of improvement beyond the control (P < 0.05), but no significant effects on cold pain threshold were evident. Lumbopelvic stabilization training may provide therapeutic effects by inducing pain modulation through an improvement in the pain threshold and reduction in pain intensity. LPST may be considered as part of the management programs for treatment of chronic low back pain. © 2017 World Institute of Pain.

Performance of Traditional and Molecular Methods for Detecting Biological Agents in Drinking Water

USGS Publications Warehouse

Francy, Donna S.; Bushon, Rebecca N.; Brady, Amie M.G.; Bertke, Erin E.; Kephart, Christopher M.; Likirdopulos, Christina A.; Mailot, Brian E.; Schaefer, Frank W.; Lindquist, H.D. Alan

2009-01-01

To reduce the impact from a possible bioterrorist attack on drinking-water supplies, analytical methods are needed to rapidly detect the presence of biological agents in water. To this end, 13 drinking-water samples were collected at 9 water-treatment plants in Ohio to assess the performance of a molecular method in comparison to traditional analytical methods that take longer to perform. Two 100-liter samples were collected at each site during each sampling event; one was seeded in the laboratory with six biological agents - Bacillus anthracis (B. anthracis), Burkholderia cepacia (as a surrogate for Bu. pseudomallei), Francisella tularensis (F. tularensis), Salmonella Typhi (S. Typhi), Vibrio cholerae (V. cholerae), and Cryptospordium parvum (C. parvum). The seeded and unseeded samples were processed by ultrafiltration and analyzed by use of quantiative polymerase chain reaction (qPCR), a molecular method, and culture methods for bacterial agents or the immunomagnetic separation/fluorescent antibody (IMS/FA) method for C. parvum as traditional methods. Six replicate seeded samples were also processed and analyzed. For traditional methods, recoveries were highly variable between samples and even between some replicate samples, ranging from below detection to greater than 100 percent. Recoveries were significantly related to water pH, specific conductance, and dissolved organic carbon (DOC) for all bacteria combined by culture methods, but none of the water-quality characteristics tested were related to recoveries of C. parvum by IMS/FA. Recoveries were not determined by qPCR because of problems in quantifying organisms by qPCR in the composite seed. Instead, qPCR results were reported as detected, not detected (no qPCR signal), or +/- detected (Cycle Threshold or 'Ct' values were greater than 40). Several sample results by qPCR were omitted from the dataset because of possible problems with qPCR reagents, primers, and probes. For the remaining 14 qPCR results (including some replicate samples), F. tularensis and V. cholerae were detected in all samples after ultrafiltration, B. anthracis was detected in 13 and +/- detected in 1 sample, and C. parvum was detected in 9 and +/- detected in 4 samples. Bu. cepacia was detected in nine samples, +/- detected in two samples, and not detected in three samples (for two out of three samples not detected, a different strain was used). The qPCR assay for V. cholerae provided two false positive - but late - signals in one unseeded sample. Numbers found by qPCR after ultrafiltration were significantly or nearly significantly related to those found by traditional methods for B. anthracis, F. tularensis, and V. cholerae but not for Bu. cepacia and C. parvum. A qPCR assay for S. Typhi was not available. The qPCR method can be used to rapidly detect B. anthracis, F. tularensis, and V. cholerae with some certainty in drinking-water samples, but additional work would be needed to optimize and test qPCR for Bu. cepacia and C. parvum and establish relations to traditional methods. The specificity for the V. cholerae assay needs to be further investigated. Evidence is provided that ultrafiltration and qPCR are promising methods to rapidly detect biological agents in the Nation's drinking-water supplies and thus reduce the impact and consequences from intentional bioterrorist events. To our knowledge, this is the first study to compare the use of traditional and qPCR methods to detect biological agents in large-volume drinking-water samples.

Effect of multiple cycles of freeze-thawing on the RNA quality of lung cancer tissues.

PubMed

Yu, Keke; Xing, Jie; Zhang, Jie; Zhao, Ruiying; Zhang, Ye; Zhao, Lanxiang

2017-09-01

RNA degradation is a major problem in tissue banking. We explored the effect of thawing flash-frozen biospecimens on the quality and integrity of RNA for genetic testing as well as for other cancer research studies. The histological quality of the frozen tumor sections was evaluated by using hematoxylin and eosin staining. RNA extraction from 60 lung cancer tissue samples subjected to various freeze/thaw cycles was performed using the RNeasy Plus isolation kit. RNA integrity was assessed by using an Agilent bioanalyzer to obtain RNA integrity numbers (RIN). Furthermore, RNA from different groups was used for fluorescence Reverse transcription-polymerase chain reaction (RT-PCR) analysis of the echinoderm microtubule-associated protein-like 4 and anaplastic lymphoma kinase (EML4-ALK) fusion gene mutation to verify whether it can be used for research or clinical testing. Highly variable RIN values were observed among the samples, which showed no correlation with the number of freeze/thaw cycles conducted. However, after 3 freeze/thaw cycles (each thaw event lasted for 10 min), an increasing number of changes in peak intensity in RINs were observed. After 5 freeze/thaw cycles, RNA integrity decreased to approximately 35%. After 3 freeze/thaw cycles, the RNA could still be used for RT-PCR analysis of EML4-ALK fusion gene mutations; whereas those subjected to 5 freeze/thaw cycles could not. Limited (<3) freeze/thaw cycles did not adversely affect the quality of RNA extracted from tumor tissues and subsequent RT-PCR analysis. Our data could be utilized in the establishment of a standardized procedure for tissue biospecimen collection and storage.

Surmounting a PCR challenge using a Contradictory matrix from the Theory of Inventive Problem Solving (TRIZ).

PubMed

Drábek, Jiří

2016-01-01

In this paper I tested whether Contradictory Matrix with 40 Inventive Principles, the simplest instrument from the Theory of Inventive Problem Solving (TRIZ), is a useful approach to a real-life PCR scenario. The PCR challenge consisted of standardization of fluorescence melting curve measurements in Competitive Amplification of Differentially Melting Amplicons (CADMA) PCR for multiple targets. Here I describe my way of using the TRIZ Matrix to generate seven alternative solutions from which I can choose the successful solution, consisting of repeated cycles of amplification and melting in a single PCR run.

Circulating polymerase chain reaction chips utilizing multiple-membrane activation

NASA Astrophysics Data System (ADS)

Wang, Chih-Hao; Chen, Yi-Yu; Liao, Chia-Sheng; Hsieh, Tsung-Min; Luo, Ching-Hsing; Wu, Jiunn-Jong; Lee, Huei-Huang; Lee, Gwo-Bin

2007-02-01

This paper reports a new micromachined, circulating, polymerase chain reaction (PCR) chip for nucleic acid amplification. The PCR chip is comprised of a microthermal control module and a polydimethylsiloxane (PDMS)-based microfluidic control module. The microthermal control modules are formed with three individual heating and temperature-sensing sections, each modulating a specific set temperature for denaturation, annealing and extension processes, respectively. Micro-pneumatic valves and multiple-membrane activations are used to form the microfluidic control module to transport sample fluids through three reaction regions. Compared with other PCR chips, the new chip is more compact in size, requires less time for heating and cooling processes, and has the capability to randomly adjust time ratios and cycle numbers depending on the PCR process. Experimental results showed that detection genes for two pathogens, Streptococcus pyogenes (S. pyogenes, 777 bps) and Streptococcus pneumoniae (S. pneumoniae, 273 bps), can be successfully amplified using the new circulating PCR chip. The minimum number of thermal cycles to amplify the DNA-based S. pyogenes for slab gel electrophoresis is 20 cycles with an initial concentration of 42.5 pg µl-1. Experimental data also revealed that a high reproducibility up to 98% could be achieved if the initial template concentration of the S. pyogenes was higher than 4 pg µl-1. The preliminary results of the current paper were presented at the 19th IEEE International Conference on Micro Electro Mechanical Systems (IEEE MEMS 2006), Istanbul, Turkey, 22-26 January, 2006.

Phase II study of neoadjuvant treatment with doxorubicin, docetaxel, and capecitabine (ATX) in locally advanced or inflammatory breast cancer.

PubMed

Manga, Gumersindo Pérez; Shahi, Parham Khosravi; Ureña, Miguel Méndez; Pereira, Rosa Quiben; Plaza, María Isabel Palomero; Peron, Yann Izarzugaza; Val, Ricardo González Del; Carrión, Joaquín Belón; Cañón, Esperanza Pérez; Alfonso, Pilar García

2010-07-01

Pathologic complete response (pCR) after preoperative systemic chemotherapy (PSCh) is associated with better outcome in locally advanced breast cancer (LABC). PSCh included: doxorubicin (A) 50 mg/m(2) i.v. on day 1; docetaxel (T) 30 mg/m(2) i.v. on days 1, 8 and 15; and capecitabine (X) 1,500 mg/m(2)/day p.o. on days 1-14, in a 4-week course repeated for up to four cycles (ATX), followed by surgery. The primary end point of this study was to evaluate the pCR rate. Secondary endpoints included clinical response rate, disease-free survival (DFS), overall survival (OS), and the toxicity profile. A total of 60 patients were included in the analysis. Median age was 49 years, and 63.3% of patients were hormone receptor positive. The median number of cycles of PSCh was four (95% CI: 3-4). Five patients (8.3%) achieved pCR in both breast and nodes, and 16.7% reached pCR only in nodes. The clinical response rate was 77% (27% complete response), but only 18% of the patients underwent conservative surgery. With a median follow-up of 20 months, 3-year DFS and OS were 76 and 90%, respectively. Grade III/IV toxicity included neutropenia (74%), febrile neutropenia (9%), mucositis (12%), and diarrhea (12%). ATX every 28 days for four cycles is associated with a modest activity (low pCR rate) in the neoadjuvant setting of LABC.

Menstrual cycle and the temporal discrimination threshold.

PubMed

Mc Govern, Eavan M; O'Connor, Emer; Beiser, Ines; Williams, Laura; Butler, John S; Quinlivan, Brendan; Narasimham, Shruti; Beck, Rebecca; Reilly, Richard B; O'Riordan, Sean; Hutchinson, Michael

2017-02-01

The temporal discrimination threshold (TDT) is a proposed pre-clinical biomarker (endophenotype) for adult onset isolated focal dystonia (AOIFD). Age- and sex-related effects on temporal discrimination demonstrate that women, before the age of 40 years, have faster temporal discrimination than men but their TDTs worsen with age at almost three times the rate of men. Thus after 40 years the TDT in women is progressively worse than in men. AOIFD is an increasingly female-predominant disorder after the age of 40; it is not clear whether this age-related sexually-dimorphic difference observed for both the TDT and sex ratio at disease onset in AOIFD is a hormonal or chromosomal effect. The aim of this study was to examine temporal discrimination at weekly intervals during two consecutive menstrual cycles in 14 healthy female volunteers to determine whether physiological hormonal changes affected temporal discrimination. We observed no significant differences in weekly temporal discrimination threshold values during the menstrual cycles and no significant correlation with the menstrual cycle stage. This observed stability of temporal discrimination during cyclical hormonal change raises interesting questions concerning the age-related sexually-dimorphic decline observed in temporal discrimination. Our findings pave the way for future studies exploring potential pathomechanisms for this age-related deterioration.

Evaluation of next generation sequencing for the analysis of Eimeria communities in wildlife.

PubMed

Vermeulen, Elke T; Lott, Matthew J; Eldridge, Mark D B; Power, Michelle L

2016-05-01

Next-generation sequencing (NGS) techniques are well-established for studying bacterial communities but not yet for microbial eukaryotes. Parasite communities remain poorly studied, due in part to the lack of reliable and accessible molecular methods to analyse eukaryotic communities. We aimed to develop and evaluate a methodology to analyse communities of the protozoan parasite Eimeria from populations of the Australian marsupial Petrogale penicillata (brush-tailed rock-wallaby) using NGS. An oocyst purification method for small sample sizes and polymerase chain reaction (PCR) protocol for the 18S rRNA locus targeting Eimeria was developed and optimised prior to sequencing on the Illumina MiSeq platform. A data analysis approach was developed by modifying methods from bacterial metagenomics and utilising existing Eimeria sequences in GenBank. Operational taxonomic unit (OTU) assignment at a high similarity threshold (97%) was more accurate at assigning Eimeria contigs into Eimeria OTUs but at a lower threshold (95%) there was greater resolution between OTU consensus sequences. The assessment of two amplification PCR methods prior to Illumina MiSeq, single and nested PCR, determined that single PCR was more sensitive to Eimeria as more Eimeria OTUs were detected in single amplicons. We have developed a simple and cost-effective approach to a data analysis pipeline for community analysis of eukaryotic organisms using Eimeria communities as a model. The pipeline provides a basis for evaluation using other eukaryotic organisms and potential for diverse community analysis studies. Copyright © 2016 Elsevier B.V. All rights reserved.

The Rotary Zone Thermal Cycler: A Low-Power System Enabling Automated Rapid PCR

PubMed Central

Bartsch, Michael S.; Renzi, Ronald F.; Van de Vreugde, James L.; Kim, Hanyoup; Knight, Daniel L.; Sinha, Anupama; Branda, Steven S.; Patel, Kamlesh D.

2015-01-01

Advances in molecular biology, microfluidics, and laboratory automation continue to expand the accessibility and applicability of these methods beyond the confines of conventional, centralized laboratory facilities and into point of use roles in clinical, military, forensic, and field-deployed applications. As a result, there is a growing need to adapt the unit operations of molecular biology (e.g., aliquoting, centrifuging, mixing, and thermal cycling) to compact, portable, low-power, and automation-ready formats. Here we present one such adaptation, the rotary zone thermal cycler (RZTC), a novel wheel-based device capable of cycling up to four different fixed-temperature blocks into contact with a stationary 4-microliter capillary-bound sample to realize 1-3 second transitions with steady state heater power of less than 10 W. We demonstrate the utility of the RZTC for DNA amplification as part of a highly integrated rotary zone PCR (rzPCR) system that uses low-volume valves and syringe-based fluid handling to automate sample loading and unloading, thermal cycling, and between-run cleaning functionalities in a compact, modular form factor. In addition to characterizing the performance of the RZTC and the efficacy of different online cleaning protocols, we present preliminary results for rapid single-plex PCR, multiplex short tandem repeat (STR) amplification, and second strand cDNA synthesis. PMID:25826708

Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

NASA Astrophysics Data System (ADS)

Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

2015-09-01

Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

Confocal epifluorescence sensor with an arc-shaped aperture for slide-based PCR quantification.

PubMed

Weng, Jui-Hong; Chen, Lin-Chi

2018-02-15

The increasing needs of point-of-care diagnostics, quarantine of epidemic pathogens, and prevention of terrorism's bio-attacks have promised the future of portable real-time quantitative polymerase chain reaction (qPCR) sensors. This work aims at developing a highly sensitive and low-cost light emitting diode (LED)-based epifluorescence sensor module for qPCR sensor development and relevant bioassay applications. Inspired by the light stop design and dark-field detection of microscopes, this paper first reports a compact confocal LED epifluorescence sensor using a light stop with an arc-shaped aperture for enhancing the flexibility of quick DNA and PCR detection. The sensor features the advantages of the dichroic mirror-free and confocal (shared-focus) characteristics, which benefits size reduction and minimal optics used. It also allows extension to integrate with in situ real-time PCR thermal cycling since the sample slide is placed apart from the epi-sensing module. The epifluorescence sensor can detect as low as sub-ng/μL standard DNA and 10 1 copies of Salmonella typhimurium InvA gene sequences (cloned in E. coli and after 30-cycle PCR) with SYBR ® Green I from non-purified culture samples, having highly sensitive and specific signal responses comparable with that of a commercial qPCR instrument. Copyright © 2017 Elsevier B.V. All rights reserved.

The effect of higher ATP cost of contraction on the metabolic response to graded exercise in patients with chronic obstructive pulmonary disease.

PubMed

Layec, Gwenael; Haseler, Luke J; Richardson, Russell S

2012-03-01

To better understand the metabolic implications of a higher ATP cost of contraction in chronic obstructive pulmonary disease (COPD), we used (31)P-magnetic resonance spectroscopy ((31)P-MRS) to examine muscle energetics and pH in response to graded exercise. Specifically, in six patients and six well-matched healthy controls, we determined the intracellular threshold for pH (T(pH)) and inorganic phosphate-to-phosphocreatine ratio (T(Pi/PCr)) during progressive dynamic plantar flexion exercise with work rate expressed as both absolute and relative intensity. Patients with COPD displayed a lower peak power output (WRmax) compared with controls (controls 25 ± 4 W, COPD 15 ± 5 W, P = 0.01) while end-exercise pH (controls 6.79 ± 0.15, COPD 6.76 ± 0.21, P = 0.87) and PCr consumption (controls 82 ± 10%, COPD 70 ± 18%, P = 0.26) were similar between groups. Both T(pH) and T(Pi/PCr) occurred at a significantly lower absolute work rate in patients with COPD compared with controls (controls: 14.7 ± 2.4 W for T(pH) and 15.3 ± 2.4 W for T(Pi/PCr); COPD: 9.7 ± 4.5 W for T(pH) and 10.0 ± 4.6 W for T(Pi/PCr), P < 0.05), but these thresholds occurred at the same percentage of WRmax (controls: 63 ± 11% WRmax for T(pH) and 67 ± 18% WRmax for T(Pi/PCr); COPD: 59 ± 9% WRmax for T(pH) and 61 ± 12% WRmax for T(Pi/PCr), P > 0.05). Indexes of mitochondrial function, the PCr recovery time constant (controls 42 ± 7 s, COPD 45 ± 11 s, P = 0.66) and the PCr resynthesis rate (controls 105 ± 21%/min, COPD 91 ± 31%/min, P = 0.43) were similar between groups. In combination, these results reveal that when energy demand is normalized to WRmax, as a consequence of higher ATP cost of contraction, patients with COPD display the same metabolic pattern as healthy subjects, suggesting that skeletal muscle energy production is well preserved in these patients.

Multidistrict Outbreak of Marburg Virus Disease-Uganda, 2012.

PubMed

Knust, Barbara; Schafer, Ilana J; Wamala, Joseph; Nyakarahuka, Luke; Okot, Charles; Shoemaker, Trevor; Dodd, Kimberly; Gibbons, Aridth; Balinandi, Stephen; Tumusiime, Alex; Campbell, Shelley; Newman, Edmund; Lasry, Estrella; DeClerck, Hilde; Boum, Yap; Makumbi, Issa; Bosa, Henry Kyobe; Mbonye, Anthony; Aceng, Jane Ruth; Nichol, Stuart T; Ströher, Ute; Rollin, Pierre E

2015-10-01

In October 2012, a cluster of illnesses and deaths was reported in Uganda and was confirmed to be an outbreak of Marburg virus disease (MVD). Patients meeting the case criteria were interviewed using a standard investigation form, and blood specimens were tested for evidence of acute or recent Marburg virus infection by reverse transcription-polymerase chain reaction (RT-PCR) and antibody enzyme-linked immunosorbent assay. The total count of confirmed and probable MVD cases was 26, of which 15 (58%) were fatal. Four of 15 laboratory-confirmed cases (27%) were fatal. Case patients were located in 4 different districts in Uganda, although all chains of transmission originated in Ibanda District, and the earliest case detected had an onset in July 2012. No zoonotic exposures were identified. Symptoms significantly associated with being a MVD case included hiccups, anorexia, fatigue, vomiting, sore throat, and difficulty swallowing. Contact with a case patient and attending a funeral were also significantly associated with being a case. Average RT-PCR cycle threshold values for fatal cases during the acute phase of illness were significantly lower than those for nonfatal cases. Following the institution of contact tracing, active case surveillance, care of patients with isolation precautions, community mobilization, and rapid diagnostic testing, the outbreak was successfully contained 14 days after its initial detection. Published by Oxford University Press on behalf of the Infectious Diseases Society of America 2015. This work is written by (a) US Government employee(s) and is in the public domain in the US.

Prevalence of protozoa, viruses, coliphages and indicator bacteria in groundwater and river water in the Kathmandu Valley, Nepal.

PubMed

Haramoto, Eiji; Yamada, Kaoru; Nishida, Kei

2011-12-01

Limited information is available on the prevalence of waterborne pathogens in aquatic environments in developing countries. In this study, water samples were collected from nine shallow wells and a river in the Kathmandu Valley, Nepal, during the rainy season in 2009 and were subjected to detection of waterborne protozoa, viruses and coliphages using a recently developed method for simultaneous concentration of protozoa and viruses in water. Escherichia coli and total coliforms were also tested as indicator bacteria. At least one type of the five pathogens tested (Cryptosporidium, Giardia, human adenoviruses, and noroviruses of genogroups I and II) was detected in five groundwater samples (56%) (1000 ml each) from shallow wells. Compared with groundwater samples, the pathogens were more abundant in the river water sample (100ml); the concentrations of Cryptosporidium and Giardia were 140 oocysts/l and 8500 cysts/l, respectively, and the mean threshold cycle (Ct) values in real-time RT-PCR were 34.3, 36.8 and 34.0 for human adenoviruses and noroviruses of genogroups I and II, respectively. Genotyping of F-RNA coliphages by real-time RT-PCR was successfully used to differentiate human and animal faecal contamination in the samples. Moreover, for the groundwater samples, protozoa and viruses were detected only in E. coli-positive samples, suggesting that E. coli may be an appropriate indicator of pathogen contamination of valley groundwater. Copyright © 2011 Royal Society of Tropical Medicine and Hygiene. Published by Elsevier Ltd. All rights reserved.

Development of real-time PCR assay for genetic identification of the mottled skate, Beringraja pulchra.

PubMed

Hwang, In Kwan; Lee, Hae Young; Kim, Min-Hee; Jo, Hyun-Su; Choi, Dong-Ho; Kang, Pil-Won; Lee, Yang-Han; Cho, Nam-Soo; Park, Ki-Won; Chae, Ho Zoon

2015-10-01

The mottled skate, Beringraja pulchra is one of the commercially important fishes in the market today. However, B. pulchra identification methods have not been well developed. The current study reports a novel real-time PCR method based on TaqMan technology developed for the genetic identification of B. pulchra. The mitochondrial cytochrome oxidase subunit 1 (COI) nucleotide sequences of 29 B. pulchra, 157 skates and rays reported in GenBank DNA database were comparatively analyzed and the COI sequences specific to B. pulchra was identified. Based on this information, a system of specific primers and Minor Groove Binding (MGB) TaqMan probe were designed. The assay successfully discriminated in 29 specimens of B. pulchra and 27 commercial samples with unknown species identity. For B. pulchra DNA, an average Threshold Cycle (Ct) value of 19.1±0.1 was obtained. Among 27 commercial samples, two samples showed average Ct values 19.1±0.0 and 26.7±0.1, respectively and were confirmed to be B. pulchra based on sequencing. The other samples tested showed undetectable or extremely weak signals for the target fragment, which was also consistent with the sequencing results. These results reveal that the method developed is a rapid and efficient tool to identify B. pulchra and might prevent fraud or mislabeling during the distribution of B. pulchra products. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Spatial and temporal distribution of two diazotrophic bacteria in the Chesapeake Bay.

PubMed

Short, Steven M; Jenkins, Bethany D; Zehr, Jonathan P

2004-04-01

The aim of this study was to initiate autecological studies on uncultivated natural populations of diazotrophic bacteria by examining the distribution of specific diazotrophs in the Chesapeake Bay. By use of quantitative PCR, the abundance of two nifH sequences (907h22 and 912h4) was quantified in water samples collected along a transect from the head to the mouth of the Chesapeake Bay during cruises in April and October 2001 and 2002. Standard curves for the quantitative PCR assays demonstrated that the relationship between gene copies and cycle threshold was linear and highly reproducible from 1 to 10(7) gene copies. The maximum number of 907h22 gene copies detected was approximately 140 ml(-1) and the maximum number of 912h4 gene copies detected was approximately 340 ml(-1). Sequence 912h4 was most abundant at the mouth of the Chesapeake Bay, and in general, its abundance increased with increasing salinity, with the highest abundances observed in April 2002. Overall, the 907h22 phylotype was most abundant at the mid-bay station. Additionally, 907h22 was most abundant in the April samples from the mid-bay and mouth of the Chesapeake Bay. Despite the fact that the Chesapeake Bay is rarely nitrogen limited, our results show that individual nitrogen-fixing bacteria have distinct nonrandom spatial and seasonal distributions in the Chesapeake Bay and are either distributed by specific physical processes or adapted to different environmental niches.

Evaluation of endogenous control gene(s) for gene expression studies in human blood exposed to 60Co γ-rays ex vivo.

PubMed

Vaiphei, S Thangminlal; Keppen, Joshua; Nongrum, Saibadaiahun; Chaubey, R C; Kma, L; Sharan, R N

2015-01-01

In gene expression studies, it is critical to normalize data using a stably expressed endogenous control gene in order to obtain accurate and reliable results. However, we currently do not have a universally applied endogenous control gene for normalization of data for gene expression studies, particularly those involving (60)Co γ-ray-exposed human blood samples. In this study, a comparative assessment of the gene expression of six widely used housekeeping endogenous control genes, namely 18S, ACTB, B2M, GAPDH, MT-ATP6 and CDKN1A, was undertaken for a range of (60)Co γ-ray doses (0.5, 1.0, 2.0 and 4.0 Gy) at 8.4 Gy min(-1) at 0 and 24 h post-irradiation time intervals. Using the NormFinder algorithm, real-time PCR data obtained from six individuals (three males and three females) were analyzed with respect to the threshold cycle (Ct) value and abundance, ΔCt pair-wise comparison, intra- and inter-group variability assessments, etc. GAPDH, either alone or in combination with 18S, was found to be the most suitable endogenous control gene and should be used in gene expression studies, especially those involving qPCR of γ-ray-exposed human blood samples. © The Author 2014. Published by Oxford University Press on behalf of The Japan Radiation Research Society and Japanese Society for Radiation Oncology.

Determination of prospective displacement-based gate threshold for respiratory-gated radiation delivery from retrospective phase-based gate threshold selected at 4D CT simulation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vedam, S.; Archambault, L.; Starkschall, G.

2007-11-15

Four-dimensional (4D) computed tomography (CT) imaging has found increasing importance in the localization of tumor and surrounding normal structures throughout the respiratory cycle. Based on such tumor motion information, it is possible to identify the appropriate phase interval for respiratory gated treatment planning and delivery. Such a gating phase interval is determined retrospectively based on tumor motion from internal tumor displacement. However, respiratory-gated treatment is delivered prospectively based on motion determined predominantly from an external monitor. Therefore, the simulation gate threshold determined from the retrospective phase interval selected for gating at 4D CT simulation may not correspond to the deliverymore » gate threshold that is determined from the prospective external monitor displacement at treatment delivery. The purpose of the present work is to establish a relationship between the thresholds for respiratory gating determined at CT simulation and treatment delivery, respectively. One hundred fifty external respiratory motion traces, from 90 patients, with and without audio-visual biofeedback, are analyzed. Two respiratory phase intervals, 40%-60% and 30%-70%, are chosen for respiratory gating from the 4D CT-derived tumor motion trajectory. From residual tumor displacements within each such gating phase interval, a simulation gate threshold is defined based on (a) the average and (b) the maximum respiratory displacement within the phase interval. The duty cycle for prospective gated delivery is estimated from the proportion of external monitor displacement data points within both the selected phase interval and the simulation gate threshold. The delivery gate threshold is then determined iteratively to match the above determined duty cycle. The magnitude of the difference between such gate thresholds determined at simulation and treatment delivery is quantified in each case. Phantom motion tests yielded coincidence of simulation and delivery gate thresholds to within 0.3%. For patient data analysis, differences between simulation and delivery gate thresholds are reported as a fraction of the total respiratory motion range. For the smaller phase interval, the differences between simulation and delivery gate thresholds are 8{+-}11% and 14{+-}21% with and without audio-visual biofeedback, respectively, when the simulation gate threshold is determined based on the mean respiratory displacement within the 40%-60% gating phase interval. For the longer phase interval, corresponding differences are 4{+-}7% and 8{+-}15% with and without audio-visual biofeedback, respectively. Alternatively, when the simulation gate threshold is determined based on the maximum average respiratory displacement within the gating phase interval, greater differences between simulation and delivery gate thresholds are observed. A relationship between retrospective simulation gate threshold and prospective delivery gate threshold for respiratory gating is established and validated for regular and nonregular respiratory motion. Using this relationship, the delivery gate threshold can be reliably estimated at the time of 4D CT simulation, thereby improving the accuracy and efficiency of respiratory-gated radiation delivery.« less

Determination of prospective displacement-based gate threshold for respiratory-gated radiation delivery from retrospective phase-based gate threshold selected at 4D CT simulation.

PubMed

Vedam, S; Archambault, L; Starkschall, G; Mohan, R; Beddar, S

2007-11-01

Four-dimensional (4D) computed tomography (CT) imaging has found increasing importance in the localization of tumor and surrounding normal structures throughout the respiratory cycle. Based on such tumor motion information, it is possible to identify the appropriate phase interval for respiratory gated treatment planning and delivery. Such a gating phase interval is determined retrospectively based on tumor motion from internal tumor displacement. However, respiratory-gated treatment is delivered prospectively based on motion determined predominantly from an external monitor. Therefore, the simulation gate threshold determined from the retrospective phase interval selected for gating at 4D CT simulation may not correspond to the delivery gate threshold that is determined from the prospective external monitor displacement at treatment delivery. The purpose of the present work is to establish a relationship between the thresholds for respiratory gating determined at CT simulation and treatment delivery, respectively. One hundred fifty external respiratory motion traces, from 90 patients, with and without audio-visual biofeedback, are analyzed. Two respiratory phase intervals, 40%-60% and 30%-70%, are chosen for respiratory gating from the 4D CT-derived tumor motion trajectory. From residual tumor displacements within each such gating phase interval, a simulation gate threshold is defined based on (a) the average and (b) the maximum respiratory displacement within the phase interval. The duty cycle for prospective gated delivery is estimated from the proportion of external monitor displacement data points within both the selected phase interval and the simulation gate threshold. The delivery gate threshold is then determined iteratively to match the above determined duty cycle. The magnitude of the difference between such gate thresholds determined at simulation and treatment delivery is quantified in each case. Phantom motion tests yielded coincidence of simulation and delivery gate thresholds to within 0.3%. For patient data analysis, differences between simulation and delivery gate thresholds are reported as a fraction of the total respiratory motion range. For the smaller phase interval, the differences between simulation and delivery gate thresholds are 8 +/- 11% and 14 +/- 21% with and without audio-visual biofeedback, respectively, when the simulation gate threshold is determined based on the mean respiratory displacement within the 40%-60% gating phase interval. For the longer phase interval, corresponding differences are 4 +/- 7% and 8 +/- 15% with and without audiovisual biofeedback, respectively. Alternatively, when the simulation gate threshold is determined based on the maximum average respiratory displacement within the gating phase interval, greater differences between simulation and delivery gate thresholds are observed. A relationship between retrospective simulation gate threshold and prospective delivery gate threshold for respiratory gating is established and validated for regular and nonregular respiratory motion. Using this relationship, the delivery gate threshold can be reliably estimated at the time of 4D CT simulation, thereby improving the accuracy and efficiency of respiratory-gated radiation delivery.

Development of a fast PCR protocol enabling rapid generation of AmpFℓSTR® Identifiler® profiles for genotyping of human DNA

PubMed Central

2012-01-01

Background Traditional PCR methods for forensic STR genotyping require approximately 2.5 to 4 hours to complete, contributing a significant portion of the time required to process forensic DNA samples. The purpose of this study was to develop and validate a fast PCR protocol that enabled amplification of the 16 loci targeted by the AmpFℓSTR® Identifiler® primer set, allowing decreased cycling times. Methods Fast PCR conditions were achieved by substituting the traditional Taq polymerase for SpeedSTAR™ HS DNA polymerase which is designed for fast PCR, by upgrading to a thermal cycler with faster temperature ramping rates and by modifying cycling parameters (less time at each temperature) and adopting a two-step PCR approach. Results The total time required for the optimized protocol is 26 min. A total of 147 forensically relevant DNA samples were amplified using the fast PCR protocol for Identifiler. Heterozygote peak height ratios were not affected by fast PCR conditions, and full profiles were generated for single-source DNA amounts between 0.125 ng and 2.0 ng. Individual loci in profiles produced with the fast PCR protocol exhibited average n-4 stutter percentages ranging from 2.5 ± 0.9% (THO1) to 9.9 ± 2.7% (D2S1338). No increase in non-adenylation or other amplification artefacts was observed. Minor contributor alleles in two-person DNA mixtures were reliably discerned. Low level cross-reactivity (monomorphic peaks) was observed with some domestic animal DNA. Conclusions The fast PCR protocol presented offers a feasible alternative to current amplification methods and could aid in reducing the overall time in STR profile production or could be incorporated into a fast STR genotyping procedure for time-sensitive situations. PMID:22394458

Development of a fast PCR protocol enabling rapid generation of AmpFℓSTR® Identifiler® profiles for genotyping of human DNA.

PubMed

Foster, Amanda; Laurin, Nancy

2012-03-06

Traditional PCR methods for forensic STR genotyping require approximately 2.5 to 4 hours to complete, contributing a significant portion of the time required to process forensic DNA samples. The purpose of this study was to develop and validate a fast PCR protocol that enabled amplification of the 16 loci targeted by the AmpFℓSTR® Identifiler® primer set, allowing decreased cycling times. Fast PCR conditions were achieved by substituting the traditional Taq polymerase for SpeedSTAR™ HS DNA polymerase which is designed for fast PCR, by upgrading to a thermal cycler with faster temperature ramping rates and by modifying cycling parameters (less time at each temperature) and adopting a two-step PCR approach. The total time required for the optimized protocol is 26 min. A total of 147 forensically relevant DNA samples were amplified using the fast PCR protocol for Identifiler. Heterozygote peak height ratios were not affected by fast PCR conditions, and full profiles were generated for single-source DNA amounts between 0.125 ng and 2.0 ng. Individual loci in profiles produced with the fast PCR protocol exhibited average n-4 stutter percentages ranging from 2.5 ± 0.9% (THO1) to 9.9 ± 2.7% (D2S1338). No increase in non-adenylation or other amplification artefacts was observed. Minor contributor alleles in two-person DNA mixtures were reliably discerned. Low level cross-reactivity (monomorphic peaks) was observed with some domestic animal DNA. The fast PCR protocol presented offers a feasible alternative to current amplification methods and could aid in reducing the overall time in STR profile production or could be incorporated into a fast STR genotyping procedure for time-sensitive situations.

Characterization of Mode 1 and Mode 2 delamination growth and thresholds in graphite/peek composites

NASA Technical Reports Server (NTRS)

Martin, Roderick H.; Murri, Gretchen B.

1988-01-01

Composite materials often fail by delamination. The onset and growth of delamination in AS4/PEEK, a tough thermoplastic matrix composite, was characterized for mode 1 and mode 2 loadings, using the Double Cantilever Beam (DCB) and the End Notched Flexure (ENF) test specimens. Delamination growth per fatigue cycle, da/dN, was related to strain energy release rate, G, by means of a power law. However, the exponents of these power laws were too large for them to be adequately used as a life prediction tool. A small error in the estimated applied loads could lead to large errors in the delamination growth rates. Hence strain energy release rate thresholds, G sub th, below which no delamination would occur were also measured. Mode 1 and 2 threshold G values for no delamination growth were found by monitoring the number of cycles to delamination onset in the DCB and ENF specimens. The maximum applied G for which no delamination growth had occurred until at least 1,000,000 cycles was considered the threshold strain energy release rate. Comments are given on how testing effects, facial interference or delamination front damage, may invalidate the experimental determination of the constants in the expression.

Characterization of Mode I and Mode II delamination growth and thresholds in AS4/PEEK composites

NASA Technical Reports Server (NTRS)

Martin, Roderick H.; Murri, Gretchen Bostaph

1990-01-01

Composite materials often fail by delamination. The onset and growth of delamination in AS4/PEEK, a tough thermoplastic matrix composite, was characterized for mode 1 and mode 2 loadings, using the Double Cantilever Beam (DCB) and the End Notched Flexure (ENF) test specimens. Delamination growth per fatigue cycle, da/dN, was related to strain energy release rate, G, by means of a power law. However, the exponents of these power laws were too large for them to be adequately used as a life prediction tool. A small error in the estimated applied loads could lead to large errors in the delamination growth rates. Hence strain energy release rate thresholds, G sub th, below which no delamination would occur were also measured. Mode 1 and 2 threshold G values for no delamination growth were found by monitoring the number of cycles to delamination onset in the DCB and ENF specimens. The maximum applied G for which no delamination growth had occurred until at least 1,000,000 cycles was considered the threshold strain energy release rate. Comments are given on how testing effects, facial interference or delamination front damage, may invalidate the experimental determination of the constants in the expression.

PCR-based detection of gene transfer vectors: application to gene doping surveillance.

PubMed

Perez, Irene C; Le Guiner, Caroline; Ni, Weiyi; Lyles, Jennifer; Moullier, Philippe; Snyder, Richard O

2013-12-01

Athletes who illicitly use drugs to enhance their athletic performance are at risk of being banned from sports competitions. Consequently, some athletes may seek new doping methods that they expect to be capable of circumventing detection. With advances in gene transfer vector design and therapeutic gene transfer, and demonstrations of safety and therapeutic benefit in humans, there is an increased probability of the pursuit of gene doping by athletes. In anticipation of the potential for gene doping, assays have been established to directly detect complementary DNA of genes that are top candidates for use in doping, as well as vector control elements. The development of molecular assays that are capable of exposing gene doping in sports can serve as a deterrent and may also identify athletes who have illicitly used gene transfer for performance enhancement. PCR-based methods to detect foreign DNA with high reliability, sensitivity, and specificity include TaqMan real-time PCR, nested PCR, and internal threshold control PCR.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martinotti, Simona; Ranzato, Elia, E-mail: ranzato@unipmn.it; Parodi, Monica

Malignant mesothelioma (MMe) is a poor-prognosis tumor in need of innovative therapies. In a previous in vivo study, we showed synergistic anti-MMe properties of the ascorbate/epigallocatechin-3-gallate/gemcitabine combination. We have now focused on the mechanism of action, showing the induction of apoptosis and cell cycle arrest through measurements of caspase 3, intracellular Ca{sup 2+}, annexin V, and DNA content. StellArray™ PCR technology and Western immunoblotting revealed DAPK2-dependent apoptosis, upregulation of cell cycle promoters, downregulation of cell cycle checkpoints and repression of NFκB expression. The complex of data indicates that the mixture is synergistic in inducing cell cycle deregulation and non-inflammatory apoptosis,more » suggesting its possible use in MMe treatment. - Highlights: • Ascorbate/epigallocathechin-gallate/gemcitabine has been tested on mesothelioma cells • A synergistic mechanism has been shown for cell cycle arrest and apoptosis • PCR-array analysis has revealed the de-regulation of apoptosis and cell cycle genes • Maximum upregulation has been found for the Death-Associated Protein Kinase-2 gene • Data suggest that the mixture could be used as a clinical treatment.« less

Studies in Above- and Below-Threshold Harmonics in Argon with an Infrared Femtosecond Laser

NASA Astrophysics Data System (ADS)

Chew, Andrew; Yin, Yanchun; Li, Jie; Ren, Xiaoming; Cunningham, Eric; Wu, Yi; Chang, Zenghu

2016-05-01

We investigate and compare the above- and below-threshold harmonics in Argon gas using our recently-developed 1 kHz, two-cycle (11.4 fs), 3mJ, and carrier-envelope-phase(CEP)-stable laser at 1.6 μm. Such ultraviolet pulses can serve as pump or probe for studying dynamics in atoms and molecules. Unlike high harmonics with photon energy well above the ionization potential, the mechanism for generating harmonics near the ionization threshold is still under intense investigation. Previous work by Chini et al. on below-threshold harmonics was done using a 0.8 μm few-cycle Ti:Sapphire spectrally-broadened source with energy up to 300 μJ. It has been predicted by theory that free-free transitions dominate the below threshold harmonic generation as the laser wavelength increase from near infrared to mid-infrared. We are therefore interested in investigating how using a longer wavelength laser might lead to changes to the behavior of below-threshold harmonics when we vary various parameters. We report the π-periodity CEP dependence and ellipticity dependence of the above- and below-threshold harmonics. This material was based on work supported by National Science Foundation (1068604), Army Research Office (W911NF-14-1-0383), Air Force Office of Scientific Research (FA9550-15-1-0037) and the DARPA PULSE program by a Grant from AMRDEC (W31P4Q1310017).

Stationarity of extreme bursts in the solar wind

NASA Astrophysics Data System (ADS)

Moloney, N. R.; Davidsen, J.

2014-05-01

Recent results have suggested that the statistics of bursts in the solar wind vary with solar cycle. Here, we show that this variation is basically absent if one considers extreme bursts. These are defined as threshold-exceeding events over the range of high thresholds for which their number decays as a power law. In particular, we find that the distribution of duration times and energies of extreme bursts in the solar wind ɛ parameter and similar observables are independent of the solar cycle and in this sense stationary, and show robust asymptotic power laws with exponents that are independent of the specific threshold. This is consistent with what has been observed for solar flares and, thus, provides evidence in favor of a link between solar flares and extreme bursts in the solar wind.

Subsurface characterization with localized ensemble Kalman filter employing adaptive thresholding

NASA Astrophysics Data System (ADS)

Delijani, Ebrahim Biniaz; Pishvaie, Mahmoud Reza; Boozarjomehry, Ramin Bozorgmehry

2014-07-01

Ensemble Kalman filter, EnKF, as a Monte Carlo sequential data assimilation method has emerged promisingly for subsurface media characterization during past decade. Due to high computational cost of large ensemble size, EnKF is limited to small ensemble set in practice. This results in appearance of spurious correlation in covariance structure leading to incorrect or probable divergence of updated realizations. In this paper, a universal/adaptive thresholding method is presented to remove and/or mitigate spurious correlation problem in the forecast covariance matrix. This method is, then, extended to regularize Kalman gain directly. Four different thresholding functions have been considered to threshold forecast covariance and gain matrices. These include hard, soft, lasso and Smoothly Clipped Absolute Deviation (SCAD) functions. Three benchmarks are used to evaluate the performances of these methods. These benchmarks include a small 1D linear model and two 2D water flooding (in petroleum reservoirs) cases whose levels of heterogeneity/nonlinearity are different. It should be noted that beside the adaptive thresholding, the standard distance dependant localization and bootstrap Kalman gain are also implemented for comparison purposes. We assessed each setup with different ensemble sets to investigate the sensitivity of each method on ensemble size. The results indicate that thresholding of forecast covariance yields more reliable performance than Kalman gain. Among thresholding function, SCAD is more robust for both covariance and gain estimation. Our analyses emphasize that not all assimilation cycles do require thresholding and it should be performed wisely during the early assimilation cycles. The proposed scheme of adaptive thresholding outperforms other methods for subsurface characterization of underlying benchmarks.

Development of PMA real-time PCR method to quantify viable cells of Pantoea agglomerans CPA-2, an antagonist to control the major postharvest diseases on oranges.

PubMed

Soto-Muñoz, Lourdes; Teixidó, Neus; Usall, Josep; Viñas, Inmaculada; Crespo-Sempere, Ana; Torres, Rosario

2014-06-16

Dilution plating is the quantification method commonly used to estimate the population level of postharvest biocontrol agents, but this method does not permit a distinction among introduced and indigenous strains. Recently, molecular techniques based on DNA amplification such as quantitative real-time PCR (qPCR) have been successfully applied for their high strain-specific detection level. However, the ability of qPCR to distinguish viable and nonviable cells is limited. A promising strategy to avoid this issue relies on the use of nucleic acid intercalating dyes, such as propidium monoazide (PMA), as a sample pretreatment prior to the qPCR. The objective of this study was to optimize a protocol based on PMA pre-treatment samples combined with qPCR to distinguish and quantify viable cells of the biocontrol agent P. agglomerans CPA-2 applied as a postharvest treatment on orange. The efficiency of PMA-qPCR method under the established conditions (30μM PMA for 20min of incubation followed by 30min of LED light exposure) was evaluated on an orange matrix. Results showed no difference in CFU or cells counts of viable cells between PMA-qPCR and dilution plating. Samples of orange matrix inoculated with a mixture of viable/dead cells showed 5.59log10 CFU/ml by dilution plating, 8.25log10 cells/ml by qPCR, and 5.93log10 cells/ml by PMA-qPCR. Furthermore, samples inoculated with heat-killed cells were not detected by dilution plating and PMA-qPCR, while by qPCR was of 8.16log10 cells/ml. The difference in quantification cycles (Cq) among qPCR and PMA-qPCR was approximately 16cycles, which means a reduction of 65,536 fold of the dead cells detected. In conclusion, PMA-qPCR method is a suitable tool for quantify viable CPA-2 cells, which could be useful to estimate the ability of this antagonist to colonize the orange surface. Copyright © 2014 Elsevier B.V. All rights reserved.

Biogeochemical cycling at the aquatic–terrestrial interface is linked to parafluvial hyporheic zone inundation history

DOE Office of Scientific and Technical Information (OSTI.GOV)

Goldman, Amy E.; Graham, Emily B.; Crump, Alex R.

The parafluvial hyporheic zone combines the heightened biogeochemical and microbial interactions indicative of a hyporheic region with direct atmospheric/terrestrial inputs and the effects of wet–dry cycles. Therefore, understanding biogeochemical cycling and microbial interactions in this ecotone is fundamental to understanding biogeochemical cycling at the aquatic–terrestrial interface and to creating robust hydrobiogeochemical models of dynamic river corridors. We aimed to (i) characterize biogeochemical and microbial differences in the parafluvial hyporheic zone across a small spatial domain (6 lateral meters) that spans a breadth of inundation histories and (ii) examine how parafluvial hyporheic sediments respond to laboratory-simulated re-inundation. Surface sediment was collected at fourmore » elevations along transects perpendicular to flow of the Columbia River, eastern WA, USA. The sediments were inundated by the river 0, 13, 127, and 398 days prior to sampling. Spatial variation in environmental variables (organic matter, moisture, nitrate, glucose, %C, %N) and microbial communities (16S and internal transcribed spacer (ITS) rRNA gene sequencing, qPCR) were driven by differences in inundation history. Microbial respiration did not differ significantly across inundation histories prior to forced inundation in laboratory incubations. Forced inundation suppressed microbial respiration across all histories, but the degree of suppression was dramatically different between the sediments saturated and unsaturated at the time of sample collection, indicating a binary threshold response to re-inundation. We present a conceptual model in which irregular hydrologic fluctuations facilitate microbial communities adapted to local conditions and a relatively high flux of CO 2. Upon rewetting, microbial communities are initially suppressed metabolically, which results in lower CO 2 flux rates primarily due to suppression of fungal respiration. Following prolonged inundation, the microbial community adapts to saturation by shifting composition, and the CO 2 flux rebounds to prior levels due to the subsequent change in respiration. Our results indicate that the time between inundation events can push the system into alternate states: we suggest (i) that, above some threshold of inundation interval, re-inundation suppresses respiration to a consistent, low rate and (ii) that, below some inundation interval, re-inundation has a minor effect on respiration. In conclusion, extending reactive transport models to capture processes that govern such dynamics will provide more robust predictions of river corridor biogeochemical function under altered surface water flow regimes in both managed and natural watersheds.« less

Biogeochemical cycling at the aquatic–terrestrial interface is linked to parafluvial hyporheic zone inundation history

DOE PAGES

Goldman, Amy E.; Graham, Emily B.; Crump, Alex R.; ...

2017-09-21

The parafluvial hyporheic zone combines the heightened biogeochemical and microbial interactions indicative of a hyporheic region with direct atmospheric/terrestrial inputs and the effects of wet–dry cycles. Therefore, understanding biogeochemical cycling and microbial interactions in this ecotone is fundamental to understanding biogeochemical cycling at the aquatic–terrestrial interface and to creating robust hydrobiogeochemical models of dynamic river corridors. We aimed to (i) characterize biogeochemical and microbial differences in the parafluvial hyporheic zone across a small spatial domain (6 lateral meters) that spans a breadth of inundation histories and (ii) examine how parafluvial hyporheic sediments respond to laboratory-simulated re-inundation. Surface sediment was collected at fourmore » elevations along transects perpendicular to flow of the Columbia River, eastern WA, USA. The sediments were inundated by the river 0, 13, 127, and 398 days prior to sampling. Spatial variation in environmental variables (organic matter, moisture, nitrate, glucose, %C, %N) and microbial communities (16S and internal transcribed spacer (ITS) rRNA gene sequencing, qPCR) were driven by differences in inundation history. Microbial respiration did not differ significantly across inundation histories prior to forced inundation in laboratory incubations. Forced inundation suppressed microbial respiration across all histories, but the degree of suppression was dramatically different between the sediments saturated and unsaturated at the time of sample collection, indicating a binary threshold response to re-inundation. We present a conceptual model in which irregular hydrologic fluctuations facilitate microbial communities adapted to local conditions and a relatively high flux of CO 2. Upon rewetting, microbial communities are initially suppressed metabolically, which results in lower CO 2 flux rates primarily due to suppression of fungal respiration. Following prolonged inundation, the microbial community adapts to saturation by shifting composition, and the CO 2 flux rebounds to prior levels due to the subsequent change in respiration. Our results indicate that the time between inundation events can push the system into alternate states: we suggest (i) that, above some threshold of inundation interval, re-inundation suppresses respiration to a consistent, low rate and (ii) that, below some inundation interval, re-inundation has a minor effect on respiration. In conclusion, extending reactive transport models to capture processes that govern such dynamics will provide more robust predictions of river corridor biogeochemical function under altered surface water flow regimes in both managed and natural watersheds.« less

The time course of phase correction: A kinematic investigation of motor adjustment to timing perturbations during sensorimotor synchronization

PubMed Central

Hove, Michael J.; Balasubramaniam, Ramesh; Keller, Peter E.

