Science.gov

Sample records for peak picking method

  1. Bayesian peak picking for NMR spectra.

    PubMed

    Cheng, Yichen; Gao, Xin; Liang, Faming

    2014-02-01

    Protein structure determination is a very important topic in structural genomics, which helps people to understand varieties of biological functions such as protein-protein interactions, protein-DNA interactions and so on. Nowadays, nuclear magnetic resonance (NMR) has often been used to determine the three-dimensional structures of protein in vivo. This study aims to automate the peak picking step, the most important and tricky step in NMR structure determination. We propose to model the NMR spectrum by a mixture of bivariate Gaussian densities and use the stochastic approximation Monte Carlo algorithm as the computational tool to solve the problem. Under the Bayesian framework, the peak picking problem is casted as a variable selection problem. The proposed method can automatically distinguish true peaks from false ones without preprocessing the data. To the best of our knowledge, this is the first effort in the literature that tackles the peak picking problem for NMR spectrum data using Bayesian method. Copyright © 2013. Production and hosting by Elsevier Ltd.

  2. Alignment of leading-edge and peak-picking time of arrival methods to obtain accurate source locations

    SciTech Connect

    Roussel-Dupre, R.; Symbalisty, E.; Fox, C.; and Vanderlinde, O.

    2009-08-01

    The location of a radiating source can be determined by time-tagging the arrival of the radiated signal at a network of spatially distributed sensors. The accuracy of this approach depends strongly on the particular time-tagging algorithm employed at each of the sensors. If different techniques are used across the network, then the time tags must be referenced to a common fiducial for maximum location accuracy. In this report we derive the time corrections needed to temporally align leading-edge, time-tagging techniques with peak-picking algorithms. We focus on broadband radio frequency (RF) sources, an ionospheric propagation channel, and narrowband receivers, but the final results can be generalized to apply to any source, propagation environment, and sensor. Our analytic results are checked against numerical simulations for a number of representative cases and agree with the specific leading-edge algorithm studied independently by Kim and Eng (1995) and Pongratz (2005 and 2007).

  3. Automated Peak Picking and Peak Integration in Macromolecular NMR Spectra Using AUTOPSY

    NASA Astrophysics Data System (ADS)

    Koradi, Reto; Billeter, Martin; Engeli, Max; Güntert, Peter; Wüthrich, Kurt

    1998-12-01

    A new approach for automated peak picking of multidimensional protein NMR spectra with strong overlap is introduced, which makes use of the program AUTOPSY (automatedpeak picking for NMRspectroscopy). The main elements of this program are a novel function for local noise level calculation, the use of symmetry considerations, and the use of lineshapes extracted from well-separated peaks for resolving groups of strongly overlapping peaks. The algorithm generates peak lists with precise chemical shift and integral intensities, and a reliability measure for the recognition of each peak. The results of automated peak picking of NOESY spectra with AUTOPSY were tested in combination with the combined automated NOESY cross peak assignment and structure calculation routine NOAH implemented in the program DYANA. The quality of the resulting structures was found to be comparable with those from corresponding data obtained with manual peak picking.

  4. Computer vision-based automated peak picking applied to protein NMR spectra.

    PubMed

    Klukowski, Piotr; Walczak, Michal J; Gonczarek, Adam; Boudet, Julien; Wider, Gerhard

    2015-09-15

    A detailed analysis of multidimensional NMR spectra of macromolecules requires the identification of individual resonances (peaks). This task can be tedious and time-consuming and often requires support by experienced users. Automated peak picking algorithms were introduced more than 25 years ago, but there are still major deficiencies/flaws that often prevent complete and error free peak picking of biological macromolecule spectra. The major challenges of automated peak picking algorithms is both the distinction of artifacts from real peaks particularly from those with irregular shapes and also picking peaks in spectral regions with overlapping resonances which are very hard to resolve by existing computer algorithms. In both of these cases a visual inspection approach could be more effective than a 'blind' algorithm. We present a novel approach using computer vision (CV) methodology which could be better adapted to the problem of peak recognition. After suitable 'training' we successfully applied the CV algorithm to spectra of medium-sized soluble proteins up to molecular weights of 26 kDa and to a 130 kDa complex of a tetrameric membrane protein in detergent micelles. Our CV approach outperforms commonly used programs. With suitable training datasets the application of the presented method can be extended to automated peak picking in multidimensional spectra of nucleic acids or carbohydrates and adapted to solid-state NMR spectra. CV-Peak Picker is available upon request from the authors. gsw@mol.biol.ethz.ch; michal.walczak@mol.biol.ethz.ch; adam.gonczarek@pwr.edu.pl Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  5. Peak picking multidimensional NMR spectra with the contour geometry based algorithm CYPICK.

    PubMed

    Würz, Julia M; Güntert, Peter

    2017-01-01

    The automated identification of signals in multidimensional NMR spectra is a challenging task, complicated by signal overlap, noise, and spectral artifacts, for which no universally accepted method is available. Here, we present a new peak picking algorithm, CYPICK, that follows, as far as possible, the manual approach taken by a spectroscopist who analyzes peak patterns in contour plots of the spectrum, but is fully automated. Human visual inspection is replaced by the evaluation of geometric criteria applied to contour lines, such as local extremality, approximate circularity (after appropriate scaling of the spectrum axes), and convexity. The performance of CYPICK was evaluated for a variety of spectra from different proteins by systematic comparison with peak lists obtained by other, manual or automated, peak picking methods, as well as by analyzing the results of automated chemical shift assignment and structure calculation based on input peak lists from CYPICK. The results show that CYPICK yielded peak lists that compare in most cases favorably to those obtained by other automated peak pickers with respect to the criteria of finding a maximal number of real signals, a minimal number of artifact peaks, and maximal correctness of the chemical shift assignments and the three-dimensional structure obtained by fully automated assignment and structure calculation.

  6. Peak picking NMR spectral data using non-negative matrix factorization

    PubMed Central

    2014-01-01

    Background Simple peak-picking algorithms, such as those based on lineshape fitting, perform well when peaks are completely resolved in multidimensional NMR spectra, but often produce wrong intensities and frequencies for overlapping peak clusters. For example, NOESY-type spectra have considerable overlaps leading to significant peak-picking intensity errors, which can result in erroneous structural restraints. Precise frequencies are critical for unambiguous resonance assignments. Results To alleviate this problem, a more sophisticated peaks decomposition algorithm, based on non-negative matrix factorization (NMF), was developed. We produce peak shapes from Fourier-transformed NMR spectra. Apart from its main goal of deriving components from spectra and producing peak lists automatically, the NMF approach can also be applied if the positions of some peaks are known a priori, e.g. from consistently referenced spectral dimensions of other experiments. Conclusions Application of the NMF algorithm to a three-dimensional peak list of the 23 kDa bi-domain section of the RcsD protein (RcsD-ABL-HPt, residues 688-890) as well as to synthetic HSQC data shows that peaks can be picked accurately also in spectral regions with strong overlap. PMID:24511909

  7. Comparison of peak-picking workflows for untargeted liquid chromatography/high-resolution mass spectrometry metabolomics data analysis.

    PubMed

    Rafiei, Atefeh; Sleno, Lekha

    2015-01-15

    Data analysis is a key step in mass spectrometry based untargeted metabolomics, starting with the generation of generic peak lists from raw liquid chromatography/mass spectrometry (LC/MS) data. Due to the use of various algorithms by different workflows, the results of different peak-picking strategies often differ widely. Raw LC/HRMS data from two types of biological samples (bile and urine), as well as a standard mixture of 84 metabolites, were processed with four peak-picking softwares: Peakview®, Markerview™, MetabolitePilot™ and XCMS Online. The overlaps between the results of each peak-generating method were then investigated. To gauge the relevance of peak lists, a database search using the METLIN online database was performed to determine which features had accurate masses matching known metabolites as well as a secondary filtering based on MS/MS spectral matching. In this study, only a small proportion of all peaks (less than 10%) were common to all four software programs. Comparison of database searching results showed peaks found uniquely by one workflow have less chance of being found in the METLIN metabolomics database and are even less likely to be confirmed by MS/MS. It was shown that the performance of peak-generating workflows has a direct impact on untargeted metabolomics results. As it was demonstrated that the peaks found in more than one peak detection workflow have higher potential to be identified by accurate mass as well as MS/MS spectrum matching, it is suggested to use the overlap of different peak-picking workflows as preliminary peak lists for more rugged statistical analysis in global metabolomics investigations. Copyright © 2014 John Wiley & Sons, Ltd.

  8. A digital algorithm for spectral deconvolution with noise filtering and peak picking: NOFIPP-DECON

    NASA Technical Reports Server (NTRS)

    Edwards, T. R.; Settle, G. L.; Knight, R. D.

    1975-01-01

    Noise-filtering, peak-picking deconvolution software incorporates multiple convoluted convolute integers and multiparameter optimization pattern search. The two theories are described and three aspects of the software package are discussed in detail. Noise-filtering deconvolution was applied to a number of experimental cases ranging from noisy, nondispersive X-ray analyzer data to very noisy photoelectric polarimeter data. Comparisons were made with published infrared data, and a man-machine interactive language has evolved for assisting in very difficult cases. A modified version of the program is being used for routine preprocessing of mass spectral and gas chromatographic data.

  9. Towards fully automated structure-based NMR resonance assignment of ¹⁵N-labeled proteins from automatically picked peaks.

    PubMed

    Jang, Richard; Gao, Xin; Li, Ming

    2011-03-01

    In NMR resonance assignment, an indispensable step in NMR protein studies, manually processed peaks from both N-labeled and C-labeled spectra are typically used as inputs. However, the use of homologous structures can allow one to use only N-labeled NMR data and avoid the added expense of using C-labeled data. We propose a novel integer programming framework for structure-based backbone resonance assignment using N-labeled data. The core consists of a pair of integer programming models: one for spin system forming and amino acid typing, and the other for backbone resonance assignment. The goal is to perform the assignment directly from spectra without any manual intervention via automatically picked peaks, which are much noisier than manually picked peaks, so methods must be error-tolerant. In the case of semi-automated/manually processed peak data, we compare our system with the Xiong-Pandurangan-Bailey-Kellogg's contact replacement (CR) method, which is the most error-tolerant method for structure-based resonance assignment. Our system, on average, reduces the error rate of the CR method by five folds on their data set. In addition, by using an iterative algorithm, our system has the added capability of using the NOESY data to correct assignment errors due to errors in predicting the amino acid and secondary structure type of each spin system. On a publicly available data set for human ubiquitin, where the typing accuracy is 83%, we achieve 91% accuracy, compared to the 59% accuracy obtained without correcting for such errors. In the case of automatically picked peaks, using assignment information from yeast ubiquitin, we achieve a fully automatic assignment with 97% accuracy. To our knowledge, this is the first system that can achieve fully automatic structure-based assignment directly from spectra. This has implications in NMR protein mutant studies, where the assignment step is repeated for each mutant.

  10. METHOD OF PEAK CURRENT MEASUREMENT

    DOEpatents

    Baker, G.E.

    1959-01-20

    The measurement and recording of peak electrical currents are described, and a method for utilizing the magnetic field of the current to erase a portion of an alternating constant frequency and amplitude signal from a magnetic mediums such as a magnetic tapes is presented. A portion of the flux from the current carrying conductor is concentrated into a magnetic path of defined area on the tape. After the current has been recorded, the tape is played back. The amplitude of the signal from the portion of the tape immediately adjacent the defined flux area and the amplitude of the signal from the portion of the tape within the area are compared with the amplitude of the signal from an unerased portion of the tape to determine the percentage of signal erasure, and thereby obtain the peak value of currents flowing in the conductor.

  11. Peak picking and the assessment of separation performance in two-dimensional high performance liquid chromatography

    SciTech Connect

    Guiochon, Georges A; Shalliker, R. Andrew

    2010-01-01

    An algorithm was developed for 2DHPLC that automated the process of peak recognition, measuring their retention times, and then subsequently plotting the information in a two-dimensional retention plane. Following the recognition of peaks, the software then performed a series of statistical assessments of the separation performance, measuring for example, correlation between dimensions, peak capacity and the percentage of usage of the separation space. Peak recognition was achieved by interpreting the first and second derivatives of each respective one-dimensional chromatogram to determine the 1D retention times of each solute and then compiling these retention times for each respective fraction 'cut'. Due to the nature of comprehensive 2DHPLC adjacent cut fractions may contain peaks common to more than one cut fraction. The algorithm determined which components were common in adjacent cuts and subsequently calculated the peak maximum profile by interpolating the space between adjacent peaks. This algorithm was applied to the analysis of a two-dimensional separation of an apple flesh extract separated in a first dimension comprising a cyano stationary phase and an aqueous/THF mobile phase as the first dimension and a second dimension comprising C18-Hydro with an aqueous/MeOH mobile phase. A total of 187 peaks were detected.

  12. Iterative interferometry-based method for picking microseismic events

    NASA Astrophysics Data System (ADS)

    Iqbal, Naveed; Al-Shuhail, Abdullatif A.; Kaka, SanLinn I.; Liu, Entao; Raj, Anupama Govinda; McClellan, James H.

    2017-05-01

    Continuous microseismic monitoring of hydraulic fracturing is commonly used in many engineering, environmental, mining, and petroleum applications. Microseismic signals recorded at the surface, suffer from excessive noise that complicates first-break picking and subsequent data processing and analysis. This study presents a new first-break picking algorithm that employs concepts from seismic interferometry and time-frequency (TF) analysis. The algorithm first uses a TF plot to manually pick a reference first-break and then iterates the steps of cross-correlation, alignment, and stacking to enhance the signal-to-noise ratio of the relative first breaks. The reference first-break is subsequently used to calculate final first breaks from the relative ones. Testing on synthetic and real data sets at high levels of additive noise shows that the algorithm enhances the first-break picking considerably. Furthermore, results show that only two iterations are needed to converge to the true first breaks. Indeed, iterating more can have detrimental effects on the algorithm due to increasing correlation of random noise.

  13. Analysis of the Peak Resistance Frequency Method.

    PubMed

    Wang, Boshuo; Weiland, James D

    2016-10-01

    This study analyzes the peak resistance frequency (PRF) method described by Mercanzini et al., a method that can easily extract the tissue resistance from impedance spectroscopy for many neural engineering applications but has no analytical description thus far. Mathematical analyses and computer simulations were used to explore underlying principles, accuracy, and limitations of the PRF method. The mathematical analyses demonstrated that the PRF method has an inherent but correctable deviation dependent on the idealness of the electrode-tissue interface, which is validated by simulations. Further simulations show that both frequency sampling and noise affect the accuracy of the PRF method, and in general, it performs less accurately than least squares methods. However, the PRF method achieves simplicity and reduced measurement and computation time at the expense of accuracy. From the qualitative results, the PRF method can work with reasonable precision and simplicity, although its limitation and the idealness of the electrode-tissue interface involved should be taken into consideration. This paper provides a mathematical foundation for the PRF method and its practical implementation.

  14. Novel automatic first-arrival picking method for ultrasound sound-speed tomography

    NASA Astrophysics Data System (ADS)

    Qu, Xiaolei; Azuma, Takashi; Imoto, Haruka; Raufy, Riaz; Lin, Hongxiang; Nakamura, Hirofumi; Tamano, Satoshi; Takagi, Shu; Umemura, Shin-ichiro; Sakuma, Ichiro; Matsumoto, Yoichiro

    2015-07-01

    Ultrasound sound-speed tomography (USST) is a promising technique for breast cancer diagnosis that is currently under investigation. Compared with two-dimensional X-ray mammography, it not only provides three-dimensional images but also avoids radiation exposure. However, the image quality of USST is highly dependent on the accuracy of travel time map (TTM). To improve the accuracy, a novel automatic first-arrival picking method is proposed in this study. With this method, Akaike information criterion is used to obtain travel time roughly, then cross-correlation of neighboring traces is employed to correct the obtained travel time. Simulation, phantom, and ex vivo experiments are implemented. The simulation experiments showed that the absolute errors of the proposed method were 52 and 98 ns for simple and complex structure data, respectively. The phantom and ex vivo experiments demonstrated the feasibility of the proposed method. In this study, a novel and robust first-arrival picking method was proposed for USST.

  15. Picking vs Waveform based detection and location methods for induced seismicity monitoring

    NASA Astrophysics Data System (ADS)

    Grigoli, Francesco; Boese, Maren; Scarabello, Luca; Diehl, Tobias; Weber, Bernd; Wiemer, Stefan; Clinton, John F.

    2017-04-01

    Microseismic monitoring is a common operation in various industrial activities related to geo-resouces, such as oil and gas and mining operations or geothermal energy exploitation. In microseismic monitoring we generally deal with large datasets from dense monitoring networks that require robust automated analysis procedures. The seismic sequences being monitored are often characterized by very many events with short inter-event times that can even provide overlapped seismic signatures. In these situations, traditional approaches that identify seismic events using dense seismic networks based on detections, phase identification and event association can fail, leading to missed detections and/or reduced location resolution. In recent years, to improve the quality of automated catalogues, various waveform-based methods for the detection and location of microseismicity have been proposed. These methods exploit the coherence of the waveforms recorded at different stations and do not require any automated picking procedure. Although this family of methods have been applied to different induced seismicity datasets, an extensive comparison with sophisticated pick-based detection and location methods is still lacking. We aim here to perform a systematic comparison in term of performance using the waveform-based method LOKI and the pick-based detection and location methods (SCAUTOLOC and SCANLOC) implemented within the SeisComP3 software package. SCANLOC is a new detection and location method specifically designed for seismic monitoring at local scale. Although recent applications have proved an extensive test with induced seismicity datasets have been not yet performed. This method is based on a cluster search algorithm to associate detections to one or many potential earthquake sources. On the other hand, SCAUTOLOC is more a "conventional" method and is the basic tool for seismic event detection and location in SeisComp3. This approach was specifically designed for

  16. An automated method for baseline correction, peak finding and peak grouping in chromatographic data.

    PubMed

    Johnsen, Lea G; Skov, Thomas; Houlberg, Ulf; Bro, Rasmus

    2013-06-21

    An automated method (FastChrom) for baseline correction, peak detection and assignment (grouping) of similar peaks across samples has been developed. The method has been tested both on artificial data and a dataset obtained from gas chromatograph analysis of wine samples. As part of the automated approach, a new method for baseline estimation has been developed and compared with other methods. FastChrom has been shown to perform at least as well as conventional software. However, compared to other approaches, FastChrom finds more peaks in the chromatograms and not only those with retention times defined by the user. FastChrom is fast and easy to use and offers the possibility of applying a retention time index which facilitates the identification of peaks and the comparison between experiments.

  17. Combining hypoxic methods for peak performance.

    PubMed

    Millet, Gregoire P; Roels, B; Schmitt, L; Woorons, X; Richalet, J P

    2010-01-01

    New methods and devices for pursuing performance enhancement through altitude training were developed in Scandinavia and the USA in the early 1990s. At present, several forms of hypoxic training and/or altitude exposure exist: traditional 'live high-train high' (LHTH), contemporary 'live high-train low' (LHTL), intermittent hypoxic exposure during rest (IHE) and intermittent hypoxic exposure during continuous session (IHT). Although substantial differences exist between these methods of hypoxic training and/or exposure, all have the same goal: to induce an improvement in athletic performance at sea level. They are also used for preparation for competition at altitude and/or for the acclimatization of mountaineers. The underlying mechanisms behind the effects of hypoxic training are widely debated. Although the popular view is that altitude training may lead to an increase in haematological capacity, this may not be the main, or the only, factor involved in the improvement of performance. Other central (such as ventilatory, haemodynamic or neural adaptation) or peripheral (such as muscle buffering capacity or economy) factors play an important role. LHTL was shown to be an efficient method. The optimal altitude for living high has been defined as being 2200-2500 m to provide an optimal erythropoietic effect and up to 3100 m for non-haematological parameters. The optimal duration at altitude appears to be 4 weeks for inducing accelerated erythropoiesis whereas <3 weeks (i.e. 18 days) are long enough for beneficial changes in economy, muscle buffering capacity, the hypoxic ventilatory response or Na(+)/K(+)-ATPase activity. One critical point is the daily dose of altitude. A natural altitude of 2500 m for 20-22 h/day (in fact, travelling down to the valley only for training) appears sufficient to increase erythropoiesis and improve sea-level performance. 'Longer is better' as regards haematological changes since additional benefits have been shown as hypoxic exposure

  18. A fast method for particle picking in cryo-electron micrographs based on fast R-CNN

    NASA Astrophysics Data System (ADS)

    Xiao, Yifan; Yang, Guangwen

    2017-06-01

    We propose a fast method to automatically pick protein particles in cryo-EM micrographs, which is now completed manually in practice. Our method is based on Fast R-CNN, with sliding window as the regions proposal solution. To reduce the false positive detections, we set a single class for the major contaminant ice, and pick out all the ice particles in the whole datasets. Tests on the recently-published cryo-EM data of three proteins have demonstrated that our approach can automatically accomplish the human-level particle picking task, and we successfully reduce the test time from 1.5 minutes of previous deep learning method to 2 seconds without any recall or precision losses. Our program is available under the MIT License at https://github.com/xiao1fan/FastParticlePicker.

  19. Improved modified energy ratio method using a multi-window approach for accurate arrival picking

    NASA Astrophysics Data System (ADS)

    Lee, Minho; Byun, Joongmoo; Kim, Dowan; Choi, Jihun; Kim, Myungsun

    2017-04-01

    To identify accurately the location of microseismic events generated during hydraulic fracture stimulation, it is necessary to detect the first break of the P- and S-wave arrival times recorded at multiple receivers. These microseismic data often contain high-amplitude noise, which makes it difficult to identify the P- and S-wave arrival times. The short-term-average to long-term-average (STA/LTA) and modified energy ratio (MER) methods are based on the differences in the energy densities of the noise and signal, and are widely used to identify the P-wave arrival times. The MER method yields more consistent results than the STA/LTA method for data with a low signal-to-noise (S/N) ratio. However, although the MER method shows good results regardless of the delay of the signal wavelet for signals with a high S/N ratio, it may yield poor results if the signal is contaminated by high-amplitude noise and does not have the minimum delay. Here we describe an improved MER (IMER) method, whereby we apply a multiple-windowing approach to overcome the limitations of the MER method. The IMER method contains calculations of an additional MER value using a third window (in addition to the original MER window), as well as the application of a moving average filter to each MER data point to eliminate high-frequency fluctuations in the original MER distributions. The resulting distribution makes it easier to apply thresholding. The proposed IMER method was applied to synthetic and real datasets with various S/N ratios and mixed-delay wavelets. The results show that the IMER method yields a high accuracy rate of around 80% within five sample errors for the synthetic datasets. Likewise, in the case of real datasets, 94.56% of the P-wave picking results obtained by the IMER method had a deviation of less than 0.5 ms (corresponding to 2 samples) from the manual picks.

  20. A novel monocular visual navigation method for cotton-picking robot based on horizontal spline segmentation

    NASA Astrophysics Data System (ADS)

    Xu, ShengYong; Wu, JuanJuan; Zhu, Li; Li, WeiHao; Wang, YiTian; Wang, Na

    2015-12-01

    Visual navigation is a fundamental technique of intelligent cotton-picking robot. There are many components and cover in the cotton field, which make difficulties of furrow recognition and trajectory extraction. In this paper, a new field navigation path extraction method is presented. Firstly, the color image in RGB color space is pre-processed by the OTSU threshold algorithm and noise filtering. Secondly, the binary image is divided into numerous horizontally spline areas. In each area connected regions of neighboring images' vertical center line are calculated by the Two-Pass algorithm. The center points of the connected regions are candidate points for navigation path. Thirdly, a series of navigation points are determined iteratively on the principle of the nearest distance between two candidate points in neighboring splines. Finally, the navigation path equation is fitted by the navigation points using the least squares method. Experiments prove that this method is accurate and effective. It is suitable for visual navigation in the complex environment of cotton field in different phases.

  1. Standardization of 65Zn by sum-peak method.

    PubMed

    Oliveira, E M; Iwahara, A; Poledna, R; Delgado, J U; da Silva, C J; da Silva, R L; Lopes, R T

    2012-09-01

    A commercial solution of (65)Zn was standardized by the sum peak-method using a planar HPGe detector. The activity results were compared with measurements made with a well type 4πγ ionization chamber, which is traceable to BIPM.RI (II)-K2.Zn-65 key-comparison performed in 2002. The sum-peak value was 42.79 kBq/g and the ionization chamber value was 42.74 kBq/g both at the reference date. The uncertainty obtained in the sum peak standardization was 0.25% (k=1), and in the ionization chamber was 0.85% (k=1). The results showed that sum-peak method can be used in (65)Zn standardization and this method is easier, simpler and more practical than others methods. Copyright © 2012 Elsevier Ltd. All rights reserved.

  2. Measurement of peak discharge at dams by indirect methods

    USGS Publications Warehouse

    Hulsing, Harry

    1967-01-01

    This chapter describes procedures for measuring peak discharges using dams, weirs, and embankments. Field and office procedures limited to this method are described. Discharge coefficients and formulas are given for three general classes of weirs-sharp-crested, broad-crested, and round-crested-and for highway embankments and weirs of unusual shape. The effects of submergence are defined for most forms.

  3. Characterization of peak flow events with local singularity method

    NASA Astrophysics Data System (ADS)

    Cheng, Q.; Li, L.; Wang, L.

    2009-07-01

    Three methods, return period, power-law frequency plot (concentration-area) and local singularity index, are introduced in the paper for characterizing peak flow events from river flow data for the past 100 years from 1900 to 2000 recorded at 25 selected gauging stations on rivers in the Oak Ridges Moraine (ORM) area, Canada. First a traditional method, return period, was applied to the maximum annual river flow data. Whereas the Pearson III distribution generally fits the values, a power-law frequency plot (C-A) on the basis of self-similarity principle provides an effective mean for distinguishing "extremely" large flow events from the regular flow events. While the latter show a power-law distribution, about 10 large flow events manifest departure from the power-law distribution and these flow events can be classified into a separate group most of which are related to flood events. It is shown that the relation between the average water releases over a time period after flow peak and the time duration may follow a power-law distribution. The exponent of the power-law or singularity index estimated from this power-law relation may be used to characterize non-linearity of peak flow recessions. Viewing large peak flow events or floods as singular processes can anticipate the application of power-law models not only for characterizing the frequency distribution of peak flow events, for example, power-law relation between the number and size of floods, but also for describing local singularity of processes such as power-law relation between the amount of water released versus releasing time. With the introduction and validation of singularity of peak flow events, alternative power-law models can be used to depict the recession property as well as other types of non-linear properties.

  4. Systems and Methods for Peak-Seeking Control

    NASA Technical Reports Server (NTRS)

    Ryan, John J (Inventor); Speyer, Jason L (Inventor)

    2013-01-01

    A computerized system and method for peak-seeking-control that uses a unique Kalman filter design to optimize a control loop, in real time, to either maximize or minimize a performance function of a physical object ("plant"). The system and method achieves more accurate and efficient peak-seeking-control by using a time-varying Kalman filter to estimate both the performance function gradient (slope) and Hessian (curvature) based on direct position measurements of the plant, and does not rely upon modeling the plant response to persistent excitation. The system and method can be naturally applied in various applications in which plant performance functions have multiple independent parameters, and it does not depend upon frequency separation to distinguish between system dimensions.

  5. Development of an Adaptive Multi-Method Algorithm for Automatic Picking of First Arrival Times: Application to Near Surface Seismic Data

    NASA Astrophysics Data System (ADS)

    Khalaf, A.; Camerlynck, C. M.; Schneider, A. C.; Florsch, N.

    2015-12-01

    Accurate picking of first arrival times plays an important role in many seismic studies, particularly in seismic tomography and reservoirs or aquifers monitoring. Many techniques have been developed for picking first arrivals automatically or semi-automatically, but most of them were developed for seismological purposes which does not attain the accuracy objectives due to the complexity of near surface structures, and to usual low signal-to-noise ratio. We propose a new adaptive algorithm for near surface data based on three picking methods, combining multi-nested windows (MNW), Higher Order Statistics (HOS), and Akaike Information Criterion (AIC). They exploit the benefits of integrating many properties, which reveal the presence of first arrivals, to provide an efficient and robust first arrivals picking. This strategy mimics the human first-break picking, where at the beginning the global trend is defined. Then the exact first-breaks are searched in the vicinity of the now defined trend. In a multistage algorithm, three successive phases are launched, where each of them characterize a specific signal property. Within each phase, the potential picks and their error range are automatically estimated, and then used sequentially as leader in the following phase picking. The accuracy and robustness of the implemented algorithm are successfully validated on synthetic and real data which have special challenges for automatic pickers. The comparison of resulting P-wave arrival times with those picked manually, and other algorithms of automatic picking, demonstrated the reliable performance of the new scheme under different noisy conditions. All parameters of our multi-method algorithm are auto-adaptive thanks to the integration in series of each sub-algorithm results in the flow. Hence, it is nearly a parameter-free algorithm, which is straightforward to implement and demands low computational resources.

  6. Methods and apparatus for reducing peak wind turbine loads

    DOEpatents

    Moroz, Emilian Mieczyslaw

    2007-02-13

    A method for reducing peak loads of wind turbines in a changing wind environment includes measuring or estimating an instantaneous wind speed and direction at the wind turbine and determining a yaw error of the wind turbine relative to the measured instantaneous wind direction. The method further includes comparing the yaw error to a yaw error trigger that has different values at different wind speeds and shutting down the wind turbine when the yaw error exceeds the yaw error trigger corresponding to the measured or estimated instantaneous wind speed.

  7. Sealed vacuum canister and method for pick-up and containment of material

    DOEpatents

    Stoutenburgh, R.R.

    1996-02-13

    A vacuum canister is described including a housing with a sealed vacuum chamber having a predetermined vacuum pressure therein and a valve having a first port for fluid communication with the vacuum chamber and a second port for receiving at least one of a fluid and a particulate material. The valve is operable between a first position to seal the vacuum chamber and retain the predetermined vacuum within the vacuum chamber, and a second position to access the vacuum chamber to permit vacuum fluid flow through the valve from the second port into the vacuum chamber. The vacuum canister, in the operation to pick up material with the valve in the second position, when the second port is located adjacent at least one of a fluid and a particulate material, is effective to displace through the valve at least one of a fluid and a particulate material into the housing. The vacuum canister is desirably suitable for picking up and containing hazardous material such as radioactive material, in which the vacuum canister includes a protective layer of lead having a predetermined thickness that is effective to shield radiation emitted from the radioactive material contained within the housing. Advantageously, the vacuum canister includes a vacuum means for establishing a predetermined vacuum pressure within the vacuum chamber. 6 figs.

  8. Sealed vacuum canister and method for pick-up and containment of material

    DOEpatents

    Stoutenburgh, Roger R.

    1996-01-01

    A vacuum canister including a housing with a sealed vacuum chamber having a predetermined vacuum pressure therein and a valve having a first port for fluid communication with the vacuum chamber and a second port for receiving at least one of a fluid and a particulate material. The valve is operable between a first position to seal the vacuum chamber and retain the predetermined vacuum within the vacuum chamber, and a second position to access the vacuum chamber to permit vacuum fluid flow through the valve from the second port into the vacuum chamber. In operation of the vacuum canister to pick up material with the valve in the second position, when the second port is located adjacent at least one of a fluid and a particulate material, is effective to displace through the valve at least one of a fluid and a particulate material into the housing. The vacuum canister is desirably suitable for picking up and containing hazardous material such as radioactive material, in which the vacuum canister includes a protective layer of lead having a predetermined thickness that is effective to shield radiation emitted from the radioactive material contained within the housing. Advantageously, the vacuum canister includes a vacuum means for establishing a predetermined vacuum pressure within the vacuum chamber.

  9. Nonlinear generalization of Den Hartog's equal-peak method

    NASA Astrophysics Data System (ADS)

    Habib, G.; Detroux, T.; Viguié, R.; Kerschen, G.

    2015-02-01

    This study addresses the mitigation of a nonlinear resonance of a mechanical system. In view of the narrow bandwidth of the classical linear tuned vibration absorber, a nonlinear absorber, termed the nonlinear tuned vibration absorber (NLTVA), is introduced in this paper. An unconventional aspect of the NLTVA is that the mathematical form of its restoring force is tailored according to the nonlinear restoring force of the primary system. The NLTVA parameters are then determined using a nonlinear generalization of Den Hartog's equal-peak method. The mitigation of the resonant vibrations of a Duffing oscillator is considered to illustrate the proposed developments.

  10. Estimate capital for operational risk using peak over threshold method

    NASA Astrophysics Data System (ADS)

    Saputri, Azizah Anugrahwati; Noviyanti, Lienda; Soleh, Achmad Zanbar

    2015-12-01

    Operational risk is inherent in bank activities. To cover this risk a bank reserves a fund called as capital. Often a bank uses Basic Indicator approach (BIA), Standardized Approach (SA), or Advanced Measurement Approach (AMA) for estimating the capital amount. BIA and SA are less-objective in comparison to AMA, since BIA and SA use non-actual loss data while AMA use the actual one. In this research, we define the capital as an OpVaR (i.e. the worst loss at a given confidence level) which will be estimated by Peak Over Threshold Method.

  11. Measurement of peak discharge at width contractions by indirect methods

    USGS Publications Warehouse

    Matthai, Howard Frederick

    1967-01-01

    This chapter describes procedures for measuring peak discharges using open-channel width contractions. Field and office procedures limited to this method are described. The discharge equation based on the continuity and energy equations between an approach cross section and the contracted section under a bridge or contraction is given. Contractions are classified into four geometric types. Discharge coefficients and computation procedures are given with a complete facsimile example of computation of a contracted-opening measurement. Additional procedures are given for multiple-opening contractions.

  12. An analytical method for predicting postwildfire peak discharges

    USGS Publications Warehouse

    Moody, John A.

    2012-01-01

    An analytical method presented here that predicts postwildfire peak discharge was developed from analysis of paired rainfall and runoff measurements collected from selected burned basins. Data were collected from 19 mountainous basins burned by eight wildfires in different hydroclimatic regimes in the western United States (California, Colorado, Nevada, New Mexico, and South Dakota). Most of the data were collected for the year of the wildfire and for 3 to 4 years after the wildfire. These data provide some estimate of the changes with time of postwildfire peak discharges, which are known to be transient but have received little documentation. The only required inputs for the analytical method are the burned area and a quantitative measure of soil burn severity (change in the normalized burn ratio), which is derived from Landsat reflectance data and is available from either the U.S. Department of Agriculture Forest Service or the U.S. Geological Survey. The method predicts the postwildfire peak discharge per unit burned area for the year of a wildfire, the first year after a wildfire, and the second year after a wildfire. It can be used at three levels of information depending on the data available to the user; each subsequent level requires either more data or more processing of the data. Level 1 requires only the burned area. Level 2 requires the burned area and the basin average value of the change in the normalized burn ratio. Level 3 requires the burned area and the calculation of the hydraulic functional connectivity, which is a variable that incorporates the sequence of soil burn severity along hillslope flow paths within the burned basin. Measurements indicate that the unit peak discharge response increases abruptly when the 30-minute maximum rainfall intensity is greater than about 5 millimeters per hour (0.2 inches per hour). This threshold may relate to a change in runoff generation from saturated-excess to infiltration-excess overland flow. The

  13. Comparison and optimization of different peak integration methods to determine the variance of unretained and extra-column peaks.

    PubMed

    Vanderheyden, Yoachim; Broeckhoven, Ken; Desmet, Gert

    2014-10-17

    Different automatic peak integration methods have been reviewed and compared for their ability to accurately determine the variance of the very narrow and very fast eluting peaks encountered when measuring the instrument band broadening of today's low dispersion liquid chromatography instruments. Using fully maximized injection concentrations to work at the highest possible signal-to-noise ratio's (SNR), the best results were obtained with the so-called variance profile analysis method. This is an extension (supplemented with a user-independent read-out algorithm) of a recently proposed method which calculates the peak variance value for any possible value of the peak end time, providing a curve containing all the possible variance values and theoretically levelling off to the (best possible estimate of the) true variance. Despite the use of maximal injection concentrations (leading to SNRs over 10,000), the peak variance errors were of the order of some 10-20%, mostly depending on the peak tail characteristics. The accuracy could however be significantly increased (to an error level below 0.5-2%) by averaging over 10-15 subsequent measurements, or by first adding the peak profiles of 10-15 subsequent runs and then analyzing this summed peak. There also appears to be an optimal detector intermediate frequency, with the higher frequencies suffering from their poorer signal-to-noise-ratio and with the smaller detector frequencies suffering from a limited number of data points. When the SNR drops below 1000, an accurate determination of the true variance of extra-column peaks of modern instruments no longer seems to be possible.

  14. Combined use of algorithms for peak picking, peak tracking and retention modelling to optimize the chromatographic conditions for liquid chromatography-mass spectrometry analysis of fluocinolone acetonide and its degradation products.

    PubMed

    Fredriksson, Mattias J; Petersson, Patrik; Axelsson, Bengt-Olof; Bylund, Dan

    2011-10-17

    A strategy for rapid optimization of liquid chromatography column temperature and gradient shape is presented. The optimization as such is based on the well established retention and peak width models implemented in software like e.g. DryLab and LC simulator. The novel part of the strategy is a highly automated processing algorithm for detection and tracking of chromatographic peaks in noisy liquid chromatography-mass spectrometry (LC-MS) data. The strategy is presented and visualized by the optimization of the separation of two degradants present in ultraviolet (UV) exposed fluocinolone acetonide. It should be stressed, however, that it can be utilized for LC-MS analysis of any sample and application where several runs are conducted on the same sample. In the application presented, 30 components that were difficult or impossible to detect in the UV data could be automatically detected and tracked in the MS data by using the proposed strategy. The number of correctly tracked components was above 95%. Using the parameters from the reconstructed data sets to the model gave good agreement between predicted and observed retention times at optimal conditions. The area of the smallest tracked component was estimated to 0.08% compared to the main component, a level relevant for the characterization of impurities in the pharmaceutical industry.

  15. Variable Depth Bragg Peak Method for Single Event Effects Testing

    NASA Technical Reports Server (NTRS)

    Buchner, S.; Kanyogoro, N.; Foster, C.; O'Neill, P.

    2011-01-01

    Traditionally, accelerator SEE testing is accomplished by removing the tops of packages so that the IC chips are accessible to heavy ions. However, ICs in some advanced packages cannot be de-lidded so a different approach is used that involves grinding and/or chemically etching away part of the package and the chip from the back side. The parts are then tested from the back side with ions having sufficient range to reach the sensitive volume. More recently, the entire silicon substrate in an SOI/SRAM was removed, making it possible to use low-energy ions with shorter ranges. Where removal of part of the package is not possible, facilities at Michigan State, NASA Space Radiation Laboratory, GANIL (France) and GSI (Germany) offer high-energy heavy ions with long ranges so that the ions can reach the devices' sensitive volumes without much change in the LET. Unfortunately, a run will typically involve only one ion species having a single energy and LET due to the long time it takes to tune a new energy. The Variable Depth Bragg Peak (VDBP) method is similar to the above method in that it involves the use of high-energy heavy ions that are able to pass through the packaging material and reach the device, obviating the need to remove the package. However, the method provides a broad range of LETs from a single ion by inserting degraders in the beam that modify the ion energy and, therefore, the LET. The crux of the method involves establishing a fiduciary point for degrader thickness, i.e., where the Bragg peak is located precisely at the sensitive volume in the device, for which the measured SEU cross-section and the ion LET are both also maxima and can be calculated using a Monte-Carlo program, TRIM. Once the fiduciary point has been established, calibrated high density polyethylene (HDPE) degraders are inserted into or removed from the beam to vary the ion LET at the device in a known manner. After each change of degrader thickness, the SEU cross-section is measured

  16. [An automatic peak detection method for LIBS spectrum based on continuous wavelet transform].

    PubMed

    Chen, Peng-Fei; Tian, Di; Qiao, Shu-Jun; Yang, Guang

    2014-07-01

    Spectrum peak detection in the laser-induced breakdown spectroscopy (LIBS) is an essential step, but the presence of background and noise seriously disturb the accuracy of peak position. The present paper proposed a method applied to automatic peak detection for LIBS spectrum in order to enhance the ability of overlapping peaks searching and adaptivity. We introduced the ridge peak detection method based on continuous wavelet transform to LIBS, and discussed the choice of the mother wavelet and optimized the scale factor and the shift factor. This method also improved the ridge peak detection method with a correcting ridge method. The experimental results show that compared with other peak detection methods (the direct comparison method, derivative method and ridge peak search method), our method had a significant advantage on the ability to distinguish overlapping peaks and the precision of peak detection, and could be be applied to data processing in LIBS.

  17. Methods for reducing peak pressure in laparoscopic grasping.

    PubMed

    Bos, Jasper; Doornebosch, Ernst W L J; Engbers, Josco G; Nyhuis, Ole; Dodou, Dimitra

    2013-12-01

    During tissue retraction with a laparoscopic grasper, tissue-damaging pressures can occur. Past research suggests that peak pressures can be considerably reduced by rounding the edges or covering the tip of the end effector with a silicon sleeve. To identify grasping methods that limit tissue damage, the effects of (a) Young's modulus of the end effector, (b) curvature of the end effector, and (c) angle with which the tissue is pulled relative to the plane of the end effector, on the pressure generated on the tissue were investigated. Artificial skin was placed between two non-serrated jaws, a pressure-sensitive film was interposed between the skin and upper jaw, and the end effector was loaded with 13 N. End effectors with Young's moduli of 0.09, 0.67, 1.49 MPa, and 69 GPa, and with non-rounded and 5 mm rounded edges were tested under pulling angles of 25°, 50°, and 75°. For non-rounded end effectors, the maximum pressure and the area across which pressure exceeded the safety threshold for tissue damage increased with Young's modulus and pulling angle. For rounded end effectors, maximum pressure did not increase monotonically with Young's modulus. Instead, the end effector with the second lowest Young's modulus yielded significantly lower maximum pressure than the end effector with the lowest Young's modulus. For rounded end effectors, pressures were below the safety threshold for all Young's moduli. This indicates that to prevent tissue damage, soft graspers may not be needed; rounding the edges of metal graspers could suffice for preventing tissue damage.

  18. PeakLink: a new peptide peak linking method in LC-MS/MS using wavelet and SVM

    PubMed Central

    Ghanat Bari, Mehrab; Ma, Xuepo; Zhang, Jianqiu

    2014-01-01

    Motivation: In liquid chromatography–mass spectrometry/tandem mass spectrometry (LC-MS/MS), it is necessary to link tandem MS-identified peptide peaks so that protein expression changes between the two runs can be tracked. However, only a small number of peptides can be identified and linked by tandem MS in two runs, and it becomes necessary to link peptide peaks with tandem identification in one run to their corresponding ones in another run without identification. In the past, peptide peaks are linked based on similarities in retention time (rt), mass or peak shape after rt alignment, which corrects mean rt shifts between runs. However, the accuracy in linking is still limited especially for complex samples collected from different conditions. Consequently, large-scale proteomics studies that require comparison of protein expression profiles of hundreds of patients can not be carried out effectively. Method: In this article, we consider the problem of linking peptides from a pair of LC-MS/MS runs and propose a new method, PeakLink (PL), which uses information in both the time and frequency domain as inputs to a non-linear support vector machine (SVM) classifier. The PL algorithm first uses a threshold on an rt likelihood ratio score to remove candidate corresponding peaks with excessively large elution time shifts, then PL calculates the correlation between a pair of candidate peaks after reducing noise through wavelet transformation. After converting rt and peak shape correlation to statistical scores, an SVM classifier is trained and applied for differentiating corresponding and non-corresponding peptide peaks. Results: PL is tested in multiple challenging cases, in which LC-MS/MS samples are collected from different disease states, different instruments and different laboratories. Testing results show significant improvement in linking accuracy compared with other algorithms. Availability and implementation: M files for the PL alignment method are available

  19. A short recollection on the paper entitled "A common sense approach to peak picking in two-, three-, and four-dimensional spectra using automatic computer analysis of contour diagrams" by D.S. Garrett, R. Powers, A.M. Gronenborn, and G.M. Clore [J. Magn. Reson. 95 (1991) 214-220

    NASA Astrophysics Data System (ADS)

    Garrett, Daniel S.; Gronenborn, Angela M.; Marius Clore, G.

    2011-12-01

    The Contour Approach to Peak Picking was developed to aid in the analysis and interpretation and of multidimensional NMR spectra of large biomolecules. In essence, it comprises an interactive graphics software tool to computationally select resonance positions in heteronuclear, 3- and 4D spectra.

  20. A short recollection on the paper entitled "A common sense approach to peak picking in two-, three-, and four-dimensional spectra using automatic computer analysis of contour diagrams" by D.S. Garrett, R. Powers, A.M. Gronenborn, and G.M. Clore [J. Magn. Reson. 95 (1991) 214-220].

    PubMed

    Garrett, Daniel S; Gronenborn, Angela M; Clore, G Marius

    2011-12-01

    The Contour Approach to Peak Picking was developed to aid in the analysis and interpretation and of multidimensional NMR spectra of large biomolecules. In essence, it comprises an interactive graphics software tool to computationally select resonance positions in heteronuclear, 3- and 4D spectra.

  1. Niemann-Pick disease

    MedlinePlus

    NPD; Sphingomyelinase deficiency; Lipid storage disorder - Niemann-Pick disease; Lysosomal storage disease - Niemann-Pick ... cannot properly break down cholesterol and other fats (lipids). This leads to too much cholesterol in the ...

  2. A NEW METHOD OF PEAK DETECTION FOR ANALYSIS OF COMPREHENSIVE TWO-DIMENSIONAL GAS CHROMATOGRAPHY MASS SPECTROMETRY DATA.

    PubMed

    Kim, Seongho; Ouyang, Ming; Jeong, Jaesik; Shen, Changyu; Zhang, Xiang

    2014-06-01

    We develop a novel peak detection algorithm for the analysis of comprehensive two-dimensional gas chromatography time-of-flight mass spectrometry (GC×GC-TOF MS) data using normal-exponential-Bernoulli (NEB) and mixture probability models. The algorithm first performs baseline correction and denoising simultaneously using the NEB model, which also defines peak regions. Peaks are then picked using a mixture of probability distribution to deal with the co-eluting peaks. Peak merging is further carried out based on the mass spectral similarities among the peaks within the same peak group. The algorithm is evaluated using experimental data to study the effect of different cut-offs of the conditional Bayes factors and the effect of different mixture models including Poisson, truncated Gaussian, Gaussian, Gamma, and exponentially modified Gaussian (EMG) distributions, and the optimal version is introduced using a trial-and-error approach. We then compare the new algorithm with two existing algorithms in terms of compound identification. Data analysis shows that the developed algorithm can detect the peaks with lower false discovery rates than the existing algorithms, and a less complicated peak picking model is a promising alternative to the more complicated and widely used EMG mixture models.

  3. Equine preantral follicles obtained via the Biopsy Pick-Up method: histological evaluation and validation of a mechanical isolation technique.

    PubMed

    Haag, K T; Magalhães-Padilha, D M; Fonseca, G R; Wischral, A; Gastal, M O; King, S S; Jones, K L; Figueiredo, J R; Gastal, E L

    2013-03-15

    The aims of this study in mares were to: (1) compare preantral follicle parameters between in vitro Biopsy Pick-Up (BPU) and scalpel blade collection methods and between histological and mechanical isolation processing (experiment 1); (2) histologically evaluate preantral follicles (experiment 2); and (3) compare histological analysis with a previously established mechanical isolation technique using a tissue chopper (experiment 3) for ovarian cortical fragments obtained in vivo using a BPU instrument. In experiment 1, preantral follicles were analyzed (N = 220; 90% primordial and 10% primary). Proportions of primordial and primary follicles did not differ (P > 0.05) between tissue collection (BPU vs. scalpel blade dissection) or processing (mechanical isolation vs. histology) methods. Follicle viability and morphology rates were similar (P > 0.05) between tissue collection methods, but mechanical isolation produced more (P < 0.05) morphologically normal follicles than histology. For experiment 2, preantral follicles (N = 332) were analyzed and primordial and transitional (combined) follicles and oocytes were 36.3 ± 0.3 and 26.1 ± 0.3 μm in diameter, respectively, and primary follicles and oocytes averaged 42.9 ± 1.8 and 31.8 ± 2.1 μm. For experiment 3 (188 preantral follicles), within the same animals, the proportion of primordial versus primary follicles was higher (P < 0.03) for histological analysis (98%) compared to tissue chopper analysis (94%), and number of follicles per mg of tissue was not affected (P > 0.05) by processing methods. In conclusion, most parameters evaluated for preantral follicles were similar between histological and tissue chopper processing techniques; hence, mechanical isolation efficiently dissociated equine preantral follicles from the ovarian cortex. Therefore, the tissue chopper could be used to isolate large numbers of morphologically normal equine preantral follicles for cryopreservation and/or in vitro culture. Copyright

  4. An automated framework for NMR resonance assignment through simultaneous slice picking and spin system forming.

    PubMed

    Abbas, Ahmed; Guo, Xianrong; Jing, Bing-Yi; Gao, Xin

    2014-06-01

    Despite significant advances in automated nuclear magnetic resonance-based protein structure determination, the high numbers of false positives and false negatives among the peaks selected by fully automated methods remain a problem. These false positives and negatives impair the performance of resonance assignment methods. One of the main reasons for this problem is that the computational research community often considers peak picking and resonance assignment to be two separate problems, whereas spectroscopists use expert knowledge to pick peaks and assign their resonances at the same time. We propose a novel framework that simultaneously conducts slice picking and spin system forming, an essential step in resonance assignment. Our framework then employs a genetic algorithm, directed by both connectivity information and amino acid typing information from the spin systems, to assign the spin systems to residues. The inputs to our framework can be as few as two commonly used spectra, i.e., CBCA(CO)NH and HNCACB. Different from the existing peak picking and resonance assignment methods that treat peaks as the units, our method is based on 'slices', which are one-dimensional vectors in three-dimensional spectra that correspond to certain ([Formula: see text]) values. Experimental results on both benchmark simulated data sets and four real protein data sets demonstrate that our method significantly outperforms the state-of-the-art methods while using a less number of spectra than those methods. Our method is freely available at http://sfb.kaust.edu.sa/Pages/Software.aspx.

  5. Comparison of Peak-Flow Estimation Methods for Small Drainage Basins in Maine

    USGS Publications Warehouse

    Hodgkins, Glenn A.; Hebson, Charles; Lombard, Pamela J.; Mann, Alexander

    2007-01-01

    Understanding the accuracy of commonly used methods for estimating peak streamflows is important because the designs of bridges, culverts, and other river structures are based on these flows. Different methods for estimating peak streamflows were analyzed for small drainage basins in Maine. For the smallest basins, with drainage areas of 0.2 to 1.0 square mile, nine peak streamflows from actual rainfall events at four crest-stage gaging stations were modeled by the Rational Method and the Natural Resource Conservation Service TR-20 method and compared to observed peak flows. The Rational Method had a root mean square error (RMSE) of -69.7 to 230 percent (which means that approximately two thirds of the modeled flows were within -69.7 to 230 percent of the observed flows). The TR-20 method had an RMSE of -98.0 to 5,010 percent. Both the Rational Method and TR-20 underestimated the observed flows in most cases. For small basins, with drainage areas of 1.0 to 10 square miles, modeled peak flows were compared to observed statistical peak flows with return periods of 2, 50, and 100 years for 17 streams in Maine and adjoining parts of New Hampshire. Peak flows were modeled by the Rational Method, the Natural Resources Conservation Service TR-20 method, U.S. Geological Survey regression equations, and the Probabilistic Rational Method. The regression equations were the most accurate method of computing peak flows in Maine for streams with drainage areas of 1.0 to 10 square miles with an RMSE of -34.3 to 52.2 percent for 50-year peak flows. The Probabilistic Rational Method was the next most accurate method (-38.5 to 62.6 percent). The Rational Method (-56.1 to 128 percent) and particularly the TR-20 method (-76.4 to 323 percent) had much larger errors. Both the TR-20 and regression methods had similar numbers of underpredictions and overpredictions. The Rational Method overpredicted most peak flows and the Probabilistic Rational Method tended to overpredict peak flows

  6. Pick a Number ... Any Number?

    ERIC Educational Resources Information Center

    Simons, Jacob V., Jr.; Price, Barbara A.

    2005-01-01

    A recent classroom revelation caused us to reconsider the adequacy of the instructions offered in our textbooks for one of our most elementary quantitative methods. Specifically, we found that many students were mystified concerning how to pick an initial objective function value when plotting an isoprofit line in order to graphically solve a…

  7. A processing method enabling the use of peak height for accurate and precise proton NMR quantitation.

    PubMed

    Hays, Patrick A; Thompson, Robert A

    2009-10-01

    In NMR, peak area quantitation is the most common method used because the area under a peak or peak group is proportional to the number of nuclei at those frequencies. Peak height quantitation has not enjoyed as much utility because of poor precision and linearity as a result of inconsistent shapes and peak widths (measured at half height). By using a post-acquisition processing method employing a Gaussian or line-broadening (exponential decay) apodization (i.e. weighting function) to normalize the shape and width of the internal standard (ISTD) peak, the heights of an analyte calibration spectrum can be compared to the analyte peaks in a sample spectrum resulting in accurate and precise quantitative results. Peak height results compared favorably with 'clean' peak area results for several hundred illicit samples of methamphetamine HCl, cocaine HCl, and heroin HCl, of varying composition and purity. Using peak height and peak area results together can enhance the confidence in the reported purity value; a major advantage in high throughput, automated quantitative analyses. Published in 2009 by John Wiley & Sons, Ltd.

  8. 13. View of Picking Shakers, Steam Picking Shaker (right), Lamp ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    13. View of Picking Shakers, Steam Picking Shaker (right), Lamp Picking Shaker (right) Photograph taken by Joseph E.B. Elliot - Huber Coal Breaker, Breaker, 101 South Main Street, Ashley, Luzerne County, PA

  9. A method for estimating peak and time of peak streamflow from excess rainfall for 10- to 640-acre watersheds in the Houston, Texas, metropolitan area

    USGS Publications Warehouse

    Asquith, William H.; Cleveland, Theodore G.; Roussel, Meghan C.

    2011-01-01

    Estimates of peak and time of peak streamflow for small watersheds (less than about 640 acres) in a suburban to urban, low-slope setting are needed for drainage design that is cost-effective and risk-mitigated. During 2007-10, the U.S. Geological Survey (USGS), in cooperation with the Harris County Flood Control District and the Texas Department of Transportation, developed a method to estimate peak and time of peak streamflow from excess rainfall for 10- to 640-acre watersheds in the Houston, Texas, metropolitan area. To develop the method, 24 watersheds in the study area with drainage areas less than about 3.5 square miles (2,240 acres) and with concomitant rainfall and runoff data were selected. The method is based on conjunctive analysis of rainfall and runoff data in the context of the unit hydrograph method and the rational method. For the unit hydrograph analysis, a gamma distribution model of unit hydrograph shape (a gamma unit hydrograph) was chosen and parameters estimated through matching of modeled peak and time of peak streamflow to observed values on a storm-by-storm basis. Watershed mean or watershed-specific values of peak and time to peak ("time to peak" is a parameter of the gamma unit hydrograph and is distinct from "time of peak") of the gamma unit hydrograph were computed. Two regression equations to estimate peak and time to peak of the gamma unit hydrograph that are based on watershed characteristics of drainage area and basin-development factor (BDF) were developed. For the rational method analysis, a lag time (time-R), volumetric runoff coefficient, and runoff coefficient were computed on a storm-by-storm basis. Watershed-specific values of these three metrics were computed. A regression equation to estimate time-R based on drainage area and BDF was developed. Overall arithmetic means of volumetric runoff coefficient (0.41 dimensionless) and runoff coefficient (0.25 dimensionless) for the 24 watersheds were used to express the rational

  10. Method of multi-dimensional moment analysis for the characterization of signal peaks

    DOEpatents

    Pfeifer, Kent B; Yelton, William G; Kerr, Dayle R; Bouchier, Francis A

    2012-10-23

    A method of multi-dimensional moment analysis for the characterization of signal peaks can be used to optimize the operation of an analytical system. With a two-dimensional Peclet analysis, the quality and signal fidelity of peaks in a two-dimensional experimental space can be analyzed and scored. This method is particularly useful in determining optimum operational parameters for an analytical system which requires the automated analysis of large numbers of analyte data peaks. For example, the method can be used to optimize analytical systems including an ion mobility spectrometer that uses a temperature stepped desorption technique for the detection of explosive mixtures.

  11. Skin picking disorder.

    PubMed

    Grant, Jon E; Odlaug, Brian L; Chamberlain, Samuel R; Keuthen, Nancy J; Lochner, Christine; Stein, Dan J

    2012-11-01

    Although skin picking has been documented in the medical literature since the 19th century, only now is it receiving serious consideration as a DSM psychiatric disorder in discussions for DSM-5. Recent community prevalence studies suggest that skin picking disorder appears to be as common as many other psychiatric disorders, with reported prevalences ranging from 1.4% to 5.4%. Clinical evaluation of patients with skin picking disorder entails a broad physical and psychiatric examination, encouraging an interdisciplinary approach to evaluation and treatment. Approaches to treatment should include cognitive-behavioral therapy (including habit reversal or acceptance-enhanced behavior therapy) and medication (serotonin reuptake inhibitors, N-acetylcysteine, or naltrexone). Based on clinical experience and research findings, the authors recommend several management approaches to skin picking disorder.

  12. Two-point method for kinetic analysis of a thermoluminescence glow peak

    NASA Astrophysics Data System (ADS)

    Ogundare, F. O.; Chithambo, M. L.

    2006-05-01

    We present a method for the estimation of defect (trap) physical parameters from thermoluminescence (TL) glow peaks. In this method, the order of kinetics b is determined using two values of TL intensity each of which corresponds to the same temperature (T-1) on two separate glow peaks of a phosphor. The two glow peaks are obtained from two aliquots of the phosphor irradiated to same dose but read out at different heating rates. The proposed method requires a minimum of only two data points in contrast to standard peak shape (PS) methods that require three points corresponding to three different temperatures on the same glow peak. Once the order of kinetics b is determined, the activation energy E is calculated by taking a second point (T-2) on any one of the two glow peaks. The values of b and E thus obtained are used to evaluate the frequency factor S'' and the number of trapped electrons before the heating begins n(o). The validity of the method was checked using two numerically generated glow peaks. For the two cases, the method reproduced the input values reasonably well. The method was also used to analyse two experimental glow peaks. The results obtained provide a reasonably good fit to the experimental data. The kinetic parameters calculated using the present technique are comparable to those calculated using PS and initial rise methods. Initial guesses can easily be obtained for E and S'' using the present technique when a glow curve is to be deconvoluted with a model consisting of many unknown parameters with E and S'' inclusive.

  13. DETECTORS AND EXPERIMENTAL METHODS: A method for interpolating asymmetric peak shapes in multiplet γ-ray spectra

    NASA Astrophysics Data System (ADS)

    Wang, Si-Guang; Mao, Ya-Jun; Tang, Pei-Jia; Zhu, Bo; Liang, Yu-Tie

    2009-05-01

    The peak shapes of γ-rays at various energies must be known before unfolding the multiplet spectra obtained by using semiconductor or scintillation detectors. Traditional methods describe isolated peaks with multi-parameter fitting functions, and assume that most of these parameters do not vary with energy because it is rare to find a spectrum with enough isolated peaks to constrain their dependence. We present an algorithm for interpolating the γ-ray profile at any intermediate energy given a pair of isolated γ-ray peaks from the spectrum under consideration. The algorithm is tested on experimental data and leads to a good agreement between the interpolated profile and the fitting function. This method is more accurate than the traditional approach, since all aspects of the peak shape are allowed to vary with energy. New definitions of Left-Half Width at Half Maximum, and Right-Half Width at Half Maximum for peak shape description are introduced in this paper.

  14. A new method that indicates the peak stress of random vibration response

    NASA Astrophysics Data System (ADS)

    Yan, Yong; Xie, Peng; Xu, Zhen; Jin, Guang

    2012-09-01

    It is an important assessment targets that make a quantitative study of the peak stress of random vibration response during the mechanical properties design process of the space payload. Based on the equivalent of the destructive effect of the random vibration peak response and sine vibration response, the paper established the link between the two, obtained the sine vibration input function that equivalent to the destructive effect of the random vibration peak response. Considering the characteristic of the quantitative research that stress of sine vibration can be, the paper analyzed the stress of the sine vibration by the finite element method and indirectly accessed to the random vibration response peak stress which equivalent to the sine vibration destructive effect. This method worked very well to indicate the peak stress of random vibration response during the ground random vibration tests. The paper provided an effective means of predictive and validation method for the mechanical properties design and test during the ground random vibration test evaluation. The developments costs of the engineering can be significant saving and greatly shorten the development cycle by the method of the peak stress of random vibration response indicated during the ground tests. It is also helpful to improve the safety and reliability of the space load structure in order to avoid the failure or fatigue of the ground random vibration tests.

  15. Metrological activity determination of 133Ba by sum-peak absolute method

    NASA Astrophysics Data System (ADS)

    da Silva, R. L.; de Almeida, M. C. M.; Delgado, J. U.; Poledna, R.; Santos, A.; de Veras, E. V.; Rangel, J.; Trindade, O. L.

    2016-07-01

    The National Laboratory for Metrology of Ionizing Radiation provides gamma sources of radionuclide and standardized in activity with reduced uncertainties. Relative methods require standards to determine the sample activity while the absolute methods, as sum-peak, not. The activity is obtained directly with good accuracy and low uncertainties. 133Ba is used in research laboratories and on calibration of detectors for analysis in different work areas. Classical absolute methods don't calibrate 133Ba due to its complex decay scheme. The sum-peak method using gamma spectrometry with germanium detector standardizes 133Ba samples. Uncertainties lower than 1% to activity results were obtained.

  16. Methods for estimating the magnitude and frequency of peak discharges of rural, unregulated streams in Virginia

    USGS Publications Warehouse

    Bisese, James A.

    1995-01-01

    Methods are presented for estimating the peak dis- charges of rural, unregulated streams in Virginia. A Pearson Type III distribution was fitted to the logarithms of annual peak-discharge records from 363 stream-gaging stations in Virginia to estimate the peak discharge at these stations for recurrence intervals of 2 to 500 years. Peak-discharge characteristics for 284 stations were regressed on potential explanatory variables, including drainage area, main channel length, main channel slope, mean basin elevation, percentage of forest cover, mean annual precipitation, and maximum rainfall intensity, by using generalized least-squares multiple-regression analysis. Stations were grouped into eight peak-discharge regions based on the five physiographic provinces in the State, and equations are presented for each region. Alternative equations using drainage area only are presented for each region. Alternative equations using drainage area only are presented for each region. Methods and sample computations are provided to estimate peak discharges for recurrence intervals of 2 to 500 years at gaged and ungaged sites in Virginia, and to adjust the regression estimates for sites where nearby gaged-site data are available.

  17. A method for modelling peak signal statistics on a mobile satellite transponder

    NASA Technical Reports Server (NTRS)

    Bilodeau, Andre; Lecours, Michel; Pelletier, Marcel; Delisle, Gilles Y.

    1990-01-01

    A simulation method is proposed. The simulation was developed to model the peak duration and energy content of signal peaks in a mobile communication satellite operating in a Frequency Division Multiple Access (FDMA) mode and presents an estimate of those power peaks for a system where the channels are modeled as band limited Gaussian noise, which is taken as a reasonable representation for Amplitude Commanded Single Sideband (ACSSB), Minimum Shift Keying (MSK), or Phase Shift Keying (PSK) modulated signals. The simulation results show that, under this hypothesis, the level of the signal power peaks for 10 percent, 1 percent, and 0.1 percent of the time are well described by a Rayleigh law and that their duration is extremely short and inversely proportional to the total FDM system bandwidth.

  18. Method and apparatus for clockless analog-to-digital conversion and peak detection

    DOEpatents

    DeGeronimo, Gianluigi

    2007-03-06

    An apparatus and method for analog-to-digital conversion and peak detection includes at least one stage, which includes a first switch, second switch, current source or capacitor, and discriminator. The discriminator changes state in response to a current or charge associated with the input signal exceeding a threshold, thereby indicating whether the current or charge associated with the input signal is greater than the threshold. The input signal includes a peak or a charge, and the converter includes a peak or charge detect mode in which a state of the switch is retained in response to a decrease in the current or charge associated with the input signal. The state of the switch represents at least a portion of a value of the peak or of the charge.

  19. [Skin-picking disorder].

    PubMed

    Niemeier, V; Peters, E; Gieler, U

    2015-10-01

    The disorder is characterized by compulsive repetitive skin-picking (SP), resulting in skin lesions. The patients must have undertaken several attempts to reduce or stop SP. The disorder must have led to clinically significant limitations in social, professional, or other important areas of life. The symptoms cannot be better explained by another emotional disorder or any other dermatological disease. In the new DSM-V, skin-picking disorder has been included in the diagnostic system as an independent disorder and describes the self-injury of the skin by picking or scratching with an underlying emotional disorder. SP is classified among the impulse-control disorders and is, thus, differentiated from compulsive disorders as such. There are often emotional comorbidities. In cases of pronounced psychosocial limitation, interdisciplinary cooperation with a psychotherapist and/or psychiatrist is indicated.

  20. Statistical processing method of sidelobe peaks for earth-station antennas

    NASA Astrophysics Data System (ADS)

    Wakana, Hiromitsu; Fujieda, Tsuyoshi; Kosaka, Katsuhiko

    1987-04-01

    For coordination studies and for the assessment of mutual interference between radiocommunication-satellite systems and between earth stations and radio-relay stations sharing the same frequency band, the method which represents off-axis radiation characteristics of the earth-station antenna is desirable. For this purpose, International Radio Consultative Committee Report 391-4 describes a statistical processing method of sidelobe peaks. This statistical processing method is based on the slope of reference radiation pattern, while the old one, which has been used, is based on the absolute peak value. Therefore, the results of the statistical evaluation using the current (new) method may differ from that using the old method. According to the measured data on a Cassegrain antenna of 13 m in diameter at about 12 GHz, it is shown that the worst 10-percent value of sidelobe peaks of the new processing method, which is the level exceeded by 10 percent of the peaks, is statistically about 0.8 dB lower than that of the old method.

  1. Evaluation of injection methods for fast, high peak capacity separations with low thermal mass gas chromatography.

    PubMed

    Fitz, Brian D; Mannion, Brandyn C; To, Khang; Hoac, Trinh; Synovec, Robert E

    2015-05-01

    Low thermal mass gas chromatography (LTM-GC) was evaluated for rapid, high peak capacity separations with three injection methods: liquid, headspace solid phase micro-extraction (HS-SPME), and direct vapor. An Agilent LTM equipped with a short microbore capillary column was operated at a column heating rate of 250 °C/min to produce a 60s separation. Two sets of experiments were conducted in parallel to characterize the instrumental platform. First, the three injection methods were performed in conjunction with in-house built high-speed cryo-focusing injection (HSCFI) to cryogenically trap and re-inject the analytes onto the LTM-GC column in a narrower band. Next, the three injection methods were performed natively with LTM-GC. Using HSCFI, the peak capacity of a separation of 50 nl of a 73 component liquid test mixture was 270, which was 23% higher than without HSCFI. Similar peak capacity gains were obtained when using the HSCFI with HS-SPME (25%), and even greater with vapor injection (56%). For the 100 μl vapor sample injected without HSCFI, the preconcentration factor, defined as the ratio of the maximum concentration of the detected analyte peak relative to the analyte concentration injected with the syringe, was determined to be 11 for the earliest eluting peak (most volatile analyte). In contrast, the preconcentration factor for the earliest eluting peak using HSCFI was 103. Therefore, LTM-GC is demonstrated to natively provide in situ analyte trapping, although not to as great an extent as with HSCFI. We also report the use of LTM-GC applied with time-of-flight mass spectrometry (TOFMS) detection for rapid, high peak capacity separations from SPME sampled banana peel headspace.

  2. Calculating the peak skin dose resulting from fluoroscopically guided interventions. Part I: Methods.

    PubMed

    Jones, A Kyle; Pasciak, Alexander S

    2011-11-15

    While direct measurement of the peak skin dose resulting from a fluoroscopically-guided procedure is possible, the decision must be made a priori at additional cost and time. It is most often the case that the need for accurate knowledge of the peak skin dose is realized only after a procedure has been completed, or after a suspected reaction has been discovered. Part I of this review article discusses methods for calculating the peak skin dose across a range of clinical scenarios. In some cases, a wealth of data are available, while in other cases few data are available and additional data must be measured in order to estimate the peak skin dose. Data may be gathered from a dose report, the DICOM headers of images, or from staff and physician interviews. After data are gathered, specific steps must be followed to convert dose metrics, such as the reference point air kerma (K(a,r)) or the kerma area product (KAP), into peak skin dose. These steps require knowledge of other related factors, such as the f-factor and the backscatter factor, tables of which are provided in this manuscript. Sources of error and the impact of these errors on the accuracy of the final estimate of the peak skin dose are discussed.

  3. VERSE-Guided Numerical RF Pulse Design: A Fast Method for Peak RF Power Control

    PubMed Central

    Lee, Daeho; Grissom, William A.; Lustig, Michael; Kerr, Adam B.; Stang, Pascal P.; Pauly, John M.

    2013-01-01

    In parallel excitation, the computational speed of numerical radiofrequency (RF) pulse design methods is critical when subject dependencies and system nonidealities need to be incorporated on-the-fly. One important concern with optimization-based methods is high peak RF power exceeding hardware or safety limits. Hence, online controllability of the peak RF power is essential. Variable-rate selective excitation pulse reshaping is ideally suited to this problem due to its simplicity and low computational cost. In this work, we first improve the fidelity of variable-rate selective excitation implementation for discrete-time waveforms through waveform oversampling such that variable-rate selective excitation can be robustly applied to numerically designed RF pulses. Then, a variable-rate selective excitation-guided numerical RF pulse design is suggested as an online RF pulse design framework, aiming to simultaneously control peak RF power and compensate for off-resonance. PMID:22135085

  4. Discrete ordinates transport methods for problems with highly forward-peaked scattering

    SciTech Connect

    Pautz, S.D.

    1998-04-01

    The author examines the solutions of the discrete ordinates (S{sub N}) method for problems with highly forward-peaked scattering kernels. He derives conditions necessary to obtain reasonable solutions in a certain forward-peaked limit, the Fokker-Planck (FP) limit. He also analyzes the acceleration of the iterative solution of such problems and offer improvements to it. He extends the analytic Fokker-Planck limit analysis to the S{sub N} equations. This analysis shows that in this asymptotic limit the S{sub N} solution satisfies a pseudospectral discretization of the FP equation, provided that the scattering term is handled in a certain way (which he describes) and that the analytic transport solution satisfies an analytic FP equation. Similar analyses of various spatially discretized S{sub N} equations reveal that they too produce solutions that satisfy discrete FP equations, given the same provisions. Numerical results agree with these theoretical predictions. He defines a multidimensional angular multigrid (ANMG) method to accelerate the iterative solution of highly forward-peaked problems. The analyses show that a straightforward application of this scheme is subject to high-frequency instabilities. However, by applying a diffusive filter to the ANMG corrections he is able to stabilize this method. Fourier analyses of model problems show that the resulting method is effective at accelerating the convergence rate when the scattering is forward-peaked. The numerical results demonstrate that these analyses are good predictors of the actual performance of the ANMG method.

  5. Peak event analysis: a novel empirical method for the evaluation of elevated particulate events

    PubMed Central

    2013-01-01

    Background We report on a novel approach to the analysis of suspended particulate data in a rural setting in southern Ontario. Analyses of suspended particulate matter and associated air quality standards have conventionally focussed on 24-hour mean levels of total suspended particulates (TSP) and particulate matter <10 microns, <2.5 microns and <1 micron in diameter (PM10, PM2.5, PM1, respectively). Less emphasis has been placed on brief peaks in suspended particulate levels, which may pose a substantial nuisance, irritant, or health hazard. These events may also represent a common cause of public complaint and concern regarding air quality. Methods Measurements of TSP, PM10, PM2.5, and PM1 levels were taken using an automated device following local complaints of dusty conditions in rural south-central Ontario, Canada. The data consisted of 126,051 by-minute TSP, PM10, PM2.5, and PM1 measurements between May and August 2012. Two analyses were performed and compared. First, conventional descriptive statistics were computed by month for TSP, PM10, PM2.5, and PM1, including mean values and percentiles (70th, 90th, and 95th). Second, a novel graphical analysis method, using density curves and line plots, was conducted to examine peak events occurring at or above the 99th percentile of per-minute TSP readings. We refer to this method as “peak event analysis”. Findings of the novel method were compared with findings from the conventional approach. Results Conventional analyses revealed that mean levels of all categories of suspended particulates and suspended particulate diameter ratios conformed to existing air quality standards. Our novel methodology revealed extreme outlier events above the 99th percentile of readings, with peak PM10 and TSP levels over 20 and 100 times higher than the respective mean values. Peak event analysis revealed and described rare and extreme peak dust events that would not have been detected using conventional descriptive statistics

  6. An R-peak detection method that uses an SVD filter and a search back system.

    PubMed

    Jung, Woo-Hyuk; Lee, Sang-Goog

    2012-12-01

    In this paper, we present a method for detecting the R-peak of an ECG signal by using an singular value decomposition (SVD) filter and a search back system. The ECG signal was detected in two phases: the pre-processing phase and the decision phase. The pre-processing phase consisted of the stages for the SVD filter, Butterworth High Pass Filter (HPF), moving average (MA), and squaring, whereas the decision phase consisted of a single stage that detected the R-peak. In the pre-processing phase, the SVD filter removed noise while the Butterworth HPF eliminated baseline wander. The MA removed the remaining noise of the signal that had gone through the SVD filter to make the signal smooth, and squaring played a role in strengthening the signal. In the decision phase, the threshold was used to set the interval before detecting the R-peak. When the latest R-R interval (RRI), suggested by Hamilton et al., was greater than 150% of the previous RRI, the method of detecting the R-peak in such an interval was modified to be 150% or greater than the smallest interval of the two most latest RRIs. When the modified search back system was used, the error rate of the peak detection decreased to 0.29%, compared to 1.34% when the modified search back system was not used. Consequently, the sensitivity was 99.47%, the positive predictivity was 99.47%, and the detection error was 1.05%. Furthermore, the quality of the signal in data with a substantial amount of noise was improved, and thus, the R-peak was detected effectively.

  7. Attenuation estimation using the peak frequency method with high-resolution time-frequency transforms

    NASA Astrophysics Data System (ADS)

    Tary, J. B.; Van der Baan, M.; Herrera, R. H.

    2016-12-01

    Seismic waves attenuate during their propagation due to Earth anelasticity. Attenuation is usually estimated by frequency domain methods such as the spectral ratio and frequency shift methods. These methods compare large frequency bandwidths of the spectra of two waveforms to compute attenuation. Time-frequency distribution resulting from high-resolution time-frequency transforms are highly localized which prevent their use to compute attenuation with these methods.The peak frequency method only requires the estimation of peak frequencies for a pair of waveforms to estimate attenuation, which is then compatible with high-resolution transforms. We here employ three transforms, namely basis pursuit, synchrosqueezing transform, and complete ensemble empirical mode decomposition (CEEMD). We evaluate their performance regarding attenuation estimation using synthetic examples with different signal-to-noise ratios, and compare their results to those of the spectral ratio and frequency shift methods. In most cases basis pursuit and the synchrosqueezing transform provide accurate results, while CEEMD show a higher sensitivity to the presence of noise.We then apply the three high-resolution transforms and the peak frequency method to two case studies, a seismic reflection profile and a vertical seismic profile (VSP). We employ centroid frequencies instead of peak frequencies because they provide stabler frequency estimates which are then transferred to stabler attenuation estimates. In the case of the seismic reflection profile, the three time-frequency transforms show small increases in centroid frequencies superimposed on a general decreasing trend. This likely corresponds to local tuning effects due to the layering superimposed on the effect of intrinsic attenuation. For the VSP, the three time-frequency transforms show consistent patterns in centroid frequencies and quality factors. These results show the worth of high-resolution transforms for attenuation estimation.

  8. Getting Your Peaks in Line: A Review of Alignment Methods for NMR Spectral Data

    PubMed Central

    Vu, Trung Nghia; Laukens, Kris

    2013-01-01

    One of the most significant challenges in the comparative analysis of Nuclear Magnetic Resonance (NMR) metabolome profiles is the occurrence of shifts between peaks across different spectra, for example caused by fluctuations in pH, temperature, instrument factors and ion content. Proper alignment of spectral peaks is therefore often a crucial preprocessing step prior to downstream quantitative analysis. Various alignment methods have been developed specifically for this purpose. Other methods were originally developed to align other data types (GC, LC, SELDI-MS, etc.), but can also be applied to NMR data. This review discusses the available methods, as well as related problems such as reference determination or the evaluation of alignment quality. We present a generic alignment framework that allows for comparison and classification of different alignment approaches according to their algorithmic principles, and we discuss their performance. PMID:24957991

  9. Practical method for the definition of chromatographic peak parameters in preparative liquid chromatography.

    PubMed

    Jin, Gaowa; Guo, Zhimou; Xiao, Yuansheng; Yan, Jingyu; Dong, Xuefang; Shen, Aijin; Wang, Chaoran; Liang, Xinmiao

    2016-10-01

    A practical method was established for the definition of chromatographic parameters in preparative liquid chromatography. The parameters contained both the peak broadening level under different amounts of sample loading and the concentration distribution of the target compound in the elution. The parameters of the peak broadening level were defined and expressed as a matrix, which consisted of sample loading, the forward broadening and the backward broadening levels. The concentration distribution of the target compound was described by the heat map of the elution profile. The most suitable stationary phase should exhibit the narrower peak broadening and it was best to broaden to both sides to compare to the peak under analytical conditions. Besides, the concentration distribution of the target compounds should be focused on the middle of the elution. The guiding principles were validated by purification of amitriptyline from the mixture of desipramine and amitriptyline. On the selected column, when the content of the impurity desipramine was lower than 0.1%, the recovery of target compound was much higher than the other columns even when the sample loading was as high as 8.03 mg/cm(3) . The parameters and methods could be used for the evaluation and selection of stationary phases in preparative chromatography.

  10. Methods for estimating peak discharge and flood boundaries of streams in Utah

    USGS Publications Warehouse

    Thomas, B.E.; Lindskov, K.L.

    1983-01-01

    Equations for estimating 2-, 5-, 10-, 25-, 50-, and 100-year peak discharges and flood depths at ungaged sites in Utah were developed using multiple-regression techniques. Ratios of 500- to 100-year values also were determined. The peak discharge equations are applicable to unregulated streams and the flood depth equations are applicable to the unregulated flow in natural stream channels. The flood depth data can be used to approximate flood prone areas. Drainage area and mean basin elevation are the two basin characteristics needed to use these equations. The standard error of estimate ranges from 38% to 74% for the 100-year peak discharge and from 23% to 33% for the 100-year flood depth. Five different flood mapping methods are described. Streams are classified into four categories as a basis for selecting a flood mapping method. Procedures for transferring flood depths obtained from the regression equations to a flood boundary map are outlined. Also, previous detailed flood mapping by government agencies and consultants is summarized to assist the user in quality control and to minimize duplication of effort. Methods are described for transferring flood frequency data from gaged to ungaged sites on the same stream. Peak discharge and flood depth frequency relations and selected basin characteristics data, updated through the 1980 water year, are tabulated for more than 300 gaging stations in Utah and adjoining states. In addition, weighted estimates of peak discharge relations based on the station data and the regression estimates are provided for each gaging station used in the regression analysis. (Author 's abstract)

  11. An Innovative Method for Flood Peak Event Separation from Discharge Time Series

    NASA Astrophysics Data System (ADS)

    Borzì, Iolanda; Bonaccorso, Brunella; Viglione, Alberto; Tito Aronica, Giuseppe

    2017-04-01

    In extreme value theory, Peak Over Threshold (POT) method is recognized to make a better use of available data with respect to Block Maxima (BM) method, as it allows to retain all relevant observations for frequency analysis, provided that an appropriate threshold is selected. Definition of a proper threshold, able to identify independent events, is in general a critical issue. In addition, in many hydrological applications, such as flood frequency analysis, threshold levels are usually site-specific. This could be a strong limitation when comparing the flood responses of different river basins within a large geographical area. In the present study, an attempt is made to develop a relatively simple criterion for the determination of different thresholds to separate relevant flood events from a large dataset of daily discharge time series recorded at European scale. The proposed method arises from the theory of stochastic processes in the frequency domain, which can provide a meaningful description of the characteristics of the series. In particular, from the analysis of the power spectral density function and the signal of the process (e.g. narrowband or broadband), it is possible to define crossings (i.e. peaks) in clusters or independent crossings of the threshold. More specifically, such a selection process of significant events may help to understand whether relatively close peaks can be referred to a single flood event or independent events. Also in the frequency domain, a mean frequency of the random process can be defined for each series to be used as a possible common criterion for the definition of the different thresholds for flood peaks selection. The advantages of this method compared to other methods, such as traditional POT, lie in the fact that it establishes a robust procedure for the separation of independent events in time series, by means of the analysis in the frequency domain. Furthermore, the choice of the threshold for the selection of

  12. Training prescription in patients on beta-blockers: percentage peak exercise methods or self-regulation?

    PubMed

    Zanettini, Renzo; Centeleghe, Paola; Ratti, Fosco; Benna, Stefania; Di Tullio, Laura; Sorlini, Nadia

    2012-04-01

    Exercise prescription based on percentage of peak exercise variables has many limitations in patients taking beta-blockers. The aim of this study was to evaluate efficacy and safety of a training protocol based on the rating of perceived exercise (RPE) in patients taking beta-blockers after cardiac surgical revascularization. 71 patients treated with beta-blockers after recent coronary artery bypass grafting were randomly allocated to two different programmes with training intensity adjusted to keep heart rate close to first ventilatory threshold (36 subjects, AeT group) or RPE between grades 4 and 5 of 10-point category-ratio BORG scale (35 subjects, RPE group). In the RPE group, mean training workloads and heart rate values were significantly higher than in the AeT group; during the last week of the programme, six RPE patients were training very close to anaerobic threshold. Aerobic peak capacity increased similarly in the two groups. Considering the potential effects on training intensity of prescriptions based on percentages of peak exercise variables, we found that only percentage heart rate reserve and peak workload methods were reliable in defining a safe upper limit of training intensity, with values of 50% and 65% respectively. Self-regulation of exercise training intensity between grades 4 and 5 of the 10-point category-ratio BORG scale is effective but may promote overtraining in some patients without significant functional advantages. For these reasons, RPE method should be integrated with objective indices based on percentage of heart rate reserve or of peak workload.