2014-01-01

Synchronizing movements with a beat requires rapid compensation for timing errors. The phase-correction response (PCR) has been studied extensively in finger tapping by shifting a metronome onset and measuring the adjustment of the following tap time. How the response unfolds during the subsequent tap cycle remains unknown. Using motion capture, we examined finger kinematics during the PCR. Participants tapped with a metronome containing phase perturbations. They tapped in ‘legato’ and ‘staccato’ style at various tempi, which altered the timing of the constituent movement stages (dwell at the surface, extension, flexion). After a phase perturbation, tapping kinematics changed compared to baseline, and the PCR was distributed differently across movement stages. In staccato tapping, the PCR trajectory changed primarily during finger extension across tempi. In legato tapping, at fast tempi the PCR occurred primarily during extension, whereas at slow tempi most phase correction was already completed during dwell. Across conditions, timing adjustments occurred primarily 100-250 ms into the following tap cycle. The change in movement around 100 ms represents the time to integrate information into an already planned movement and the rapidity suggests a subcortical route. PMID:25151103

Multiplex Fluorogenic Real-Time PCR for Detection and Quantification of Escherichia coli O157:H7 in Dairy Wastewater Wetlands

PubMed Central

Ibekwe, A. Mark; Watt, Pamela M.; Grieve, Catherine M.; Sharma, Vijay K.; Lyons, Steven R.

2002-01-01

Surface water and groundwater are continuously used as sources of drinking water in many metropolitan areas of the United States. The quality of water from these sources may be reduced due to increases in contaminants such as Escherichia coli from urban and agricultural runoffs. In this study, a multiplex fluorogenic PCR assay was used to quantify E. coli O157:H7 in soil, manure, cow and calf feces, and dairy wastewater in an artificial wetland. Primers and probes were designed to amplify and quantify the Shiga-like toxin 1 (stx1) and 2 (stx2) genes and the intimin (eae) gene of E. coli O157:H7 in a single reaction. Primer specificity was confirmed with DNA from 33 E. coli O157:H7 and related strains with and without the three genes. A direct correlation was determined between the fluorescence threshold cycle (CT) and the starting quantity of E. coli O157:H7 DNA. A similar correlation was observed between the CT and number of CFU per milliliter used in the PCR assay. A detection limit of 7.9 × 10−5 pg of E. coli O157:H7 DNA ml−1 equivalent to approximately 6.4 × 103 CFU of E. coli O157:H7 ml−1 based on plate counts was determined. Quantification of E. coli O157:H7 in soil, manure, feces, and wastewater was possible when cell numbers were ≥3.5 × 104 CFU g−1. E. coli O157:H7 levels detected in wetland samples decreased by about 2 logs between wetland influents and effluents. The detection limit of the assay in soil was improved to less than 10 CFU g−1 with a 16-h enrichment. These results indicate that the developed PCR assay is suitable for quantitative determination of E. coli O157:H7 in environmental samples and represents a considerable advancement in pathogen quantification in different ecosystems. PMID:12324331

MPN estimation of qPCR target sequence recoveries from whole cell calibrator samples.

PubMed

Sivaganesan, Mano; Siefring, Shawn; Varma, Manju; Haugland, Richard A

2011-12-01

DNA extracts from enumerated target organism cells (calibrator samples) have been used for estimating Enterococcus cell equivalent densities in surface waters by a comparative cycle threshold (Ct) qPCR analysis method. To compare surface water Enterococcus density estimates from different studies by this approach, either a consistent source of calibrator cells must be used or the estimates must account for any differences in target sequence recoveries from different sources of calibrator cells. In this report we describe two methods for estimating target sequence recoveries from whole cell calibrator samples based on qPCR analyses of their serially diluted DNA extracts and most probable number (MPN) calculation. The first method employed a traditional MPN calculation approach. The second method employed a Bayesian hierarchical statistical modeling approach and a Monte Carlo Markov Chain (MCMC) simulation method to account for the uncertainty in these estimates associated with different individual samples of the cell preparations, different dilutions of the DNA extracts and different qPCR analytical runs. The two methods were applied to estimate mean target sequence recoveries per cell from two different lots of a commercially available source of enumerated Enterococcus cell preparations. The mean target sequence recovery estimates (and standard errors) per cell from Lot A and B cell preparations by the Bayesian method were 22.73 (3.4) and 11.76 (2.4), respectively, when the data were adjusted for potential false positive results. Means were similar for the traditional MPN approach which cannot comparably assess uncertainty in the estimates. Cell numbers and estimates of recoverable target sequences in calibrator samples prepared from the two cell sources were also used to estimate cell equivalent and target sequence quantities recovered from surface water samples in a comparative Ct method. Our results illustrate the utility of the Bayesian method in accounting for uncertainty, the high degree of precision attainable by the MPN approach and the need to account for the differences in target sequence recoveries from different calibrator sample cell sources when they are used in the comparative Ct method. Published by Elsevier B.V.

Cycling Power Outputs Predict Functional Threshold Power And Maximum Oxygen Uptake.

PubMed

Denham, Joshua; Scott-Hamilton, John; Hagstrom, Amanda D; Gray, Adrian J

2017-09-11

Functional threshold power (FTP) has emerged as a correlate of lactate threshold and is commonly assessed by recreational and professional cyclists for tailored exercise programing. To identify whether results from traditional aerobic and anaerobic cycling tests could predict FTP and V˙ O2max, we analysed the association between estimated FTP, maximum oxygen uptake (V˙ O2max [mlkgmin]) and power outputs obtained from a maximal cycle ergometry cardiopulmonary exercise test (CPET) and a 30-s Wingate test in a heterogeneous cohort of cycle-trained and untrained individuals (N=40, mean±SD; age: 32.6±10.6 y; relative V˙ O2max: 46.8±9.1 mlkgmin). The accuracy and sensitivity of the prediction equations was also assessed in young men (N=11) before and after a 6-wk sprint interval training intervention.Moderate to strong positive correlations were observed between FTP, relative V˙ O2max and power outputs achieved during incremental and 30-s Wingate cycling tests (r=.39-.965, all P<.05). While maximum power achieved during incremental cycle testing (Pmax) and relative V˙ O2max were predictors of FTP (r =.93), age and FTP (Wkg) estimated relative V˙ O2max (r=.80). Our findings confirm that FTP predominantly relies on aerobic metabolism and indicate both prediction models are sensitive enough to detect meaningful exercise-induced changes in FTP and V˙ O2max. Thus, coaches should consider limiting the time and load demands placed on athletes by conducting a maximal cycle ergometry CPET to estimate FTP. Additionally, a 20-min FTP test is a convenient method to assess V˙ O2max and is particularly relevant for exercise professionals without access to expensive CPET equipment.

Detection of Yersinia Enterocolitica Species in Pig Tonsils and Raw Pork Meat by the Real-Time Pcr and Culture Methods.

PubMed

Stachelska, M A

2017-09-26

The aim of the present study was to establish a rapid and accurate real-time PCR method to detect pathogenic Yersinia enterocolitica in pork. Yersinia enterocolitica is considered to be a crucial zoonosis, which can provoke diseases both in humans and animals. The classical culture methods designated to detect Y. enterocolitica species in food matrices are often very time-consuming. The chromosomal locus _tag CH49_3099 gene, that appears in pathogenic Y. enterocolitica strains, was applied as DNA target for the 5' nuclease PCR protocol. The probe was labelled at the 5' end with the fluorescent reporter dye (FAM) and at the 3' end with the quencher dye (TAMRA). The real-time PCR cycling parameters included 41 cycles. A Ct value which reached a value higher than 40 constituted a negative result. The developed for the needs of this study qualitative real-time PCR method appeared to give very specific and reliable results. The detection rate of locus _tag CH49_3099 - positive Y. enterocolitica in 150 pig tonsils was 85 % and 32 % with PCR and culture methods, respectively. Both the Real-time PCR results and culture method results were obtained from material that was enriched during overnight incubation. The subject of the study were also raw pork meat samples. Among 80 samples examined, 7 ones were positive when real-time PCR was applied, and 6 ones were positive when classical culture method was applied. The application of molecular techniques based on the analysis of DNA sequences such as the Real-time PCR enables to detect this pathogenic bacteria very rapidly and with higher specificity, sensitivity and reliability in comparison to classical culture methods.

Detection of Histoplasma capsulatum from clinical specimens by cycling probe-based real-time PCR and nested real-time PCR.

PubMed

Muraosa, Yasunori; Toyotome, Takahito; Yahiro, Maki; Watanabe, Akira; Shikanai-Yasuda, Maria Aparecida; Kamei, Katsuhiko

2016-05-01

We developed new cycling probe-based real-time PCR and nested real-time PCR assays for the detection of Histoplasma capsulatum that were designed to detect the gene encoding N-acetylated α-linked acidic dipeptidase (NAALADase), which we previously identified as an H. capsulatum antigen reacting with sera from patients with histoplasmosis. Both assays specifically detected the DNAs of all H. capsulatum strains but not those of other fungi or human DNA. The limited of detection (LOD) of the real-time PCR assay was 10 DNA copies when using 10-fold serial dilutions of the standard plasmid DNA and 50 DNA copies when using human serum spiked with standard plasmid DNA. The nested real-time PCR improved the LOD to 5 DNA copies when using human serum spiked with standard plasmid DNA, which represents a 10-fold higher than that observed with the real-time PCR assay. To assess the ability of the two assays to diagnose histoplasmosis, we analyzed a small number of clinical specimens collected from five patients with histoplasmosis, such as sera (n = 4), formalin-fixed paraffin-embedded (FFPE) tissue (n = 4), and bronchoalveolar lavage fluid (BALF) (n = 1). Although clinical sensitivity of the real-time PCR assay was insufficiently sensitive (33%), the nested real-time PCR assay increased the clinical sensitivity (77%), suggesting it has a potential to be a useful method for detecting H. capsulatum DNA in clinical specimens. © The Author 2015. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Rapid Communication: MiR-92a as a housekeeping gene for analysis of bovine mastitis-related microRNA in milk.

PubMed

Lai, Y C; Fujikawa, T; Ando, T; Kitahara, G; Koiwa, M; Kubota, C; Miura, N

2017-06-01

Our aim was to identify a suitable microRNA housekeeping gene for real-time PCR analysis of bovine mastitis-related microRNA in milk. We identified , , and as housekeeping gene candidates on the basis of previous Solexa sequencing results. Threshold cycle (CT) values for , , and did not differ between milk from control cows and milk from mastitis-affected cows. NormFinder software identified as the most stable single housekeeping gene. We evaluated the suitability of the housekeeping gene candidates by using them to assess expression levels of the inflammation-related gene . Regardless of the housekeeping gene candidates used for normalization, relative expression levels of were significantly higher in mastitis-affected samples than in control samples. However, of all the housekeeping genes and gene combinations investigated, normalization with alone generated the difference in relative expression between mastitis-affected and control samples with the highest significance. These results suggest that is suitable for use as a housekeeping gene for analysis of bovine mastitis-related microRNA in milk.

Gas ultrasonic flow rate measurement through genetic-ant colony optimization based on the ultrasonic pulse received signal model

NASA Astrophysics Data System (ADS)

Hou, Huirang; Zheng, Dandan; Nie, Laixiao

2015-04-01

For gas ultrasonic flowmeters, the signals received by ultrasonic sensors are susceptible to noise interference. If signals are mingled with noise, a large error in flow measurement can be caused by triggering mistakenly using the traditional double-threshold method. To solve this problem, genetic-ant colony optimization (GACO) based on the ultrasonic pulse received signal model is proposed. Furthermore, in consideration of the real-time performance of the flow measurement system, the improvement of processing only the first three cycles of the received signals rather than the whole signal is proposed. Simulation results show that the GACO algorithm has the best estimation accuracy and ant-noise ability compared with the genetic algorithm, ant colony optimization, double-threshold and enveloped zero-crossing. Local convergence doesn’t appear with the GACO algorithm until -10 dB. For the GACO algorithm, the converging accuracy and converging speed and the amount of computation are further improved when using the first three cycles (called GACO-3cycles). Experimental results involving actual received signals show that the accuracy of single-gas ultrasonic flow rate measurement can reach 0.5% with GACO-3 cycles, which is better than with the double-threshold method.

The rotary zone thermal cycler: A low-power system enabling automated rapid PCR

DOE PAGES

Bartsch, Michael S.; Edwards, Harrison S.; Gas Transmission Systems, Walnut Creek, CA; ...

2015-03-31

In this study, advances in molecular biology, microfluidics, and laboratory automation continue to expand the accessibility and applicability of these methods beyond the confines of conventional, centralized laboratory facilities and into point of use roles in clinical, military, forensic, portable, and field-deployed applications. As a result, there is a growing need to adapt the unit operations of molecular biology such as aliquoting, centrifuging, mixing, and thermal cycling to compact, portable, low-power, and automation-ready formats. Here we present one such adaptation, the rotary zone thermal cycler (RZTC), a novel wheel-based device capable of cycling up to four different fixed-temperature blocks intomore » contact with a stationary 4-microliter capillary-bound sample to realize 1-3 second transitions with steady state heater power of less than 10 W. We further demonstrate the utility of the RZTC for DNA amplification as part of a highly integrated rotary zone PCR (rzPCR) system using low-volume valves and syringe-based fluid handling to automate sample loading and unloading, thermal cycling, and between run cleaning functionalities in a compact, modular form factor. In addition to characterizing the performance of the RZTC and the efficacy of different online cleaning protocols, preliminary results are presented for rapid single-plex PCR, multiplex short tandem repeat (STR) amplification, and second strand cDNA synthesis.« less

The rotary zone thermal cycler: A low-power system enabling automated rapid PCR

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bartsch, Michael S.; Edwards, Harrison S.; Gas Transmission Systems, Walnut Creek, CA

In this study, advances in molecular biology, microfluidics, and laboratory automation continue to expand the accessibility and applicability of these methods beyond the confines of conventional, centralized laboratory facilities and into point of use roles in clinical, military, forensic, portable, and field-deployed applications. As a result, there is a growing need to adapt the unit operations of molecular biology such as aliquoting, centrifuging, mixing, and thermal cycling to compact, portable, low-power, and automation-ready formats. Here we present one such adaptation, the rotary zone thermal cycler (RZTC), a novel wheel-based device capable of cycling up to four different fixed-temperature blocks intomore » contact with a stationary 4-microliter capillary-bound sample to realize 1-3 second transitions with steady state heater power of less than 10 W. We further demonstrate the utility of the RZTC for DNA amplification as part of a highly integrated rotary zone PCR (rzPCR) system using low-volume valves and syringe-based fluid handling to automate sample loading and unloading, thermal cycling, and between run cleaning functionalities in a compact, modular form factor. In addition to characterizing the performance of the RZTC and the efficacy of different online cleaning protocols, preliminary results are presented for rapid single-plex PCR, multiplex short tandem repeat (STR) amplification, and second strand cDNA synthesis.« less

Convectively driven PCR thermal-cycling

DOEpatents

Benett, William J.; Richards, James B.; Milanovich, Fred P.

2003-07-01

A polymerase chain reaction system provides an upper temperature zone and a lower temperature zone in a fluid sample. Channels set up convection cells in the fluid sample and move the fluid sample repeatedly through the upper and lower temperature zone creating thermal cycling.

Contribution of the qPCR for the Diagnosis of Pneumocystosis

PubMed Central

Issa, Nahema; Gabriel, Frederic; Baulier, Gildas; Accoceberry, Isabelle; Mourissoux, Gaelle; Guisset, Olivier; Camou, Fabrice

2017-01-01

Abstract Background Pneumocystis jirovecii pneumonia (PCP) is an opportunistic fungal respiratory infection. The incidence of PCP has decreased among HIV patients, however among non HIV-negative patients on immunosuppressive drugs; an increase in incidence is noted. In this population, the diagnosis of PCP is difficult because the clinical presentation is atypical and the direct examination (DE) of the respiratory secretions is often negative. In this context, detection of Pneumocystis jirovecii DNA in respiratory secretions by real-time quantitative chain reaction (qPCR) should be usefull. Methods In order to evaluate the usefulness of qPCR, all patients hospitalized in medicine or intensive care unit (ICU) in a university hospital and having a positive qPCR in respiratory secretions were included in a retrospective study conducted between 2013 and 2016. Based on clinical data, respiratory secretions, imaging and treatment, patients were classified into three groups: certain PCP, possible, or colonization, irrespective of the value of qPCR. Results One hundred and fifty patients, including 38 infected with HIV, were included: 75 in medicine and 75 in intensive care. Ninety patients (60%) had bronchoalveolar lavage. The diagnosis of PCP was considered certain or possible for 52 and 77 patients respectively and rejected (colonization) for 21 patients. DE was negative for 78% of non-HIV patients and 29% of HIV patients. Among the 129 patients with PCP, the hospital mortality was 35.9% in ICU and 21.5% in medicine. The median value of qPCR was 76,650 copies/mL among patients with PCP and 3,220 copies/mL among colonized patients (P < 0.001) with no significant difference in type of respiratory specimen or place of hospitalization. The optimal threshold value of qPCR determined from the ROC curve was 10,100 copies/mL with a sensitivity of 76.6% and a specificity of 86%. Specificity was 100% at the threshold of 59,250 copies/mL. Conclusion If qPCR alone is imperfect for the differential diagnosis between colonization and infection, it has the merit of guiding the clinician towards the diagnosis of PCP especially for non-HIV patients whose DE of the respiratory secretions is negative in nearly 80% of cases, both in medicine and ICU. Disclosures All authors: No reported disclosures.

Pathological complete response after neoadjuvant chemotherapy is an independent predictive factor irrespective of simplified breast cancer intrinsic subtypes: a landmark and two-step approach analyses from the EORTC 10994/BIG 1-00 phase III trial.

PubMed

Bonnefoi, H; Litière, S; Piccart, M; MacGrogan, G; Fumoleau, P; Brain, E; Petit, T; Rouanet, P; Jassem, J; Moldovan, C; Bodmer, A; Zaman, K; Cufer, T; Campone, M; Luporsi, E; Malmström, P; Werutsky, G; Bogaerts, J; Bergh, J; Cameron, D A

2014-06-01

Pathological complete response (pCR) following chemotherapy is strongly associated with both breast cancer subtype and long-term survival. Within a phase III neoadjuvant chemotherapy trial, we sought to determine whether the prognostic implications of pCR, TP53 status and treatment arm (taxane versus non-taxane) differed between intrinsic subtypes. Patients were randomized to receive either six cycles of anthracycline-based chemotherapy or three cycles of docetaxel then three cycles of eprirubicin/docetaxel (T-ET). pCR was defined as no evidence of residual invasive cancer (or very few scattered tumour cells) in primary tumour and lymph nodes. We used a simplified intrinsic subtypes classification, as suggested by the 2011 St Gallen consensus. Interactions between pCR, TP53 status, treatment arm and intrinsic subtype on event-free survival (EFS), distant metastasis-free survival (DMFS) and overall survival (OS) were studied using a landmark and a two-step approach multivariate analyses. Sufficient data for pCR analyses were available in 1212 (65%) of 1856 patients randomized. pCR occurred in 222 of 1212 (18%) patients: 37 of 496 (7.5%) luminal A, 22 of 147 (15%) luminal B/HER2 negative, 51 of 230 (22%) luminal B/HER2 positive, 43 of 118 (36%) HER2 positive/non-luminal, 69 of 221(31%) triple negative (TN). The prognostic effect of pCR on EFS did not differ between subtypes and was an independent predictor for better EFS [hazard ratio (HR) = 0.40, P < 0.001 in favour of pCR], DMFS (HR = 0.32, P < 0.001) and OS (HR = 0.32, P < 0.001). Chemotherapy arm was an independent predictor only for EFS (HR = 0.73, P = 0.004 in favour of T-ET). The interaction between TP53, intrinsic subtypes and survival outcomes only approached statistical significance for EFS (P = 0.1). pCR is an independent predictor of favourable clinical outcomes in all molecular subtypes in a two-step multivariate analysis. EORTC 10994/BIG 1-00 Trial registration number NCT00017095. © The Author 2014. Published by Oxford University Press on behalf of the European Society for Medical Oncology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Textural features of 18F-FDG PET after two cycles of neoadjuvant chemotherapy can predict pCR in patients with locally advanced breast cancer.

PubMed

Cheng, Lin; Zhang, Jianping; Wang, Yujie; Xu, Xiaoli; Zhang, Yongping; Zhang, Yingjian; Liu, Guangyu; Cheng, Jingyi

2017-08-01

This study was designed to evaluate the utility of textural features for predicting pathological complete response (pCR) to neoadjuvant chemotherapy (NAC). Sixty-one consecutive patients with locally advanced breast cancer underwent 18 F-FDG PET/CT scanning at baseline and after the second course of NAC. Changes to imaging parameters [maximum standardized uptake value (SUV max ), metabolic tumor volume (MTV), total lesion glycolysis (TLG)] and textural features (entropy, coarseness, skewness) between the 2 scans were measured by two independent radiologists. Pathological responses were reviewed by one pathologist, and the significance of the predictive value of each parameter was analyzed using a Chi-squared test. Receiver operating characteristic curve analysis was used to compare the area under the curve (AUC) for each parameter. pCR was observed more often in patients with HER2-positive tumors (22 patients) than in patients with HER2-negative tumors (5 patients) (71.0 vs. 16.7%, p < 0.001). ∆ %SUV max , ∆ %entropy and ∆ %coarseness were significantly useful for differentiating pCR from non-pCR in the HER2-negative group, and the AUCs for these parameters were 0.928, 0.808 and 0.800, respectively (p = 0.003, 0.032 and 0.037). In the HER2-positive group, ∆ %SUV max and ∆ %skewness were moderately useful for predicting pCR, and the respective AUCs were 0.747 and 0.758 (p = 0.033 and 0.026). Although there was no significant difference in the AUCs between groups for these parameters, an additional 3/22 patients in the HER2-positive group with pCR were identified when ∆ %skewness and ∆ %SUV max were considered together (p = 0.031). The absolute values for each parameter before NAC and after 2 cycles cannot predict pCR in our patients. Neither ∆ %MTV nor ∆ %TLG was efficiently predictive of pCR in any group. The early changes in the textural features of 18 F-FDG PET images after two cycles of NAC are predictive of pCR in both HER2-negative and HER2-positive patients; this evidence warrants confirmation by further research.

Validation of an Anaplasma marginale cELISA for use in the diagnosis of A. ovis infections in domestic sheep and Anaplasma spp. in wild ungulates.

PubMed

Scoles, Glen A; Goff, Will L; Lysyk, Timothy J; Lewis, Gregory S; Knowles, Donald P

2008-07-27

A commercially available (cELISA) kit for diagnosing Anaplasma marginale infection in cattle was validated for diagnosing A ovis infection in sheep using the bovine serum controls as supplied by the manufacturer (BcELISA) and sheep serum controls from pathogen-free sheep (OcELISA). True positives were identified using two previously established assays, a nested PCR (nPCR) test and an indirect immunofluorescent assay (IFA). The BcELISA was also applied to sera from various species of wild ruminants, comparing the results with the IFA. Receiver operating characteristic (ROC) analysis indicated that the predicted threshold inhibition for the BcELISA was 19.2. The sensitivity for the BcELISA was 98.2% and the specificity was 96.3%. The predicted threshold inhibition decreased to 14.3 for the OcELISA; the sensitivity was 96.5% and the specificity was 98.1%. There was >/=90% concordance between IFA and nPCR, as well as between the BcELISA at 19% inhibition cutoff and either IFA or PCR. Concordance between the cELISA and IFA using sera from elk, mule deer, bighorn sheep, pronghorn antelope, and black-tailed deer ranged from 64% to 100%. This commercially available cELISA test kit can be used very effectively to test domestic sheep for infection with A. ovis using the kit-supplied controls (i.e. the BcELISA) and a 19% inhibition cutoff; the kit may also be useful for detecting intra-erythrocytic Anaplasma infections in wild ruminants.

Variability of space climate and its extremes with successive solar cycles

NASA Astrophysics Data System (ADS)

Chapman, Sandra; Hush, Phillip; Tindale, Elisabeth; Dunlop, Malcolm; Watkins, Nicholas

2016-04-01

Auroral geomagnetic indices coupled with in situ solar wind monitors provide a comprehensive data set, spanning several solar cycles. Space climate can be considered as the distribution of space weather. We can then characterize these observations in terms of changing space climate by quantifying how the statistical properties of ensembles of these observed variables vary between different phases of the solar cycle. We first consider the AE index burst distribution. Bursts are constructed by thresholding the AE time series; the size of a burst is the sum of the excess in the time series for each time interval over which the threshold is exceeded. The distribution of burst sizes is two component with a crossover in behaviour at thresholds ≈ 1000 nT. Above this threshold, we find[1] a range over which the mean burst size is almost constant with threshold for both solar maxima and minima. The burst size distribution of the largest events has a functional form which is exponential. The relative likelihood of these large events varies from one solar maximum and minimum to the next. If the relative overall activity of a solar maximum/minimum can be estimated, these results then constrain the likelihood of extreme events of a given size for that solar maximum/minimum. We next develop and apply a methodology to quantify how the full distribution of geomagnetic indices and upstream solar wind observables are changing between and across different solar cycles. This methodology[2] estimates how different quantiles of the distribution, or equivalently, how the return times of events of a given size, are changing. [1] Hush, P., S. C. Chapman, M. W. Dunlop, and N. W. Watkins (2015), Robust statistical properties of the size of large burst events in AE, Geophys. Res. Lett.,42 doi:10.1002/2015GL066277 [2] Chapman, S. C., D. A. Stainforth, N. W. Watkins, (2013) On estimating long term local climate trends , Phil. Trans. Royal Soc., A,371 20120287 DOI:10.1098/rsta.2012.0287

Instability and breakdown of the coral-algae symbiosis upon exceedence of the interglacial pCO2 threshold (>260 ppmv): the "missing" Earth-System feedback mechanism

NASA Astrophysics Data System (ADS)

Wooldridge, Scott A.

2017-12-01

Changes in the atmospheric partial pressure of CO2 ( pCO2) leads to predictable impacts on the surface ocean carbonate system. Here, the importance of atmospheric pCO2 <260 ppmv is established for the optimum performance (and stability) of the algal endosymbiosis employed by a key suite of tropical reef-building coral species. Violation of this symbiotic threshold is revealed as a prerequisite for major historical reef extinction events, glacial-interglacial feedback climate cycles, and the modern decline of coral reef ecosystems. Indeed, it is concluded that this symbiotic threshold enacts a fundamental feedback mechanism needed to explain the characteristic dynamics (and drivers) of the coupled land-ocean-atmosphere carbon cycle of the Earth System since the mid-Miocene, some 25 million yr ago.

The effect of signal duration on the underwater hearing thresholds of two harbor seals (Phoca vitulina) for single tonal signals between 0.2 and 40 kHz.

PubMed

Kastelein, Ronald A; Hoek, Lean; Wensveen, Paul J; Terhune, John M; de Jong, Christ A F

2010-02-01

The underwater hearing sensitivities of two 2-year-old female harbor seals were quantified in a pool built for acoustic research by using a behavioral psycho-acoustic technique. The animals were trained only to respond when they detected an acoustic signal ("go/no-go" response). Detection thresholds were obtained for pure tone signals (frequencies: 0.2-40 kHz; durations: 0.5-5000 ms, depending on the frequency; 59 frequency-duration combinations). Detection thresholds were quantified by varying the signal amplitude by the 1-up, 1-down staircase method, and were defined as the stimulus levels, resulting in a 50% detection rate. The hearing thresholds of the two seals were similar for all frequencies except for 40 kHz, for which the thresholds differed by, on average, 3.7 dB. There was an inverse relationship between the time constant (tau), derived from an exponential model of temporal integration, and the frequency [log(tau)=2.86-0.94 log(f);tau in ms and f in kHz]. Similarly, the thresholds increased when the pulse was shorter than approximately 780 cycles (independent of the frequency). For pulses shorter than the integration time, the thresholds increased by 9-16 dB per decade reduction in the duration or number of cycles in the pulse. The results of this study suggest that most published hearing thresholds

Advantages and limitations of quantitative PCR (Q-PCR)-based approaches in microbial ecology.

PubMed

Smith, Cindy J; Osborn, A Mark

2009-01-01

Quantitative PCR (Q-PCR or real-time PCR) approaches are now widely applied in microbial ecology to quantify the abundance and expression of taxonomic and functional gene markers within the environment. Q-PCR-based analyses combine 'traditional' end-point detection PCR with fluorescent detection technologies to record the accumulation of amplicons in 'real time' during each cycle of the PCR amplification. By detection of amplicons during the early exponential phase of the PCR, this enables the quantification of gene (or transcript) numbers when these are proportional to the starting template concentration. When Q-PCR is coupled with a preceding reverse transcription reaction, it can be used to quantify gene expression (RT-Q-PCR). This review firstly addresses the theoretical and practical implementation of Q-PCR and RT-Q-PCR protocols in microbial ecology, highlighting key experimental considerations. Secondly, we review the applications of (RT)-Q-PCR analyses in environmental microbiology and evaluate the contribution and advances gained from such approaches. Finally, we conclude by offering future perspectives on the application of (RT)-Q-PCR in furthering understanding in microbial ecology, in particular, when coupled with other molecular approaches and more traditional investigations of environmental systems.

The sylvatic transmission cycle of Trypanosoma cruzi in a rural area in the humid Chaco of Argentina.

PubMed

Alvarado-Otegui, J A; Ceballos, L A; Orozco, M M; Enriquez, G F; Cardinal, M V; Cura, C; Schijman, A G; Kitron, U; Gürtler, R E

2012-10-01

Little is known about the sylvatic transmission cycle of Trypanosoma cruzi in the Gran Chaco ecoregion. We conducted surveys to identify the main sylvatic hosts of T. cruzi, parasite discrete typing units and vector species involved in Pampa del Indio, a rural area in the humid Argentinean Chaco. A total of 44 mammals from 14 species were captured and examined for infection by xenodiagnosis and polymerase chain reaction amplification of the hyper-variable region of kinetoplast DNA minicircles of T. cruzi (kDNA-PCR). Ten (22.7%) mammals were positive by xenodiagnosis or kDNA-PCR. Four of 11 (36%) Didelphis albiventris (white-eared opossums) and six of nine (67%) Dasypus novemcinctus (nine-banded armadillos) were positive by xenodiagnosis and or kDNA-PCR. Rodents, other armadillo species, felids, crab-eating raccoons, hares and rabbits were not infected. Positive animals were highly infectious to the bugs that fed upon them as determined by xenodiagnosis. All positive opossums were infected with T. cruzi I and all positive nine-banded armadillos with T. cruzi III. Extensive searches in sylvatic habitats using 718 Noireau trap-nights only yielded Triatoma sordida whereas no bug was collected in 26 light-trap nights. Four armadillos or opossums fitted with a spool-and-line device were successfully tracked to their refuges; only one Panstrongylus geniculatus was found in an armadillo burrow. No sylvatic triatomine was infected with T. cruzi by microscopical examination or kDNA-PCR. Our results indicate that two independent sylvatic transmission cycles of T. cruzi occur in the humid Chaco. The putative vectors of both cycles need to be identified conclusively. Copyright © 2012 Elsevier B.V. All rights reserved.

The sylvatic transmission cycle of Trypanosoma cruzi in a rural area in the humid Chaco of Argentina

PubMed Central

Alvarado-Otegui, J.A.; Ceballos, L.A.; Orozco, M.M.; Enriquez, G.F.; Cardinal, M.V.; Cura, C.; Schijman, A.G.; Kitron, U.; Gürtler, R.E.

2012-01-01

Little is known about the sylvatic transmission cycle of Trypanosoma cruzi in the Gran Chaco ecoregion. We conducted surveys to identify the main sylvatic hosts of T. cruzi, parasite discrete typing units and vector species involved in Pampa del Indio, a rural area in the humid Argentinean Chaco. A total of 44 mammals from 14 species was captured and examined for infection by xenodiagnosis and polymerase chain reaction amplification of the hyper-variable region of kinetoplast DNA minicircles of T. cruzi (kDNA-PCR). Ten (22.7%) mammals were positive by xenodiagnosis or kDNA-PCR. Four of 11 (36%) Didelphis albiventris (white-eared opossums) and six of nine (67%) Dasypus novemcinctus (nine-banded armadillos) were positive by xenodiagnosis and or kDNA-PCR. Rodents, other armadillo species, felids, crab-eating raccoons, hares and rabbits were not infected. Positive animals were highly infectious to the bugs that fed upon them as determined by xenodiagnosis. All positive opossums were infected with T. cruzi I and all positive nine-banded armadillos with T. cruzi III. Extensive searches in sylvatic habitats using 718 Noireau trap-nights only yielded Triatoma sordida whereas no bug was collected in 26 light-trap nights. Four armadillos or opossums fitted with a spool-and-line device were successfully tracked to their refuges; only one Panstrongylus geniculatus was found in an armadillo burrow. No sylvatic triatomine was infected with T. cruzi by microscopical examination or kDNA-PCR. Our results indicate that two independent sylvatic transmission cycles of T. cruzi occur in the humid Chaco. The putative vectors of both cycles need to be identified conclusively. PMID:22771688

Introducing Undergraduate Students to Real-Time PCR

ERIC Educational Resources Information Center

Hancock, Dale; Funnell, Alister; Jack, Briony; Johnston, Jill

2010-01-01

An experiment is conducted, which in four 3 h laboratory sessions, introduces third year undergraduate Biochemistry students to the technique of real-time PCR in a biological context. The model used is a murine erythroleukemia cell line (MEL cells). These continuously cycling, immature red blood cells, arrested at an early stage in erythropoiesis,…

Centrifugal Microfluidic System for Nucleic Acid Amplification and Detection.

PubMed

Miao, Baogang; Peng, Niancai; Li, Lei; Li, Zheng; Hu, Fei; Zhang, Zengming; Wang, Chaohui

2015-11-04

We report here the development of a rapid PCR microfluidic system comprising a double-shaft turntable and centrifugal-based disc that rapidly drives the PCR mixture between chambers set at different temperatures, and the bidirectional flow improved the space utilization of the disc. Three heating resistors and thermistors maintained uniform, specific temperatures for the denaturation, annealing, and extension steps of the PCR. Infrared imaging showed that there was little thermal interference between reaction chambers; the system enabled the cycle number and reaction time of each step to be independently adjusted. To validate the function and efficiency of the centrifugal microfluidic system, a 350-base pair target gene from the hepatitis B virus was amplified and quantitated by fluorescence detection. By optimizing the cycling parameters, the reaction time was reduced to 32 min as compared to 120 min for a commercial PCR machine. DNA samples with concentrations ranging from 10 to 10⁶ copies/mL could be quantitatively analyzed using this system. This centrifugal-based microfluidic platform is a useful system and possesses industrialization potential that can be used for portable diagnostics.

Centrifugal Microfluidic System for Nucleic Acid Amplification and Detection

PubMed Central

Miao, Baogang; Peng, Niancai; Li, Lei; Li, Zheng; Hu, Fei; Zhang, Zengming; Wang, Chaohui

2015-01-01

We report here the development of a rapid PCR microfluidic system comprising a double-shaft turntable and centrifugal-based disc that rapidly drives the PCR mixture between chambers set at different temperatures, and the bidirectional flow improved the space utilization of the disc. Three heating resistors and thermistors maintained uniform, specific temperatures for the denaturation, annealing, and extension steps of the PCR. Infrared imaging showed that there was little thermal interference between reaction chambers; the system enabled the cycle number and reaction time of each step to be independently adjusted. To validate the function and efficiency of the centrifugal microfluidic system, a 350-base pair target gene from the hepatitis B virus was amplified and quantitated by fluorescence detection. By optimizing the cycling parameters, the reaction time was reduced to 32 min as compared to 120 min for a commercial PCR machine. DNA samples with concentrations ranging from 10 to 106 copies/mL could be quantitatively analyzed using this system. This centrifugal-based microfluidic platform is a useful system and possesses industrialization potential that can be used for portable diagnostics. PMID:26556354

High-speed thermal cycling system and method of use

DOEpatents

Hansen, A.D.A.; Jaklevic, J.M.

1996-04-16

A thermal cycling system and method of use are described. The thermal cycling system is based on the circulation of temperature-controlled water directly to the underside of thin-walled polycarbonate plates. The water flow is selected from a manifold fed by pumps from heated reservoirs. The plate wells are loaded with typically 15-20 microliters of reagent mix for the PCR process. Heat transfer through the thin polycarbonate is sufficiently rapid that the contents reach thermal equilibrium with the water in less than 15 seconds. Complete PCR amplification runs of 40 three-step cycles have been performed in as little as 14.5 minutes, with the results showing substantially enhanced specificity compared to conventional technology requiring run times in excess of 100 minutes. The plate clamping station is designed to be amenable to robotic loading and unloading of the system. It includes a heated lid, thus eliminating the need for mineral oil overlay of the reactants. The present system includes three or more plate holder stations, fed from common reservoirs but operating with independent switching cycles. The system can be modularly expanded. 13 figs.

High-speed thermal cycling system and method of use

DOEpatents

Hansen, Anthony D. A.; Jaklevic, Joseph M.

1996-01-01

A thermal cycling system and method of use are described. The thermal cycling system is based on the-circulation of temperature-controlled water directly to the underside of thin-walled polycarbonate microtiter plates. The water flow is selected from a manifold fed by pumps from heated reservoirs. The plate wells are loaded with typically 15-20 .mu.l of reagent mix for the PCR process. Heat transfer through the thin polycarbonate is sufficiently rapid that the contents reach thermal equilibrium with the water in less than 15 seconds. Complete PCR amplification runs of 40 three-step cycles have been performed in as little as 14.5 minutes, with the results showing substantially enhanced specificity compared to conventional technology requiring run times in excess of 100 minutes. The plate clamping station is designed to be amenable to robotic loading and unloading of the system. It includes a heated lid, thus eliminating the need for mineral oil overlay of the reactants. The present system includes three or more plate holder stations, fed from common reservoirs but operating with independent switching cycles. The system can be modularly expanded.

Successful downstream application of the Paxgene Blood RNA system from small blood samples in paediatric patients for quantitative PCR analysis

PubMed Central

Carrol, Enitan D; Salway, Fiona; Pepper, Stuart D; Saunders, Emma; Mankhambo, Limangeni A; Ollier, William E; Hart, C Anthony; Day, Phillip

2007-01-01

Background The challenge of gene expression studies is to reliably quantify levels of transcripts, but this is hindered by a number of factors including sample availability, handling and storage. The PAXgene™ Blood RNA System includes a stabilizing additive in a plastic evacuated tube, but requires 2.5 mL blood, which makes routine implementation impractical for paediatric use. The aim of this study was to modify the PAXgene™ Blood RNA System kit protocol for application to small, sick chidren, without compromising RNA integrity, and subsequently to perform quantitative analysis of ICAM and interleukin-6 gene expression. Aliquots of 0.86 mL PAXgene™ reagent were put into microtubes and 0.3 mL whole blood added to maintain the same recommended proportions as in the PAXgene™ evacuated tube system. RNA quality was assessed using the Agilent BioAnalyser 2100 and an in-house TaqMan™ assay which measures GAPDH transcript integrity by determining 3' to 5' ratios. qPCR analysis was performed on an additional panel of 7 housekeeping genes. Three reference genes (HPRT1, YWHAZ and GAPDH) were identified using the GeNORM algorithm, which were subsequently used to normalising target gene expression levels. ICAM-1 and IL-6 gene expression were measured in 87 Malawian children with invasive pneumococcal disease. Results Total RNA yield was between 1,114 and 2,950 ng and the BioAnalyser 2100 demonstrated discernible 18s and 28s bands. The cycle threshold values obtained for the seven housekeeping genes were between 15 and 30 and showed good consistency. Median relative ICAM and IL-6 gene expression were significantly reduced in non-survivors compared to survivors (ICAM: 3.56 vs 4.41, p = 0.04, and IL-6: 2.16 vs 6.73, p = 0.02). Conclusion We have successfully modified the PAXgene™ blood collection system for use in small children and demonstrated preservation of RNA integrity and successful quantitative real-time PCR analysis. PMID:17850649

Emerging Tuberculosis Pathogen Hijacks Social Communication Behavior in the Group-Living Banded Mongoose (Mungos mungo)

PubMed Central

Sanderson, Claire E.; Larsen, Michelle H.; Robbe-Austerman, Suelee; Williams, Mark C.; Palmer, Mitchell V.

2016-01-01

ABSTRACT An emerging Mycobacterium tuberculosis complex (MTC) pathogen, M. mungi, infects wild banded mongooses (Mungos mungo) in Northern Botswana, causing significant mortality. This MTC pathogen did not appear to be transmitted through a primary aerosol or oral route. We utilized histopathology, spoligotyping, mycobacterial interspersed repetitive units-variable number of tandem repeats (MIRU-VNTR), quantitative PCR (qPCR), and molecular markers (regions of difference [RDs] from various MTC members, including region of difference 1 [RD1] from M. bovis BCG [RD1BCG], M. microti [RD1mic], and M. pinnipedii [RD1seal], genes Rv1510 [RD4], Rv1970 [RD7], Rv3877/8 [RD1], and Rv3120 [RD12], insertion element IS1561, the 16S RNA gene, and gene Rv0577 [cfp32]), including the newly characterized mongoose-specific deletion in RD1 (RD1mon), in order to demonstrate the presence of M. mungi DNA in infected mongooses and investigate pathogen invasion and exposure mechanisms. M. mungi DNA was identified in 29% of nasal planum samples (n = 52), 56% of nasal rinses and swabs (n = 9), 53% of oral swabs (n = 19), 22% of urine samples (n = 23), 33% of anal gland tissue (n = 18), and 39% of anal gland secretions (n = 44). The occurrence of extremely low cycle threshold values obtained with qPCR in anal gland and nasal planum samples indicates that high levels of M. mungi can be found in these tissue types. Histological data were consistent with these results, suggesting that pathogen invasion occurs through breaks in the nasal planum and/or skin of the mongoose host, which are in frequent contact with anal gland secretions and urine during olfactory communication behavior. Lesions in the lung, when present, occurred only with disseminated disease. No environmental sources of M. mungi DNA could be found. We report primary environmental transmission of an MTC pathogen that occurs in association with social communication behavior. PMID:27165798

Assessment of early response biomarkers in relation to long‐term survival in patients with HER2‐negative breast cancer receiving neoadjuvant chemotherapy plus bevacizumab: Results from the Phase II PROMIX trial

PubMed Central

Kimbung, Siker; Markholm, Ida; Bjöhle, Judith; Lekberg, Tobias; von Wachenfeldt, Anna; Azavedo, Edward; Saracco, Ariel; Hellström, Mats; Veerla, Srinivas; Paquet, Eric; Bendahl, Pär‐Ola; Fernö, Mårten; Bergh, Jonas; Loman, Niklas

2017-01-01

Pathologic complete response (pCR) is a predictor for favorable outcome after neoadjuvant treatment in early breast cancer. Modulation of gene expression may also provide early readouts of biological activity and prognosis, offering the possibility for timely response‐guided treatment adjustment. The role of early transcriptional changes in predicting response to neoadjuvant chemotherapy plus bevacizumab was investigated. One‐hundred‐and‐fifty patients with large, operable and locally advanced HER2‐negative breast cancer received epirubicin and docetaxel, with the addition of bevacizumab. Patients underwent tumor biopsies at baseline, after Cycle 2 and at the time of surgery. The primary end point, pCR, and its relation with the secondary endpoints event‐free survival (EFS), overall survival (OS) and gene expression profiles, are reported. The pCR rate was 13% (95% CI 8.6–20.2), with significantly more pCRs among triple‐negative [28% (95% CI 14.8–45.4)] than among hormone receptor positive (HR+) tumors [9% (95% CI 4.6–16.3); (OR = 3.9 [CI = 1.5–10.3])]. pCR rates were not associated with EFS or OS. PAM50 subtypes significantly changed after Cycle 2 (p = 0.03) and an index of absolute changes in PAM50 correlations between these time‐points was associated with EFS [HR = 0.62 (CI = 0.3–1.1)]. In univariable analyses, signatures for angiogenesis, proliferation, estrogen receptor signaling, invasion and metastasis, and immune response, measured after Cycle 2, were associated with pCR in HR+ tumors. Evaluation of changes in molecular subtypes and other signatures early in the course of neoadjuvant treatment may be predictive of pCR and EFS. These factors may help guide further treatment and should be considered when designing neoadjuvant trials. PMID:28940389

Typeability of DNA in Touch Traces Deposited on Paper and Optical Data Discs.

PubMed

Sołtyszewski, Ireneusz; Szeremeta, Michał; Skawrońska, Małgorzata; Niemcunowicz-Janica, Anna; Pepiński, Witold

2015-01-01

Nucleated epithelial cells that are transferred by casual touching and handling of objects are the primary source of biological evidence that is found in high-volume crimes. Cellular material associated with touch traces usually contains low levels of DNA template making it challenging to acquire an informative profile. The main purpose of this study was to examine the efficacy of DNA typing in fingerprints deposited on optical data discs and the office paper. Latent fingerprints were made by 60 subjects of both sexes (30 males and 30 females). A highly effective DNA extraction method with QIAamp DNA Mini Kit (Qiagen) and an increased sensitivity PCR by AmpFlSTR® NGM™ Amplification Kit (Applied Biosystems) carried out at standard 30 cycles and at increased 34 cycles were used. The mean value of total DNA recovery was 0.4 ng from CDs/DVDs and 0.3 ng from the office paper. Amplification of Low Template DNA (LT-DNA) resulted in improved analytical success by increasing the number of PCR cycles from standard 30 to 34. On the other hand, the increased PCR cycles resulted in allele drop-ins showing additional peaks, the majority of which were outside the stutter positions. Rigorous procedures and interpretation guidelines are required during LT-DNA for producing reliable and reproducible DNA profiles for forensic purposes.

Real-time PCR assay for the detection and quantification of Legionella pneumophila in environmental water samples: utility for daily practice.

PubMed

Morio, Florent; Corvec, Stéphane; Caroff, Nathalie; Le Gallou, Florence; Drugeon, Henri; Reynaud, Alain

2008-07-01

We developed a quantitative real-time PCR assay targeting the mip gene of Legionella pneumophila for a prospective study from September 2004 to April 2005. It was compared with a standard culture method (French guideline AFNOR T90-431), analysing 120 water samples collected to monitor the risk related to Legionellae at Nantes hospital and to investigate a case of legionellosis acquired from hospital environment. Samples from six distinct water distribution systems were analysed by DNA extraction, amplification and detection with specific primers and FRET probes. The detection limit was 100 genomic units of L. pneumophila per liter (GU/l), the positivity threshold about 600 GU/l and the quantification limit 800 GU/l. PCR results were divided into three groups: negative (n=63), positive but non-quantifiable (n=22) or positive (n=35). PCR showed higher sensitivity than culture, whereas four culture-positive samples appeared negative by PCR (PCR inhibitor detected for two of them). Although no correlation was observed between both methods and real-time PCR cannot substitute for the reference method, it represents an interesting complement. Its sensitivity, reproducibility and rapidity appear particularly interesting in epidemic contexts in order to identify the source of contamination or to evaluate critical points of contamination in water distribution systems.

Thermal analysis of the vortex tube based thermocycler for fast DNA amplification: Experimental and two-dimensional numerical results

NASA Astrophysics Data System (ADS)

Raghavan, V.; Whitney, Scott E.; Ebmeier, Ryan J.; Padhye, Nisha V.; Nelson, Michael; Viljoen, Hendrik J.; Gogos, George

2006-09-01

In this article, experimental and numerical analyses to investigate the thermal control of an innovative vortex tube based polymerase chain reaction (VT-PCR) thermocycler are described. VT-PCR is capable of rapid DNA amplification and real-time optical detection. The device rapidly cycles six 20μl 96bp λ-DNA samples between the PCR stages (denaturation, annealing, and elongation) for 30cycles in approximately 6min. Two-dimensional numerical simulations have been carried out using computational fluid dynamics (CFD) software FLUENT v.6.2.16. Experiments and CFD simulations have been carried out to measure/predict the temperature variation between the samples and within each sample. Heat transfer rate (primarily dictated by the temperature differences between the samples and the external air heating or cooling them) governs the temperature distribution between and within the samples. Temperature variation between and within the samples during the denaturation stage has been quite uniform (maximum variation around ±0.5 and 1.6°C, respectively). During cooling, by adjusting the cold release valves in the VT-PCR during some stage of cooling, the heat transfer rate has been controlled. Improved thermal control, which increases the efficiency of the PCR process, has been obtained both experimentally and numerically by slightly decreasing the rate of cooling. Thus, almost uniform temperature distribution between and within the samples (within 1°C) has been attained for the annealing stage as well. It is shown that the VT-PCR is a fully functional PCR machine capable of amplifying specific DNA target sequences in less time than conventional PCR devices.

Single Cell Characterization of Prostate Cancer-Circulating Tumor Cells

DTIC Science & Technology

2013-09-01

prostate cancer using RT- PCR [8] and EGFR mutations in non-small cell lung cancer [45]. Microarray-based assessments of gene expression have been carried...analysis. DAPI negative putative CTCs were isolated in 1 ul of 10% Superblock/PBS with a pipetteman into a 0.2 ml PCR tube containing 2.5 ul of 5...Sequencing kit (Clontech). cDNA was amplified using the Advantage 2 PCR kit (Clontech) for 18–25 cycles prior to conversion into a Illumina compatible DNA

Specific Identification and Targeted Characterization of Bifidobacterium lactis from Different Environmental Isolates by a Combined Multiplex-PCR Approach

PubMed Central

Ventura, Marco; Reniero, Roberto; Zink, Ralf

2001-01-01

The species Bifidobacterium lactis, with its main representative strain Bb12 (DSM 10140), is a yoghurt isolate used as a probiotic strain and is commercially applied in different types of yoghurts and infant formulas. In order to ensure the genetic identity and safety of this bacterial isolate, species- and strain-specific molecular tools for genetic fingerprinting must be available to identify isolated bifidobacteria or lactic acid bacteria from, e.g., various clinical environments of relevance in medical microbiology. Two opposing rRNA gene-targeted primers have been developed for specific detection of this microorganism by PCR. The specificity of this approach was evaluated and verified with DNA samples isolated from single and mixed cultures of bifidobacteria and lactobacilli (48 isolates, including the type strains of 29 Bifidobacterium and 9 Lactobacillus species). Furthermore, we performed a Multiplex-PCR using oligonucleotide primers targeting a specific region of the 16S rRNA gene for the genus Bifidobacterium and a conserved eubacterial 16S rDNA sequence. The specificity and sensitivity of this detection with a pure culture of B. lactis were, respectively, 100 bacteria/ml after 25 cycles of PCR and 1 to 10 bacteria/ml after a 50-cycle nested-PCR approach. PMID:11375192

Neoadjuvant chemotherapy in breast cancer: prediction of pathologic response with PET/CT and dynamic contrast-enhanced MR imaging--prospective assessment.