  13. Method and apparatus for reducing rotor blade deflections, loads, and/or peak rotational speed

    DOEpatents

    Moroz, Emilian Mieczyslaw; Pierce, Kirk Gee

    2006-10-17

    A method for reducing at least one of loads, deflections of rotor blades, or peak rotational speed of a wind turbine includes storing recent historical pitch related data, wind related data, or both. The stored recent historical data is analyzed to determine at least one of whether rapid pitching is occurring or whether wind speed decreases are occurring. A minimum pitch, a pitch rate limit, or both are imposed on pitch angle controls of the rotor blades conditioned upon results of the analysis.

  14. A sensitive and specific LC-MS/MS method for rapid diagnosis of Niemann-Pick C1 disease from human plasma[S

    PubMed Central

    Jiang, Xuntian; Sidhu, Rohini; Porter, Forbes D.; Yanjanin, Nicole M.; Speak, Anneliese O.; te Vruchte, Danielle Taylor; Platt, Frances M.; Fujiwara, Hideji; Scherrer, David E.; Zhang, Jessie; Dietzen, Dennis J.; Schaffer, Jean E.; Ory, Daniel S.

    2011-01-01

    Niemann-Pick type C1 (NPC1) disease is a rare, progressively fatal neurodegenerative disease for which there are no FDA-approved therapies. A major barrier to developing new therapies for this disorder has been the lack of a sensitive and noninvasive diagnostic test. Recently, we demonstrated that two cholesterol oxidation products, specifically cholestane-3β,5α,6β-triol (3β,5α,6β-triol) and 7-ketocholesterol (7-KC), were markedly increased in the plasma of human NPC1 subjects, suggesting a role for these oxysterols in diagnosis of NPC1 disease and evaluation of therapeutics in clinical trials. In the present study, we describe the development of a sensitive and specific LC-MS/MS method for quantifying 3β,5α,6β-triol and 7-KC human plasma after derivatization with N,N-dimethylglycine. We show that dimethylglycine derivatization successfully enhanced the ionization and fragmentation of 3β,5α,6β-triol and 7-KC for mass spectrometric detection of the oxysterol species in human plasma. The oxysterol dimethylglycinates were resolved with high sensitivity and selectivity, and enabled accurate quantification of 3β,5α,6β-triol and 7-KC concentrations in human plasma. The LC-MS/MS assay was able to discriminate with high sensitivity and specificity between control and NPC1 subjects, and offers for the first time a noninvasive, rapid, and highly sensitive method for diagnosis of NPC1 disease. PMID:21518695

  15. Improved Shear Wave Group Velocity Estimation Method Based on Spatiotemporal Peak and Thresholding Motion Search.

    PubMed

    Amador Carrascal, Carolina; Chen, Shigao; Manduca, Armando; Greenleaf, James F; Urban, Matthew W

    2017-04-01

    Quantitative ultrasound elastography is increasingly being used in the assessment of chronic liver disease. Many studies have reported ranges of liver shear wave velocity values for healthy individuals and patients with different stages of liver fibrosis. Nonetheless, ongoing efforts exist to stabilize quantitative ultrasound elastography measurements by assessing factors that influence tissue shear wave velocity values, such as food intake, body mass index, ultrasound scanners, scanning protocols, and ultrasound image quality. Time-to-peak (TTP) methods have been routinely used to measure the shear wave velocity. However, there is still a need for methods that can provide robust shear wave velocity estimation in the presence of noisy motion data. The conventional TTP algorithm is limited to searching for the maximum motion in time profiles at different spatial locations. In this paper, two modified shear wave speed estimation algorithms are proposed. The first method searches for the maximum motion in both space and time [spatiotemporal peak (STP)]; the second method applies an amplitude filter [spatiotemporal thresholding (STTH)] to select points with motion amplitude higher than a threshold for shear wave group velocity estimation. The two proposed methods (STP and STTH) showed higher precision in shear wave velocity estimates compared with TTP in phantom. Moreover, in a cohort of 14 healthy subjects, STP and STTH methods improved both the shear wave velocity measurement precision and the success rate of the measurement compared with conventional TTP.

  16. Review of Methods to Assign the NMR Peaks of Reductively Methylated Proteins

    PubMed Central

    Roberson, Kevin J.; Macnaughtan, Megan A.

    2014-01-01

    Reductive methylation of lysyl side-chain amines has been a successful tool in the advancement of high resolution structural biology. The utility of this method has continuously gained ground as a protein chemical modification; first, as a tool to aid protein crystallization and later, as a probe in protein nuclear magnetic resonance (NMR) spectroscopy. As an isotope-labeling strategy for NMR studies, reductive methylation has contributed to the study of protein-protein interactions and global conformational changes. While more detailed structural studies using this labeling strategy are possible, the hurdle of assigning the NMR peaks to the corresponding reductively methylated amine hinders its use. In this review, we discuss and compare strategies used to assign the NMR peaks of reductively methylated protein-amines. PMID:25175010

  17. Application of a Database-Independent Approach To Assess the Quality of Operational Taxonomic Unit Picking Methods.

    PubMed

    Schloss, Patrick D

    2016-01-01

    Assignment of 16S rRNA gene sequences to operational taxonomic units (OTUs) allows microbial ecologists to overcome the inconsistencies and biases within bacterial taxonomy and provides a strategy for clustering similar sequences that do not have representatives in a reference database. I have applied the Matthews correlation coefficient to assess the ability of 15 reference-independent and -dependent clustering algorithms to assign sequences to OTUs. This metric quantifies the ability of an algorithm to reflect the relationships between sequences without the use of a reference and can be applied to any data set or method. The most consistently robust method was the average neighbor algorithm; however, for some data sets, other algorithms matched its performance.

  18. Application of a Database-Independent Approach To Assess the Quality of Operational Taxonomic Unit Picking Methods

    PubMed Central

    2016-01-01

    ABSTRACT Assignment of 16S rRNA gene sequences to operational taxonomic units (OTUs) allows microbial ecologists to overcome the inconsistencies and biases within bacterial taxonomy and provides a strategy for clustering similar sequences that do not have representatives in a reference database. I have applied the Matthews correlation coefficient to assess the ability of 15 reference-independent and -dependent clustering algorithms to assign sequences to OTUs. This metric quantifies the ability of an algorithm to reflect the relationships between sequences without the use of a reference and can be applied to any data set or method. The most consistently robust method was the average neighbor algorithm; however, for some data sets, other algorithms matched its performance. PMID:27832214

  19. Methods for Adjusting U.S. Geological Survey Rural Regression Peak Discharges in an Urban Setting

    USGS Publications Warehouse

    Moglen, Glenn E.; Shivers, Dorianne E.

    2006-01-01

    A study was conducted of 78 U.S. Geological Survey gaged streams that have been subjected to varying degrees of urbanization over the last three decades. Flood-frequency analysis coupled with nonlinear regression techniques were used to generate a set of equations for converting peak discharge estimates determined from rural regression equations to a set of peak discharge estimates that represent known urbanization. Specifically, urban regression equations for the 2-, 5-, 10-, 25-, 50-, 100-, and 500-year return periods were calibrated as a function of the corresponding rural peak discharge and the percentage of impervious area in a watershed. The results of this study indicate that two sets of equations, one set based on imperviousness and one set based on population density, performed well. Both sets of equations are dependent on rural peak discharges, a measure of development (average percentage of imperviousness or average population density), and a measure of homogeneity of development within a watershed. Average imperviousness was readily determined by using geographic information system methods and commonly available land-cover data. Similarly, average population density was easily determined from census data. Thus, a key advantage to the equations developed in this study is that they do not require field measurements of watershed characteristics as did the U.S. Geological Survey urban equations developed in an earlier investigation. During this study, the U.S. Geological Survey PeakFQ program was used as an integral tool in the calibration of all equations. The scarcity of historical land-use data, however, made exclusive use of flow records necessary for the 30-year period from 1970 to 2000. Such relatively short-duration streamflow time series required a nonstandard treatment of the historical data function of the PeakFQ program in comparison to published guidelines. Thus, the approach used during this investigation does not fully comply with the

  20. Stability and a fast calculation method of travel speed of pulse peak in convergence zone

    NASA Astrophysics Data System (ADS)

    Ren, Yun; Zhang, RenHe; Wang, Jun; Guo, YongGang; Luo, WenYu

    2014-07-01

    A long-range sound propagation experiment was conducted in the West Pacific Ocean in summer 2013. The signals received by a towed array indicate that the travel speed of pulse peak (TSPP) in the convergence zones is stable. Therefore, an equivalent sound speed can be used at all ranges in the convergence zones. A fast calculation method based on the beam-displacement ray-mode (BDRM) theory and convergence zone theory is proposed to calculate this equivalent sound speed. The computation speed of this proposed method is over 1000 times faster than that of the conventional calculation method based on the normal mode theory, with the computation error less than 0.4% compared with the experimental result. Also, the effect of frequency and sound speed profile on the TSPP is studied with the conventional and fast calculation methods, showing that the TSPP is almost independent of the frequency and sound speed profile in the ocean surface layer.

  1. Renewal of an old European Pharmacopoeia method for Terazosin using modeling with mass spectrometric peak tracking.

    PubMed

    Kormány, Róbert; Molnár, Imre; Fekete, Jenő

    2017-02-20

    An older method for terazosin was reworked in order to reduce the analysis time from 90min (2×45min) to below 5min. The method in European Pharmacopoeia (Ph.Eur.) investigates the specified impurities separately. The reason of the different methods is that the retention of two impurities is not adequate in reversed phase, not even with 100% water. Therefore ion-pair-chromatography has to be applied and since that two impurities absorb at low UV-wavelength they had to be analyzed by different method than the other specified impurities. In our new method we could improve the retention with pH elevation using a new type of stationary phases available for high pH applications. Also a detection wavelength could be selected that is appropriate for the detection and quantification of all impurities. The method development is the bottleneck of liquid chromatography even today, when more and more fast chromatographic systems are used. Expert knowledge with intelligent programs is available to reduce the time of method development and offer extra information about the robustness of the separation. Design of Experiments (DoE) for simultaneous optimization of gradient time (tG), temperature (T) and ternary eluent composition (tC) requires 12 experiments. A good alternative way to identify a certain peak in different chromatograms is the molecular mass of the compound, due to its high specificity. Liquid Chromatography-Mass Spectrometry (LC-MS) is now a routine technique and increasingly available in laboratories. In our experiment for the resolution- and retention modeling the DryLab4 method development software (Version 4.2) was used. In recent versions of the software the use of (m/z)-MS-data is possible along the UV-peak-area-tracking technology. The modelled and measured chromatograms showed excellent correlations. The average retention time deviations were ca. 0.5s and there was no difference between the predicted and measured Rs,crit -values.

  2. A new method to induce molecular low bias negative differential resistance with multi-peaks

    NASA Astrophysics Data System (ADS)

    Min, Y.; Zhong, C. G.; Dong, Z. C.; Zhao, Z. Y.; Zhou, P. X.; Yao, K. L.

    2016-02-01

    According to a first-principles study of the transport properties of two thiolated anthracene-9,10-diono molecules sandwiching ethyl, a new method to induce molecular low bias negative differential resistance with multi-peaks for strong n- or p-type molecules is proposed. The anthracene-9,10-diono molecule shows strong n-type characteristics when in contact with Au and Ag electrodes via a thiolate. The multiple negative differential resistance effect originated from the molecule-electrode couple is different between Ag and Au electrodes. Our investigations may promise potential for applications in molecular devices with low power dissipation and multifunction in the future.

  3. Instrumented Pick Detects Coal/Rock Interface

    NASA Technical Reports Server (NTRS)

    Wu, T.; Erkes, J. W.

    1983-01-01

    Instrumented pick installed on cutting drum of coal shearer for longwall mining measures cutting force with strain-gage-bridge load cell. Force signal transmitted to remote recorder. Transmitter located in base of pick assembly. Antenna located in shadow of rotating pick. Changes in characteristics of force signals from pick used to determine whether pick is cutting coal or rock.

  4. Mathematical method to calculate full-energy peak efficiency of detectors based on transfer technique

    NASA Astrophysics Data System (ADS)

    Gouda, M. M.; Hamzawy, A.; Badawi, M. S.; El-Khatib, A. M.; Thabet, A. A.; Abbas, M. I.

    2016-02-01

    The full-energy peak efficiency of high-purity germanium well-type detector is extremely important to calculate the absolute activities of natural and artificial radionuclides for samples with low radioactivity. In this work, the efficiency transfer method in an integral form is proposed to calculate the full-energy peak efficiency and to correct the coincidence summing effect for a high-purity germanium well-type detector. This technique is based on the calculation of the ratio of the effective solid angles subtended by the well-type detector with cylindrical sources measured inside detector cavity and an axial point source measured out the detector cavity including the attenuation of the photon by the absorber system. This technique can be easily applied in establishing the efficiency calibration curves of well-type detectors. The calculated values of the efficiency are in good agreement with the experimental calibration data obtained with a mixed γ-ray standard source containing 60Co and 88Y.

  5. Detection limit calculations for peak evaluation methods in HPGe gamma-ray spectrometry according to ISO 11929

    NASA Astrophysics Data System (ADS)

    Kanisch, Günter

    2017-05-01

    Two peak area estimation methods in gamma-ray spectrometry, the total peak area (TPA) and the background step function (BSF) methods are re-considered first. For least-squares (LS) peak fitting then, a new net peak area uncertainty model is established. It results in a new function fB replacing a TPA method internal design factor. This allows applying the TPA-related decision threshold (DT) and detection limit (DL) formulae, based on ISO 11929(2010), also for peak fitting. Linear LS adapted to Poisson counting data is suggested to derive fB values for a single peak and different combinations of background shape components including a fitted BSF. fB is then adapted to penalized non-linear fitting including Poisson maximum likelihood estimation by MC simulations. Within the DL iteration the fB method is much faster than with non-linear re-fitting. The fitted peak area uncertainty can be safely modeled for peak areas up to 10 DT which is sufficient for DL calculations. The extension for peak multiplets is indicated.

  6. Method and device for remotely monitoring an area using a low peak power optical pump

    DOEpatents

    Woodruff, Steven D.; Mcintyre, Dustin L.; Jain, Jinesh C.

    2014-07-22

    A method and device for remotely monitoring an area using a low peak power optical pump comprising one or more pumping sources, one or more lasers; and an optical response analyzer. Each pumping source creates a pumping energy. The lasers each comprise a high reflectivity mirror, a laser media, an output coupler, and an output lens. Each laser media is made of a material that emits a lasing power when exposed to pumping energy. Each laser media is optically connected to and positioned between a corresponding high reflectivity mirror and output coupler along a pumping axis. Each output coupler is optically connected to a corresponding output lens along the pumping axis. The high reflectivity mirror of each laser is optically connected to an optical pumping source from the one or more optical pumping sources via an optical connection comprising one or more first optical fibers.

  7. Ultrafast optomechanical pulse picking

    NASA Astrophysics Data System (ADS)

    Lilienfein, Nikolai; Holzberger, Simon; Pupeza, Ioachim

    2017-01-01

    State-of-the-art optical switches for coupling pulses into and/or out of resonators are based on either the electro-optic or the acousto-optic effect in transmissive elements. In high-power applications, the damage threshold and other nonlinear and thermal effects in these elements impede further improvements in pulse energy, duration, and average power. We propose a new optomechanical switching concept which is based solely on reflective elements and is suitable for switching times down to the ten-nanosecond range. To this end, an isolated section of a beam path is moved in a system comprising mirrors rotating at a high angular velocity and stationary imaging mirrors, without affecting the propagation of the beam thereafter. We discuss three variants of the concept and exemplify practical parameters for its application in regenerative amplifiers and stack-and-dump enhancement cavities. We find that optomechanical pulse picking has the potential to achieve switching rates of up to a few tens of kilohertz while supporting pulse energies of up to several joules.

  8. Ultrasonic 3-D Vector Flow Method for Quantitative In Vivo Peak Velocity and Flow Rate Estimation.

    PubMed

    Holbek, Simon; Ewertsen, Caroline; Bouzari, Hamed; Pihl, Michael Johannes; Hansen, Kristoffer Lindskov; Stuart, Matthias Bo; Thomsen, Carsten; Nielsen, Michael Bachmann; Jensen, Jorgen Arendt

    2017-03-01

    Current clinical ultrasound (US) systems are limited to show blood flow movement in either 1-D or 2-D. In this paper, a method for estimating 3-D vector velocities in a plane using the transverse oscillation method, a 32×32 element matrix array, and the experimental US scanner SARUS is presented. The aim of this paper is to estimate precise flow rates and peak velocities derived from 3-D vector flow estimates. The emission sequence provides 3-D vector flow estimates at up to 1.145 frames/s in a plane, and was used to estimate 3-D vector flow in a cross-sectional image plane. The method is validated in two phantom studies, where flow rates are measured in a flow-rig, providing a constant parabolic flow, and in a straight-vessel phantom ( ∅=8 mm) connected to a flow pump capable of generating time varying waveforms. Flow rates are estimated to be 82.1 ± 2.8 L/min in the flow-rig compared with the expected 79.8 L/min, and to 2.68 ± 0.04 mL/stroke in the pulsating environment compared with the expected 2.57 ± 0.08 mL/stroke. Flow rates estimated in the common carotid artery of a healthy volunteer are compared with magnetic resonance imaging (MRI) measured flow rates using a 1-D through-plane velocity sequence. Mean flow rates were 333 ± 31 mL/min for the presented method and 346 ± 2 mL/min for the MRI measurements.

  9. Methods for estimating the magnitude and frequency of peak streamflows for unregulated streams in Oklahoma

    USGS Publications Warehouse

    Lewis, Jason M.

    2010-01-01

    Peak-streamflow regression equations were determined for estimating flows with exceedance probabilities from 50 to 0.2 percent for the state of Oklahoma. These regression equations incorporate basin characteristics to estimate peak-streamflow magnitude and frequency throughout the state by use of a generalized least squares regression analysis. The most statistically significant independent variables required to estimate peak-streamflow magnitude and frequency for unregulated streams in Oklahoma are contributing drainage area, mean-annual precipitation, and main-channel slope. The regression equations are applicable for watershed basins with drainage areas less than 2,510 square miles that are not affected by regulation. The resulting regression equations had a standard model error ranging from 31 to 46 percent. Annual-maximum peak flows observed at 231 streamflow-gaging stations through water year 2008 were used for the regression analysis. Gage peak-streamflow estimates were used from previous work unless 2008 gaging-station data were available, in which new peak-streamflow estimates were calculated. The U.S. Geological Survey StreamStats web application was used to obtain the independent variables required for the peak-streamflow regression equations. Limitations on the use of the regression equations and the reliability of regression estimates for natural unregulated streams are described. Log-Pearson Type III analysis information, basin and climate characteristics, and the peak-streamflow frequency estimates for the 231 gaging stations in and near Oklahoma are listed. Methodologies are presented to estimate peak streamflows at ungaged sites by using estimates from gaging stations on unregulated streams. For ungaged sites on urban streams and streams regulated by small floodwater retarding structures, an adjustment of the statewide regression equations for natural unregulated streams can be used to estimate peak-streamflow magnitude and frequency.

  10. C-arm rotation as a method for reducing peak skin dose in interventional cardiology

    PubMed Central

    Pasciak, Alexander S; Bourgeois, Austin C; Jones, A Kyle

    2014-01-01

    Purpose Prolonged interventional cardiology (IC) procedures may result in radiation-induced skin injury, a potentially preventable cause of patient morbidity. Rotating the C-arm during an IC procedure may reduce this risk, although the methods by which the technique can be practically applied remains unexplored. A previous study demonstrated that C-arm rotation often increases peak skin dose (PSD) in interventional radiology procedures. The purpose of this study was to determine whether C-arm rotation reduces the PSD in IC procedures and, if so, under what circumstances. Materials and methods Simulations were performed using a numerical ray-tracing algorithm to analyse the effect of C-arm rotation on PSD across a range of patient sizes, C-arm configurations and procedure types. Specific data from modern fluoroscopes and patient dimensions were used as inputs to the simulations. Results In many cases, modest C-arm rotation angles completely eliminated overlap between X-ray field sites on the skin. When overlap remained, PSD increases were generally small. One exception was craniocaudal rotation, which tended to increase PSD. C-arm rotation was most effective for large patients and small X-ray field sizes. Small patients may not benefit from C-arm rotation as a procedural modification. The use of a prophylactic method where the C-arm was rotated between small opposing oblique angles was effective in reducing PSD. Conclusions With the exception of rotation to steep craniocaudal angles, rotating the C-arm reduces PSD in IC procedures when used as either a procedural modification or a prophylactic strategy. Tight collimation increases the benefit of C-arm rotation. PMID:25568803

  11. Method of Hoogenstraaten as a tool for obtaining the trap parameters of general-order thermoluminescence glow peaks

    NASA Astrophysics Data System (ADS)

    Rasheedy, M. S.

    2005-09-01

    The Hoogenstraaten method is a technique that uses various heating rates for obtaining the activation energy E (eV) in the case of first-order thermoluminescence glow peaks. This method can also be used for obtaining E (eV) for all types of glow peaks regardless of their kinetics order (b). The present work shows that the intercept of the Hoogenstraaten relation, which is usually used for obtaining the frequency factor S (s(-1)) of the first-order glow peak, can be used as a very good approximation to obtain the pre-exponential factor S''(s(-1)) in the case of general-order glow peaks, when one uses Hoogenstraatens method to obtain E (eV). In addition, the present work suggests a numerical method for obtaining the kinetics order of the general-order glow peak. The method depends on the activation energy E (eV) obtained by the Hoogenstraaten method and the above-mentioned approximation for obtaining the pre-exponential factor S''(s(-1)). An independent evaluation of the suggested methods for obtaining the trap parameters, the activation energy E (eV), the pre-exponential factor S''(s(-1)) and the kinetics order (b) is illustrated here by taking a numerically computed glow peak and applying a one-trap and one-recombination-center model.

  12. Methods and results of peak-flow frequency analyses for streamgages in and bordering Minnesota, through water year 2011

    USGS Publications Warehouse

    Kessler, Erich W.; Lorenz, David L.; Sanocki, Christopher A.

    2013-01-01

    Peak-flow frequency analyses were completed for 409 streamgages in and bordering Minnesota having at least 10 systematic peak flows through water year 2011. Selected annual exceedance probabilities were determined by fitting a log-Pearson type III probability distribution to the recorded annual peak flows. A detailed explanation of the methods that were used to determine the annual exceedance probabilities, the historical period, acceptable low outliers, and analysis method for each streamgage are presented. The final results of the analyses are presented.

  13. Comparative Analysis of Peak Ground Acceleration Before and After Padang Earthquake 2009 Using Mc. Guirre Method

    NASA Astrophysics Data System (ADS)

    Ayu Rahmalia, Diah; Nilamprasasti, Hesti

    2017-04-01

    We have analyzed the earthquakes data in West Sumatra province to determine peak ground acceleration value. The peak ground acceleration is a parameter that describes the strength of the tremor that ever happened. This paper aims to compare the value of the peak ground acceleration by considering the b-value before and after the Padang earthquake 2009. This research was carried out in stages, starting by taking the earthquake data in West Sumatra province with boundary coordinates 0.923° LU - 2.811° LS and 97.075° - 102.261° BT, before and after the 2009 Padang earthquake with a magnitude ≥ 3 and depth of ≤ 300 km, calculation of the b-value, and ended by creating peak ground acceleration map based on Mc. Guirre empirical formula with Excel and Surfer software. Based on earthquake data from 2002 until before Padang earthquake 2009, the b-value is 0.874 while the b-value after the Padang earthquake in 2009 to 2016 is 0.891. Considering b value, it can be known that peak ground acceleration before and after the 2009 Padang earthquake might be different. Based on the seismic data before 2009, the peak ground acceleration value of West Sumatra province is ranged from 7,002 to 308.875 gal. This value will be compared by the value of the peak ground acceleration after the Padang earthquake in 2009 which ranged from 7,946 to 372,736 gal.

  14. A Multiscale Method (``Sparse Bayes Blocks'') for Revealing Sharply-Peaked High Energy Pulsars

    NASA Astrophysics Data System (ADS)

    Connors, A.; Carramiñana, A.

    2002-12-01

    Multiscale models are the best basis for elucidating both very fine and broad faint structures, even for X-ray and γ --ray Poison count data, esp. in 2D imaging (Starck, J. L., Pantin, E., Murtagh, F., 2002, PASP, 114,1051). But one sees at once they are also well-suited to describe 1D structures such as pulsar light-curves, with their extreme sharp peaks and occasional broad bridges between them (Thompson 2001/astro-ph/0101039). Hence, we have derived a statistic for detecting pulsars at X- or gamma-ray energies with the `spikiness' explictly built in. The best current methods, being Fourier-transform based, may not be optimal for detecting this class of `spiky' light-curve (Zn2; e.g. de Jager et al./astro-ph/0010179 and references therein). Instead, we use one or a very few `Bayes Blocks' (Scargle/astro-ph/9711233) of arbitrary height and width to represent the light-curve; then derive an optimum statistic (likelihood ratio) for testing against flatness via Bayesian Inference. Preliminary Monte Carlo tests show that it works as well or better than a standard Z62 statistic for a range of standard sharply peaked light-curves, especially at low signal-to-noise (Connors and Carramiñana, 2002, SCMAIII Proceedings). Here, we demonstrate it on known pulsars using CGRO/EGRET and COMPTEL data. Many of the bright unidentified sources in the gamma-ray sky may also turn out to be relatively nearby (Gould-belt: Gehrels et al2000, Nature, 404, 363) radio-quiet, gamma-ray loud pulsars, such as Geminga (Halpern and Holt 1992, Nature, 357, 222; Bertsch et al 1992, Nature, 357, 306). Can a new high-resolution algorithm help illuminate the identities of some of these? Funded in part by AISR ``AS-DATA'', with J. Scargle and V. Kashyap; and AISR ``Astrostatistics Recipes in Python'', with T. Loredo and T. Oliphant. AC thanks the hospitaltiy of Wellesley College, and the Harvard Astrostatistics Working Group.

  15. C-arm rotation as a method for reducing peak skin dose in interventional cardiology.

    PubMed

    Pasciak, Alexander S; Bourgeois, Austin C; Jones, A Kyle

    2014-01-01

    Prolonged interventional cardiology (IC) procedures may result in radiation-induced skin injury, a potentially preventable cause of patient morbidity. Rotating the C-arm during an IC procedure may reduce this risk, although the methods by which the technique can be practically applied remains unexplored. A previous study demonstrated that C-arm rotation often increases peak skin dose (PSD) in interventional radiology procedures. The purpose of this study was to determine whether C-arm rotation reduces the PSD in IC procedures and, if so, under what circumstances. Simulations were performed using a numerical ray-tracing algorithm to analyse the effect of C-arm rotation on PSD across a range of patient sizes, C-arm configurations and procedure types. Specific data from modern fluoroscopes and patient dimensions were used as inputs to the simulations. In many cases, modest C-arm rotation angles completely eliminated overlap between X-ray field sites on the skin. When overlap remained, PSD increases were generally small. One exception was craniocaudal rotation, which tended to increase PSD. C-arm rotation was most effective for large patients and small X-ray field sizes. Small patients may not benefit from C-arm rotation as a procedural modification. The use of a prophylactic method where the C-arm was rotated between small opposing oblique angles was effective in reducing PSD. With the exception of rotation to steep craniocaudal angles, rotating the C-arm reduces PSD in IC procedures when used as either a procedural modification or a prophylactic strategy. Tight collimation increases the benefit of C-arm rotation.

  16. [The symmetric zero-area conversion adptive peak-seeking method research for LIBS/Raman spectra].

    PubMed

    Bi, Yun-Feng; Li, Ying; Zheng, Rong-Er

    2013-02-01

    Automatic peak seeking is an indispensable link for in situ and real-time spectral detection and analysis, and has important significance for application of spectral technology to such fields as long-term marine monitoring and oil mud logging. Based on some typical LIBS/Raman spectrum data obtained from lab, three kinds of symmetric zero-area transformation functions respectively constructed from Gaussian, Lorentz and Voigt function were compared, and the results show that there exists an optimal symmetrical zero-area transformation function for peak seeking, but all the transformation functions obtain the same peak position and peak width under their optimal parameters. The proposed method is free from spectrum background and baseline trend influence, adaptive to the wide range of SNR, close to or even better than artificial recognition for weak peak, and could be used in future automatic in-situ analysis of LIBS and Raman.

  17. Bonded joint and method. [for reducing peak shear stress in adhesive bonds

    NASA Technical Reports Server (NTRS)

    Sainsbury-Carter, J. B. (Inventor)

    1974-01-01

    An improved joint is described for reducing the peak shear stress in adhesive bonds when adhesives are used to bond two materials which are in a lapped relationship and which differ in value of modulus of elasticity. An insert placed between the adhesive and one of the two materials acts to cushion the discontinuity of material stiffness thereby reducing the peak shear stress in the adhesive bond.

  18. Modeling picking on pharmaceutical tablets

    NASA Astrophysics Data System (ADS)

    Swaminathan, Shrikant

    Tablets are the most popular solid dosage form in the pharmaceutical industry because they are cheap to manufacture, chemically and mechanically stable and easy to transport and fairly easy to control dosage. Pharmaceutical tableting operations have been around for decades however the process is still not well understood. One of the common problems faced during the production of pharmaceutical tablets by powder compaction is sticking of powder to the punch face, This is known as 'sticking'. A more specialized case of sticking is picking when the powder is pulled away form the compact in the vicinity of debossed features. In the pharmaceutical industry, picking is solved by trial and error which is an expensive, labor intensive and time consuming affair. The objective of this work was to develop, validate, and implement a modeling framework for predicting picking in powder compacts. The model was developed in Abaqus a commercially available finite element package. The resulting model was used to investigate the influence of debossed feature geometry viz. the stroke angle and degree of pre-pick, and, influence of lubricant on picking. (Abstract shortened by ProQuest.).

  19. Stem Cells and Niemann Pick Disease

    PubMed Central

    Andolina, Marino

    2014-01-01

    Background and Objectives: Niemann Pick A disease causes a progressive accumulation of sphyngomyelin in several organs and the survival of the patients is usually limited to three years. We describe the outcome of a patient suffering from Niemann Pick A disease, who first underwent an haploidentical bone marrow transplantation, and then intrathecal and I.V injections of mesenchymal cells. Methods and Results: While the outcome of bone marrow transplantation was a complete failure, one month after the treatment with the mesenchymal cells the patient improved from the psychomotor and the parenchymal storage perspective. When hypersplenism was solved platelets rose quickly from 20,000 to 120,000/microliter. Conclusions: Therefore cellular therapy should be considered as a possible choice of treatment of NPA disease. PMID:24921025

  20. Methods and equations for estimating peak streamflow per square mile in Virginia’s urban basins

    USGS Publications Warehouse

    Austin, Samuel H.

    2014-01-01

    Models are presented that describe Virginia urban area annual peak streamflow per square mile based on basin percent urban area and basin drainage area. Equations are provided to estimate Virginia urban peak flow per square mile of basin drainage area in each of the following annual exceedance probability categories: 0.995, 0.99, 0.95, 0.9, 0.8, 0.67, 0.5, 0.43, 0.2, 0.1, 0.04, 0.02, 0.01, 0.005, and 0.002 (recurrence intervals of 1.005, 1.01, 1.05, 1.11, 1.25, 1.49, 2.0, 2.3, 5, 10, 25, 50, 100, 200, and 500 years, respectively). Equations apply to Virginia drainage basins ranging in size from no less than 1.2 mi2 to no more than 2,400 mi2 containing at least 10 percent urban area, and not more than 96 percent urban area. A total of 115 Virginia drainage basins were analyzed. Actual-by-predicted plots and leverage plots for response variables and explanatory variables in each peak-flow annual exceedance probability category indicate robust model fits and significant explanatory power. Equations for 8 of 15 urban peak-flow response surface models yield R-square values greater than 0.8. Relations identified in statistical models, describing significant increases in urban peak stream discharges as basin urban area increases, affirm empirical relations reported in past studies of change in stream discharge, lag times, and physical streamflow processes, most notably those detailed for urban areas in northern Virginia.

  1. Method for reducing peak phase current and decreasing staring time for an internal combustion engine having an induction machine

    DOEpatents

    Amey, David L.; Degner, Michael W.

    2002-01-01

    A method for reducing the starting time and reducing the peak phase currents for an internal combustion engine that is started using an induction machine starter/alternator. The starting time is reduced by pre-fluxing the induction machine and the peak phase currents are reduced by reducing the flux current command after a predetermined period of time has elapsed and concurrent to the application of the torque current command. The method of the present invention also provides a strategy for anticipating the start command for an internal combustion engine and determines a start strategy based on the start command and the operating state of the internal combustion engine.

  2. Seismic Hazard Analysis based on Earthquake Vulnerability and Peak Ground Acceleration using Microseismic Method at Universitas Negeri Semarang

    NASA Astrophysics Data System (ADS)

    Sulistiawan, H.; Supriyadi; Yulianti, I.

    2017-02-01

    Microseismic is a harmonic vibration of land that occurs continuously at a low frequency. The characteristics of microseismic represents the characteristics of the soil layer based on the value of its natural frequency. This paper presents the analysis of seismic hazard at Universitas Negeri Semarang using microseismic method. The data acquisition was done at 20 points with distance between points 300 m by using three component’s seismometer. The data was processed using Horizontal to Vertical Spectral Ratio (HVSR) method to obtain the natural frequency and amplification value. The value of the natural frequency and amplification used to determine the value of the earthquake vulnerability and peak ground acceleration (PGA). The result shows then the earthquake vulnerability value range from 0.2 to 7.5, while the value of the average peak ground acceleration (PGA) is in the range 10-24 gal. Therefore, the average peak ground acceleration equal to earthquake intensity IV MMI scale.

  3. A hybrid method for geological and geophysical data with multi-peak distributions using the PSO-GRG algorithm

    NASA Astrophysics Data System (ADS)

    Ge, Xinmin; Fan, Yiren; Cao, Yingchang; Wang, Yang; Cong, Yunhai; Liu, Lailei

    2015-06-01

    To allow peak searching and parameter estimation for geological and geophysical data with multi-peak distributions, we explore a hybrid method based on a combination of the particle swarm optimization (PSO) and generalized reduced gradient (GRG) algorithms. After characterizing peaks using the additive Gaussian function, a nonlinear objective function is established, which transforms our task into a search for optimal solutions. In this process, PSO is used to obtain the initial values, aiming for global convergence, while GRG is subsequently implemented for higher stability. Iterations are stopped when the convergence criteria are satisfied. Finally, grayscale histograms of backscattering electron images of sandstone show that the proposed algorithm performs much better than other methods such as PSO, GRG, simulated annealing and differential evolution, achieving a faster convergence speed and minimal variances.

  4. A robust method for pulse peak determination in a digital volume pulse waveform with a wandering baseline.

    PubMed

    Jang, Dae-Geun; Farooq, Umar; Park, Seung-Hun; Hahn, Minsoo

    2014-10-01

    This paper presents a robust method for pulse peak determination in a digital volume pulse (DVP) waveform with a wandering baseline. A proposed new method uses a modified morphological filter (MMF) to eliminate a wandering baseline signal of the DVP signal with minimum distortion and a slope sum function (SSF) with an adaptive thresholding scheme to detect pulse peaks from the baseline-removed DVP signal. Further in order to cope with over-detected and missed pulse peaks, knowledge based rules are applied as a postprocessor. The algorithm automatically adjusts detection parameters periodically to adapt to varying beat morphologies and fluctuations. Compared with conventional methods (highpass filtering, linear interpolation, cubic spline interpolation, and wavelet adaptive filtering), our method performs better in terms of the signal-to-error ratio, the computational burden (0.125 seconds for one minute of DVP signal analysis with the Intel Core 2 Quad processor @ 2.40 GHz PC), the true detection rate (97.32% with an acceptance level of 4 ms ) as well as the normalized error rate (0.18%). In addition, the proposed method can detect true positions of pulse peaks more accurately and becomes very useful for pulse transit time (PTT) and pulse rate variability (PRV) analyses.

  5. Measurement of intrinsic properties of amyloid fibrils by the peak force QNM method

    NASA Astrophysics Data System (ADS)

    Adamcik, Jozef; Lara, Cecile; Usov, Ivan; Jeong, Jae Sun; Ruggeri, Francesco S.; Dietler, Giovanni; Lashuel, Hilal A.; Hamley, Ian W.; Mezzenga, Raffaele

    2012-07-01

    We report the investigation of the mechanical properties of different types of amyloid fibrils by the peak force quantitative nanomechanical (PF-QNM) technique. We demonstrate that this technique correctly measures the Young's modulus independent of the polymorphic state and the cross-sectional structural details of the fibrils, and we show that values for amyloid fibrils assembled from heptapeptides, α-synuclein, Aβ(1-42), insulin, β-lactoglobulin, lysozyme, ovalbumin, Tau protein and bovine serum albumin all fall in the range of 2-4 GPa.

  6. Photometric method for the quantification of chlorophylls and their derivatives in complex mixtures: fitting with Gauss-peak spectra.

    PubMed

    Küpper, H; Spiller, M; Küpper, F C

    2000-11-15

    Accurate quantification of pigments in mixtures is essential in all cases in which separation of pigments by chromatography is impracticable for one reason or another. An example is the analysis of in vivo formation of heavy metal-substituted chlorophylls in heavy metal-stressed plants. We describe here a novel, accurate UV/VIS spectrophotometric method for the quantification of individual chlorophyll derivatives in complex mixtures, which has the potential for universal applicability for mixtures difficult to separate. The method is based on the description of each pigment spectrum by a series of Gaussian peaks. A sample spectrum is then fitted by a linear combination of these "Gauss-peak spectra" including an automatic correction of wavelength inaccuracy and baseline instability of the spectrometer as well as a correction of the widening of absorbance peaks in more concentrated pigment solutions. The automatic correction of peak shifts can also partially correct shifts caused by processes like allomerization. In this paper, we present the Gauss-peak spectra for Mg-chlorophyll a, b, c, pheophytin a, b, c, Cu-chlorophyll a, b, c, and Zn-chlorophyll a in acetone; Mg-chlorophyll a, b, pheophytin a, b, Cu-chlorophyll a, b, allomerized Cu-chlorophyll a, b, and Zn-chlorophyll a, b in cyclohexane; Mg-chlorophyll a, b, pheophytin a, b, and Cu-chlorophyll a, b in diethyl ether.

  7. DETECTORS AND EXPERIMENTAL METHODS: Heuristic approach for peak regions estimation in gamma-ray spectra measured by a NaI detector

    NASA Astrophysics Data System (ADS)

    Zhu, Meng-Hua; Liu, Liang-Gang; You, Zhong; Xu, Ao-Ao

    2009-03-01

    In this paper, a heuristic approach based on Slavic's peak searching method has been employed to estimate the width of peak regions for background removing. Synthetic and experimental data are used to test this method. With the estimated peak regions using the proposed method in the whole spectrum, we find it is simple and effective enough to be used together with the Statistics-sensitive Nonlinear Iterative Peak-Clipping method.

  8. Pick's Theorem: What a Lemon!

    ERIC Educational Resources Information Center

    Russell, Alan R.

    2004-01-01

    Pick's theorem can be used in various ways just like a lemon. This theorem generally finds its way in the syllabus approximately at the middle school level and in fact at times students have even calculated the area of a state considering its outline with the help of the above theorem.

  9. Pick's Theorem: What a Lemon!

    ERIC Educational Resources Information Center

    Russell, Alan R.

    2004-01-01

    Pick's theorem can be used in various ways just like a lemon. This theorem generally finds its way in the syllabus approximately at the middle school level and in fact at times students have even calculated the area of a state considering its outline with the help of the above theorem.

  10. Methods for predicting peak discharge of floods caused by failure of natural and constructed earthen dams

    USGS Publications Warehouse

    Walder, J.S.; O'Connor, J. E.

    1997-01-01

    Floods from failures of natural and constructed dams constitute a widespread hazard to people and property. Expeditious means of assessing flood hazards are necessary, particularly in the case of natural dams, which may form suddenly and unexpectedly. We revise statistical relations (derived from data for past constructed and natural dam failures) between peak discharge (Q(p)) and water volume released (V(0)) or drop in lake level (d) but assert that such relations, even when cast into a dimensionless form, are of limited utility because they fail to portray the effect of breach-formation rate. We then analyze a simple, physically based model of dam-breach formation to show that the hydrograph at the breach depends primarily on a dimensionless parameter ?? = kV0/g1/2d7/2, where k is the mean erosion rate of the breach and g is acceleration due to gravity. The functional relationship between Q(p) and ?? takes asymptotically distinct forms depending on whether ?? << 1 (relatively slow breach formation or small lake volume) or ?? >> 1 (relatively fast breach formation or large lake volume). Theoretical predictions agree well with data from dam failures for which k, and thus ??, can be estimated. The theory thus provides a rapid means of predicting the plausible range of values of peak discharge at the breach in an earthen dam as long as the impounded water volume and the water depth at the dam face can be estimated.

  11. The influence of (134)Cs on the (137)Cs gamma-spectrometric peak-to-valley ratio and improvement of the peak-to-valley method by limiting the detector field of view.

    PubMed

    Östlund, Karl; Samuelsson, Christer; Mattsson, Sören; Rääf, Christopher L

    2017-10-01

    The peak-to-valley method was investigated under laboratory conditions and in situ with respect to both (134)Cs perturbation of the (137)Cs valley and use of collimation. The (134)Cs perturbation is significant down to (134)Cs:(137)Cs activity ratios of 1:100. In these cases the full energy peaks from (134)Cs (796 and 802keV) and associated valley should be used instead of the peak and valley from the (137)Cs 662keV peak. Use of collimators in situ outside Fukushima Daiichi significantly increased PTV for (134)Cs. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Normalization method of highly forward-peaked scattering phase function using the double exponential formula for radiative transfer

    NASA Astrophysics Data System (ADS)

    Fujii, Hiroyuki; Okawa, Shinpei; Yamada, Yukio; Hoshi, Yoko; Watanabe, Masao

    2016-12-01

    Numerical calculation of photon migration in biological tissue using the radiative transfer equation (RTE) has attracted great interests in biomedical optics and imaging. Because biological tissue is a highly forward-peaked scattering medium, a normalization of scattering phase function in the RTE is crucial. This paper proposes a simple way of normalizing the phase function by the double exponential formula, which is heuristically modified from the original one. The proposed method is validated by the agreement between the numerical solution of the RTE with the proposed method and analytical solution of the RTE for the case of a highly forward-peaked scattering medium, while the numerical solutions with conventional normalization methods disagree with the analytical solution. This result suggests the proposed method is accurate in numerical calculation of the RTE.

  13. Numerical method for the estimation of column radial heterogeneity and of the actual column efficiency from tailing peak profiles.

    PubMed

    Miyabe, Kanji; Guiochon, Georges

    2011-01-01

    It is probably impossible to prepare high-performance liquid chromatography (HPLC) columns that have a completely homogeneous packing structure. Many reports in the literature show that the radial distributions of the mobile phase flow velocity and the local column efficiency are not flat, even in columns considered as good. A degree of radial heterogeneity seems to be a common property of all HPLC columns and an important source of peak tailing, which prevents the derivation of accurate information on chromatographic behavior from a straightforward analysis of elution peak profiles. This work reports on a numerical method developed to derive from recorded peak profiles the column efficiency at the column center, the degree of column radial heterogeneity, and the polynomial function that best represents the radial distributions of the flow velocity and the column efficiency. This numerical method was applied to two concrete examples of tailing peak profiles previously described. It was demonstrated that this numerical method is effective to estimate important parameters characterizing the radial heterogeneity of chromatographic columns.

  14. A fading-based method for checking the presence of closely overlapping peaks in thermoluminescent (TL) materials

    NASA Astrophysics Data System (ADS)

    Furetta, C.

    The paper describes a method, based on fading experiment, for determining the presence of a complex structure in the thermoluminescent glow curve emission from herbs, e.g. oregano and nopal. Because of the polymineral content of the inorganic part of these herbs, the emitted glow curve is the result of several overlapping glow peaks, each one corresponding to another mineral. The initial rise method is also used for determining the activation energy of each component.

  15. Ouchterlony double immunodiffusion method demonstrates absence of ferritin immunoreactivity in visceral organs from nine patients with Niemann-Pick disease type C.

    PubMed

    Christomanou, H; Harzer, K

    1996-08-01

    Ouchterlony double immunodiffusion clearly demonstrated absence of ferritin, the principal iron storage protein, in spleen and/or liver extracts from nine patients with Niemann-Pick disease type C (NPC). The patients died from different clinical forms of this disease of still unknown etiology. The absence of ferritin immunoreactivity was shown using two different antisera raised in rabbits against ferritin from human spleen or liver, organs which predominantly contain light chain subunits (L-ferritin). A diagnostic double immunodiffusion assay of ferritin is, therefore, feasible with small amounts of NPC liver tissue, e.g., needle biopsy specimens. Furthermore, SDS-polyacrylamide gel electrophoresis after Coomassie blue staining revealed an almost complete absence of the L-ferritin protein band in crude spleen heat extracts from two NPC patients. The absence of visceral ferritin in all nine patients studied is suggestive of a biochemical abnormality that is as characteristic as the known impairment of cellular trafficking of LDL-derived cholesterol in this complex lysosomal storage disorder. According to recent data a relationship exists between ferritin-dependent lipid peroxidation and oxidative modification of LDL. We suggest that deficiency of the antioxidant ferritin-whatever the nature of this deficiency might be-could lead to uncontrolled LDL oxidation with subsequent multisubstrate lipidosis in NPC disease.

  16. ‘Wanting’ and ‘liking’ skin picking: A validation of the Skin Picking Reward Scale

    PubMed Central

    Snorrason, Ivar; Olafsson, Ragnar P.; Houghton, David C.; Woods, Douglas W.; Lee, Han-Joo

    2015-01-01

    Background and Aims Excoriation (skin-picking) disorder (SPD) is often conceptualized as a behavioral addiction in which aberrant reward processing may play an important role. The current study sought to develop a self-report instrument – the Skin Picking Reward Scale (SPRS) – that measures how strongly skin picking is ‘liked’ (i.e., the degree of pleasurable feelings while receiving the reward) and ‘wanted’ (i.e., the degree of the motivation to seek the reward). Methods We administered the SPRS to individuals who endorsed excessive skin picking in online surveys and examined the scale’s factor structure (Studies 1 and 2). We then asked individuals with documented pathological skin picking to complete the SPRS and other relevant questionnaires on two occasions one week apart (Study 3). Results Exploratory (Study 1; n = 330) and confirmatory (Study 2; n = 144) factor analyses consistently supported a two-factor structure reflecting the ‘liking’ and ‘wanting’ constructs. Results from Study 3 (N = 36) indicated that the Wanting and the Liking scales had adequate internal consistency and test–retest reliability. Additionally, consistent with predictions, the Wanting scale, but not the Liking scale, was associated with picking urges the following week, greater cue-reactivity, and more picking-related routines/habits. Discussion These initial findings suggest that SPRS is a psychometrically sound measure of ‘wanting’ and ‘liking’ in pathological skin picking. The SPRS may facilitate research on reward processing anomalies in SPD and serve as a useful clinical instrument (e.g., to identify those at risk for cue-induced relapse). PMID:26690620

  17. Activity determination of a 201Tl solution by 4πβ-γ and sum-peak coincidence methods

    NASA Astrophysics Data System (ADS)

    Ruzzarin, A.; da Silva, M. A. L.; Iwahara, A.; da Silva, R. L.; Filho, O. L. T.; Poledna, R.; Lopes, R. T.

    2016-07-01

    201Tl is used in nuclear medicine in cardiac imaging for evaluating the injury level in cardiac muscle at rest and exercise. In this work the activity concentration of a 201 Tl radioactive solution has been absolutely determined using the 4πβ-γ coincidence and sum-peak coincidence methods. The presence of 202Tl radioactive impurity that imposes some difficult in the activity measurements was taken into account in the measurements. In the sum-peak method a planar germanium detector was used. The half-lives were evaluated by the reference source method and the results obtained were (3.033 ± 0.004) d and (12.320 ± 0.163) d, respectively, for 201Tl and 202Tl.

  18. A method of digital filtering to enhance the peaks of evoked potentials: application to auditory brainstem responses.

    PubMed

    Grandori, F; Bonfioli, F; Peretti, G; Antonelli, A R

    1988-08-01

    The aim of this paper is to propose a method of data processing for the analysis of evoked potentials, in particular for auditory brainstem responses. The present method has been developed to simplify and speed up the interpretation of the recordings by means of an enhancement of the response peaks. Even for experienced observers, identification of the response waves and subsequent latency measurements may sometimes constitute a difficult task, due to the presence of residual noise or to interference between the temporal waveforms of adjacent peaks and troughs. The method is implemented with a digital non-causal (zero-phase shift) filter, based on the convolution with a finite impulse response, to make the computation time compatible with the use of low-cost microcomputers. The performance is shown to be very good in several examples.

  19. Nano-mechanical characterization of disassembling amyloid fibrils using the Peak Force QNM method.

    PubMed

    Wang, Wenpin; Guo, Zongxia; Sun, Jing; Li, Zhibo

    2017-02-01

    The comprehensive understanding of disassembly mechanism of amyloid fibrils requires nano-scale characterization of the mechanical properties of amyloid fibrils during the disassembly process. In this work, gemini surfactant C12 C6 C12 Br2 micelles were used as a probe to disassemble Aβ(1-40) fibrils. The microstructure evolution and nano-mechanical properties of Aβ(1-40) fibrils during the disassembly process were systematically investigated by the Peak Force Quantitative Nano-mechanical (PF-QNM) technique. The results show an obvious decrease in Young's modulus of mature fibrils with high β-sheet contents (2.4 ± 1.0 GPa) in comparison to the resulting peptide/surfactant complexes (1.1 ± 0.8 GPa) with loose surface structures. Interestingly, the Young's modulus of spherical peptide/surfactant complexes on the core was more than 3 GPa. This strategy can be used as a standard protocol to investigate the interaction mechanism between amyloid fibrils and small molecules, which may open up new possibilities to explore the mechanism of relevant human diseases.

  20. Characterizing substrate properties of purine-related compounds with purine metabolism enzymes for enzymatic peak-shift HPLC method.

    PubMed

    Fukuuchi, T; Morimura, A; Kawatani, M; Yamamoto, K; Yamaoka, N; Kaneko, K

    2014-01-01

    We have extended peak-shift method for measuring purine bases to make it suitable for other purine-related compounds. We optimized the reactions of the purine metabolism enzymes 5'-nucleotidase (EC 3.1.3.5), purine nucleoside phosphorylase (PNP) (EC 2.4.2.1), xanthine oxidase (XO) (EC 1.17.3.2), urate hydroxylase (EC 1.7.3.3), adenosine deaminase (ADA) (EC 3.5.4.4), and guanine deaminase (EC 3.5.4.3) by determining their substrate specificity and reaction kinetics. These enzymes eliminate the five purine base peaks (adenine, guanine, hypoxanthine, xanthine, and uric acid) and four nucleosides (adenosine, guanosine, inosine, and xanthosine). The bases and nucleosides can be identified and accurately quantified by comparing the chromatograms before and after treatment with the enzymes. Elimination of the individual purine compound peaks was complete in a few minutes. However, when there were multiple substrates, such as for XO, and when the metabolites were purine compounds, such as for PNP and ADA, it took longer to eliminate the peaks. The optimum reaction conditions for the peak-shift assay methods were an assay mixture containing the substrate (10 μL, 0.1 mg/mL), the combined enzyme solution (10 μL each, optimum concentration), and 50 mM sodium phosphate (up to 120 μL, pH 7.4). The mixture was incubated for 60 minutes at 37°C. This method should be suitable for determining the purine content of a variety of samples, without interference from impurities.

  1. Using dendrogeomorphological and hydraulic methods for peak discharge estimation of flash flood

    NASA Astrophysics Data System (ADS)

    Ballesteros, Juan Antonio; Eguibar, Miguel Angel; María Bodoque, Jose; Díez-Herrero, Andrés.; Gutierrez, Ignacio; Stoffel, Markus

    2010-05-01

    The study of processes such as flash floods in ungauged mountain basins often requires the combination of different techniques enabling numerical models to be developed in order to understand the processes. In this study, we have focused on the use of detailed topography obtained with Terrestrial Laser Scanner (TLS) and dendrogeomorphological evidences to reconstruct the peak discharge of an remarkable event that took place on December 18th 1997, in the stream Arroyo Cabrera (Gredos Mountain Range, Spanish Central System). The methodology was carried out on a river reach characterized for presenting a hydraulic jump on stable bed-rock and numerous scarred trees caused by the impact of rocks and woody debris during the event. Along a 500 m stretch, a high-resolution Digital Elevation Model (DEM) was built with an average precision of 5 mm based on more than 4 million points taken using a TLS. Subsequently, both topographic and dendrogeomorphological data were included in bidimensional hydraulic models.In addition, we propose a methodology to define scenarios based on the deviation between the PSI and the results of hydraulic model that allows convergence in the estimation of flow. The results obtained from the methodology developed allow the magnitude of the event studied concerning the transported flow of an unknown flash flood event. We also discuss the use of PSI from trees to future paleoflood studies. Knowing the advantages and disadvantages derived from each case provides useful information for producing future flash flood hazard maps in ungauged catchments, with exposed goods of great vulnerability. Keywords: Terrestrial Laser Scan, Dendrogeomorphology, Digital Elevation Model, ungauged basins, Spanish Central System.

  2. A peak filtering method with improved transient response for narrow-band disturbance rejection in hard disk drives

    NASA Astrophysics Data System (ADS)

    Hong, Fan; Khiang Pang, Chee

    2014-02-01

    Peak filtering methods are commonly used in track-following control of hard disk drives (HDDs) to suppress narrow-band disturbances around a specific frequency. When there are significant plant dynamics within the bandwidth of the filter, the closed-loop system is prone to be unstable due to the lightly damped poles of the filter, as well as lightly damped poles of the plant. On the other hand, settling response of such peak filters during shock disturbances is slow, and increases tremendously with decreasing damping ratios. In this article, we present a novel design of peak filters with improved transient responses using a phase scheduling method in addition to varying gain and damping ratio. By doing so, the stability margin of the closed-loop systems during both transient stage and steady-state stage will be improved. The effectiveness of the proposed methodology is verified with extensive simulations and the proposed method is then applied in an integrative servo analysis platform to carry out a scaling exercise to evaluate and predict servo performance to support 10 Terabits/in2.

  3. Comparison of four peak spinal loading exposure measurement methods and their association with low-back pain.

    PubMed

    Neumann, W P; Wells, R P; Norman, R W; Andrews, D M; Frank, J; Shannon, H S; Kerr, M S

    1999-10-01

    This paper examines the performance of 4 different methods of estimating peak spinal loading and their relationship with the reporting of low-back pain. The data used for this comparison was a subset of subjects from a case-referent study of low-back-pain reporting in the automotive industry, in which 130 random referents and 105 cases (or job-matched proxies) were studied. The peak load on the lumbar spine was determined using a biomechanical model with model inputs coming from a detailed self-report questionnaire, a task-based check list, a video digitization method, and a posture and load sampling technique. The methods were directly comparable through a common metric of newtons or newton meters of spinal loading in compression, shear, or moment modes. All the methods showed significant and substantial associations with low-back pain in all modes (odds ratios 1.6-2.3). The intraclass correlation coefficients (ICC) showed strong similarities between the checklist and video digitized techniques (ICC 0.84-0.91), moderate similarities between these techniques and the work sampling method (ICC 0.49-0.52), and poor correlations (ICC 0.16-0.40) between the self-report questionnaire and the observer recorded measures. While all the methods detected significant odds ratios, they cannot all be used interchangeably for risk assessment at the individual level. Peak spinal compression, moment, and shear are important risk factors for low-back pain reporting, no matter which measurement method is used. Questionnaires can be used for large-scale studies. At the individual level a task-based checklist provides biomechanical model inputs at lower cost and equal performance compared with the criterion video digitization system.

  4. Automated method for the systematic interpretation of resonance peaks in spectrum data

    DOEpatents

    Damiano, B.; Wood, R.T.

    1997-04-22

    A method is described for spectral signature interpretation. The method includes the creation of a mathematical model of a system or process. A neural network training set is then developed based upon the mathematical model. The neural network training set is developed by using the mathematical model to generate measurable phenomena of the system or process based upon model input parameter that correspond to the physical condition of the system or process. The neural network training set is then used to adjust internal parameters of a neural network. The physical condition of an actual system or process represented by the mathematical model is then monitored by extracting spectral features from measured spectra of the actual process or system. The spectral features are then input into said neural network to determine the physical condition of the system or process represented by the mathematical model. More specifically, the neural network correlates the spectral features (i.e. measurable phenomena) of the actual process or system with the corresponding model input parameters. The model input parameters relate to specific components of the system or process, and, consequently, correspond to the physical condition of the process or system. 1 fig.

  5. Automated method for the systematic interpretation of resonance peaks in spectrum data

    DOEpatents

    Damiano, Brian; Wood, Richard T.

    1997-01-01

    A method for spectral signature interpretation. The method includes the creation of a mathematical model of a system or process. A neural network training set is then developed based upon the mathematical model. The neural network training set is developed by using the mathematical model to generate measurable phenomena of the system or process based upon model input parameter that correspond to the physical condition of the system or process. The neural network training set is then used to adjust internal parameters of a neural network. The physical condition of an actual system or process represented by the mathematical model is then monitored by extracting spectral features from measured spectra of the actual process or system. The spectral features are then input into said neural network to determine the physical condition of the system or process represented by the mathematical. More specifically, the neural network correlates the spectral features (i.e. measurable phenomena) of the actual process or system with the corresponding model input parameters. The model input parameters relate to specific components of the system or process, and, consequently, correspond to the physical condition of the process or system.

  6. Multi-peak pattern in Multi-gap RPC time-over-threshold distributions and an offline calibration method

    NASA Astrophysics Data System (ADS)

    Yang, R. X.; Li, C.; Sun, Y. J.; Heng, Y. K.; Sun, S. S.; Dai, H. L.; Wu, Z.; Liu, Z.; Wang, X. Z.; An, F. F.

    2017-01-01

    The Beijing Spectrometer (BESIII) has just updated its end-cap Time-of-Flight (ETOF) system, using the Multi-gap Resistive Plate Chamber (MRPC) to replace the current scintillator detectors. These MRPCs shows multi-peak phenomena in their time-over-threshold (TOT) distribution, which was also observed in the Long-strip MRPC built for the RHIC-STAR Muon Telescope Detector (MTD). After carefully investigated the correlation between the multi-peak distribution and incident hit positions along the strips, we find out that it can be semi-quantitatively explained by the signal reflections on the ends of the readout strips. Therefore a new offline calibration method was implemented on the MRPC ETOF data in BESIII, making T-TOT correlation significantly improved to evaluate the time resolution.

  7. Enhancement of the automatic onset time picking via wavelet thresholding

    NASA Astrophysics Data System (ADS)

    Gaci, Said

    2013-04-01

    Since arrival time-picking is a critical step in the analysis of geophysical data, many time picking algorithms have been developed. Nowadays, the ''short-time-average through long-time-average trigger'' (STA/LTA) in different forms are the most commonly used. This study aims at improving this algorithm in the presence of high amplitude noise. The suggested method consists of denoising the seismic trace using the discrete wavelet transform. Therefore, the STA/LTA curve obtained from the denoised trace displays a faster build up at the position of the wave arrival, and the picking error is reduced. The application of this technique is first demonstrated on synthetic seismic traces with varying noise levels, then extended to uphole seismic traces recorded in the Algerian Sahara. The results show that the picked first arrivals are more accurate than those yielded by the standard STA/LTA algorithm and this method can tolerate high noise levels. Keywords: picking, first arrival, seismic wave, wavelet thresholding.

  8. Control method for peak power delivery with limited DC-bus voltage

    DOEpatents

    Edwards, John; Xu, Longya; Bhargava, Brij B.

    2006-09-05

    A method for driving a neutral point-clamped multi-level voltage source inverter supplying a synchronous motor is provided. A DC current is received at a neutral point-clamped multi-level voltage source inverter. The inverter has first, second, and third output nodes. The inverter also has a plurality of switches. A desired speed of a synchronous motor connected to the inverter by the first second and third nodes is received by the inverter. The synchronous motor has a rotor and the speed of the motor is defined by the rotational rate of the rotor. A position of the rotor is sensed, current flowing to the motor out of at least two of the first, second, and third output nodes is sensed, and predetermined switches are automatically activated by the inverter responsive to the sensed rotor position, the sensed current, and the desired speed.

  9. Method and apparatus for determining peak temperature along an optical fiber

    DOEpatents

    Fox, R.J.

    1982-07-29

    The invention relates to a new method and new apparatus for determining the hottest temperature or the coldest temperature prevailing along the length of an optical-fiber light guide. The invention is conducted with an optical fiber capable of supporting multidiode propagation of light and comprising a core, a cladding, and a jacket. The core is selected to have (1) a higher refractive index than the core and the cladding and (2) a relatively high negative temperature coefficient of refractive index. A light beam capable of establishing substantially single-mode propagation in the core is launched into an end thereof at an angle to the axis. The angle is increased to effect the onset of light fraction from the core into the cladding. The value of the launch angle corresponding to the onset is determined and then used to establish the refractive index of the core corresponding to the onset angle. The maximum temperature prevailing along the fiber then is determined from the (1) refractive index so determined and (2) the temperature coefficient of refractive index for the core. The invention is based on the finding that the launch angle corresponding to the onset of refraction into the cladding is uniquely determined by the maximum value of the ratio of the core refractive index to the cladding refractive index, which maximum occurs at the hottest point along the fiber.

  10. Method and apparatus for determining peak temperature along an optical fiber

    DOEpatents

    Fox, Richard J.

    1985-01-01

    The invention relates to a new method and new apparatus for determining the hottest temperature or the coldest temperature prevailing along the length of an optical-fiber light guide. The invention is conducted with an optical fiber capable of supporting multidiode propagation of light and comprising a core, a cladding, and a jacket. The core is selected to have (1) a higher refractive index than the core and the cladding and (2) a relatively high negative temperature coefficient of refractive index. A light beam capable of establishing substantially single-mode propagation in the core is launched into an end thereof at an angle to the axis. The angle is increased to effect the onset of light refraction from the core into the cladding. The value of the launch angle corresponding to the onset is determined and then used to establish the refractive index of the core corresponding to the onset angle. The maximum temperature prevailing along the fiber then is determined from the (1) refractive index so determined and (2) the temperature coefficient of refractive index for the core. The invention is based on the finding that the launch angle corresponding to the onset of refraction into the cladding is uniquely determined by the maximum value of the ratio of the core refractive index to the cladding refractive index, which maximum occurs at the hottest point along the fiber.

  11. DSM-5 field survey: skin picking disorder.

    PubMed

    Lochner, Christine; Grant, Jon E; Odlaug, Brian L; Stein, Dan J

    2012-11-01

    Pathologic skin picking (skin picking disorder [SPD]) is a prevalent and disabling condition, which has received increasing study. It is timely to consider including SPD in DSM-5. The aim of this field survey was to investigate possible diagnostic criteria for SPD. Patients age >10 with skin-picking symptoms were recruited. Patients were assessed with 2 modules based on the Structured Clinical Interview for DSM, which addressed proposed DSM-5 diagnostic criteria for SPD. Additional questions were included to test other possible diagnostic criteria. Thirty-eight patients had SPD. All had recurrent skin picking that resulted in skin lesions. Skin picking persisted despite repeated attempts to decrease or stop. "Urges" or "needs" to pull were not endorsed by all patients, but did correlate with severity of skin picking. "Resistance" to picking also was not universally endorsed. These data support the proposed DSM-5 diagnostic criteria for SPD. Although most patients have urges to pick or a sense of relief when picking, such phenomena are not universal and should not be included in the diagnostic criteria set. An additional criterion of repeated attempts to decrease or stop skin picking seems warranted.

  12. Methods for estimating peak-flow frequencies at ungaged sites in Montana based on data through water year 2011: Chapter F in Montana StreamStats

    USGS Publications Warehouse

    Sando, Roy; Sando, Steven K.; McCarthy, Peter M.; Dutton, DeAnn M.

    2016-04-05

    This report chapter also presents other methods for estimating peak-flow frequencies at ungaged sites. Two methods for estimating peak-flow frequencies at ungaged sites located on the same streams as streamflow-gaging stations are described. Additionally, envelope curves relating maximum recorded annual peak flows to contributing drainage area for each of the eight hydrologic regions in Montana are presented and compared to a national envelope curve. In addition to providing general information on characteristics of large peak flows, the regional envelope curves can be used to assess the reasonableness of peak-flow frequency estimates determined using the regression equations.

  13. Comparative quantification of dietary supplemented neural creatine concentrations with (1)H-MRS peak fitting and basis spectrum methods.

    PubMed

    Turner, Clare E; Russell, Bruce R; Gant, Nicholas

    2015-11-01

    Magnetic resonance spectroscopy (MRS) is an analytical procedure that can be used to non-invasively measure the concentration of a range of neural metabolites. Creatine is an important neurometabolite with dietary supplementation offering therapeutic potential for neurological disorders with dysfunctional energetic processes. Neural creatine concentrations can be probed using proton MRS and quantified using a range of software packages based on different analytical methods. This experiment examines the differences in quantification performance of two commonly used analysis packages following a creatine supplementation strategy with potential therapeutic application. Human participants followed a seven day dietary supplementation regime in a placebo-controlled, cross-over design interspersed with a five week wash-out period. Spectroscopy data were acquired the day immediately following supplementation and analyzed with two commonly-used software packages which employ vastly different quantification methods. Results demonstrate that neural creatine concentration was augmented following creatine supplementation when analyzed using the peak fitting method of quantification (105.9%±10.1). In contrast, no change in neural creatine levels were detected with supplementation when analysis was conducted using the basis spectrum method of quantification (102.6%±8.6). Results suggest that software packages that employ the peak fitting procedure for spectral quantification are possibly more sensitive to subtle changes in neural creatine concentrations. The relative simplicity of the spectroscopy sequence and the data analysis procedure suggest that peak fitting procedures may be the most effective means of metabolite quantification when detection of subtle alterations in neural metabolites is necessary. The straightforward technique can be used on a clinical magnetic resonance imaging system. Copyright © 2015 Elsevier Inc. All rights reserved.

  14. Method for resolution of closely situated resonance peaks for the yield of negative ions based on the energy

    SciTech Connect

    Mazunov, V.A.; Khvostenko, V.I.; Fal'ko, V.S.; Chanbarisov, V.Sh.

    1982-04-20

    A method was proposed for isolating and resolving on the basis of the energy the closely situated resonance peaks for the yield of negative ions when the mass spectrometry method is used to study the capture of electrons by molecules. In essence, the method for isolating and resolving on the basis of the energy the closely situated resonance peaks of the EYC (effective yield curves) of negative ions consists in obtaining and subsequently comparing the total current of the particles (ions plus neutrals) with a definite m/z ratio and the current of the neutral particles that are formed during ejection of the electrons. The EYC of the (M - H)/sup -/ ions from 2-propylthiophene, where two peaks with maxima at 5.1 and 8.7 +/- 0.1 eV were observed. The accuracy, with which the position of the maximum of the isolated resonance peak can be indicated, depends on tau/sub a/ as a function of the energy of the electrons. For many molecular ions and fragment ions, tau/sub a/ decreases with increase in the energy in the resonance region, while an analysis of the experimental data indicates that the observed decrease in tau/sub a/ with increase in the energy is usually less than 0.0001 sec per 1 eV. With such a change in the lifetime the shift in the maximum of the EYC of the neutral component of the stream of particles toward higher electron energies relative to the maximum of the ion current corresponds to approx. 0.2 eV. Taking this into account and a systematic error of 0.1 eV in the nonlinearity of the energy scale of the electrons, and also the accuracy of determining the position of the maximum of the EYC (0.1 eV), it can be said that the closely situated states of negative ions can be isolated with a accuracy of +/- 0.2 eV.

  15. A Semiautomated Multilayer Picking Algorithm for Ice-sheet Radar Echograms Applied to Ground-Based Near-Surface Data

    NASA Technical Reports Server (NTRS)

    Onana, Vincent De Paul; Koenig, Lora Suzanne; Ruth, Julia; Studinger, Michael; Harbeck, Jeremy P.

    2014-01-01

    Snow accumulation over an ice sheet is the sole mass input, making it a primary measurement for understanding the past, present, and future mass balance. Near-surface frequency-modulated continuous-wave (FMCW) radars image isochronous firn layers recording accumulation histories. The Semiautomated Multilayer Picking Algorithm (SAMPA) was designed and developed to trace annual accumulation layers in polar firn from both airborne and ground-based radars. The SAMPA algorithm is based on the Radon transform (RT) computed by blocks and angular orientations over a radar echogram. For each echogram's block, the RT maps firn segmented-layer features into peaks, which are picked using amplitude and width threshold parameters of peaks. A backward RT is then computed for each corresponding block, mapping the peaks back into picked segmented-layers. The segmented layers are then connected and smoothed to achieve a final layer pick across the echogram. Once input parameters are trained, SAMPA operates autonomously and can process hundreds of kilometers of radar data picking more than 40 layers. SAMPA final pick results and layer numbering still require a cursory manual adjustment to correct noncontinuous picks, which are likely not annual, and to correct for inconsistency in layer numbering. Despite the manual effort to train and check SAMPA results, it is an efficient tool for picking multiple accumulation layers in polar firn, reducing time over manual digitizing efforts. The trackability of good detected layers is greater than 90%.

  16. Nail picking disorder (onychotillomania): a case report.

    PubMed

    Snorrason, Ivar; Woods, Douglas W

    2014-03-01

    Nail picking disorder (onychotillomania) is characterized by excessive picking or pulling at one's own finger- or toenails. This condition has received scant research attention and may be related to other body focused repetitive behaviors such as pathological nail biting, skin picking and hair pulling. We present a case of a male client with a chronic and severe nail picking habit treated with acceptance-enhanced behavior therapy. The client showed clinical characteristics similar to other body focused repetitive behaviors and responded moderately well to the treatment. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. Improved Operating Performance of Mining Machine Picks

    NASA Astrophysics Data System (ADS)

    Prokopenko, S.; Li, A.; Kurzina, I.; Sushko, A.

    2016-08-01

    The reasons of low performance of mining machine picks are stated herein. In order to improve the wear resistance and the cutting ability of picks a new design of a cutting carbide tip insert to be fixed on a removable and rotating pick head is developed. Owing to the new design, the tool ensures a twofold increase in the cutting force maintained longer, a twofold reduction in the specific power consumption of the breaking process, and extended service life of picks and the possibility of their multiple use.

  18. Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.

    PubMed

    Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G

    2017-07-19

    Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

  19. Estimating extremes in climate change simulations using the peaks-over-threshold method with a non-stationary threshold

    NASA Astrophysics Data System (ADS)

    Kyselý, Jan; Picek, Jan; Beranová, Romana

    2010-05-01

    The paper presents a methodology for estimating high quantiles of distributions of daily temperature in a non-stationary context, based on peaks-over-threshold analysis with a time-dependent threshold expressed in terms of regression quantiles. The extreme value models are applied to estimate 20-yr return values of maximum daily temperature over Europe in transient global climate model (GCM) simulations for the 21st century. A comparison of scenarios of changes in the 20-yr return temperatures based on the non-stationary peaks-over-threshold models with conventional stationary models is performed. It is demonstrated that the application of the stationary extreme value models in temperature data from GCM scenarios yields results that may be to a large extent biased, while the non-stationary models lead to spatial patterns that are robust and enable one to detect areas where the projected warming in the tail of the distribution of daily temperatures is largest. The method also allows splitting the projected warming of extremely high quantiles into two parts that reflect change in the location and scale of the distribution of extremes, respectively. Spatial patterns of the two components differ significantly in the examined climate change projections over Europe.

  20. Load controller and method to enhance effective capacity of a photovotaic power supply using a dynamically determined expected peak loading

    DOEpatents

    Perez, Richard

    2003-04-01

    A load controller and method are provided for maximizing effective capacity of a non-controllable, renewable power supply coupled to a variable electrical load also coupled to a conventional power grid. Effective capacity is enhanced by monitoring power output of the renewable supply and loading, and comparing the loading against the power output and a load adjustment threshold determined from an expected peak loading. A value for a load adjustment parameter is calculated by subtracting the renewable supply output and the load adjustment parameter from the current load. This value is then employed to control the variable load in an amount proportional to the value of the load control parameter when the parameter is within a predefined range. By so controlling the load, the effective capacity of the non-controllable, renewable power supply is increased without any attempt at operational feedback control of the renewable supply. The expected peak loading of the variable load can be dynamically determined within a defined time interval with reference to variations in the variable load.

  1. Reducing Skin Picking via Competing Activities

    ERIC Educational Resources Information Center

    Lane, Kathleen Lynne; Thompson, Ada; Reske, Cara L.; Gable, Lauren M.; Barton-Arwood, Sally

    2006-01-01

    This study examined the outcomes of a competing activities intervention to decrease skin picking exhibited by a 9-year-old student with comorbid diagnoses. Results of an ABCBAB design revealed that the use of student-selected manipulatives resulted in reduced skin picking. (Contains 1 figure.)

  2. Extending the S-FFT direct-methods algorithm to density functions with positive and negative peaks. XIV.

    PubMed

    Rius, Jordi; Frontera, Carles

    2008-11-01

    Some years ago the direct-methods origin-free modulus sum function (S) was adapted to the processing of intensity data from density functions with positive and negative peaks [Rius, Miravitlles & Allmann (1996). Acta Cryst. A52, 634-639]. That implementation used phase relationships explicitly. Although successfully applied to different situations where the number of reflections was small, its generalization to larger problems required avoiding the time-consuming manipulation of quartet terms. To circumvent this limitation, a modification of the recently introduced S-FFT algorithm (that maximizes S with only Fourier transforms) is presented here. The resulting S2-FFT algorithm is highly effective for crystal structures with at least one moderate scatterer in the unit cell. Test calculations have been performed on conventional single-crystal X-ray diffraction data, on neutron diffraction data of compounds with negative scatterers and on intensities of superstructure reflections to solve difference structures.

  3. Using Design of Experiments Methods for Assessing Peak Contact Pressure to Material Properties of Soft Tissue in Human Knee

    PubMed Central

    Jahan, Ali; Arumugam, Manohar; Hassan, Mohd Roshdi

    2013-01-01

    Contact pressure in the knee joint is a key element in the mechanisms of knee pain and osteoarthritis. Assessing the contact pressure in tibiofemoral joint is a challenging mechanical problem due to uncertainty in material properties. In this study, a sensitivity analysis of tibiofemoral peak contact pressure to the material properties of the soft tissue was carried out through fractional factorial and Box-Behnken designs. The cartilage was modeled as linear elastic material, and in addition to its elastic modulus, interaction effects of soft tissue material properties were added compared to previous research. The results indicated that elastic modulus of the cartilage is the most effective factor. Interaction effects of axial/radial modulus with elastic modulus of cartilage, circumferential and axial/radial moduli of meniscus were other influential factors. Furthermore this study showed how design of experiment methods can help designers to reduce the number of finite element analyses and to better interpret the results. PMID:27006925

  4. Load controller and method to enhance effective capacity of a photovoltaic power supply using a dynamically determined expected peak loading

    DOEpatents

    Perez, Richard

    2005-05-03

    A load controller and method are provided for maximizing effective capacity of a non-controllable, renewable power supply coupled to a variable electrical load also coupled to a conventional power grid. Effective capacity is enhanced by monitoring power output of the renewable supply and loading, and comparing the loading against the power output and a load adjustment threshold determined from an expected peak loading. A value for a load adjustment parameter is calculated by subtracting the renewable supply output and the load adjustment parameter from the current load. This value is then employed to control the variable load in an amount proportional to the value of the load control parameter when the parameter is within a predefined range. By so controlling the load, the effective capacity of the non-controllable, renewable power supply is increased without any attempt at operational feedback control of the renewable supply.

  5. Automatic P-S phase picking procedure based on Kurtosis: Vanuatu region case study

    NASA Astrophysics Data System (ADS)

    Baillard, C.; Crawford, W. C.; Ballu, V.; Hibert, C.

    2012-12-01

    Automatic P and S phase picking is indispensable for large seismological data sets. Robust algorithms, based on short term and long term average ratio comparison (Allen, 1982), are commonly used for event detection, but further improvements can be made in phase identification and picking. We present a picking scheme using consecutively Kurtosis-derived Characteristic Functions (CF) and Eigenvalue decompositions on 3-component seismic data to independently pick P and S arrivals. When computed over a sliding window of the signal, a sudden increase in the CF reveals a transition from a gaussian to a non-gaussian distribution, characterizing the phase onset (Saragiotis, 2002). One advantage of the method is that it requires much fewer adjustable parameters than competing methods. We modified the Kurtosis CF to improve pick precision, by computing the CF over several frequency bandwidths, window sizes and smoothing parameters. Once phases were picked, we determined the onset type (P or S) using polarization parameters (rectilinearity, azimuth and dip) calculated using Eigenvalue decompositions of the covariance matrix (Cichowicz, 1993). Finally, we removed bad picks using a clustering procedure and the signal-to-noise ratio (SNR). The pick quality index was also assigned based on the SNR value. Amplitude calculation is integrated into the procedure to enable automatic magnitude calculation. We applied this procedure to data from a network of 30 wideband seismometers (including 10 oceanic bottom seismometers) in Vanuatu that ran for 10 months from May 2008 to February 2009. We manually picked the first 172 events of June, whose local magnitudes range from 0.7 to 3.7. We made a total of 1601 picks, 1094 P and 507 S. We then applied our automatic picking to the same dataset. 70% of the manually picked onsets were picked automatically. For P-picks, the difference between manual and automatic picks is 0.01 ± 0.08 s overall; for the best quality picks (quality index 0: 64

  6. Effectiveness, Efficiency, and Appeal: Pick Any Two? The Influence of Learning Domains and Learning Outcomes on Designer Judgments of Useful Instructional Methods

    ERIC Educational Resources Information Center

    Honebein, Peter C.; Honebein, Cass H.

    2015-01-01

    When choosing instructional methods, instructional designers trade-off or sacrifice an outcome, such as effectiveness, efficiency, or appeal. In instructional planning theory, this is referred to as values about priorities. When "values about priorities" are combined with "conditions about content," we expect that a different…

  7. Effectiveness, Efficiency, and Appeal: Pick Any Two? The Influence of Learning Domains and Learning Outcomes on Designer Judgments of Useful Instructional Methods

    ERIC Educational Resources Information Center

    Honebein, Peter C.; Honebein, Cass H.

    2015-01-01

    When choosing instructional methods, instructional designers trade-off or sacrifice an outcome, such as effectiveness, efficiency, or appeal. In instructional planning theory, this is referred to as values about priorities. When "values about priorities" are combined with "conditions about content," we expect that a different…

  8. Twin Peaks

    NASA Technical Reports Server (NTRS)

    1997-01-01

    The two hills in the distance, approximately one to two kilometers away, have been dubbed the 'Twin Peaks' and are of great interest to Pathfinder scientists as objects of future study. The white areas on the left hill, called the 'Ski Run' by scientists, may have been formed by hydrologic processes.

    The image was taken by the Imager for Mars Pathfinder (IMP) after its deployment on Sol 3. Mars Pathfinder was developed and managed by the Jet Propulsion Laboratory (JPL) for the National Aeronautics and Space Administration. The IMP was developed by the University of Arizona Lunar and Planetary Laboratory under contract to JPL. Peter Smith is the Principal Investigator.

  9. Improved method for predicting the peak signal-to-noise ratio quality of decoded images in fractal image coding

    NASA Astrophysics Data System (ADS)

    Wang, Qiang; Bi, Sheng

    2017-01-01

    To predict the peak signal-to-noise ratio (PSNR) quality of decoded images in fractal image coding more efficiently and accurately, an improved method is proposed. After some derivations and analyses, we find that the linear correlation coefficients between coded range blocks and their respective best-matched domain blocks can determine the dynamic range of their collage errors, which can also provide the minimum and the maximum of the accumulated collage error (ACE) of uncoded range blocks. Moreover, the dynamic range of the actual percentage of accumulated collage error (APACE), APACEmin to APACEmax, can be determined as well. When APACEmin reaches a large value, such as 90%, APACEmin to APACEmax will be limited in a small range and APACE can be computed approximately. Furthermore, with ACE and the approximate APACE, the ACE of all range blocks and the average collage error (ACER) can be obtained. Finally, with the logarithmic relationship between ACER and the PSNR quality of decoded images, the PSNR quality of decoded images can be predicted directly. Experiments show that compared with the previous similar method, the proposed method can predict the PSNR quality of decoded images more accurately and needs less computation time simultaneously.

  10. Prevalence and heritability of skin picking in an adult community sample: a twin study.

    PubMed

    Monzani, Benedetta; Rijsdijk, Fruhling; Cherkas, Lynn; Harris, Juliette; Keuthen, Nancy; Mataix-Cols, David

    2012-07-01

    Skin-picking disorder (SPD) is a disabling psychiatric condition that can lead to skin damage and other medical complications. Epidemiological data is scarce and its causes are unknown. The present study examined the prevalence and heritability of skin-picking symptoms in a large sample of twins. A total of 2,518 twins completed a valid and reliable self-report measure of skin-picking behavior. The prevalence of clinically significant skin picking was established using empirically derived cut-offs. Twin modeling methods were employed to decompose the variance in the liability to skin picking into additive genetic and shared and non-shared environmental factors. A total of 1.2% of twins scored above the cut-off, indicative of clinically significant skin picking. All these participants were women. Univariate model-fitting analyses (female twins only, N = 2,191) showed that genetic factors accounted for approximately 40% (95% CI 19-58%) of the variance in skin picking, with non-shared environmental factors and measurement error accounting for the remaining variance (60% [95% CI 42-81%]). Shared environmental factors were negligible. It is concluded that pathological skin picking is relatively prevalent problem, particularly among women, and that it tends to run in families primarily due to genetic factors. Non-shared environmental factors are also likely to play an important role in its etiology. Copyright © 2012 Wiley Periodicals, Inc.

  11. Stability indicating validated HPLC method for quantification of levothyroxine with eight degradation peaks in the presence of excipients.