PubMed

Tateishi, Ukihide; Miyake, Mototaka; Nagaoka, Tomoaki; Terauchi, Takashi; Kubota, Kazunori; Kinoshita, Takayuki; Daisaki, Hiromitsu; Macapinlac, Homer A

2012-04-01

To clarify whether fluorine 18 ((18)F) fluorodeoxyglucose (FDG) positron emission tomography (PET)/computed tomography (CT) and dynamic contrast-enhanced (DCE) magnetic resonance (MR) imaging performed after two cycles of neoadjuvant chemotherapy (NAC) can be used to predict pathologic response in breast cancer. Institutional human research committee approval and written informed consent were obtained. Accuracy after two cycles of NAC for predicting pathologic complete response (pCR) was examined in 142 women (mean age, 57 years: range, 43-72 years) with histologically proved breast cancer between December 2005 and February 2009. Quantitative PET/CT and DCE MR imaging were performed at baseline and after two cycles of NAC. Parameters of PET/CT and of blood flow and microvascular permeability at DCE MR were compared with pathologic response. Patients were also evaluated after NAC by using Response Evaluation Criteria in Solid Tumors (RECIST) 1.1 based on DCE MR measurements and European Organization for Research and Treatment of Cancer (EORTC) criteria and PET Response Criteria in Solid Tumors (PERCIST) 1.0 based on PET/CT measurements. Multiple logistic regression analyses were performed to examine continuous variables at PET/CT and DCE MR to predict pCR, and diagnostic accuracies were compared with the McNemar test. Significant decrease from baseline of all parameters at PET/CT and DCE MR was observed after NAC. Therapeutic response was obtained in 24 patients (17%) with pCR and 118 (83%) without pCR. Sensitivity, specificity, and accuracy to predict pCR were 45.5%, 85.5%, and 82.4%, respectively, with RECIST and 70.4%, 95.7%, and 90.8%, respectively, with EORTC and PERCIST. Multiple logistic regression revealed three significant independent predictors of pCR: percentage maximum standardized uptake value (%SUV(max)) (odds ratio [OR], 1.22; 95% confidence interval [CI]: 1.11, 1.34; P < .0001), percentage rate constant (%k(ep)) (OR, 1.07; CI: 1.03, 1.12; P = .002), and percentage area under the time-intensity curve over 90 seconds (%AUC(90)) (OR, 1.04; CI: 1.01, 1.07; P = .048). When diagnostic accuracies are compared, PET/CT is superior to DCE MR for the prediction of pCR (%SUV(max) [90.1%] vs %κ(ep) [83.8%] or %AUC(90) [76.8%]; P < .05). The sensitivities of %SUV(max) (66.7%), %k(ep) (51.7%), and %AUC(90) (50.0%) at (18)F-FDG PET/CT and DCE MR after two cycles of NAC are not acceptable, but the specificities (96.4%, 92.0%, and 95.2%, respectively) are high for stratification of pCR cases in breast cancer. © RSNA, 2012.

Dynamics of Perceived Exertion in Constant-Power Cycling: Time- and Workload-Dependent Thresholds

ERIC Educational Resources Information Center

Balagué, Natàlia; Hristovski, Robert; García, Sergi; Aguirre, Cecilia; Vázquez, Pablo; Razon, Selen; Tenenbaum, Gershon

2015-01-01

Purpose: The purpose of this study was to test the dynamics of perceived exertion shifts (PES) as a function of time and workload during constant-power cycling. Method: Fifty-two participants assigned to 4 groups performed a cycling task at 4 different constant workloads corresponding to their individual rates of perceived exertion (RPEs = 13, 15,…

75 FR 57696 - Change to FMCSA Policy on Calculating and Publicizing the Driver, Vehicle, and Hazardous...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-09-22

... document revises the date used to calculate the threshold crash and OOS rates, from calendar year cycles to fiscal year cycles, from October 1 of a given year to September 30 of the following year. This will... determine HMSP eligibility, before the motor carrier HMSP registration cycle begins on January 1. DATES...

Interlaminar shear fracture toughness and fatigue thresholds for composite materials

NASA Technical Reports Server (NTRS)

Obrien, T. Kevin; Murri, Gretchen B.; Salpekar, Satish A.

1987-01-01

Static and cyclic end notched flexure tests were conducted on a graphite epoxy, a glass epoxy, and graphite thermoplastic to determine their interlaminar shear fracture toughness and fatigue thresholds for delamination in terms of limiting values of the mode II strain energy release rate, G-II, for delamination growth. The influence of precracking and data reduction schemes are discussed. Finite element analysis indicated that the beam theory calculation for G-II with the transverse shear contribution included was reasonably accurate over the entire range of crack lengths. Cyclic loading significantly reduced the critical G-II for delamination. A threshold value of the maximum cyclic G-II below which no delamination occurred after one million cycles was identified for each material. Also, residual static toughness tests were conducted on glass epoxy specimens that had undergone one million cycles without delamination. A linear mixed-mode delamination criteria was used to characterize the static toughness of several composite materials; however, a total G threshold criterion appears to characterize the fatigue delamination durability of composite materials with a wide range of static toughness.

Improving efficiency and reliability of environmental DNA analysis for silver carp

USGS Publications Warehouse

Amberg, Jon J.; McCalla, S. Grace; Monroe, Emy; Lance, Richard; Baerwaldt, Kelly; Gaikowski, Mark P.

2015-01-01

Natural resource agencies have established surveillance programs which use environmental DNA (eDNA) for the early detection of bighead carp Hypophthalmichthys nobilis and silver carp Hypophthalmichthys molitrix before they establish populations within the Great Lakes. This molecular monitoring technique must be highly accurate and precise for confident interpretation and also efficient, both in detection threshold and cost. Therefore, we compared two DNA extraction techniques and compared a new quantitative PCR (qPCR) assay with the conventional PCR (cPCR) assay used by monitoring programs. Both the qPCR and cPCR assays were able to amplify the DNA of silver carp present in environmental samples taken from locations where mixed populations of bigheaded carps existed. However, the qPCR assay had substantially fewer PCR positive samples which were subsequently determined not to contain DNA of bigheaded carps than the cPCR assay. Additionally, the qPCR assay was able to amplify the DNA of bigheaded carps even in the presence of inhibitors that blocked amplification with cPCR. Also, the selection of an appropriate DNA extraction method can significantly alter the efficiency of eDNA surveillance programs by lowering detection limits and by decreasing costs associated with sample processing. The results reported herein are presently being incorporated into eDNA surveillance programs to decrease the costs, increase DNA yield and increase the confidence that assays are amplifying the target DNA. These results are critical to enhancing our ability to accurately and confidently interpret the results reported from monitoring programs using eDNA for early detection of invasive species.

Identification of appropriate reference genes for normalizing transcript expression by quantitative real-time PCR in Litsea cubeba.

PubMed

Lin, Liyuan; Han, Xiaojiao; Chen, Yicun; Wu, Qingke; Wang, Yangdong

2013-12-01

Quantitative real-time PCR has emerged as a highly sensitive and widely used method for detection of gene expression profiles, via which accurate detection depends on reliable normalization. Since no single control is appropriate for all experimental treatments, it is generally advocated to select suitable internal controls prior to use for normalization. This study reported the evaluation of the expression stability of twelve potential reference genes in different tissue/organs and six fruit developmental stages of Litsea cubeba in order to screen the superior internal reference genes for data normalization. Two softwares-geNorm, and NormFinder-were used to identify stability of these candidate genes. The cycle threshold difference and coefficient of variance were also calculated to evaluate the expression stability of candidate genes. F-BOX, EF1α, UBC, and TUA were selected as the most stable reference genes across 11 sample pools. F-BOX, EF1α, and EIF4α exhibited the highest expression stability in different tissue/organs and different fruit developmental stages. Besides, a combination of two stable reference genes would be sufficient for gene expression normalization in different fruit developmental stages. In addition, the relative expression profiles of DXS and DXR were evaluated by EF1α, UBC, and SAMDC. The results further validated the reliability of stable reference genes and also highlighted the importance of selecting suitable internal controls for L. cubeba. These reference genes will be of great importance for transcript normalization in future gene expression studies on L. cubeba.

Usual normalization strategies for gene expression studies impair the detection and analysis of circadian patterns.

PubMed

Figueredo, Diego de Siqueira; Barbosa, Mayara Rodrigues; Coimbra, Daniel Gomes; Dos Santos, José Luiz Araújo; Costa, Ellyda Fernanda Lopes; Koike, Bruna Del Vechio; Alexandre Moreira, Magna Suzana; de Andrade, Tiago Gomes

2018-03-01

Recent studies have shown that transcriptomes from different tissues present circadian oscillations. Therefore, the endogenous variation of total RNA should be considered as a potential bias in circadian studies of gene expression. However, normalization strategies generally include the equalization of total RNA concentration between samples prior to cDNA synthesis. Moreover, endogenous housekeeping genes (HKGs) frequently used for data normalization may exhibit circadian variation and distort experimental results if not detected or considered. In this study, we controlled experimental conditions from the amount of initial brain tissue samples through extraction steps, cDNA synthesis, and quantitative real time PCR (qPCR) to demonstrate a circadian oscillation of total RNA concentration. We also identified that the normalization of the RNA's yield affected the rhythmic profiles of different genes, including Per1-2 and Bmal1. Five widely used HKGs (Actb, Eif2a, Gapdh, Hprt1, and B2m) also presented rhythmic variations not detected by geNorm algorithm. In addition, the analysis of exogenous microRNAs (Cel-miR-54 and Cel-miR-39) spiked during RNA extraction suggests that the yield was affected by total RNA concentration, which may impact circadian studies of small RNAs. The results indicate that the approach of tissue normalization without total RNA equalization prior to cDNA synthesis can avoid bias from endogenous broad variations in transcript levels. Also, the circadian analysis of 2 -Cycle threshold (Ct) data, without HKGs, may be an alternative for chronobiological studies under controlled experimental conditions.

Optimal Reference Gene Selection for Expression Studies in Human Reticulocytes.

PubMed

Aggarwal, Anu; Jamwal, Manu; Viswanathan, Ganesh K; Sharma, Prashant; Sachdeva, ManUpdesh S; Bansal, Deepak; Malhotra, Pankaj; Das, Reena

2018-05-01

Reference genes are indispensable for normalizing mRNA levels across samples in real-time quantitative PCR. Their expression levels vary under different experimental conditions and because of several inherent characteristics. Appropriate reference gene selection is thus critical for gene-expression studies. This study aimed at selecting optimal reference genes for gene-expression analysis of reticulocytes and at validating them in hereditary spherocytosis (HS) and β-thalassemia intermedia (βTI) patients. Seven reference genes (PGK1, MPP1, HPRT1, ACTB, GAPDH, RN18S1, and SDHA) were selected because of published reports. Real-time quantitative PCR was performed on reticulocytes in 20 healthy volunteers, 15 HS patients, and 10 βTI patients. Threshold cycle values were compared with fold-change method and RefFinder software. The stable reference genes recommended by RefFinder were validated with SLC4A1 and flow cytometric eosin-5'-maleimide binding assay values in HS patients and HBG2 and high performance liquid chromatography-derived percentage of hemoglobin F in βTI. Comprehensive ranking predicted MPP1 and GAPDH as optimal reference genes for reticulocytes that were not affected in HS and βTI. This was further confirmed on validation with eosin-5'-maleimide results and percentage of hemoglobin F in HS and βTI patients, respectively. Hence, MPP1 and GAPDH are good reference genes for reticulocyte expression studies compared with ACTB and RN18S1, the two most commonly used reference genes. Copyright © 2018 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

L-Dopa decarboxylase (DDC) constitutes an emerging biomarker in predicting patients' survival with stomach adenocarcinomas.

PubMed

Florou, Dimitra; Papadopoulos, Iordanis N; Fragoulis, Emmanuel G; Scorilas, Andreas

2013-02-01

Stomach adenocarcinoma represents a major health problem and is regarded as the second commonest cause of cancer-associated mortality, universally, since it is still difficult to be perceived at a curable stage. Several lines of evidence have pointed out that the expression of L-Dopa decarboxylase (DDC) gene and/or protein becomes distinctively modulated in several human neuroendocrine neoplasms as well as adenocarcinomas. In order to elucidate the clinical role of DDC on primary gastric adenocarcinomas, we determined qualitatively and quantitatively the mRNA levels of the gene with regular PCR and real-time PCR by using the comparative threshold cycle method, correspondingly, and detected the expression of DDC protein by immunoblotting in cancerous and normal stomach tissue specimens. A statistically significant association was disclosed between DDC expression and gastric intestinal histotype as well as tumor localization at the distal third part of the stomach (p = 0.025 and p = 0.029, respectively). Univariate and multivariate analyses highlighted the powerful prognostic importance of DDC in relation to disease-free survival and overall survival of gastric cancer patients. According to Kaplan-Meier curves, the relative risk of relapse was found to be decreased in DDC-positive (p = 0.031) patients who, also, exhibited higher overall survival rates (p = 0.016) than those with DDC-negative tumors. This work is the first to shed light on the potential clinical usefulness of DDC, as an efficient tumor biomarker in gastric cancer. The provided evidence underlines the propitious predictive value of DDC expression in the survival of stomach adenocarcinoma patients.

Chronic deficit in the expression of voltage-gated potassium channel Kv3.4 subunit in the hippocampus of pilocarpine-treated epileptic rats

PubMed Central

Pacheco Otalora, Luis F.; Skinner, Frank; Oliveira, Mauro S.; Dotson, Bianca Farrel; Arshadmansab, Massoud F.; Pandari, Tarun; Garcia, Ileana; Robles, Leslie; Rosas, Gerardo; Mello, Carlos F.; Ermolinsky, Boris S.; Garrido-Sanabria, Emilio R.

2010-01-01

Voltage gated K+ channels (Kv) are a highly diverse group of channels critical in determining neuronal excitability. Deficits of Kv channel subunit expression and function have been implicated in the pathogenesis of epilepsy. In this study, we investigate whether the expression of the specific subunit Kv3.4 is affected during epileptogenesis following pilocarpine-induced status epilepticus. For this purpose, we used immunohistochemistry, Western blotting assays and comparative analysis of gene expression using TaqMan-based probes and delta-delta cycle threshold (Δ ΔCT) method of quantitative real-time polymerase chain reaction (qPCR) technique in samples obtained from age-matched control and epileptic rats. A marked down-regulation of Kv3.4 immunoreactivity was detected in the stratum lucidum and hilus of dentate gyrus in areas corresponding to the mossy fiber system of chronically epileptic rats. Correspondingly, a 20% reduction of Kv3.4 protein levels was detected in the hippocampus of chronic epileptic rats. Real-time quantitative PCR analysis of gene expression revealed that a significant 33% reduction of transcripts for Kv3.4 (gene Kcnc4) occurred after 1 month of pilocarpine-induced status epilepticus and persisted during the chronic phase of the model. These data indicate a reduced expression of Kv3.4 channels at protein and transcript levels in the epileptic hippocampus. Down-regulation of Kv3.4 in mossy fibers may contribute to enhanced presynaptic excitability leading to recurrent seizures in the pilocarpine model of temporal lobe epilepsy. PMID:20971086

Influence of phytogenic feed additive on Lawsonia intracellularis infection in pigs.

PubMed

Draskovic, Vladimir; Bosnjak-Neumuller, Jasna; Vasiljevic, Marko; Petrujkic, Branko; Aleksic, Nevenka; Kukolj, Vladimir; Stanimirovic, Zoran

2018-03-01

Lawsonia intracellularis is known to cause proliferative enteropathy (PE), one of the economically most important swine diseases with global distribution. Not unlike other enteric diseases, PE is a frequent indication for antibiotic therapy. However, their unjustified use leads to an emerging problem - antimicrobial resistance. Thus, the aim of this research was to assess if a phytogenic additive may replace antibiotics in the control of PE in 144 weaned piglets (72 treated and 72 controls) naturally infected with L. intracellularis. The quantity of L. intracellularis faecal shedding was monitored by real-time polymerase chain reaction (PCR) assay in faecal samples on day 0, 14 and 28, whilst the level of the ileum damage was determined by immunohistochemistry (IHC) assay performed on gut sections. Real-time PCR assay revealed that cycle-threshold (Ct) values in the treatment group increased significantly over time and were higher than in the control. These results indicate that the use of the phytogenic additive decreases the faecal excretion of L. intracellularis both throughout the experiment and in comparison to the control. The expression of the L. intracellularis antigen in IHC assay was lower in treated animals, implying that the additive leads to the decrease in the pathogen quantity in the ileum. Significantly higher feed conversion ratio was recorded in the treatment group. The results indicate that the phytogenic additive may be beneficial in the control of PE, but additional research is necessary to assess its use in various pig categories and define the optimum concentrations. Copyright © 2018 Elsevier B.V. All rights reserved.

Respiratory Viral Detections During Symptomatic and Asymptomatic Periods in Young Andean Children

PubMed Central

Howard, Leigh M.; Johnson, Monika; Williams, John V.; Zhu, Yuwei; Gil, Ana I.; Edwards, Kathryn M.; Griffin, Marie R.; Lanata, Claudio F.; Grijalva, Carlos G.

2015-01-01

Background Viruses are commonly detected in children with acute respiratory illnesses (ARI) and in asymptomatic children. Longitudinal studies of viral detections during asymptomatic periods surrounding ARI could facilitate interpretation of viral detections but are currently scant. Methods We used reverse transcription-polymerase chain reaction (RT-PCR) to analyze respiratory samples from young Andean children for viruses during asymptomatic periods within 8-120 days of index ARI (cough or fever). We compared viral detections over time within children and explored RT-PCR cycle thresholds (CT) as surrogates for viral loads. Results At least one respiratory virus was detected in 367 (43%) of 859 samples collected during asymptomatic periods, with more frequent detections in periods with rhinorrhea (49%) than those without (34%, p<0.001). Relative to index ARI with human rhinovirus (HRV), adenovirus (AdV), respiratory syncytial virus (RSV), and parainfluenza virus (PIV) detected, the same virus was also detected during 32%, 22%, 10%, and 3% of asymptomatic periods, respectively. RSV was only detected 8-30 days after index RSV ARI, whereas HRV and AdV were detected throughout asymptomatic periods. Human metapneumovirus (MPV) and influenza were rarely detected during asymptomatic periods (<3%). No significant differences were observed in the CT for HRV or AdV during asymptomatic periods relative to ARI. For RSV, CT were significantly lower during ARI relative to the asymptomatic period (p=0.03). Conclusions These findings indicate that influenza, MPV, PIV, and RSV detections in children with ARI usually indicate a causal relationship. When HRV or AdV is detected during ARI, the causal relationship is less certain. PMID:26121205

Analysis of Diagnostic Findings From the European Mobile Laboratory in Guéckédou, Guinea, March 2014 Through March 2015.

PubMed

Kerber, Romy; Krumkamp, Ralf; Diallo, Boubacar; Jaeger, Anna; Rudolf, Martin; Lanini, Simone; Bore, Joseph Akoi; Koundouno, Fara Raymond; Becker-Ziaja, Beate; Fleischmann, Erna; Stoecker, Kilian; Meschi, Silvia; Mély, Stéphane; Newman, Edmund N C; Carletti, Fabrizio; Portmann, Jasmine; Korva, Misa; Wolff, Svenja; Molkenthin, Peter; Kis, Zoltan; Kelterbaum, Anne; Bocquin, Anne; Strecker, Thomas; Fizet, Alexandra; Castilletti, Concetta; Schudt, Gordian; Ottowell, Lisa; Kurth, Andreas; Atkinson, Barry; Badusche, Marlis; Cannas, Angela; Pallasch, Elisa; Bosworth, Andrew; Yue, Constanze; Pályi, Bernadett; Ellerbrok, Heinz; Kohl, Claudia; Oestereich, Lisa; Logue, Christopher H; Lüdtke, Anja; Richter, Martin; Ngabo, Didier; Borremans, Benny; Becker, Dirk; Gryseels, Sophie; Abdellati, Saïd; Vermoesen, Tine; Kuisma, Eeva; Kraus, Annette; Liedigk, Britta; Maes, Piet; Thom, Ruth; Duraffour, Sophie; Diederich, Sandra; Hinzmann, Julia; Afrough, Babak; Repits, Johanna; Mertens, Marc; Vitoriano, Inês; Bah, Amadou; Sachse, Andreas; Boettcher, Jan Peter; Wurr, Stephanie; Bockholt, Sabrina; Nitsche, Andreas; Županc, Tatjana Avšič; Strasser, Marc; Ippolito, Giuseppe; Becker, Stephan; Raoul, Herve; Carroll, Miles W; De Clerck, Hilde; Van Herp, Michel; Sprecher, Armand; Koivogui, Lamine; Magassouba, N'Faly; Keïta, Sakoba; Drury, Patrick; Gurry, Cèline; Formenty, Pierre; May, Jürgen; Gabriel, Martin; Wölfel, Roman; Günther, Stephan; Di Caro, Antonino

2016-10-15

 A unit of the European Mobile Laboratory (EMLab) consortium was deployed to the Ebola virus disease (EVD) treatment unit in Guéckédou, Guinea, from March 2014 through March 2015.  The unit diagnosed EVD and malaria, using the RealStar Filovirus Screen reverse transcription-polymerase chain reaction (RT-PCR) kit and a malaria rapid diagnostic test, respectively.  The cleaned EMLab database comprised 4719 samples from 2741 cases of suspected EVD from Guinea. EVD was diagnosed in 1231 of 2178 hospitalized patients (57%) and in 281 of 563 who died in the community (50%). Children aged <15 years had the highest proportion of Ebola virus-malaria parasite coinfections. The case-fatality ratio was high in patients aged <5 years (80%) and those aged >74 years (90%) and low in patients aged 10-19 years (40%). On admission, RT-PCR analysis of blood specimens from patients who died in the hospital yielded a lower median cycle threshold (Ct) than analysis of blood specimens from survivors (18.1 vs 23.2). Individuals who died in the community had a median Ct of 21.5 for throat swabs. Multivariate logistic regression on 1047 data sets revealed that low Ct values, ages of <5 and ≥45 years, and, among children aged 5-14 years, malaria parasite coinfection were independent determinants of a poor EVD outcome.  Virus load, age, and malaria parasite coinfection play a role in the outcome of EVD. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America.

Analysis of Diagnostic Findings From the European Mobile Laboratory in Guéckédou, Guinea, March 2014 Through March 2015

PubMed Central

Kerber, Romy; Krumkamp, Ralf; Diallo, Boubacar; Jaeger, Anna; Rudolf, Martin; Lanini, Simone; Bore, Joseph Akoi; Koundouno, Fara Raymond; Becker-Ziaja, Beate; Fleischmann, Erna; Stoecker, Kilian; Meschi, Silvia; Mély, Stéphane; Newman, Edmund N. C.; Carletti, Fabrizio; Portmann, Jasmine; Korva, Misa; Wolff, Svenja; Molkenthin, Peter; Kis, Zoltan; Kelterbaum, Anne; Bocquin, Anne; Strecker, Thomas; Fizet, Alexandra; Castilletti, Concetta; Schudt, Gordian; Ottowell, Lisa; Kurth, Andreas; Atkinson, Barry; Badusche, Marlis; Cannas, Angela; Pallasch, Elisa; Bosworth, Andrew; Yue, Constanze; Pályi, Bernadett; Ellerbrok, Heinz; Kohl, Claudia; Oestereich, Lisa; Logue, Christopher H.; Lüdtke, Anja; Richter, Martin; Ngabo, Didier; Borremans, Benny; Becker, Dirk; Gryseels, Sophie; Abdellati, Saïd; Vermoesen, Tine; Kuisma, Eeva; Kraus, Annette; Liedigk, Britta; Maes, Piet; Thom, Ruth; Duraffour, Sophie; Diederich, Sandra; Hinzmann, Julia; Afrough, Babak; Repits, Johanna; Mertens, Marc; Vitoriano, Inês; Bah, Amadou; Sachse, Andreas; Boettcher, Jan Peter; Wurr, Stephanie; Bockholt, Sabrina; Nitsche, Andreas; Županc, Tatjana Avšič; Strasser, Marc; Ippolito, Giuseppe; Becker, Stephan; Raoul, Herve; Carroll, Miles W.; De Clerck, Hilde; Van Herp, Michel; Sprecher, Armand; Koivogui, Lamine; Magassouba, N'Faly; Keïta, Sakoba; Drury, Patrick; Gurry, Cèline; Formenty, Pierre; May, Jürgen; Gabriel, Martin; Wölfel, Roman; Günther, Stephan; Di Caro, Antonino

2016-01-01

Background. A unit of the European Mobile Laboratory (EMLab) consortium was deployed to the Ebola virus disease (EVD) treatment unit in Guéckédou, Guinea, from March 2014 through March 2015. Methods. The unit diagnosed EVD and malaria, using the RealStar Filovirus Screen reverse transcription–polymerase chain reaction (RT-PCR) kit and a malaria rapid diagnostic test, respectively. Results. The cleaned EMLab database comprised 4719 samples from 2741 cases of suspected EVD from Guinea. EVD was diagnosed in 1231 of 2178 hospitalized patients (57%) and in 281 of 563 who died in the community (50%). Children aged <15 years had the highest proportion of Ebola virus–malaria parasite coinfections. The case-fatality ratio was high in patients aged <5 years (80%) and those aged >74 years (90%) and low in patients aged 10–19 years (40%). On admission, RT-PCR analysis of blood specimens from patients who died in the hospital yielded a lower median cycle threshold (Ct) than analysis of blood specimens from survivors (18.1 vs 23.2). Individuals who died in the community had a median Ct of 21.5 for throat swabs. Multivariate logistic regression on 1047 data sets revealed that low Ct values, ages of <5 and ≥45 years, and, among children aged 5–14 years, malaria parasite coinfection were independent determinants of a poor EVD outcome. Conclusions. Virus load, age, and malaria parasite coinfection play a role in the outcome of EVD. PMID:27638946

Tropical Cyclone Diurnal Cycle as Observed by TRMM

NASA Technical Reports Server (NTRS)

Leppert, Kenneth D., II; Cecil, D. J.

2015-01-01

Using infrared satellite data, previous work has shown a consistent diurnal cycle in the pattern of cold cloud tops around mature tropical cyclones. In particular, an increase in the coverage by cold cloud tops often occurs in the inner core of the storm around the time of sunset and subsequently propagates outward to several hundred kilometers over the course of the following day. This consistent cycle may have important implications for structure and intensity changes of tropical cyclones and the forecasting of such changes. Because infrared satellite measurements are primarily sensitive to cloud top, the goal of this study is to use passive and active microwave measurements from the Tropical Rainfall Measurement Mission (TRMM) Microwave Imager (TMI) and Precipitation Radar (PR), respectively, to examine and better understand the tropical cyclone diurnal cycle throughout a larger depth of the storm's clouds. The National Hurricane Center's best track dataset was used to extract all PR and TMI pixels within 1000 km of each tropical cyclone that occurred in the Atlantic basin between 1998-2011. Then the data was composited according to radius (100-km bins from 0-1000 km) and local standard time (LST; 3-hr bins). Specifically, PR composites involved finding the percentage of pixels with reflectivity greater than or equal to 20 dBZ at various heights (i.e., 2-14 km in increments of 2 km) as a function of radius and time. The 37- and 85- GHz TMI channels are especially sensitive to scattering by precipitation-sized ice in the mid to upper portions of clouds. Hence, the percentage of 37- and 85-GHz polarization corrected temperatures less than various thresholds were calculated using data from all storms as a function of radius and time. For 37 GHz, thresholds of 260 K, 265 K, 270 K, and 275 K were used, and for 85 GHz, thresholds of 200-270 K in increments of 10 K were utilized. Note that convection forced by the interactions of a tropical cyclone with land (e.g., due to frictional convergence) may disrupt the natural convective cycle of a cyclone. Hence, only data pertaining to storms whose centers were greater than 300 km from land were included in the composites. Early results suggest the presence of a diurnal cycle in the PR composites of all Atlantic basin tropical cyclones from a height of 2-12 km from approximately 0-400 km radius, but the cycle is most apparent above 6 km. At a height of 8 km, there is a peak (minimum) in the percentage of PR pixels greater than or equal to 20 dBZ near 0 (21) LST in the inner core with some indication that this signal propagates outward with time. In contrast, the 37- and 85-GHz composites show little indication of a diurnal cycle at any radii, regardless of the threshold used. Ongoing work with this project will involve sub-setting the composites according to storm intensity to see if the diurnal cycle varies with storm strength. Moderate to strong vertical wind shear often leads to asymmetries in tropical cyclone convection and may disrupt the cyclone's natural diurnal cycle. Therefore, wind shear thresholds will be applied to the composites to determine if the diurnal cycle becomes more apparent in a low shear environment. Finally, other work to be completed will involve developing composites for other tropical cyclone basins, including the East Pacific, Northwest Pacific, South Pacific, and Indian Ocean.

Loss of capacity to recover from acidosis on repeat exercise in chronic fatigue syndrome: a case-control study.

PubMed

Jones, David E J; Hollingsworth, Kieren G; Jakovljevic, Djordje G; Fattakhova, Gulnar; Pairman, Jessie; Blamire, Andrew M; Trenell, Michael I; Newton, Julia L

2012-02-01

Chronic fatigue syndrome (CFS) patients frequently describe difficulties with repeat exercise. Here, we explore muscle bioenergetic function in response to three bouts of exercise. A total of 18 CFS (CDC 1994) patients and 12 sedentary controls underwent assessment of maximal voluntary contraction (MVC), repeat exercise with magnetic resonance spectroscopy and cardio-respiratory fitness test to determine anaerobic threshold. Chronic fatigue syndrome patients undertaking MVC fell into two distinct groups: 8 (45%) showed normal PCr depletion in response to exercise at 35% of MVC (PCr depletion >33%; lower 95% CI for controls); 10 CFS patients had low PCr depletion (generating abnormally low MVC values). The CFS whole group exhibited significantly reduced anaerobic threshold, heart rate, VO(2) , VO(2) peak and peak work compared to controls. Resting muscle pH was similar in controls and both CFS patient groups. However, the CFS group achieving normal PCr depletion values showed increased intramuscular acidosis compared to controls after similar work after each of the three exercise periods with no apparent reduction in acidosis with repeat exercise of the type reported in normal subjects. This CFS group also exhibited significant prolongation (almost 4-fold) of the time taken for pH to recover to baseline. When exercising to comparable levels to normal controls, CFS patients exhibit profound abnormality in bioenergetic function and response to it. Although exercise intervention is the logical treatment for patients showing acidosis, any trial must exclude subjects who do not initiate exercise as they will not benefit. This potentially explains previous mixed results in CFS exercise trials. © 2011 The Authors. European Journal of Clinical Investigation © 2011 Stichting European Society for Clinical Investigation Journal Foundation.

The impact of p53 on the early stage replication of retrovirus.

PubMed

Kinnetz, Michaela; Alghamdi, Faris; Racz, Michael; Hu, Wenwei; Shi, Binshan

2017-08-09

The function of p53 in cancer biology has been studied extensively, but its role in anti-retrovirus infection has been elusive for many years. The restriction of retrovirus early stage replication by p53 was investigated in this study. VSV-G pseudotyped retrovirus with GFP reporter gene was used to infect both HCT116 p53 +/+ cells and its isogenic p53 knockout HCT116 p53 -/- cells. The infection was detected by flow cytometry. Reverse transcription products were quantified by real time PCR. Mutation analysis was performed after 1-LTR cycle and 2-LTR cycle DNA were amplified and PCR products were sequenced. Transcription and translation of cyclin-dependent kinase inhibitor 1 (p21 Cip1 ) and SAM domain and HD domain-containing protein 1 (SAMHD1) were analyzed by TaqMan PCR and Western blot experiments. siRNA experiment was applied to study the role of p53 downstream gene p21 Cip1 in the restriction of retrovirus infection. It was found that the block of retrovirus infection in non-cycling cells was significantly attenuated in HCT116 p53 -/- cells when compared to HCT116 p53 +/+ cells. It was found that both late reverse transcription products and viral 2-LTR cycle DNA were significantly increased in infected non-cycling HCT116 p53 -/- cells. Furthermore, the mutation frequency detected in 1-LTR DNA from HCT116 p53 +/+ cells were significantly decreased in comparison to HCT116 p53 -/- cells. A higher number of insertion and deletion mutations were detected in the joint region of 2-LTR cycle DNA in infected p53 +/+ cells. Cell cycle analysis showed retrovirus infection promoted host cell replication. Higher levels of mRNA and protein of p21 Cip1 were found in HCT116 p53 +/+ cells in comparison to the HCT116 p53 -/- cells. Furthermore, knockdown of p21 Cip1 in non-cycling HCT116 p53 +/+ cells significantly increased the infection. The results of this study showed that p53 is an important restriction factor that interferes with retrovirus infection in its early stage of replication. Our results suggested that p53 mediates the inhibition of retrovirus infection in non-cycling cells through it downstream gene p21 Cip1 , and p53 also functions to influence formation of 1-LTR cycle and 2-LTR cycle DNA.

Effects of Temperature on the Histotripsy Intrinsic Threshold for Cavitation.

PubMed

Vlaisavljevich, Eli; Xu, Zhen; Maxwell, Adam; Mancia, Lauren; Zhang, Xi; Lin, Kuang-Wei; Duryea, Alexander; Sukovich, Jonathan; Hall, Tim; Johnsen, Eric; Cain, Charles

2016-05-10

Histotripsy is an ultrasound ablation method that depends on the initiation of a dense cavitation bubble cloud to fractionate soft tissue. Previous work has demonstrated that a cavitation cloud can be formed by a single acoustic pulse with one high amplitude negative cycle, when the negative pressure amplitude exceeds a threshold intrinsic to the medium. The intrinsic thresholds in soft tissues and tissue phantoms that are water-based are similar to the intrinsic threshold of water over an experimentally verified frequency range of 0.3-3 MHz. Previous work studying the histotripsy intrinsic threshold has been limited to experiments performed at room temperature (~20°C). In this study, we investigate the effects of temperature on the histotripsy intrinsic threshold in water, which is essential to accurately predict the intrinsic thresholds expected over the full range of in vivo therapeutic temperatures. Based on previous work studying the histotripsy intrinsic threshold and classical nucleation theory, we hypothesize that the intrinsic threshold will decrease with increasing temperature. To test this hypothesis, the intrinsic threshold in water was investigated both experimentally and theoretically. The probability of generating cavitation bubbles was measured by applying a single pulse with one high amplitude negative cycle at 1 MHz to distilled, degassed water at temperatures ranging from 10°C-90°C. Cavitation was detected and characterized by passive cavitation detection and high-speed photography, from which the probability of cavitation was measured vs. pressure amplitude. The results indicate that the intrinsic threshold (the negative pressure at which the cavitation probability=0.5) significantly decreases with increasing temperature, showing a nearly linear decreasing trend from 29.8±0.4 MPa at 10˚C to 14.9±1.4 MPa at 90˚C. Overall, the results of this study support our hypothesis that the intrinsic threshold is highly dependent upon the temperature of the medium, which may allow for better predictions of cavitation generation at body temperature in vivo and at the elevated temperatures commonly seen in high intensity focused ultrasound (HIFU) regimes.

Effects of Temperature on the Histotripsy Intrinsic Threshold for Cavitation

PubMed Central

Vlaisavljevich, Eli; Xu, Zhen; Maxwell, Adam; Mancia, Lauren; Zhang, Xi; Lin, Kuang-Wei; Duryea, Alexander; Sukovich, Jonathan; Hall, Tim; Johnsen, Eric; Cain, Charles

2018-01-01

Histotripsy is an ultrasound ablation method that depends on the initiation of a dense cavitation bubble cloud to fractionate soft tissue. Previous work has demonstrated that a cavitation cloud can be formed by a single acoustic pulse with one high amplitude negative cycle, when the negative pressure amplitude exceeds a threshold intrinsic to the medium. The intrinsic thresholds in soft tissues and tissue phantoms that are water-based are similar to the intrinsic threshold of water over an experimentally verified frequency range of 0.3–3 MHz. Previous work studying the histotripsy intrinsic threshold has been limited to experiments performed at room temperature (~ 20°C). In this study, we investigate the effects of temperature on the histotripsy intrinsic threshold in water, which is essential to accurately predict the intrinsic thresholds expected over the full range of in vivo therapeutic temperatures. Based on previous work studying the histotripsy intrinsic threshold and classical nucleation theory, we hypothesize that the intrinsic threshold will decrease with increasing temperature. To test this hypothesis, the intrinsic threshold in water was investigated both experimentally and theoretically. The probability of generating cavitation bubbles was measured by applying a single pulse with one high amplitude negative cycle at 1 MHz to distilled, degassed water at temperatures ranging from 10°C–90°C. Cavitation was detected and characterized by passive cavitation detection and high-speed photography, from which the probability of cavitation was measured vs. pressure amplitude. The results indicate that the intrinsic threshold (the negative pressure at which the cavitation probability = 0.5) significantly decreases with increasing temperature, showing a nearly linear decreasing trend from 29.8±0.4 MPa at 10°C to 14.9±1.4 MPa at 90°C. Overall, the results of this study support our hypothesis that the intrinsic threshold is highly dependent upon the temperature of the medium, which may allow for better predictions of cavitation generation at body temperature in vivo and at the elevated temperatures commonly seen in high intensity focused ultrasound (HIFU) regimes. PMID:28113706

Life cycle expression analysis of three cell wall degradation-related genes in ethylene-treated grass

USDA-ARS?s Scientific Manuscript database

Ethylene regulates multiple developmental processes during a plant life cycle, but the effect of ethylene on the upregulation of senescence-, stress-, and post-harvest-related genes in forage grasses is poorly understood. In this work, we used quantitative PCR to determine whether ethylene applicat...

Validation of PCR methods for quantitation of genetically modified plants in food.

PubMed

Hübner, P; Waiblinger, H U; Pietsch, K; Brodmann, P

2001-01-01

For enforcement of the recently introduced labeling threshold for genetically modified organisms (GMOs) in food ingredients, quantitative detection methods such as quantitative competitive (QC-PCR) and real-time PCR are applied by official food control laboratories. The experiences of 3 European food control laboratories in validating such methods were compared to describe realistic performance characteristics of quantitative PCR detection methods. The limit of quantitation (LOQ) of GMO-specific, real-time PCR was experimentally determined to reach 30-50 target molecules, which is close to theoretical prediction. Starting PCR with 200 ng genomic plant DNA, the LOQ depends primarily on the genome size of the target plant and ranges from 0.02% for rice to 0.7% for wheat. The precision of quantitative PCR detection methods, expressed as relative standard deviation (RSD), varied from 10 to 30%. Using Bt176 corn containing test samples and applying Bt176 specific QC-PCR, mean values deviated from true values by -7to 18%, with an average of 2+/-10%. Ruggedness of real-time PCR detection methods was assessed in an interlaboratory study analyzing commercial, homogeneous food samples. Roundup Ready soybean DNA contents were determined in the range of 0.3 to 36%, relative to soybean DNA, with RSDs of about 25%. Taking the precision of quantitative PCR detection methods into account, suitable sample plans and sample sizes for GMO analysis are suggested. Because quantitative GMO detection methods measure GMO contents of samples in relation to reference material (calibrants), high priority must be given to international agreements and standardization on certified reference materials.

Multiplex real-time PCR using temperature sensitive primer-supplying hydrogel particles and its application for malaria species identification

PubMed Central

Byoun, Mun Sub; Yoo, Changhoon; Sim, Sang Jun; Lim, Chae Seung; Kim, Sung Woo

2018-01-01

Real-time PCR, also called quantitative PCR (qPCR), has been powerful analytical tool for detection of nucleic acids since it developed. Not only for biological research but also for diagnostic needs, qPCR technique requires capacity to detect multiple genes in recent years. Solid phase PCR (SP-PCR) where one or two directional primers are immobilized on solid substrates could analyze multiplex genetic targets. However, conventional SP-PCR was subjected to restriction of application for lack of PCR efficiency and quantitative resolution. Here we introduce an advanced qPCR with primer-incorporated network (PIN). One directional primers are immobilized in the porous hydrogel particle by covalent bond and the other direction of primers are temporarily immobilized at so-called 'Supplimers'. Supplimers released the primers to aqueous phase in the hydrogel at the thermal cycling of PCR. It induced the high PCR efficiency over 92% with high reliability. It reduced the formation of primer dimers and improved the selectivity of qPCR thanks to the strategy of 'right primers supplied to right place only'. By conducting a six-plex qPCR of 30 minutes, we analyzed DNA samples originated from malaria patients and successfully identified malaria species in a single reaction. PMID:29293604

Total protein of whole saliva as a biomarker of anaerobic threshold.

PubMed

Bortolini, Miguel Junior Sordi; De Agostini, Guilherme Gularte; Reis, Ismair Teodoro; Lamounier, Romeu Paulo Martins Silva; Blumberg, Jeffrey B; Espindola, Foued Salmen

2009-09-01

Saliva provides a convenient and noninvasive matrix for assessing specific physiological parameters, including some biomarkers of exercise. We investigated whether the total protein concentration of whole saliva (TPWS) would reflect the anaerobic threshold during an incremental exercise test. After a warm-up period, 13 nonsmoking men performed a maximum incremental exercise on a cycle ergometer. Blood and stimulated saliva were collected during the test. The TPWS anaerobic threshold (PAT) was determined using the Dmax method. The PAT was correlated with the blood lactate anaerobic threshold (AT; r = .93, p < .05). No significant difference (p = .16) was observed between PAT and AT. Thus, TPWS provides a convenient and noninvasive matrix for determining the anaerobic threshold during incremental exercise tests.

Impact of rapid methicillin-resistant Staphylococcus aureus polymerase chain reaction testing on mortality and cost effectiveness in hospitalized patients with bacteraemia: a decision model.

PubMed

Brown, Jack; Paladino, Joseph A

2010-01-01

Patients hospitalized with Staphylococcus aureus bacteraemia have an unacceptably high mortality rate. Literature available to date has shown that timely selection of the most appropriate antibacterial may reduce mortality. One tool that may help with this selection is a polymerase chain reaction (PCR) assay that distinguishes methicillin (meticillin)-resistant S. aureus (MRSA) from methicillin-susceptible S. aureus (MSSA) in less than 1 hour. To date, no information is available evaluating the impact of this PCR technique on clinical or economic outcomes. To evaluate the effect of a rapid PCR assay on mortality and economics compared with traditional empiric therapy, using a literature-derived model. A literature search for peer-reviewed European (EU) and US publications regarding treatment regimens, outcomes and costs was conducted. Information detailing the rates of infection, as well as the specificity and sensitivity of a rapid PCR assay (Xpert MRSA/SA Blood Culture PCR) were obtained from the peer-reviewed literature. Sensitivity analysis varied the prevalence rate of MRSA from 5% to 80%, while threshold analysis was applied to the cost of the PCR test. Hospital and testing resource consumption were valued with direct medical costs, adjusted to year 2009 values. Adjusted life-years were determined using US and WHO life tables. The cost-effectiveness ratio was defined as the cost per life-year saved. Incremental cost-effectiveness ratios (ICERs) were calculated to determine the additional cost necessary to produce additional effectiveness. All analyses were performed using TreeAge Software (2008). The mean mortality rates were 23% for patients receiving empiric vancomycin subsequently switched to semi-synthetic penicillin (SSP) for MSSA, 36% for patients receiving empiric vancomycin treatment for MRSA, 59% for patients receiving empiric SSP subsequently switched to vancomycin for MRSA and 12% for patients receiving empiric SSP for MSSA. Furthermore, with an MRSA prevalence of 30%, the numbers of patients needed to test in order to save one life were 14 and 16 compared with empiric vancomycin and SSP, respectively. The absolute mortality difference for MRSA prevalence rates of 80% and 5% favoured the PCR testing group at 2% and 10%, respectively, compared with empiric vancomycin and 18% and 1%, respectively, compared with empiric SSP. In the EU, the cost-effectiveness ratios for empiric vancomycin- and SSP-treated patients were Euro 695 and Euro 687 per life-year saved, respectively, compared with Euro 636 per life-year saved for rapid PCR testing. In the US, the cost-effectiveness ratio was $US 898 per life-year saved for empiric vancomycin and $US 820 per life-year saved for rapid PCR testing. ICERs demonstrated dominance of the PCR test in all instances. Threshold analysis revealed that PCR testing would be less costly overall, even at greatly inflated assay prices. Rapid PCR testing for MRSA appears to have the potential to reduce mortality rates while being less costly than empiric therapy in the EU and US, across a wide range of MRSA prevalence rates and PCR test costs.

Late Ebola virus relapse causing meningoencephalitis: a case report.

PubMed

Jacobs, Michael; Rodger, Alison; Bell, David J; Bhagani, Sanjay; Cropley, Ian; Filipe, Ana; Gifford, Robert J; Hopkins, Susan; Hughes, Joseph; Jabeen, Farrah; Johannessen, Ingolfur; Karageorgopoulos, Drosos; Lackenby, Angie; Lester, Rebecca; Liu, Rebecca S N; MacConnachie, Alisdair; Mahungu, Tabitha; Martin, Daniel; Marshall, Neal; Mepham, Stephen; Orton, Richard; Palmarini, Massimo; Patel, Monika; Perry, Colin; Peters, S Erica; Porter, Duncan; Ritchie, David; Ritchie, Neil D; Seaton, R Andrew; Sreenu, Vattipally B; Templeton, Kate; Warren, Simon; Wilkie, Gavin S; Zambon, Maria; Gopal, Robin; Thomson, Emma C

2016-07-30

There are thousands of survivors of the 2014 Ebola outbreak in west Africa. Ebola virus can persist in survivors for months in immune-privileged sites; however, viral relapse causing life-threatening and potentially transmissible disease has not been described. We report a case of late relapse in a patient who had been treated for severe Ebola virus disease with high viral load (peak cycle threshold value 13.2). A 39-year-old female nurse from Scotland, who had assisted the humanitarian effort in Sierra Leone, had received intensive supportive treatment and experimental antiviral therapies, and had been discharged with undetectable Ebola virus RNA in peripheral blood. The patient was readmitted to hospital 9 months after discharge with symptoms of acute meningitis, and was found to have Ebola virus in cerebrospinal fluid (CSF). She was treated with supportive therapy and experimental antiviral drug GS-5734 (Gilead Sciences, San Francisco, Foster City, CA, USA). We monitored Ebola virus RNA in CSF and plasma, and sequenced the viral genome using an unbiased metagenomic approach. On admission, reverse transcriptase PCR identified Ebola virus RNA at a higher level in CSF (cycle threshold value 23.7) than plasma (31.3); infectious virus was only recovered from CSF. The patient developed progressive meningoencephalitis with cranial neuropathies and radiculopathy. Clinical recovery was associated with addition of high-dose corticosteroids during GS-5734 treatment. CSF Ebola virus RNA slowly declined and was undetectable following 14 days of treatment with GS-5734. Sequencing of plasma and CSF viral genome revealed only two non-coding changes compared with the original infecting virus. Our report shows that previously unanticipated, late, severe relapses of Ebola virus can occur, in this case in the CNS. This finding fundamentally redefines what is known about the natural history of Ebola virus infection. Vigilance should be maintained in the thousands of Ebola survivors for cases of relapsed infection. The potential for these cases to initiate new transmission chains is a serious public health concern. Royal Free London NHS Foundation Trust. Copyright © 2016 Elsevier Ltd. All rights reserved.

Cutaneous afferents mediating the cutaneous silent period in the upper limbs: evidences for a role of low-threshold sensory fibres.

PubMed

Serrao, M; Parisi, L; Pierelli, F; Rossi, P

2001-11-01

To evaluate the contribution of the low-threshold afferents to the production of the cutaneous silent period (CSP) in the upper limbs. The CSP was studied in 10 healthy adults and 4 patients with Friedreich's ataxia. The following neurophysiological aspects were studied: (a) relationship between sensory threshold (ST), sensory action potential (SAP) amplitude and CSP parameters; (b) habituation and recovery cycle of the CSP at different stimulus intensities (2xST and 8xST); (c) pattern of responses in distal and proximal muscles at different stimulus intensities (2xST and 8xST). (a) The CSP occurred at low intensities (1xST and 2xST) and increased abruptly between 3.5xST and 4xST (corresponding to the pain threshold). The SAP amplitude was saturated before CSP saturation. In the patients with Friedreich's ataxia, the CSP appeared only at higher stimulus intensities (6xST-8xST). (b) The CSP evoked at 2xST showed a fast habituation and slow recovery cycle whereas the opposite behaviour was found at 8xST. (c) Low-threshold stimuli induced an inhibitory response restricted to the distal muscles. High-intensity stimulation produced an electromyographic suppression, significantly increasing from proximal to distal muscles. Our findings support the notion that low-threshold afferents participate in the production of the CSP in the upper limbs. The different afferents may activate different central neural networks with separate functional significance.

Anaerobic Threshold and Salivary α-amylase during Incremental Exercise.

PubMed

Akizuki, Kazunori; Yazaki, Syouichirou; Echizenya, Yuki; Ohashi, Yukari

2014-07-01

[Purpose] The purpose of this study was to clarify the validity of salivary α-amylase as a method of quickly estimating anaerobic threshold and to establish the relationship between salivary α-amylase and double-product breakpoint in order to create a way to adjust exercise intensity to a safe and effective range. [Subjects and Methods] Eleven healthy young adults performed an incremental exercise test using a cycle ergometer. During the incremental exercise test, oxygen consumption, carbon dioxide production, and ventilatory equivalent were measured using a breath-by-breath gas analyzer. Systolic blood pressure and heart rate were measured to calculate the double product, from which double-product breakpoint was determined. Salivary α-amylase was measured to calculate the salivary threshold. [Results] One-way ANOVA revealed no significant differences among workloads at the anaerobic threshold, double-product breakpoint, and salivary threshold. Significant correlations were found between anaerobic threshold and salivary threshold and between anaerobic threshold and double-product breakpoint. [Conclusion] As a method for estimating anaerobic threshold, salivary threshold was as good as or better than determination of double-product breakpoint because the correlation between anaerobic threshold and salivary threshold was higher than the correlation between anaerobic threshold and double-product breakpoint. Therefore, salivary threshold is a useful index of anaerobic threshold during an incremental workload.