    PubMed

    Shah, R B; Bryant, A; Collier, J; Habib, M J; Khan, M A

    2008-08-06

    A simple, sensitive, accurate, and robust stability indicating analytical method is presented for identification, separation, and quantitation of l-thyroxine and eight degradation impurities with an internal standard. The method was used in the presence of commonly used formulation excipients such as butylated hydroxyanisole, povidone, crospovidone, croscarmellose sodium, mannitol, sucrose, acacia, lactose monohydrate, confectionary sugar, microcrystalline cellulose, sodium laurel sulfate, magnesium stearate, talc, and silicon dioxide. The two active thyroid hormones: 3,3',5,5'-tetra-iodo-l-thyronine (l-thyroxine-T4) and 3,3',5-tri-iodo-l-thyronine (T3) and degradation products including di-iodothyronine (T2), thyronine (T0), tyrosine (Tyr), di-iodotyrosine (DIT), mono-iodotyrosine (MIT), 3,3',5,5'-tetra-iodothyroacetic acid (T4AA) and 3,3',5-tri-iodothyroacetic acid (T3AA) were assayed by the current method. The separation of l-thyroxine and eight metabolites along with theophylline (internal standard) was achieved using a C18 column (25 degrees C) with a mobile phase of trifluoroacetic acid (0.1%, v/v, pH 3)-acetonitrile in gradient elution at 0.8 ml/min at 223 nm. The sample diluent was 0.01 M methanolic NaOH. Method was validated according to FDA, USP, and ICH guidelines for inter-day accuracy, precision, and robustness after checking performance with system suitability. Tyr (4.97 min), theophylline (9.09 min), MIT (9.55 min), DIT (11.37 min), T0 (11.63 min), T2 (14.47 min), T3 (16.29 min), T4 (17.60 min), T3AA (22.71 min), and T4AA (24.83 min) separated in a single chromatographic run. Linear relationship (r2>0.99) was observed between the peak area ratio and the concentrations for all of the compounds within the range of 2-20 microg/ml. The total time for analysis, equilibration and recovery was 40 min. The method was shown to separate well from commonly employed formulation excipients. Accuracy ranged from 95 to 105% for T4 and 90 to 110% for all other

  12. Characterizing Earthquake Rupture Properties Using Peak High-Frequency Offset

    NASA Astrophysics Data System (ADS)

    Wen, L.; Meng, L.

    2014-12-01

    Teleseismic array back-projection (BP) of high frequency (~1Hz) seismic waves has been recently applied to image the aftershock sequence of the Tohoku-Oki earthquake. The BP method proves to be effective in capturing early aftershocks that are difficult to be detected due to the contamination of the mainshock coda wave. Furthermore, since the event detection is based on the identification of the local peaks in time series of the BP power, the resulting event location corresponds to the peak high-frequency energy rather than the hypocenter. In this work, we show that the comparison between the BP-determined catalog and conventional phase-picking catalog provides estimates of the spatial and temporal offset between the hypocenter and the peak high-frequency radiation. We propose to measure this peak high-frequency shift of global earthquakes between M4.0 to M7.0. We average the BP locations calibrated by multiple reference events to minimize the uncertainty due to the variation of 3D path effects. In our initial effort focusing on the foreshock and aftershock sequence of the 2014 Iquique earthquake, we find systematic shifts of the peak high-frequency energy towards the down-dip direction. We find that the amount of the shift is a good indication of rupture length, which scales with the earthquake magnitude. Further investigations of the peak high frequency offset may provide constraints on earthquake source properties such as rupture directivity, rupture duration, rupture speed, and stress drop.

  13. Peak purity assessment in a triple-active fixed-dose combination drug product related substances method using a commercial two-dimensional liquid chromatography system.

    PubMed

    Shackman, Jonathan G; Kleintop, Brent L

    2014-10-01

    Pharmaceutical formulations containing multiple active components challenge the development of analytical methods, especially as the individual active ingredients diverge in their physicochemical properties. Establishing specificity, especially peak purity, is one of the major evaluation criteria when developing a related substances method for drug substances or products. Fixed-dose combination products may not be amenable to common strategies for assessing peak purity, such as performing orthogonal separations, due to the complexity of the separation and/or diversity of the active ingredients. An alternate approach to evaluating peak purity is demonstrated for a triple-active component fixed-dose combination product under development. A commercially available automated two-dimensional liquid chromatography system was used to perform a selective comprehensive multidimensional separation of an active ingredient peak. The first dimension performed the drug product impurity/degradant profiling method; the second dimension assayed these fractions using the drug substance profiling method, which was pseudo-orthogonal to the first dimension. A total of 14 targeted fractions were sampled across the first dimension main peak, with 11 containing detectable analytes and the remaining fractions bracketing the main peak. This degree of sampling allowed profiling of a coeluting degradant present at a 0.2% w/w level throughout the main peak. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Peak oxygen uptake in children: evaluation of an older prediction method and development of a new one.

    PubMed

    Arngrimsson, Sigurbjorn Arni; Sveinsson, Torarinn; Jóhannsson, Erlingur

    2008-02-01

    The purpose of this study was to validate an equation that has been used to predict peak oxygen uptake (VO2peak) and, if invalid, to develop a new equation predicting VO2peak from performance on a cycle ergometer test. Forty-five 9- and 15-year-old children underwent a VO2peak test and were randomized into developmental (DEV) and cross-validation (C-V) groups. The equation under validation, which requires knowledge of resting energy expenditure (REE), underestimated VO2peak (p < .05), but once adjusted with a new parameter calculated in DEV, it cross-validated well (rYY' = .98, SE = .18 L . min-1). The accuracy of a new prediction equation built in DEV, not using REE, was confirmed in C-V (rYY' = .98, SE = .17 L . min-1) and the slope and intercept were not different from the line of identity (p < .05). VO2peak in schoolchildren can be predicted with good accuracy from an equation based on the whole sample [VO2peak = -1.5986 + 0.0115 . (maximal power output) + 0.0109 . (mass) + 0.1313 . (gender) + 0.0085 . (maximal heart rate)].

  15. Extraction of structural and chemical information from high angle annular dark-field image by an improved peaks finding method.

    PubMed

    Yin, Wenhao; Huang, Rong; Qi, Ruijuan; Duan, Chungang

    2016-09-01

    With the development of spherical aberration (Cs) corrected scanning transmission electron microscopy (STEM), high angle annular dark filed (HAADF) imaging technique has been widely applied in the microstructure characterization of various advanced materials with atomic resolution. However, current qualitative interpretation of the HAADF image is not enough to extract all the useful information. Here a modified peaks finding method was proposed to quantify the HAADF-STEM image to extract structural and chemical information. Firstly, an automatic segmentation technique including numerical filters and watershed algorithm was used to define the sub-areas for each atomic column. Then a 2D Gaussian fitting was carried out to determine the atomic column positions precisely, which provides the geometric information at the unit-cell scale. Furthermore, a self-adaptive integration based on the column position and the covariance of statistical Gaussian distribution were performed. The integrated intensities show very high sensitivity on the mean atomic number with improved signal-to-noise (S/N) ratio. Consequently, the polarization map and strain distributions were rebuilt from a HAADF-STEM image of the rhombohedral and tetragonal BiFeO3 interface and a MnO2 monolayer in LaAlO3 /SrMnO3 /SrTiO3 heterostructure was discerned from its neighbor TiO2 layers. Microsc. Res. Tech. 79:820-826, 2016. © 2016 Wiley Periodicals, Inc.

  16. Pick-up ions at Pluto

    NASA Astrophysics Data System (ADS)

    Kecskemety, K.; Cravens, T. E.

    1993-04-01

    Methane molecules escaping from Pluto's atmosphere are ionized, and the resulting ions are picked up by the solar wind. The mass loading associated with this ion pick-up can produce a cometlike interaction of the solar wind with Pluto. Heavy ion gyroradii are as large as a half million km in the weak interplanetary magnetic field that exists at 30 AU, which is about an order of magnitude larger than the size of the 'interaction region'. We have calculated velocity space distributions of pick-up ions using numerically determined ion trajectories. The predicted pick-up ion fluxes are high enough to be detectable by standard charged particle detectors as far upstream of Pluto as 10 exp 6 km.

  17. Target Picking Methods for Magnetic Data

    DTIC Science & Technology

    2008-09-01

    clustering algorithm was also tested on data collected at the Badlands Bombing Range (BBR) on the Pine Ridge Reservation in South Dakota and at...Albuquerque. The reservation is bordered on the north by the Sandia Military Reservation, which includes Kirtland Air Force Base, the Manzano

  18. Identifying P phase arrival of weak events: The Akaike Information Criterion picking application based on the Empirical Mode Decomposition

    NASA Astrophysics Data System (ADS)

    Li, Xibing; Shang, Xueyi; Morales-Esteban, A.; Wang, Zewei

    2017-03-01

    Seismic P phase arrival picking of weak events is a difficult problem in seismology. The algorithm proposed in this research is based on Empirical Mode Decomposition (EMD) and on the Akaike Information Criterion (AIC) picker. It has been called the EMD-AIC picker. The EMD is a self-adaptive signal decomposition method that not only improves Signal to Noise Ratio (SNR) but also retains P phase arrival information. Then, P phase arrival picking has been determined by applying the AIC picker to the selected main Intrinsic Mode Functions (IMFs). The performance of the EMD-AIC picker has been evaluated on the basis of 1938 micro-seismic signals from the Yongshaba mine (China). The P phases identified by this algorithm have been compared with manual pickings. The evaluation results confirm that the EMD-AIC pickings are highly accurate for the majority of the micro-seismograms. Moreover, the pickings are independent of the kind of noise. Finally, the results obtained by this algorithm have been compared to the wavelet based Discrete Wavelet Transform (DWT)-AIC pickings. This comparison has demonstrated that the EMD-AIC picking method has a better picking accuracy than the DWT-AIC picking method, thus showing this method's reliability and potential.

  19. A rapid and non-invasive method for measuring the peak positive pressure of HIFU fields by a laser beam.

    PubMed

    Wang, Hua; Zeng, Deping; Chen, Ziguang; Yang, Zengtao

    2017-04-12

    Based on the acousto-optic interaction, we propose a laser deflection method for rapidly, non-invasively and quantitatively measuring the peak positive pressure of HIFU fields. In the characterization of HIFU fields, the effect of nonlinear propagation is considered. The relation between the laser deflection length and the peak positive pressure is derived. Then the laser deflection method is assessed by comparing it with the hydrophone method. The experimental results show that the peak positive pressure measured by laser deflection method is little higher than that obtained by the hydrophone, confirming that they are in reasonable agreement. Considering that the peak pressure measured by hydrophones is always underestimated, the laser deflection method is assumed to be more accurate than the hydrophone method due to the absence of the errors in hydrophone spatial-averaging measurement and the influence of waveform distortion on hydrophone corrections. Moreover, noting that the Lorentz formula still remains applicable to high-pressure environments, the laser deflection method exhibits a great potential for measuring HIFU field under high-pressure amplitude. Additionally, the laser deflection method provides a rapid way for measuring the peak positive pressure, without the scan time, which is required by the hydrophones.

  20. Methods for Estimating Peak Discharges and Unit Hydrographs for Streams in the City of Charlotte and Mecklenburg County, North Carolina

    USGS Publications Warehouse

    Weaver, J. Curtis

    2003-01-01

    Procedures for estimating peak discharges and unit hydrographs were developed for streams in the city of Charlotte and Mecklenburg County in response to a need for better techniques for characterizing the flow of streams. The procedures presented in this report provide the means for estimating unit hydrographs as part of the process used in watershed modeling and(or) design of stormwater-management structures. The procedures include three statistical relations for use in estimating storm peak discharge, unit-hydrograph peak discharge, and unit-hydrograph lag time. A final component of the procedures is the development of a dimensionless unit hydrograph developed from streamflow and rainfall data collected during the 1995-2000 water years at 25 streamgaging stations and up to 60 raingages in the city and county. The statistical relation to estimate the storm peak discharge is based on analyses of observed peak discharges regressed against rainfall and basin characteristics using a database of 412 observations from 61 storm events among the 25 gaging stations. The rainfall characteristics included basin-average rainfall amounts as well as estimates of the maximum and minimum storm rainfall in the basin. The basin characteristics consisted of land-use information and other physical basin characteristics, such as drainage area, channel length, channel slope, percentage of impervious area, and percentage of the basin served by detention. The analyses resulted in a relation that can be used for estimating storm peak discharge based on drainage area, basin-average rainfall, and impervious area. Average unit hydrographs were developed for 24 of 25 streamgaging stations, using from three to nine storms at each site. The average unit hydrograph for each station was converted into four classes of unit hydrographs with durations corresponding to one-fourth, one-third, one-half, and three-fourths of the station-average lag time. For 23 sites, the lag-time-duration hydrographs

  1. Use of remote sensing methods to assess the physical and ecological impacts of dams in a hydro peaking system

    NASA Astrophysics Data System (ADS)

    Buehler, H.; Hassan, M. A.; Eaton, B. C.; Dugdale, S. J.

    2011-12-01

    The 1955 damming of the Kananaskis River provides a unique opportunity to assess changes in channel morphology associated with dams. In contrast to many dam-influenced systems, this dam did not cut sediment sources therefore dam induced changes in channel morphology can be attributed to the altered flow regime. The dam produced a change in the flow regime through reduction in the magnitude of large flows and created daily peaking flows which maintain the competence to partially mobilize sediment. We assessed the reach scale morphological change on the Kananaskis which has occurred since 1958. The downstream propagation of change and the influence of riparian vegetation on channel change were also considered. Historic aerial photos were used to reconstruct pre-dam width and morphology. Airborne remote sensing methods were used to determine the present state of the system including grain size, channel geometry, and distribution of species in riparian forests. Analysis of width at 11 sites downstream of the dam revealed that channel response was not unidirectional, rather 5 reaches widened, 2 narrowed, and 4 experienced no change. Throughout the entire study region the vegetated banks shifted from dominance by grasses and shrubs to dense coniferous forests. The UBC regime model was used as a reference for equilibrium channel width associated with pre-dam and post-dam conditions. The model indicated that the channel would narrow with the maximum width adjustment occurring nearest to the dam and decreasing in the downstream direction. Due to the transient nature of the system, the model results were not expressed by the system. The response of the system reflects the complex set of controls on channel evolution which cannot be fully represented by the simplified models which do not consider the entire flow regime.

  2. Picking among pen-reared quail

    USGS Publications Warehouse

    Nestler, R.B.; Coburn, D.R.; Titus, H.W.

    1945-01-01

    During five years (1939-43) of nutritional research on pen-reared bobwhite quail at the Patuxent Research Refuge, Bowie, Maryland, observations on picking among birds of all ages showed the following results: 1. Picking occurred on all grains tested: corn, wheat, oats, oat groats, barley, millet, buckwheat, kaffir, and mixtures of cereals. The lowest incidence was with buckwheat as the sole grain in a growing diet....2. Picking occurred on all levels of fiber from one to 11per cent in a growing diet....3. Picking occurred on various grinds of corn, barley, and oats, but was least when these cereals were ground in a hammer mill with 3/32 inch mesh screen....4. The incidence was as high on diets containing animal protein as on those containing no animal protein. ....5. After picking began, the addition of one or two per cent of salt to the diet for several days was effective, in many instances, in checking the disorder. Results at the Refuge and the answers to questionnaires from 222 private propagators of gamebirds showed that in two-thirds. of the cases, treatment with an increased quantity of salt successfully stopped the trouble. As a preventative, however, salt was of little value. Picking occurred on both low and high levels of salt.....6. Supplementing the regular diet with certain feed concentrates such as fishmeal, soybean oil meal, liver meal, or chopped greens offered in a separate feeder for a day or two, was as efficacious as the addition of salt.....7. More picking occurred among quail chicks on a 22 per cent level of protein than on higher levels.....8. There was less picking on diets relished by the birds than on those seemingly unpalatable.....9. There was no correlation. between the amount of floor space per chick and the incidence of picking.....10. Increasing the feeding and drinking space seemed to have a marked beneficial effect.....11. Some adult birds on wire floors resorted to self-picking of their feet after the toes were frost-bitten.

  3. [Research on K-means clustering segmentation method for MRI brain image based on selecting multi-peaks in gray histogram].

    PubMed

    Chen, Zhaoxue; Yu, Haizhong; Chen, Hao

    2013-12-01

    To solve the problem of traditional K-means clustering in which initial clustering centers are selected randomly, we proposed a new K-means segmentation algorithm based on robustly selecting 'peaks' standing for White Matter, Gray Matter and Cerebrospinal Fluid in multi-peaks gray histogram of MRI brain image. The new algorithm takes gray value of selected histogram 'peaks' as the initial K-means clustering center and can segment the MRI brain image into three parts of tissue more effectively, accurately, steadily and successfully. Massive experiments have proved that the proposed algorithm can overcome many shortcomings caused by traditional K-means clustering method such as low efficiency, veracity, robustness and time consuming. The histogram 'peak' selecting idea of the proposed segmentootion method is of more universal availability.

  4. Pick to place trajectories in human arm training environment.

    PubMed

    Ziherl, Jaka; Podobnik, Janez; Sikic, Mario; Munih, Marko

    2009-01-01

    This paper presents a new method of trajectory planning in rehabilitation robotics. First were measured in healthy subject the pick to place trajectories while haptic robot is in zero impedance space. B-spline approximation is used to mathematically define the measured paths. This trajectory path serves as a central line for the rounding haptic tunnel. In addition to radial elastic and damping force an optional guidance force can be applied along the tunnel to reach the place point. The B-spline control points were observed around the robot and arm workspace. The trajectory path defined with B-splines is compared with minimum jerk and minimum torque defined trajectories. Finally are compared the pick to place movements with and without tunnel use in healthy subject and in stroke hemiplegic patient.

  5. A new method for the determination of peak distribution across a two-dimensional separation space for the identification of optimal column combinations.

    PubMed

    Leonhardt, Juri; Teutenberg, Thorsten; Buschmann, Greta; Gassner, Oliver; Schmidt, Torsten C

    2016-11-01

    For the identification of the optimal column combinations, a comparative orthogonality study of single columns and columns coupled in series for the first dimension of a microscale two-dimensional liquid chromatographic approach was performed. In total, eight columns or column combinations were chosen. For the assessment of the optimal column combination, the orthogonality value as well as the peak distributions across the first and second dimension was used. In total, three different methods of orthogonality calculation, namely the Convex Hull, Bin Counting, and Asterisk methods, were compared. Unfortunately, the first two methods do not provide any information of peak distribution. The third method provides this important information, but is not optimal when only a limited number of components are used for method development. Therefore, a new concept for peak distribution assessment across the separation space of two-dimensional chromatographic systems and clustering detection was developed. It could be shown that the Bin Counting method in combination with additionally calculated histograms for the respective dimensions is well suited for the evaluation of orthogonality and peak clustering. The newly developed method could be used generally in the assessment of 2D separations. Graphical Abstract ᅟ.

  6. A novel FFT/IFFT based peak-to-average power reduction method for OFDM communication systems using tone reservation

    NASA Astrophysics Data System (ADS)

    Besong, Samuel Oru; Yu, Xiaoyou; Li, Bin; Hou, Weibing; Wang, Xiaochun

    2011-10-01

    One of the main drawbacks of OFDM systems is the high Peak-to-Average Power ratio, which could limit transmission efficiency and efficient use of HPA. In this paper we present a modified tone reservation scheme for PAPR reduction using FFT iterations to generate the tones. In this Scheme, the reserve tones are designed to both cancel peaks and slightly increase the average power to induce a better PAPR reduction..The tones are generated by means of 2 FFT operations and the process is sometimes iterated to achieve better PAPR reductions. This scheme achieves a significant PAPR reduction of at least 4.6dB when about 4% of the carriers are used as reserve tones and with even lesser iterations when simulated in an OFDM system.

  7. Methods for estimating the magnitude and frequency of peak streamflows at ungaged sites in and near the Oklahoma Panhandle

    USGS Publications Warehouse

    Smith, S. Jerrod; Lewis, Jason M.; Graves, Grant M.

    2015-09-28

    Generalized-least-squares multiple-linear regression analysis was used to formulate regression relations between peak-streamflow frequency statistics and basin characteristics. Contributing drainage area was the only basin characteristic determined to be statistically significant for all percentage of annual exceedance probabilities and was the only basin characteristic used in regional regression equations for estimating peak-streamflow frequency statistics on unregulated streams in and near the Oklahoma Panhandle. The regression model pseudo-coefficient of determination, converted to percent, for the Oklahoma Panhandle regional regression equations ranged from about 38 to 63 percent. The standard errors of prediction and the standard model errors for the Oklahoma Panhandle regional regression equations ranged from about 84 to 148 percent and from about 76 to 138 percent, respectively. These errors were comparable to those reported for regional peak-streamflow frequency regression equations for the High Plains areas of Texas and Colorado. The root mean square errors for the Oklahoma Panhandle regional regression equations (ranging from 3,170 to 92,000 cubic feet per second) were less than the root mean square errors for the Oklahoma statewide regression equations (ranging from 18,900 to 412,000 cubic feet per second); therefore, the Oklahoma Panhandle regional regression equations produce more accurate peak-streamflow statistic estimates for the irrigated period of record in the Oklahoma Panhandle than do the Oklahoma statewide regression equations. The regression equations developed in this report are applicable to streams that are not substantially affected by regulation, impoundment, or surface-water withdrawals. These regression equations are intended for use for stream sites with contributing drainage areas less than or equal to about 2,060 square miles, the maximum value for the independent variable used in the regression analysis.

  8. Modular Pick-and-Bucket Mining Machine

    NASA Technical Reports Server (NTRS)

    Gangal, M. D.; Lewis, E. V.

    1985-01-01

    Concept for improved conventional pick-and-bucket mining machine offered as backup for hydrojet-jaw mining machine. Picks on chain dislodge coal and buckets on chain scoop it up. Depending on width cut, unit composed of only two end modules or end modules plus one, two, or three incremental modules. Folding curved shields protect sides of miner from falling coal and rock. Two side stabilizers - extendable hydraulic members - anchor miner against lateral drift. Unlike conventional machines, new version tilts cutters vertically and skews them horizontally to changing floor slopes and seam heights.

  9. Comparing methods for measuring peak look duration: are individual differences observed on screen-based tasks also found in more ecologically valid contexts?

    PubMed

    Wass, Sam V

    2014-08-01

    Convergent research points to the importance of studying the ontogenesis of sustained attention during the early years of life, but little research hitherto has compared and contrasted different techniques available for measuring sustained attention. Here, we compare methods that have been used to assess one parameter of sustained attention, namely infants' peak look duration to novel stimuli. Our focus was to assess whether individual differences in peak look duration are stable across different measurement techniques. In a single cohort of 42 typically developing 11-month-old infants we assessed peak look duration using six different measurement paradigms (four screen-based, two naturalistic). Zero-order correlations suggested that individual differences in peak look duration were stable across all four screen-based paradigms, but no correlations were found between peak look durations observed on the screen-based and the naturalistic paradigms. A factor analysis conducted on the dependent variable of peak look duration identified two factors. All four screen-based tasks loaded onto the first factor, but the two naturalistic tasks did not relate, and mapped onto a different factor. Our results question how individual differences observed on screen-based tasks manifest in more ecologically valid contexts.

  10. SAM 2.1—A computer program for plotting and formatting surveying data for estimating peak discharges by the slope-area method

    USGS Publications Warehouse

    Hortness, J.E.

    2004-01-01

    The U.S. Geological Survey (USGS) measures discharge in streams using several methods. However, measurement of peak discharges is often impossible or impractical due to difficult access, inherent danger of making measurements during flood events, and timing often associated with flood events. Thus, many peak discharge values often are calculated after the fact by use of indirect methods. The most common indirect method for estimating peak dis- charges in streams is the slope-area method. This, like other indirect methods, requires measuring the flood profile through detailed surveys. Processing the survey data for efficient entry into computer streamflow models can be time demanding; SAM 2.1 is a program designed to expedite that process. The SAM 2.1 computer program is designed to be run in the field on a portable computer. The program processes digital surveying data obtained from an electronic surveying instrument during slope- area measurements. After all measurements have been completed, the program generates files to be input into the SAC (Slope-Area Computation program; Fulford, 1994) or HEC-RAS (Hydrologic Engineering Center-River Analysis System; Brunner, 2001) computer streamflow models so that an estimate of the peak discharge can be calculated.

  11. Automated Interval velocity picking for Atlantic Multi-Channel Seismic Data

    NASA Astrophysics Data System (ADS)

    Singh, Vishwajit

    2016-04-01

    This paper described the challenge in developing and testing a fully automated routine for measuring interval velocities from multi-channel seismic data. Various approaches are employed for generating an interactive algorithm picking interval velocity for continuous 1000-5000 normal moveout (NMO) corrected gather and replacing the interpreter's effort for manual picking the coherent reflections. The detailed steps and pitfalls for picking the interval velocities from seismic reflection time measurements are describe in these approaches. Key ingredients these approaches utilized for velocity analysis stage are semblance grid and starting model of interval velocity. Basin-Hopping optimization is employed for convergence of the misfit function toward local minima. SLiding-Overlapping Window (SLOW) algorithm are designed to mitigate the non-linearity and ill- possessedness of root-mean-square velocity. Synthetic data case studies addresses the performance of the velocity picker generating models perfectly fitting the semblance peaks. A similar linear relationship between average depth and reflection time for synthetic model and estimated models proposed picked interval velocities as the starting model for the full waveform inversion to project more accurate velocity structure of the subsurface. The challenges can be categorized as (1) building accurate starting model for projecting more accurate velocity structure of the subsurface, (2) improving the computational cost of algorithm by pre-calculating semblance grid to make auto picking more feasible.

  12. APASVO: A free software tool for automatic P-phase picking and event detection in seismic traces

    NASA Astrophysics Data System (ADS)

    Romero, José Emilio; Titos, Manuel; Bueno, Ángel; Álvarez, Isaac; García, Luz; Torre, Ángel de la; Benítez, M.a. Carmen

    2016-05-01

    The accurate estimation of the arrival time of seismic waves or picking is a problem of major interest in seismic research given its relevance in many seismological applications, such as earthquake source location and active seismic tomography. In the last decades, several automatic picking methods have been proposed with the ultimate goal of implementing picking algorithms whose results are comparable to those obtained by manual picking. In order to facilitate the use of these automated methods in the analysis of seismic traces, this paper presents a new free, open source, software graphical tool, named APASVO, which allows picking tasks in an easy and user-friendly way. The tool also provides event detection functionality, where a relatively imprecise estimation of the onset time is sufficient. The application implements the STA-LTA detection algorithm and the AMPA picking algorithm. An autoregressive AIC-based picking method can also be applied. Besides, this graphical tool is complemented with two additional command line tools, an event picking tool and a synthetic earthquake generator. APASVO is a multiplatform tool that works on Windows, Linux and OS X. The application can process data in a large variety of file formats. It is implemented in Python and relies on well-known scientific computing packages such as ObsPy, NumPy, SciPy and Matplotlib.

  13. Psychology Experiment Authoring Kit (PEAK): formal usability testing of an easy-to-use method for creating computerized experiments.

    PubMed

    Schneider, Walter; Bolger, D J; Eschman, Amy; Neff, Christopher; Zuccolotto, Anthony P

    2005-05-01

    In academic courses in which one task for the students is to understand empirical methodology and the nature of scientific inquiry, the ability of students to create and implement their own experiments allows them to take intellectual ownership of, and greatly facilitates, the learning process. The Psychology Experiment Authoring Kit (PEAK) is a novel spreadsheet-based interface allowing students and researchers with rudimentary spreadsheet skills to create cognitive and cognitive neuroscience experiments in minutes. Students fill in a spreadsheet listing of independent variables and stimuli, insert columns that represent experimental objects such as slides (presenting text, pictures, and sounds) and feedback displays to create complete experiments, all within a single spreadsheet. The application then executes experiments with centisecond precision. Formal usability testing was done in two stages: (1) detailed coding of 10 individual subjects in one-on-one experimenter/subject videotaped sessions and (2) classroom testing of 64 undergraduates. In both individual and classroom testing, the students learned to effectively use PEAK within 2 h, and were able to create a lexical decision experiment in under 10 min. Findings from the individual testing in Stage 1 resulted in significant changes to documentation and training materials and identification of bugs to be corrected. Stage 2 testing identified additional bugs to be corrected and new features to be considered to facilitate student understanding of the experiment model. Such testing will improve the approach with each semester. The students were typically able to create their own projects in 2 h.

  14. Teaching Children with Niemann-Pick Disease

    ERIC Educational Resources Information Center

    Gartin, Barbara C.; Murdick, Nikki L.; Cooley, Jennifer; Barnett, Sara

    2013-01-01

    Niemann-Pick Disease (NPD) is a group of rare inherited disorders that are both systemic and degenerative. Knowledge of the disease, its characteristics, and its progression are essential for the teacher and related service personnel to provide an appropriate educational experience for the student. For the teacher who has a student with NPC in…

  15. An Elementary Proof of Pick's Theorem.

    ERIC Educational Resources Information Center

    Pullman, Howard W.

    1979-01-01

    Pick's Theorem, a statement of the relationship between the area of a polygonal region on a lattice and its interior and boundary lattice points, is familiar to those whose students have participated in activities and discovery lessons using the geoboard. The proof presented, although rather long, is well within the grasp of the average geometry…

  16. Influence of peak-broadening and interdetector volume error on size-exclusive chromatographic analysis with dual viscometric-concentration detection using the universal calibration method.

    PubMed

    Netopilík, M

    2001-04-27

    The effect of peak-broadening and error in interdetector volume on the local calibration curve and experimental molecular-mass averages obtained by size-exclusion chromatography (SEC) with dual concentration/viscosity detection, and determination of molecular mass using the universal calibration (UC) method, is theoretically examined using a polymer sample with a molecular-mass distribution (MMD) approximated by the log-normal function. Although peak-broadening is often neglected, its effect on the slope of the local calibration curve and, consequently, on the experimentally obtained values of the weight-to-number average ratio is large. To obtain the right values of these parameters, a numerical correction is usually recommended. While using the UC method, the relationships between the extent of peak broadening, calibration slopes and interdetector volume are complex and can contribute to the occurrence of undiscovered errors. For this reason, an understanding of this problem, using a model, is necessary. The results of the UC method are compared with those obtained using dual-detection with known Mark-Houwink-Kuhn-Sakurada parameters (MHKS method), light-scattering (LS)/concentration detection as well as with the results obtained using conventional calibration. Due to peak-broadening, the slope of a local calibration curve and the weight-to-number average ratio, (Mw/Mn)", obtained using the UC method, increase compared to the theoretical values, whereas they decrease using the MHKS or LS methods. The increase when using the UC method is even larger compared to evaluation using conventional calibration. The effect of the error in interdetector volume on the slopes of local calibrations and the weight-to-number average ratios is opposite in the UC method to that found using the MHKS and LS methods.

  17. Peak separation method for sub-lattice strain analysis at atomic resolution: Application to InAs/GaSb superlattice.

    PubMed

    Kim, Honggyu; Meng, Yifei; Rouviére, Jean-Luc; Zuo, Jian-Min

    2017-01-01

    We report on a direct measurement of cation and anion sub-lattice strain in an InAs/GaSb type-II strained layer superlattice (T2SLs) using atomic resolution imaging and advanced image processing. Atomic column positions in InAs and GaSb are determined by separating the cation and anion peak intensities. Analysis of the InAs/GaSb T2SLs reveals the compressive strain in the nominal GaSb layer and tensile strain at interfaces between constituent layers, which indicate In incorporation into the nominal GaSb layer and the formation of GaAs like interfaces, respectively. The results are compared with the model-dependent X-ray diffraction measurements in terms of interfacial chemical intermixing and strain. Together, these techniques provide a robust measurement of atomic-scale strain which is vital to determine T2SL properties.

  18. ADARRI: a novel method to detect spurious R-peaks in the electrocardiogram for heart rate variability analysis in the intensive care unit.

    PubMed

    Rebergen, Dennis J; Nagaraj, Sunil B; Rosenthal, Eric S; Bianchi, Matt T; van Putten, Michel J A M; Westover, M Brandon

    2017-02-16

    We developed a simple and fully automated method for detecting artifacts in the R-R interval (RRI) time series of the ECG that is tailored to the intensive care unit (ICU) setting. From ECG recordings of 50 adult ICU-subjects we selected 60 epochs with valid R-peak detections and 60 epochs containing artifacts leading to missed or false positive R-peak detections. Next, we calculated the absolute value of the difference between two adjacent RRIs (adRRI), and obtained the empirical probability distributions of adRRI values for valid R-peaks and artifacts. From these, we calculated an optimal threshold for separating adRRI values arising from artifact versus non-artefactual data. We compared the performance of our method with the methods of Berntson and Clifford on the same data. We identified 257,458 R-peak detections, of which 235,644 (91.5%) were true detections and 21,814 (8.5%) arose from artifacts. Our method showed superior performance for detecting artifacts with sensitivity 100%, specificity 99%, precision 99%, positive likelihood ratio of 100 and negative likelihood ratio <0.001 compared to Berntson's and Clifford's method with a sensitivity, specificity, precision and positive and negative likelihood ratio of 99%, 78%, 82%, 4.5, 0.013 for Berntson's method and 55%, 98%, 96%, 27.5, 0.460 for Clifford's method, respectively. A novel algorithm using a patient-independent threshold derived from the distribution of adRRI values in ICU ECG data identifies artifacts accurately, and outperforms two other methods in common use. Furthermore, the threshold was calculated based on real data from critically ill patients and the algorithm is easy to implement.

  19. 'Wanting' and 'liking' skin picking: A validation of the Skin Picking Reward Scale.

    PubMed

    Snorrason, Ivar; Olafsson, Ragnar P; Houghton, David C; Woods, Douglas W; Lee, Han-Joo

    2015-12-01

    Excoriation (skin-picking) disorder (SPD) is often conceptualized as a behavioral addiction in which aberrant reward processing may play an important role. The current study sought to develop a self-report instrument--the Skin Picking Reward Scale (SPRS)--that measures how strongly skin picking is 'liked' (i.e., the degree of pleasurable feelings while receiving the reward) and 'wanted' (i.e., the degree of the motivation to seek the reward). We administered the SPRS to individuals who endorsed excessive skin picking in online surveys and examined the scale's factor structure (Studies 1 and 2). We then asked individuals with documented pathological skin picking to complete the SPRS and other relevant questionnaires on two occasions one week apart (Study 3). Exploratory (Study 1; n = 330) and confirmatory (Study 2; n = 144) factor analyses consistently supported a two-factor structure reflecting the 'liking' and 'wanting' constructs. Results from Study 3 (N = 36) indicated that the Wanting and the Liking scales had adequate internal consistency and test-retest reliability. Additionally, consistent with predictions, the Wanting scale, but not the Liking scale, was associated with picking urges the following week, greater cue-reactivity, and more picking-related routines/habits. These initial findings suggest that SPRS is a psychometrically sound measure of 'wanting' and 'liking' in pathological skin picking. The SPRS may facilitate research on reward processing anomalies in SPD and serve as a useful clinical instrument (e.g., to identify those at risk for cue-induced relapse).

  20. Peak resolution by semiderivative voltammetry

    SciTech Connect

    Toman, Jeffrey J.; Brown, Steven D.

    1981-08-01

    One of the limitations of dynamic electrochemistry, when used as a quantitative analytical technique, is the resolution of overlapping waves. Approaches used in the past have been either time intensive methods using many blanks, or have relied on many empirical peak parameters. Using an approach based on semidifferential voltammetry, two new techniques have been developed for rapid peak deconvolution. The first technique, NIFITl, is an iterative stripping routine, while the second, BIMFIT, is based on sequential simplex optimization. Both approaches were characterized by deconvolution of synthetic fused peak systems. Subsequently, both were applied to semi-differentiated linear scan voltammograms of Cd2+, Pb2+ and In3+ and to semi-differentiated linear scan anodic stripping voltammograms of Cd2+, ln3+ and Tl+. Deconvolutions were directly characterized by peak height, peak potential and peak halfwidth, in addition to the total squared deviation of the fit peaks from the real fused peaks. Studies of individual peaks as well as of standard additions to fused peaks showed both methods worked well, with excellent deconvolution efficiencies. Synthetic data were totally deconvoluted with peak separation as small as 25 mv, while real systems were deconvoluted with separations below 40 mv. Peak parameters obtained from these deconvolutions allow observations of electrode processes, even in systems containing overlapping peaks.

  1. A physically-based method for predicting peak discharge of floods caused by failure of natural and constructed earthen dams

    USGS Publications Warehouse

    Walder, J.S.; O'Connor, J. E.; Costa, J.E.; ,

    1997-01-01

    We analyse a simple, physically-based model of breach formation in natural and constructed earthen dams to elucidate the principal factors controlling the flood hydrograph at the breach. Formation of the breach, which is assumed trapezoidal in cross-section, is parameterized by the mean rate of downcutting, k, the value of which is constrained by observations. A dimensionless formulation of the model leads to the prediction that the breach hydrograph depends upon lake shape, the ratio r of breach width to depth, the side slope ?? of the breach, and the parameter ?? = (V.D3)(k/???gD), where V = lake volume, D = lake depth, and g is the acceleration due to gravity. Calculations show that peak discharge Qp depends weakly on lake shape r and ??, but strongly on ??, which is the product of a dimensionless lake volume and a dimensionless erosion rate. Qp(??) takes asymptotically distinct forms depending on whether < ??? 1 or < ??? 1. Theoretical predictions agree well with data from dam failures for which k could be reasonably estimated. The analysis provides a rapid and in many cases graphical way to estimate plausible values of Qp at the breach.We analyze a simple, physically-based model of breach formation in natural and constructed earthen dams to elucidate the principal factors controlling the flood hydrograph at the breach. Formation of the breach, which is assumed trapezoidal in cross-section, is parameterized by the mean rate of downcutting, k, the value of which is constrained by observations. A dimensionless formulation of the model leads to the prediction that the breach hydrograph depends upon lake shape, the ratio r of breach width to depth, the side slope ?? of the breach, and the parameter ?? = (V/D3)(k/???gD), where V = lake volume, D = lake depth, and g is the acceleration due to gravity. Calculations show that peak discharge Qp depends weakly on lake shape r and ??, but strongly on ??, which is the product of a dimensionless lake volume and a

  2. Features that define the best ChIP-seq peak calling algorithms.

    PubMed

    Thomas, Reuben; Thomas, Sean; Holloway, Alisha K; Pollard, Katherine S

    2016-05-11

    Chromatin immunoprecipitation followed by sequencing (ChIP-seq) is an important tool for studying gene regulatory proteins, such as transcription factors and histones. Peak calling is one of the first steps in the analysis of these data. Peak calling consists of two sub-problems: identifying candidate peaks and testing candidate peaks for statistical significance. We surveyed 30 methods and identified 12 features of the two sub-problems that distinguish methods from each other. We picked six methods GEM, MACS2, MUSIC, BCP, Threshold-based method (TM) and ZINBA] that span this feature space and used a combination of 300 simulated ChIP-seq data sets, 3 real data sets and mathematical analyses to identify features of methods that allow some to perform better than the others. We prove that methods that explicitly combine the signals from ChIP and input samples are less powerful than methods that do not. Methods that use windows of different sizes are more powerful than the ones that do not. For statistical testing of candidate peaks, methods that use a Poisson test to rank their candidate peaks are more powerful than those that use a Binomial test. BCP and MACS2 have the best operating characteristics on simulated transcription factor binding data. GEM has the highest fraction of the top 500 peaks containing the binding motif of the immunoprecipitated factor, with 50% of its peaks within 10 base pairs of a motif. BCP and MUSIC perform best on histone data. These findings provide guidance and rationale for selecting the best peak caller for a given application.

  3. Features that define the best ChIP-seq peak calling algorithms

    PubMed Central

    Thomas, Sean; Holloway, Alisha K.; Pollard, Katherine S.

    2017-01-01

    Abstract Chromatin immunoprecipitation followed by sequencing (ChIP-seq) is an important tool for studying gene regulatory proteins, such as transcription factors and histones. Peak calling is one of the first steps in the analysis of these data. Peak calling consists of two sub-problems: identifying candidate peaks and testing candidate peaks for statistical significance. We surveyed 30 methods and identified 12 features of the two sub-problems that distinguish methods from each other. We picked six methods GEM, MACS2, MUSIC, BCP, Threshold-based method (TM) and ZINBA] that span this feature space and used a combination of 300 simulated ChIP-seq data sets, 3 real data sets and mathematical analyses to identify features of methods that allow some to perform better than the others. We prove that methods that explicitly combine the signals from ChIP and input samples are less powerful than methods that do not. Methods that use windows of different sizes are more powerful than the ones that do not. For statistical testing of candidate peaks, methods that use a Poisson test to rank their candidate peaks are more powerful than those that use a Binomial test. BCP and MACS2 have the best operating characteristics on simulated transcription factor binding data. GEM has the highest fraction of the top 500 peaks containing the binding motif of the immunoprecipitated factor, with 50% of its peaks within 10 base pairs of a motif. BCP and MUSIC perform best on histone data. These findings provide guidance and rationale for selecting the best peak caller for a given application. PMID:27169896

  4. Non-parametric linear regression of discrete Fourier transform convoluted chromatographic peak responses under non-ideal conditions of internal standard method.

    PubMed

    Korany, Mohamed A; Maher, Hadir M; Galal, Shereen M; Fahmy, Ossama T; Ragab, Marwa A A

    2010-11-15

    This manuscript discusses the application of chemometrics to the handling of HPLC response data using the internal standard method (ISM). This was performed on a model mixture containing terbutaline sulphate, guaiphenesin, bromhexine HCl, sodium benzoate and propylparaben as an internal standard. Derivative treatment of chromatographic response data of analyte and internal standard was followed by convolution of the resulting derivative curves using 8-points sin x(i) polynomials (discrete Fourier functions). The response of each analyte signal, its corresponding derivative and convoluted derivative data were divided by that of the internal standard to obtain the corresponding ratio data. This was found beneficial in eliminating different types of interferences. It was successfully applied to handle some of the most common chromatographic problems and non-ideal conditions, namely: overlapping chromatographic peaks and very low analyte concentrations. For example, a significant change in the correlation coefficient of sodium benzoate, in case of overlapping peaks, went from 0.9975 to 0.9998 on applying normal conventional peak area and first derivative under Fourier functions methods, respectively. Also a significant improvement in the precision and accuracy for the determination of synthetic mixtures and dosage forms in non-ideal cases was achieved. For example, in the case of overlapping peaks guaiphenesin mean recovery% and RSD% went from 91.57, 9.83 to 100.04, 0.78 on applying normal conventional peak area and first derivative under Fourier functions methods, respectively. This work also compares the application of Theil's method, a non-parametric regression method, in handling the response ratio data, with the least squares parametric regression method, which is considered the de facto standard method used for regression. Theil's method was found to be superior to the method of least squares as it assumes that errors could occur in both x- and y-directions and

  5. Quantitative Metabolome Analysis Based on Chromatographic Peak Reconstruction in Chemical Isotope Labeling Liquid Chromatography Mass Spectrometry.