Residence time control on hot moments of net nitrate production and uptake in the hyporheic zone

USGS Publications Warehouse

Briggs, Martin A.; Lautz, Laura K.; Hare, Danielle K.

2014-01-01

moments of net production and uptake, enhancing NO3- production as residence times approach the anaerobic threshold, and changing zones of net NO3- production to uptake as residence times increase past the net sink threshold. The anaerobic and net sink thresholds for beaver-influenced streambed morphology occur at much shorter residence times (1.3 h and 2.3 h, respectively) compared to other documented hyporheic systems, and the net sink threshold compares favorably to the lower boundary of the anaerobic threshold determined for this system with the new oxygen Damkohler number. The consistency of the residence time threshold values of NO3- cycling in this study, despite environmental variability and disparate morphology, indicates that NO3- hot moment dynamics are primarily driven by changes in physical hydrology and associated residence times.

Current advances in molecular methods for detection of nitrite-dependent anaerobic methane oxidizing bacteria in natural environments.

PubMed

Chen, Jing; Dick, Richard; Lin, Jih-Gaw; Gu, Ji-Dong

2016-12-01

Nitrite-dependent anaerobic methane oxidation (n-damo) process uniquely links microbial nitrogen and carbon cycles. Research on n-damo bacteria progresses quickly with experimental evidences through enrichment cultures. Polymerase chain reaction (PCR)-based methods for detecting them in various natural ecosystems and engineered systems play a very important role in the discovery of their distribution, abundance, and biodiversity in the ecosystems. Important characteristics of n-damo enrichments were obtained and their key significance in microbial nitrogen and carbon cycles was investigated. The molecular methods currently used in detecting n-damo bacteria were comprehensively reviewed and discussed for their strengths and limitations in applications with a wide range of samples. The pmoA gene-based PCR primers for n-damo bacterial detection were evaluated and, in particular, several incorrectly stated PCR primer nucleotide sequences in the published papers were also pointed out to allow correct applications of the PCR primers in current and future investigations. Furthermore, this review also offers the future perspectives of n-damo bacteria based on current information and methods available for a better acquisition of new knowledge about this group of bacteria.

Monitoring of ovarian activity by measurement of urinary excretion rates using the Ovarian Monitor, Part IV: the relationship of the pregnanediol glucuronide threshold to basal body temperature and cervical mucus as markers for the beginning of the post-ovulatory infertile period.

PubMed

Blackwell, Leonard F; Vigil, Pilar; Alliende, María Elena; Brown, Simon; Festin, Mario; Cooke, Delwyn G

2016-02-01

Do the basal body temperature (BBT) shift and the cervical mucus markers for the beginning of the post-ovulatory infertile phase (POIP) of a menstrual cycle agree with the corresponding urinary pregnanediol glucuronide (PdG) threshold value? Perfect agreement between the cervical mucus markers and BBT shift and the hormonal definition of the start of post-ovulatory infertility occurred for only 7-17% of the cycles. The PdG threshold of 7.0 µmol/24 h is an objective and accurate marker for the beginning of the POIP. The rise in serum progesterone also produces the BBT shift and changes in cervical mucus which determine the mucus peak. Serum progesterone and urinary PdG are closely correlated when variations in urine volume are taken into account. Individual menstrual cycle profiles of urinary PdG excretion rates for 91 fertile cycles from normally cycling women were analysed to identify the day of the beginning of the POIP. These days were compared with those determined by the day of the BBT shift +2 days, the day of the mucus peak +4 days and the later of these two indicators. The study lasted 3 years. A total of 62 women with normal menstrual cycles were recruited from three centres: Palmerston North, New Zealand; Sydney, Australia and Santiago, Chile. The cycles were displayed individually in a proprietary database program which recorded the PdG excretion rates, the BBT shift day and the cervical mucus peak day. A group of 15 women from a separate Chilean study had PdG urinary data measured as well as their day of ovulation determined by ultrasound. The BBT and cervical mucus markers differed significantly in their identification of the beginning of the POIP when compared with the PdG excretion rate of 7.0 µmol/24 h. The observation that the BBT shift day and the mucus peak day could be identified even though the PdG excretion rates were still at baseline levels in some cycles could lead to an unexpected pregnancy for women using these natural family planning (NFP) indicators. The study consisted only of fertile cycles from women with regular cycles of 20-40 days duration. All the women were intending to avoid a pregnancy during the study, thus the limits of the fertile window were not tested. The NFP signals occurring earlier than the PdG threshold day could lead to an unexpected pregnancy. The signals occurring on the same day or later than the PdG threshold would not lead to unexpected pregnancies, but would require extra abstinence that could lead to non-compliance with the NFP method. A possible improvement in reliability of NFP methods is suggested. This study (project #90905) was funded by the NDP/UNFPA/UNICEF/WHO/World Bank Special Programme of Research, Development and Research Training in Human Reproduction (HRP). D.G.C. currently works for a diagnostic development company, Science Haven Ltd. The other authors have nothing to declare. © The Author 2015. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Novel approach to quantitative polymerase chain reaction using real-time detection: application to the detection of gene amplification in breast cancer.

PubMed

Bièche, I; Olivi, M; Champème, M H; Vidaud, D; Lidereau, R; Vidaud, M

1998-11-23

Gene amplification is a common event in the progression of human cancers, and amplified oncogenes have been shown to have diagnostic, prognostic and therapeutic relevance. A kinetic quantitative polymerase-chain-reaction (PCR) method, based on fluorescent TaqMan methodology and a new instrument (ABI Prism 7700 Sequence Detection System) capable of measuring fluorescence in real-time, was used to quantify gene amplification in tumor DNA. Reactions are characterized by the point during cycling when PCR amplification is still in the exponential phase, rather than the amount of PCR product accumulated after a fixed number of cycles. None of the reaction components is limited during the exponential phase, meaning that values are highly reproducible in reactions starting with the same copy number. This greatly improves the precision of DNA quantification. Moreover, real-time PCR does not require post-PCR sample handling, thereby preventing potential PCR-product carry-over contamination; it possesses a wide dynamic range of quantification and results in much faster and higher sample throughput. The real-time PCR method, was used to develop and validate a simple and rapid assay for the detection and quantification of the 3 most frequently amplified genes (myc, ccndl and erbB2) in breast tumors. Extra copies of myc, ccndl and erbB2 were observed in 10, 23 and 15%, respectively, of 108 breast-tumor DNA; the largest observed numbers of gene copies were 4.6, 18.6 and 15.1, respectively. These results correlated well with those of Southern blotting. The use of this new semi-automated technique will make molecular analysis of human cancers simpler and more reliable, and should find broad applications in clinical and research settings.

Effects of Ultrasound Frequency and Tissue Stiffness on the Histotripsy Intrinsic Threshold for Cavitation

PubMed Central

Vlaisavljevich, Eli; Lin, Kuang-Wei; Maxwell, Adam; Warnez, Matthew; Mancia, Lauren; Singh, Rahul; Putnam, Andrew J.; Fowlkes, Brian; Johnsen, Eric; Cain, Charles; Xu, Zhen

2015-01-01

Histotripsy is an ultrasound ablation method that depends on the initiation of a cavitation bubble cloud to fractionate soft tissue. Previous work has demonstrated a cavitation cloud can be formed by a single pulse with one high amplitude negative cycle, when the negative pressure amplitude directly exceeds a pressure threshold intrinsic to the medium. We hypothesize that the intrinsic threshold in water-based tissues is determined by the properties of the water inside the tissue and changes in tissue stiffness or ultrasound frequency will have a minimal impact on the histotripsy intrinsic threshold. To test this hypothesis, the histotripsy intrinsic threshold was investigated both experimentally and theoretically. The probability of cavitation was measured by subjecting tissue phantoms with adjustable mechanical properties and ex vivo tissues to a histotripsy pulse of 1–2 cycles produced by 345 kHz, 500 kHz, 1.5 MHz, and 3 MHz histotripsy transducers. Cavitation was detected and characterized by passive cavitation detection and high-speed photography, from which the probability of cavitation was measured vs. pressure amplitude. The results demonstrated that the intrinsic threshold (the negative pressure at which probability=0.5) is independent of stiffness for Young’s moduli (E) < 1 MPa with only a small increase (~2–3 MPa) in the intrinsic threshold for tendon (E=380 MPa). Additionally, results for all samples showed only a small increase of ~2–3 MPa when the frequency was increased from 345 kHz to 3 MHz. The intrinsic threshold was measured to be between 24.7–30.6 MPa for all samples and frequencies tested in this study. Overall, the results of this study indicate that the intrinsic threshold to initiate a histotripsy bubble cloud is not significantly impacted by tissue stiffness or ultrasound frequency in hundreds of kHz to MHz range. PMID:25766571

Effects of ultrasound frequency and tissue stiffness on the histotripsy intrinsic threshold for cavitation.

PubMed

Vlaisavljevich, Eli; Lin, Kuang-Wei; Maxwell, Adam; Warnez, Matthew T; Mancia, Lauren; Singh, Rahul; Putnam, Andrew J; Fowlkes, Brian; Johnsen, Eric; Cain, Charles; Xu, Zhen

2015-06-01

Histotripsy is an ultrasound ablation method that depends on the initiation of a cavitation bubble cloud to fractionate soft tissue. Previous work has indicated that a cavitation cloud can be formed by a single pulse with one high-amplitude negative cycle, when the negative pressure amplitude directly exceeds a pressure threshold intrinsic to the medium. We hypothesize that the intrinsic threshold in water-based tissues is determined by the properties of the water inside the tissue, and changes in tissue stiffness or ultrasound frequency will have a minimal impact on the histotripsy intrinsic threshold. To test this hypothesis, the histotripsy intrinsic threshold was investigated both experimentally and theoretically. The probability of cavitation was measured by subjecting tissue phantoms with adjustable mechanical properties and ex vivo tissues to a histotripsy pulse of 1-2 cycles produced by 345-kHz, 500-kHz, 1.5-MHz and 3-MHz histotripsy transducers. Cavitation was detected and characterized by passive cavitation detection and high-speed photography, from which the probability of cavitation was measured versus pressure amplitude. The results revealed that the intrinsic threshold (the negative pressure at which probability = 0.5) is independent of stiffness for Young's moduli (E) <1 MPa, with only a small increase (∼2-3 MPa) in the intrinsic threshold for tendon (E = 380 MPa). Additionally, results for all samples revealed only a small increase of ∼2-3 MPa when the frequency was increased from 345 kHz to 3 MHz. The intrinsic threshold was measured to be between 24.7 and 30.6 MPa for all samples and frequencies tested in this study. Overall, the results of this study indicate that the intrinsic threshold to initiate a histotripsy bubble cloud is not significantly affected by tissue stiffness or ultrasound frequency in the hundreds of kilohertz to megahertz range. Copyright © 2015 World Federation for Ultrasound in Medicine & Biology. Published by Elsevier Inc. All rights reserved.

Aspergillus Polymerase Chain Reaction: Systematic Review of Evidence for Clinical Use in Comparison With Antigen Testing

PubMed Central

White, P. Lewis; Wingard, John R.; Bretagne, Stéphane; Löffler, Jürgen; Patterson, Thomas F.; Slavin, Monica A.; Barnes, Rosemary A.; Pappas, Peter G.; Donnelly, J. Peter

2015-01-01

Background. Aspergillus polymerase chain reaction (PCR) was excluded from the European Organisation for the Research and Treatment of Cancer/Mycoses Study Group (EORTC/MSG) definitions of invasive fungal disease because of limited standardization and validation. The definitions are being revised. Methods. A systematic literature review was performed to identify analytical and clinical information available on inclusion of galactomannan enzyme immunoassay (GM-EIA) (2002) and β-d-glucan (2008), providing a minimal threshold when considering PCR. Categorical parameters and statistical performance were compared. Results. When incorporated, GM-EIA and β-d-glucan sensitivities and specificities for diagnosing invasive aspergillosis were 81.6% and 91.6%, and 76.9% and 89.4%, respectively. Aspergillus PCR has similar sensitivity and specificity (76.8%–88.0% and 75.0%–94.5%, respectively) and comparable utility. Methodological recommendations and commercial PCR assays assist standardization. Although all tests have limitations, currently, PCR is the only test with independent quality control. Conclusions. We propose that there is sufficient evidence that is at least equivalent to that used to include GM-EIA and β-d-glucan testing, and that PCR is now mature enough for inclusion in the EORTC/MSG definitions. PMID:26113653

Aspergillus Polymerase Chain Reaction: Systematic Review of Evidence for Clinical Use in Comparison With Antigen Testing.

PubMed

White, P Lewis; Wingard, John R; Bretagne, Stéphane; Löffler, Jürgen; Patterson, Thomas F; Slavin, Monica A; Barnes, Rosemary A; Pappas, Peter G; Donnelly, J Peter

2015-10-15

Aspergillus polymerase chain reaction (PCR) was excluded from the European Organisation for the Research and Treatment of Cancer/Mycoses Study Group (EORTC/MSG) definitions of invasive fungal disease because of limited standardization and validation. The definitions are being revised. A systematic literature review was performed to identify analytical and clinical information available on inclusion of galactomannan enzyme immunoassay (GM-EIA) (2002) and β-d-glucan (2008), providing a minimal threshold when considering PCR. Categorical parameters and statistical performance were compared. When incorporated, GM-EIA and β-d-glucan sensitivities and specificities for diagnosing invasive aspergillosis were 81.6% and 91.6%, and 76.9% and 89.4%, respectively. Aspergillus PCR has similar sensitivity and specificity (76.8%-88.0% and 75.0%-94.5%, respectively) and comparable utility. Methodological recommendations and commercial PCR assays assist standardization. Although all tests have limitations, currently, PCR is the only test with independent quality control. We propose that there is sufficient evidence that is at least equivalent to that used to include GM-EIA and β-d-glucan testing, and that PCR is now mature enough for inclusion in the EORTC/MSG definitions. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America.

Decreased background parenchymal enhancement of the contralateral breast after two cycles of neoadjuvant chemotherapy is associated with tumor response in HER2-positive breast cancer.

PubMed

You, Chao; Gu, Yajia; Peng, Wen; Li, Jianwei; Shen, Xuxia; Liu, Guangyu; Peng, Weijun

2018-07-01

Background Several recent studies have focused on the association between background parenchymal enhancement (BPE) and tumor response to neoadjuvant chemotherapy (NAC), but early prediction of tumor response based on BPE has yet not been investigated. Purpose To retrospectively investigate whether changes in the BPE of the contralateral breast following NAC could help predict tumor response in early stage HER2-positive breast cancer. Material and Methods Data from 71 patients who were diagnosed with unilateral HER2 positive breast cancer and then underwent NAC with trastuzumab before surgery were analyzed retrospectively. Two experienced radiologists independently categorized the patients' levels of BPE of the contralateral breast into four categories (1 = minimal, 2 = mild, 3 = moderate, 4 = marked) at baseline and after the second cycle of NAC. After undergoing surgery, 34 patients achieved pathologic complete response (pCR) and 37 patients had residual disease (non-pCR). The association between BPE and histopathologic tumor response was analyzed. Result The level of BPE was higher in premenopausal than post-menopausal women both at baseline and after the second cycle of NAC ( P < 0.005). A significant reduction in BPE ( P < 0.001) was observed after the second NAC cycle; however, a more obvious decrease in BPE was identified in premenopausal relative to post-menopausal women ( P = 0.041). No significant association was identified between pCR and baseline BPE ( P = 0.287). However, after the second NAC cycle, decreased BPE was significantly associated with pCR ( P = 0.003). Conclusion For HER2-positive patients, changes in BPE may serve as an additional imaging biomarker of treatment response at an early stage.

Sensitivity of Small RNA-Based Detection of Plant Viruses.

PubMed

Santala, Johanna; Valkonen, Jari P T

2018-01-01

Plants recognize unrelated viruses by the antiviral defense system called RNA interference (RNAi). RNAi processes double-stranded viral RNA into small RNAs (sRNAs) of 21-24 nucleotides, the reassembly of which into longer strands in silico allows virus identification by comparison with the sequences available in databases. The aim of this study was to compare the virus detection sensitivity of sRNA-based virus diagnosis with the established virus species-specific polymerase chain reaction (PCR) approach. Viruses propagated in tobacco plants included three engineered, infectious clones of Potato virus A (PVA), each carrying a different marker gene, and an infectious clone of Potato virus Y (PVY). Total RNA (containing sRNA) was isolated and subjected to reverse-transcription real-time PCR (RT-RT-PCR) and sRNA deep-sequencing at different concentrations. RNA extracted from various crop plants was included in the reactions to normalize RNA concentrations. Targeted detection of selected viruses showed a similar threshold for the sRNA and reverse-transcription quantitative PCR (RT-qPCR) analyses. The detection limit for PVY and PVA by RT-qPCR in this study was 3 and 1.5 fg of viral RNA, respectively, in 50 ng of total RNA per PCR reaction. When knowledge was available about the viruses likely present in the samples, sRNA-based virus detection was 10 times more sensitive than RT-RT-PCR. The advantage of sRNA analysis is the detection of all tested viruses without the need for virus-specific primers or probes.

Expression stability of two housekeeping genes (18S rRNA and G3PDH) during in vitro maturation of follicular oocytes in buffalo (Bubalus bubalis).

PubMed

Aswal, Ajay Pal Singh; Raghav, Sarvesh; De, Sachinandan; Thakur, Manish; Goswami, Surender Lal; Datta, Tirtha Kumar

2008-01-15

The present study was undertaken to evaluate the expression stability of two housekeeping genes (HKGs), 18S rRNA and G3PDH during in vitro maturation (IVM) of oocytes in buffalo, which qualifies their use as internal controls for valid qRT-PCR estimation of other oocyte transcripts. A semi quantitative RT-PCR system was used with optimised qRT-PCR parameters at exponential PCR cycle for evaluation of temporal expression pattern of these genes over 24 h of IVM. 18S rRNA was found more stable in its expression pattern than G3PDH.

[Application of rapid PCR to authenticate medicinal snakes].

PubMed

Chen, Kang; Jiang, Chao; Yuan, Yuan; Huang, Lu-Qi; Li, Man

2014-10-01

To obtained an accurate, rapid and efficient method for authenticate medicinal snakes listed in Chinese Pharmacopoeia (Zaocysd humnades, Bungarus multicinctus, Agkistrodon acutus), a rapid PCR method for authenticate snakes and its adulterants was established based on the classic molecular authentication methods. DNA was extracted by alkaline lysis and the specific primers were amplified by two-steps PCR amplification method. The denatured and annealing temperature and cycle numbers were optimized. When 100 x SYBR Green I was added in the PCR product, strong green fluorescence was visualized under 365 nm UV whereas adulterants without. The whole process can complete in 30-45 minutes. The established method provides the technical support for authentication of the snakes on field.

A PCR Based Microbial Monitoring Alternative Method of Detection and Identification of Microbes Aboard ISS

NASA Technical Reports Server (NTRS)

Khodadad, Christina; Oubre, Cherie; Castro, Victoria; Flint, Stephanie; Ott, Mark; Roman, Monserrate; Wheeler, Ray; Melendez, Orlando

2017-01-01

Previous research has shown that microorganisms and potential human pathogens have been detected on the International Space Station (ISS) with additional introduction of new microflora occurring with every exchange of crew or addition of equipment and supplies. These microbes are readily transferred between crew and subsystems (i.e. ECLSS, environmental control and life support systems). As this can be detrimental to astronaut health and optimal performance of ISS systems, monitoring of systems such as ECLSS to include identification of microbial contaminants could prevent adverse effects on human health and life support systems. Current monitoring on ISS is laborious and utilizes culture based methods followed by sample return to Earth for complete analysis. Future, long-distance spaceflight missions will require real-time monitoring capabilities that enable efficient and rapid assessments of the microbial environment allowing for expedited decisions and more targeted response to cope with anomalies. Polymerase chain reaction (PCR), a molecular microbial monitoring method was chosen and numerous PCR instruments investigated for their potential to perform in microgravity conditions. Using ISS as a test bed for PCR verification in microgravity will enable NASA to assess whether molecular based microbiological sensors may be components of reliable, closed-loop life support and habitation systems in spacecraft, enhancing infrastructure capabilities through increased efficiency, reliability, and time savings by enabling sample analysis on orbit. NASA selected the Water Monitoring Suite as one of the rapid spaceflight hardware demonstration activities utilizing a streamlined process to minimize the time required to fly experimental flight hardware. The RAZOR EX (BioFire Defense, Salt Lake City, UT) system was part of the water monitoring suite and is a commercial off-the-shelf (COTS) real-time PCR instrument designed for field work. The RAZOR EX was originally designed for Department of Defense (DoD) under a small business innovative research (SBIR) grant and is ruggedized, compact and provides a rapid, sample to answer in less than an hour. PCR assays using a fluorescent probe were optimized and spiked with known concentrations of DNA (Pseudomonas aeruginosa) ranging from 0.002 to 20 ng. PCR reagents were lyophilized and configured in customized pouches and tested for flight readiness. Three types of water were used to rehydrate the reagents and demonstrate the fidelity of the PCR reaction in microgravity. Molecular grade deionized water served as a control while filtered and unfiltered ISS potable water served to test for chemical or biological inhibitors. All three types were compared to parallel ground test results. Nine tests were run on ISS (3 of each water type) and the critical threshold cycle (Ct) was compared to parallel ground tests completed at Kennedy Space Center, FL and Johnson Space Center, TX. All concentrations of Pseudomonas aeruginosa DNA were detected. A comparison of the Ct produced in real time PCR indicated similarity between flight and ground samples. There appeared to be no significant difference between flight or ground PCR reactions or between any of the three water types. This testing demonstrated the ability to perform molecular testing during spaceflight operations with similar sensitivity. It will allow for future ground development of molecular protocols and minimize the need for spaceflight testing. Future testing will include development of additional targets including environmental and health related organisms.

The numbers game: quantitative analysis of Neorickettsia sp. propagation through complex life cycle of its digenean host using real-time qPCR.

PubMed

Greiman, Stephen E; Tkach, Vasyl V

2016-07-01

Bacteria of the genus Neorickettsia are obligate intracellular endosymbionts of parasitic flukes (Digenea) and are passed through the entire complex life cycle of the parasite by vertical transmission. Several species of Neorickettsia are known to cause diseases in domestic animals, wildlife, and humans. Quantitative data on the transmission of the bacteria through the digenean life cycle is almost completely lacking. This study quantified for the first time the abundance of Neorickettsia within multiple stages of the life cycle of the digenean Plagiorchis elegans. Snails Lymnaea stagnalis collected from a pond in North Dakota were screened for the presence of digenean cercariae, which were subsequently tested for the presence of Neorickettsia. Three L. stagnalis were found shedding P. elegans cercariae infected with Neorickettsia. These snails were used to initiate three separate laboratory life cycles and obtain all life cycle stages for bacterial quantification. A quantitative real-time PCR assay targeting the GroEL gene was developed to enumerate Neorickettsia sp. within different stages of the digenean life cycle. The number of bacteria significantly increased throughout all stages, from eggs to adults. The two largest increases in number of bacteria occurred during the period from eggs to cercariae and from 6-day metacercariae to 48-h juvenile worms. These two periods seem to be the most important for Neorickettsia propagation through the complex digenean life cycle and maturation in the definitive host.

Reduction of Powerplex(®) Y23 reaction volume for genotyping buccal cell samples on FTA(TM) cards.

PubMed

Raziel, Aliza; Dell'Ariccia-Carmon, Aviva; Zamir, Ashira

2015-01-01

PowerPlex(®) Y23 is a novel kit for Y-STR typing that includes new highly discriminating loci. The Israel DNA Database laboratory has recently adopted it for routine Y-STR analysis. This study examined PCR amplification from 1.2-mm FTA punch in reduced volumes of 5 and 10 μL. Direct amplification and washing of the FTA punches were examined in different PCR cycle numbers. One short robotically performed wash was found to improve the quality and the percent of profiles obtained. The optimal PCR cycle number was determined for 5 and 10 μL reaction volumes. The percent of obtained profiles, color balance, and reproducibility were examined. High-quality profiles were achieved in 90% and 88% of the samples amplified in 5 and 10 μL, respectively, in the first attempt. Volume reduction to 5 μL has a vast economic impact especially for DNA database laboratories. © 2014 American Academy of Forensic Sciences.

Inkjet Printing Based Droplet Generation for Integrated Online Digital Polymerase Chain Reaction.

PubMed

Zhang, Weifei; Li, Nan; Koga, Daisuke; Zhang, Yong; Zeng, Hulie; Nakajima, Hizuru; Lin, Jin-Ming; Uchiyama, Katsumi

2018-04-17

We report on the development of a novel and flexible online digital polymerase chain reaction (dPCR) system. The system was composed of three parts: an inkjet for generating the droplets, a coiled fused-silica capillary for thermal cycling, and a laser-induced fluorescence detector (LIFD) for positive droplet counting. Upon inkjet printing, monodisperse droplets were continuously generated in the oil phase and then introduced into the capillary in the form of a stable dispersion. The droplets containing one or zero molecules of target DNA passed through the helical capillary that was attached to a cylindrical thermal cycler for PCR amplification, resulting in the generation of fluorescence for the DNA-positive droplet. After 36 PCR cycles, the fluorescence signal intensity was detected by laser-induced fluorescence located at the downstream of the capillary, followed by a positive/negative counting. The present system was successfully applied to the absolute quantification of the HPV sequence in Caski cells with dynamic ranges spanning 4 orders of magnitude.

Optimization of ultrahigh-speed multiplex PCR for forensic analysis.

PubMed

Gibson-Daw, Georgiana; Crenshaw, Karin; McCord, Bruce

2018-01-01

In this paper, we demonstrate the design and optimization of an ultrafast PCR amplification technique, used with a seven-locus multiplex that is compatible with conventional capillary electrophoresis systems as well as newer microfluidic chip devices. The procedure involves the use of a high-speed polymerase and a rapid cycling protocol to permit multiplex PCR amplification of forensic short tandem repeat loci in 6.5 min. We describe the selection and optimization of master mix reagents such as enzyme, buffer, MgCl 2 , and dNTPs, as well as primer ratios, total volume, and cycle conditions, in order to get the best profile in the shortest time possible. Sensitivity and reproducibility studies are also described. The amplification process utilizes a small high-speed thermocycler and compact laptop, making it portable and potentially useful for rapid, inexpensive on-site genotyping. The seven loci of the multiplex were taken from conventional STR genotyping kits and selected for their size and lack of overlap. Analysis was performed using conventional capillary electrophoresis and microfluidics with fluorescent detection. Overall, this technique provides a more rapid method for rapid sample screening of suspects and victims. Graphical abstract Rapid amplification of forensic DNA using high speed thermal cycling followed by capillary or microfluidic electrophoresis.

Direct typing of Canine parvovirus (CPV) from infected dog faeces by rapid mini sequencing technique.

PubMed

V, Pavana Jyothi; S, Akila; Selvan, Malini K; Naidu, Hariprasad; Raghunathan, Shwethaa; Kota, Sathish; Sundaram, R C Raja; Rana, Samir Kumar; Raj, G Dhinakar; Srinivasan, V A; Mohana Subramanian, B

2016-12-01

Canine parvovirus (CPV) is a non-enveloped single stranded DNA virus with an icosahedral capsid. Mini-sequencing based CPV typing was developed earlier to detect and differentiate all the CPV types and FPV in a single reaction. This technique was further evaluated in the present study by performing the mini-sequencing directly from fecal samples which avoided tedious virus isolation steps by cell culture system. Fecal swab samples were collected from 84 dogs with enteritis symptoms, suggestive of parvoviral infection from different locations across India. Seventy six of these samples were positive by PCR; the subsequent mini-sequencing reaction typed 74 of them as type 2a virus, and 2 samples as type 2b. Additionally, 25 of the positive samples were typed by cycle sequencing of PCR products. Direct CPV typing from fecal samples using mini-sequencing showed 100% correlation with CPV typing by cycle sequencing. Moreover, CPV typing was achieved by mini-sequencing even with faintly positive PCR amplicons which was not possible by cycle sequencing. Therefore, the mini-sequencing technique is recommended for regular epidemiological follow up of CPV types, since the technique is rapid, highly sensitive and high capacity method for CPV typing. Copyright © 2016. Published by Elsevier B.V.

Inside the lifestyle of the virophage.

PubMed

Desnues, C; Raoult, D

2010-01-01

We sought to better characterize Sputnik, the first isolated virophage, and to analyze its parasitic lifestyle during co-infection with Marseillevirus (a new giant virus) in Acanthamoeba castellanii. A combination of electron microscopy, immunofluorescence microscopy, and real-time PCR was used to characterize the kinetics of the viral replication cycle. RT-PCR was performed to detect RNAs inside the Sputnik virions. Sputnik is a new viral entity carrying an almost complete ready-to-use set of viral RNAs (20 out of 21). Sputnik does not replicate with Marseillevirus but delays its replication cycle. While Marseillevirus is successfully internalized by A. castellanii following co-infections with Mamavirus and Sputnik, it does not initiate a replication cycle. In contrast, both Marseillevirus and Mamavirus can replicate in the amoeba in case of co-infection, but the development of one is exclusive from the other inside a single amoeba cell. This work provides new insight into the Sputnik replication cycle with another giant virus and confirms that Sputnik is a virophage. It shows new dimensions of the interactions existing among giant viruses. Copyright 2010 S. Karger AG, Basel.

Recruitment of single muscle fibers during submaximal cycling exercise.

PubMed

Altenburg, T M; Degens, H; van Mechelen, W; Sargeant, A J; de Haan, A

2007-11-01

In literature, an inconsistency exists in the submaximal exercise intensity at which type II fibers are activated. In the present study, the recruitment of type I and II fibers was investigated from the very beginning and throughout a 45-min cycle exercise at 75% of the maximal oxygen uptake, which corresponded to 38% of the maximal dynamic muscle force. Biopsies of the vastus lateralis muscle were taken from six subjects at rest and during the exercise, two at each time point. From the first biopsy single fibers were isolated and characterized as type I and II, and phosphocreatine-to-creatine (PCr/Cr) ratios and periodic acid-Schiff (PAS) stain intensities were measured. Cross sections were cut from the second biopsy, individual fibers were characterized as type I and II, and PAS stain intensities were measured. A decline in PCr/Cr ratio and in PAS stain intensity was used as indication of fiber recruitment. Within 1 min of exercise both type I and, although to a lesser extent, type II fibers were recruited. Furthermore, the PCr/Cr ratio revealed that the same proportion of fibers was recruited during the whole 45 min of exercise, indicating a rather constant recruitment. The PAS staining, however, proved inadequate to fully demonstrate fiber recruitment even after 45 min of exercise. We conclude that during cycling exercise a greater proportion of type II fibers is recruited than previously reported for isometric contractions, probably because of the dynamic character of the exercise. Furthermore, the PCr/Cr ratio method is more sensitive in determining fiber activation than the PAS stain intensity method.

Endometrial development and function in experimentally induced luteal phase deficiency.

PubMed

Usadi, Rebecca S; Groll, Jeremy M; Lessey, Bruce A; Lininger, Ruth A; Zaino, Richard J; Fritz, Marc A; Young, Steven L

2008-10-01

It is generally assumed that delayed endometrial development observed in luteal phase deficiency (LPD) is the result of abnormally low progesterone (P) levels. This hypothesis has never been tested by direct experiment. Our objective was to evaluate the effects of P concentrations on human endometrium. A randomized trial was conducted at an academic medical center. Twenty-nine healthy, ovulatory 18- to 35-yr-old women participated. Endometrial samples were obtained from women in natural cycles and two groups of experimentally modeled cycles. Women undergoing modeled cycles were treated with GnRH agonist and a fixed physiological dose of transdermal estradiol, followed by randomization to 10 or 40 mg daily im P administration to achieve either normal circulating luteal P or 4-fold lower P concentrations, the latter representing an experimental model of LPD. Tissue specimens, obtained after 10 days of P exposure, were analyzed by histological dating, immunohistochemistry, immunoblot, and real-time quantitative RT-PCR (qRT-PCR). Histological dating of endometrium, immunohistochemistry for endometrial integrins, and qRT-PCR analysis for nine putative functional markers showed no differences between the three groups. Preliminary data from Western analysis suggest that some proteins may be affected by low serum P concentrations. Histological endometrial dating does not reflect circulating P concentrations and cannot serve as a reliable bioassay of the quality of luteal function. Assessment of selected functional markers by either immunohistochemistry or qRT-PCR is similarly insensitive to decreased circulating P. Preliminary evidence suggests that abnormally low luteal phase serum P concentrations may have important functional consequences not otherwise detected.

Masking potency and whiteness of noise at various noise check sizes.

PubMed

Kukkonen, H; Rovamo, J; Näsänen, R

1995-02-01

The masking effect of spatial noise can be increased by increasing either the rms contrast or check size of noise. In this study, the authors investigated the largest noise check size that still mimics the effect of white noise in grating detection and how it depends on the bandwidth and spatial frequency of a grating. The authors measured contrast energy thresholds, E, for vertical cosine gratings at various spatial frequencies and bandwidths. Gratings were embedded in two-dimensional spatial noise. The side length of the square noise checks was varied in the experiments. The spectral density, N(0,0), of white spatial noise at zero frequency was calculated by multiplying the noise check area by the rms contrast of noise squared. The physical signal-to-noise ratio at threshold [E/N(0,0)]0.5 was initially constant but then started to decrease. The largest noise check that still produced a constant physical signal-to-noise ratio at threshold was directly proportional to the spatial frequency. When expressed as a fraction of grating cycle, the largest noise check size depended only on stimulus bandwidth. The smallest number of noise checks per grating cycle needed to mimic the effect of white noise decreased from 4.2 to 2.6 when the number of grating cycles increased from 1 to 64. Spatial noise can be regarded as white in grating detection if there are at least four square noise checks per grating cycle at all spatial frequencies.

Centrifugal unbalance detection system

DOEpatents

Cordaro, Joseph V.; Reeves, George; Mets, Michael

2002-01-01

A system consisting of an accelerometer sensor attached to a centrifuge enclosure for sensing vibrations and outputting a signal in the form of a sine wave with an amplitude and frequency that is passed through a pre-amp to convert it to a voltage signal, a low pass filter for removing extraneous noise, an A/D converter and a processor and algorithm for operating on the signal, whereby the algorithm interprets the amplitude and frequency associated with the signal and once an amplitude threshold has been exceeded the algorithm begins to count cycles during a predetermined time period and if a given number of complete cycles exceeds the frequency threshold during the predetermined time period, the system shuts down the centrifuge.

A TaqMan-PCR protocol for quantification and differentiation of the phytopathogenic Clavibacter michiganensis subspecies.

PubMed

Bach, H-J; Jessen, I; Schloter, M; Munch, J C

2003-01-01

Real-time TaqMan-PCR assays were developed for detection, differentiation and absolute quantification of the pathogenic subspecies of Clavibacter michiganensis (Cm) in one single PCR run. The designed primer pair, targeting intergenic sequences of the rRNA operon (ITS) common in all subspecies, was suitable for the amplification of the expected 223-nt DNA fragments of all subspecies. Closely related bacteria were completely discriminated, except of Rathayibacter iranicus, from which weak PCR product bands appeared on agarose gel after 35 PCR cycles. Sufficient specificity of PCR detection was reached by introduction of the additional subspecies specific probes used in TaqMan-PCR. Only Cm species were detected and there was clear differentiation among the subspecies C. michiganensis sepedonicus (Cms), C. michiganensis michiganensis (Cmm), C. michiganensis nebraskensis (Cmn), C. michiganensis insidiosus (Cmi) and C. michiganensis tessellarius (Cmt). The TaqMan assays were optimized to enable a simultaneous quantification of each subspecies. Validity is shown by comparison with cell counts.

Enhancing the efficiency of polymerase chain reaction using graphene nanoflakes.

PubMed

Abdul Khaliq, R; Kafafy, Raed; Salleh, Hamzah Mohd; Faris, Waleed Fekry

2012-11-16

The effect of the recently developed graphene nanoflakes (GNFs) on the polymerase chain reaction (PCR) has been investigated in this paper. The rationale behind the use of GNFs is their unique physical and thermal properties. Experiments show that GNFs can enhance the thermal conductivity of base fluids and results also revealed that GNFs are a potential enhancer of PCR efficiency; moreover, the PCR enhancements are strongly dependent on GNF concentration. It was found that GNFs yield DNA product equivalent to positive control with up to 65% reduction in the PCR cycles. It was also observed that the PCR yield is dependent on the GNF size, wherein the surface area increases and augments thermal conductivity. Computational fluid dynamics (CFD) simulations were performed to analyze the heat transfer through the PCR tube model in the presence and absence of GNFs. The results suggest that the superior thermal conductivity effect of GNFs may be the main cause of the PCR enhancement.

A comparative study of digital PCR and real-time qPCR for the detection and quantification of HPV mRNA in sentinel lymph nodes of cervical cancer patients.

PubMed

Carow, Katrin; Read, Christina; Häfner, Norman; Runnebaum, Ingo B; Corner, Adam; Dürst, Matthias

2017-10-30

Qualitative analyses showed that the presence of HPV mRNA in sentinel lymph nodes of cervical cancer patients with pN0 status is associated with significantly decreased recurrence free survival. To further address the clinical potential of the strategy and to define prognostic threshold levels it is necessary to use a quantitative assay. Here, we compare two methods of quantification: digital PCR and standard quantitative PCR. Serial dilutions of 5 ng-5 pg RNA (≙ 500-0.5 cells) of the cervical cancer cell line SiHa were prepared in 5 µg RNA of the HPV-negative human keratinocyte cell line HaCaT. Clinical samples consisted of 10 sentinel lymph nodes with varying HPV transcript levels. Reverse transcription of total RNA (5 µg RNA each) was performed in 100 µl and cDNA aliquots were analyzed by qPCR and dPCR. Digital PCR was run in the RainDrop ® Digital PCR system (RainDance Technologies) using a probe-based detection of HPV E6/E7 cDNA PCR products with 11 µl template. qPCR was done using a Rotor Gene Q 5plex HRM (Qiagen) amplifying HPV E6/E7 cDNA in a SYBR Green format with 1 µl template. For the analysis of both, clinical samples and serial dilution samples, dPCR and qPCR showed comparable sensitivity. With regard to reproducibility, both methods differed considerably, especially for low template samples. Here, we found with qPCR a mean variation coefficient of 126% whereas dPCR enabled a significantly lower mean variation coefficient of 40% (p = 0.01). Generally, we saw with dPCR a substantial reduction of subsampling errors, which most likely reflects the large cDNA amounts available for analysis. Compared to real-time PCR, dPCR shows higher reliability. Thus, our HPV mRNA dPCR assay holds promise for the clinical evaluation of occult tumor cells in histologically tumor-free lymph nodes in future studies.

Functional integration of PCR amplification and capillary eletrophoresis in a microfabricated DNA analysis device

DOE Office of Scientific and Technical Information (OSTI.GOV)

Woolley, A.T.; deMello, A.J.; Mathies, R.A.

Microfabricated silicon PCR reactors and glass capillary electrophoresis (CE) chips have been successfully coupled to form an integrated DNA analysis system. This construct combines the rapid thermal cycling capabilities of microfabricated PCR devices (10{degree}C/s heating, 2.5{degree}C/s cooling) with the high-speed (<120 s) DNA separations provided by microfabricated CE chips. The PCR chamber and the CE chip were directly linked through a photolithographically fabricated channel filled with hydroxyethylcellulose sieving matrix. Electrophoretic injection directly from the PCR chamber through the cross injection channel was used as an `electrophoretic valve` to couple the PCR and CE devices on-chip. To demonstrate the functionality ofmore » this system, a 15 min PCR amplification of a {Beta}-globin target cloned in m13 was immediately followed by high-speed CE chip separation in under 120 s, providing a rapid PCR-CE analysis in under 20 min. A rapid assay for genomic Salmonella DNA was performed in under 45 min, demonstrating that challenging amplifications of diagnostically interesting targets can also be performed. Real-time monitoring of PCR target amplification in these integrated PCR-CE devices is also feasible. 33 refs., 6 figs.« less

Development and validation of rt-qpcr for vesicular stomatitis virus detection (Alagoas vesiculovirus).

PubMed

de Oliveira, Anapolino Macedo; Fonseca, Antônio Augusto; Camargos, Marcelo Fernandes; Orzil, Lívia Maria; Laguardia-Nascimento, Mateus; Oliveira, Anna Gabriella Guimarães; Rodrigues, Jacqueline Gomes; Sales, Mariana Lázaro; de Oliveira, Tatiana Flávia Pinheiro; de Melo, Cristiano Barros

2018-07-01

Vesicular stomatitis is an infectious disease that occurs mainly in countries of the Western Hemisphere and affects cattle, swine and horses. The clinical symptoms in cattle and swine are similar to foot-and-mouth disease and include vesicular ulceration of the tongue and mouth. The disease requires a rapid and accurate differential diagnosis, aiming for immediate implementation of control measures. The objective of the present study was to develop and perform validation tests of multiplex RT-qPCR(s) for the detection of RNA from Alagoas vesiculovirus, considering the parameters of sensitivity and analytical specificity, analytical performance (repeatability and reproducibility criteria) and the uncertainty of the measurement. The threshold cycle values obtained in triplicate from each sample were evaluated by considering the variations between days, analysts and equipment in an analysis of variance aimed at determining the variances of repeatability and reproducibility. The results showed that RT-qPCRs had excellent sensitivity and specificity in the detection of RNA of the Alagoas vesiculovirus. The validation parameters showed low coefficients of variation and were equivalent to those found in other validation studies, indicating that the tests presented excellent repeatability and reproducibility. Copyright © 2018 Elsevier B.V. All rights reserved.

Impact of the Addition of Carboplatin and/or Bevacizumab to Neoadjuvant Once-per-Week Paclitaxel Followed by Dose-Dense Doxorubicin and Cyclophosphamide on Pathologic Complete Response Rates in Stage II to III Triple-Negative Breast Cancer: CALGB 40603 (Alliance)

PubMed Central

Sikov, William M.; Berry, Donald A.; Perou, Charles M.; Singh, Baljit; Cirrincione, Constance T.; Tolaney, Sara M.; Kuzma, Charles S.; Pluard, Timothy J.; Somlo, George; Port, Elisa R.; Golshan, Mehra; Bellon, Jennifer R.; Collyar, Deborah; Hahn, Olwen M.; Carey, Lisa A.; Hudis, Clifford A.; Winer, Eric P.

2015-01-01

Purpose One third of patients with triple-negative breast cancer (TNBC) achieve pathologic complete response (pCR) with standard neoadjuvant chemotherapy (NACT). CALGB 40603 (Alliance), a 2 × 2 factorial, open-label, randomized phase II trial, evaluated the impact of adding carboplatin and/or bevacizumab. Patients and Methods Patients (N = 443) with stage II to III TNBC received paclitaxel 80 mg/m2 once per week (wP) for 12 weeks, followed by doxorubicin plus cyclophosphamide once every 2 weeks (ddAC) for four cycles, and were randomly assigned to concurrent carboplatin (area under curve 6) once every 3 weeks for four cycles and/or bevacizumab 10 mg/kg once every 2 weeks for nine cycles. Effects of adding these agents on pCR breast (ypT0/is), pCR breast/axilla (ypT0/isN0), treatment delivery, and toxicities were analyzed. Results Patients assigned to either carboplatin or bevacizumab were less likely to complete wP and ddAC without skipped doses, dose modification, or early discontinuation resulting from toxicity. Grade ≥ 3 neutropenia and thrombocytopenia were more common with carboplatin, as were hypertension, infection, thromboembolic events, bleeding, and postoperative complications with bevacizumab. Employing one-sided P values, addition of either carboplatin (60% v 44%; P = .0018) or bevacizumab (59% v 48%; P = .0089) significantly increased pCR breast, whereas only carboplatin (54% v 41%; P = .0029) significantly raised pCR breast/axilla. More-than-additive interactions between the two agents could not be demonstrated. Conclusion In stage II to III TNBC, addition of either carboplatin or bevacizumab to NACT increased pCR rates, but whether this will improve relapse-free or overall survival is unknown. Given results from recently reported adjuvant trials, further investigation of bevacizumab in this setting is unlikely, but the role of carboplatin could be evaluated in definitive studies, ideally limited to biologically defined patient subsets most likely to benefit from this agent. PMID:25092775

One-Step Multiplex RT-qPCR Assay for the Detection of Peste des petits ruminants virus, Capripoxvirus, Pasteurella multocida and Mycoplasma capricolum subspecies (ssp.) capripneumoniae.

PubMed

Settypalli, Tirumala Bharani Kumar; Lamien, Charles Euloge; Spergser, Joachim; Lelenta, Mamadou; Wade, Abel; Gelaye, Esayas; Loitsch, Angelika; Minoungou, Germaine; Thiaucourt, Francois; Diallo, Adama

2016-01-01

Respiratory infections, although showing common clinical symptoms like pneumonia, are caused by bacterial, viral or parasitic agents. These are often reported in sheep and goats populations and cause huge economic losses to the animal owners in developing countries. Detection of these diseases is routinely done using ELISA or microbiological methods which are being reinforced or replaced by molecular based detection methods including multiplex assays, where detection of different pathogens is carried out in a single reaction. In the present study, a one-step multiplex RT-qPCR assay was developed for simultaneous detection of Capripoxvirus (CaPV), Peste de petits ruminants virus (PPRV), Pasteurella multocida (PM) and Mycoplasma capricolum ssp. capripneumonia (Mccp) in pathological samples collected from small ruminants with respiratory disease symptoms. The test performed efficiently without any cross-amplification. The multiplex PCR efficiency was 98.31%, 95.48%, 102.77% and 91.46% whereas the singleplex efficiency was 93.43%, 98.82%, 102.55% and 92.0% for CaPV, PPRV, PM and Mccp, respectively. The correlation coefficient was greater than 0.99 for all the targets in both multiplex and singleplex. Based on cycle threshold values, intra and inter assay variability, ranged between the limits of 2%-4%, except for lower concentrations of Mccp. The detection limits at 95% confidence interval (CI) were 12, 163, 13 and 23 copies/reaction for CaPV, PPRV, PM and Mccp, respectively. The multiplex assay was able to detect CaPVs from all genotypes, PPRV from the four lineages, PM and Mccp without amplifying the other subspecies of mycoplasmas. The discriminating power of the assay was proven by accurate detection of the targeted pathogen (s) by screening 58 viral and bacterial isolates representing all four targeted pathogens. Furthermore, by screening 81 pathological samples collected from small ruminants showing respiratory disease symptoms, CaPV was detected in 17 samples, PPRV in 45, and PM in six samples. In addition, three samples showed a co-infection of PPRV and PM. Overall, the one-step multiplex RT-qPCR assay developed will be a valuable tool for rapid detection of individual and co-infections of the targeted pathogens with high specificity and sensitivity.

Real-time quantitative polymerase chain reaction analysis of patients with refractory chronic periodontitis.

PubMed

Marconcini, Simone; Covani, Ugo; Barone, Antonio; Vittorio, Orazio; Curcio, Michele; Barbuti, Serena; Scatena, Fabrizio; Felli, Lamberto; Nicolini, Claudio

2011-07-01

Periodontitis is a complex multifactorial disease and is typically polygenic in origin. Genes play a fundamental part in each biologic process forming complex networks of interactions. However, only some genes have a high number of interactions with other genes in the network and may, therefore, be considered to play an important role. In a preliminary bioinformatic analysis, five genes that showed a higher number of interactions were identified and termed leader genes. In the present study, we use real-time quantitative polymerase chain reaction (PCR) technology to evaluate the expression levels of leader genes in the leukocytes of 10 patients with refractory chronic periodontitis and compare the expression levels with those of the same genes in 24 healthy patients. Blood was collected from 24 healthy human subjects and 10 patients with refractory chronic periodontitis and placed into heparinized blood collection tubes by personnel trained in phlebotomy using a sterile technique. Blood leukocyte cells were immediately lysed by using a kit for total RNA purification from human whole blood. Complementary DNA (cDNA) synthesis was obtained from total RNA and then real-time quantitative PCR was performed. PCR efficiencies were calculated with a relative standard curve derived from a five cDNA dilution series in triplicate that gave regression coefficients >0.98 and efficiencies >96%. The standard curves were obtained using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and growth factor receptor binding protein 2 (GRB2), casitas B-lineage lymphoma (CBL), nuclear factor-KB1 (NFKB1), and REL-A (gene for transcription factor p65) gene primers and amplified with 1.6, 8, 40, 200, and 1,000 ng/μL total cDNA. Curves obtained for each sample showed a linear relationship between RNA concentrations and the cycle threshold value of real-time quantitative PCR for all genes. Data were expressed as mean ± SE (SEM). The groups were compared to the analysis of variance. A probability value <0.01 was considered statistically significant. The present study agrees with the preliminary bioinformatics analysis. In our experiments, the association of pathology with the genes was statistically significant for GRB2 and CBL (P <0.01), and it was not statistically significant for REL-A and NFKB1. This article lends support to our preliminary hypothesis that assigned an important role in refractory aggressive periodontitis to leader genes.

Factors affecting the relationship between quantitative polymerase chain reaction (qPCR) and culture-based enumeration of Enterococcus in environmental waters.

PubMed

Raith, M R; Ebentier, D L; Cao, Y; Griffith, J F; Weisberg, S B

2014-03-01

To determine the extent to which discrepancies between qPCR and culture-based results in beach water quality monitoring can be attributed to: (i) within-method variability, (ii) between-method difference within each method class (qPCR or culture) and (iii) between-class difference. We analysed 306 samples using two culture-based (EPA1600 and Enterolert) and two qPCR (Taqman and Scorpion) methods, each in duplicate. Both qPCR methods correlated with EPA1600, but regression analyses indicated approximately 0·8 log10 unit overestimation by qPCR compared to culture methods. Differences between methods within a class were less than half of this and were minimal for between-replicate within a method. Using the 104 Enterococcus per 100 ml management decision threshold, Taqman qPCR indicated the same decisions as EPA1600 for 87% of the samples, but indicated beach posting for unhealthful water when EPA1600 did not for 12% of the samples. After accounting for within-method and within-class variability, 8% of the samples exhibited true between-class discrepancy where both qPCR methods indicated beach posting while both culture methods did not. Measurement target difference (DNA vs growth) accounted for the majority of the qPCR-vs-culture discrepancy, but its influence on monitoring application is outweighed by frequent incorrect posting with culture methods due to incubation time delay. This is the first study to quantify the frequency with which culture-vs-qPCR discrepancies can be attributed to target difference - vs - method variability. © 2013 The Society for Applied Microbiology.

Non-linear responses of glaciated prairie wetlands to climate warming

USGS Publications Warehouse

Johnson, W. Carter; Werner, Brett; Guntenspergen, Glenn R.

2016-01-01

The response of ecosystems to climate warming is likely to include threshold events when small changes in key environmental drivers produce large changes in an ecosystem. Wetlands of the Prairie Pothole Region (PPR) are especially sensitive to climate variability, yet the possibility that functional changes may occur more rapidly with warming than expected has not been examined or modeled. The productivity and biodiversity of these wetlands are strongly controlled by the speed and completeness of a vegetation cover cycle driven by the wet and dry extremes of climate. Two thresholds involving duration and depth of standing water must be exceeded every few decades or so to complete the cycle and to produce highly functional wetlands. Model experiments at 19 weather stations employing incremental warming scenarios determined that wetland function across most of the PPR would be diminished beyond a climate warming of about 1.5–2.0 °C, a critical temperature threshold range identified in other climate change studies.

Factors affecting performance in an ultraendurance triathlon.

PubMed

Laursen, P B; Rhodes, E C

2001-01-01

In the recent past, researchers have found many key physiological variables that correlate highly with endurance performance. These include maximal oxygen uptake (VO2max), anaerobic threshold (AT), economy of motion and the fractional utilisation of oxygen uptake (VO2). However, beyond typical endurance events such as the marathon, termed 'ultraendurance' (i.e. >4 hours), performance becomes harder to predict. The ultraendurance triathlon (UET) is a 3-sport event consisting of a 3.8 km swim and a 180 km cycle, followed by a 42.2 km marathon run. It has been hypothesised that these triathletes ride at approximately their ventilatory threshold (Tvent) during the UET cycling phase. However, laboratory assessments of cycling time to exhaustion at a subject's AT peak at 255 minutes. This suggests that the AT is too great an intensity to be maintained during a UET, and that other factors cause detriments in prolonged performance. Potential defeating factors include the provision of fuels and fluids due to finite gastric emptying rates causing changes in substrate utilisation, as well as fluid and electrolyte imbalances. Thus, an optimum ultraendurance intensity that may be relative to the AT intensity is needed to establish ultraendurance intensity guidelines. This optimal UET intensity could be referred to as the ultraendurance threshold.

Capillary electrophoresis with electrochemiluminescent detection for highly sensitive assay of genetically modified organisms.

PubMed

Guo, Longhua; Yang, Huanghao; Qiu, Bin; Xiao, Xueyang; Xue, Linlin; Kim, Donghwan; Chen, Guonan

2009-12-01

A capillary electrophoresis coupled with electrochemiluminescent detection system (CE-ECL) was developed for the detection of polymerase chain reaction (PCR) amplicons. The ECL luminophore, tris(1,10-phenanthroline) ruthenium(II) (Ru(phen)(3)(2+)), was labeled to the PCR primers before amplification. Ru(phen)(3)(2+) was then introduced to PCR amplicons by PCR amplification. Eventually, the PCR amplicons were separated and detected by the homemade CE-ECL system. The detection of a typical genetically modified organism (GMO), Roundup Ready Soy (RRS), was shown as an example to demonstrate the reliability of the proposed approach. Four pairs of primers were amplified by multiple PCR (MPCR) simultaneously, three of which were targeted on the specific sequence of exogenous genes of RRS, and another was targeted on the endogenous reference gene of soybean. Both the conditions for PCR amplification and CE-ECL separation and detection were investigated in detail. Results showed that, under the optimal conditions, the proposed method can accurately identifying RRS. The corresponding limit of detection (LOD) was below 0.01% with 35 PCR cycles.

Electric stimulation of the tuberomamillary nucleus affects epileptic activity and sleep-wake cycle in a genetic absence epilepsy model.

PubMed

Blik, Vitaliya

2015-01-01

Deep brain stimulation (DBS) is a promising approach for epilepsy treatment, but the optimal targets and parameters of stimulation are yet to be investigated. Tuberomamillary nucleus (TMN) is involved in EEG desynchronization-one of the proposed mechanisms for DBS action. We studied whether TMN stimulation could interfere with epileptic spike-wave discharges (SWDs) in WAG/Rij rats with inherited absence epilepsy and whether such stimulation would affect sleep-wake cycle. EEG and video registration were used to determine SWD occurrence and stages of sleep and wake during three-hours recording sessions. Stimulation (100Hz) was applied in two modes: closed-loop (with previously determined interruption threshold intensity) or open-loop mode (with 50% or 70% threshold intensity). Closed-loop stimulation successfully interrupted SWDs but elevated their number by 148 ± 54% compared to baseline. It was accompanied by increase in number of episodes but not total duration of both active and passive wakefulness. Open-loop stimulation with amplitude 50% threshold did not change measured parameters, though 70% threshold stimulation reduced SWDs number by 40 ± 9%, significantly raised the amount of active wakefulness and decreased the amount of both slow-wave and rapid eye movement sleep. These results suggest that the TMN is unfavorable as a target for DBS as its stimulation may cause alterations in sleep-wake cycle. A careful choosing of parameters and control of sleep-wake activity is necessary when applying DBS in epilepsy. Copyright © 2014 Elsevier B.V. All rights reserved.

Tumour size is the only predictive factor of distant recurrence after pathological complete response to neoadjuvant chemotherapy in patients with large operable or locally advanced breast cancers: a sub-study of EORTC 10994/BIG 1-00 phase III trial.

PubMed

Fei, F; Messina, C; Slaets, L; Chakiba, C; Cameron, D; Bogaerts, J; Bonnefoi, H

2015-02-01

Although achieving a pathological complete response (pCR) after neoadjuvant chemotherapy (NACT) in breast cancer predicts a better outcome, some patients still relapse. The objectives of this study were to describe the types of events in this group of patients and to identify predictive factors for relapse. Patients with large operable or locally advanced breast cancers (T4d tumours were excluded) were randomised to receive either six cycles of anthracycline-based chemotherapy or three cycles of docetaxel followed by three cycles of eprirubicin/docetaxel. pCR was defined as no evidence of residual invasive cancer (or very few scattered tumour cells) in the primary tumour and axillary lymph nodes at surgery. Two Cox regression analyses were performed to identify predictive factors of relapse: one for recurrence-free interval (RFI) and one for distant recurrence-free interval (DRFI). Out of 283 eligible patients who achieved a pCR, 40 (14.1%) and 28 (9.9%) presented an event of interest for the RFI and DRFI analyses, respectively. Five-year RFI, DRFI and overall survival (OS) were 85.3% (95% confidence interval (CI), 80.1-89.3), 89.6% (95% CI, 85.0-92.9) and 91.9% (95% CI, 87.2-94.9), respectively. No predictors for RFI after pCR were identified. For DRFI, tumour size was the only predictor: Hazard ratio (HR) T3 versus T1-2=3.62 (95% CI, 1.66-7.89); HR T4 versus T1-2: HR, 2.80 (95% CI, 0.62-12.64) p=0.0048. In this study, clinical tumour size emerged as the only predictor for DRFI after pCR, with T3 and T4 tumours having an increased risk for distant recurrence compared to T1-2 tumours. Copyright © 2014 Elsevier Ltd. All rights reserved.

Characteristics and Outcomes of Pediatric Patients With Ebola Virus Disease Admitted to Treatment Units in Liberia and Sierra Leone: A Retrospective Cohort Study.

PubMed

Smit, Michael A; Michelow, Ian C; Glavis-Bloom, Justin; Wolfman, Vanessa; Levine, Adam C

2017-02-01

The clinical and virologic characteristics of Ebola virus disease (EVD) in children have not been thoroughly documented. Consecutive children aged <18 years with real-time polymerase chain reaction (RT-PCR)-confirmed EVD were enrolled retrospectively in 5 Ebola treatment units in Liberia and Sierra Leone in 2014/2015. Data collection and medical management were based on standardized International Medical Corps protocols. We performed descriptive statistics, multivariate logistic regression, and Kaplan-Meier survival analyses. Of 122 children enrolled, the median age was 7 years and one-third were aged <5 years. The female-to-male ratio was 1.3. The most common clinical features at triage and during hospitalization were fever, weakness, anorexia, and diarrhea, although 21% of patients were initially afebrile and 6 patients remained afebrile. Bleeding was rare at presentation (5%) and manifested subsequently in fewer than 50%. The overall case fatality rate was 57%. Factors associated with death in bivariate analyses were age <5 years, bleeding at any time during hospitalization, and high viral load. After adjustment with logistic regression modeling, the odds of death were 14.8-fold higher if patients were aged <5 years, 5-fold higher if the patient had any evidence of bleeding, and 5.2-fold higher if EVD RT-PCR cycle threshold value was ≤20. Plasmodium parasitemia had no impact on EVD outcomes. Age <5 years, bleeding, and high viral loads were poor prognostic indicators of children with EVD. Research to understand mechanisms of these risk factors and the impact of dehydration and electrolyte imbalance will improve health outcomes. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America.

Lessons from a large norovirus outbreak: impact of viral load, patient age and ward design on duration of symptoms and shedding and likelihood of transmission.

PubMed

Partridge, D G; Evans, C M; Raza, M; Kudesia, G; Parsons, H K

2012-05-01

Hospital norovirus outbreaks cause significant financial and operational disruption which should be minimised by optimal handling of affected areas and use of isolation facilities. To identify factors associated with increased duration of symptoms and viral excretion and increased probability of transmission. Retrospective observational study of a large norovirus outbreak at a UK teaching hospital in the winter of 2009-2010 where patients were diagnosed using a real-time polymerase chain reaction (PCR) assay. Symptom duration was significantly associated with patient age (Spearman rank correlation coefficient: 0.197; P = 0.002) but not with PCR cycle threshold (C(T)) value. Duration of viral excretion was found to be longer in patients with higher viral loads. Transmission within a ward bay was not significantly associated either with age or with C(T) value but was more likely to occur in some ward blocks than others, which may relate to differences in ward design. Transfer of patients into isolation rooms or cohorted area within two days of symptom onset did not significantly influence probability of onward transmission (52% vs 47%; P = 0.67). The presented data suggest that C(T) value may guide timing of repeat sample collection if ongoing gastrointestinal symptoms may relate to other pathologies, and that patients developing symptoms of norovirus may remain in their current bay rather than being moved into isolation facilities. The bay or ward should be closed to new admissions but it should be anticipated that duration of symptoms and therefore closure will be longer when the outbreak involves elderly patients. Copyright © 2012 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.

[Determination of the anaerobic threshold by the rate of ventilation and cardio interval variability].

PubMed

Seluianov, V N; Kalinin, E M; Pak, G D; Maevskaia, V I; Konrad, A H

2011-01-01

The aim of this work is to develop methods for determining the anaerobic threshold according to the rate of ventilation and cardio interval variability during the test with stepwise increases load on the cycle ergometer and treadmill. In the first phase developed the method for determining the anaerobic threshold for lung ventilation. 49 highly skilled skiers took part in the experiment. They performed a treadmill ski-walking test with sticks with gradually increasing slope from 0 to 25 degrees, the slope increased by one degree every minute. In the second phase we developed a method for determining the anaerobic threshold according dynamics ofcardio interval variability during the test. The study included 86 athletes of different sports specialties who performed pedaling on the cycle ergometer "Monarch" in advance. Initial output was 25 W, power increased by 25 W every 2 min. The pace was steady--75 rev/min. Measurement of pulmonary ventilation and oxygen and carbon dioxide content was performed using gas analyzer COSMED K4. Sampling of arterial blood was carried from the ear lobe or finger, blood lactate concentration was determined using an "Akusport" instrument. RR-intervals registration was performed using heart rate monitor Polar s810i. As a result, it was shown that the graphical method for determining the onset of anaerobic threshold ventilation (VAnP) coincides with the accumulation of blood lactate 3.8 +/- 0.1 mmol/l when testing on a treadmill and 4.1 +/- 0.6 mmol/1 on the cycle ergometer. The connection between the measure of oxygen consumption at VAnP and the dispersion of cardio intervals (SD1), derived regression equation: VO2AnT = 0.35 + 0.01SD1W + 0.0016SD1HR + + 0.106SD1(ms), l/min; (R = 0.98, error evaluation function 0.26 L/min, p < 0.001), where W (W)--Power, HR--heart rate (beats/min), SD1--cardio intervals dispersion (ms) at the moment of registration of cardio interval threshold.

Optimization of Diamond Nucleic Acid Dye for quantitative PCR.

PubMed

Haines, Alicia M; Tobe, Shanan S; Linacre, Adrian

2016-10-01

Here, we evaluate Diamond Nucleic Acid Dye (DD) for use in quantitative PCR (qPCR) applications. Although DD is a commercially available stain for detection of DNA separated by gel electrophoresis, its use as a detection dye in qPCR has yet to be described. To determine if DD can be used in qPCR, we investigated its inhibitory effects on qPCR at concentrations ranging 0.1-2.5×. Serial dilution of DNA was used to determine the efficiency, sensitivity, and linearity of DD-generated qPCR data in comparison to other commonly used fluorescent dyes such as SYBR Green (SG), EvaGreen (EG), and BRYT Green (BG). DD was found to be comparable with other dyes for qPCR applications, with an R2 value >0.9 and an efficiency of 0.83. Mitochondrial DNA (mtDNA) target signals were successfully produced by DD over a DNA dilution range of ~28 ng- 0.28 pg, demonstrating comparable sensitivity to the other dyes investigated. Cq values obtained using DD were lower than those using EG by almost 7 cycles. We conclude that Diamond Nucleic Acid Dye is a cheaper, less toxic alternative for qPCR applications.

Direct elicitation of template concentration from quantification cycle (Cq) distributions in digital PCR.

PubMed

Mojtahedi, Mitra; Fouquier d'Hérouël, Aymeric; Huang, Sui

2014-01-01

Digital PCR (dPCR) exploits limiting dilution of a template into an array of PCR reactions. From this array the number of reactions that contain at least one (as opposed to zero) initial template is determined, allowing inferring the original template concentration. Here we present a novel protocol to efficiently infer the concentration of a sample and its optimal dilution for dPCR from few targeted qPCR assays. By taking advantage of the real-time amplification feature of qPCR as opposed to relying on endpoint PCR assessment as in standard dPCR prior knowledge of template concentration is not necessary. This eliminates the need for serial dilutions in a separate titration and reduces the number of necessary reactions. We describe the theory underlying our approach and discuss experimental moments that contribute to uncertainty. We present data from a controlled experiment where the initial template concentration is known as proof of principle and apply our method on directly monitoring transcript level change during cell differentiation as well as gauging amplicon numbers in cDNA samples after pre-amplification. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Simultaneous detection of Plasmodium vivax and Plasmodium falciparum gametocytes in clinical isolates by multiplex-nested RT-PCR

PubMed Central

2012-01-01

Background Gametocyte carriage is essential for malaria transmission and endemicity of disease; thereby it is a target for malaria control strategies. Malaria-infected individuals may harbour gametocytes below the microscopic detection threshold that can be detected by reverse transcription polymerase chain reaction (RT-PCR) targeting gametocyte-specific mRNA. To date, RT-PCR has mainly been applied to the diagnosis of Plasmodium falciparum gametocytes but very limited for that of Plasmodium vivax. Methods A multiplex-nested RT-PCR targeting Pfs25 and Pvs25 mRNA specific to mature gametocytes of P. falciparum and P. vivax, respectively, was developed. The assay was evaluated using blood samples collected in rainy and dry seasons from febrile patients,in a malaria-endemic area in Thailand. Malaria diagnosis was performed by Giemsa-stained blood smears and 18S rRNA PCR. Results The multiplex-nested RT-PCR detected Pfs25 mRNA in 75 of 86 (87.2%) P. falciparum-infected individuals and Pvs25 mRNA in 82 of 90 (91.1%) P. vivax malaria patients diagnosed by 18S rRNA PCR. Gametocytes were detected in 38 (eight P. falciparum and 30 P. vivax) of 157 microscopy positive samples, implying that a large number of patients harbour sub-microscopic gametocytaemia. No seasonal differences in gametocyte carriage were observed for both malaria species diagnosed by multiplex-nested RT-PCR. With single-nested RT-PCR targeting Pfs25 or Pvs25 mRNA as standard, the multiplex-nested RT-PCR offered sensitivities of 97.4% and 98.9% and specificities of 100% and 98.8% for diagnosing mature gametocytes of P. falciparum and P. vivax, respectively. The minimum detection limit of the multiplex-nested PCR was 10 copies of templates. Conclusions The multiplex-nested RT-PCR developed herein is useful for simultaneous assessment of both P. falciparum and P. vivax gametocyte carriage that is prevalent and generally sympatric in several malaria-endemic areas outside Africa. PMID:22682065

Simultaneous detection of Plasmodium vivax and Plasmodium falciparum gametocytes in clinical isolates by multiplex-nested RT-PCR.

PubMed

Kuamsab, Napaporn; Putaporntip, Chaturong; Pattanawong, Urassaya; Jongwutiwes, Somchai

2012-06-10

Gametocyte carriage is essential for malaria transmission and endemicity of disease; thereby it is a target for malaria control strategies. Malaria-infected individuals may harbour gametocytes below the microscopic detection threshold that can be detected by reverse transcription polymerase chain reaction (RT-PCR) targeting gametocyte-specific mRNA. To date, RT-PCR has mainly been applied to the diagnosis of Plasmodium falciparum gametocytes but very limited for that of Plasmodium vivax. A multiplex-nested RT-PCR targeting Pfs25 and Pvs25 mRNA specific to mature gametocytes of P. falciparum and P. vivax, respectively, was developed. The assay was evaluated using blood samples collected in rainy and dry seasons from febrile patients,in a malaria-endemic area in Thailand. Malaria diagnosis was performed by Giemsa-stained blood smears and 18S rRNA PCR. The multiplex-nested RT-PCR detected Pfs25 mRNA in 75 of 86 (87.2%) P. falciparum-infected individuals and Pvs25 mRNA in 82 of 90 (91.1%) P. vivax malaria patients diagnosed by 18S rRNA PCR. Gametocytes were detected in 38 (eight P. falciparum and 30 P. vivax) of 157 microscopy positive samples, implying that a large number of patients harbour sub-microscopic gametocytaemia. No seasonal differences in gametocyte carriage were observed for both malaria species diagnosed by multiplex-nested RT-PCR. With single-nested RT-PCR targeting Pfs25 or Pvs25 mRNA as standard, the multiplex-nested RT-PCR offered sensitivities of 97.4% and 98.9% and specificities of 100% and 98.8% for diagnosing mature gametocytes of P. falciparum and P. vivax, respectively. The minimum detection limit of the multiplex-nested PCR was 10 copies of templates. The multiplex-nested RT-PCR developed herein is useful for simultaneous assessment of both P. falciparum and P. vivax gametocyte carriage that is prevalent and generally sympatric in several malaria-endemic areas outside Africa.

Using sigmoidal curve-fitting in a real- time PCR detection assay to determine detection thresholds

Treesearch

Pedro Uribe; Frank N. Martin

2008-01-01

Phytophthora ramorum, the causal agent of sudden oak death (SOD) is a quarantine pathogen that has forced the implementation of extraordinary measures to track and contain the movement of infected nursery stock both within and outside of the three western states of California, Oregon and Washington. Federal guidelines in the United States for...

[Evaluation of cytomegalovirus quantification in blood by the R-gene real-time PCR test].

PubMed

Marque-Juillet, S; Touzard, A; Monnier, S; Fernand-Laurent, C; Therby, A; Rigaudeau, S; Harzic, M

2010-04-01

Diagnosing the presence of cytomegalovirus (CMV) in the blood of immunodepressed patients is often done by quantitative polymerase chain reaction (Q-PCR) even though the reference method remains the antigenemia pp65 (Ag-pp65) test. To define the predictive value of the Q-PCR in the diagnosis of CMV disease and assess treatment efficacy using the CMV R-gene test. To compare the Q-PCR results and feasibility with those of the Ag-pp65 test. The Q-PCR was performed in 34 whole blood samples (frozen at -80 degrees C until use) from five patients diagnosed with CMV disease, defined as the presence of clinical signs and Ag-pp65 in the nuclei of more than two cells. After extraction, viral DNA was quantified in each sample using the Q-PCR CMV R-gene kit according to the manufacturer's instructions. Immediately after blood was drawn, the Ag-pp65 test had been performed in 32 samples using CINAkit (Argene). The 16 samples positive by the Ag-pp65 test were also positive by PCR; six samples negative by the Ag-pp65 test were positive by PCR; and the remaining 10 samples were negative by both techniques. During treatment, the two markers' kinetics were similar. The CMV R-gene test has a predictive value as good as that of the Ag-pp65 test but is fast and easier to use. A prospective study with a greater number of patients is needed to define the prediction threshold for CMV disease. Copyright 2009 Elsevier Masson SAS. All rights reserved.

[Application of recombinase polymerase amplification in the detection of Pseudomonas aeruginosa].

PubMed

Jin, X J; Gong, Y L; Yang, L; Mo, B H; Peng, Y Z; He, P; Zhao, J N; Li, X L

2018-04-20

Objective: To establish an optimized method of recombinase polymerase amplification (RPA) to rapidly detect Pseudomonas aeruginosa in clinic. Methods: (1) The DNA templates of one standard Pseudomonas aeruginosa strain was extracted and detected by polymerase chain reaction (PCR), real-time fluorescence quantitative PCR and RPA. Time of sample loading, time of amplification, and time of detection of the three methods were recorded. (2) One standard Pseudomonas aeruginosa strain was diluted in 7 concentrations of 1×10(7,) 1×10(6,) 1×10(5,) 1×10(4,) 1×10(3,) 1×10(2,) and 1×10(1) colony forming unit (CFU)/mL after recovery and cultivation. The DNA templates of Pseudomonas aeruginosa and negative control strain Pseudomonas putida were extracted and detected by PCR, real-time fluorescence quantitative PCR, and RPA separately. The sensitivity of the three methods in detecting Pseudomonas aeruginosa was analyzed. (3) The DNA templates of one standard Pseudomonas aeruginosa strain and four negative control strains ( Staphylococcus aureus, Acinetobacter baumanii, Candida albicans, and Pseudomonas putida ) were extracted separately, and then they were detected by PCR, real-time fluorescence quantitative PCR, and RPA. The specificity of the three methods in detecting Pseudomonas aeruginosa was analyzed. (4) The DNA templates of 28 clinical strains of Pseudomonas aeruginosa preserved in glycerin, 1 clinical strain of which was taken by cotton swab, and negative control strain Pseudomonas putida were extracted separately, and then they were detected by RPA. Positive amplification signals of the clinical strains were observed, and the detection rate was calculated. All experiments were repeated for 3 times. Sensitivity results were analyzed by GraphPad Prism 5.01 statistical software. Results: (1) The loading time of RPA, PCR, and real-time fluorescence quantitative PCR for detecting Pseudomonas aeruginosa were all 20 minutes. In PCR, time of amplification was 98 minutes, time of gel detection was 20 minutes, and the total time was 138 minutes. In real-time fluorescence quantitative PCR, amplification and detection could be completed simultaneously, which took 90 minutes, and the total time was 110 minutes. In RPA, amplification and detection could also be completed simultaneously, which took 15 minutes, and the total time was 35 minutes. (2) Pseudomonas putida did not show positive amplification signals or gel positive results in any of the three detection methods. The detection limit of Pseudomonas aeruginosa in real-time fluorescence quantitative PCR and PCR was 1×10(1) CFU/mL, and that of Pseudomonas aeruginosa in RPA was 1×10(2) CFU/mL. In RPA and real-time fluorescence quantitative PCR, the higher the concentration of Pseudomonas aeruginosa, the shorter threshold time and smaller the number of cycles, namely shorter time for detecting the positive amplified signal. In real-time fluorescence quantitative PCR, all positive amplification signal could be detected when the concentration of Pseudomonas aeruginosa was 1×10(1)-1×10(7) CFU/mL. In RPA, the detection rate of positive amplification signal was 0 when the concentration of Pseudomonas aeruginosa was 1×10(1) CFU/mL, while the detection rate of positive amplification signal was 67% when the concentration of Pseudomonas aeruginosa was 1×10(2) CFU/mL, and the detection rate of positive amplification signal was 100% when the concentration of Pseudomonas aeruginosa was 1×10(3)-1×10(7) CFU/mL. (3) In RPA, PCR, and real-time fluorescence quantitative PCR, Pseudomonas aeruginosa showed positive amplification signals and gel positive results, but there were no positive amplification signals or gel positive results in four negative control strains of Acinetobacter baumannii, Staphylococcus aureus, Candida albicans, and Pseudomonas putida . (4) In RPA, 28 clinical strains of Pseudomonas aeruginosa preserved in glycerin and 1 clinical strain of Pseudomonas aeruginosa taken by cotton swab showed positive amplification signals, while Pseudomonas putida did not show positive amplification signal. The detection rate of positive amplification signal of 29 clinical strains of Pseudomonas aeruginosa in RPA was 100%. Conclusions: The established optimized RPA technology for fast detection of Pseudomonas aeruginosa requires shorter time, with high sensitivity and specificity. It was of great value in fast detection of Pseudomonas aeruginosa infection in clinic.

Simple Objective Detection of Human Lyme Disease Infection Using Immuno-PCR and a Single Recombinant Hybrid Antigen

PubMed Central

Halpern, Micah D.; Molins, Claudia R.; Schriefer, Martin

2014-01-01

A serology-based tiered approach has, to date, provided the most effective means of laboratory confirmation of clinically suspected cases of Lyme disease, but it lacks sensitivity in the early stages of disease and is often dependent on subjectively scored immunoblots. We recently demonstrated the use of immuno-PCR (iPCR) for detecting Borrelia burgdorferi antibodies in patient serum samples that were positive for Lyme disease. To better understand the performance of the Lyme disease iPCR assay, the repeatability and variability of the background of the assay across samples from a healthy population (n = 36) were analyzed. Both of these parameters were found to have coefficients of variation of <3%. Using eight antigen-specific iPCR assays and positive call thresholds established for each assay, iPCR IgM and/or IgG diagnosis from Lyme disease patient serum samples (n = 12) demonstrated a strong correlation with that of 2-tier testing. Furthermore, a simplified iPCR approach using a single hybrid antigen and detecting only IgG antibodies confirmed the 2-tier diagnosis in the Lyme disease patient serum samples (n = 12). Validation of the hybrid antigen IgG iPCR assay using a blinded panel of Lyme disease and non-Lyme disease patient serum samples (n = 92) resulted in a sensitivity of 69% (95% confidence interval [CI], 50% to 84%), compared to that of the 2-tier analysis at 59% (95% CI, 41% to 76%), and a specificity of 98% (95% CI, 91% to 100%) compared to that of the 2-tier analysis at 97% (95% CI, 88% to 100%). A single-tier hybrid antigen iPCR assay has the potential to be an improved method for detecting host-generated antibodies against B. burgdorferi. PMID:24899074

DEVELOPMENTAL NEUROTOXICITY OF ORGANOPHOSPHATES TARGETS CELL CYCLE AND APOPTOSIS, REVEALED BY TRANSCRIPTIONAL PROFILES IN VIVO AND IN VITRO

PubMed Central

Slotkin, Theodore A.; Seidler, Frederic J.

2012-01-01

Developmental organophosphate exposure reduces the numbers of neural cells, contributing to neurobehavioral deficits. We administered chlorpyrifos or diazinon to newborn rats on postnatal days 1–4, in doses straddling the threshold for barely-detectable cholinesterase, and evaluated gene expression in the cell cycle and apoptosis pathways on postnatal day 5. Both organophosphates evoked transcriptional changes in 20–25% of the genes in each category; chlorpyrifos and diazinon targeted the same genes, with similar magnitudes of change, as evidenced by high concordance. Furthermore, the same effects were obtained with doses above or below the threshold for cholinesterase inhibition, indicating a mechanism unrelated to anticholinesterase actions. We then evaluated the effects of chlorpyrifos in undifferentiated and differentiating PC12 cells and found even greater targeting of cell cycle and apoptosis genes, affecting up to 40% of all genes in the pathways. Notably, the genes affected in undifferentiated cells were not concordant with those in differentiating cells, pointing to dissimilar outcomes dependent on developmental stage. The in vitro model successfully identified 60–70% of the genes affected by chlorpyrifos in vivo, indicating that the effects are exerted directly on developing neural cells. Our results show that organophosphates target the genes regulating the cell cycle and apoptosis in the developing brain and in neuronotypic cells in culture, with the pattern of vulnerability dependent on the specific stage of development. Equally important, these effects do not reflect actions on cholinesterase and operate at exposures below the threshold for any detectable inhibition of this enzyme. PMID:22222554

Developmental neurotoxicity of organophosphates targets cell cycle and apoptosis, revealed by transcriptional profiles in vivo and in vitro.

PubMed

Slotkin, Theodore A; Seidler, Frederic J

2012-03-01

Developmental organophosphate exposure reduces the numbers of neural cells, contributing to neurobehavioral deficits. We administered chlorpyrifos or diazinon to newborn rats on postnatal days 1-4, in doses straddling the threshold for barely-detectable cholinesterase inhibition, and evaluated gene expression in the cell cycle and apoptosis pathways on postnatal day 5. Both organophosphates evoked transcriptional changes in 20-25% of the genes in each category; chlorpyrifos and diazinon targeted the same genes, with similar magnitudes of change, as evidenced by high concordance. Furthermore, the same effects were obtained with doses above or below the threshold for cholinesterase inhibition, indicating a mechanism unrelated to anticholinesterase actions. We then evaluated the effects of chlorpyrifos in undifferentiated and differentiating PC12 cells and found even greater targeting of cell cycle and apoptosis genes, affecting up to 40% of all genes in the pathways. Notably, the genes affected in undifferentiated cells were not concordant with those in differentiating cells, pointing to dissimilar outcomes dependent on developmental stage. The in vitro model successfully identified 60-70% of the genes affected by chlorpyrifos in vivo, indicating that the effects are exerted directly on developing neural cells. Our results show that organophosphates target the genes regulating the cell cycle and apoptosis in the developing brain and in neuronotypic cells in culture, with the pattern of vulnerability dependent on the specific stage of development. Equally important, these effects do not reflect actions on cholinesterase and operate at exposures below the threshold for any detectable inhibition of this enzyme. Copyright © 2011 Elsevier Inc. All rights reserved.

First finding of Trypanosoma cruzi II in vampire bats from a district free of domestic vector-borne transmission in Northeastern Argentina.

PubMed

Argibay, Hernán D; Orozco, M Marcela; Cardinal, M Victoria; Rinas, Miguel A; Arnaiz, María; Mena Segura, Carlos; Gürtler, Ricardo E

2016-09-01

Establishing the putative links between sylvatic and domestic transmission cycles of Trypanosoma cruzi, the etiological agent of Chagas disease, is of public health relevance. We conducted three surveys to assess T. cruzi infection in wild mammals from a rural and a preserved area in Misiones Province, Northeastern Argentina, which had recently been declared free of vector- and blood-borne transmission of human T. cruzi infection. A total of 200 wild mammals were examined by xenodiagnosis (XD) and/or polymerase chain reaction (PCR) amplification of the hyper-variable region of kinetoplast DNA minicircles of T. cruzi (kDNA-PCR). The overall prevalence of T. cruzi infection was 8%. Nine (16%) of 57 Didelphis albiventris opossums and two (7%) of 29 Desmodus rotundus vampire bats were positive by both XD and kDNA-PCR. Additionally, one D. rotundus positive for T. cruzi by kDNA-PCR tested positive by satellite-DNA-PCR (SAT-DNA-PCR). The T. cruzi-infected bats were captured indoors and in the yard of a vacant dwelling. All D. albiventris were infected with TcI and both XD-positive D. rotundus by TcII. Fifty-five opossum cubs within the marsupium were negative by XD. The mean infectiousness to the vector was 62% in D. albiventris and 50% in D. rotundus. Mice experimentally infected with a parasite isolate from a vampire bat displayed lesions typically caused by T. cruzi. Our study documents the presence of the genotype TcII in a sylvatic host for the first time in Argentina, and the occurrence of two transmission cycles of T. cruzi in a district free of domestic vector-borne transmission.

Molecular characterization of human and animal Echinococcus granulosus isolates in Isfahan, Iran.

PubMed

Shahnazi, Mojtaba; Hejazi, Hosein; Salehi, Mansour; Andalib, Ali Reza

2011-01-01

Cystic hydatid disease (CHD) is one of the most important zoonotic diseases in different parts of Iran. While it causes major health problem, there is limited information about its transmission cycles and reservoirs of human infection. Therefore we aimed to characterize the existence Echinococcus granulosus cysts in humans and animals in the province of Isfahan, central region of Iran. We collected hydatid cysts from the liver and lungs of patients who underwent surgery procedure and also cysts were obtained from domestic animals at slaughterhouses. DNA was extracted from the protoscoleces and examined by polymerase chain reaction (PCR) of rDNA internal transcribed spacer1 (ITS1-PCR) and PCR-restriction fragment length polymorphism (PCR-RFLP). In addition, fragments of the genes coding for mitochondrial cytochrome c oxidase subunit 1 (CO1) and NADH dehydrogenase 1 (ND1) were sequenced. Among the two different identified strains/genotypes (sheep and camel), the sheep strain was shown to be the most common genotype of E. granulosus affecting humans, sheep, cattle, goats and occasionally camels. Nine out of 26 camel samples were infected with sheep strain. However the camel genotype was observed in humans, camels and cattle. Seventeen out of 26 camel isolates, 6 out of 31 human and 5 out of 14 cattle samples were infected with the camel genotype. The camel genotypes had PCR and RFLP patterns which were different from the PCR and RFLP patterns of the rest of isolates (sheep strain). The results of this study showed that the 'camel' strain was actual source of infection to humans which circulates between intermediate hosts including camels and cattle, and it confirms the camel-dog transmission cycle in Isfahan. Copyright © 2010 Elsevier B.V. All rights reserved.

Titer-plate formatted continuous flow thermal reactors: Design and performance of a nanoliter reactor

PubMed Central

Chen, Pin-Chuan; Park, Daniel S.; You, Byoung-Hee; Kim, Namwon; Park, Taehyun; Soper, Steven A.; Nikitopoulos, Dimitris E.; Murphy, Michael C.

2010-01-01

Arrays of continuous flow thermal reactors were designed, configured, and fabricated in a 96-device (12 × 8) titer-plate format with overall dimensions of 120 mm × 96 mm, with each reactor confined to a 8 mm × 8 mm footprint. To demonstrate the potential, individual 20-cycle (740 nL) and 25-cycle (990 nL) reactors were used to perform the continuous flow polymerase chain reaction (CFPCR) for amplification of DNA fragments of different lengths. Since thermal isolation of the required temperature zones was essential for optimal biochemical reactions, three finite element models, executed with ANSYS (v. 11.0, Canonsburg, PA), were used to characterize the thermal performance and guide system design: (1) a single device to determine the dimensions of the thermal management structures; (2) a single CFPCR device within an 8 mm × 8 mm area to evaluate the integrity of the thermostatic zones; and (3) a single, straight microchannel representing a single loop of the spiral CFPCR device, accounting for all of the heat transfer modes, to determine whether the PCR cocktail was exposed to the proper temperature cycling. In prior work on larger footprint devices, simple grooves between temperature zones provided sufficient thermal resistance between zones. For the small footprint reactor array, 0.4 mm wide and 1.2 mm high fins were necessary within the groove to cool the PCR cocktail efficiently, with a temperature gradient of 15.8°C/mm, as it flowed from the denaturation zone to the renaturation zone. With temperature tolerance bands of ±2°C defined about the nominal temperatures, more than 72.5% of the microchannel length was located within the desired temperature bands. The residence time of the PCR cocktail in each temperature zone decreased and the transition times between zones increased at higher PCR cocktail flow velocities, leading to less time for the amplification reactions. Experiments demonstrated the performance of the CFPCR devices as a function of flow velocity, fragment length, and copy number. A 99 bp DNA fragment was successfully amplified at flow velocities from 1 mm/s to 3 mm/s, requiring from 8.16 minutes for 20 cycles (24.48 s/cycle) to 2.72 minutes for 20 cycles (8.16 s/cycle), respectively. Yield compared to the same amplification sequence performed using a bench top thermal cycler decreased nonlinearly from 73% (at 1 mm/s) to 13% (at 3 mm/s) with shorter residence time at the optimal temperatures for the reactions due to increased flow rate primarily responsible. Six different DNA fragments with lengths between 99 bp and 997 bp were successfully amplified at 1 mm/s. Repeatable, successful amplification of a 99 bp fragment was achieved with a minimum of 8000 copies of the DNA template. This is the first demonstration and characterization of continuous flow thermal reactors within the 8 mm × 8 mm footprint of a 96-well micro-titer plate and is the smallest continuous flow PCR to date. PMID:20871807

SCB thermite igniter studies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bickes, R.W. Jr.; Wackerbarth, D.E.; Mohler, J.H.

1996-12-31

The authors report on recent studies comparing the ignition threshold of temperature cycled, SCB thermite devices with units that were not submitted to temperature cycling. Aluminum/copper-oxide thermite was pressed into units at two densities, 45% of theoretical maximum density (TMD) or 47% of TMD. Half of each of the density sets underwent three thermal cycles; each cycle consisted of 2 hours at 74 C and 2 hours at {minus}54 C, with a 5 minute maximum transfer time between temperatures. The temperature cycled units were brought to ambient temperature before the threshold testing. Both the density and the thermal cycling affectedmore » the all-fire voltage. Using a 5.34 {micro}F CDU (capacitor discharge unit) firing set, the all-fire voltage for the units that were not temperature cycled increased with density from 32.99 V (45% TMD) to 39.32 V (47% TMD). The all-fire voltages for the thermally cycled units were 34.42 V (45% TMD) and 58.1 V (47% TMD). They also report on no-fire levels at ambient temperature for two component designs; the 5 minute no-fire levels were greater than 1.2 A. Units were also subjected to tests in which 1 W of RF power was injected into the bridges at 10 MHz for 5 minutes. The units survived and fired normally afterwards. Finally, units were subjected to pin-to-pin electrostatic discharge (ESD) tests. None of the units fired upon application of the ESD pulse, and all of the tested units fired normally afterwards.« less

[Cytotonic and cytotoxic effect of cholera toxin on Vero cells and its relation to PCR].

PubMed

Rodríguez-Angeles, M G; Giono-Cerezo, S; Valdespino-Gómez, J L

1994-01-01

We studied 40 Vibrio cholerae strains: 16 from stool, 16 from sewage and 8 from food. The serotypes were Inaba in 21 strains, 8 Ogawa strains and 11 V. cholerae non-O1. PCR was made with ctx2 and ctx3 primers with 25 cycles of temperature: 1 min at 94 degrees C, 1 min at 60 degrees C and 1 min at 72 degrees C. 24 V. cholerae strains were positive: 18/24 Inaba y 6/24 Ogawa. PCR was negative for 16 strains: 3 Inaba serotype, 2 Ogawa y 11 V. cholerae non-O1. In Vero culture cells 18 strains were cytotonic, 21 cytotoxic and 1 strain was negative. ELISA was positive for 11 strains with PCR positive. The PCR sensitivity was 95.83% compared with culture cells. V. cholerae O1 produced cytotoxic effect on Vero culture cells, maybe related to ACE factor. Colony blot was made with a specific probe labeled with digoxigenin and it could detect 4 Vibrio cholerae toxigenic strains with PCR negative. All V. cholerae Non O1 strains were PCR negative.

Development of real-time PCR technique for the estimation of population density of Pythium intermedium in forest soils.

PubMed

Li, Mingzhu; Senda, Masako; Komatsu, Tsutomu; Suga, Haruhisa; Kageyama, Koji

2010-10-20

Pythium intermedium is known to play an important role in the carbon cycling of cool-temperate forest soils. In this study, a fast, precise and effective real-time PCR technique for estimating the population densities of P. intermedium from soils was developed using species-specific primers. Specificity was confirmed both with conventional PCR and real-time PCR. The detection limit (sensitivity) was determined and amplification standard curves were generated using SYBR Green II fluorescent dye. A rapid and accurate assay for quantification of P. intermedium in Takayama forest soils of Japan was developed using a combination of a new DNA extraction method and PCR primers were developed for real-time PCR. And the distribution of P. intermedium in forest soil was investigated with both soil plating method and the developed real-time PCR technique. This new technique will be a useful tool and can be applied to practical use for studying the role of Pythium species in forest and agricultural ecosystems. Copyright © 2009 Elsevier GmbH. All rights reserved.

A novel approach for human whole transcriptome analysis based on absolute gene expression of microarray data.

PubMed

Bikel, Shirley; Jacobo-Albavera, Leonor; Sánchez-Muñoz, Fausto; Cornejo-Granados, Fernanda; Canizales-Quinteros, Samuel; Soberón, Xavier; Sotelo-Mundo, Rogerio R; Del Río-Navarro, Blanca E; Mendoza-Vargas, Alfredo; Sánchez, Filiberto; Ochoa-Leyva, Adrian

2017-01-01

In spite of the emergence of RNA sequencing (RNA-seq), microarrays remain in widespread use for gene expression analysis in the clinic. There are over 767,000 RNA microarrays from human samples in public repositories, which are an invaluable resource for biomedical research and personalized medicine. The absolute gene expression analysis allows the transcriptome profiling of all expressed genes under a specific biological condition without the need of a reference sample. However, the background fluorescence represents a challenge to determine the absolute gene expression in microarrays. Given that the Y chromosome is absent in female subjects, we used it as a new approach for absolute gene expression analysis in which the fluorescence of the Y chromosome genes of female subjects was used as the background fluorescence for all the probes in the microarray. This fluorescence was used to establish an absolute gene expression threshold, allowing the differentiation between expressed and non-expressed genes in microarrays. We extracted the RNA from 16 children leukocyte samples (nine males and seven females, ages 6-10 years). An Affymetrix Gene Chip Human Gene 1.0 ST Array was carried out for each sample and the fluorescence of 124 genes of the Y chromosome was used to calculate the absolute gene expression threshold. After that, several expressed and non-expressed genes according to our absolute gene expression threshold were compared against the expression obtained using real-time quantitative polymerase chain reaction (RT-qPCR). From the 124 genes of the Y chromosome, three genes (DDX3Y, TXLNG2P and EIF1AY) that displayed significant differences between sexes were used to calculate the absolute gene expression threshold. Using this threshold, we selected 13 expressed and non-expressed genes and confirmed their expression level by RT-qPCR. Then, we selected the top 5% most expressed genes and found that several KEGG pathways were significantly enriched. Interestingly, these pathways were related to the typical functions of leukocytes cells, such as antigen processing and presentation and natural killer cell mediated cytotoxicity. We also applied this method to obtain the absolute gene expression threshold in already published microarray data of liver cells, where the top 5% expressed genes showed an enrichment of typical KEGG pathways for liver cells. Our results suggest that the three selected genes of the Y chromosome can be used to calculate an absolute gene expression threshold, allowing a transcriptome profiling of microarray data without the need of an additional reference experiment. Our approach based on the establishment of a threshold for absolute gene expression analysis will allow a new way to analyze thousands of microarrays from public databases. This allows the study of different human diseases without the need of having additional samples for relative expression experiments.

Artificial Autopolyploidization Modifies the Tricarboxylic Acid Cycle and GABA Shunt in Arabidopsis thaliana Col-0

NASA Astrophysics Data System (ADS)

Vergara, Fredd; Kikuchi, Jun; Breuer, Christian

2016-05-01

Autopolyploidy is a process whereby the chromosome set is multiplied and it is a common phenomenon in angiosperms. Autopolyploidy is thought to be an important evolutionary force that has led to the formation of new plant species. Despite its relevance, the consequences of autopolyploidy in plant metabolism are poorly understood. This study compares the metabolic profiles of natural diploids and artificial autotetraploids of Arabidopsis thaliana Col-0. Different physiological parameters are compared between diploids and autotetraploids using nuclear magnetic resonance (NMR), elemental analysis (carbon:nitrogen balance) and quantitative real-time PCR (qRT-PCR). The main difference between diploid and autotetraploid A. thaliana Col-0 is observed in the concentration of metabolites related to the tricarboxylic acid cycle (TCA) and γ-amino butyric acid (GABA) shunt, as shown by multivariate statistical analysis of NMR spectra. qRT-PCR shows that genes related to the TCA and GABA shunt are also differentially expressed between diploids and autotetraploids following similar trends as their corresponding metabolites. Solid evidence is presented to demonstrate that autopolyploidy influences core plant metabolic processes.

Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics.

PubMed

Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David

2014-02-20

Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas.

Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics

NASA Astrophysics Data System (ADS)

Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David

2014-02-01

Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas.

Development of a real-time PCR method for the differential detection and quantification of four solanaceae in GMO analysis: potato (Solanum tuberosum), tomato (Solanum lycopersicum), eggplant (Solanum melongena), and pepper (Capsicum annuum).

PubMed

Chaouachi, Maher; El Malki, Redouane; Berard, Aurélie; Romaniuk, Marcel; Laval, Valérie; Brunel, Dominique; Bertheau, Yves

2008-03-26

The labeling of products containing genetically modified organisms (GMO) is linked to their quantification since a threshold for the presence of fortuitous GMOs in food has been established. This threshold is calculated from a combination of two absolute quantification values: one for the specific GMO target and the second for an endogenous reference gene specific to the taxon. Thus, the development of reliable methods to quantify GMOs using endogenous reference genes in complex matrixes such as food and feed is needed. Plant identification can be difficult in the case of closely related taxa, which moreover are subject to introgression events. Based on the homology of beta-fructosidase sequences obtained from public databases, two couples of consensus primers were designed for the detection, quantification, and differentiation of four Solanaceae: potato (Solanum tuberosum), tomato (Solanum lycopersicum), pepper (Capsicum annuum), and eggplant (Solanum melongena). Sequence variability was studied first using lines and cultivars (intraspecies sequence variability), then using taxa involved in gene introgressions, and finally, using taxonomically close taxa (interspecies sequence variability). This study allowed us to design four highly specific TaqMan-MGB probes. A duplex real time PCR assay was developed for simultaneous quantification of tomato and potato. For eggplant and pepper, only simplex real time PCR tests were developed. The results demonstrated the high specificity and sensitivity of the assays. We therefore conclude that beta-fructosidase can be used as an endogenous reference gene for GMO analysis.

Rapid, cost-effective, sensitive and quantitative detection of Acinetobacter baumannii from pneumonia patients

PubMed Central

Nomanpour, B; Ghodousi, A; Babaei, A; Abtahi, HR; Tabrizi, M; Feizabadi, MM

2011-01-01

Background and Objectives Pneumonia with Acinetobacter baumannii has a major therapeutic problem in health care settings. Decision to initiate correct antibiotic therapy requires rapid identification and quantification of organism. The aim of this study was to develop a rapid and sensitive method for direct detection of A. baumannii from respiratory specimens. Materials and Methods A Taqman real time PCR based on the sequence of bla oxa-51 was designed and used for direct detection of A. baumannii from 361 respiratory specimens of patients with pneumonia. All specimens were checked by conventional bacteriology in parallel. Results The new real time PCR could detect less than 200 cfu per ml of bacteria in specimens. There was agreement between the results of real time PCR and culture (Kappa value 1.0, p value<0.001). The sensitivity, specificity and predictive values of real time PCR were 100%. The prevalence of A. baumannii in pneumonia patients was 10.53 % (n=38). Poly-microbial infections were detected in 65.71% of specimens. Conclusion Acinetobacter baumannii is the third causative agent in nosocomial pneumonia after Pseudomonas aeroginosa (16%) and Staphylococcus aureus (13%) at Tehran hospitals. We recommend that 104 CFU be the threshold for definition of infection with A. baumannii using real time PCR. PMID:22530083

ReadqPCR and NormqPCR: R packages for the reading, quality checking and normalisation of RT-qPCR quantification cycle (Cq) data.

PubMed

Perkins, James R; Dawes, John M; McMahon, Steve B; Bennett, David L H; Orengo, Christine; Kohl, Matthias

2012-07-02

Measuring gene transcription using real-time reverse transcription polymerase chain reaction (RT-qPCR) technology is a mainstay of molecular biology. Technologies now exist to measure the abundance of many transcripts in parallel. The selection of the optimal reference gene for the normalisation of this data is a recurring problem, and several algorithms have been developed in order to solve it. So far nothing in R exists to unite these methods, together with other functions to read in and normalise the data using the chosen reference gene(s). We have developed two R/Bioconductor packages, ReadqPCR and NormqPCR, intended for a user with some experience with high-throughput data analysis using R, who wishes to use R to analyse RT-qPCR data. We illustrate their potential use in a workflow analysing a generic RT-qPCR experiment, and apply this to a real dataset. Packages are available from http://www.bioconductor.org/packages/release/bioc/html/ReadqPCR.htmland http://www.bioconductor.org/packages/release/bioc/html/NormqPCR.html These packages increase the repetoire of RT-qPCR analysis tools available to the R user and allow them to (amongst other things) read their data into R, hold it in an ExpressionSet compatible R object, choose appropriate reference genes, normalise the data and look for differential expression between samples.