    PubMed

    Huan, Tao; Li, Liang

    2015-07-21

    Generating precise and accurate quantitative information on metabolomic changes in comparative samples is important for metabolomics research where technical variations in the metabolomic data should be minimized in order to reveal biological changes. We report a method and software program, IsoMS-Quant, for extracting quantitative information from a metabolomic data set generated by chemical isotope labeling (CIL) liquid chromatography mass spectrometry (LC-MS). Unlike previous work of relying on mass spectral peak ratio of the highest intensity peak pair to measure relative quantity difference of a differentially labeled metabolite, this new program reconstructs the chromatographic peaks of the light- and heavy-labeled metabolite pair and then calculates the ratio of their peak areas to represent the relative concentration difference in two comparative samples. Using chromatographic peaks to perform relative quantification is shown to be more precise and accurate. IsoMS-Quant is integrated with IsoMS for picking peak pairs and Zero-fill for retrieving missing peak pairs in the initial peak pairs table generated by IsoMS to form a complete tool for processing CIL LC-MS data. This program can be freely downloaded from the www.MyCompoundID.org web site for noncommercial use.

  6. Ovine luteinizing hormone. V. Significance of flow-through peaks observed during chromatofocusing as revealed by various methods of sample preparation and application.

    PubMed

    Grotjan, H E; Schanbacher, B D; Keel, B A

    1991-07-19

    In a previous study [Keel et al., Biol, Reprod., 36 (1987) 1102] the ovine luteinizing hormone (oLH) in pituitary extracts was chromatofocused on pH 10.5-7 gradients after equilibration in 25 mM triethylamine-HCl, pH 11.0, by gel permeation. Under these conditions, some immunoreactive oLH flowed through the columns unrestricted and this was interpreted to represent extremely basic isoforms. However, when selected flow-through peaks were re-chromatofocused, each was contaminated with other isoforms of oLH. In order to clarify this dilemma, various methods of sample preparation and application were systematically compared. Consistent with previous observations, variable amounts of the immunoreactive oLH in pituitary extracts equilibrated in triethylamine by gel permeation, dialysis, flow dialysis or ion-retardation chromatography eluted as flow-through peaks when chromatofocused. In contrast, when the ionic components in the pituitary homogenization buffer were removed by these methods as well as ultrafiltration and the proteins were applied to the resin in the elution buffer (1:45 Pharmalyte 8-10.5-HCl, pH 7.0), none of the immunoreactive oLH in pituitary extracts eluted as a flow-through peak. Thus, it appears that oLH eluting as a flow-through peak results from incomplete binding of the hormone to the chromatofocusing resin when applied in triethylamine.

  7. A physically-based method for predicting peak discharge of floods caused by failure of natural and constructed earthen dams

    USGS Publications Warehouse

    Walder, J.S.

    1997-01-01

    We analyse a simple, physically-based model of breach formation in natural and constructed earthen dams to elucidate the principal factors controlling the flood hydrograph at the breach. Formation of the breach, which is assumed trapezoidal in cross-section, is parameterized by the mean rate of downcutting, k, the value of which is constrained by observations. A dimensionless formulation of the model leads to the prediction that the breach hydrograph depends upon lake shape, the ratio r of breach width to depth, the side slope ?? of the breach, and the parameter ?? = (V/ D3)(k/???gD), where V = lake volume, D = lake depth, and g is the acceleration due to gravity. Calculations show that peak discharge Qp depends weakly on lake shape r and ??, but strongly on ??, which is the product of a dimensionless lake volume and a dimensionless erosion rate. Qp(??) takes asymptotically distinct forms depending on whether ?? > 1. Theoretical predictions agree well with data from dam failures for which k could be reasonably estimated. The analysis provides a rapid and in many cases graphical way to estimate plausible values of Qp at the breach.

  8. Promoting physical therapists’ use of research evidence to inform clinical practice: part 2 - a mixed methods evaluation of the PEAK program

    PubMed Central

    2014-01-01

    Background Clinicians need innovative educational programs to enhance their capacity for using research evidence to inform clinical decision-making. This paper and its companion paper introduce the Physical therapist-driven Education for Actionable Knowledge translation (PEAK) program, an educational program designed to promote physical therapists’ integration of research evidence into clinical decision-making. This, second of two, papers reports a mixed methods feasibility study of the PEAK program among physical therapists at three university-based clinical facilities. Methods A convenience sample of 18 physical therapists participated in the six-month educational program. Mixed methods were used to triangulate results from pre-post quantitative data analyzed concurrently with qualitative data from semi-structured interviews and focus groups. Feasibility of the program was assessed by evaluating change in participants’ attitudes, self-efficacy, knowledge, skills, and self-reported behaviors in addition to their perceptions and reaction to the program. Results All 18 therapists completed the program. The group experienced statistically significant improvements in evidence based practice self-efficacy and self-reported behavior (p < 0.001). Four themes were supported by integrated quantitative and qualitative results: 1. The collaborative nature of the PEAK program was engaging and motivating; 2. PEAK participants experienced improved self-efficacy, creating a positive cycle where success reinforces engagement with research evidence; 3. Participants’ need to understand how to interpret statistics was not fully met; 4. Participants believed that the utilization of research evidence in their clinical practice would lead to better patient outcomes. Conclusions The PEAK program is a feasible educational program for promoting physical therapists’ use of research evidence in practice. A key ingredient seems to be guided small group work leading to a final

  9. From benchmarking HITS-CLIP peak detection programs to a new method for identification of miRNA-binding sites from Ago2-CLIP data

    PubMed Central

    Bottini, Silvia; Hamouda-Tekaya, Nedra; Tanasa, Bogdan; Zaragosi, Laure-Emmanuelle; Grandjean, Valerie; Repetto, Emanuela

    2017-01-01

    Abstract Experimental evidence indicates that about 60% of miRNA-binding activity does not follow the canonical rule about the seed matching between miRNA and target mRNAs, but rather a non-canonical miRNA targeting activity outside the seed or with a seed-like motifs. Here, we propose a new unbiased method to identify canonical and non-canonical miRNA-binding sites from peaks identified by Ago2 Cross-Linked ImmunoPrecipitation associated to high-throughput sequencing (CLIP-seq). Since the quality of peaks is of pivotal importance for the final output of the proposed method, we provide a comprehensive benchmarking of four peak detection programs, namely CIMS, PIPE-CLIP, Piranha and Pyicoclip, on four publicly available Ago2-HITS-CLIP datasets and one unpublished in-house Ago2-dataset in stem cells. We measured the sensitivity, the specificity and the position accuracy toward miRNA binding sites identification, and the agreement with TargetScan. Secondly, we developed a new pipeline, called miRBShunter, to identify canonical and non-canonical miRNA-binding sites based on de novo motif identification from Ago2 peaks and prediction of miRNA::RNA heteroduplexes. miRBShunter was tested and experimentally validated on the in-house Ago2-dataset and on an Ago2-PAR-CLIP dataset in human stem cells. Overall, we provide guidelines to choose a suitable peak detection program and a new method for miRNA-target identification. PMID:28108660

  10. Extraction of full absorption peaks in airborne gamma-spectrometry by filtering techniques coupled with a study of the derivatives. Comparison with the window method.

    PubMed

    Guillot, L

    2001-01-01

    In this paper, an adaptation of a spectral profile analysis method, currently used in high-resolution spectrometry, to airborne gamma measurements is presented. A new algorithm has been developed for extraction of full absorption peaks by studying the variations in the spectral profile of data recorded with large-volume NaI detectors (16 l) with a short sampling time (2 s). The use of digital filters, taking into consideration the characteristics of the absorption peaks, significantly reduced the counting fluctuations, making detection possible based on study of the first and second derivatives. The absorption peaks are then obtained by modelling, followed by subtraction of the Compton continuum in the detection window. Compared to the conventional stripping ratio method, spectral profile analysis offers similar performance for the natural radioelements. The 137Cs 1SD detection limit is approximately 1200 Bq/m2 in a natural background of 200 Bq/kg 40K, 33 Bq/kg 238U and 33 Bq/kg 232Th. At low energy the very high continuum leads to detection limits similar to those obtained by the windows method, but the results obtained are more reliable. In the presence of peak overlaps, however, analysis of the spectral profile alone is not sufficient to separate the peaks, and further processing is necessary. Within the framework of environmental monitoring studies, spectral profile analysis is of great interest because it does not require any assumptions about the nature of the nuclides. The calculation of the concentrations from the results obtained is simple and reliable, since only the full absorption contributions are taken into consideration. A quantitative estimate of radioactive anomalies can thus be obtained rapidly.

  11. 7 CFR 51.1315 - Carefully hand-picked.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Carefully hand-picked. 51.1315 Section 51.1315... STANDARDS) United States Standards for Winter Pears 1 Definitions § 51.1315 Carefully hand-picked. Carefully hand-picked means that the pears do not show evidence of rough handling or of having been on the ground....

  12. 7 CFR 51.1274 - Carefully hand-picked.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Carefully hand-picked. 51.1274 Section 51.1274... STANDARDS) United States Standards for Summer and Fall Pears 1 Definitions § 51.1274 Carefully hand-picked. Carefully hand-picked means that the pears do not show evidence of rough handling or of having been on...

  13. 7 CFR 51.1315 - Carefully hand-picked.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Carefully hand-picked. 51.1315 Section 51.1315 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards... Carefully hand-picked. Carefully hand-picked means that the pears do not show evidence of rough handling or...

  14. 7 CFR 51.1315 - Carefully hand-picked.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Carefully hand-picked. 51.1315 Section 51.1315... STANDARDS) United States Standards for Winter Pears 1 Definitions § 51.1315 Carefully hand-picked. Carefully hand-picked means that the pears do not show evidence of rough handling or of having been on the ground. ...

  15. 7 CFR 51.1274 - Carefully hand-picked.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Carefully hand-picked. 51.1274 Section 51.1274 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards... § 51.1274 Carefully hand-picked. Carefully hand-picked means that the pears do not show evidence of...

  16. 7 CFR 51.1274 - Carefully hand-picked.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Carefully hand-picked. 51.1274 Section 51.1274... STANDARDS) United States Standards for Summer and Fall Pears 1 Definitions § 51.1274 Carefully hand-picked. Carefully hand-picked means that the pears do not show evidence of rough handling or of having been on the...

  17. 7 CFR 51.1315 - Carefully hand-picked.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Carefully hand-picked. 51.1315 Section 51.1315... STANDARDS) United States Standards for Winter Pears 1 Definitions § 51.1315 Carefully hand-picked. Carefully hand-picked means that the pears do not show evidence of rough handling or of having been on the ground. ...

  18. 7 CFR 51.1274 - Carefully hand-picked.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Carefully hand-picked. 51.1274 Section 51.1274... STANDARDS) United States Standards for Summer and Fall Pears 1 Definitions § 51.1274 Carefully hand-picked. Carefully hand-picked means that the pears do not show evidence of rough handling or of having been on the...

  19. 7 CFR 51.1274 - Carefully hand-picked.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Carefully hand-picked. 51.1274 Section 51.1274 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards... § 51.1274 Carefully hand-picked. Carefully hand-picked means that the pears do not show evidence of...

  20. 7 CFR 51.1315 - Carefully hand-picked.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Carefully hand-picked. 51.1315 Section 51.1315 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards... Carefully hand-picked. Carefully hand-picked means that the pears do not show evidence of rough handling or...

  1. Obstructive pressure peak: a new method for differentiation of obstructive and central apneas under auto-CPAP therapy.

    PubMed

    Ruhle, K H; Domanski, U; Nilius, G

    2013-03-01

    Auto-CPAP devices (APAP) are controlled, e.g.,by the respiratory flow and pressure to adjust the treatment pressure to the variable obstruction in sleep apnea syndromes.By obstruction of the upper airway during inspiration,a pressure difference between the lower airways and the mask can be measured. In case of an opening of the pharynx at the end of the obstruction, the pressure decreases immediately. This brief negative pressure, the so-called obstructive pressure peak (OPP) can be used to identify obstruction or open airways with the algorithm of an APAP device. Useless pressure increases, e.g., after central apneas without obstruction may be avoided. We therefore investigated the association of the OPP signal with respiratory events during APAP therapy. In this pilot study, 13 patients with obstructive sleep apnea syndrome were evaluated. Attended automatic CPAP titration (SOMNO balance, Fa Weinmann Hamburg/Germany)was performed. The OPP signal was recorded synchronous lyin parallel with the polysomnographic data. If the OPP signal was within a time range of ± 5 s of the resumption of normal breathing, it was assigned to the event. A total of 480 sleep-related breathing disorders events were studied. The most common were the mixed apneas associated with more than 90% of all cases with an OPP signal, followed by obstructive sleep apneas (66.7%)and central apneas (38%). The difference in OPP frequency distribution between central apneas and obstructive apneas was significant with p<0.001. The analysis of the pressure characteristics of APAP treatment with the registration of OPP allows a further differentiation in obstructed and not obstructed upper airways.

  2. Plant metabolomics: resolution and quantification of elusive peaks in liquid chromatography-mass spectrometry profiles of complex plant extracts using multi-way decomposition methods.

    PubMed

    Khakimov, Bekzod; Amigo, José Manuel; Bak, Søren; Engelsen, Søren Balling

    2012-11-30

    Previous studies on LC-MS metabolomic profiling of 127 F2 Barbarea vulgaris plants derived from a cross of parental glabrous (G) and pubescent (P) type, revealed four triterpenoid saponins (hederagenin cellobioside, oleanolic acid cellobioside, epihederagenin cellobioside, and gypsogenin cellobioside) that correlated with resistance of plants against the insect herbivore, Phyllotreta nemorum. In this study, for the first time, we demonstrate the efficiency of the multi-way decomposition method PARAllel FACtor analysis 2 (PARAFAC2) for exploring complex LC-MS data. PARAFAC2 enabled automated resolution and quantification of several elusive chromatographic peaks (e.g. overlapped, elution time shifted and low s/n ratio), which could not be detected and quantified by conventional chromatographic data analysis. Raw LC-MS data of 127 F2 B. vulgaris plants were arranged in a three-way array (elution time point×mass spectra×samples), divided into 17 different chromatographic intervals and each interval were individually modeled by PARAFAC2. Three main outputs of the PARAFAC2 models described: (1) elution time profile, (2) relative abundance, and (3) pure mass spectra of the resolved peaks modeled from each interval of the chromatographic data. PARAFAC2 scores corresponding to relative abundances of the resolved peaks were extracted and further used for correlation and partial least squares (PLS) analysis. A total of 71 PARAFAC2 components (which correspond to actual peaks, baselines and tails of neighboring peaks) were modeled from 17 different chromatographic retention time intervals of the LC-MS data. In addition to four previously known saponins, correlation- and PLS-analysis resolved five unknown saponin-like compounds that were significantly correlated with insect resistance. The method also enabled a good separation between resistant and susceptible F2 plants. PARAFAC2 spectral loadings corresponding to the pure mass spectra of chromatographic peaks matched well

  3. Development of sensitized pick coal interface detector system

    NASA Technical Reports Server (NTRS)

    Burchill, R. F.

    1979-01-01

    One approach for detection of the coal interface is measurement of the pick cutting hoads and shock through the use of pick strain gage load cells and accelerometers. The cutting drum of a long wall mining machine contains a number of cutting picks. In order to measure pick loads and shocks, one pick was instrumented and telementry used to transmit the signals from the drum to an instrument-type tape recorder. A data system using FM telemetry was designed to transfer cutting bit load and shock information from the drum of a longwall shearer coal mining machine to a chassis mounted data recorder.

  4. Searching for Dual AGNs in Galaxy Mergers: Understanding Double-Peaked [O III] and Ultra Hard X-rays as Selection Method

    NASA Astrophysics Data System (ADS)

    McGurk, Rosalie C.; Max, Claire E.; Medling, Anne; Shields, Gregory A.

    2015-01-01

    When galaxies merge, gas accretes onto both central supermassive black holes. Thus, one expects to see close pairs of active galactic nuclei (AGNs), or dual AGNs, in a fraction of galaxy mergers. However, finding them remains a challenge. The presence of double-peaked [O III] or of ultra hard X-rays have been proposed as techniques to select dual AGNs efficiently. We studied a sample of double-peaked narrow [O III] emitting AGNs from SDSS DR7. By obtaining new and archival high spatial resolution images taken with the Keck 2 Laser Guide Star Adaptive Optics system and the near-infrared (IR) camera NIRC2, we showed that 30% of double-peaked [O III] emission line SDSS AGNs have two spatial components within a 3' radius. However, spatially resolved spectroscopy or X-ray observations are needed to confirm these galaxy pairs as systems containing two AGNs. We followed up these spatially-double candidate dual AGNs with integral field spectroscopy from Keck OSIRIS and Gemini GMOS and with long-slit spectroscopy from Keck NIRSPEC and Shane Kast Double Spectrograph. We find double-peaked emitters are caused sometimes by dual AGN and sometimes by outflows or narrow line kinematics. We also performed Chandra X-ray ACIS-S observations on 12 double-peaked candidate dual AGNs. Using our observations and 8 archival observations, we compare the distribution of X-ray photons to our spatially double near-IR images, measure X-ray luminosities and hardness ratios, and estimate column densities. By assessing what fraction of double-peaked emission line SDSS AGNs are true dual AGNs, we can better determine whether double-peaked [O III] is an efficient dual AGN indicator and constrain the statistics of dual AGNs. A second technique to find dual AGN is the detection of ultra hard X-rays by the Swift Burst Alert Telescope. We use CARMA observations to measure and map the CO(1-0) present in nearby ultra-hard X-ray Active Galactic Nuclei (AGNs) merging with either a quiescent companion

  5. Refinement of arrival-time picks using a cross-correlation based workflow

    NASA Astrophysics Data System (ADS)

    Akram, Jubran; Eaton, David W.

    2016-12-01

    We propose a new iterative workflow based on cross-correlation for improved arrival-time picking on microseismic data. In this workflow, signal-to-noise ratio (S/N) and polarity weighted stacking are used to minimize the effect of S/N and polarity fluctuations on the pilot waveform computation. We use an exhaustive search technique for polarity estimation through stack power maximization. We use pseudo-synthetic and real microseismic data from western Canada in order to demonstrate the effectiveness of proposed workflow relative to Akaike information criterion (AIC) and a previously published cross-correlation based method. The pseudo-synthetic microseismic waveforms are obtained by introducing Gaussian noise and polarity fluctuations into waveforms from a high S/N microseismic event. We find that the cross-correlation based approaches yield more accurate arrival-time picks as compared to AIC for low S/N waveforms. AIC is not affected by waveform polarities as it works on individual receiver levels whereas the accuracy of existing cross-correlation method decreases in spite of using envelope correlation. We show that our proposed workflow yields better and consistent arrival-time picks regardless of waveform amplitude and polarity variations within the receiver array. After refinement, the initial arrival-time picks are located closer to the best estimated manual picks.

  6. Stochastic shock response spectrum decomposition method based on probabilistic definitions of temporal peak acceleration, spectral energy, and phase lag distributions of mechanical impact pyrotechnic shock test data

    NASA Astrophysics Data System (ADS)

    Hwang, James Ho-Jin; Duran, Adam

    2016-08-01

    Most of the times pyrotechnic shock design and test requirements for space systems are provided in Shock Response Spectrum (SRS) without the input time history. Since the SRS does not describe the input or the environment, a decomposition method is used to obtain the source time history. The main objective of this paper is to develop a decomposition method producing input time histories that can satisfy the SRS requirement based on the pyrotechnic shock test data measured from a mechanical impact test apparatus. At the heart of this decomposition method is the statistical representation of the pyrotechnic shock test data measured from the MIT Lincoln Laboratory (LL) designed Universal Pyrotechnic Shock Simulator (UPSS). Each pyrotechnic shock test data measured at the interface of a test unit has been analyzed to produce the temporal peak acceleration, Root Mean Square (RMS) acceleration, and the phase lag at each band center frequency. Maximum SRS of each filtered time history has been calculated to produce a relationship between the input and the response. Two new definitions are proposed as a result. The Peak Ratio (PR) is defined as the ratio between the maximum SRS and the temporal peak acceleration at each band center frequency. The ratio between the maximum SRS and the RMS acceleration is defined as the Energy Ratio (ER) at each band center frequency. Phase lag is estimated based on the time delay between the temporal peak acceleration at each band center frequency and the peak acceleration at the lowest band center frequency. This stochastic process has been applied to more than one hundred pyrotechnic shock test data to produce probabilistic definitions of the PR, ER, and the phase lag. The SRS is decomposed at each band center frequency using damped sinusoids with the PR and the decays obtained by matching the ER of the damped sinusoids to the ER of the test data. The final step in this stochastic SRS decomposition process is the Monte Carlo (MC

  7. Peak-Finding Algorithms.

    PubMed

    Hung, Jui-Hung; Weng, Zhiping

    2017-03-01

    Microarray and next-generation sequencing technologies have greatly expedited the discovery of genomic DNA that can be enriched using various biochemical methods. Chromatin immunoprecipitation (ChIP) is a general method for enriching chromatin fragments that are specifically recognized by an antibody. The resulting DNA fragments can be assayed by microarray (ChIP-chip) or sequencing (ChIP-seq). This introduction focuses on ChIP-seq data analysis. The first step of analyzing ChIP-seq data is identifying regions in the genome that are enriched in a ChIP sample; these regions are called peaks.

  8. The Impact of Visual Guided Order Picking on Ocular Comfort, Ocular Surface and Tear Function

    PubMed Central

    Klein-Theyer, Angelika; Horwath-Winter, Jutta; Rabensteiner, Dieter Franz; Schwantzer, Gerold; Wultsch, Georg; Aminfar, Haleh; Heidinger, Andrea; Boldin, Ingrid

    2016-01-01

    Purpose We investigated the effects of a visual picking system on ocular comfort, the ocular surface and tear function compared to those of a voice guided picking solution. Design Prospective, observational, cohort study. Method Setting: Institutional. Study Population: A total of 25 young asymptomatic volunteers performed commissioning over 10 hours on two consecutive days. Main Outcome Measures: The operators were guided in the picking process by two different picking solutions, either visually or by voice while their subjective symptoms and ocular surface and tear function parameters were recorded. Results The visual analogue scale (VAS) values, according to subjective dry eye symptoms, in the visual condition were significantly higher at the end of the commissioning than the baseline measurements. In the voice condition, the VAS values remained stable during the commissioning. The tear break-up time (BUT) values declined significantly in the visual condition (pre-task: 16.6 sec and post-task: 9.6 sec) in the right eyes, that were exposed to the displays, the left eyes in the visual condition showed only a minor decline, whereas the BUT values in the voice condition remained constant (right eyes) or even increased (left eyes) over the time. No significant differences in the tear meniscus height values before and after the commissioning were observed in either condition. Conclusion In our study, the use of visually guided picking solutions was correlated with post-task subjective symptoms and tear film instability. PMID:27314855

  9. Quantitative laser-induced breakdown spectroscopy data using peak area step-wise regression analysis: an alternative method for interpretation of Mars science laboratory results

    SciTech Connect

    Clegg, Samuel M; Barefield, James E; Wiens, Roger C; Dyar, Melinda D; Schafer, Martha W; Tucker, Jonathan M

    2008-01-01

    The ChemCam instrument on the Mars Science Laboratory (MSL) will include a laser-induced breakdown spectrometer (LIBS) to quantify major and minor elemental compositions. The traditional analytical chemistry approach to calibration curves for these data regresses a single diagnostic peak area against concentration for each element. This approach contrasts with a new multivariate method in which elemental concentrations are predicted by step-wise multiple regression analysis based on areas of a specific set of diagnostic peaks for each element. The method is tested on LIBS data from igneous and metamorphosed rocks. Between 4 and 13 partial regression coefficients are needed to describe each elemental abundance accurately (i.e., with a regression line of R{sup 2} > 0.9995 for the relationship between predicted and measured elemental concentration) for all major and minor elements studied. Validation plots suggest that the method is limited at present by the small data set, and will work best for prediction of concentration when a wide variety of compositions and rock types has been analyzed.

  10. Cold pressor pain in skin picking disorder

    PubMed Central

    Grant, Jon E.; Redden, Sarah A.; Chamberlain, Samuel R.

    2017-01-01

    Excoriation (skin-picking) disorder (SPD) is a disabling, under-recognized condition in which individuals repeatedly pick at their skin, leading to noticeable tissue damage. There has been no examination as to whether individuals with SPD have different pain thresholds or pain tolerances compared to healthy counterparts. Adults with SPD were examined on a variety of clinical measures including symptom severity and functioning. All participants underwent the cold pressor test. Heart rate, blood pressure, and self-reported pain were compared between SPD participants (n=14) and healthy controls (n=14). Adults with SPD demonstrated significantly dampened autonomic response to cold pressor pain as exhibited by reduced heart rate compared to controls (group x time interaction using repeated ANOVA F=3.258, p<0.001). There were no significant differences between the groups in terms of overall pain tolerance (measured in seconds), recovery time, or blood pressure. SPD symptom severity was not significantly associated with autonomic response in the patients. In this study, adults with SPD exhibited a dampened autonomic response to pain while reporting pain intensity similar to that reported by the controls. The lack of an autonomic response may explain why the SPD participants continue a behavior that they cognitively find painful and may offer options for future interventions. PMID:28063396

  11. Brushes and picks used on nails during the surgical scrub to reduce bacteria: a randomised trial.

    PubMed

    Tanner, J; Khan, D; Walsh, S; Chernova, J; Lamont, S; Laurent, T

    2009-03-01

    Though brushes are no longer used on the hands and forearms during the surgical scrub, they are still widely used on the nails. The aim of this study was to determine whether nail picks and nail brushes are effective in providing additional decontamination during a surgical hand scrub. A total of 164 operating department staff were randomised to undertake one of the following three surgical hand-scrub protocols: chlorhexidine only; chlorhexidine and a nail pick; or chlorhexidine and a nail brush. Bacterial hand sampling was conducted before and 1h after scrubbing using a modified version of the glove juice method. No statistically significant differences in bacterial numbers were found between any two of the three intervention groups. Nail brushes and nail picks used during surgical hand scrubs do not decrease bacterial numbers and are unnecessary.

  12. A case of combined Pick's disease and Alzheimer's disease.

    PubMed Central

    Smith, D A; Lantos, P L

    1983-01-01

    The diagnosis of combined Pick's and Alzheimer's disease is rare, and over the years different authors have used different criteria to arrive at such a diagnosis. A case is reported of presenile dementia in which the histological changes of Pick's disease and Alzheimer's disease were mingled. The brain showed no focal atrophy, but the Pick changes were most numerous in the hippocampus and in the temporal lobe. An antibody against the 155 kilodalton component of neurofilaments demonstrated not only neurofibrillary tangles and components of senile plaques, but also Pick's inclusions. Images PMID:6310050

  13. Coal/rock interface detection by sensitized pick, part A

    NASA Technical Reports Server (NTRS)

    Wu, P. T. K.; Erkes, J. W.

    1981-01-01

    In order to increase the operating margins of the detector for safe, reliable operation under difficult in-mine conditions the transmitted signal strength was increased to provide additional signal margin for in-mine conditions and the transmitter section was redesigned to reduce frequency pulling of the transmitter frequency with variations in antenna load. The linearity of the pick load SCO signal with true pick load was increased, and hysteresis effects were minimized. The sensitized pick hardware was ruggedized for rough inmine use. The sensitized pick and telemetry system provided excellent, high quality signals proportional to cutting load under all conditions experienced during testing.

  14. Peak Oil, Peak Coal and Climate Change

    NASA Astrophysics Data System (ADS)

    Murray, J. W.

    2009-05-01

    Research on future climate change is driven by the family of scenarios developed for the IPCC assessment reports. These scenarios create projections of future energy demand using different story lines consisting of government policies, population projections, and economic models. None of these scenarios consider resources to be limiting. In many of these scenarios oil production is still increasing to 2100. Resource limitation (in a geological sense) is a real possibility that needs more serious consideration. The concept of 'Peak Oil' has been discussed since M. King Hubbert proposed in 1956 that US oil production would peak in 1970. His prediction was accurate. This concept is about production rate not reserves. For many oil producing countries (and all OPEC countries) reserves are closely guarded state secrets and appear to be overstated. Claims that the reserves are 'proven' cannot be independently verified. Hubbert's Linearization Model can be used to predict when half the ultimate oil will be produced and what the ultimate total cumulative production (Qt) will be. US oil production can be used as an example. This conceptual model shows that 90% of the ultimate US oil production (Qt = 225 billion barrels) will have occurred by 2011. This approach can then be used to suggest that total global production will be about 2200 billion barrels and that the half way point will be reached by about 2010. This amount is about 5 to 7 times less than assumed by the IPCC scenarios. The decline of Non-OPEC oil production appears to have started in 2004. Of the OPEC countries, only Saudi Arabia may have spare capacity, but even that is uncertain, because of lack of data transparency. The concept of 'Peak Coal' is more controversial, but even the US National Academy Report in 2007 concluded only a small fraction of previously estimated reserves in the US are actually minable reserves and that US reserves should be reassessed using modern methods. British coal production can be

  15. Comparative study of some robust statistical methods: weighted, parametric, and nonparametric linear regression of HPLC convoluted peak responses using internal standard method in drug bioavailability studies.

    PubMed

    Korany, Mohamed A; Maher, Hadir M; Galal, Shereen M; Ragab, Marwa A A

    2013-05-01

    This manuscript discusses the application and the comparison between three statistical regression methods for handling data: parametric, nonparametric, and weighted regression (WR). These data were obtained from different chemometric methods applied to the high-performance liquid chromatography response data using the internal standard method. This was performed on a model drug Acyclovir which was analyzed in human plasma with the use of ganciclovir as internal standard. In vivo study was also performed. Derivative treatment of chromatographic response ratio data was followed by convolution of the resulting derivative curves using 8-points sin x i polynomials (discrete Fourier functions). This work studies and also compares the application of WR method and Theil's method, a nonparametric regression (NPR) method with the least squares parametric regression (LSPR) method, which is considered the de facto standard method used for regression. When the assumption of homoscedasticity is not met for analytical data, a simple and effective way to counteract the great influence of the high concentrations on the fitted regression line is to use WR method. WR was found to be superior to the method of LSPR as the former assumes that the y-direction error in the calibration curve will increase as x increases. Theil's NPR method was also found to be superior to the method of LSPR as the former assumes that errors could occur in both x- and y-directions and that might not be normally distributed. Most of the results showed a significant improvement in the precision and accuracy on applying WR and NPR methods relative to LSPR.

  16. First arrival time picking for microseismic data based on shearlet transform

    NASA Astrophysics Data System (ADS)

    Cheng, Yao; Li, Yue; Zhang, Chao

    2017-03-01

    Automatic identification and first arrival time picking of microseismic data play an important role in microseismic monitoring technology, and it is the precondition for real-time microseismic hypocenter location. This paper presents a novel first arrival time picking method based on shearlet transform (ST), which aims to get satisfactory results in low signal-to-noise ratio data. The ST is used to decompose noisy microseismic data. By the coefficient differences between the signal and noise at fine scales, the signal points can be preliminarily selected from the noise. To further improve the accuracy of the signal recognition, a correction to the selected signal points is made by utilizing the scale correlation between adjacent scales. The realization of the correction depends on the distances between the signal points at one scale and those at its adjacent scale. After the correction, the moment of the first identified signal point is the first arrival time. This proposed method can produce a superior performance in the accuracy of the first arrival time picking, compared with the other methods, as demonstrated using synthetic and field microseismic data. The actual picking performance of the method is further verified by receiver operating characteristic curves.

  17. Automated on-line column-switching HPLC-MS/MS method with peak focusing for the determination of nine environmental phenols in urine.

    PubMed

    Ye, Xiaoyun; Kuklenyik, Zsuzsanna; Needham, Larry L; Calafat, Antonia M

    2005-08-15

    We developed a method using isotope dilution on-line solid-phase extraction (SPE) coupled to high-performance liquid chromatography-tandem mass spectrometry (HPLC-MS/MS) for the determination in urine of nine environmental phenolic compounds: Bisphenol A; 4-tert-octylphenol; o-phenylphenol; 2,4-dichlorophenol; 2,5-dichlorophenol; 2,4,5-trichlorophenol; 2,4,6-trichlorophenol; benzophenone-3 (2-hydroxy-4-metoxybenzophenone); and triclosan (2,4,4'-trichloro-2'-hydroxyphenyl ether). A unique fully automated column-switching system, constructed using 1 autosampler, 2 HPLC pumps, and a 10-port switching valve, was designed to allow for concurrent SPE-HPLC operation with peak focusing. The phenols present in 100 microL of urine were retained and concentrated on a C18 reversed-phase size-exclusion SPE column. Then, the phenols were "back-eluted" from the SPE column and diluted through a mixing Tee before being separated from other urine matrix components using a pair of monolithic HPLC columns. The phenols were detected by negative ion-atmospheric pressure chemical ionization-MS/MS. The efficient preconcentration of the phenols by the SPE column, analyte peak focusing by the dilution, and minimal ion suppression in the LC/MS interface by the buffer-free mobile phases resulted in limits of detection as low as 0.1-0.4 ng/mL for most analytes. The method was validated on spiked pooled urine samples and on urine samples from 30 adults with no known occupational exposure to environmental phenols. The method can be used for quick and accurate analysis of large numbers of samples in epidemiologic studies for assessing the prevalence of human exposure to environmental phenols.

  18. JWST NIRCam pick-off mirror grounding

    NASA Astrophysics Data System (ADS)

    Demroff, Howard; Mammini, Paul V.; Jacoby, Mike S.; Jones, Brian; Hu, Sidney; Dammann, Ron; Mathieson, James

    2013-09-01

    The optics train of the Near Infrared Camera (NIRCam) instrument for NASA's James Webb Space Telescope (JWST) includes a pick-off mirror (POM) mounted in the focus and alignment mechanism (FAM). Over the course of the mission, the POM will have a narrow view of the L2 space environment. Charged particles will impinge and collect on the mirror surface increasing the possibility of arcing to the adjacent baffle. A technique to ground the POM and remove accumulated charge has been qualified and implemented on the flight instrument. This paper will provide an overview of the qualification process including cryogenic resistance measurements, vibration testing and optical surface error measurements. To measure the efficiency of this grounding technique, a POM engineering model was exposed to representative mission electron fluence and results with the POM grounded and ungrounded will be presented.

  19. Niemann-Pick type B in adulthood

    PubMed Central

    Simões, Rita Gonçalves; Maia, Helena

    2015-01-01

    Niemann-Pick disease (NPD) is a rare group of autosomal recessive disorders associated with intracellular deposition of sphingomyelin. NPD type B is a milder form, generally later in onset, with a good prognosis for survival into adulthood and usually with no neurological abnormalities. The authors describe the case of a 52-year-old man who presented with unexplained pancytopenia and splenomegaly. He was admitted to emergency splenectomy due to pathological splenic rupture. The histological findings showed diffuse histiocytosis, suggesting lysosomal storage disease. The NPD was confirmed when residual activity of acid sphingomyelinase in peripheral blood leucocytes and cultured skin fibroblasts was detected. Besides lipid abnormalities, the patient also had lipid interstitial pneumonia. There is no treatment for NPD. Management is based on surveillance and supportive care. The patient has reached the sixth decade of life with no symptoms and, despite the pneumonia and splenectomy, he still has a fairly healthy life. PMID:25657196

  20. PeakWorks

    SciTech Connect

    2016-11-30

    The PeakWorks software is designed to assist in the quantitative analysis of atom probe tomography (APT) generated mass spectra. Specifically, through an interactive user interface, mass peaks can be identified automatically (defined by a threshold) and/or identified manually. The software then provides a means to assign specific elemental isotopes (including more than one) to each peak. The software also provides a means for the user to choose background subtraction of each peak based on background fitting functions, the choice of which is left to the users discretion. Peak ranging (the mass range over which peaks are integrated) is also automated allowing the user to chose a quantitative range (e.g. full-widthhalf- maximum). The software then integrates all identified peaks, providing a background-subtracted composition, which also includes the deconvolution of peaks (i.e. those peaks that happen to have overlapping isotopic masses). The software is also able to output a 'range file' that can be used in other software packages, such as within IVAS. A range file lists the peak identities, the mass range of each identified peak, and a color code for the peak. The software is also able to generate 'dummy' peak ranges within an outputted range file that can be used within IVAS to provide a means for background subtracted proximity histogram analysis.

  1. Skin Picking in Turkish Students: Prevalence, Characteristics, and Gender Differences

    ERIC Educational Resources Information Center

    Calikusu, Celal; Kucukgoncu, Suat; Tecer, Ozlem; Bestepe, Emrem

    2012-01-01

    The aim of this study is to investigate the prevalence, characteristics, triggers, and consequences of skin picking (SP) in a sample of Turkish university students, with an emphasis on gender differences. A total of 245 students from two universities in Turkey were assessed by using the Skin Picking Inventory. In total, 87.8% of the students…

  2. Skin Picking in Turkish Students: Prevalence, Characteristics, and Gender Differences

    ERIC Educational Resources Information Center

    Calikusu, Celal; Kucukgoncu, Suat; Tecer, Ozlem; Bestepe, Emrem

    2012-01-01

    The aim of this study is to investigate the prevalence, characteristics, triggers, and consequences of skin picking (SP) in a sample of Turkish university students, with an emphasis on gender differences. A total of 245 students from two universities in Turkey were assessed by using the Skin Picking Inventory. In total, 87.8% of the students…

  3. Niemann-Pick disease type A presenting as unilateral tremors.

    PubMed

    Vykuntaraju, K N; Lokanatha, Hemalatha; Shivananda

    2012-11-01

    Niemann-Pick group of diseases are rare lysosomal storage disorders. The clinical phenotype is variable. We report a child who first time presented with tremors of tongue and tremors of one side of the body. On examination child had hemiparesis and hepatosplenomegaly. Bone marrow examination shows storage cells suggestive of Niemann-Pick cells and enzyme assay confirmed the diagnosis.

  4. Open-label escitalopram treatment for pathological skin picking.

    PubMed

    Keuthen, Nancy J; Jameson, Mariko; Loh, Rebecca; Deckersbach, Thilo; Wilhelm, Sabine; Dougherty, Darin D

    2007-09-01

    Pathological skin picking is characterized by dysfunctional, repetitive and excessive manipulation of the skin resulting in noticeable tissue damage. This study sought to assess the effectiveness of escitalopram in treating pathological skin picking. Twenty-nine individuals with pathological skin picking were enrolled in an 18-week, open-label trial of escitalopram. Study measures assessing skin picking severity and impact, anxiety, depression, and quality of life were given at baseline and weeks 2, 4, 6, 10, 14, and 18. The mean maximally tolerated dose was 25.0 mg (standard deviation=8.4). For the 19 study completers, pre-post-treatment analyses revealed significant improvements (P<0.05) on measures of skin picking severity and impact, quality of life, and self-rated anxiety and depression. Completer as well as intent-to-treat analyses indicated that approximately half of the sample satisfied full medication response criteria and one-quarter were partial medication responders. Correlational analyses indicated that changes in depression, anxiety, and quality of life co-occurred with reductions in skin picking severity but not impact. A high percentage of variance in severity, however, remained unexplained. These results suggest that escitalopram can be an effective agent in reducing pathological skin picking. The lack of medication response in a subset of our sample suggests the possibility of pathological skin picking subtypes.

  5. [Niemann-Pick type C disease: pathophysiology, diagnosis and treatment].

    PubMed

    Ohno, Kousaku

    2016-03-01

    Niemann-Pick type C (NPC) disease is an autosomal recessive neurodegenerative disorder which is caused in 95% by a mutation in the NPC1 gene on chromosome 18 or by NPC2 mutation, encoding for 2 different lysosomal lipid transport proteins. The impaired protein function leads to systemic intralysosomal accumulation of free cholesterol and shingolipids particularly in the CNS. In Japan, currently 34 living NPC patients are known as of December 2015. Considering the prevalence of the disease in the Western countries, the real number of NPC patients is most likely to be five-folds higher. For NPC, treatment methods are established and an approved disease-specific medications are available. It is important that patients early in their disease are referred to expert centers, in order to ensure timely initiation of treatment and to delay the progression of neurological symptoms as a goal.

  6. Peak flow meter (image)

    MedlinePlus

    A peak flow meter is commonly used by a person with asthma to measure the amount of air that can be ... become narrow or blocked due to asthma, peak flow values will drop because the person cannot blow ...