An air-pressure-free elastomeric valve for integrated nucleic acid analysis by capillary electrophoresis

NASA Astrophysics Data System (ADS)

Jung, Wooseok; Barrett, Matthew; Brooks, Carla; Rivera, Andrew; Birdsell, Dawn N.; Wagner, David M.; Zenhausern, Frederic

2015-12-01

We present a new elastomeric valve for integrated nucleic acid analysis by capillary electrophoresis. The valve functions include metering to capture a designated volume of biological sample into a polymerase chain reaction (PCR) chamber, sealing to preserve the sample during PCR cycling, and transfer of the PCR-products and on-chip formamide post-processing for the analysis of DNA fragments by capillary gel electrophoresis. This new valve differs from prior art polydimethylsiloxane (PDMS) valves in that the valve is not actuated externally by air-pressure or vacuum so that it simplifies a DNA analysis system by eliminating the need for an air-pressure or vacuum source, and off-cartridge solenoid valves, control circuit boards and software. Instead, the new valve is actuated by a thermal cycling peltier assembly integrated within the hardware instrument that tightly comes in contact with a microfluidic cartridge for thermal activation during PCR, so that it spontaneously closes the valve without an additional actuator system. The valve has bumps in the designated locations so that it has a self-alignment that does not require precise alignment of a valve actuator. Moreover, the thickness of the new valve is around 600 μm with an additional bump height of 400 μm so that it is easy to handle and very feasible to fabricate by injection molding compared to other PDMS valves whose thicknesses are around 30-100 μm. The new valve provided over 95% of metering performance in filling the fixed volume of the PCR chamber, preserved over 97% of the sample volume during PCR, and showed very comparable capillary electrophoresis peak heights to the benchtop assay tube controls with very consistent transfer volume of the PCR-product and on-chip formamide. The new valve can perform a core function for integrated nucleic acid analysis by capillary electrophoresis.

[Application of repair enzymes to improve the quality of degraded DNA templates for PCR amplification].

PubMed

Dovgerd, A P; Zharkov, D O

2014-01-01

PCR amplification of severely degraded DNA, including ancient DNA, forensic samples, and preparations from deeply processed foodstuffs, is a serious problem. Living organisms have a set of enzymes to repair lesions in their DNA. In this work, we have developed and characterized model systems of degraded high-molecular-weight DNA with a predominance of different types of damage. It was shown that depurination and oxidation of the model plasmid DNA template led to a decrease in the PCR efficiency. A set of enzymes performing a full cycle of excision repair of some lesions was determined. The treatment of model-damaged substrates with this set of enzymes resulted in an increased PCR product yield as compared with that of the unrepaired samples.

Nanoscale superstructures assembled by polymerase chain reaction (PCR): programmable construction, structural diversity, and emerging applications.

PubMed

Kuang, Hua; Ma, Wei; Xu, Liguang; Wang, Libing; Xu, Chuanlai

2013-11-19

Polymerase chain reaction (PCR) is an essential tool in biotechnology laboratories and is becoming increasingly important in other areas of research. Extensive data obtained over the last 12 years has shown that the combination of PCR with nanoscale dispersions can resolve issues in the preparation DNA-based materials that include both inorganic and organic nanoscale components. Unlike conventional DNA hybridization and antibody-antigen complexes, PCR provides a new, effective assembly platform that both increases the yield of DNA-based nanomaterials and allows researchers to program and control assembly with predesigned parameters including those assisted and automated by computers. As a result, this method allows researchers to optimize to the combinatorial selection of the DNA strands for their nanoparticle conjugates. We have developed a PCR approach for producing various nanoscale assemblies including organic motifs such as small molecules, macromolecules, and inorganic building blocks, such as nanorods (NRs), metal, semiconductor, and magnetic nanoparticles (NPs). We start with a nanoscale primer and then modify that building block using the automated steps of PCR-based assembly including initialization, denaturation, annealing, extension, final elongation, and final hold. The intermediate steps of denaturation, annealing, and extension are cyclic, and we use computer control so that the assembled superstructures reach their predetermined complexity. The structures assembled using a small number of PCR cycles show a lower polydispersity than similar discrete structures obtained by direct hybridization between the nanoscale building blocks. Using different building blocks, we assembled the following structural motifs by PCR: (1) discrete nanostructures (NP dimers, NP multimers including trimers, pyramids, tetramers or hexamers, etc.), (2) branched NP superstructures and heterochains, (3) NP satellite-like superstructures, (4) Y-shaped nanostructures and DNA networks, (5) protein-DNA co-assembly structures, and (6) DNA block copolymers including trimers and pentamers. These results affirm that this method can produce a variety of chemical structures and in yields that are tunable. Using PCR-based preparation of DNA-bridged nanostructures, we can program the assembly of the nanoscale blocks through the adjustment of the primer intensity on the assembled units, the number of PCR cycles, or both. The resulting structures are highly complex and diverse and have interesting dynamics and collective properties. Potential applications of these materials include chirooptical materials, probe fabrication, and environmental and biomedical sensors.

Digital Biological Converter

DTIC Science & Technology

2013-06-28

of cuts that each fragment should be cut into so the fragments are no greater than a specific length threshold. Additionally, vector sequences and...restriction sites are attached to each fragment while ensuring the restriction sites are unique to each sequence. The vector sequences serve as hooks...for assembly into vector for cloning purposes, and also as primer binding domains for PCR ampl ification. The restriction sites are added to

Modeling of Sonos Memory Cell Erase Cycle

NASA Technical Reports Server (NTRS)

Phillips, Thomas A.; MacLeond, Todd C.; Ho, Fat D.

2010-01-01

Silicon-oxide-nitride-oxide-silicon (SONOS) nonvolatile semiconductor memories (NVSMS) have many advantages. These memories are electrically erasable programmable read-only memories (EEPROMs). They utilize low programming voltages, endure extended erase/write cycles, are inherently resistant to radiation, and are compatible with high-density scaled CMOS for low power, portable electronics. The SONOS memory cell erase cycle was investigated using a nonquasi-static (NQS) MOSFET model. The SONOS floating gate charge and voltage, tunneling current, threshold voltage, and drain current were characterized during an erase cycle. Comparisons were made between the model predictions and experimental device data.

Quantitative Real-Time PCR using the Thermo Scientific Solaris qPCR Assay

PubMed Central

Ogrean, Christy; Jackson, Ben; Covino, James

2010-01-01

The Solaris qPCR Gene Expression Assay is a novel type of primer/probe set, designed to simplify the qPCR process while maintaining the sensitivity and accuracy of the assay. These primer/probe sets are pre-designed to >98% of the human and mouse genomes and feature significant improvements from previously available technologies. These improvements were made possible by virtue of a novel design algorithm, developed by Thermo Scientific bioinformatics experts. Several convenient features have been incorporated into the Solaris qPCR Assay to streamline the process of performing quantitative real-time PCR. First, the protocol is similar to commonly employed alternatives, so the methods used during qPCR are likely to be familiar. Second, the master mix is blue, which makes setting the qPCR reactions easier to track. Third, the thermal cycling conditions are the same for all assays (genes), making it possible to run many samples at a time and reducing the potential for error. Finally, the probe and primer sequence information are provided, simplifying the publication process. Here, we demonstrate how to obtain the appropriate Solaris reagents using the GENEius product search feature found on the ordering web site (www.thermo.com/solaris) and how to use the Solaris reagents for performing qPCR using the standard curve method. PMID:20567213

Sources of PCR-induced distortions in high-throughput sequencing data sets

PubMed Central

Kebschull, Justus M.; Zador, Anthony M.

2015-01-01

PCR permits the exponential and sequence-specific amplification of DNA, even from minute starting quantities. PCR is a fundamental step in preparing DNA samples for high-throughput sequencing. However, there are errors associated with PCR-mediated amplification. Here we examine the effects of four important sources of error—bias, stochasticity, template switches and polymerase errors—on sequence representation in low-input next-generation sequencing libraries. We designed a pool of diverse PCR amplicons with a defined structure, and then used Illumina sequencing to search for signatures of each process. We further developed quantitative models for each process, and compared predictions of these models to our experimental data. We find that PCR stochasticity is the major force skewing sequence representation after amplification of a pool of unique DNA amplicons. Polymerase errors become very common in later cycles of PCR but have little impact on the overall sequence distribution as they are confined to small copy numbers. PCR template switches are rare and confined to low copy numbers. Our results provide a theoretical basis for removing distortions from high-throughput sequencing data. In addition, our findings on PCR stochasticity will have particular relevance to quantification of results from single cell sequencing, in which sequences are represented by only one or a few molecules. PMID:26187991

Pre-amplification in the context of high-throughput qPCR gene expression experiment.

PubMed

Korenková, Vlasta; Scott, Justin; Novosadová, Vendula; Jindřichová, Marie; Langerová, Lucie; Švec, David; Šídová, Monika; Sjöback, Robert

2015-03-11

With the introduction of the first high-throughput qPCR instrument on the market it became possible to perform thousands of reactions in a single run compared to the previous hundreds. In the high-throughput reaction, only limited volumes of highly concentrated cDNA or DNA samples can be added. This necessity can be solved by pre-amplification, which became a part of the high-throughput experimental workflow. Here, we focused our attention on the limits of the specific target pre-amplification reaction and propose the optimal, general setup for gene expression experiment using BioMark instrument (Fluidigm). For evaluating different pre-amplification factors following conditions were combined: four human blood samples from healthy donors and five transcripts having high to low expression levels; each cDNA sample was pre-amplified at four cycles (15, 18, 21, and 24) and five concentrations (equivalent to 0.078 ng, 0.32 ng, 1.25 ng, 5 ng, and 20 ng of total RNA). Factors identified as critical for a success of cDNA pre-amplification were cycle of pre-amplification, total RNA concentration, and type of gene. The selected pre-amplification reactions were further tested for optimal Cq distribution in a BioMark Array. The following concentrations combined with pre-amplification cycles were optimal for good quality samples: 20 ng of total RNA with 15 cycles of pre-amplification, 20x and 40x diluted; and 5 ng and 20 ng of total RNA with 18 cycles of pre-amplification, both 20x and 40x diluted. We set up upper limits for the bulk gene expression experiment using gene expression Dynamic Array and provided an easy-to-obtain tool for measuring of pre-amplification success. We also showed that variability of the pre-amplification, introduced into the experimental workflow of reverse transcription-qPCR, is lower than variability caused by the reverse transcription step.

An integrated, self-contained microfluidic cassette for isolation, amplification, and detection of nucleic acids

PubMed Central

Chen, Dafeng; Mauk, Michael; Qiu, Xianbo; Liu, Changchun; Kim, Jitae; Ramprasad, Sudhir; Ongagna, Serge; Abrams, William R.; Malamud, Daniel; Corstjens, Paul L. A. M.

2010-01-01

A self-contained, integrated, disposable, sample-to-answer, polycarbonate microfluidic cassette for nucleic acid—based detection of pathogens at the point of care was designed, constructed, and tested. The cassette comprises on-chip sample lysis, nucleic acid isolation, enzymatic amplification (polymerase chain reaction and, when needed, reverse transcription), amplicon labeling, and detection. On-chip pouches and valves facilitate fluid flow control. All the liquids and dry reagents needed for the various reactions are pre-stored in the cassette. The liquid reagents are stored in flexible pouches formed on the chip surface. Dry (RT-)PCR reagents are pre-stored in the thermal cycling, reaction chamber. The process operations include sample introduction; lysis of cells and viruses; solid-phase extraction, concentration, and purification of nucleic acids from the lysate; elution of the nucleic acids into a thermal cycling chamber and mixing with pre-stored (RT-)PCR dry reagents; thermal cycling; and detection. The PCR amplicons are labeled with digoxigenin and biotin and transmitted onto a lateral flow strip, where the target analytes bind to a test line consisting of immobilized avidin-D. The immobilized nucleic acids are labeled with up-converting phosphor (UCP) reporter particles. The operation of the cassette is automatically controlled by an analyzer that provides pouch and valve actuation with electrical motors and heating for the thermal cycling. The functionality of the device is demonstrated by detecting the presence of bacterial B.Cereus, viral armored RNA HIV, and HIV I virus in saliva samples. The cassette and actuator described here can be used to detect other diseases as well as the presence of bacterial and viral pathogens in the water supply and other fluids. PMID:20401537

An integrated, self-contained microfluidic cassette for isolation, amplification, and detection of nucleic acids.

PubMed

Chen, Dafeng; Mauk, Michael; Qiu, Xianbo; Liu, Changchun; Kim, Jitae; Ramprasad, Sudhir; Ongagna, Serge; Abrams, William R; Malamud, Daniel; Corstjens, Paul L A M; Bau, Haim H

2010-08-01

A self-contained, integrated, disposable, sample-to-answer, polycarbonate microfluidic cassette for nucleic acid-based detection of pathogens at the point of care was designed, constructed, and tested. The cassette comprises on-chip sample lysis, nucleic acid isolation, enzymatic amplification (polymerase chain reaction and, when needed, reverse transcription), amplicon labeling, and detection. On-chip pouches and valves facilitate fluid flow control. All the liquids and dry reagents needed for the various reactions are pre-stored in the cassette. The liquid reagents are stored in flexible pouches formed on the chip surface. Dry (RT-)PCR reagents are pre-stored in the thermal cycling, reaction chamber. The process operations include sample introduction; lysis of cells and viruses; solid-phase extraction, concentration, and purification of nucleic acids from the lysate; elution of the nucleic acids into a thermal cycling chamber and mixing with pre-stored (RT-)PCR dry reagents; thermal cycling; and detection. The PCR amplicons are labeled with digoxigenin and biotin and transmitted onto a lateral flow strip, where the target analytes bind to a test line consisting of immobilized avidin-D. The immobilized nucleic acids are labeled with up-converting phosphor (UCP) reporter particles. The operation of the cassette is automatically controlled by an analyzer that provides pouch and valve actuation with electrical motors and heating for the thermal cycling. The functionality of the device is demonstrated by detecting the presence of bacterial B.Cereus, viral armored RNA HIV, and HIV I virus in saliva samples. The cassette and actuator described here can be used to detect other diseases as well as the presence of bacterial and viral pathogens in the water supply and other fluids.

Suppression of LH during ovarian stimulation: analysing threshold values and effects on ovarian response and the outcome of assisted reproduction in down-regulated women stimulated with recombinant FSH.

PubMed

Balasch, J; Vidal, E; Peñarrubia, J; Casamitjana, R; Carmona, F; Creus, M; Fábregues, F; Vanrell, J A

2001-08-01

It has been recently suggested that gonadotrophin-releasing hormone agonist down-regulation in some normogonadotrophic women may result in profound suppression of LH concentrations, impairing adequate oestradiol synthesis and IVF and pregnancy outcome. The aims of this study, where receiver-operating characteristic (ROC) analysis was used, were: (i) to assess the usefulness of serum LH measurement on stimulation day 7 (S7) as a predictor of ovarian response, IVF outcome, implantation, and the outcome of pregnancy in patients treated with recombinant FSH under pituitary suppression; and (ii) to define the best threshold value, if any, to discriminate between women with 'low' or 'normal' LH concentrations. A total of 144 infertile women undergoing IVF/intracytoplasmic sperm injection (ICSI) treatment were included. Seventy-two consecutive patients having a positive pregnancy test (including 58 ongoing pregnancies and 14 early pregnancy losses) were initially selected. As a control non-pregnant group, the next non-conception IVF/ICSI cycle after each conceptual cycle in our assisted reproduction programme was used. The median and range of LH values in non-conception cycles, conception cycles, ongoing pregnancies, and early pregnancy losses, clearly overlapped. ROC analysis showed that serum LH concentration on S7 was unable to discriminate between conception and non-conception cycles (AUC(ROC) = 0.52; 95% CI: 0.44 to 0.61) or ongoing pregnancy versus early pregnancy loss groups (AUC(ROC) = 0.59; 95% CI: 0.46 to 0.70). To assess further the potential impact of suppressed concentrations of circulating LH during ovarian stimulation on the outcome of IVF/ICSI treatment, the three threshold values of mid-follicular serum LH proposed in the literature (<1, < or =0.7, <0.5 IU/l) to discriminate between women with 'low' or 'normal' LH were applied to our study population. No significant differences were found with respect to ovarian response, IVF/ICSI outcome, implantation, and the outcome of pregnancy between 'low' and 'normal' S7 LH women as defined by those threshold values. Our results do not support the need for additional exogenous LH supplementation in down-regulated women receiving a recombinant FSH-only preparation.

Long-range Coulomb effect in above-threshold ionization of Ne subject to few-cycle and multicycle laser fields

NASA Astrophysics Data System (ADS)

Xu, SongPo; Quan, Wei; Chen, YongJu; Xiao, ZhiLei; Wang, YanLan; Kang, HuiPeng; Hua, LinQiang; Gong, Cheng; Lai, XuanYang; Liu, XiaoJun; Hao, XiaoLei; Hu, ShiLin; Chen, Jing

2017-06-01

The long-range Coulomb effect (LRCE) is demonstrated experimentally and theoretically by investigating the pulse duration dependence of low-energy structure (LES) in above-threshold ionization of Ne. It is found experimentally that at 800 nm the LES shows itself as a double-hump structure (DHS) in momentum distribution of singly charged ion for Ne, and moreover, this structure is more prominent for multicycle laser fields than for few-cycle cases. This result can be reproduced and explained qualitatively with a semiclassical model and attributed to the paramount role of LRCE. That is to say, after the laser field vanishes, the electrons decelerate while flying away from the core by the long-range tail of Coulomb potential, which eventually makes DHS less notable.

Sensitivity of a low threshold directional detector to CNO-cycle solar neutrinos

NASA Astrophysics Data System (ADS)

Bonventre, R.; Orebi Gann, G. D.

2018-06-01

A first measurement of neutrinos from the CNO fusion cycle in the Sun would allow a resolution to the current solar metallicity problem. Detection of these low-energy neutrinos requires a low-threshold detector, while discrimination from radioactive backgrounds in the region of interest is significantly enhanced via directional sensitivity. This combination can be achieved in a water-based liquid scintillator target, which offers enhanced energy resolution beyond a standard water Cherenkov detector. We study the sensitivity of such a detector to CNO neutrinos under various detector and background scenarios, and draw conclusions about the requirements for such a detector to successfully measure the CNO neutrino flux. A detector designed to measure CNO neutrinos could also achieve a few-percent measurement of pep neutrinos.

Nonlinear climatic sensitivity to greenhouse gases over past 4 glacial/interglacial cycles.

PubMed

Lo, Li; Chang, Sheng-Pu; Wei, Kuo-Yen; Lee, Shih-Yu; Ou, Tsong-Hua; Chen, Yi-Chi; Chuang, Chih-Kai; Mii, Horng-Sheng; Burr, George S; Chen, Min-Te; Tung, Ying-Hung; Tsai, Meng-Chieh; Hodell, David A; Shen, Chuan-Chou

2017-07-04

The paleoclimatic sensitivity to atmospheric greenhouse gases (GHGs) has recently been suggested to be nonlinear, however a GHG threshold value associated with deglaciation remains uncertain. Here, we combine a new sea surface temperature record spanning the last 360,000 years from the southern Western Pacific Warm Pool with records from five previous studies in the equatorial Pacific to document the nonlinear relationship between climatic sensitivity and GHG levels over the past four glacial/interglacial cycles. The sensitivity of the responses to GHG concentrations rises dramatically by a factor of 2-4 at atmospheric CO 2 levels of >220 ppm. Our results suggest that the equatorial Pacific acts as a nonlinear amplifier that allows global climate to transition from deglacial to full interglacial conditions once atmospheric CO 2 levels reach threshold levels.

Sensitive, microliter PCR with consensus degenerate primers for Epstein Barr virus amplification

PubMed Central

Oh, Kyudam; Pak, Nikita; Saunders, D. Curtis; Conrardy, Christina; Landers, James P.; Tong, Suxiang; Forest, Craig R.

2016-01-01

Sensitive identification of the etiology of viral diseases is key to implementing appropriate prevention and treatment. The gold standard for virus identification is the polymerase chain reaction (PCR), a technique that allows for highly specific and sensitive detection of pathogens by exponentially amplifying a specific region of DNA from as little as a single copy through thermocycling a biochemical cocktail. Today, molecular biology laboratories use commercial instruments that operate in 0.5–2 h/analysis using reaction volumes of 5–50 μL contained within polymer tubes or chambers. Towards reducing this volume and maintaining performance, we present a semi-quantitative, systematic experimental study of how PCR yield is affected by tube/chamber substrate, surface-area-to-volume ratio (SA:V), and passivation methods. We perform PCR experiments using traditional PCR tubes as well as using disposable polymer microchips with 1 μL reaction volumes thermocycled using water baths. We report the first oil encapsulation microfluidic PCR method without fluid flow and its application to the first microfluidic amplification of Epstein Barr virus using consensus degenerate primers, a powerful and broad PCR method to screen for both known and novel members of a viral family. The limit of detection is measured as 140 starting copies of DNA from a starting concentration of 3×105 copies/mL, regarded as an accepted sensitivity threshold for diagnostic purposes, and reaction specificity was improved as compared to conventional methods. Also notable, these experiments were conducted with conventional reagent concentrations, rather than commonly spiked enzyme and/or template mixtures. This experimental study of the effects of substrate, SA:V, and passivation, together with sensitive and specific microfluidic PCR with consensus degenerate primers represent advances towards lower cost and higher throughput pathogen screening. PMID:23080522

Diagnosis of Pneumocystis jirovecii Pneumonia in Immunocompromised Patients by Real-Time PCR: a 4-Year Prospective Study

PubMed Central

Belaz, Sorya; Revest, Matthieu; Tattevin, Pierre; Jouneau, Stéphane; Decaux, Olivier; Chevrier, Sylviane; Le Tulzo, Yves; Gangneux, Jean-Pierre

2014-01-01

Pneumocystis jirovecii pneumonia (PCP) is a life-threatening infection in immunocompromised patients. Quantitative real-time PCR (qPCR) is more sensitive than microscopic examination for the detection of P. jirovecii but also detects colonized patients. Hence, its positive predictive value (PPV) needs evaluation. In this 4-year prospective observational study, all immunocompromised patients with acute respiratory symptoms who were investigated for PCP were included, totaling 659 patients (814 bronchoalveolar lavage fluid samples). Patients with negative microscopy but positive qPCR were classified through medical chart review as having retained PCP, possible PCP, or colonization, and their clinical outcomes were compared to those of patients with microscopically proven PCP. Overall, 119 patients were included for analysis, of whom 35, 41, and 43 were classified as having retained PCP, possible PCP, and colonization, respectively. The 35 patients with retained PCP had clinical findings similar to those with microscopically proven PCP but lower fungal loads (P < 0.001) and were mainly non-HIV-infected patients (P < 0.05). Although the mean amplification threshold was higher in colonized patients, it was not possible to determine a discriminant qPCR cutoff. The PPV of qPCR in patients with negative microscopy were 29.4% and 63.8% when considering retained PCP and retained plus possible PCP, respectively. Patients with possible PCP had a higher mortality rate than patients with retained PCP or colonization (63% versus 3% and 16%, respectively); patients who died had not received co-trimoxazole. In conclusion, qPCR is a useful tool to diagnose PCP in non-HIV patients, and treatment might be better targeted through a multicomponent algorithm including both clinical/radiological parameters and qPCR results. PMID:25009050

Population size estimation in Yellowstone wolves with error-prone noninvasive microsatellite genotypes.

PubMed

Creel, Scott; Spong, Goran; Sands, Jennifer L; Rotella, Jay; Zeigle, Janet; Joe, Lawrence; Murphy, Kerry M; Smith, Douglas

2003-07-01

Determining population sizes can be difficult, but is essential for conservation. By counting distinct microsatellite genotypes, DNA from noninvasive samples (hair, faeces) allows estimation of population size. Problems arise because genotypes from noninvasive samples are error-prone, but genotyping errors can be reduced by multiple polymerase chain reaction (PCR). For faecal genotypes from wolves in Yellowstone National Park, error rates varied substantially among samples, often above the 'worst-case threshold' suggested by simulation. Consequently, a substantial proportion of multilocus genotypes held one or more errors, despite multiple PCR. These genotyping errors created several genotypes per individual and caused overestimation (up to 5.5-fold) of population size. We propose a 'matching approach' to eliminate this overestimation bias.

Phosphorylation of mitogen-activated protein kinase (MAPK) is required for cytokinesis and progression of cell cycle in tobacco BY-2 cells.

PubMed

Ma, Zhaowu; Yu, Guanghui

2010-02-15

The role of mitogen-activated protein kinase (MAPK) in plant cytokinesis remains largely uncharacterized. To elucidate its role, tobacco Bright Yellow-2 (BY-2) cells have been synchronized using a two-step procedure, and the different phases of the cell cycle identified by Histone 4 gene expression and the mitotic index. MAPK expression was analyzed by semi-quantitative (SQ) RT-PCR and protein gel blot analysis for phosphorylated MAPK during cell cycle progression. The SQ RT-PCR analysis indicated that MAPK expression is lower in mitosis than in interphase (G1, G2 and S). However, the amount of phosphorylated MAPK remained stable throughout the cell cycle, indicating that MAPK activity is predominantly regulated at the post-translational level and that phosphorylation of MAPK plays an important role in mitosis. Application of the specific MAPK phosphorylation inhibitor U0126 revealed that while U0126 treatment decreases the phosphorylation of MAPK and the progression from telophase to early cytokinesis is significantly inhibited. The formation of the phragmoplast is also negatively affected at this stage. These results demonstrate that MAPK phosphorylation is involved in the formation of the cell plate within the phragmoplast during cytokinesis and that MAPK predominantly functions during the cytokinesis stage of the cell cycle in tobacco BY-2 cells. Copyright 2009 Elsevier GmbH. All rights reserved.

Numerical exploration of Kaldorian interregional macrodynamics: stability and the trade threshold for business cycles under fixed exchange rates.

PubMed

Asada, Toichiro; Douskos, Christos; Markellos, Panagiotis

2011-01-01

The stability of equilibrium and the possibility of generation of business cycles in a discrete interregional Kaldorian macrodynamic model with fixed exchange rates are explored using numerical methods. One of the aims is to illustrate the feasibility and effectiveness of the numerical approach for dynamical systems of moderately high dimensionality and several parameters. The model considered is five-dimensional with four parameters, the speeds of adjustment of the goods markets and the degrees of economic interactions between the regions through trade and capital movement. Using a grid search method for the determination of the region of stability of equilibrium in two-dimensional parameter subspaces, and coefficient criteria for the flip bifurcation - and Hopf bifurcation - curve, we determine the stability region in several parameter ranges and identify Hopf bifurcation curves when they exist. It is found that interregional cycles emerge only for sufficient interregional trade. The relevant threshold is predicted by the model at 14 - 16 % of trade transactions. By contrast, no minimum level of capital mobility exists in a global sense as a requirement for the emergence of interregional cycles; the main conclusion being, therefore, that cycles may occur for very low levels of capital mobility if trade is sufficient. Examples of bifurcation and Lyapunov exponent diagrams illustrating the occurrence of cycles or period doubling, and examples of the development of the occurring cycles, are given. Both supercritical and subcritical bifurcations are found to occur, the latter type indicating coexistence of a point and a cyclical attractor.

AMPLIFICATION OF RIBOSOMAL RNA SEQUENCES - Book Chapter

EPA Science Inventory

This book chapter contains the following headings and subheadings: Introduction; Experimental Approach - Precautions, Template, Primers, Reaction Conditions, Enhancers, Post Amplification; Procedures - Template DNA, Basic PCR, Thermal Cycle Parameters, Enzyme Addition, Agarose Ge...

Ontogenetic improvement of visual function in the medaka Oryzias latipes based on an optomotor testing system for larval and adult fish

USGS Publications Warehouse

Carvalho, Paulo S. M.; Noltie, Douglas B.; Tillitt, D.E.

2002-01-01

We developed a system for evaluation of visual function in larval and adult fish. Both optomotor (swimming) and optokinetic (eye movement) responses were monitored and recorded using a system of rotating stripes. The system allowed manipulation of factors such as width of the stripes used, rotation speed of the striped drum, and light illuminance levels within both the scotopic and photopic ranges. Precise control of these factors allowed quantitative measurements of visual acuity and motion detection. Using this apparatus, we tested the hypothesis that significant posthatch ontogenetic improvements in visual function occur in the medaka Oryzias latipes, and also that this species shows significant in ovo neuronal development. Significant improvements in the acuity angle alpha (ability to discriminate detail) were observed from approximately 5 degrees at hatch to 1 degree in the oldest adult stages. In addition, we measured a significant improvement in flicker fusion thresholds (motion detection skills) between larval and adult life stages within both the scotopic and photopic ranges of light illuminance. Ranges of flicker fusion thresholds (X±SD) at log I=1.96 (photopic) varied from 37.2±1.6 cycles/s in young adults to 18.6±1.6 cycles/s in young larvae 10 days posthatch. At log I=−2.54 (scotopic), flicker fusion thresholds varied from 5.8±0.7 cycles/s in young adults to 1.7±0.4 cycles/s in young larvae 10 days posthatch. Light sensitivity increased approximately 2.9 log units from early hatched larval stages to adults. The demonstrated ontogenetic improvements in visual function probably enable the fish to explore new resources, thereby enlarging their fundamental niche.

Advances of the reverse lactate threshold test: Non-invasive proposal based on heart rate and effect of previous cycling experience

PubMed Central

2018-01-01

Our first aim was to compare the anaerobic threshold (AnT) determined by the incremental protocol with the reverse lactate threshold test (RLT), investigating the previous cycling experience effect. Secondarily, an alternative RLT application based on heart rate was proposed. Two groups (12 per group-according to cycling experience) were evaluated on cycle ergometer. The incremental protocol started at 25 W with increments of 25 W at each 3 minutes, and the AnT was calculated by bissegmentation, onset of blood lactate concentration and maximal deviation methods. The RLT was applied in two phases: a) lactate priming segment; and b) reverse segment; the AnT (AnTRLT) was calculated based on a second order polynomial function. The AnT from the RLT was calculated based on the heart rate (AnTRLT-HR) by the second order polynomial function. In regard of the Study 1, most of statistical procedures converged for similarity between the AnT determined from the bissegmentation method and AnTRLT. For 83% of non-experienced and 75% of experienced subjects the bias was 4% and 2%, respectively. In Study 2, no difference was found between the AnTRLT and AnTRLT-HR. For 83% of non-experienced and 91% of experienced subjects, the bias between AnTRLT and AnTRLT-HR was similar (i.e. 6%). In summary, the AnT determined by the incremental protocol and RLT are consistent. The AnT can be determined during the RLT via heart rate, improving its applicability. However, future studies are required to improve the agreement between variables. PMID:29534108

Lymphocyte density determined by computational pathology validated as a predictor of response to neoadjuvant chemotherapy in breast cancer: secondary analysis of the ARTemis trial.

PubMed

Ali, H R; Dariush, A; Thomas, J; Provenzano, E; Dunn, J; Hiller, L; Vallier, A-L; Abraham, J; Piper, T; Bartlett, J M S; Cameron, D A; Hayward, L; Brenton, J D; Pharoah, P D P; Irwin, M J; Walton, N A; Earl, H M; Caldas, C

2017-08-01

We have previously shown lymphocyte density, measured using computational pathology, is associated with pathological complete response (pCR) in breast cancer. The clinical validity of this finding in independent studies, among patients receiving different chemotherapy, is unknown. The ARTemis trial randomly assigned 800 women with early stage breast cancer between May 2009 and January 2013 to three cycles of docetaxel, followed by three cycles of fluorouracil, epirubicin and cyclophosphamide once every 21 days with or without four cycles of bevacizumab. The primary endpoint was pCR (absence of invasive cancer in the breast and lymph nodes). We quantified lymphocyte density within haematoxylin and eosin (H&E) whole slide images using our previously described computational pathology approach: for every detected lymphocyte the average distance to the nearest 50 lymphocytes was calculated and the density derived from this statistic. We analyzed both pre-treatment biopsies and post-treatment surgical samples of the tumour bed. Of the 781 patients originally included in the primary endpoint analysis of the trial, 609 (78%) were included for baseline lymphocyte density analyses and a subset of 383 (49% of 781) for analyses of change in lymphocyte density. The main reason for loss of patients was the availability of digitized whole slide images. Pre-treatment lymphocyte density modelled as a continuous variable was associated with pCR on univariate analysis (odds ratio [OR], 2.92; 95% CI, 1.78-4.85; P < 0.001) and after adjustment for clinical covariates (OR, 2.13; 95% CI, 1.24-3.67; P = 0.006). Increased pre- to post-treatment lymphocyte density showed an independent inverse association with pCR (adjusted OR, 0.1; 95% CI, 0.033-0.31; P < 0.001). Lymphocyte density in pre-treatment biopsies was validated as an independent predictor of pCR in breast cancer. Computational pathology is emerging as a viable and objective means of identifying predictive biomarkers for cancer patients. NCT01093235. © The Author 2017. Published by Oxford University Press on behalf of the European Society for Medical Oncology.

Comparison of the Performances of Five Primer Sets for the Detection and Quantification of Plasmodium in Anopheline Vectors by Real-Time PCR.

PubMed

Chaumeau, V; Andolina, C; Fustec, B; Tuikue Ndam, N; Brengues, C; Herder, S; Cerqueira, D; Chareonviriyaphap, T; Nosten, F; Corbel, V

2016-01-01

Quantitative real-time polymerase chain reaction (qrtPCR) has made a significant improvement for the detection of Plasmodium in anopheline vectors. A wide variety of primers has been used in different assays, mostly adapted from molecular diagnosis of malaria in human. However, such an adaptation can impact the sensitivity of the PCR. Therefore we compared the sensitivity of five primer sets with different molecular targets on blood stages, sporozoites and oocysts standards of Plasmodium falciparum (Pf) and P. vivax (Pv). Dilution series of standard DNA were used to discriminate between methods at low concentrations of parasite and to generate standard curves suitable for the absolute quantification of Plasmodium sporozoites. Our results showed that the best primers to detect blood stages were not necessarily the best ones to detect sporozoites. Absolute detection threshold of our qrtPCR assay varied between 3.6 and 360 Pv sporozoites and between 6 and 600 Pf sporozoites per mosquito according to the primer set used in the reaction mix. In this paper, we discuss the general performance of each primer set and highlight the need to use efficient detection methods for transmission studies.

Comparison of the Performances of Five Primer Sets for the Detection and Quantification of Plasmodium in Anopheline Vectors by Real-Time PCR

PubMed Central

Chaumeau, V.; Andolina, C.; Fustec, B.; Tuikue Ndam, N.; Brengues, C.; Herder, S.; Cerqueira, D.; Chareonviriyaphap, T.; Nosten, F.; Corbel, V.

2016-01-01

Quantitative real-time polymerase chain reaction (qrtPCR) has made a significant improvement for the detection of Plasmodium in anopheline vectors. A wide variety of primers has been used in different assays, mostly adapted from molecular diagnosis of malaria in human. However, such an adaptation can impact the sensitivity of the PCR. Therefore we compared the sensitivity of five primer sets with different molecular targets on blood stages, sporozoites and oocysts standards of Plasmodium falciparum (Pf) and P. vivax (Pv). Dilution series of standard DNA were used to discriminate between methods at low concentrations of parasite and to generate standard curves suitable for the absolute quantification of Plasmodium sporozoites. Our results showed that the best primers to detect blood stages were not necessarily the best ones to detect sporozoites. Absolute detection threshold of our qrtPCR assay varied between 3.6 and 360 Pv sporozoites and between 6 and 600 Pf sporozoites per mosquito according to the primer set used in the reaction mix. In this paper, we discuss the general performance of each primer set and highlight the need to use efficient detection methods for transmission studies. PMID:27441839

The safest parameters for FUS-induced blood-brain barrier opening without effects on the opening volume

NASA Astrophysics Data System (ADS)

Tung, Yao-Sheng; Olumolade, Yemi; Wang, Shutao; Wu, Shih-Ying; Konofagou, Elisa E.

2012-11-01

Acoustic cavitation has been identified as the main physical mechanism for the focused ultrasound (FUS) induced blood-brain barrier (BBB) opening. In this paper, the mechanism of stable cavitation (SC) and inertial cavitation (IC) responsible for BBB opening was investigated. Thirty-three (n=33) mice were intravenously injected with bubbles of 4-5 μm in diameter. The right hippocampus was then sonicated using focused 1.5-MHz ultrasound and three different studies were carried out. First, pulse lengths (PLs) of 0.1, 0.5, 2, and 5 ms at 0.18- MPa peak rarefactional pressure with 5-Hz pulse repetition frequency (PRF) and 5-minute duration were used to identify the threshold of PL using SC. Second, the effects of the duty cycle and exposure time were investigated. Third, the BBB opening size was compared between the SC and the IC. In the case of IC-induced BBB opening, a burst sequence (3-cycles PL; 5-Hz burst repetition frequency (BRF); 30 s duration) at 0.45 MPa was applied. Passive cavitation detection was performed with each sonication to detect whether a broadband response was obtained, i.e., if IC occurred, during BBB opening. The properties of BBB opening were measured through MRI. The threshold of PL for BBB opening was identified between 0.1 and 0.5 ms using SC, but the BBB can be opened in few cycles using IC. The BBB opening volume and normalized intensity increased with the PL, but reached saturation when the PL was above 2 ms. Once the PL threshold was reached, the same exposure time induced a similar BBB opening volume, but longer sonication duration induced higher MR intensity. The duty cycle was found not to play an important role on the BBB opening. Comparable BBB opening volume (20-25 mm3) could be reached between long PL (7500 cycles, i.e., 5 ms) at 0.18 MPa and 3 cycles at 0.45 MPa. 3-kDa fluorescently tagged dextran may be able to diffuse to the parenchyma after IC-induced BBB opening at 0.45 MPa but not after SC-induced BBB opening at 0.18 MPa.

Preparation of 13C/15N-labeled oligomers using the polymerase chain reaction

DOEpatents

Chen, Xian; Gupta, Goutam; Bradbury, E. Morton

2001-01-01

Preparation of .sup.13 C/.sup.15 N-labeled DNA oligomers using the polymerase chain reaction (PCR). A PCR based method for uniform (.sup.13 C/.sup.15 N)-labeling of DNA duplexes is described. Multiple copies of a blunt-ended duplex are cloned into a plasmid, each copy containing the sequence of interest and restriction Hinc II sequences at both the 5' and 3' ends. PCR using bi-directional primers and uniformly .sup.13 C/.sup.15 N-labeled dNTP precursors generates labeled DNA duplexes containing multiple copies of the sequence of interest. Twenty-four cycles of PCR, followed by restriction and purification, gave the uniformly .sup.13 C/.sup.15 N-labeled duplex sequence with a 30% yield. Such labeled duplexes find significant applications in multinuclear magnetic resonance spectroscopy.

Quantitative PCR estimates Angiostrongylus cantonensis (rat lungworm) infection levels in semi-slugs (Parmarion martensi)

PubMed Central

Jarvi, Susan I.; Farias, Margaret E.M.; Howe, Kay; Jacquier, Steven; Hollingsworth, Robert; Pitt, William

2013-01-01

The life cycle of the nematode Angiostrongylus cantonensis involves rats as the definitive host and slugs and snails as intermediate hosts. Humans can become infected upon ingestion of intermediate or paratenic (passive carrier) hosts containing stage L3 A. cantonensis larvae. Here, we report a quantitative PCR (qPCR) assay that provides a reliable, relative measure of parasite load in intermediate hosts. Quantification of the levels of infection of intermediate hosts is critical for determining A. cantonensis intensity on the Island of Hawaii. The identification of high intensity infection ‘hotspots’ will allow for more effective targeted rat and slug control measures. qPCR appears more efficient and sensitive than microscopy and provides a new tool for quantification of larvae from intermediate hosts, and potentially from other sources as well. PMID:22902292

A prospectively validated nomogram for predicting the risk of chemotherapy-induced febrile neutropenia: a multicenter study.

PubMed

Bozcuk, H; Yıldız, M; Artaç, M; Kocer, M; Kaya, Ç; Ulukal, E; Ay, S; Kılıç, M P; Şimşek, E H; Kılıçkaya, P; Uçar, S; Coskun, H S; Savas, B

2015-06-01

There is clinical need to predict risk of febrile neutropenia before a specific cycle of chemotherapy in cancer patients. Data on 3882 chemotherapy cycles in 1089 consecutive patients with lung, breast, and colon cancer from four teaching hospitals were used to construct a predictive model for febrile neutropenia. A final nomogram derived from the multivariate predictive model was prospectively confirmed in a second cohort of 960 consecutive cases and 1444 cycles. The following factors were used to construct the nomogram: previous history of febrile neutropenia, pre-cycle lymphocyte count, type of cancer, cycle of current chemotherapy, and patient age. The predictive model had a concordance index of 0.95 (95 % confidence interval (CI) = 0.91-0.99) in the derivation cohort and 0.85 (95 % CI = 0.80-0.91) in the external validation cohort. A threshold of 15 % for the risk of febrile neutropenia in the derivation cohort was associated with a sensitivity of 0.76 and specificity of 0.98. These figures were 1.00 and 0.49 in the validation cohort if a risk threshold of 50 % was chosen. This nomogram is helpful in the prediction of febrile neutropenia after chemotherapy in patients with lung, breast, and colon cancer. Usage of this nomogram may help decrease the morbidity and mortality associated with febrile neutropenia and deserves further validation.

Reduction of In-Stent Restenosis Risk on Nickel-Free Stainless Steel by Regulating Cell Apoptosis and Cell Cycle

PubMed Central

Li, Liming; Pan, Shuang; Zhou, Xiaohang; Meng, Xin; Han, Xiaoxi; Ren, Yibin; Yang, Ke; Guan, Yifu

2013-01-01

High nitrogen nickel-free austenitic stainless steel (HNNF SS) is one of the biomaterials developed recently for circumventing the in-stent restenosis (ISR) in coronary stent applications. To understand the ISR-resistance mechanism, we have conducted a comparative study of cellular and molecular responses of human umbilical vein endothelial cells (HUVECs) to HNNF SS and 316L SS (nickel-containing austenitic 316L stainless steel) which is the stent material used currently. CCK-8 analysis and flow cytometric analysis were used to assess the cellular responses (proliferation, apoptosis, and cell cycle), and quantitative real-time PCR (qRT-PCR) was used to analyze the gene expression profile of HUVECs exposed to HNNF SS and 316L SS, respectively. Flow cytometry analysis revealed that 316L SS could activate the cellular apoptosis more efficiently and initiate an earlier entry into the S-phase of cell cycle than HNNF SS. At the molecular level, qRT-PCR results showed that the genes regulating cell apoptosis and autophagy were overexpressed on 316L SS. Further examination indicated that nickel released from 316L SS triggered the cell apoptosis via Fas-Caspase8-Caspase3 exogenous pathway. These molecular mechanisms of HUVECs present a good model for elucidating the observed cellular responses. The findings in this study furnish valuable information for understanding the mechanism of ISR-resistance on the cellular and molecular basis as well as for developing new biomedical materials for stent applications. PMID:23638002

Multi response optimization of internal grinding process parameters for outer ring using Taguchi method and PCR-TOPSIS

NASA Astrophysics Data System (ADS)

Wisnuadi, Alief Regyan; Damayanti, Retno Wulan; Pujiyanto, Eko

2018-02-01

Bearing is one of the most widely used parts in automotive industry. One of the leading bearing manufacturing companies in the world is SKF Indonesia. This company must produce bearing with international standard. SKF Indonesia must do continuous improvement in order to face competition. During this time, SKF Indonesia is only performing quality control at its Quality Assurance department. In other words, quality improvement at SKF Indonesia has not been done thoroughly. The purpose of this research is to improve quality of outer ring product at SKF Indonesia by conducting an internal grinding process experiment about setting speed ratio, fine position, and spark out grinding time. The specific purpose of this experiment is to optimize some quality responses such as roughness, roundness, and cycle time. All of the response in this experiment were smaller the better. Taguchi method and PCR-TOPSIS are used for the optimization process. The result of this research shows that by using Taguchi method and PCR-TOPSIS, the optimum condition occurs on speed ratio 36, fine position 18 µm/s and spark out 0.5 s. The optimum conditions result were roughness 0.398 µm, roundness 1.78 µm and cycle time 8.1 s. This results have been better than the previous results and meet the standards. The roughness of 0.523 µm decrease to 0.398 µm and the average cycle time of 8.5 s decrease to 8.1 s.

ReadqPCR and NormqPCR: R packages for the reading, quality checking and normalisation of RT-qPCR quantification cycle (Cq) data

PubMed Central

2012-01-01

Background Measuring gene transcription using real-time reverse transcription polymerase chain reaction (RT-qPCR) technology is a mainstay of molecular biology. Technologies now exist to measure the abundance of many transcripts in parallel. The selection of the optimal reference gene for the normalisation of this data is a recurring problem, and several algorithms have been developed in order to solve it. So far nothing in R exists to unite these methods, together with other functions to read in and normalise the data using the chosen reference gene(s). Results We have developed two R/Bioconductor packages, ReadqPCR and NormqPCR, intended for a user with some experience with high-throughput data analysis using R, who wishes to use R to analyse RT-qPCR data. We illustrate their potential use in a workflow analysing a generic RT-qPCR experiment, and apply this to a real dataset. Packages are available from http://www.bioconductor.org/packages/release/bioc/html/ReadqPCR.htmland http://www.bioconductor.org/packages/release/bioc/html/NormqPCR.html Conclusions These packages increase the repetoire of RT-qPCR analysis tools available to the R user and allow them to (amongst other things) read their data into R, hold it in an ExpressionSet compatible R object, choose appropriate reference genes, normalise the data and look for differential expression between samples. PMID:22748112

Cytomegalovirus (CMV) DNA quantification in bronchoalveolar lavage fluid of immunocompromised patients with CMV pneumonia.

PubMed

Beam, Elena; Germer, Jeffrey J; Lahr, Brian; Yao, Joseph D C; Limper, Andrew Harold; Binnicker, Matthew J; Razonable, Raymund R

2018-01-01

Cytomegalovirus (CMV) pneumonia causes major morbidity and mortality. Its diagnosis requires demonstration of viral cytopathic changes in tissue, entailing risks of lung biopsy. This study aimed to determine CMV viral load (VL) thresholds in bronchoalveolar lavage fluid (BALF) for diagnosis of CMV pneumonia in immunocompromised patients. CMV VL in BALF was studied in 17 patients (83% transplant recipients) and 21 control subjects with and without CMV pneumonia, respectively, using an FDA-approved PCR assay (Cobas ® AmpliPrep/Cobas TaqMan ® CMV Test, Roche Molecular Systems, Inc.) calibrated to the WHO International Standard for CMV DNA (NIBSC: 09/162). Receiver operating characteristic curve analysis produced a BALF CMV VL threshold of 34 800, IU/mL with 91.7% sensitivity and 100.0% specificity for diagnosis of possible, probable, and proven CMV pneumonia in transplant patients, while a threshold of 656 000 IU/mL yielded 100% sensitivity and specificity among biopsy-proven cases. For all immunocompromised patients, a VL threshold of 274 IU/mL was selected. VL thresholds also were normalized to BALF cell count yielding a threshold of 0.32 IU/10 6 cells with 91.7% sensitivity and 90.5% specificity for possible, probable, and proven CMV pneumonia in transplant recipients. Monitoring CMV VL in BALF may be a less invasive method for diagnosing CMV pneumonia in immunocompromised patients. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Rapid PCR amplification using a microfluidic device with integrated microwave heating and air impingement cooling.

PubMed

Shaw, Kirsty J; Docker, Peter T; Yelland, John V; Dyer, Charlotte E; Greenman, John; Greenway, Gillian M; Haswell, Stephen J

2010-07-07

A microwave heating system is described for performing polymerase chain reaction (PCR) in a microfluidic device. The heating system, in combination with air impingement cooling, provided rapid thermal cycling with heating and cooling rates of up to 65 degrees C s(-1) and minimal over- or under-shoot (+/-0.1 degrees C) when reaching target temperatures. In addition, once the required temperature was reached it could be maintained with an accuracy of +/-0.1 degrees C. To demonstrate the functionality of the system, PCR was successfully performed for the amplification of the Amelogenin locus using heating rates and quantities an order of magnitude faster and smaller than current commercial instruments.

Multiplexed target detection using DNA-binding dye chemistry in droplet digital PCR.

PubMed

McDermott, Geoffrey P; Do, Duc; Litterst, Claudia M; Maar, Dianna; Hindson, Christopher M; Steenblock, Erin R; Legler, Tina C; Jouvenot, Yann; Marrs, Samuel H; Bemis, Adam; Shah, Pallavi; Wong, Josephine; Wang, Shenglong; Sally, David; Javier, Leanne; Dinio, Theresa; Han, Chunxiao; Brackbill, Timothy P; Hodges, Shawn P; Ling, Yunfeng; Klitgord, Niels; Carman, George J; Berman, Jennifer R; Koehler, Ryan T; Hiddessen, Amy L; Walse, Pramod; Bousse, Luc; Tzonev, Svilen; Hefner, Eli; Hindson, Benjamin J; Cauly, Thomas H; Hamby, Keith; Patel, Viresh P; Regan, John F; Wyatt, Paul W; Karlin-Neumann, George A; Stumbo, David P; Lowe, Adam J

2013-12-03

Two years ago, we described the first droplet digital PCR (ddPCR) system aimed at empowering all researchers with a tool that removes the substantial uncertainties associated with using the analogue standard, quantitative real-time PCR (qPCR). This system enabled TaqMan hydrolysis probe-based assays for the absolute quantification of nucleic acids. Due to significant advancements in droplet chemistry and buoyed by the multiple benefits associated with dye-based target detection, we have created a "second generation" ddPCR system compatible with both TaqMan-probe and DNA-binding dye detection chemistries. Herein, we describe the operating characteristics of DNA-binding dye based ddPCR and offer a side-by-side comparison to TaqMan probe detection. By partitioning each sample prior to thermal cycling, we demonstrate that it is now possible to use a DNA-binding dye for the quantification of multiple target species from a single reaction. The increased resolution associated with partitioning also made it possible to visualize and account for signals arising from nonspecific amplification products. We expect that the ability to combine the precision of ddPCR with both DNA-binding dye and TaqMan probe detection chemistries will further enable the research community to answer complex and diverse genetic questions.

Micro flow-through PCR in a PMMA chip fabricated by KrF excimer laser.

PubMed

Yao, Liying; Liu, Baoan; Chen, Tao; Liu, Shibing; Zuo, Tiechuan

2005-09-01

As the third PCR technology, micro flow-through PCR chip can amplify DNA specifically in an exponential fashion in vitro. Nowadays many academies in the world have successfully amplified DNA using their own-made flow-through PCR chip. In this paper, the ablation principle of PMMA at 248 nm excimer laser was studied, then a PMMA based flow-through PCR chip with 20 cycles was fabricated by excimer laser at 19 kv and 18 mm/min. The chip was bonded together with another cover chip at 105( composite function)C, 160 N and 20 minutes. In the end, it was integrated with electrical thermal thin films and Pt 100 temperature sensors. The temperature controllers was built standard PID digital temperature controller, the temperature control precision was +/- 0.2( composite function)C. The temperature grads between the three temperature zones were 16.5 and 22.2( composite function)C respectively, the gaps between the temperature zones could realize heat insulation.

Improvement of DGGE analysis by modifications of PCR protocols for analysis of microbial community members with low abundance.

PubMed

Wang, Yong-Feng; Zhang, Fang-Qiu; Gu, Ji-Dong

2014-06-01

Denaturing gradient gel electrophoresis (DGGE) is a powerful technique to reveal the community structures and composition of microorganisms in complex natural environments and samples. However, positive and reproducible polymerase chain reaction (PCR) products, which are difficult to acquire for some specific samples due to low abundance of the target microorganisms, significantly impair the effective applications of DGGE. Thus, nested PCR is often introduced to generate positive PCR products from the complex samples, but one problem is also introduced: The total number of thermocycling in nested PCR is usually unacceptably high, which results in skewed community structures by generation of random or mismatched PCR products on the DGGE gel, and this was demonstrated in this study. Furthermore, nested PCR could not resolve the uneven representative issue with PCR products of complex samples with unequal richness of microbial population. In order to solve the two problems in nested PCR, the general protocol was modified and improved in this study. Firstly, a general PCR procedure was used to amplify the target genes with the PCR primers without any guanine cytosine (GC) clamp, and then, the resultant PCR products were purified and diluted to 0.01 μg ml(-1). Subsequently, the diluted PCR products were utilized as templates to amplify again with the same PCR primers with the GC clamp for 17 cycles, and the products were finally subjected to DGGE analysis. We demonstrated that this is a much more reliable approach to obtain a high quality DGGE profile with high reproducibility. Thus, we recommend the adoption of this improved protocol in analyzing microorganisms of low abundance in complex samples when applying the DGGE fingerprinting technique to avoid biased results.

Rapamycin causes growth arrest and inhibition of invasion in human chondrosarcoma cells.

PubMed

Song, Jian; Wang, Xiaobo; Zhu, Jiaxue; Liu, Jun

2016-01-01

Chondrosarcoma is a highly malignant tumor that is characterized by a potent capacity to invade locally and cause distant metastasis and notable for its lack of response to conventional chemotherapy or radiotherapy. Rapamycin, the inhibitor of mammalian target of rapamycin (mTOR), is a valuable drug with diverse clinical applications and regulates many cellular processes. However, the effects of rapamycin on cell growth and invasion of human chondrosarcoma cells are not well known. We determined the effect of rapamycin on cell proliferation, cell cycle arrest and invasion by using MTS, flow cytometry and invasion assays in two human chondrosarcoma cell lines, SW1353 and JJ012. Cell cycle regulatory and invasion-related genes' expression analysis was performed by quantitative RT-PCR (qRT-PCR). We also evaluated the effect of rapamycin on tumor growth by using mice xenograph models. Rapamycin significantly inhibited the cell proliferation, induced cell cycle arrest and decreased the invasion ability of human chondrosarcoma cells. Meanwhile, rapamycin modulated the cell cycle regulatory and invasion-related genes' expression. Furthermore, the tumor growth of mice xenograph models with human chondrosarcoma cells was significantly inhibited by rapamycin. These results provided further insight into the role of rapamycin in chondrosarcoma. Therefore, rapamycin targeted therapy may be a potential treatment strategy for chondrosarcoma.

Robustness of equations that define molecular subtypes of glioblastoma tumors based on five transcripts measured by RT-PCR.

PubMed

Castells, Xavier; Acebes, Juan José; Majós, Carles; Boluda, Susana; Julià-Sapé, Margarida; Candiota, Ana Paula; Ariño, Joaquín; Barceló, Anna; Arús, Carles

2015-01-01

Glioblastoma (Gb) is one of the most deadly tumors. Its molecular subtypes are yet to be fully characterized while the attendant efforts for personalized medicine need to be intensified in relation to glioblastoma diagnosis, treatment, and prognosis. Several molecular signatures based on gene expression microarrays were reported, but the use of microarrays for routine clinical practice is challenged by attendant economic costs. Several authors have proposed discriminant equations based on RT-PCR. Still, the discriminant threshold is often incompletely described, which makes proper validation difficult. In a previous work, we have reported two Gb subtypes based on the expression levels of four genes: CHI3L1, LDHA, LGALS1, and IGFBP3. One Gb subtype presented with low expression of the four genes mentioned, and of MGMT in a large portion of the patients (with anticipated high methylation of its promoter), and mutated IDH1. Here, we evaluate the robustness of the equations fitted with these genes using RT-PCR values in a set of 64 cases and importantly, define an unequivocal discriminant threshold with a view to prognostic implications. We developed two approaches to generate the discriminant equations: 1) using the expression level of the four genes mentioned above, and 2) using those genes displaying the highest correlation with survival among the aforementioned four ones, plus MGMT, as an attempt to further reduce the number of genes. The ease of equations' applicability, reduction in cost for raw data, and robustness in terms of resampling-based classification accuracy warrant further evaluation of these equations to discern Gb tumor biopsy heterogeneity at molecular level, diagnose potential malignancy, and prognosis of individual patients with glioblastomas.

Meta-analysis on the association between pathologic complete response and triple-negative breast cancer after neoadjuvant chemotherapy.

PubMed

Wu, Kunpeng; Yang, Qiaozhu; Liu, Yi; Wu, Aibing; Yang, Zhixiong

2014-04-15

Triple-negative breast cancer (TNBC) is a special subtype of breast cancer that is characterized by poor prognosis, strong tumor invasion and a high pathologic complete response (pCR) to neoadjuvant chemotherapy (NAC). The pCR rate is a prognostic factor for TNBC. We aimed to evaluate the relationship between pCR and TNBC after NAC and originally tried to identify factors related to achieving pCR for TNBC using a meta-analysis. We systematically searched the literature for pCR and breast cancer after NAC and carefully identified eligibility criteria. The association between pCR and breast cancer subtypes was estimated using Review Manager, while pCR rates for TNBC and non-TNBC were determined using Meta-Analyst. This analysis included a total of 9,460 cases from 27 studies. The summary odds ratio estimating the relationship between pCR and breast cancer subtypes (TNBC vs non-TNBC) was 3.02 (95% confidence interval (CI), 2.66 to 3.42). The TNBC pCR rate was 28.9% (95% CI, 27.0 to 30.8%) and the non-TNBC was 12.5% (95% CI, 11.7 to 13.4%). From subgroup analyses, we identified the factors associated with the highest pCR rates for TNBC. TNBC has a higher pCR rate than non-TNBC. In the NAC setting, these factors of platinum-containing, more than six cycles, four kinds of drugs, 16 weeks' treatment duration and sequential chemotherapy may contribute to increasing the pCR rate.

COMplementary Primer ASymmetric PCR (COMPAS-PCR) Applied to the Identification of Salmo salar, Salmo trutta and Their Hybrids

PubMed Central

2016-01-01

Avoiding complementarity between primers when designing a PCR assay constitutes a central rule strongly anchored in the mind of the molecular scientist. 3’-complementarity will extend the primers during PCR elongation using one another as template, consequently disabling further possible involvement in traditional target amplification. However, a 5’-complementarity will leave the primers unchanged during PCR cycles, albeit sequestered to one another, therefore also suppressing target amplification. We show that 5’-complementarity between primers may be exploited in a new PCR method called COMplementary-Primer-Asymmetric (COMPAS)-PCR, using asymmetric primer concentrations to achieve target PCR amplification. Moreover, such a design may paradoxically reduce spurious non-target amplification by actively sequestering the limiting primer. The general principles were demonstrated using 5S rDNA direct repeats as target sequences to design a species-specific assay for identifying Salmo salar and Salmo trutta using almost fully complementary primers overlapping the same target sequence. Specificity was enhanced by using 3’-penultimate point mutations and the assay was further developed to enable identification of S. salar x S. trutta hybrids by High Resolution Melt analysis in a 35 min one-tube assay. This small paradigm shift, using highly complementary primers for PCR, should help develop robust assays that previously would not be considered. PMID:27783658

Smart sensing to drive real-time loads scheduling algorithm in a domotic architecture

NASA Astrophysics Data System (ADS)

Santamaria, Amilcare Francesco; Raimondo, Pierfrancesco; De Rango, Floriano; Vaccaro, Andrea

2014-05-01

Nowadays the focus on power consumption represent a very important factor regarding the reduction of power consumption with correlated costs and the environmental sustainability problems. Automatic control load based on power consumption and use cycle represents the optimal solution to costs restraint. The purpose of these systems is to modulate the power request of electricity avoiding an unorganized work of the loads, using intelligent techniques to manage them based on real time scheduling algorithms. The goal is to coordinate a set of electrical loads to optimize energy costs and consumptions based on the stipulated contract terms. The proposed algorithm use two new main notions: priority driven loads and smart scheduling loads. The priority driven loads can be turned off (stand by) according to a priority policy established by the user if the consumption exceed a defined threshold, on the contrary smart scheduling loads are scheduled in a particular way to don't stop their Life Cycle (LC) safeguarding the devices functions or allowing the user to freely use the devices without the risk of exceeding the power threshold. The algorithm, using these two kind of notions and taking into account user requirements, manages loads activation and deactivation allowing the completion their operation cycle without exceeding the consumption threshold in an off-peak time range according to the electricity fare. This kind of logic is inspired by industrial lean manufacturing which focus is to minimize any kind of power waste optimizing the available resources.

Office-Cycling: A Promising Way to Raise Pain Thresholds and Increase Metabolism with Minimal Compromising of Work Performance

PubMed Central

Nyberg, André; Hedlund, Mattias; Häger, Charlotte K.; McDonough, Suzanne; Björklund, Martin

2018-01-01

Aim Establishing the effects of low intensity cycling (LC), moderate intensity cycling (MC), and standing at a simulated office workstation on pain modulation, work performance, and metabolic expenditure. Methods 36 healthy adults (21 females), mean age 26.8 (SD 7.6) years, partook in this randomized 3 × 3 crossover trial with 75 minutes of LC on 20% of maximum aerobic power (MAP) output, 30 minutes of MC on 50% of MAP, and standing 30 minutes with 48-hour wash-out periods. Outcome measures were pain modulation (pressure pain threshold (PPT) and thermal pain threshold)), work performance (transcription, mouse pointing, and cognitive performance), and metabolic expenditure. Results PPTs increased in all conditions. PPT trapezius showed the highest increase after LC, 39.3 kilopascals (kPa) (15.6; 78.6), compared to MC, 17.0 kPa (2.8; 49.9), and standing, 16.8 kPa (−5.6; 39.4), p = 0.015. Transcription was reduced during LC and MC. Mouse pointing precision was best during standing and worst and slowest during MC. Cognitive performance did not differ between conditions. Metabolic expenditure rates were 1.4 (1.3; 1.7), 3.3 (2.3; 3.7), and 7.5 (5.8; 8.7) kcal/minute during standing, LC, and MC, respectively (p < 0.001). Conclusions LC seems to be the preferred option; it raised PPTs, more than doubled metabolic expenditure, whilst minimally influencing work performance. PMID:29607323

A dysbiosis index to assess microbial changes in fecal samples of dogs with chronic inflammatory enteropathy.

PubMed

AlShawaqfeh, M K; Wajid, B; Minamoto, Y; Markel, M; Lidbury, J A; Steiner, J M; Serpedin, E; Suchodolski, J S

2017-11-01

Recent studies have identified various bacterial groups that are altered in dogs with chronic inflammatory enteropathies (CE) compared to healthy dogs. The study aim was to use quantitative PCR (qPCR) assays to confirm these findings in a larger number of dogs, and to build a mathematical algorithm to report these microbiota changes as a dysbiosis index (DI). Fecal DNA from 95 healthy dogs and 106 dogs with histologically confirmed CE was analyzed. Samples were grouped into a training set and a validation set. Various mathematical models and combination of qPCR assays were evaluated to find a model with highest discriminatory power. The final qPCR panel consisted of eight bacterial groups: total bacteria, Faecalibacterium, Turicibacter, Escherichia coli, Streptococcus, Blautia, Fusobacterium and Clostridium hiranonis. The qPCR-based DI was built based on the nearest centroid classifier, and reports the degree of dysbiosis in a single numerical value that measures the closeness in the l2 - norm of the test sample to the mean prototype of each class. A negative DI indicates normobiosis, whereas a positive DI indicates dysbiosis. For a threshold of 0, the DI based on the combined dataset achieved 74% sensitivity and 95% specificity to separate healthy and CE dogs. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

[Experimental study and clinical application of rapid diagnosis of systemic candida albicans infection in burns by polymerase chain reaction].

PubMed

Deng, G; Zhang, Y; Xiao, G

1995-09-01

For rapid diagnosis of systemic candidiasis, the polymerase chain reaction (PCR) was used to amplify a segment of Candida albican DNA coding for the cytochrome P450 L1 A1 in vitro. The technique provided unambiguous evidence of the presence of Candida albicans in as short as 8 hours with a detection threshold of 20 organisms. 200 blood and 120 urine specimens were collected from thirty rabbits with burn and candidiasis. Specimens of blood (n = 6), urine (n = 6), sputum (n = 7) and wound exudate (n = 7) were also collected from eight serious burn patients. PCR technique was used in all the specimens, and the result was compared with conventional fungus culture. It was shown that: (1) The positive detection rate of Candida by PCR was significantly higher than by culture for blood specimens (P < 0.01) and serial specimens of urine (P < 0.05) in infected burn animals. The clinical specimens showed the same results; (2) In evaluating diagnostic value of PCR for systemic Candida albicans infection, it was found that sensitivity, accuracy and negative prediction rate were superior to the conventional culture method. These results suggest that PCR technic may provide a rapid sensitive and specific means for the diagnosis of systemic Candida albicans infection. In addition, it may be helpful in the evaluation of therapeutic response or recurrence of infection.

A novel approach for human whole transcriptome analysis based on absolute gene expression of microarray data

PubMed Central

Bikel, Shirley; Jacobo-Albavera, Leonor; Sánchez-Muñoz, Fausto; Cornejo-Granados, Fernanda; Canizales-Quinteros, Samuel; Soberón, Xavier; Sotelo-Mundo, Rogerio R.; del Río-Navarro, Blanca E.; Mendoza-Vargas, Alfredo; Sánchez, Filiberto

2017-01-01

Background In spite of the emergence of RNA sequencing (RNA-seq), microarrays remain in widespread use for gene expression analysis in the clinic. There are over 767,000 RNA microarrays from human samples in public repositories, which are an invaluable resource for biomedical research and personalized medicine. The absolute gene expression analysis allows the transcriptome profiling of all expressed genes under a specific biological condition without the need of a reference sample. However, the background fluorescence represents a challenge to determine the absolute gene expression in microarrays. Given that the Y chromosome is absent in female subjects, we used it as a new approach for absolute gene expression analysis in which the fluorescence of the Y chromosome genes of female subjects was used as the background fluorescence for all the probes in the microarray. This fluorescence was used to establish an absolute gene expression threshold, allowing the differentiation between expressed and non-expressed genes in microarrays. Methods We extracted the RNA from 16 children leukocyte samples (nine males and seven females, ages 6–10 years). An Affymetrix Gene Chip Human Gene 1.0 ST Array was carried out for each sample and the fluorescence of 124 genes of the Y chromosome was used to calculate the absolute gene expression threshold. After that, several expressed and non-expressed genes according to our absolute gene expression threshold were compared against the expression obtained using real-time quantitative polymerase chain reaction (RT-qPCR). Results From the 124 genes of the Y chromosome, three genes (DDX3Y, TXLNG2P and EIF1AY) that displayed significant differences between sexes were used to calculate the absolute gene expression threshold. Using this threshold, we selected 13 expressed and non-expressed genes and confirmed their expression level by RT-qPCR. Then, we selected the top 5% most expressed genes and found that several KEGG pathways were significantly enriched. Interestingly, these pathways were related to the typical functions of leukocytes cells, such as antigen processing and presentation and natural killer cell mediated cytotoxicity. We also applied this method to obtain the absolute gene expression threshold in already published microarray data of liver cells, where the top 5% expressed genes showed an enrichment of typical KEGG pathways for liver cells. Our results suggest that the three selected genes of the Y chromosome can be used to calculate an absolute gene expression threshold, allowing a transcriptome profiling of microarray data without the need of an additional reference experiment. Discussion Our approach based on the establishment of a threshold for absolute gene expression analysis will allow a new way to analyze thousands of microarrays from public databases. This allows the study of different human diseases without the need of having additional samples for relative expression experiments. PMID:29230367

Long Noncoding RNA PANDA Positively Regulates Proliferation of Osteosarcoma Cells.

PubMed

Kotake, Yojiro; Goto, Taiki; Naemura, Madoka; Inoue, Yasutoshi; Okamoto, Haruna; Tahara, Keiichiro

2017-01-01

A long noncoding RNA, p21-associated ncRNA DNA damage-activated (PANDA), associates with nuclear transcription factor Y subunit alpha (NF-YA) and inhibits its binding to promoters of apoptosis-related genes, thereby repressing apoptosis in normal human fibroblasts. Here, we show that PANDA is involved in regulating proliferation in the U2OS human osteosarcoma cell line. U2OS cells were transfected with siRNAs against PANDA 72 h later and they were subjected to reverse transcription-polymerase chain reaction (RT-PCR), quantitative RT-PCR and cell-cycle analysis. PANDA was highly expressed in U2OS cells, and its expression was induced by DNA damage. Silencing PANDA caused arrest at the G 1 phase of the cell cycle, leading to inhibition of cell proliferation. Quantitative RT-PCR showed that silencing PANDA increased mRNA levels of the cyclin-dependent kinase inhibitor p18, which caused G 1 phase arrest. These results suggest that PANDA promotes G 1 -S transition by repressing p18 transcription, and thus promotes U2OS cell proliferation. Copyright© 2017 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics

PubMed Central

Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David

2014-01-01

Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas. PMID:24553130

Expression of the nifH Gene of a Herbaspirillum Endophyte in Wild Rice Species: Daily Rhythm during the Light-Dark Cycle

PubMed Central

You, Mu; Nishiguchi, Tomohiro; Saito, Asami; Isawa, Tsuyoshi; Mitsui, Hisayuki; Minamisawa, Kiwamu

2005-01-01

The expression of nitrogenase genes of Herbaspirillum sp. B501 associated in shoot (leaf and stem) of wild rice, Oryza officinalis, was studied by means of reverse transcription-PCR (RT-PCR) targeted at the nifH gene. RT-PCR analyses indicate that nifH transcript was detected exclusively from nitrogen-fixing cells of gfp-tagged strain B501gfp1 in both free-living and endophytic states by using a constitutive gfp gene transcript as a positive control. Transcription of nifH and nitrogen fixation in free-living cells were induced maximally at a 2% O2 concentration and repressed in free air (21% O2). nifH transcription was monitored in the endophytic cells by using total RNA extracted from B501gfp1-inoculated wild rice plants during daily light-dark cycles. The level of nifH transcription in planta varied dramatically, with a maximum during the light period. Moreover, the light radiation enhanced nifH expression even in free-living cells grown in culture. These results suggest that in planta nitrogen fixation by the endophyte shows a daily rhythm determined by the plant's light environment. PMID:16332801

Phase- and intensity-resolved measurements of above threshold ionization by few-cycle pulses

NASA Astrophysics Data System (ADS)

Kübel, M.; Arbeiter, M.; Burger, C.; Kling, Nora G.; Pischke, T.; Moshammer, R.; Fennel, T.; Kling, M. F.; Bergues, B.

2018-07-01

We investigate the carrier-envelope phase (CEP) and intensity dependence of the longitudinal momentum distribution of photoelectrons resulting from above threshold ionization of argon by few-cycle laser pulses. The intensity of the pulses with a center wavelength of 750 nm is varied in a range between 0.7 × 1014 and 5.5× {10}14 {{W}} {cm}}-2. Our measurements reveal a prominent maximum in the CEP-dependent asymmetry at photoelectron energies of 2 U P (U P being the ponderomotive potential), that is persistent over the entire intensity range. Further local maxima are observed around 0.3 and 0.8 U P. The experimental results are in good agreement with theoretical results obtained by solving the three-dimensional time-dependent Schrödinger equation. We show that for few-cycle pulses, the amplitude of the CEP-dependent asymmetry provides a reliable measure for the peak intensity on target. Moreover, the measured asymmetry amplitude exhibits an intensity-dependent interference structure at low photoelectron energy, which could be used to benchmark model potentials for complex atoms.

SYBR green-based real-time reverse transcription-PCR for typing and subtyping of all hemagglutinin and neuraminidase genes of avian influenza viruses and comparison to standard serological subtyping tests.

PubMed

Tsukamoto, Kenji; Panei, Carlos Javier; Javier, Panei Carlos; Shishido, Makiko; Noguchi, Daigo; Pearce, John; Kang, Hyun-Mi; Jeong, Ok Mi; Lee, Youn-Jeong; Nakanishi, Koji; Ashizawa, Takayoshi

2012-01-01

Continuing outbreaks of H5N1 highly pathogenic (HP) avian influenza virus (AIV) infections of wild birds and poultry worldwide emphasize the need for global surveillance of wild birds. To support the future surveillance activities, we developed a SYBR green-based, real-time reverse transcriptase PCR (rRT-PCR) for detecting nucleoprotein (NP) genes and subtyping 16 hemagglutinin (HA) and 9 neuraminidase (NA) genes simultaneously. Primers were improved by focusing on Eurasian or North American lineage genes; the number of mixed-base positions per primer was set to five or fewer, and the concentration of each primer set was optimized empirically. Also, 30 cycles of amplification of 1:10 dilutions of cDNAs from cultured viruses effectively reduced minor cross- or nonspecific reactions. Under these conditions, 346 HA and 345 NA genes of 349 AIVs were detected, with average sensitivities of NP, HA, and NA genes of 10(1.5), 10(2.3), and 10(3.1) 50% egg infective doses, respectively. Utility of rRT-PCR for subtyping AIVs was compared with that of current standard serological tests by using 104 recent migratory duck virus isolates. As a result, all HA genes and 99% of the NA genes were genetically subtyped, while only 45% of HA genes and 74% of NA genes were serologically subtyped. Additionally, direct subtyping of AIVs in fecal samples was possible by 40 cycles of amplification: approximately 70% of HA and NA genes of NP gene-positive samples were successfully subtyped. This validation study indicates that rRT-PCR with optimized primers and reaction conditions is a powerful tool for subtyping varied AIVs in clinical and cultured samples.

Understanding the meaning of lactate threshold in resistance exercises.

PubMed

Garnacho-Castaño, M V; Dominguez, R; Maté-Muñoz, J L

2015-05-01

This study compares acute cardiorespiratory, metabolic, mechanical and rating of perceived effort (RPE) responses to 2 different prolonged constant-load exercises, half-squat (HS) and cycle ergometry, performed at a workload corresponding to the lactate threshold (LT). A total of 18 healthy subjects completed 5 exercise tests separated by 48 h rest periods: an incremental cycle ergometer test, a constant-load cycle ergometer test at LT intensity, a one-repetition maximum (1RM) HS test, an incremental HS test and a constant-load HS test at LT intensity. In both constant-load tests, cardiorespiratory, metabolic and RPE data were recorded. Mechanical responses before and after each test were assessed in terms of jump height and mean power measured in a counter movement jump (CMJ) test. In both exercises, cardiorespiratory and metabolic responses stabilized, though cardiorespiratory responses were significantly greater for cycle ergometry (P<0.001), with the exception of respiratory exchange ratio (RER), which was higher for HS (P=0.028). Mechanical fatigue was observed in only HS (P<0.001). In conclusion, different exercise modalities induced different yet stable acute cardiorespiratory and metabolic responses. Although such responses were significantly reduced in HS, greater mechanical fatigue was produced, most likely because of the particular muscle actions involved in this form of exercise. © Georg Thieme Verlag KG Stuttgart · New York.

Goodwin accelerator model revisited with fixed time delays

NASA Astrophysics Data System (ADS)

Matsumoto, Akio; Merlone, Ugo; Szidarovszky, Ferenc

2018-05-01

Dynamics of Goodwin's accelerator business cycle model is reconsidered. The model is characterized by a nonlinear accelerator and an investment time delay. The role of the nonlinearity for the birth of persistent oscillations is fully discussed in the existing literature. On the other hand, not much of the role of the delay has yet been revealed. The purpose of this paper is to show that the delay really matters. In the original framework of Goodwin [6], it is first demonstrated that there is a threshold value of the delay: limit cycles arise for smaller values than the threshold and so do sawtooth oscillations for larger values. In the extended framework in which a consumption or saving delay, in addition to the investment delay, is introduced, three main results are demonstrated under assumption of the identical length of investment and consumption delays. The dynamics with consumption delay is basically the same as that of the single delay model. Second, in the case of saving delay, the steady state can coexist with the stable and unstable limit cycles in the stable case. Third, in the unstable case, there is an interval of delay in which the limit cycle or the sawtooth oscillation emerges depending on the choice of the constant initial function.

Storage Thresholds for Relative Sea Level Signals in the Stratigraphic Record

NASA Astrophysics Data System (ADS)

Li, Q.; Yu, L.; Straub, K. M.

2015-12-01

Many argue that the tug of Relative Sea Level (RSL) change represents the most important allogenic forcing affecting deltas and is the primary control on stratigraphic architecture of deltas. However, the range of amplitudes and periodicities of RSL cycles stored in stratigraphy remains unknown. Here we use a suite of physical experiments to show that RSL cycles with magnitudes and periodicities less than the spatial and temporal scales of deltaic internal (autogenic) dynamics cannot confidently be extracted from the physical stratigraphic record. Additional analysis of deltaic morphodynamics also suggest no significant differences between an experiment with constant boundary conditions (control experiment) and an experiment with small magnitude and short periodicity RSL cycles, relative to the autogenic dynamics. Significant differences in the aspect ratio of channel bodies and deposit sand fractions do exists between our control experiment and those experiments with either large magnitudes or long periodicities RSL cycles. Using a compilation of data from major river delta systems, we show that our predicted thresholds for RSL signal storage often overlap with the magnitudes and periodicities of commonly discussed drivers of global sea level. This theory defines quantitative limits on the range of paleo-RSL information that can be extracted from the stratigraphic record, which could aid stratigraphic prediction and the inversion of stratigraphy for paleo- deltaic response to climate change.

Real-time PCR detection chemistry.

PubMed

Navarro, E; Serrano-Heras, G; Castaño, M J; Solera, J

2015-01-15

Real-time PCR is the method of choice in many laboratories for diagnostic and food applications. This technology merges the polymerase chain reaction chemistry with the use of fluorescent reporter molecules in order to monitor the production of amplification products during each cycle of the PCR reaction. Thus, the combination of excellent sensitivity and specificity, reproducible data, low contamination risk and reduced hand-on time, which make it a post-PCR analysis unnecessary, has made real-time PCR technology an appealing alternative to conventional PCR. The present paper attempts to provide a rigorous overview of fluorescent-based methods for nucleic acid analysis in real-time PCR described in the literature so far. Herein, different real-time PCR chemistries have been classified into two main groups; the first group comprises double-stranded DNA intercalating molecules, such as SYBR Green I and EvaGreen, whereas the second includes fluorophore-labeled oligonucleotides. The latter, in turn, has been divided into three subgroups according to the type of fluorescent molecules used in the PCR reaction: (i) primer-probes (Scorpions, Amplifluor, LUX, Cyclicons, Angler); (ii) probes; hydrolysis (TaqMan, MGB-TaqMan, Snake assay) and hybridization (Hybprobe or FRET, Molecular Beacons, HyBeacon, MGB-Pleiades, MGB-Eclipse, ResonSense, Yin-Yang or displacing); and (iii) analogues of nucleic acids (PNA, LNA, ZNA, non-natural bases: Plexor primer, Tiny-Molecular Beacon). In addition, structures, mechanisms of action, advantages and applications of such real-time PCR probes and analogues are depicted in this review. Copyright © 2014 Elsevier B.V. All rights reserved.

Extended PCR conditions to reduce drop-out frequencies in low template STR typing including unequal mixtures.

PubMed

Weiler, Natalie E C; Matai, Anuska S; Sijen, Titia

2012-01-01

Forensic laboratories employ various approaches to obtain short tandem repeat (STR) profiles from minimal traces (<100 pg DNA input). Most approaches aim to sensitize DNA profiling by increasing the amplification level by a higher cycle number or enlarging the amount of PCR products analyzed during capillary electrophoresis. These methods have limitations when unequal mixtures are genotyped, since the major component will be over-amplified or over-loaded. This study explores an alternative strategy for improved detection of the minor components in low template (LT) DNA typing that may be better suited for the detection of the minor component in mixtures. The strategy increases the PCR amplification efficiency by extending the primer annealing time several folds. When the AmpFℓSTR(®) Identifiler(®) amplification parameters are changed to an annealing time of 20 min during all 28 cycles, the drop-out frequency is reduced for both pristine DNA and single or multiple donor mock case work samples. In addition, increased peak heights and slightly more drop-ins are observed while the heterozygous peak balance remains similar as with the conventional Identifiler protocol. By this extended protocol, full DNA profiles were obtained from only 12 sperm heads (which corresponds to 36 pg of DNA) that were collected by laser micro dissection. Notwithstanding the improved detection, allele drop-outs do persist, albeit in lower frequencies. Thus a LT interpretation strategy such as deducing consensus profiles from multiple independent amplifications is appropriate. The use of extended PCR conditions represents a general approach to improve detection of unequal mixtures as shown using four commercially available kits (AmpFℓSTR(®) Identifiler, SEfiler Plus, NGM and Yfiler). The extended PCR protocol seems to amplify more of the molecules in LT samples during PCR, which results in a lower drop-out frequency. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

A longitudinal study of Campylobacter distribution in a turkey production chain

PubMed Central

Perko-Mäkelä, Päivikki; Isohanni, Pauliina; Katzav, Marianne; Lund, Marianne; Hänninen, Marja-Liisa; Lyhs, Ulrike

2009-01-01

Background Campylobacter is the most common cause of bacterial enteritis worldwide. Handling and eating of contaminated poultry meat has considered as one of the risk factors for human campylobacteriosis.Campylobacter contamination can occur at all stages of a poultry production cycle. The objective of this study was to determine the occurrence of Campylobacter during a complete turkey production cycle which lasts for 1,5 years of time. For detection of Campylobacter, a conventional culture method was compared with a PCR method. Campylobacter isolates from different types of samples have been identified to the species level by a multiplex PCR assay. Methods Samples (N = 456) were regularly collected from one turkey parent flock, the hatchery, six different commercial turkey farms and from 11 different stages at the slaughterhouse. For the detection of Campylobacter, a conventional culture and a PCR method were used. Campylobacter isolates (n = 143) were identified to species level by a multiplex PCR assay. Results No Campylobacter were detected in either the samples from the turkey parent flock or from hatchery samples using the culture method. PCR detected Campylobacter DNA in five faecal samples and one fluff and eggshell sample. Six flocks out of 12 commercial turkey flocks where found negative at the farm level but only two were negative at the slaughterhouse. Conclusion During the brooding period Campylobacter might have contact with the birds without spreading of the contamination within the flock. Contamination of working surfaces and equipment during slaughter of a Campylobacter positive turkey flock can persist and lead to possible contamination of negative flocks even after the end of the day's cleaning and desinfection. Reduction of contamination at farm by a high level of biosecurity control and hygiene may be one of the most efficient ways to reduce the amount of contaminated poultry meat in Finland. Due to the low numbers of Campylobacter in the Finnish turkey production chain, enrichment PCR seems to be the optimal detection method here. PMID:19348687

Effects of acute hypoxia on the determination of anaerobic threshold using the heart rate-work rate relationships during incremental exercise tests.

PubMed

Ozcelik, O; Kelestimur, H

2004-01-01

Anaerobic threshold which describes the onset of systematic increase in blood lactate concentration is a widely used concept in clinical and sports medicine. A deflection point between heart rate-work rate has been introduced to determine the anaerobic threshold non-invasively. However, some researchers have consistently reported a heart rate deflection at higher work rates, while others have not. The present study was designed to investigate whether the heart rate deflection point accurately predicts the anaerobic threshold under the condition of acute hypoxia. Eight untrained males performed two incremental exercise tests using an electromagnetically braked cycle ergometer: one breathing room air and one breathing 12 % O2. The anaerobic threshold was estimated using the V-slope method and determined from the increase in blood lactate and the decrease in standard bicarbonate concentration. This threshold was also estimated by in the heart rate-work rate relationship. Not all subjects exhibited a heart rate deflection. Only two subjects in the control and four subjects in the hypoxia groups showed a heart rate deflection. Additionally, the heart rate deflection point overestimated the anaerobic threshold. In conclusion, the heart rate deflection point was not an accurate predictor of anaerobic threshold and acute hypoxia did not systematically affect the heart rate-work rate relationships.

S-phase arrest after vincristine treatment may promote hepatitis B virus replication

PubMed Central

Xu, Lei; Tu, Zeng; Xu, Ge; Hu, Jie-Li; Cai, Xue-Fei; Zhan, Xing-Xing; Wang, Yu-Wei; Huang, Yuan; Chen, Juan; Huang, Ai-Long

2015-01-01

AIM: To observe the effect of vincristine on hepatitis B virus (HBV) replication in vitro and to study its possible mechanisms. METHODS: Vincristine was added to the cultures of two cell lines stably expressing HBV. Then, the levels of hepatitis B surface antigen (HBsAg), hepatitis B e antigen (HBeAg), and hepatitis B core antigen (HBcAg) in the supernatants or cytoplasm were examined using by enzyme-linked immunosorbent assay and Western blot. The HBV pregenome RNA (pgRNA) was detected using reverse transcription-PCR and real-time fluorescent quantitative PCR (RT-qPCR), and viral DNA was detected using Southern blot and RT-qPCR. Cell proliferation after drug treatment was detected using the BrdU incorporation test and the trypan blue exclusion assay. Cell cycle and cell apoptosis were examined using flow cytometry and Western blot. RESULTS: Vincristine up-regulated HBV replication directly in vitro in a dose-dependent manner, and 24-h exposure to 0.1 μmol/L vincristine induced more than 4-fold and 3-fold increases in intracellular HBV DNA and the secretion of viral DNA, respectively. The expression of HBV pgRNA, intracellular HBsAg and HBcAg, and the secretion of HBeAg were also increased significantly after drug treatment. Most importantly, vincristine promoted the cell excretion of HBV nucleocapsids instead of HBV Dane particles, and the nucleocapsids are closely related to the HBV pathogenesis. Furthermore, vincristine inhibited the proliferation of cells stably expressing HBV. The higher the concentration of the drug, the more significant the inhibition of the cell proliferation and the stronger the HBV replication ability in cells. Flow cytometry indicated that cell cycle arrest at S-phase was responsible for the cell proliferation inhibition. CONCLUSION: Vincristine has a strong stimulatory effect on HBV replication and induces cell cycle arrest, and cell proliferation inhibition may be conducive to viral replication. PMID:25663769

A model for life predictions of nickel-base superalloys in high-temperature low cycle fatigue

NASA Technical Reports Server (NTRS)

Romanoski, Glenn R.; Pelloux, Regis M.; Antolovich, Stephen D.

1988-01-01

Extensive characterization of low-cycle fatigue damage mechanisms was performed on polycrystalline Rene 80 and IN100 tested in the temperature range from 871 to 1000 C. Low-cycle fatigue life was found to be dominated by propagation of microcracks to a critical size governed by the maximum tensile stress. A model was developed which incorporates a threshold stress for crack extension, a stress-based crack growth expression, and a failure criterion. The mathematical equivalence between this mechanistically based model and the strain-life low-cycle fatigue law was demonstrated using cyclic stress-strain relationships. The model was shown to correlate the high-temperature low-cycle fatigue data of the different nickel-base superalloys considered in this study.

International business cycle synchronization since the 1870s: Evidence from a novel network approach

NASA Astrophysics Data System (ADS)

Antonakakis, Nikolaos; Gogas, Periklis; Papadimitriou, Theophilos; Sarantitis, Georgios Antonios

2016-04-01

In this study, we examine the issue of business cycle synchronization from a historical perspective in 27 developed and developing countries. Based on a novel complex network approach, the Threshold-Minimum Dominating Set (T-MDS), our results reveal heterogeneous patterns of international business cycle synchronization during fundamental globalization periods since the 1870s. In particular, the proposed methodology reveals that worldwide business cycles de-coupled during the Gold Standard, though they were synchronized during the Great Depression. The Bretton Woods era was associated with a lower degree of synchronization as compared to that during the Great Depression, while worldwide business cycle synchronization increased to unprecedented levels during the latest period of floating exchange rates and the Great Recession.

Real space mapping of oxygen vacancy diffusion and electrochemical transformations by hysteretic current reversal curve measurements

DOEpatents

Kalinin, Sergei V.; Balke, Nina; Borisevich, Albina Y.; Jesse, Stephen; Maksymovych, Petro; Kim, Yunseok; Strelcov, Evgheni

2014-06-10

An excitation voltage biases an ionic conducting material sample over a nanoscale grid. The bias sweeps a modulated voltage with increasing maximal amplitudes. A current response is measured at grid locations. Current response reversal curves are mapped over maximal amplitudes of the bias cycles. Reversal curves are averaged over the grid for each bias cycle and mapped over maximal bias amplitudes for each bias cycle. Average reversal curve areas are mapped over maximal amplitudes of the bias cycles. Thresholds are determined for onset and ending of electrochemical activity. A predetermined number of bias sweeps may vary in frequency where each sweep has a constant number of cycles and reversal response curves may indicate ionic diffusion kinetics.

A Multiplex PCR for the Simultaneous Detection and Genotyping of the Echinococcus granulosus Complex

PubMed Central

Boubaker, Ghalia; Macchiaroli, Natalia; Prada, Laura; Cucher, Marcela A.; Rosenzvit, Mara C.; Ziadinov, Iskender; Deplazes, Peter; Saarma, Urmas; Babba, Hamouda; Gottstein, Bruno; Spiliotis, Markus

2013-01-01

Echinococcus granulosus is characterized by high intra-specific variability (genotypes G1–G10) and according to the new molecular phylogeny of the genus Echinococcus, the E. granulosus complex has been divided into E. granulosus sensu stricto (G1–G3), E. equinus (G4), E. ortleppi (G5), and E. canadensis (G6–G10). The molecular characterization of E. granulosus isolates is fundamental to understand the spatio-temporal epidemiology of this complex in many endemic areas with the simultaneous occurrence of different Echinococcus species and genotypes. To simplify the genotyping of the E. granulosus complex we developed a single-tube multiplex PCR (mPCR) allowing three levels of discrimination: (i) Echinococcus genus, (ii) E. granulosus complex in common, and (iii) the specific genotype within the E. granulosus complex. The methodology was established with known DNA samples of the different strains/genotypes, confirmed on 42 already genotyped samples (Spain: 22 and Bulgaria: 20) and then successfully applied on 153 unknown samples (Tunisia: 114, Algeria: 26 and Argentina: 13). The sensitivity threshold of the mPCR was found to be 5 ng Echinoccoccus DNA in a mixture of up to 1 µg of foreign DNA and the specificity was 100% when template DNA from closely related members of the genus Taenia was used. Additionally to DNA samples, the mPCR can be carried out directly on boiled hydatid fluid or on alkaline-lysed frozen or fixed protoscoleces, thus avoiding classical DNA extractions. However, when using Echinococcus eggs obtained from fecal samples of infected dogs, the sensitivity of the mPCR was low (<40%). Thus, except for copro analysis, the mPCR described here has a high potential for a worldwide application in large-scale molecular epidemiological studies on the Echinococcus genus. PMID:23350011

A multiplex PCR for the simultaneous detection and genotyping of the Echinococcus granulosus complex.

PubMed

Boubaker, Ghalia; Macchiaroli, Natalia; Prada, Laura; Cucher, Marcela A; Rosenzvit, Mara C; Ziadinov, Iskender; Deplazes, Peter; Saarma, Urmas; Babba, Hamouda; Gottstein, Bruno; Spiliotis, Markus

2013-01-01

Echinococcus granulosus is characterized by high intra-specific variability (genotypes G1-G10) and according to the new molecular phylogeny of the genus Echinococcus, the E. granulosus complex has been divided into E. granulosus sensu stricto (G1-G3), E. equinus (G4), E. ortleppi (G5), and E. canadensis (G6-G10). The molecular characterization of E. granulosus isolates is fundamental to understand the spatio-temporal epidemiology of this complex in many endemic areas with the simultaneous occurrence of different Echinococcus species and genotypes. To simplify the genotyping of the E. granulosus complex we developed a single-tube multiplex PCR (mPCR) allowing three levels of discrimination: (i) Echinococcus genus, (ii) E. granulosus complex in common, and (iii) the specific genotype within the E. granulosus complex. The methodology was established with known DNA samples of the different strains/genotypes, confirmed on 42 already genotyped samples (Spain: 22 and Bulgaria: 20) and then successfully applied on 153 unknown samples (Tunisia: 114, Algeria: 26 and Argentina: 13). The sensitivity threshold of the mPCR was found to be 5 ng Echinoccoccus DNA in a mixture of up to 1 µg of foreign DNA and the specificity was 100% when template DNA from closely related members of the genus Taenia was used. Additionally to DNA samples, the mPCR can be carried out directly on boiled hydatid fluid or on alkaline-lysed frozen or fixed protoscoleces, thus avoiding classical DNA extractions. However, when using Echinococcus eggs obtained from fecal samples of infected dogs, the sensitivity of the mPCR was low (<40%). Thus, except for copro analysis, the mPCR described here has a high potential for a worldwide application in large-scale molecular epidemiological studies on the Echinococcus genus.

Intravenous antibiotics reduce the presence of Aspergillus in adult cystic fibrosis sputum.

PubMed

Baxter, Caroline G; Rautemaa, Riina; Jones, Andrew M; Webb, A Kevin; Bull, Matthew; Mahenthiralingam, Eshwar; Denning, David W

2013-07-01

Pseudomonas aeruginosa and Aspergillus fumigatus frequently co-colonise the airways of patients with cystic fibrosis (CF). This study aimed to assess the impact of short-term administration of intravenous antipseudomonal antibiotics during CF exacerbations on the presence of Aspergillus. Pre- and post-antibiotic sputum samples from 26 adult patients with CF and chronic Pseudomonas colonisation were analysed for the presence of Aspergillus by fungal culture, real-time PCR and galactomannan antigen (GM). Lung function (forced expiratory volume in 1 s and forced vital capacity % predicted) and blood levels of total IgE, specific A fumigatus IgE and specific A fumigatus IgG were measured at the start and end of antibiotics. Respiratory viral real-time PCR and bacterial community profiling using ribosomal intergenic spacer analysis (RISA) were performed to estimate concurrent changes in the lung microbiome. Aspergillus PCR and GM were more sensitive than culture in detecting Aspergillus species (culture 8%, GM 31%, PCR 77%). There was a significant decline in the presence of Aspergillus, measured both by PCR and GM index, following antibacterial therapy (PCR: median increase in crossing threshold 1.7 (IQR 0.5-3.8), p<0.001; GM: median fall in GM index 0.7 (IQR 0.4-1.6), p=0.016). All patients improved clinically with a significant increase in lung function (p<0.0001). RISA community analysis showed large changes in bacterial community similarity in 67% of patients following antibiotics. Viral RT-PCR demonstrated the presence of a concurrent respiratory virus in 27% of patients. Intravenous antibiotics targeting Pseudomonas during CF pulmonary exacerbations have a negative impact on the presence of Aspergillus in sputum samples.

Polymerase chain displacement reaction.

PubMed

Harris, Claire L; Sanchez-Vargas, Irma J; Olson, Ken E; Alphey, Luke; Fu, Guoliang

2013-02-01

Quantitative PCR assays are now the standard method for viral diagnostics. These assays must be specific, as well as sensitive, to detect the potentially low starting copy number of viral genomic material. We describe a new technique, polymerase chain displacement reaction (PCDR), which uses multiple nested primers in a rapid, capped, one-tube reaction that increases the sensitivity of normal quantitative PCR (qPCR) assays. Sensitivity was increased by approximately 10-fold in a proof-of-principle test on dengue virus sequence. In PCDR, when extension occurs from the outer primer, it displaces the extension strand produced from the inner primer by utilizing a polymerase that has strand displacement activity. This allows a greater than 2-fold increase of amplification product for each amplification cycle and therefore increased sensitivity and speed over conventional PCR. Increased sensitivity in PCDR would be useful in nucleic acid detection for viral diagnostics.

High-throughput real-time quantitative reverse transcription PCR.

PubMed

Bookout, Angie L; Cummins, Carolyn L; Mangelsdorf, David J; Pesola, Jean M; Kramer, Martha F

2006-02-01

Extensive detail on the application of the real-time quantitative polymerase chain reaction (QPCR) for the analysis of gene expression is provided in this unit. The protocols are designed for high-throughput, 384-well-format instruments, such as the Applied Biosystems 7900HT, but may be modified to suit any real-time PCR instrument. QPCR primer and probe design and validation are discussed, and three relative quantitation methods are described: the standard curve method, the efficiency-corrected DeltaCt method, and the comparative cycle time, or DeltaDeltaCt method. In addition, a method is provided for absolute quantification of RNA in unknown samples. RNA standards are subjected to RT-PCR in the same manner as the experimental samples, thus accounting for the reaction efficiencies of both procedures. This protocol describes the production and quantitation of synthetic RNA molecules for real-time and non-real-time RT-PCR applications.

Evaluation of tolerability and efficacy of incorporating carboplatin in neoadjuvant anthracycline and taxane based therapy in a BRCA1 enriched triple-negative breast cancer cohort.

PubMed

Sella, Tal; Gal Yam, Einav Nili; Levanon, Keren; Rotenberg, Tal Shapira; Gadot, Moran; Kuchuk, Iryna; Molho, Rinat Bernstein; Itai, Amit; Modiano, Tami Mekel; Gold, Raya; Kaufman, Bella; Shimon, Shani Paluch

2018-05-22

The addition of carboplatin (Cb) to neoadjuvant chemotherapy in triple-negative breast cancer (TNBC) has been demonstrated to improve pathologic complete response (pCR) at the expense of increased toxicity. We aimed to evaluate the effectiveness and tolerability of dose-dense anthracycline & cyclophosphamide (ddAC) followed by weekly paclitaxel (wT) in combination with weekly Cb. Retrospective data was collected on patients with clinical stage I-III TNBC treated with neoadjuvant ddAC-wTCb (four cycles of ddA 60 mg/m 2 and ddC 600 mg/m 2 every 2 weeks followed by 12 cycles of wT 80 mg/m 2 with Cb AUC 1.5). Indices of tolerability and pCR were evaluated and compared to a historical cohort (n = 76) treated with ddAC-T. A secondary objective was to evaluate the rates of pCR by BRCA status. For 43 eligible patients, mean age was 41.5 years, 51% had clinical stage II disease, 81.4% were clinically node positive and 32.6% carried a deleterious BRCA1 mutation. Only 35% completed all scheduled doses of chemotherapy. Grade 3/4 neutropenia was observed in 42.5% of patients. Overall pCR was 51.2%; 44.8% in BRCA wild-type compared to 64.3% in BRCA-associated TNBC (p = 0.232). pCR rates with ddAC-wTCb were similar to historic institutional rates with ddAC-T (51.2% vs. 51.3%, p = 0.987) and were comparable when stratified by BRCA status. In pooled multivariate analysis, only BRCA status (HR 4.00, 95%CI 1.65-9.75, p = 0.002) was significantly associated with pCR. Neoadjuvant ddAC-wTCb is less tolerable in clinical practice compared to most clinical trials, with a pCR comparable to historic rates using non-platinum regimen. The role of Cb in neoadjuvant chemotherapy for BRCA mutated TNBC remains uncertain. Copyright © 2018 Elsevier Ltd. All rights reserved.

Sulphur-oxidizing and sulphate-reducing communities in Brazilian mangrove sediments.

PubMed

Varon-Lopez, Maryeimy; Dias, Armando Cavalcante Franco; Fasanella, Cristiane Cipolla; Durrer, Ademir; Melo, Itamar Soares; Kuramae, Eiko Eurya; Andreote, Fernando Dini

2014-03-01

Mangrove soils are anaerobic environments rich in sulphate and organic matter. Although the sulphur cycle is one of the major actors in this ecosystem, little is known regarding the sulphur bacteria communities in mangrove soils. We investigated the abundance, composition and diversity of sulphur-oxidizing (SOB) and sulphate-reducing (SRB) bacteria in sediments from three Brazilian mangrove communities: two contaminated, one with oil (OilMgv) and one with urban waste and sludge (AntMgv), and one pristine (PrsMgv). The community structures were assessed using quantitative real-time polymerase chain reaction (qPCR), polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE) and clone libraries, using genes for the enzymes adenosine-5'-phosphosulphate reductase (aprA) and sulphite reductase (Dsr) (dsrB). The abundance for qPCR showed the ratio dsrB/aprA to be variable among mangroves and higher according to the gradient observed for oil contamination in the OilMgv. The PCR-DGGE patterns analysed by Nonmetric Multidimensional Scaling revealed differences among the structures of the three mangrove communities. The clone libraries showed that Betaproteobacteria, Gammaproteobacteria and Deltaproteobacteria were the most abundant groups associated with sulphur cycling in mangrove sediments. We conclude that the microbial SOB and SRB communities in mangrove soils are different in each mangrove forest and that such microbial communities could possibly be used as a proxy for contamination in mangrove forests. © 2013 John Wiley & Sons Ltd and Society for Applied Microbiology.

Ultrafast, sensitive and large-volume on-chip real-time PCR for the molecular diagnosis of bacterial and viral infections.