  7. Simulating cryo electron tomograms of crowded cell cytoplasm for assessment of automated particle picking.

    PubMed

    Pei, Long; Xu, Min; Frazier, Zachary; Alber, Frank

    2016-10-05

    Cryo-electron tomography is an important tool to study structures of macromolecular complexes in close to native states. A whole cell cryo electron tomogram contains structural information of all its macromolecular complexes. However, extracting this information remains challenging, and relies on sophisticated image processing, in particular for template-free particle extraction, classification and averaging. To develop these methods it is crucial to realistically simulate tomograms of crowded cellular environments, which can then serve as ground truth models for assessing and optimizing methods for detection of complexes in cell tomograms. We present a framework to generate crowded mixtures of macromolecular complexes for realistically simulating cryo electron tomograms including noise and image distortions due to the missing-wedge effects. Simulated tomograms are then used for assessing the template-free Difference-of-Gaussian (DoG) particle-picking method to detect complexes of different shapes and sizes under various crowding and noise levels. We identified DoG parameter settings that maximize precision and recall for detecting particles over a wide range of sizes and shapes. We observed that medium sized DoG scaling factors showed the overall best performance. To further improve performance, we propose a combination strategy for integrating results from multiple parameter settings. With increasing macromolecular crowding levels, the precision of particle picking remained relatively high, while the recall was dramatically reduced, which limits the detection of sufficient copy numbers of complexes in a crowded environment. Over a wide range of increasing noise levels, the DoG particle picking performance remained stable, but dramatically reduced beyond a specific noise threshold. Automatic and reference-free particle picking is an important first step in a visual proteomics analysis of cell tomograms. However, cell cytoplasm is highly crowded, which makes

  8. Application of a cross correlation-based picking algorithm to an active seismic experiment in Sicily and Aeolian Islands

    NASA Astrophysics Data System (ADS)

    Diaz, Alejandro; Álvarez, Isaac; De la Torre, Ángel; García, Luz; Benítez, Ma Carmen; Cortés, Guillermo

    2014-05-01

    The detection of the arrival time of seismic waves or picking is of great importance in many seismology applications. Traditionally, picking has been carried out by human operators. This process is not systematic and relies completely on the expertise and judgment of the analysts. The limitations of manual picking and the increasing amount of data daily stored in the seismic networks worldwide distributed and in active seismic experiments lead to the development of automatic picking algorithms. Current conventional algorithms work with single signals, such as the "short-term average over long-term average" (STA/LTA) algorithm, autoregressive methods or the recently developed "Adaptive Multiband Picking Algorithm" (AMPA). This work proposes a correlation-based picking algorithm, whose main advantage is the fact of using the information of a set of signals, improving the signal to noise ratio and therefore the picking accuracy. The main advantage of this approach is that the algorithm does not require to set up sophisticated parameters, in contrast to other automatic algorithms. The accuracy of the conventional STA/LTA algorithm, the recently developed AMPA algorithm, an autoregressive method, and a preliminary version of the cross correlation-based picking algorithm were assessed using a huge data set composed by active seismic signals from experiments in Tenerife Island (January 2007, Spain). The experiment consisted of the deployment of a dense seismic network on Tenerife Island (125 seismometers in total) and the shooting of air-guns around the island with the Spanish oceanographic vessel Hespérides (6459 air shots in total). Only 110937 signals (13.74% of the total) had the signal to noise ratio enough to be manually picked. Results showed that the use of the cross correlation-based picking algorithm significantly increases the number of signals that can be considered in the tomography. A new active seismic experiment will cover Sicily and Aeolian Islands (TOMO

  9. Development of sensitized pick coal interface detector system

    NASA Technical Reports Server (NTRS)

    Burchill, R. F.

    1982-01-01

    One approach for detection of the coal interface is measurement of pick cutting loads and shock through the use of pick strain gage load cells and accelerometers. The cutting drum of a long wall mining machine contains a number of cutting picks. In order to measure pick loads and shocks, one pick was instrumented and telemetry used to transmit the signals from the drum to an instrument-type tape recorder. A data system using FM telemetry was designed to transfer cutting bit load and shock information from the drum of a longwall shearer coal mining machine to a chassis mounted data recorder. The design of components in the test data system were finalized, the required instruments were assembled, the instrument system was evaluated in an above-ground simulation test, and an underground test series to obtain tape recorded sensor data was conducted.

  10. Calculation method using Clarkson integration for the physical dose at the center of the spread-out Bragg peak in carbon-ion radiotherapy

    SciTech Connect

    Tajiri, Minoru; Maeda, Takamasa; Isobe, Yoshiharu; Kuroiwa, Toshitaka; Tanimoto, Katsuyuki; Shibayama, Koichi; Koba, Yusuke; Fukuda, Shigekazu

    2013-07-15

    Purpose: In broad-beam carbon-ion radiotherapy performed using the heavy-ion medical accelerator in Chiba, the number of monitor units is determined by measuring the physical dose at the center of the spread-out Bragg peak (SOBP) for the treatment beam. The total measurement time increases as the number of treatment beams increases, which hinders the treatment of an increased number of patients. Hence, Kusano et al.[Jpn. J. Med. Phys. 23(Suppl. 2), 65-68 (2003)] proposed a method to calculate the physical dose at the center of the SOBP for a treatment beam. Based on a recent study, the authors here propose a more accurate calculation method.Methods: The authors measured the physical dose at the center of the SOBP while varying the circular field size and range-shifter thickness. The authors obtained the physical dose at the center of the SOBP for an irregularly shaped beam using Clarkson integration based on these measurements.Results: The difference between the calculated and measured physical doses at the center of the SOBP varied with a change in the central angle of the sector segment. The differences between the calculated and measured physical doses at the center of the SOBP were within {+-}1% for all irregularly shaped beams that were used to validate the calculation method.Conclusions: The accuracy of the proposed method depends on both the number of angular intervals used for Clarkson integration and the fineness of the basic data used for calculations: sampling numbers for the field size and thickness of the range shifter. If those parameters are properly chosen, the authors can obtain a calculated monitor unit number with high accuracy sufficient for clinical applications.

  11. The prevalence of pathologic skin picking in US adults.

    PubMed

    Keuthen, Nancy J; Koran, Lorrin M; Aboujaoude, Elias; Large, Michael D; Serpe, Richard T

    2010-01-01

    Despite increasing recognition of the potentially severe medical and psychosocial costs of pathologic skin picking (PSP), no large-sample, randomized investigation of its prevalence in a national population has been conducted. Two thousand five hundred and thirteen US adults were interviewed during the spring and summer of 2004 in a random-sample, national household computer-assisted phone survey of PSP phenomenology and associated functional impairment. Respondents were classified for subsequent analysis according to proposed diagnostic criteria. Of all respondents, 16.6% endorsed lifetime PSP with noticeable skin damage; 60.3% of these denied picking secondary to an inflammation or itch from a medical condition. One fifth to one quarter of those with lifetime PSP not related to a medical condition endorsed tension or nervousness before picking, tension or nervousness when attempting to resist picking, and pleasure or relief during or after picking. A total of 1.4% of our entire sample satisfied our criteria of picking with noticeable skin damage not attributable to another condition and with associated distress or psychosocial impairment. Pickers satisfying these latter criteria differed from other respondents in demographics (age, marital status) and both picking phenomenology and frequency. Copyright 2010 Elsevier Inc. All rights reserved.

  12. Clinical characteristics and medical complications of pathologic skin picking.

    PubMed

    Odlaug, Brian L; Grant, Jon E

    2008-01-01

    This study sought to detail the phenomenology and medical consequences of pathologic skin picking (PSP). Sixty subjects (11.7% males) with PSP (mean+/-S.D.=33.7+/-11.6 years) were assessed. Subjects seen in a pharmacological study as well as those from an ongoing outpatient longitudinal study comprised this sample. Subjects were assessed for current and lifetime psychiatric comorbidity (using the Structured Clinical Interview for DSM-IV Axis I Disorders), clinical severity (using the Clinical Global Impression - Severity scale) and psychosocial interference due to picking (using the Sheehan Disability Scale). Clinical characteristic data, including time spent picking per day, sites picked and medical complications directly resulting from skin picking behavior, as well as family history, were also obtained. The mean age (+/-S.D.) of onset for PSP was 12.3+/-9.6 years. The face was the most common area picked. Subjects reported picking a mean of 107.6 min each day. Scarring, ulcerations and infections were common. Few had ever sought psychiatric treatment for their behavior. Current comorbid Axis I psychiatric conditions were found in 38.3% of the sample. Trichotillomania (36.7%), compulsive nail biting (26.7%), depressive disorder (16.7%) and obsessive-compulsive disorder (15%) were the most common current comorbid conditions. PSP appears to be time consuming and frequently associated with medical complications. Research is needed to optimize patient care for individuals with this behavior.

  13. Primary stabbing "ice-pick" headache.

    PubMed

    Mukharesh, Loulwah O; Jan, Mohammed M S

    2011-10-01

    Primary stabbing "ice-pick" headache is rarely reported in children. It is characterized by transient, sharp stabbing pain that occurs within a localized area of the scalp for seconds. Five children were diagnosed according to the International Classification of Headache Disorders Diagnostic Criteria, Second Edition. Ages at diagnosis ranged from 6-16 years (mean age, 9.8 years), with signs lasting for 3-12 months (mean, 6.5 months) before assessment. All children presented with recurrent daily to monthly headaches that were very brief, lasting for seconds. The headache was orbital in one child, temporal in one child, and occipital in three children. Three children manifested other associated migraine headache types, and two had a positive family history of migraine. Amitriptyline was prescribed to two patients because of headache frequency and severity. The signs gradually subsided in all patients during follow-up of 3 months to 5 years (mean, 27 months). Primary stabbing headache may occasionally occur in children with features different from those encountered in adults. The headache is less frequent and often occipital in location. Its signs respond well to amitriptyline. However, larger prospective pediatric studies are needed to describe this syndrome further.

  14. Development of computerized Kana Pick-out Test for the neuropsychological examination.

    PubMed

    Inoue, Masashi; Suyama, Akihiko; Kato, Toshiaki; Urakami, Katsuya; Nakashima, Kenji; Meshitsuka, Shunsuke

    2003-03-01

    The Kana Pick-out Test, which was developed in Japan and done with paper and pencil, is said to be suitable for inspecting higher-order brain function and to be a good method for screening persons with mild or slight dementia. We have developed a computerized version of the Kana Pick-out Test, which runs on a stand-alone computer, intended to be utilized for mass screening and self-administration. The program was developed with Microsoft Visual Basic 6.0 and runs under the Windows operating system on any IBM PC compatible computer. In this study, all subjects could use the system by interacting with the computer and it was found that the system seemed to have the capability of detecting cognitive status equal to the paper-based Kana Pick-out Test. Besides this, we developed a network-based Kana Pick-out game software which was intended to attract user's notice. The game program was written in JAVA language and runs on a web-browser supporting JAVA on any operating system. The program, a so called applet, is located on our web site (http://environ.med.tottori-u.ac.jp) and anyone can use the applet by accessing our homepage.

  15. Are Bragg Peaks Gaussian?

    PubMed Central

    Hammouda, Boualem

    2014-01-01

    It is common practice to assume that Bragg scattering peaks have Gaussian shape. The Gaussian shape function is used to perform most instrumental smearing corrections. Using Monte Carlo ray tracing simulation, the resolution of a realistic small-angle neutron scattering (SANS) instrument is generated reliably. Including a single-crystal sample with large d-spacing, Bragg peaks are produced. Bragg peaks contain contributions from the resolution function and from spread in the sample structure. Results show that Bragg peaks are Gaussian in the resolution-limited condition (with negligible sample spread) while this is not the case when spread in the sample structure is non-negligible. When sample spread contributes, the exponentially modified Gaussian function is a better account of the Bragg peak shape. This function is characterized by a non-zero third moment (skewness) which makes Bragg peaks asymmetric for broad neutron wavelength spreads. PMID:26601025

  16. The relationship of psychological trauma with trichotillomania and skin picking.

    PubMed

    Özten, Eylem; Sayar, Gökben Hızlı; Eryılmaz, Gül; Kağan, Gaye; Işık, Sibel; Karamustafalıoğlu, Oğuz

    2015-01-01

    Interactions between psychological, biological and environmental factors are important in development of trichotillomania and skin picking. The aim of this study is to determine the relationship of traumatic life events, symptoms of post-traumatic stress disorder and dissociation in patients with diagnoses of trichotillomania and skin picking disorder. The study included patients who was diagnosed with trichotillomania (n=23) or skin picking disorder (n=44), and healthy controls (n=37). Beck Depression Inventory, Traumatic Stress Symptoms Scale and Dissociative Experiences Scale were administered. All groups checked a list of traumatic life events to determine the exposed traumatic events. There was no statistical significance between three groups in terms of Dissociative Experiences Scale scores (P=0.07). But Beck Depression Inventory and Traumatic Stress Symptoms Scale scores of trichotillomania and skin picking groups were significantly higher than the control group. Subjects with a diagnosis of trichotillomania and skin picking reported statistically significantly higher numbers of traumatic and negative events in childhood compared to healthy subjects. We can conclude that trauma may play a role in development of both trichotillomania and skin picking. Increased duration of trichotillomania or skin picking was correlated with decreased presence of post-traumatic stress symptoms. The reason for the negatively correlation of severity of post-traumatic stress symptoms and self-harming behavior may be speculated as developing trichotillomania or skin picking symptoms helps the patient to cope with intrusive thoughts related to trauma. Future longitudinal research must focus on whether trauma and post-traumatic stress or trichotillomania and skin picking precede the development of mental disorder.

  17. Weld bead reinforcement removal: A method of improving the strength and ductility of peaked welds in 2219-T87 aluminum alloy plate

    NASA Technical Reports Server (NTRS)

    Lovoy, C. V.

    1979-01-01

    The results of a study to determine the degree to which the ductility and tensile properties of peaked welds could be enhanced by removing the reinforcing bead and fairing the weld nugget into the adjacent parent metal are presented. The study employed 2219-T87 aluminum alloy plate, tungsten inert gas (TIG) welding, and 2319 filler wire. The study concluded that significant improvements in peak weld, ultimate strength, and ductility can be obtained through removal and fairing of the weld reinforcing bead. The specimens so treated and tested in this program exhibited ultimate strength improvements of 2 to 3 percent for peak angles of 5.8 to 10 degrees and 10 to 22 percent for welds with peak angles of 11.7 to 16.9 degrees. It was also determined that removal of the weld bead enhanced the ability of peaked welds to straighten when exposed to cyclic loading at stress levels above the yield strength.

  18. Brain gangliosides in the presenile dementia of Pick.

    PubMed Central

    Kamp, P E; den Hartog Jager, W A; Maathuis, J; de Groot, P A; de Jong, J M; Bolhuis, P A

    1986-01-01

    Histochemical analysis of frontal and temporal lobes from four patients with Pick presenile dementia indicated intracellular and extracellular deposits of gangliosides. Thin layer chromatography of gangliosides disclosed the presence of an unknown ganglioside, a decrease of N-acetylgalactosamine-GDla and an increase of GTla and/or GD2 in white matter of Pick brain. Chromatography of gray matter and quantitation of the sialic acid content yielded results similar to controls. It is suggested that degradation and removal of gangliosides is incomplete in Pick disease. Images PMID:3746324

  19. Automated on-line column-switching HPLC-MS/MS method with peak focusing for measuring parabens, triclosan, and other environmental phenols in human milk.

    PubMed

    Ye, Xiaoyun; Bishop, Amber M; Needham, Larry L; Calafat, Antonia M

    2008-08-01

    Parabens (esters of p-hydroxybenzoic acid) and triclosan are widely used as preservatives and antimicrobial agents, respectively, in personal care products, pharmaceuticals, and food processing. Because of their widespread use and potential risk to human health, assessing human exposure to these compounds in breastfed infants is of interest. We developed a sensitive method, using a unique on-line solid-phase extraction-high performance liquid chromatography-tandem mass spectrometry system with peak focusing feature, to measure in human milk the concentrations of five parabens (methyl-, ethyl-, propyl-, butyl-, and benzyl parabens), triclosan, and six other environmental phenols: bisphenol A (BPA); ortho-phenylphenol (OPP); 2,4-dichlorophenol; 2,5-dichlorophenol; 2,4,5-trichlorophenol; and 2-hydroxy-4-methoxybenzophenone (BP-3). The method, validated by use of breast milk pooled samples, shows good reproducibility (inter-day coefficient of variations ranging from 3.5% to 16.3%) and accuracy (spiked recoveries ranging from 84% to 119% at four spiking levels). The detection limits for most of the analytes are below 1 ng mL(-1) in 100 microL of milk. We tested the usefulness of the method by measuring the concentrations of these twelve compounds in four human milk samples. We detected methyl paraben, propyl paraben, triclosan, BPA, OPP, and BP-3 in some of the samples tested. The free species of these compounds appear to be the most prevalent in milk. Nevertheless, to demonstrate the utility of these measures for exposure and risk assessment purposes, additional data about sampling and storage of the milk, and on the stability of the analytes in milk, are needed.

  20. System for conveyor belt part picking using structured light and 3D pose estimation

    NASA Astrophysics Data System (ADS)

    Thielemann, J.; Skotheim, Ø.; Nygaard, J. O.; Vollset, T.

    2009-01-01

    Automatic picking of parts is an important challenge to solve within factory automation, because it can remove tedious manual work and save labor costs. One such application involves parts that arrive with random position and orientation on a conveyor belt. The parts should be picked off the conveyor belt and placed systematically into bins. We describe a system that consists of a structured light instrument for capturing 3D data and robust methods for aligning an input 3D template with a 3D image of the scene. The method uses general and robust pre-processing steps based on geometric primitives that allow the well-known Iterative Closest Point algorithm to converge quickly and robustly to the correct solution. The method has been demonstrated for localization of car parts with random position and orientation. We believe that the method is applicable for a wide range of industrial automation problems where precise localization of 3D objects in a scene is needed.

  1. Optimum onset period for training based on maximum peak velocity of height by wavelet interpolation method in Japanese high school athletes.

    PubMed

    Fujii, Katsunori; Demura, Shinichi; Matsuzawa, Jinzaburou

    2005-01-01

    The Wavelet Interpolation Method (WIM) was applied to the longitudinal records of individuals' heights and weights from 6 to 17 years of age (1983 to 1994) in an athlete group (male: 45, female: 50) and a control group (male: 85, female: 85). The criterion of maturity was derived from age at Maximum Peak Velocity (MPV) of height in the control group. Ages at MPV of height and weight were compared between the athletes and control subjects. The WIM was also applied to mean heights from 6.5 to 17.5 years of all the subjects classified by maturation rate in order to derive a model of growth velocity types. Among the athletes, the males were early-maturing and the females tended to be late-maturing. The difference between the ages at MPV of height and weight in males and females was less in the athletes group than in the control group. For the growth velocity model, in the athlete group, three types could be confirmed among the males, and five among the females. By making use of the type models, it was possible to clarify the spans of adolescence as classified by maturation rates, and it was concluded that the period following the age at MPV seems appropriate for the introduction of regular athletic training for each level of maturity.

  2. Peak Experience Project

    ERIC Educational Resources Information Center

    Scott, Daniel G.; Evans, Jessica

    2010-01-01

    This paper emerges from the continued analysis of data collected in a series of international studies concerning Childhood Peak Experiences (CPEs) based on developments in understanding peak experiences in Maslow's hierarchy of needs initiated by Dr Edward Hoffman. Bridging from the series of studies, Canadian researchers explore collected…

  3. Peak Experience Project

    ERIC Educational Resources Information Center

    Scott, Daniel G.; Evans, Jessica

    2010-01-01

    This paper emerges from the continued analysis of data collected in a series of international studies concerning Childhood Peak Experiences (CPEs) based on developments in understanding peak experiences in Maslow's hierarchy of needs initiated by Dr Edward Hoffman. Bridging from the series of studies, Canadian researchers explore collected…

  4. A Noise Reduction Method for Dual-Mass Micro-Electromechanical Gyroscopes Based on Sample Entropy Empirical Mode Decomposition and Time-Frequency Peak Filtering

    PubMed Central

    Shen, Chong; Li, Jie; Zhang, Xiaoming; Shi, Yunbo; Tang, Jun; Cao, Huiliang; Liu, Jun

    2016-01-01

    The different noise components in a dual-mass micro-electromechanical system (MEMS) gyroscope structure is analyzed in this paper, including mechanical-thermal noise (MTN), electronic-thermal noise (ETN), flicker noise (FN) and Coriolis signal in-phase noise (IPN). The structure equivalent electronic model is established, and an improved white Gaussian noise reduction method for dual-mass MEMS gyroscopes is proposed which is based on sample entropy empirical mode decomposition (SEEMD) and time-frequency peak filtering (TFPF). There is a contradiction in TFPS, i.e., selecting a short window length may lead to good preservation of signal amplitude but bad random noise reduction, whereas selecting a long window length may lead to serious attenuation of the signal amplitude but effective random noise reduction. In order to achieve a good tradeoff between valid signal amplitude preservation and random noise reduction, SEEMD is adopted to improve TFPF. Firstly, the original signal is decomposed into intrinsic mode functions (IMFs) by EMD, and the SE of each IMF is calculated in order to classify the numerous IMFs into three different components; then short window TFPF is employed for low frequency component of IMFs, and long window TFPF is employed for high frequency component of IMFs, and the noise component of IMFs is wiped off directly; at last the final signal is obtained after reconstruction. Rotation experimental and temperature experimental are carried out to verify the proposed SEEMD-TFPF algorithm, the verification and comparison results show that the de-noising performance of SEEMD-TFPF is better than that achievable with the traditional wavelet, Kalman filter and fixed window length TFPF methods. PMID:27258276

  5. A Noise Reduction Method for Dual-Mass Micro-Electromechanical Gyroscopes Based on Sample Entropy Empirical Mode Decomposition and Time-Frequency Peak Filtering.

    PubMed

    Shen, Chong; Li, Jie; Zhang, Xiaoming; Shi, Yunbo; Tang, Jun; Cao, Huiliang; Liu, Jun

    2016-05-31

    The different noise components in a dual-mass micro-electromechanical system (MEMS) gyroscope structure is analyzed in this paper, including mechanical-thermal noise (MTN), electronic-thermal noise (ETN), flicker noise (FN) and Coriolis signal in-phase noise (IPN). The structure equivalent electronic model is established, and an improved white Gaussian noise reduction method for dual-mass MEMS gyroscopes is proposed which is based on sample entropy empirical mode decomposition (SEEMD) and time-frequency peak filtering (TFPF). There is a contradiction in TFPS, i.e., selecting a short window length may lead to good preservation of signal amplitude but bad random noise reduction, whereas selecting a long window length may lead to serious attenuation of the signal amplitude but effective random noise reduction. In order to achieve a good tradeoff between valid signal amplitude preservation and random noise reduction, SEEMD is adopted to improve TFPF. Firstly, the original signal is decomposed into intrinsic mode functions (IMFs) by EMD, and the SE of each IMF is calculated in order to classify the numerous IMFs into three different components; then short window TFPF is employed for low frequency component of IMFs, and long window TFPF is employed for high frequency component of IMFs, and the noise component of IMFs is wiped off directly; at last the final signal is obtained after reconstruction. Rotation experimental and temperature experimental are carried out to verify the proposed SEEMD-TFPF algorithm, the verification and comparison results show that the de-noising performance of SEEMD-TFPF is better than that achievable with the traditional wavelet, Kalman filter and fixed window length TFPF methods.

  6. Taboo search algorithm for item assignment in synchronized zone automated order picking system

    NASA Astrophysics Data System (ADS)

    Wu, Yingying; Wu, Yaohua

    2014-07-01

    The idle time which is part of the order fulfillment time is decided by the number of items in the zone; therefore the item assignment method affects the picking efficiency. Whereas previous studies only focus on the balance of number of kinds of items between different zones but not the number of items and the idle time in each zone. In this paper, an idle factor is proposed to measure the idle time exactly. The idle factor is proven to obey the same vary trend with the idle time, so the object of this problem can be simplified from minimizing idle time to minimizing idle factor. Based on this, the model of item assignment problem in synchronized zone automated order picking system is built. The model is a form of relaxation of parallel machine scheduling problem which had been proven to be NP-complete. To solve the model, a taboo search algorithm is proposed. The main idea of the algorithm is minimizing the greatest idle factor of zones with the 2-exchange algorithm. Finally, the simulation which applies the data collected from a tobacco distribution center is conducted to evaluate the performance of the algorithm. The result verifies the model and shows the algorithm can do a steady work to reduce idle time and the idle time can be reduced by 45.63% on average. This research proposed an approach to measure the idle time in synchronized zone automated order picking system. The approach can improve the picking efficiency significantly and can be seen as theoretical basis when optimizing the synchronized automated order picking systems.

  7. Kids Can Pick Up Nicotine on Their Hands

    MedlinePlus

    ... HealthDay News) -- Everyone's heard about the dangers of secondhand smoke. Now, researchers say children can pick up nicotine ... Prevention. Previous research has shown that residue from secondhand smoke accumulates in dust, on home surfaces, on clothes ...

  8. Peak power ratio generator

    DOEpatents

    Moyer, Robert D.

    1985-01-01

    A peak power ratio generator is described for measuring, in combination with a conventional power meter, the peak power level of extremely narrow pulses in the gigahertz radio frequency bands. The present invention in a preferred embodiment utilizes a tunnel diode and a back diode combination in a detector circuit as the only high speed elements. The high speed tunnel diode provides a bistable signal and serves as a memory device of the input pulses for the remaining, slower components. A hybrid digital and analog loop maintains the peak power level of a reference channel at a known amount. Thus, by measuring the average power levels of the reference signal and the source signal, the peak power level of the source signal can be determined.

  9. Significance of periodogram peaks

    NASA Astrophysics Data System (ADS)

    Süveges, Maria; Guy, Leanne; Zucker, Shay

    2016-10-01

    Three versions of significance measures or False Alarm Probabilities (FAPs) for periodogram peaks are presented and compared for sinusoidal and box-like signals, with specific application on large-scale surveys in mind.

  10. Peak power ratio generator

    DOEpatents

    Moyer, R.D.

    A peak power ratio generator is described for measuring, in combination with a conventional power meter, the peak power level of extremely narrow pulses in the gigahertz radio frequency bands. The present invention in a preferred embodiment utilizes a tunnel diode and a back diode combination in a detector circuit as the only high speed elements. The high speed tunnel diode provides a bistable signal and serves as a memory device of the input pulses for the remaining, slower components. A hybrid digital and analog loop maintains the peak power level of a reference channel at a known amount. Thus, by measuring the average power levels of the reference signal and the source signal, the peak power level of the source signal can be determined.

  11. Pikes Peak, Colorado

    USGS Publications Warehouse

    Brunstein, Craig; Quesenberry, Carol; Davis, John; Jackson, Gene; Scott, Glenn R.; D'Erchia, Terry D.; Swibas, Ed; Carter, Lorna; McKinney, Kevin; Cole, Jim

    2006-01-01

    For 200 years, Pikes Peak has been a symbol of America's Western Frontier--a beacon that drew prospectors during the great 1859-60 Gold Rush to the 'Pikes Peak country,' the scenic destination for hundreds of thousands of visitors each year, and an enduring source of pride for cities in the region, the State of Colorado, and the Nation. November 2006 marks the 200th anniversary of the Zebulon M. Pike expedition's first sighting of what has become one of the world's most famous mountains--Pikes Peak. In the decades following that sighting, Pikes Peak became symbolic of America's Western Frontier, embodying the spirit of Native Americans, early explorers, trappers, and traders who traversed the vast uncharted wilderness of the Western Great Plains and the Southern Rocky Mountains. High-quality printed paper copies of this poster are available at no cost from Information Services, U.S. Geological Survey (1-888-ASK-USGS).

  12. Central Peak Crater

    NASA Image and Video Library

    2010-10-07

    As crater size increases, craters become more complex. This moderate size crater contains a central peak, created by rebound of molten material just following the impact. This image was captured by NASA Mars Odyssey on Sept. 8, 2010.

  13. A New First Break Picking for Three-Component VSP Data Using Gesture Sensor and Polarization Analysis.

    PubMed

    Li, Huailiang; Tuo, Xianguo; Shen, Tong; Wang, Ruili; Courtois, Jérémie; Yan, Minhao

    2017-09-19

    A new first break picking for three-component (3C) vertical seismic profiling (VSP) data is proposed to improve the estimation accuracy of first arrivals, which adopts gesture detection calibration and polarization analysis based on the eigenvalue of the covariance matrix. This study aims at addressing the problem that calibration is required for VSP data using the azimuth and dip angle of geophones, due to the direction of geophones being random when applied in a borehole, which will further lead to the first break picking possibly being unreliable. Initially, a gesture-measuring module is integrated in the seismometer to rapidly obtain high-precision gesture data (including azimuth and dip angle information). Using re-rotating and re-projecting using earlier gesture data, the seismic dataset of each component will be calibrated to the direction that is consistent with the vibrator shot orientation. It will promote the reliability of the original data when making each component waveform calibrated to the same virtual reference component, and the corresponding first break will also be properly adjusted. After achieving 3C data calibration, an automatic first break picking algorithm based on the autoregressive-Akaike information criterion (AR-AIC) is adopted to evaluate the first break. Furthermore, in order to enhance the accuracy of the first break picking, the polarization attributes of 3C VSP recordings is applied to constrain the scanning segment of AR-AIC picker, which uses the maximum eigenvalue calculation of the covariance matrix. The contrast results between pre-calibration and post-calibration using field data show that it can further improve the quality of the 3C VSP waveform, which is favorable to subsequent picking. Compared to the obtained short-term average to long-term average (STA/LTA) and the AR-AIC algorithm, the proposed method, combined with polarization analysis, can significantly reduce the picking error. Applications of actual field

  14. Niemann-Pick disease type C.

    PubMed

    Vanier, Marie T

    2010-06-03

    Niemann-Pick C disease (NP-C) is a neurovisceral atypical lysosomal lipid storage disorder with an estimated minimal incidence of 1/120,000 live births. The broad clinical spectrum ranges from a neonatal rapidly fatal disorder to an adult-onset chronic neurodegenerative disease. The neurological involvement defines the disease severity in most patients but is typically preceded by systemic signs (cholestatic jaundice in the neonatal period or isolated spleno- or hepatosplenomegaly in infancy or childhood). The first neurological symptoms vary with age of onset: delay in developmental motor milestones (early infantile period), gait problems, falls, clumsiness, cataplexy, school problems (late infantile and juvenile period), and ataxia not unfrequently following initial psychiatric disturbances (adult form). The most characteristic sign is vertical supranuclear gaze palsy. The neurological disorder consists mainly of cerebellar ataxia, dysarthria, dysphagia, and progressive dementia. Cataplexy, seizures and dystonia are other common features. NP-C is transmitted in an autosomal recessive manner and is caused by mutations of either the NPC1 (95% of families) or the NPC2 genes. The exact functions of the NPC1 and NPC2 proteins are still unclear. NP-C is currently described as a cellular cholesterol trafficking defect but in the brain, the prominently stored lipids are gangliosides. Clinical examination should include comprehensive neurological and ophthalmological evaluations. The primary laboratory diagnosis requires living skin fibroblasts to demonstrate accumulation of unesterified cholesterol in perinuclear vesicles (lysosomes) after staining with filipin. Pronounced abnormalities are observed in about 80% of the cases, mild to moderate alterations in the remainder ("variant" biochemical phenotype). Genotyping of patients is useful to confirm the diagnosis in the latter patients and essential for future prenatal diagnosis. The differential diagnosis may include

  15. Atomic identification of fluorescent Q-dots on tau-positive fibrils in 3D-reconstructed pick bodies.

    PubMed

    Uematsu, Miho; Adachi, Eijiro; Nakamura, Ayako; Tsuchiya, Kuniaki; Uchihara, Toshiki

    2012-04-01

    Pick body disease, characterized by the presence of Pick bodies, is distinguished from neurofibrillary tangles in Alzheimer disease on the basis of their smooth, spherical shape. Quantum dots (QDs) are nanometer-scale, water-soluble fluorophores that are detectable both as a fluorescent signal by light microscopy and as electron-dense particles under electron microscopy. In this study, tau-positive Pick bodies were immunofluorescently labeled with QD nanocrystals composed of cadmium selenide for three-dimensional (3D) reconstruction and subsequently subjected to electron microscopic observation to identify QD immunolabeling on the same Pick body for comparison in detail. The identity of the QD nanocrystals, which label the tau-positive fibrils, was confirmed by the presence of both cadmium and selenium on these nanocrystals, demonstrated as parallel peaks corresponding to these atoms on energy-dispersive X-ray spot analysis under super-resolution scanning transmission electron microscopy. This confirmation of the specificity of the QD labeling through both its fluorescence and energy-dispersive X-ray spectra reinforces the reliability of the labeling. In addition, this exact comparison of the same structure by electron microscopy and 3D light microscopy demonstrates how its ultrastructural details are related to its surrounding structures on a 3D basis, providing further insights into how molecules woven into specific pathological ultrastructures are at work in situ. Copyright © 2012 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  16. Chromatofocusing of skin fibroblast sphingomyelinase: alterations in Niemann-Pick disease type C shared by GM1-gangliosidosis.

    PubMed

    Vanier, M T; Rousson, R; Louisot, P

    1983-05-30

    Sphingomyelinase activity of cultivated skin fibroblast extracts from normal individuals was resolved by chromatofocusing in the pH range 8-5 into three major components with pI's of 7.3, 6.3 and 5.9, respectively. Chromatofocusing proved a more efficient and reproducible separation technique than preparative flat-bed isoelectric focusing and it gave a constant profile even when detergent concentration varied. In skin fibroblasts from five patients with Niemann-Pick disease type C, a varying degree of reduction in the proportion of the 7.3 peak was observed. In a patient with clinical features of Niemann-Pick disease type C, the finding of such a profile would thus be a good argument for the diagnosis, but it is not pathognomonic as we found similar changes in two cases with GM1-gangliosidosis, while some cases of Niemann-Pick disease type C have borderline normal profiles. These results challenge the concept of a specific sphingomyelinase isoenzyme deficiency as the basic defect in Niemann-Pick disease type C.

  17. Design of micropulse-picking system with acoustic-optic modulators in mid-infrared region FEL

    NASA Astrophysics Data System (ADS)

    Heya, Manabu; Fukami, Yuko; Nagata, Hiroyuki; Nunoyama, Hiroaki; Awazu, Kunio

    2001-05-01

    A micropulse-picking system attached to a free electron laser (FEL) opens a broad range of potential applications of ultrafast phenomena in medicine and biology. This paper reports the micropulse-picking system of a mid-infrared (IR) FEL at iFEL, Osaka University. We have designed the system with a germanium acousto-optic modulator (Ge-AOM), which can effectively deflect the direction of the FEL propagation due to Bragg diffraction of the FEL and radio frequency (RF) waves. The system includes a reducing optics for the FEL beam, a focusing optics onto the Ge- AOM and a micropulse-picking device (including the Ge-AOM and the RF driver). The system, which is independent on wavelength in the mid-IR region, can be realized by using the following technique: the RF frequency is carefully controlled to satisfy the Bragg angle matching over the mid-IR region. As a result, the micropulse-picking system can supply single and/or some FEL micropulses at an arbitrary repetition rate over the mid-IR region (equals 2 - 12 micrometers ) and can control the resulting peak power and average power in the ranges of approximately 1 - 2 MW and approximately 50 (mu) W - 20 mW, respectively.

  18. Excessive Picking in Prader-Willi Syndrome: A Pilot Study of Phenomenological Aspects and Comorbid Symptoms.

    ERIC Educational Resources Information Center

    Wigren, Margareta; Heimann, Mikael

    2001-01-01

    Interviews with parents of 37 individuals (ages 12-30) with Prader-Willi syndrome revealed two-thirds displayed skin picking with a frequency ranging from chronic to transient, episodic symptoms. Many individuals with skin picking also exhibited comorbid picking behaviors And individuals with excessive skin picking also had frequent tantrums and…

  19. Adaptive Bacteria Colony Picking in Unstructured Environments Using Intensity Histogram and Unascertained LS-SVM Classifier

    PubMed Central

    Zhang, Kun; Fei, Minrui; Li, Xin

    2014-01-01

    Features analysis is an important task which can significantly affect the performance of automatic bacteria colony picking. Unstructured environments also affect the automatic colony screening. This paper presents a novel approach for adaptive colony segmentation in unstructured environments by treating the detected peaks of intensity histograms as a morphological feature of images. In order to avoid disturbing peaks, an entropy based mean shift filter is introduced to smooth images as a preprocessing step. The relevance and importance of these features can be determined in an improved support vector machine classifier using unascertained least square estimation. Experimental results show that the proposed unascertained least square support vector machine (ULSSVM) has better recognition accuracy than the other state-of-the-art techniques, and its training process takes less time than most of the traditional approaches presented in this paper. PMID:24955423

  20. [A peak recognition algorithm designed for chromatographic peaks of transformer oil].

    PubMed

    Ou, Linjun; Cao, Jian

    2014-09-01

    In the field of the chromatographic peak identification of the transformer oil, the traditional first-order derivative requires slope threshold to achieve peak identification. In terms of its shortcomings of low automation and easy distortion, the first-order derivative method was improved by applying the moving average iterative method and the normalized analysis techniques to identify the peaks. Accurate identification of the chromatographic peaks was realized through using multiple iterations of the moving average of signal curves and square wave curves to determine the optimal value of the normalized peak identification parameters, combined with the absolute peak retention times and peak window. The experimental results show that this algorithm can accurately identify the peaks and is not sensitive to the noise, the chromatographic peak width or the peak shape changes. It has strong adaptability to meet the on-site requirements of online monitoring devices of dissolved gases in transformer oil.

  1. An initial abstraction and constant loss model, and methods for estimating unit hydrographs, peak streamflows, and flood volumes for urban basins in Missouri

    USGS Publications Warehouse

    Huizinga, Richard J.

    2014-01-01

    The rainfall-runoff pairs from the storm-specific GUH analysis were further analyzed against various basin and rainfall characteristics to develop equations to estimate the peak streamflow and flood volume based on a quantity of rainfall on the basin.

  2. Analyte quantification with comprehensive two-dimensional gas chromatography: assessment of methods for baseline correction, peak delineation, and matrix effect elimination for real samples.

    PubMed

    Samanipour, Saer; Dimitriou-Christidis, Petros; Gros, Jonas; Grange, Aureline; Samuel Arey, J

    2015-01-02

    Comprehensive two-dimensional gas chromatography (GC×GC) is used widely to separate and measure organic chemicals in complex mixtures. However, approaches to quantify analytes in real, complex samples have not been critically assessed. We quantified 7 PAHs in a certified diesel fuel using GC×GC coupled to flame ionization detector (FID), and we quantified 11 target chlorinated hydrocarbons in a lake water extract using GC×GC with electron capture detector (μECD), further confirmed qualitatively by GC×GC with electron capture negative chemical ionization time-of-flight mass spectrometer (ENCI-TOFMS). Target analyte peak volumes were determined using several existing baseline correction algorithms and peak delineation algorithms. Analyte quantifications were conducted using external standards and also using standard additions, enabling us to diagnose matrix effects. We then applied several chemometric tests to these data. We find that the choice of baseline correction algorithm and peak delineation algorithm strongly influence the reproducibility of analyte signal, error of the calibration offset, proportionality of integrated signal response, and accuracy of quantifications. Additionally, the choice of baseline correction and the peak delineation algorithm are essential for correctly discriminating analyte signal from unresolved complex mixture signal, and this is the chief consideration for controlling matrix effects during quantification. The diagnostic approaches presented here provide guidance for analyte quantification using GC×GC.

  3. Analysis of middle cerebral artery peak systolic velocity in monochorionic twin pregnancies as a method for identifying spontaneous twin anaemia-polycythaemia sequence.

    PubMed

    Sainz, José A; Romero, Cristina; García-Mejido, José; Soto, Fátima; Turmo, Enriqueta

    2014-07-01

    A regular Doppler control evaluation of middle cerebral artery peak systolic velocity is needed in order to identify twin anaemia polycythaemia sequence in monochorionic twin pregnancies. Here, we present a clinical case of spontaneous TAPS, and we review the diagnostic criteria and management strategies for this syndrome.

  4. Picking and Nibbling in Children and Adolescents with Eating Disorders

    PubMed Central

    Kass, Andrea E.; Accurso, Erin C.; Goldschmidt, Andrea B.; Anam, Seeba; Byrne, Catherine E.; Kinasz, Kate; Goodyear, Alexandria; O'Brien, Setareh; Le Grange, Daniel

    2016-01-01

    Objective Picking and nibbling (P&N), defined as eating in an unplanned and repetitious way between meals and snacks, is prevalent among adults with eating disorders (EDs), but unexamined among youth with EDs. This study sought to assess the prevalence of P&N in youth with EDs and its association with ED and comorbid pathology. Method Youth (N = 515; ages 7–18) who presented to one outpatient ED research-clinical program were assessed for ED and comorbid pathology. Results Two-fifths (n = 214, 41.6%) of youth endorsed P&N. These individuals were older (p < .001) and had a higher percent expected body weight (p = .006) than those who denied P&N. Controlling for age and percent expected body weight, P&N was only associated with global ED pathology in youth with anorexia nervosa (AN) or atypical AN (p = .007). P&N was not associated with ED diagnosis, ED pathology in youth with bulimia nervosa or subclinical bulimia nervosa, binge eating, compensatory behaviors, secret eating, or the presence of a mood or anxiety disorder (p's > .05). Discussion Consistent with research in adults, P&N is prevalent but not significantly associated with ED pathology, except for global ED pathology in youth with AN/atypical AN, or comorbid disorders. PMID:26282064

  5. Pathological skin picking in individuals with body dysmorphic disorder

    PubMed Central

    Grant, Jon E.; Menard, William; Phillips, Katharine A.