PubMed

Houssin, Timothée; Cramer, Jérémy; Grojsman, Rébecca; Bellahsene, Lyes; Colas, Guillaume; Moulet, Hélène; Minnella, Walter; Pannetier, Christophe; Leberre, Maël; Plecis, Adrien; Chen, Yong

2016-04-21

To control future infectious disease outbreaks, like the 2014 Ebola epidemic, it is necessary to develop ultrafast molecular assays enabling rapid and sensitive diagnoses. To that end, several ultrafast real-time PCR systems have been previously developed, but they present issues that hinder their wide adoption, notably regarding their sensitivity and detection volume. An ultrafast, sensitive and large-volume real-time PCR system based on microfluidic thermalization is presented herein. The method is based on the circulation of pre-heated liquids in a microfluidic chip that thermalize the PCR chamber by diffusion and ultrafast flow switches. The system can achieve up to 30 real-time PCR cycles in around 2 minutes, which makes it the fastest PCR thermalization system for regular sample volume to the best of our knowledge. After biochemical optimization, anthrax and Ebola simulating agents could be respectively detected by a real-time PCR in 7 minutes and a reverse transcription real-time PCR in 7.5 minutes. These detections are respectively 6.4 and 7.2 times faster than with an off-the-shelf apparatus, while conserving real-time PCR sample volume, efficiency, selectivity and sensitivity. The high-speed thermalization also enabled us to perform sharp melting curve analyses in only 20 s and to discriminate amplicons of different lengths by rapid real-time PCR. This real-time PCR microfluidic thermalization system is cost-effective, versatile and can be then further developed for point-of-care, multiplexed, ultrafast and highly sensitive molecular diagnoses of bacterial and viral diseases.

[A new method of processing quantitative PCR data].

PubMed

Ke, Bing-Shen; Li, Guang-Yun; Chen, Shi-Min; Huang, Xiang-Yan; Chen, Ying-Jian; Xu, Jun

2003-05-01

Today standard PCR can't satisfy the need of biotechnique development and clinical research any more. After numerous dynamic research, PE company found there is a linear relation between initial template number and cycling time when the accumulating fluorescent product is detectable.Therefore,they developed a quantitative PCR technique to be used in PE7700 and PE5700. But the error of this technique is too great to satisfy the need of biotechnique development and clinical research. A better quantitative PCR technique is needed. The mathematical model submitted here is combined with the achievement of relative science,and based on the PCR principle and careful analysis of molecular relationship of main members in PCR reaction system. This model describes the function relation between product quantity or fluorescence intensity and initial template number and other reaction conditions, and can reflect the accumulating rule of PCR product molecule accurately. Accurate quantitative PCR analysis can be made use this function relation. Accumulated PCR product quantity can be obtained from initial template number. Using this model to do quantitative PCR analysis,result error is only related to the accuracy of fluorescence intensity or the instrument used. For an example, when the fluorescence intensity is accurate to 6 digits and the template size is between 100 to 1,000,000, the quantitative result accuracy will be more than 99%. The difference of result error is distinct using same condition,same instrument but different analysis method. Moreover,if the PCR quantitative analysis system is used to process data, it will get result 80 times of accuracy than using CT method.

[Overexpression of inhibitor of β-catenin and T cell factor (ICAT) promotes proliferation and migration of cervical cancer Caski cells].

PubMed

Jiang, Yayun; Wang, Ting; Wang, Jinshu; Xia, Jing; Gou, Liyao; Liu, Mengyao; Zhang, Yan

2016-11-01

Objective To investigate the effect of overexpressed inhibitor of β-catenin and T cell factor (ICAT) on the proliferation and migration of human cervical cancer Caski cells. Methods Caski cells were transfected with ICAT recombinant adenovirus (AdICAT). The levels of ICAT mRNA and protein were detected by quantitative real-time PCR (qRT-PCR) and Western blotting, respectively. Effect of ICAT overexpression on proliferation, cell cycle and migration in Caski cells was respectively evaluated by MTT assay, flow cytometry and Transwell TM migration assays. Results The expression of ICAT remarkably increased in Caski cells after AdICAT infection. Overexpression of ICAT promoted Caski cells' proliferation, arrested the cell cycle in the S phase and enhanced cell migration. Conclusion Overexpression of ICAT can promote the proliferation and migration of Caski cervical cancer cells.

Cross-platform comparison for the detection of RAS mutations in cfDNA (ddPCR Biorad detection assay, BEAMing assay, and NGS strategy).

PubMed

Garcia, Jessica; Forestier, Julien; Dusserre, Eric; Wozny, Anne-Sophie; Geiguer, Florence; Merle, Patrick; Tissot, Claire; Ferraro-Peyret, Carole; Jones, Frederick S; Edelstein, Daniel L; Cheynet, Valérie; Bardel, Claire; Vilchez, Gaelle; Xu, Zhenyu; Bringuier, Pierre Paul; Barritault, Marc; Brengle-Pesce, Karen; Guillet, Marielle; Chauvenet, Marion; Manship, Brigitte; Brevet, Marie; Rodriguez-Lafrasse, Claire; Hervieu, Valérie; Couraud, Sébastien; Walter, Thomas; Payen, Léa

2018-04-20

CfDNA samples from colon (mCRC) and non-small cell lung cancers (NSCLC) (CIRCAN cohort) were compared using three platforms: droplet digital PCR (ddPCR, Biorad); BEAMing/OncoBEAM™-RAS-CRC (Sysmex Inostics); next-generation sequencing (NGS, Illumina), utilizing the 56G oncology panel (Swift Biosciences). Tissue biopsy and time matched cfDNA samples were collected at diagnosis in the mCRC cohort and during 1st progression in the NSCLC cohort. Excellent matches between cfDNA/FFPE mutation profiles were observed. Detection thresholds were between 0.5-1% for cfDNA samples examined using ddPCR and NGS, and 0.03% with BEAMing. This high level of sensitivity enabled the detection of KRAS mutations in 5/19 CRC patients with negative FFPE profiles. In the mCRC cohort, comparison of mutation results obtained by testing FFPE to those obtained by testing cfDNA by ddPCR resulted in 47% sensitivity, 77% specificity, 70% positive predictive value (PPV) and 55% negative predictive value (NPV). For BEAMing, we observed 93% sensitivity, 69% specificity, 78% PPV and 90% NPV. Finally, sensitivity of NGS was 73%, specificity was 77%, PPV 79% and NPV 71%. Our study highlights the complementarity of different diagnostic approaches and variability of results between OncoBEAM™-RAS-CRC and NGS assays. While the NGS assay provided a larger breadth of coverage of the major targetable alterations of 56 genes in one run, its performance for specific alterations was frequently confirmed by ddPCR results.

Cross-platform comparison for the detection of RAS mutations in cfDNA (ddPCR Biorad detection assay, BEAMing assay, and NGS strategy)

PubMed Central

Garcia, Jessica; Forestier, Julien; Dusserre, Eric; Wozny, Anne-Sophie; Geiguer, Florence; Merle, Patrick; Tissot, Claire; Ferraro-Peyret, Carole; Jones, Frederick S.; Edelstein, Daniel L.; Cheynet, Valérie; Bardel, Claire; Vilchez, Gaelle; Xu, Zhenyu; Bringuier, Pierre Paul; Barritault, Marc; Brengle-Pesce, Karen; Guillet, Marielle; Chauvenet, Marion; Manship, Brigitte; Brevet, Marie; Rodriguez-Lafrasse, Claire; Hervieu, Valérie; Couraud, Sébastien; Walter, Thomas; Payen, Léa

2018-01-01

CfDNA samples from colon (mCRC) and non-small cell lung cancers (NSCLC) (CIRCAN cohort) were compared using three platforms: droplet digital PCR (ddPCR, Biorad); BEAMing/OncoBEAM™-RAS-CRC (Sysmex Inostics); next-generation sequencing (NGS, Illumina), utilizing the 56G oncology panel (Swift Biosciences). Tissue biopsy and time matched cfDNA samples were collected at diagnosis in the mCRC cohort and during 1st progression in the NSCLC cohort. Excellent matches between cfDNA/FFPE mutation profiles were observed. Detection thresholds were between 0.5–1% for cfDNA samples examined using ddPCR and NGS, and 0.03% with BEAMing. This high level of sensitivity enabled the detection of KRAS mutations in 5/19 CRC patients with negative FFPE profiles. In the mCRC cohort, comparison of mutation results obtained by testing FFPE to those obtained by testing cfDNA by ddPCR resulted in 47% sensitivity, 77% specificity, 70% positive predictive value (PPV) and 55% negative predictive value (NPV). For BEAMing, we observed 93% sensitivity, 69% specificity, 78% PPV and 90% NPV. Finally, sensitivity of NGS was 73%, specificity was 77%, PPV 79% and NPV 71%. Our study highlights the complementarity of different diagnostic approaches and variability of results between OncoBEAM™-RAS-CRC and NGS assays. While the NGS assay provided a larger breadth of coverage of the major targetable alterations of 56 genes in one run, its performance for specific alterations was frequently confirmed by ddPCR results. PMID:29765524

Multiplex quantification of 12 European Union authorized genetically modified maize lines with droplet digital polymerase chain reaction.

PubMed

Dobnik, David; Spilsberg, Bjørn; Bogožalec Košir, Alexandra; Holst-Jensen, Arne; Žel, Jana

2015-08-18

Presence of genetically modified organisms (GMO) in food and feed products is regulated in many countries. The European Union (EU) has implemented a threshold for labeling of products containing more than 0.9% of authorized GMOs per ingredient. As the number of GMOs has increased over time, standard-curve based simplex quantitative polymerase chain reaction (qPCR) analyses are no longer sufficiently cost-effective, despite widespread use of initial PCR based screenings. Newly developed GMO detection methods, also multiplex methods, are mostly focused on screening and detection but not quantification. On the basis of droplet digital PCR (ddPCR) technology, multiplex assays for quantification of all 12 EU authorized GM maize lines (per April first 2015) were developed. Because of high sequence similarity of some of the 12 GM targets, two separate multiplex assays were needed. In both assays (4-plex and 10-plex), the transgenes were labeled with one fluorescence reporter and the endogene with another (GMO concentration = transgene/endogene ratio). It was shown that both multiplex assays produce specific results and that performance parameters such as limit of quantification, repeatability, and trueness comply with international recommendations for GMO quantification methods. Moreover, for samples containing GMOs, the throughput and cost-effectiveness is significantly improved compared to qPCR. Thus, it was concluded that the multiplex ddPCR assays could be applied for routine quantification of 12 EU authorized GM maize lines. In case of new authorizations, the events can easily be added to the existing multiplex assays. The presented principle of quantitative multiplexing can be applied to any other domain.

The development of rating of perceived exertion-based tests of physical working capacity.

PubMed

Mielke, Michelle; Housh, Terry J; Malek, Moh H; Beck, Travis W; Schmidt, Richard J; Johnson, Glen O

2008-01-01

The purpose of the present study was to use ratings of perceived exertion (RPE) from the Borg (6-20) and OMNI-Leg (0-10) scales to determine the Physical Working Capacity at the Borg and OMNI thresholds (PWC(BORG) and PWC(OMNI)). PWC(BORG) and PWC(OMNI) were compared with other fatigue thresholds determined from the measurement of heart rate (the Physical Working Capacity at the Heart Rate Threshold: PWC(HRT)), and oxygen consumption (the Physical Working Capacity at the Oxygen Consumption Threshold, PWC(VO2)), as well as the ventilatory threshold (VT). Fifteen men and women volunteers (mean age +/- SD = 22 +/- 1 years) performed an incremental test to exhaustion on an electronically braked ergometer for the determination of VO2 peak and VT. The subjects also performed 4 randomly ordered workbouts to exhaustion at different power outputs (ranging from 60 to 206W) for the determination of PWC(BORG), PWC(OMNI), PWC(HRT), and PWC(VO2). The results indicated that there were no significant mean differences among the fatigue thresholds: PWC(BORG) (mean +/- SD = 133 +/- 37W; 67 +/- 8% of VO2 peak), PWC(OMNI) (137 +/- 44W; 68 +/- 9% of VO2 peak), PWC(HRT) (135 +/- 36W; 68 +/- 8% of VO2 peak), PWC(VO2) (145 +/- 41W; 72 +/- 7% of VO2 peak) and VT (131 +/- 45W; 66 +/- 8% of VO2 peak). The results of this study indicated that the mathematical model used to estimate PWC(HRT) and PWC(VO2) can be applied to ratings of perceived exertion to determine PWC(BORG) and PWC(OMNI) during cycle ergometry. Salient features of the PWC(BORG) and PWC(OMNI) tests are that they are simple to administer and require the use of only an RPE scale, a stopwatch, and a cycle ergometer. Furthermore, the power outputs at the PWC(BORG) and PWC(OMNI) may be useful to estimate the VT noninvasively and without the need for expired gas analysis.

The role of positive and negative pressure on cavitation nucleation in nanodroplet-mediated histotripsy.

PubMed

Vlaisavljevich, Eli; Aydin, Omer; Lin, Kuang-Wei; Durmaz, Yasemin Yuksel; Fowlkes, Brian; ElSayed, Mohamed; Xu, Zhen

2016-01-21

Nanodroplet-mediated histotripsy (NMH) is an ultrasound ablation technique combining histotripsy with acoustically sensitive perfluorocarbon (PFC) nanodroplets that can be selectively delivered to tumor cells for targeted tumor ablation. NMH takes advantage of the significantly reduced cavitation threshold of the nanodroplets, allowing for cavitation to be selectively generated only in regions containing nanodroplets. Understanding the physical mechanisms underlying the nanodroplet cavitation process is essential to the development of NMH. In this study, we hypothesize that cavitation nucleation is caused by the negative pressure (p-) exposed to the PFC, and the NMH cavitation threshold is therefore determined by the incident p-  of the single-cycle pulses commonly used in NMH. This paper reports the first study that separately investigates the effects of negative and positive pressure on the NMH cavitation threshold using near half-cycle ultrasound pulses with dominant negative (negative-polarity pulses) or positive (positive-polarity pulses) pressure phases. Tissue phantoms containing perfluorohexane (PFH) nanodroplets were exposed to negative-polarity and positive-polarity pulses generated by a frequency compounding transducer recently developed in our lab, and the probability of generating cavitation was measured as a function of peak negative (p-) and peak positive (p+) pressure. The results showed close agreement in the p- cavitation threshold for PFH phantoms exposed to negative-polarity (11.4 ± 0.1 MPa) and positive-polarity (11.7 ± 0.2 MPa) pulses. The p+ at the cavitation threshold, in contrast, was measured to be sign ficantly different for the negative-polarity (4.0 ± 0.1 MPa) and positive-polarity (42.6 ± 0.2 MPa) pulses. In the final part of this study, the experimental results were compared to the cavitation threshold predicted by classical nucleation theory (CNT), with results showing close agreement between simulations and experiments. Overall, the results support our hypothesis and provide significant insight into the physical mechanisms underlying NMH.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tuenge, Jason R.; Hollomon, Brad; Dillon, Heather E.

This report covers the third part of a larger U.S. Department of Energy (DOE) project to assess the life-cycle environmental and resource impacts in the manufacturing, transport, use, and disposal of light-emitting diode (LED) lighting products in relation to incumbent lighting technologies. All three reports are available on the DOE website (www.ssl.energy.gov/tech_reports.html). • Part 1: Review of the Life-Cycle Energy Consumption of Incandescent, Compact Fluorescent and LED Lamps; • Part 2: LED Manufacturing and Performance; • Part 3: LED Environmental Testing. Parts 1 and 2 were published in February and June 2012, respectively. The Part 1 report included a summarymore » of the life-cycle assessment (LCA) process and methodology, provided a literature review of more than 25 existing LCA studies of various lamp types, and performed a meta-analysis comparing LED lamps with incandescent and compact fluorescent lamps (CFLs). Drawing from the Part 1 findings, Part 2 performed a more detailed assessment of the LED manufacturing process and used these findings to provide a comparative LCA taking into consideration a wider range of environmental impacts. Both reports concluded that the life-cycle environmental impact of a given lamp is dominated by the energy used during lamp operation—the upstream generation of electricity drives the total environmental footprint of the product. However, a more detailed understanding of end-of-life disposal considerations for LED products has become increasingly important as their installation base has grown. The Part 3 study (reported herein) was undertaken to augment the LCA findings with chemical analysis of a variety of LED, CFL, and incandescent lamps using standard testing procedures. A total of 22 samples, representing 11 different models, were tested to determine whether any of 17 elements were present at levels exceeding California or Federal regulatory thresholds for hazardous waste. Key findings include: • The selected models were generally found to be below thresholds for Federally regulated elements; • All CFLs and LED lamps and most incandescent lamps exceeded California thresholds for Copper; • Most CFL samples exceeded California thresholds for Antimony and Nickel, and half of the LED samples exceeded California thresholds for Zinc; • The greatest contributors were the screw bases, drivers, ballasts, and wires or filaments; • Overall concentrations in LED lamps were comparable to cell phones and other types of electronic devices, and were generally attributable to components other than the internal LED light sources; • Although the life-cycle environmental impact of the LED lamps is favorable when compared to CFLs and incandescent lamps, recycling will likely gain importance as consumer adoption increases. This study was exploratory in nature and was not intended to provide a definitive indication of regulatory compliance for any specific lamp model or technology. Further study would be needed to more broadly characterize the various light source technologies; to more accurately and precisely characterize a specific model; or to determine whether product redesign would be appropriate.« less

Phase II Study of Neoadjuvant Anthracycline-Based Regimens Combined With Nanoparticle Albumin-Bound Paclitaxel and Trastuzumab for Human Epidermal Growth Factor Receptor 2-Positive Operable Breast Cancer.

PubMed

Tanaka, Satoru; Iwamoto, Mitsuhiko; Kimura, Kosei; Matsunami, Nobuki; Morishima, Hirotaka; Yoshidome, Katsuhide; Nomura, Takashi; Morimoto, Takashi; Yamamoto, Daigo; Tsubota, Yu; Kobayashi, Toshihiro; Uchiyama, Kazuhisa

2015-06-01

We treated patients with operable human epidermal growth factor receptor 2-positive breast cancer with neoadjuvant anthracycline regimens followed by nanoparticle albumin-bound paclitaxel plus trastuzumab. Of the 44 patients, 49% achieved a pathologic complete response (pCR). The pCR rate was 36% and 71% in the patients with estrogen receptor-positive and -negative cancer, respectively. Neoadjuvant therapy using this combination appears to be effective and safe. Introduction: Neoadjuvant chemotherapy plus trastuzumab. Neoadjuvant chemotherapy plus trastuzumab results in a 30% to 50% pathologic complete response (pCR) rate in human epidermal growth factor receptor 2 (HER2)-positive breast cancer and has been associated with improved therapeutic outcomes. Thus, the pCR rate can be useful in evaluating novel agents in this patient population. Nanoparticle albumin-bound (nab)-paclitaxel (PTX) can reduce the toxicity of PTX while maintaining its efficacy. The present study evaluated the activity and safety of nab-PTX as a neoadjuvant treatment of HER2(+) breast cancer. We treated patients with stage I to IIIA breast cancer using neoadjuvant epirubicin/cyclophosphamide (EC) or 5-fluorouracil/epirubicin/cyclophosphamide every 3 weeks (q3w) for 4 cycles, followed by nab-PTX (260 mg/m(2)) plus trastuzumab q3w for 4 cycles. The primary endpoint was the pCR rate. The secondary endpoints included the clinical response rate, disease-free survival, pathologic response rate (defined as pCR or minimal residual invasive disease only in the breast), breast-conserving surgery rate, and safety. Forty-six patients were enrolled. One patient met the exclusion criteria because of the coexistence of another malignant disease; therefore, we evaluated 45 patients in the entire study. One patient experienced rapid disease progression during EC therapy, leaving 44 patients evaluable for nab-PTX treatment. Of the 45 patients, 49% achieved a pCR. The pCR rate was 36% and 71% in those with estrogen receptor-positive and -negative cancer, respectively. Of all the study treatments, the most frequent reason for delay or dose reduction was hematologic toxicity; only 1 patient required a dose reduction for nab-PTX because of peripheral neuropathy. Neoadjuvant therapy using this combination appears to be effective and safe. Copyright © 2015 Elsevier Inc. All rights reserved.

A disposable laser print-cut-laminate polyester microchip for multiplexed PCR via infra-red-mediated thermal control.

PubMed

Ouyang, Yiwen; Duarte, Gabriela R M; Poe, Brian L; Riehl, Paul S; dos Santos, Fernando M; Martin-Didonet, Claudia C G; Carrilho, Emanuel; Landers, James P

2015-12-11

Infrared (IR)-mediated thermal cycling system, a method proven to be a effective for sub-μL scale polymerase chain reaction (PCR) on microchips, has been integrated with DNA extraction and separation on a glass microchip in a fully integrated micro Total Analysis System by Easley et al., in 2006. IR-PCR has been demonstrated on both glass and PMMA microdevices where the fabrication (bonding) is not trivial. Polyester-toner (PeT) microfluidic devices have significant potential as cost-effective, disposable microdevices as a result of the ease of fabrication (∼$0.25 USD and <10 min per device) and availability of commercial substrates. For the first time, we demonstrate here the thermal cycling in PeT microchips on the IR-PCR system. Undesirable IR absorption by the black-toner bonding layer was eliminated with a spatial filter in the form of an aluminum foil mask. The solution heating rate for a black PeT microchip using a tungsten lamp was 10.1 ± 0.7 °C s(-1) with a cooling rate of roughly -12 ± 0.9 °C s(-1) assisted by forced air cooling. Dynamic surface passivation strategies allowed the successful amplification of a 520 bp fragment of the λ-phage genome (in 11 min) and a 1500 bp region of Azospirillum brasilense. Using a centrosymmetric chamber configuration in a multichamber PeT microchip, homogenous temperature distribution over all chambers was achieved with inter-chamber temperature differences at annealing, extension and denaturing steps of less than ±2 °C. The effectiveness of the multichamber system was demonstrated with the simultaneous amplification of a 390 bp amplicon of human β-globin gene in five PeT PCR microchambers. The relative PCR amplification efficiency with a human β-globin DNA fragment ranged from 70% to 90%, in comparison to conventional thermal cyclers, with an inter-chamber standard deviation of ∼10%. Development of PeT microchips for IR-PCR has the potential to provide rapid, low-volume amplification while also integrating PCR with extraction upstream and separation/detection downstream. Copyright © 2015. Published by Elsevier B.V.

Relative sensitivity of conventional and real-time PCR assays for detection of SFG Rickettsia in blood and tissue samples from laboratory animals.

PubMed

Zemtsova, Galina E; Montgomery, Merrill; Levin, Michael L

2015-01-01

Studies on the natural transmission cycles of zoonotic pathogens and the reservoir competence of vertebrate hosts require methods for reliable diagnosis of infection in wild and laboratory animals. Several PCR-based applications have been developed for detection of infections caused by Spotted Fever group Rickettsia spp. in a variety of animal tissues. These assays are being widely used by researchers, but they differ in their sensitivity and reliability. We compared the sensitivity of five previously published conventional PCR assays and one SYBR green-based real-time PCR assay for the detection of rickettsial DNA in blood and tissue samples from Rickettsia- infected laboratory animals (n = 87). The real-time PCR, which detected rickettsial DNA in 37.9% of samples, was the most sensitive. The next best were the semi-nested ompA assay and rpoB conventional PCR, which detected as positive 18.4% and 14.9% samples respectively. Conventional assays targeting ompB, gltA and hrtA genes have been the least sensitive. Therefore, we recommend the SYBR green-based real-time PCR as a tool for the detection of rickettsial DNA in animal samples due to its higher sensitivity when compared to more traditional assays.

Relative Sensitivity of Conventional and Real-Time PCR Assays for Detection of SFG Rickettsia in Blood and Tissue Samples from Laboratory Animals

PubMed Central

Zemtsova, Galina E.; Montgomery, Merrill; Levin, Michael L.

2015-01-01

Studies on the natural transmission cycles of zoonotic pathogens and the reservoir competence of vertebrate hosts require methods for reliable diagnosis of infection in wild and laboratory animals. Several PCR-based applications have been developed for detection of infections caused by Spotted Fever group Rickettsia spp. in a variety of animal tissues. These assays are being widely used by researchers, but they differ in their sensitivity and reliability. We compared the sensitivity of five previously published conventional PCR assays and one SYBR green-based real-time PCR assay for the detection of rickettsial DNA in blood and tissue samples from Rickettsia- infected laboratory animals (n = 87). The real-time PCR, which detected rickettsial DNA in 37.9% of samples, was the most sensitive. The next best were the semi-nested ompA assay and rpoB conventional PCR, which detected as positive 18.4% and 14.9% samples respectively. Conventional assays targeting ompB, gltA and hrtA genes have been the least sensitive. Therefore, we recommend the SYBR green-based real-time PCR as a tool for the detection of rickettsial DNA in animal samples due to its higher sensitivity when compared to more traditional assays. PMID:25607846

Interference of peritoneal dialysis fluids with cell cycle mechanisms.

PubMed

Büchel, Janine; Bartosova, Maria; Eich, Gwendolyn; Wittenberger, Timo; Klein-Hitpass, Ludger; Steppan, Sonja; Hackert, Thilo; Schaefer, Franz; Passlick-Deetjen, Jutta; Schmitt, Claus P

2015-01-01

Peritoneal dialysis fluids (PDF) differ with respect to osmotic and buffer compound, and pH and glucose degradation products (GDP) content. The impact on peritoneal membrane integrity is still insufficiently described. We assessed global genomic effects of PDF in primary human peritoneal mesothelial cells (PMC) by whole genome analyses, quantitative real-time polymerase chain reaction (RT-PCR) and functional measurements. PMC isolated from omentum of non-uremic patients were incubated with conventional single chamber PDF (CPDF), lactate- (LPDF), bicarbonate- (BPDF) and bicarbonate/lactate-buffered double-chamber PDF (BLPDF), icodextrin (IPDF) and amino acid PDF (APDF), diluted 1:1 with medium. Affymetrix GeneChip U133Plus2.0 (Affymetrix, CA, USA) and quantitative RT-PCR were applied; cell viability was assessed by proliferation assays. The number of differentially expressed genes compared to medium was 464 with APDF, 208 with CPDF, 169 with IPDF, 71 with LPDF, 45 with BPDF and 42 with BLPDF. Out of these genes 74%, 73%, 79%, 72%, 47% and 57% were downregulated. Gene Ontology (GO) term annotations mainly revealed associations with cell cycle (p = 10(-35)), cell division, mitosis, and DNA replication. One hundred and eighteen out of 249 probe sets detecting genes involved in cell cycle/division were suppressed, with APDF-treated PMC being affected the most regarding absolute number and degree, followed by CPDF and IPDF. Bicarbonate-containing PDF and BLPDF-treated PMC were affected the least. Quantitative RT-PCR measurements confirmed microarray findings for key cell cycle genes (CDK1/CCNB1/CCNE2/AURKA/KIF11/KIF14). Suppression was lowest for BPDF and BLPDF, they upregulated CCNE2 and SMC4. All PDF upregulated 3 out of 4 assessed cell cycle repressors (p53/BAX/p21). Cell viability scores confirmed gene expression results, being 79% of medium for LPDF, 101% for BLPDF, 51% for CPDF and 23% for IPDF. Amino acid-containing PDF (84%) incubated cells were as viable as BPDF (86%). In conclusion, PD solutions substantially differ with regard to their gene regulating profile and impact on vital functions of PMC, i.e. on cells known to be essential for peritoneal membrane homeostasis. Copyright © 2015 International Society for Peritoneal Dialysis.

Interference of Peritoneal Dialysis Fluids with Cell Cycle Mechanisms

PubMed Central

Büchel, Janine; Bartosova, Maria; Eich, Gwendolyn; Wittenberger, Timo; Klein-Hitpass, Ludger; Steppan, Sonja; Hackert, Thilo; Schaefer, Franz; Passlick-Deetjen, Jutta; Schmitt, Claus P.

2015-01-01

♦ Introduction: Peritoneal dialysis fluids (PDF) differ with respect to osmotic and buffer compound, and pH and glucose degradation products (GDP) content. The impact on peritoneal membrane integrity is still insufficiently described. We assessed global genomic effects of PDF in primary human peritoneal mesothelial cells (PMC) by whole genome analyses, quantitative real-time polymerase chain reaction (RT-PCR) and functional measurements. ♦ Methods: PMC isolated from omentum of non-uremic patients were incubated with conventional single chamber PDF (CPDF), lactate- (LPDF), bicarbonate- (BPDF) and bicarbonate/lactate-buffered double-chamber PDF (BLPDF), icodextrin (IPDF) and amino acid PDF (APDF), diluted 1:1 with medium. Affymetrix GeneChip U133Plus2.0 (Affymetrix, CA, USA) and quantitative RT-PCR were applied; cell viability was assessed by proliferation assays. ♦ Results: The number of differentially expressed genes compared to medium was 464 with APDF, 208 with CPDF, 169 with IPDF, 71 with LPDF, 45 with BPDF and 42 with BLPDF. Out of these genes 74%, 73%, 79%, 72%, 47% and 57% were downregulated. Gene Ontology (GO) term annotations mainly revealed associations with cell cycle (p = 10-35), cell division, mitosis, and DNA replication. One hundred and eighteen out of 249 probe sets detecting genes involved in cell cycle/division were suppressed, with APDF-treated PMC being affected the most regarding absolute number and degree, followed by CPDF and IPDF. Bicarbonate-containing PDF and BLPDF-treated PMC were affected the least. Quantitative RT-PCR measurements confirmed microarray findings for key cell cycle genes (CDK1/CCNB1/CCNE2/AURKA/KIF11/KIF14). Suppression was lowest for BPDF and BLPDF, they upregulated CCNE2 and SMC4. All PDF upregulated 3 out of 4 assessed cell cycle repressors (p53/BAX/p21). Cell viability scores confirmed gene expression results, being 79% of medium for LPDF, 101% for BLPDF, 51% for CPDF and 23% for IPDF. Amino acid-containing PDF (84%) incubated cells were as viable as BPDF (86%). ♦ Conclusion: In conclusion, PD solutions substantially differ with regard to their gene regulating profile and impact on vital functions of PMC, i.e. on cells known to be essential for peritoneal membrane homeostasis. PMID:25082841

From individual to population level effects of toxicants in the tubicifid Branchiura sowerbyi using threshold effect models in a Bayesian framework.

PubMed

Ducrot, Virginie; Billoir, Elise; Péry, Alexandre R R; Garric, Jeanne; Charles, Sandrine

2010-05-01

Effects of zinc were studied in the freshwater worm Branchiura sowerbyi using partial and full life-cycle tests. Only newborn and juveniles were sensitive to zinc, displaying effects on survival, growth, and age at first brood at environmentally relevant concentrations. Threshold effect models were proposed to assess toxic effects on individuals. They were fitted to life-cycle test data using Bayesian inference and adequately described life-history trait data in exposed organisms. The daily asymptotic growth rate of theoretical populations was then simulated with a matrix population model, based upon individual-level outputs. Population-level outputs were in accordance with existing literature for controls. Working in a Bayesian framework allowed incorporating parameter uncertainty in the simulation of the population-level response to zinc exposure, thus increasing the relevance of test results in the context of ecological risk assessment.

Ebola Virus Disease, Democratic Republic of the Congo, 2014.

PubMed

Nanclares, Carolina; Kapetshi, Jimmy; Lionetto, Fanshen; de la Rosa, Olimpia; Tamfun, Jean-Jacques Muyembe; Alia, Miriam; Kobinger, Gary; Bernasconi, Andrea

2016-09-01

During July-November 2014, the Democratic Republic of the Congo underwent its seventh Ebola virus disease (EVD) outbreak. The etiologic agent was Zaire Ebola virus; 66 cases were reported (overall case-fatality rate 74.2%). Through a retrospective observational study of confirmed EVD in 25 patients admitted to either of 2 Ebola treatment centers, we described clinical features and investigated correlates associated with death. Clinical features were mainly generic. At admission, 76% of patients had >1 gastrointestinal symptom and 28% >1 hemorrhagic symptom. The case-fatality rate in this group was 48% and was higher for female patients (67%). Cox regression analysis correlated death with initial low cycle threshold, indicating high viral load. Cycle threshold was a robust predictor of death, as were fever, hiccups, diarrhea, dyspnea, dehydration, disorientation, hematemesis, bloody feces during hospitalization, and anorexia in recent medical history. Differences from other outbreaks could suggest guidance for optimizing clinical management and disease control.

Effect of memory in non-Markovian Boolean networks illustrated with a case study: A cell cycling process

NASA Astrophysics Data System (ADS)

Ebadi, H.; Saeedian, M.; Ausloos, M.; Jafari, G. R.

2016-11-01

The Boolean network is one successful model to investigate discrete complex systems such as the gene interacting phenomenon. The dynamics of a Boolean network, controlled with Boolean functions, is usually considered to be a Markovian (memory-less) process. However, both self-organizing features of biological phenomena and their intelligent nature should raise some doubt about ignoring the history of their time evolution. Here, we extend the Boolean network Markovian approach: we involve the effect of memory on the dynamics. This can be explored by modifying Boolean functions into non-Markovian functions, for example, by investigating the usual non-Markovian threshold function —one of the most applied Boolean functions. By applying the non-Markovian threshold function on the dynamical process of the yeast cell cycle network, we discover a power-law-like memory with a more robust dynamics than the Markovian dynamics.

Comprehensive Review on the Surrogate Endpoints of Efficacy Proposed or Hypothesized in the Scientific Community Today.

PubMed

von Minckwitz, Gunter; Fontanella, Caterina

2015-05-01

An intermediate endpoint is a surrogate marker of treatment efficacy assessed earlier than the true outcome of interest. A suitable intermediate endpoint in neoadjuvant trials of specific breast cancer subtypes is pathological complete response (pCR) rate, defined as no invasive (+/-noninvasive) residual cancer in breast and nodes at surgery. On the basis of available evidence, Food and Drug Administration the US allowed to use of pCR as a surrogate endpoint for accelerated approval process. However, surrogacy to long-term outcome remains an unresolved issue. Literature data provide indications that triple-negative, HER2-positive, and high-grade hormone receptor-positive breast cancer subtypes achieved the highest pCR rate; the prognostic impact of pCR on survival is established only for these aggressive subtypes. In the German experience, early response after two to four cycles of neoadjuvant treatment strongly correlated with both pCR rate and long-term outcome. Therefore, early response may be considered a predictive marker for pCR and used for driving clinical trial design. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Clinical Value of Basal Serum Progesterone Prior to Initiate Ovarian Hyper-Stimulation with GnRH Antagonists: A Retrospective Cohort Study.

PubMed

Faulisi, Sonia; Reschini, Marco; Borroni, Raffaella; Paffoni, Alessio; Busnelli, Andrea; Somigliana, Edgardo

2017-01-01

The routine assessment of day 3 serum progesterone prior to initiation of ovarian hyper-stimulation with the use of GnRH antagonists is under debate. In this study, we evaluated the clinical utility of this policy. Retrospective cohort study of women undergoing in vitro fertilization (IVF) with the use of GnRH antagonists aimed at determining the frequency of cases with progesterone levels exceeding the recommended threshold of 1,660 pg/ml and at evaluating whether this assessment may be predictive of pregnancy. Serum progesterone exceeded the recommended threshold in one case (0.3%, 95% CI 0.01-1.5). The median (interquartile range) basal progesterone in women who did (n = 95) and did not (n = 217) become pregnant were 351 (234-476) and 380 (237-531) pg/ml, respectively (p = 0.28). The 90th percentile of the basal progesterone distribution in women who became pregnant was 660 pg/ml. Cases with serum progesterone exceeding this threshold in successful and unsuccessful cycles were 10 (10%) and 30 (14%), respectively (p = 0.47). The capacity of basal progesterone to predict pregnancy was evaluated using receiver operating characteristic curve (area under the curve = 0.54, 95% CI 0.47-0.61, p = 0.28). No graphically evident threshold emerged. Routine day 3 serum progesterone assessment in IVF cycles with the use of GnRH antagonists is not justified. Further evidence is warranted prior to claiming its systematic use. © 2016 S. Karger AG, Basel.

Prefrontal cortex haemodynamics and affective responses during exercise: a multi-channel near infrared spectroscopy study.

PubMed

Tempest, Gavin D; Eston, Roger G; Parfitt, Gaynor

2014-01-01

The dose-response effects of the intensity of exercise upon the potential regulation (through top-down processes) of affective (pleasure-displeasure) responses in the prefrontal cortex during an incremental exercise protocol have not been explored. This study examined the functional capacity of the prefrontal cortex (reflected by haemodynamics using near infrared spectroscopy) and affective responses during exercise at different intensities. Participants completed an incremental cycling exercise test to exhaustion. Changes (Δ) in oxygenation (O2Hb), deoxygenation (HHb), blood volume (tHb) and haemoglobin difference (HbDiff) were measured from bilateral dorsal and ventral prefrontal areas. Affective responses were measured every minute during exercise. Data were extracted at intensities standardised to: below ventilatory threshold, at ventilatory threshold, respiratory compensation point and the end of exercise. During exercise at intensities from ventilatory threshold to respiratory compensation point, ΔO2Hb, ΔHbDiff and ΔtHb were greater in mostly ventral than dorsal regions. From the respiratory compensation point to the end of exercise, ΔO2Hb remained stable and ΔHbDiff declined in dorsal regions. As the intensity increased above the ventilatory threshold, inverse associations between affective responses and oxygenation in (a) all regions of the left hemisphere and (b) lateral (dorsal and ventral) regions followed by the midline (ventral) region in the right hemisphere were observed. Differential activation patterns occur within the prefrontal cortex and are associated with affective responses during cycling exercise.

Prefrontal Cortex Haemodynamics and Affective Responses during Exercise: A Multi-Channel Near Infrared Spectroscopy Study

PubMed Central

Tempest, Gavin D.; Eston, Roger G.; Parfitt, Gaynor

2014-01-01

The dose-response effects of the intensity of exercise upon the potential regulation (through top-down processes) of affective (pleasure-displeasure) responses in the prefrontal cortex during an incremental exercise protocol have not been explored. This study examined the functional capacity of the prefrontal cortex (reflected by haemodynamics using near infrared spectroscopy) and affective responses during exercise at different intensities. Participants completed an incremental cycling exercise test to exhaustion. Changes (Δ) in oxygenation (O2Hb), deoxygenation (HHb), blood volume (tHb) and haemoglobin difference (HbDiff) were measured from bilateral dorsal and ventral prefrontal areas. Affective responses were measured every minute during exercise. Data were extracted at intensities standardised to: below ventilatory threshold, at ventilatory threshold, respiratory compensation point and the end of exercise. During exercise at intensities from ventilatory threshold to respiratory compensation point, ΔO2Hb, ΔHbDiff and ΔtHb were greater in mostly ventral than dorsal regions. From the respiratory compensation point to the end of exercise, ΔO2Hb remained stable and ΔHbDiff declined in dorsal regions. As the intensity increased above the ventilatory threshold, inverse associations between affective responses and oxygenation in (a) all regions of the left hemisphere and (b) lateral (dorsal and ventral) regions followed by the midline (ventral) region in the right hemisphere were observed. Differential activation patterns occur within the prefrontal cortex and are associated with affective responses during cycling exercise. PMID:24788166

On the Relationship Between Spotless Days and the Sunspot Cycle: A Supplement

NASA Technical Reports Server (NTRS)

Wilson, Robert M.; Hathaway, David H.

2006-01-01

This study provides supplemental material to an earlier study concerning the relationship between spotless days and the sunspot cycle. Our previous study, Technical Publication (TP)-2005-213608 determined the timing and size of sunspot minimum and maximum for the new sunspot cycle, relative to the occurrence of the first spotless day during the declining phase of the old sunspot cycle and the last spotless day during the rising portion of the new cycle. Because the number of spotless days (NSD) rapidly increases as the cycle nears sunspot minimum and rapidly decreases thereafter, the size and timing of sunspot minimum and maximum might be more accurately determined using a higher threshold for comparison, rather than using the first and last spotless day occurrences. It is this aspect that is investigated more thoroughly in this TP.

A QUANTITATIVE REAL-TIME PCR ASSAY FOR DETECTION OF CYCLOSPORA CAYETANESIS

EPA Science Inventory

Cyclospora cayetanensis, a coccidian parasite with a direct fecal-oral life cycle, has become recognized world-wide as an emerging pathogen in both immunocompromised and immunocompetent individuals. Clinical manifestations include prolonged diarrhea, nausea, abdominal cramps, an...

Transesophageal echocardiographic strain imaging predicts aortic biomechanics: Beyond diameter.

PubMed

Emmott, Alexander; Alzahrani, Haitham; Alreishidan, Mohammed; Therrien, Judith; Leask, Richard L; Lachapelle, Kevin

2018-03-11

Clinical guidelines recommend resection of ascending aortic aneurysms at diameters 5.5 cm or greater to prevent rupture or dissection. However, approximately 40% of all ascending aortic dissections occur below this threshold. We propose new transesophageal echocardiography strain-imaging moduli coupled with blood pressure measurements to predict aortic dysfunction below the surgical threshold. A total of 21 patients undergoing aortic resection were recruited to participate in this study. Transesophageal echocardiography imaging of the aortic short-axis and invasive radial blood pressure traces were taken for 3 cardiac cycles. By using EchoPAC (GE Healthcare, Madison, Wis) and postprocessing in MATLAB (MathWorks, Natick, Mass), circumferential stretch profiles were generated and combined with the blood pressure traces. From these data, 2 in vivo stiffness moduli were calculated: the Cardiac Cycle Pressure Modulus and Cardiac Cycle Stress Modulus. From the resected aortic ring, testing squares were isolated for ex vivo mechanical analysis and histopathology. Each square underwent equibiaxial tensile testing to generate stress-stretch profiles for each patient. Two ex vivo indices were calculated from these profiles (energy loss and incremental stiffness) for comparison with the Cardiac Cycle Pressure Modulus and Cardiac Cycle Stress Modulus. The echo-derived stiffness moduli demonstrate positive significant covariance with ex vivo tensile biomechanical indices: energy loss (vs Cardiac Cycle Pressure Modulus: R 2  = 0.5873, P < .0001; vs Cardiac Cycle Stress Modulus: R 2  = 0.6401, P < .0001) and apparent stiffness (vs Cardiac Cycle Pressure Modulus: R 2  = 0.2079, P = .0378; vs Cardiac Cycle Stress Modulus: R 2  = 0.3575, P = .0042). Likewise, these transesophageal echocardiography-derived moduli are highly predictive of the histopathologic composition of collagen and elastin (collagen/elastin ratio vs Cardiac Cycle Pressure Modulus: R 2  = 0.6165, P < .0001; vs Cardiac Cycle Stress Modulus: R 2  = 0.6037, P < .0001). Transesophageal echocardiography-derived stiffness moduli correlate strongly with aortic wall biomechanics and histopathology, which demonstrates the added benefit of using simple echocardiography-derived biomechanics to stratify patient populations. Copyright © 2018. Published by Elsevier Inc.

Diagnostic devices for isothermal nucleic acid amplification.

PubMed

Chang, Chia-Chen; Chen, Chien-Cheng; Wei, Shih-Chung; Lu, Hui-Hsin; Liang, Yang-Hung; Lin, Chii-Wann

2012-01-01

Since the development of the polymerase chain reaction (PCR) technique, genomic information has been retrievable from lesser amounts of DNA than previously possible. PCR-based amplifications require high-precision instruments to perform temperature cycling reactions; further, they are cumbersome for routine clinical use. However, the use of isothermal approaches can eliminate many complications associated with thermocycling. The application of diagnostic devices for isothermal DNA amplification has recently been studied extensively. In this paper, we describe the basic concepts of several isothermal amplification approaches and review recent progress in diagnostic device development.

Diagnostic Devices for Isothermal Nucleic Acid Amplification

PubMed Central

Chang, Chia-Chen; Chen, Chien-Cheng; Wei, Shih-Chung; Lu, Hui-Hsin; Liang, Yang-Hung; Lin, Chii-Wann

2012-01-01

Since the development of the polymerase chain reaction (PCR) technique, genomic information has been retrievable from lesser amounts of DNA than previously possible. PCR-based amplifications require high-precision instruments to perform temperature cycling reactions; further, they are cumbersome for routine clinical use. However, the use of isothermal approaches can eliminate many complications associated with thermocycling. The application of diagnostic devices for isothermal DNA amplification has recently been studied extensively. In this paper, we describe the basic concepts of several isothermal amplification approaches and review recent progress in diagnostic device development. PMID:22969402

[EXPERIENCE OF STUDY AND POSSIBLE WAYS OF ELIMINATION OF FALSE POSITIVE AND FALSE NEGATIVE RESULTS DURING EXECUTION OF POLYMERASE CHAIN REACTION ON AN EXAMPLE OF JUNIN VIRUS RNA DETECTION].

PubMed

Sizikova, T E; Lebedev, V N; Pantyukhov, V B; Borisevich, S V; Merkulov, V A

2015-01-01

Experience of study and possible ways of elimination of false positive and false negative results during execution of polymerase chain reaction on an example of Junin virus RNA detection. MATERIALSS AND METHODS: Junin virus--causative agent of Argentine hemorrhagic fever (AHF) strain XJpR37/5787 was obtained from the State collection of pathogenicity group I causative agents of the 48th Central Research Institute. Reagent kit for detection of Junin virus RNA by RT-PCR was developed in the Institute and consists of 4 sets: for isolation of RNA, execution of reverse-transcription reaction, execution of PCR and electrophoretic detection of PCR products. RT-PCR was carried out by a standard technique. Continuous cell cultures of African green monkey Vero B, GMK-AH-1(D) were obtained from the museum of cell culture department of the Centre. An experimental study of the effect of various factors of impact on the sample under investigation ("thawing-freezing", presence of formaldehyde, heparin) on the obtaining of false negative results during Junin virus RNA detection by using RT-PCR was studied. Addition of 0.01% heparin to the samples was shown to completely inhibit PCR. Addition of 0.05% formaldehyde significantly reduces sensitivity of the method. A possibility of reduction of analysis timeframe from 15 to 5 days was shown during detection of the causative agent in samples with low concentration of the latter by growing the samples and subsequent analysis of the material obtained by using RT-PCR. During detection of causative agent by using RT-PCR false negative results could appear in the presence of formaldehyde and heparin in the sample. A possibility of elimination of false negative PCR results due to concentration of the causative agent in the sample under investigation at a level below sensitivity threshold was shown on the example of Junin virus RNA detection by using growing of the pathogen in appropriate accumulation system with subsequent analysis of the material obtained using PCR.

Phase II randomized clinical trial evaluating neoadjuvant chemotherapy regimens with weekly paclitaxel or eribulin followed by doxorubicin and cyclophosphamide in women with locally advanced HER2-negative breast cancer: NSABP Foundation Study FB-9.

PubMed

Abraham, Jame; Robidoux, André; Tan, Antoinette R; Limentani, Steven; Sturtz, Keren; Shalaby, Ibrahim; Alcorn, Hope; Buyse, Marc E; Wolmark, Norman; Jacobs, Samuel A

2015-07-01

Locally advanced breast cancer (LABC) is a good setting in which to monitor response to neoadjuvant chemotherapy, to downsize the tumor (which facilitates breast-conserving surgery), and to test newer agents in untreated patients. Eribulin (E) has shown activity in patients who have undergone previous taxane, anthracycline, and capecitabine treatment. We aimed to evaluate the neoadjuvant use of E followed by doxorubicin and cyclophosphamide (AC) in patients with HER2-negative LABC, using as a control a randomized group of women who received weekly paclitaxel (WP). Fifty women with LABC were accrued January-August 2013. Patients were randomized (1:2) to receive either WP (N = 19) for 12 treatments or E (N = 31) every 3 weeks for 4 cycles followed by AC every 3 weeks for 4 cycles before surgery. 17/19 patients who took WP and 25/30 who took E completed all cycles. Patients were evaluated by clinical examination and breast MRI at baseline and after completion of E or WP. Surgical pCR in breast and lymph nodes was determined by a local pathologist following chemotherapy. Forty-nine patients received ≥1 dose of neoadjuvant chemotherapy and are included in this analysis. Forty-eight underwent surgery; one had disease that was inoperable (on E) and is included as no-pCR patient. 17/19 of these patients who took WP completed 12 doses; 28/30 on E completed 4 cycles. Six discontinued treatment on WP, E, or AC. Both treatments were well tolerated. pCR on WP = 5/19(26 %) and on E = 5/30(17 %). Both regimens were equally well tolerated with no unexpected toxicities. pCR did not suggest higher activity with E than with other standard regimens in these LABC patients.

Influence of Shell Properties on High-Frequency Ultrasound Imaging and Drug Delivery Using Polymer-Shelled Microbubbles

PubMed Central

Chitnis, Parag V.; Koppolu, Sujeethraj; Mamou, Jonathan; Chlon, Ceciel; Ketterling, Jeffrey A.

2013-01-01

This two-part study investigated shell rupture of ultrasound contrast agents (UCAs) under static overpressure conditions and the subharmonic component from UCAs subjected to 20-MHz tonebursts. Five different polylactide-shelled UCAs with shell-thickness-to-radius ratios (STRRs) of 7.5, 30, 40, 65, and 100 nm/μm were subjected to static overpressure in a glycerol-filled test chamber. A video microscope imaged the UCAs as pressure varied from 2 to 330 kPa over 90 min. Images were postprocessed to obtain the pressure threshold for rupture and the diameter of individual microbubbles. Backscatter from individual UCAs was investigated by flowing a dilute UCA solution through a wall-less flow phantom placed at the geometric focus of a 20-MHz transducer. UCAs were subjected to 10- and 20-cycle tonebursts of acoustic pressures ranging from 0.3 to 2.3 MPa. A method based on singular-value decomposition (SVD) was employed to obtain a cumulative subharmonic score (SHS). Different UCA types exhibited distinctly different rupture thresholds that were linearly related to their STRR, but uncorrelated with UCA size. The rupture threshold for the UCAs with an STRR = 100 nm/μm was more than 4 times greater than the UCAs with an STRR = 7.5 nm/μm. The polymer-shelled UCAs produced substantial subharmonic response but the subharmonic response to 20-MHz excitation did not correlate with STRRs or UCA-rupture pressures. The 20-cycle excitation resulted in an SHS that was 2 to 3 times that of UCAs excited with 10-cycle tonebursts. PMID:23287913