    2006-01-01

    Objective The objective of this study was to examine the prevalence and clinical correlates of pathological skin picking (PSP) in a large sample of individuals with body dysmorphic disorder (BDD). Method One hundred seventy-six individuals with BDD (71.0% women; mean age, 32.5 ± 12.3 years) were assessed with respect to comorbidity, BDD severity, delusionality (insight), quality of life and social/occupational functioning, using reliable and valid measures. All variables were compared in BDD subjects with and without lifetime PSP. Results About 44.9% of subjects reported lifetime PSP, and 36.9% reported current PSP secondary to BDD. BDD subjects with PSP were more likely to be female, to have skin preoccupations, to have comorbid trichotillomania or a personality disorder, to camouflage with makeup and to seek and receive nonpsychiatric (e.g., dermatological) treatment for their skin preoccupations. Conclusion There is a high prevalence of PSP among individuals with BDD, and clinicians should be aware of the clinical correlates of this problematic behavior. PMID:17088164

  6. Correlation-Peak Imaging

    NASA Astrophysics Data System (ADS)

    Ziegler, A.; Metzler, A.; Köckenberger, W.; Izquierdo, M.; Komor, E.; Haase, A.; Décorps, M.; von Kienlin, M.

    1996-08-01

    Identification and quantitation in conventional1H spectroscopic imagingin vivois often hampered by the small chemical-shift range. To improve the spectral resolution of spectroscopic imaging, homonuclear two-dimensional correlation spectroscopy has been combined with phase encoding of the spatial dimensions. From the theoretical description of the coherence-transfer signal in the Fourier-transform domain, a comprehensive acquisition and processing strategy is presented that includes optimization of the width and the position of the acquisition windows, matched filtering of the signal envelope, and graphical presentation of the cross peak of interest. The procedure has been applied to image the spatial distribution of the correlation peaks from specific spin systems in the hypocotyl of castor bean (Ricinus communis) seedlings. Despite the overlap of many resonances, correlation-peak imaging made it possible to observe a number of proton resonances, such as those of sucrose, β-glucose, glutamine/glutamate, lysine, and arginine.

  7. Hale Central Peak

    NASA Technical Reports Server (NTRS)

    2004-01-01

    19 September 2004 This Mars Global Surveyor (MGS) Mars Orbiter Camera (MOC) image shows some of the mountains that make up the central peak region of Hale Crater, located near 35.8oS, 36.5oW. Dark, smooth-surfaced sand dunes are seen to be climbing up the mountainous slopes. The central peak of a crater consists of rock brought up during the impact from below the crater floor. This autumn image is illuminated from the upper left and covers an area approximately 3 km (1.9 mi) across.

  8. Nonmedical factors associated with feather picking in pet psittacine birds.

    PubMed

    Gaskins, Lori A; Hungerford, Laura

    2014-06-01

    A nested case-control study was performed to determine nonmedical risk factors associated with feather picking in psittacine birds. Forty-two case birds, reported by their owners to pick their feathers, and 126 unaffected birds were compared. The odds of feather picking were higher in 2 species categories, African grey parrots (Psitticus erithacus, adjusted odds ratio [ORadj = 8.4, P < .001) and cockatoos (Cacatua species, ORadj = 12.7, P < .001). The odds of feather picking also were higher for birds that were out of their cages more than 8 hours per day (ORadj = 7.4, P < .001) and for birds that had been taken in by the owner as a "rescue" (ORadj = 4.7, P < .01). The odds of feather picking decreased by almost 90% (ORadj = 0.1, P < .005) for birds that interacted with people at least 4 hours a day. These findings identify characteristics that practitioners may want to include when asking bird owners about behavioral history and may be useful in focusing future research regarding this behavior.

  9. Make peak flow a habit!

    MedlinePlus

    Asthma - make peak flow a habit; Reactive airway disease - peak flow; Bronchial asthma - peak flow ... your airways are narrowed and blocked due to asthma, your peak flow values drop. You can check ...

  10. Peak-flow characteristics of Virginia streams

    USGS Publications Warehouse

    Austin, Samuel H.; Krstolic, Jennifer L.; Wiegand, Ute

    2011-01-01

    Peak-flow annual exceedance probabilities, also called probability-percent chance flow estimates, and regional regression equations are provided describing the peak-flow characteristics of Virginia streams. Statistical methods are used to evaluate peak-flow data. Analysis of Virginia peak-flow data collected from 1895 through 2007 is summarized. Methods are provided for estimating unregulated peak flow of gaged and ungaged streams. Station peak-flow characteristics identified by fitting the logarithms of annual peak flows to a Log Pearson Type III frequency distribution yield annual exceedance probabilities of 0.5, 0.4292, 0.2, 0.1, 0.04, 0.02, 0.01, 0.005, and 0.002 for 476 streamgaging stations. Stream basin characteristics computed using spatial data and a geographic information system are used as explanatory variables in regional regression model equations for six physiographic regions to estimate regional annual exceedance probabilities at gaged and ungaged sites. Weighted peak-flow values that combine annual exceedance probabilities computed from gaging station data and from regional regression equations provide improved peak-flow estimates. Text, figures, and lists are provided summarizing selected peak-flow sites, delineated physiographic regions, peak-flow estimates, basin characteristics, regional regression model equations, error estimates, definitions, data sources, and candidate regression model equations. This study supersedes previous studies of peak flows in Virginia.

  11. A morphometric and molecular study of Anastrepha pickeli Lima (Diptera: Tephritidae).

    PubMed

    Bomfim, Z V; Lima, K M; Silva, J G; Costa, M A; Zucchi, Robert A

    2011-10-01

    This study investigated the level of morphometric and genetic variability among populations of Anastrepha pickeli Lima from several localities in Brazil, one locality in Bolivia and one in Paraguay. Traditional and geometric morphometric analyses were used, as well as sequencing of a fragment of the cytochrome oxidase gene (COI). Six variables were measured from the aculeus for traditional morphometric analysis and 14 landmarks from the right wing were used for geometric analysis, using 10 specimes/population. The aculeus tip length, aculeus width at the end of the cloaca opening, and the serrate part length contributed with 62.7% for grouping. According to the results from traditional morphometry, there was no significant difference, but the multivariate tests showed that the canonical variables were statistically significant, indicating a difference in the wing conformation among populations. Molecular phylogenetic analysis indicated that the populations clustered into three clades and revealed a high level of genetic variation within A. pickeli populations from various geographic regions. Anastrepha pickeli populations differed among them according to the methods used in this study, showing incongruence among the methods used.

  12. Kitt Peak Observes Comet

    NASA Image and Video Library

    2005-05-16

    he Kitt Peak National Observatory 2.1-meter telescope observed comet Tempel 1 on April 11, 2005, when the comet was near its closest approach to the Earth. A pinkish dust jet is visible to the southwest, with the broader neutral gas coma surrounding it.

  13. On-line spectrophotometric method for monitoring weak residual absorption of CaMoO4 single crystals near the intrinsic luminescence peak

    NASA Astrophysics Data System (ADS)

    Buzanov, O. A.; Kanevskii, V. M.; Kornoukhov, V. N.; Nabatov, B. V.; Nabatov, V. V.; Fedorov, V. A.

    2013-11-01

    The optical and spectral characteristics of isotopically enriched Czochralski-grown 40Ca100MoO4 single crystals have been investigated. This material is promising for detecting double neutrinoless β decay. The possibility and the technique of spectrophotometric monitoring of weak residual absorption near the intrinsic luminescence peak of this scintillation material, which is designed for developing new-generation detectors of elementary particles, are considered.

  14. On-line spectrophotometric method for monitoring weak residual absorption of CaMoO{sub 4} single crystals near the intrinsic luminescence peak

    SciTech Connect

    Buzanov, O. A.; Kanevskii, V. M.; Kornoukhov, V. N.; Nabatov, B. V.; Nabatov, V. V.; Fedorov, V. A.

    2013-11-15

    The optical and spectral characteristics of isotopically enriched Czochralski-grown {sup 40}Ca{sup 100}MoO{sub 4} single crystals have been investigated. This material is promising for detecting double neutrinoless {beta} decay. The possibility and the technique of spectrophotometric monitoring of weak residual absorption near the intrinsic luminescence peak of this scintillation material, which is designed for developing new-generation detectors of elementary particles, are considered.

  15. Saccadic Eye Movement Characteristics in Adult Niemann-Pick Type C Disease: Relationships with Disease Severity and Brain Structural Measures

    PubMed Central

    Abel, Larry A.; Bowman, Elizabeth A.; Velakoulis, Dennis; Fahey, Michael C.; Desmond, Patricia; Macfarlane, Matthew D.; Looi, Jeffrey Chee Leong; Adamson, Christopher L.; Walterfang, Mark

    2012-01-01

    Niemann-Pick Type C disease (NPC) is a rare genetic disorder of lipid metabolism. A parameter related to horizontal saccadic peak velocity was one of the primary outcome measures in the clinical trial assessing miglustat as a treatment for NPC. Neuropathology is widespread in NPC, however, and could be expected to affect other saccadic parameters. We compared horizontal saccadic velocity, latency, gain, antisaccade error percentage and self-paced saccade generation in 9 adult NPC patients to data from 10 age-matched controls. These saccadic measures were correlated with appropriate MRI-derived brain structural measures (e.g., dorsolateral prefrontal cortex, frontal eye fields, supplemental eye fields, parietal eye fields, pons, midbrain and cerebellar vermis) and with measures of disease severity and duration. The best discriminators between groups were reflexive saccade gain and the two volitional saccade measures. Gain was also the strongest correlate with disease severity and duration. Most of the saccadic measures showed strongly significant correlations with neurophysiologically appropriate brain regions. While our patient sample is small, the apparent specificity of these relationships suggests that as new diagnostic methods and treatments become available for NPC, a broader range of saccadic measures may be useful tools for the assessment of disease progression and treatment efficacy. PMID:23226429

  16. Nibbling and picking in obese patients with Binge Eating Disorder.

    PubMed

    Masheb, Robin M; Roberto, Christina A; White, Marney A

    2013-12-01

    The goal of this study was to examine the clinical utility of nibbling behavior, defined as eating in an unplanned and repetitious manner between meals and snacks without a sense of loss of control, in obese patients with Binge Eating Disorder (BED). Two-hundred seventeen (N = 217) consecutive, treatment-seeking, obese patients with BED were assessed with the Eating Disorder Examination (EDE). Nibbling frequency was examined in relation to current weight, eating disorder psychopathology and eating patterns. Results found that nibbling/picking was not related to body mass index, objective bulimic, subjective bulimic, or overeating episodes, food avoidance, sensitivity to weight gain, or any subscales of the EDE. However, nibbling/picking was significantly related to frequency of morning and afternoon snacking (r = .21, p = .002; r = .27, p < .001). The assessment of nibbling/picking behaviors among individuals with BED might not provide clinically significant information. © 2013.

  17. Impact Crater with Peak

    NASA Technical Reports Server (NTRS)

    2002-01-01

    (Released 14 June 2002) The Science This THEMIS visible image shows a classic example of a martian impact crater with a central peak. Central peaks are common in large, fresh craters on both Mars and the Moon. This peak formed during the extremely high-energy impact cratering event. In many martian craters the central peak has been either eroded or buried by later sedimentary processes, so the presence of a peak in this crater indicates that the crater is relatively young and has experienced little degradation. Observations of large craters on the Earth and the Moon, as well as computer modeling of the impact process, show that the central peak contains material brought from deep beneath the surface. The material exposed in these peaks will provide an excellent opportunity to study the composition of the martian interior using THEMIS multi-spectral infrared observations. The ejecta material around the crater can is well preserved, again indicating relatively little modification of this landform since its initial creation. The inner walls of this approximately 18 km diameter crater show complex slumping that likely occurred during the impact event. Since that time there has been some downslope movement of material to form the small chutes and gullies that can be seen on the inner crater wall. Small (50-100 m) mega-ripples composed of mobile material can be seen on the floor of the crater. Much of this material may have come from the walls of the crater itself, or may have been blown into the crater by the wind. The Story When a meteor smacked into the surface of Mars with extremely high energy, pow! Not only did it punch an 11-mile-wide crater in the smoother terrain, it created a central peak in the middle of the crater. This peak forms kind of on the 'rebound.' You can see this same effect if you drop a single drop of milk into a glass of milk. With craters, in the heat and fury of the impact, some of the land material can even liquefy. Central peaks like the one

  18. Impact Crater with Peak

    NASA Technical Reports Server (NTRS)

    2002-01-01

    (Released 14 June 2002) The Science This THEMIS visible image shows a classic example of a martian impact crater with a central peak. Central peaks are common in large, fresh craters on both Mars and the Moon. This peak formed during the extremely high-energy impact cratering event. In many martian craters the central peak has been either eroded or buried by later sedimentary processes, so the presence of a peak in this crater indicates that the crater is relatively young and has experienced little degradation. Observations of large craters on the Earth and the Moon, as well as computer modeling of the impact process, show that the central peak contains material brought from deep beneath the surface. The material exposed in these peaks will provide an excellent opportunity to study the composition of the martian interior using THEMIS multi-spectral infrared observations. The ejecta material around the crater can is well preserved, again indicating relatively little modification of this landform since its initial creation. The inner walls of this approximately 18 km diameter crater show complex slumping that likely occurred during the impact event. Since that time there has been some downslope movement of material to form the small chutes and gullies that can be seen on the inner crater wall. Small (50-100 m) mega-ripples composed of mobile material can be seen on the floor of the crater. Much of this material may have come from the walls of the crater itself, or may have been blown into the crater by the wind. The Story When a meteor smacked into the surface of Mars with extremely high energy, pow! Not only did it punch an 11-mile-wide crater in the smoother terrain, it created a central peak in the middle of the crater. This peak forms kind of on the 'rebound.' You can see this same effect if you drop a single drop of milk into a glass of milk. With craters, in the heat and fury of the impact, some of the land material can even liquefy. Central peaks like the one

  19. NITPICK: peak identification for mass spectrometry data

    PubMed Central

    Renard, Bernhard Y; Kirchner, Marc; Steen , Hanno; Steen, Judith AJ; Hamprecht , Fred A

    2008-01-01

    Background The reliable extraction of features from mass spectra is a fundamental step in the automated analysis of proteomic mass spectrometry (MS) experiments. Results This contribution proposes a sparse template regression approach to peak picking called NITPICK. NITPICK is a Non-greedy, Iterative Template-based peak PICKer that deconvolves complex overlapping isotope distributions in multicomponent mass spectra. NITPICK is based on fractional averagine, a novel extension to Senko's well-known averagine model, and on a modified version of sparse, non-negative least angle regression, for which a suitable, statistically motivated early stopping criterion has been derived. The strength of NITPICK is the deconvolution of overlapping mixture mass spectra. Conclusion Extensive comparative evaluation has been carried out and results are provided for simulated and real-world data sets. NITPICK outperforms pepex, to date the only alternate, publicly available, non-greedy feature extraction routine. NITPICK is available as software package for the R programming language and can be downloaded from . PMID:18755032

  20. ActiveSeismoPick3D - automatic first arrival determination for large active seismic arrays

    NASA Astrophysics Data System (ADS)

    Paffrath, Marcel; Küperkoch, Ludger; Wehling-Benatelli, Sebastian; Friederich, Wolfgang

    2016-04-01

    We developed a tool for automatic determination of first arrivals in active seismic data based on an approach, that utilises higher order statistics (HOS) and the Akaike information criterion (AIC), commonly used in seismology, but not in active seismics. Automatic picking is highly desirable in active seismics as the number of data provided by large seismic arrays rapidly exceeds of what an analyst can evaluate in a reasonable amount of time. To bring the functionality of automatic phase picking into the context of active data, the software package ActiveSeismoPick3D was developed in Python. It uses a modified algorithm for the determination of first arrivals which searches for the HOS maximum in unfiltered data. Additionally, it offers tools for manual quality control and postprocessing, e.g. various visualisation and repicking functionalities. For flexibility, the tool also includes methods for the preparation of geometry information of large seismic arrays and improved interfaces to the Fast Marching Tomography Package (FMTOMO), which can be used for the prediction of travel times and inversion for subsurface properties. Output files are generated in the VTK format, allowing the 3D visualization of e.g. the inversion results. As a test case, a data set consisting of 9216 traces from 64 shots was gathered, recorded at 144 receivers deployed in a regular 2D array of a size of 100 x 100 m. ActiveSeismoPick3D automatically checks the determined first arrivals by a dynamic signal to noise ratio threshold. From the data a 3D model of the subsurface was generated using the export functionality of the package and FMTOMO.

  1. Automatic seed picking for brachytherapy postimplant validation with 3D CT images.

    PubMed

    Zhang, Guobin; Sun, Qiyuan; Jiang, Shan; Yang, Zhiyong; Ma, Xiaodong; Jiang, Haisong

    2017-06-22

    Postimplant validation is an indispensable part in the brachytherapy technique. It provides the necessary feedback to ensure the quality of operation. The ability to pick implanted seed relates directly to the accuracy of validation. To address it, an automatic approach is proposed for picking implanted brachytherapy seeds in 3D CT images. In order to pick seed configuration (location and orientation) efficiently, the approach starts with the segmentation of seed from CT images using a thresholding filter which based on gray-level histogram. Through the process of filtering and denoising, the touching seed and single seed are classified. The true novelty of this approach is found in the application of the canny edge detection and improved concave points matching algorithm to separate touching seeds. Through the computation of image moments, the seed configuration can be determined efficiently. Finally, two different experiments are designed to verify the performance of the proposed approach: (1) physical phantom with 60 model seeds, and (2) patient data with 16 cases. Through assessment of validated results by a medical physicist, the proposed method exhibited promising results. Experiment on phantom demonstrates that the error of seed location and orientation is within ([Formula: see text]) mm and ([Formula: see text])[Formula: see text], respectively. In addition, the most seed location and orientation error is controlled within 0.8 mm and 3.5[Formula: see text] in all cases, respectively. The average process time of seed picking is 8.7 s per 100 seeds. In this paper, an automatic, efficient and robust approach, performed on CT images, is proposed to determine the implanted seed location as well as orientation in a 3D workspace. Through the experiments with phantom and patient data, this approach also successfully exhibits good performance.

  2. PEAK LIMITING AMPLIFIER

    DOEpatents

    Goldsworthy, W.W.; Robinson, J.B.

    1959-03-31

    A peak voltage amplitude limiting system adapted for use with a cascade type amplifier is described. In its detailed aspects, the invention includes an amplifier having at least a first triode tube and a second triode tube, the cathode of the second tube being connected to the anode of the first tube. A peak limiter triode tube has its control grid coupled to thc anode of the second tube and its anode connected to the cathode of the second tube. The operation of the limiter is controlled by a bias voltage source connected to the control grid of the limiter tube and the output of the system is taken from the anode of the second tube.

  3. INDIAN PEAKS WILDERNESS, COLORADO.

    USGS Publications Warehouse

    Pearson, Robert C.; Speltz, Charles N.

    1984-01-01

    The Indian Peaks Wilderness northwest of Denver is partly within the Colorado Mineral Belt, and the southeast part of it contains all the geologic characteristics associated with the several nearby mining districts. Two deposits have demonstrated mineral resources, one of copper and the other of uranium; both are surrounded by areas with probable potential. Two other areas have probable resource potential for copper, gold, and possibly molydenum. Detailed gravity and magnetic studies in the southeast part of the Indian Peaks Wilderness might detect in the subsurface igneous bodies that may be mineralized. Physical exploration such as drilling would be necessary to determine more precisely the copper resources at the Roaring Fork locality and uranium resources at Wheeler Basin.

  4. PEAK READING VOLTMETER

    DOEpatents

    Dyer, A.L.

    1958-07-29

    An improvement in peak reading voltmeters is described, which provides for storing an electrical charge representative of the magnitude of a transient voltage pulse and thereafter measuring the stored charge, drawing oniy negligible energy from the storage element. The incoming voltage is rectified and stored in a condenser. The voltage of the capacitor is applied across a piezoelectric crystal between two parallel plates. Amy change in the voltage of the capacitor is reflected in a change in the dielectric constant of the crystal and the capacitance between a second pair of plates affixed to the crystal is altered. The latter capacitor forms part of the frequency determlning circuit of an oscillator and means is provided for indicating the frequency deviation which is a measure of the peak voltage applied to the voltmeter.

  5. Comparison of Assurance GDS(®) MPX ID for Top STEC with Reference Culture Methods for the Detection of E. coli Top 6 STEC; Direct Confirmation of Top 6 STEC from Isolation Plates and Determination of Equivalence of PickPen(®) and FSIS OctoMACS™ Concentration Protocols.

    PubMed

    Feldsine, Philip; Lienau, Andrew H; Shah, Khyati; Immermann, Amy; Soliven, Khanh; Kaur, Mandeep; Kerr, David E; Jucker, Markus; Hammack, Tom; Brodsky, Michael; Agin, James

    2016-01-01

    Assurance GDS(®) MPX ID for Top Shiga toxin-producing Escherichia coli (STEC; MPX ID) was validated according to the AOAC INTERNATIONAL Methods Committee Guidelines for Validation of Microbiological Methods for Foods and Environmental Surfaces as (1) a secondary screening method for specific detection of the Top 6 STEC serogroups (O26, O45, O103, O111, O121, and O145) in raw beef trim, raw ground beef, raw spinach, and on stainless steel; and (2) as a confirmatory method for the identification of pure culture isolates as Top 6 STEC. MPX ID is used in conjunction with the upfront BCS Assurance GDS MPX Top 7 STEC assay. This Performance Tested Method(SM) validation has two main parts: Method Developer studies and the Independent Laboratory study. A total of 180 samples and controls were analyzed. Results showed that MPX ID had no statistically significant differences with the reference culture methods for the detection of Top 6 STEC in the food matrixes (raw beef trim, raw ground beef, and raw spinach) and environmental sponges (stainless steel) studied. Inclusivity/exclusivity studies were also conducted. One hundred percent inclusivity among the 50 Top 6 STEC serovars tested and 100% exclusivity for the 30 non-Top 6 STEC organisms tested were demonstrated. For validation of MPX ID as a confirmatory method for isolated colonies, all inclusivity and exclusivity organisms were streaked for isolation onto five STEC plating media: modified rainbow agar, Levine's eosin-methylene blue (L-EMB) agar, rainbow agar with novobiocin and cefixime, and enterohemolysin agar with selective agents as well as trypticase soy agar with yeast extract. These isolated colonies were suspended and analyzed by Assurance GDS MPX Top 7 STEC and MPX ID. MPX ID was able to correctly confirm all inclusivity organisms from all plate types, except two STEC isolates from L-EMB agar plates only in the Independent Laboratory study. All exclusivity organisms were correctly determined by MPX ID as non

  6. Evaluation of Target Picking Methods for Magnetic Data

    DTIC Science & Technology

    2008-03-01

    Pine Ridge Reservation in South Dakota and at 29 Palms in California (Barrow, 1998). The results of this test showed the automatic processor...The reservation is bordered on the north by the Sandia Military Reservation, which includes Kirtland Air Force Base, the Manzano Mountains on the east

  7. Reliable spectrometric fiber Bragg grating peak detection

    NASA Astrophysics Data System (ADS)

    Magalhães, Filipe; Martins, Paulo; Ferreira, Luís. A.; Araújo, Francisco M.

    2015-09-01

    A method for reliable fiber Bragg grating peak detection compatible with spectrometric demodulation schemes is presented. High immunity to differential losses and independency on the threshold settings was achieved. The effectiveness of the demonstrated method was corroborated by a 3σ accuracy of 2pm determined over 109 samples of 100 resonant peaks multiplexed in [1500; 1600] nm spectral range acquired throughout a year.

  8. Pick_sw: a program for interactive picking of S-wave data, version 2.00

    USGS Publications Warehouse

    Ellefsen, Karl J.

    2002-01-01

    Program pick_sw is used to interactively pick travel times from S-wave data. It is assumed that the data are collected using 2 shots of opposite polarity at each shot location. The traces must be in either the SEG-2 format or the SU format. The program is written in the IDL and C programming languages, and the program is executed under the Windows operating system. (The program may also execute under other operating systems like UNIX if the C language functions are re-compiled).

  9. Why Not Rent a Truck to Pick Up Textbooks?

    ERIC Educational Resources Information Center

    Crossland, Stephen K.; Tubbs, Randahl L.

    1979-01-01

    High freight costs stimulated the idea of renting a truck to pick up publisher textbook orders. Benefits, including lower cost per 100 pounds of freight and scheduling when there is room to receive cartons and crew to process the books, outweigh the problems encountered. (MLW)

  10. Point Picking and Distributing on the Disc and Sphere

    DTIC Science & Technology

    2015-07-01

    the originator. Army Research Laboratory Aberdeen Proving Ground, MD 21005-5066 ARL-TR-7333 July 2015 Point Picking and Distributing on ...and Distributing on the Disc and Sphere 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) Mary K Arthur 5d

  11. An Introduction to SPEAR (Seismogram Picking Error from Analyst Review)

    NASA Astrophysics Data System (ADS)

    Zeiler, C. P.; Velasco, A. A.; Anderson, D.; Pingitore, N. E.

    2008-12-01

    A grassroots initiative began in February of 2008 at the University of Texas at El Paso to understand how seismologists measure earthquakes. The Seismogram Picking Error from Analyst Review (SPEAR) project is designed to be a forum where seismologists can propose, discuss and experimentally test theories on proper procedures to identify and measure seismic phases. We outline the history of seismogram analysis and explore areas of seismogram analysis that still need to be defined. The main concern for SPEAR, at this time, is the impact of picking errors produced by merging earthquake catalogs. Our initial effort has been to establish a common data set for seismologists to pick. The preliminary studies from this data set have shown that significant bias between authors of catalogs may exist. We provide techniques to ensure that these biases can be identified and correctly managed to provide accurate mergers of earthquake measurements. The overall goal of SPEAR is to provide a repository of information to aid seismologists in comparing and sharing measurements. We want to document in the repository and explore all aspects of the picking process, from the basics of learning how to read a seismogram to complex transformations and enhancements of signals. Your participation in SPEAR will aid the seismological community to close the knowledge gaps that exist in seismogram analysis.

  12. A case of progressive aphasia without dementia: "temporal" Pick's disease?

    PubMed Central

    Scheltens, P; Hazenberg, G J; Lindeboom, J; Valk, J; Wolters, E C

    1990-01-01

    We report a patient who suffered from progressive aphasia for nine years, before developing mild behavioural disturbances. Sequential computed tomography (CT) scanning and magnetic resonance (MRI) imaging showed progressive bilateral temporal atrophy. The case is thought to be a temporal form of Pick's disease, in which isolated progressive aphasia was the only symptom over many years. Images PMID:2303835

  13. 61. Picking Floor, Large Pile of Waste Rock and Wood ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    61. Picking Floor, Large Pile of Waste Rock and Wood date unknown Historic Photograph, Photographer Unknown; Collection of William Everett, Jr. (Wilkes-Barre, PA), photocopy by Joseph E.B. Elliot - Huber Coal Breaker, 101 South Main Street, Ashley, Luzerne County, PA

  14. "Micro-robots" pick up a glass bead

    SciTech Connect

    2011-01-01

    "Micro-robots", which are really collections of particles animated by magnetic fields, pick up a glass bead and move it around the screen. Each movement is precisely controlled. The "asters" were designed by Alexey Snezkho and Igor Aronson at Argonne National Laboratory. Video courtesy Nature Materials. Read the full story at http://go.usa.gov/KAT

  15. Systematic Approaches to Experimentation: The Case of Pick's Theorem

    ERIC Educational Resources Information Center

    Papadopoulos, Ioannis; Iatridou, Maria

    2010-01-01

    In this paper two 10th graders having an accumulated experience on problem-solving ancillary to the concept of area confronted the task to find Pick's formula for a lattice polygon's area. The formula was omitted from the theorem in order for the students to read the theorem as a problem to be solved. Their working is examined and emphasis is…

  16. A near fatal case of pathological skin picking.

    PubMed

    Kim, Daniel I; Garrison, Roger C; Thompson, Gary

    2013-01-01

    Female, 51 FINAL DIAGNOSIS: Patological skin picking Symptoms: Aphasia • headache • hemiparesis • incontinence - Clinical Procedure: - Specialty: Dermatology. Challenging differential diagnosis. Pathological skin picking (PSP) disorder is characterized by repetitive and compulsive picking of the skin resulting in tissue damage. PSP has been shown to affect 5.4% of a community sample, 4% of college students, and 2% of patients seen in a dermatology clinic. It can be associated with significant disfigurement. The diagnosis requires obtaining a careful history and high clinical suspicion. We report a previously healthy 51-year-old Caucasian female with a history of "acne" who presented with new onset right-sided hemiparesis, mild aphasia and an episode of incontinence. She had memory loss of the prior few days. She also complained of a four-day history of intense headaches and dizziness. CT and MRI of the head showed encephalomalacia involving the left frontal and parietal lobes. Further history from the patient revealed that the patient had been picking at her forehead with a sewing needle and later with a long knitting needle. PSP is a prevalent disorder, which can have potentially serious health consequences. Besides potential disfigurement and scarring, PSP can have significant morbidity and mortality. Early diagnosis and appropriate treatment by clinicians are essential to prevent potentially fatal consequences.

  17. Why Not Rent a Truck to Pick Up Textbooks?

    ERIC Educational Resources Information Center

    Crossland, Stephen K.; Tubbs, Randahl L.

    1979-01-01

    High freight costs stimulated the idea of renting a truck to pick up publisher textbook orders. Benefits, including lower cost per 100 pounds of freight and scheduling when there is room to receive cartons and crew to process the books, outweigh the problems encountered. (MLW)

  18. Peaking Into the Dark

    NASA Image and Video Library

    2017-09-28

    In this dramatic scene, an unnamed crater in Mercury's northern volcanic plains is bathed in darkness as the sun sits low on the horizon. Rising from the floor of the crater is its central peak, a small mountain resulting from the crater's formation. A central peak is a type of crater morphology that lies between "simple" and "peak ring" in the range of crater morphology on Mercury. This image was acquired as a high-resolution targeted observation. Targeted observations are images of a small area on Mercury's surface at resolutions much higher than the 200-meter/pixel morphology base map. It is not possible to cover all of Mercury's surface at this high resolution, but typically several areas of high scientific interest are imaged in this mode each week. The MESSENGER spacecraft is the first ever to orbit the planet Mercury, and the spacecraft's seven scientific instruments and radio science investigation are unraveling the history and evolution of the Solar System's innermost planet. During the first two years of orbital operations, MESSENGER acquired over 150,000 images and extensive other data sets. MESSENGER is capable of continuing orbital operations until early 2015. Credit: NASA/Johns Hopkins University Applied Physics Laboratory/Carnegie Institution of Washington NASA image use policy. NASA Goddard Space Flight Center enables NASA’s mission through four scientific endeavors: Earth Science, Heliophysics, Solar System Exploration, and Astrophysics. Goddard plays a leading role in NASA’s accomplishments by contributing compelling scientific knowledge to advance the Agency’s mission. Follow us on Twitter Like us on Facebook Find us on Instagram

  19. Kitt Peak speckle camera

    NASA Technical Reports Server (NTRS)

    Breckinridge, J. B.; Mcalister, H. A.; Robinson, W. G.

    1979-01-01

    The speckle camera in regular use at Kitt Peak National Observatory since 1974 is described in detail. The design of the atmospheric dispersion compensation prisms, the use of film as a recording medium, the accuracy of double star measurements, and the next generation speckle camera are discussed. Photographs of double star speckle patterns with separations from 1.4 sec of arc to 4.7 sec of arc are shown to illustrate the quality of image formation with this camera, the effects of seeing on the patterns, and to illustrate the isoplanatic patch of the atmosphere.

  20. Kitt Peak speckle camera

    NASA Technical Reports Server (NTRS)

    Breckinridge, J. B.; Mcalister, H. A.; Robinson, W. G.

    1979-01-01

    The speckle camera in regular use at Kitt Peak National Observatory since 1974 is described in detail. The design of the atmospheric dispersion compensation prisms, the use of film as a recording medium, the accuracy of double star measurements, and the next generation speckle camera are discussed. Photographs of double star speckle patterns with separations from 1.4 sec of arc to 4.7 sec of arc are shown to illustrate the quality of image formation with this camera, the effects of seeing on the patterns, and to illustrate the isoplanatic patch of the atmosphere.

  1. Twin Peaks - 3D

    NASA Technical Reports Server (NTRS)

    1997-01-01

    The two hills in the distance, approximately one to two kilometers away, have been dubbed the 'Twin Peaks' and are of great interest to Pathfinder scientists as objects of future study. 3D glasses are necessary to identify surface detail. The white areas on the left hill, called the 'Ski Run' by scientists, may have been formed by hydrologic processes.

    The IMP is a stereo imaging system with color capability provided by 24 selectable filters -- twelve filters per 'eye.

    Click below to see the left and right views individually. [figure removed for brevity, see original site] Left [figure removed for brevity, see original site] Right

  2. Sunset over "Twin Peaks"

    NASA Image and Video Library

    1997-08-06

    This image was taken by the Imager for Mars Pathfinder (IMP) about one minute after sunset on Mars on Sol 21. The prominent hills dubbed "Twin Peaks" form a dark silhouette at the horizon, while the setting sun casts a pink glow over the darkening sky. The image was taken as part of a twilight study which indicates how the brightness of the sky fades with time after sunset. Scientists found that the sky stays bright for up to two hours after sunset, indicating that Martian dust extends very high into the atmosphere. http://photojournal.jpl.nasa.gov/catalog/PIA00783

  3. [Picking up and analysis of the surface myoelectric signals of respiratory muscule].

    PubMed

    Weng, J F; Long, S C

    2001-07-01

    In this paper, we introduce the technique used to obtain the surface diaphragmatic EMG and monitor respiratory activity. The signals are picked up from the ECG electrodes. By using an ECG masking system based on a digital processor, the dominant effect of the ECG (that is R-wave, P-wave and T-wave) was removed. Initial clinical measurements indicate this EMG method is more direct and effective than others for monitoring respiratory activity. It is hoped that this method can be used to monitor the development of respiratory function.

  4. Implementation and testing of a real-time 3-component phase picking program for Earthworm using the CECM algorithm

    NASA Astrophysics Data System (ADS)

    Baker, B. I.; Friberg, P. A.

    2014-12-01

    Modern seismic networks typically deploy three component (3C) sensors, but still fail to utilize all of the information available in the seismograms when performing automated phase picking for real-time event location. In most cases a variation on a short term over long term average threshold detector is used for picking and then an association program is used to assign phase types to the picks. However, the 3C waveforms from an earthquake contain an abundance of information related to the P and S phases in both their polarization and energy partitioning. An approach that has been overlooked and has demonstrated encouraging results is the Component Energy Comparison Method (CECM) by Nagano et al. as published in Geophysics 1989. CECM is well suited to being used in real-time because the calculation is not computationally intensive. Furthermore, the CECM method has fewer tuning variables (3) than traditional pickers in Earthworm such as the Rex Allen algorithm (N=18) or even the Anthony Lomax Filter Picker module (N=5). In addition to computing the CECM detector we study the detector sensitivity by rotating the signal into principle components as well as estimating the P phase onset from a curvature function describing the CECM as opposed to the CECM itself. We present our results implementing this algorithm in a real-time module for Earthworm and show the improved phase picks as compared to the traditional single component pickers using Earthworm.

  5. Estimation of peak winds from hourly observations

    NASA Technical Reports Server (NTRS)

    Graves, M. E.

    1973-01-01

    Two closely related methods to obtain estimates of the hourly peak wind at Cape Kennedy were compared by statistical tests. The methods evaluated the Monin-Obukhov stability length and the standard deviation of the hourly observed wind speed, so as to augment the latter quantity by F standard deviations. F is an optimized factor. A third method utilizing an optimized gust factor was also applied to the hourly wind. The latter procedure estimated 2952 peak winds with an rms error of 2.81 knots, an accuracy which was not surpassed by the other methods. Peak ground wind speed data were developed for use in space shuttle design operation analyses.

  6. Evaluation of alignment methods and data pretreatments on the determination of the most important peaks for the discrimination of coffee varieties Arabica and Robusta using gas chromatography-mass spectroscopy.

    PubMed

    Hovell, A M C; Pereira, E J; Arruda, N P; Rezende, C M

    2010-09-30

    Coffee samples were analyzed by GC/MS in order to determine the most important peaks for the discrimination of the varieties Arabica and Robusta. The resulting peak tables from chromatographic analysis were aligned and pretreated before being submitted to multivariate analysis. A rapid and easy-to-perform peak alignment procedure, which does not require advanced programming skills to use, was compared with the tedious manual alignment procedure. The influence of three types of data pretreatment, normalization, logarithmic and square root transformations and their combinations, on the variables selected as most important by the regression coefficients of partial least squares-discriminant analysis (PLS-DA), are shown. Test samples different from those used in the calibration and comparison with the substances already known as being responsible for Arabica and Robusta coffees discrimination were used to determine the best pretreatments for both datasets. The data pretreatment consisting of square root transformation followed by normalization (RN) was chosen as being the most appropriate. The results obtained showed that the much quicker automated aligned method could be used as a substitute for the manually aligned method, allowing all the peaks in the chromatogram to be used for multivariate analysis. Copyright © 2010 Elsevier B.V. All rights reserved.

  7. Identification of Two Sulfated Cholesterol Metabolites Found in the Urine of a Patient with Niemann–Pick Disease Type C as Novel Candidate Diagnostic Markers

    PubMed Central

    Maekawa, Masamitsu; Omura, Kaoru; Sekiguchi, Shoutaro; Iida, Takashi; Saigusa, Daisuke; Yamaguchi, Hiroaki; Mano, Nariyasu

    2016-01-01

    In the urine of a Niemann–Pick disease type C (NPC) patient, we have identified three characteristic intense peaks that have not been observed in the urine of a 3β-hydroxysteroid-Δ5-C27-steroid dehydrogenase deficiency patient or a healthy infant and adult. Based on accurate masses of the protonated molecules, we focused on two of them as candidate NPC diagnostic markers. Two synthesized authentic preparations agreed with the two compounds found in NPC patient urine in regard to both chromatographic behavior and accurate masses of the deprotonated molecules. Moreover, the isotopic patterns of the deprotonated molecules, twin peaks unique to the sulfur-containing compounds appearing in their second isotope positions, and accurate masses of product ions observed at m/z 97 also agreed between the target compounds and authentic preparations. We identified the two compounds as the sulfated cholesterol metabolites as 3β-sulfooxy-7β-hydroxy-5-cholen-24-oic acid and 3β-sulfooxy-7-oxo-5-cholen-24-oic acid. These two compounds represent more promising candidate diagnostic markers for NPC diagnosis than three other candidates that are multiple conjugates of cholesterol metabolites, 3β-sulfooxy-7β-N-acetylglucosaminyl-5-cholen-24-oic acid and its glycine and taurine conjugates, although we have reported an analytical method for determining the urinary levels of these compounds using liquid chromatography/electrospray ionization tandem mass spectrometry, because of their lack of N-acetylglucosamine conjugation. PMID:27900236

  8. Evaluating the Magnitude and Duration of Cold Load Pick-up on Residential Distribution Feeders Using Multi-State Load Models

    SciTech Connect

    Schneider, Kevin P.; Sortomme, Eric; Venkata, S. S.; Miller, Melanie T.; Ponder, Leslie

    2016-09-01

    The increased level of demand that is associated with the restoration of service after an outage, Cold Load Pick-Up (CLPU), can be significantly higher than pre-outage levels, even exceeding the normal distribution feeder peak demand. These high levels of demand can delay restoration efforts and in extreme cases damage equipment. The negative impacts of CLPU can be mitigated with strategies that restore the feeder in sections, minimizing the load current. The challenge for utilities is to manage the current level on critical equipment while minimizing the time to restore service to all customers. Accurately modeling CLPU events is the first step in developing improved restoration strategies that minimize restoration times. This paper presents a new method for evaluating the magnitude of the CLPU peak, and its duration, using multi-state load models. The use of multi-state load models allows for a more accurate representation of the end-use loads that are present on residential distribution feeders.

  9. P and S automatic picks for 3D earthquake tomography in NE Italy

    NASA Astrophysics Data System (ADS)

    Lovisa, L.; Bragato, P.; Gentili, S.

    2006-12-01

    Earthquake tomography is useful to study structural and geological features of the crust. In particular, it uses P and S arrival times for reconstructing weaves velocity fields and locating earthquakes hypocenters. However, tomography needs a large effort to provide a high number of manual picks. On the other side, many automatic picking methods have been proposed, but they are usually applied to preliminary elaboration of the data (fast alert and automatic bulletin generation); they are generally considered not reliable for tomography. In this work, we present and discuss the results of Vp, Vs and Vp/Vs tomographies obtained using automatic picks generated by the system TAPNEI (Gentili and Bragato 2006), applied in the NE Italy. Preliminarily, in order to estimate the error in comparison with the unknown true arrival times, an analysis on the picking quality is done. The tests have been performed using two dataset: the first is made up by 240 earthquakes automatically picked by TAPNEI; the second counts in the same earthquakes but manually picked (OGS database). The grid and the software used to perform tomography (Sim28, Michelini and Mc Evilly, 1991) are the same in the two cases. Vp, Vs and Vp/Vs fields of the two tomographies and their differences are shown on vertical sections. In addiction, the differences in earthquakes locations are studied; in particular, the quality of the accuracy of the localizations has been analyzed by estimating the distance of the hypocenter distributions with respect to the manual locations. The analysis include also a qualitative comparison with an independent tomography (Gentile et al., 2000) performed using Simulps (Evans et al, 1994) on a set of 224 earthquakes accurately selected and manually relocated. The quality of the pickings and the comparison with the tomography obtained by manual data suggest that earthquake tomography with automatic data can provide reliable results. We suggest the use of such data when a large

  10. 21 CFR 872.6650 - Massaging pick or tip for oral hygiene.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Massaging pick or tip for oral hygiene. 872.6650... (CONTINUED) MEDICAL DEVICES DENTAL DEVICES Miscellaneous Devices § 872.6650 Massaging pick or tip for oral hygiene. (a) Identification. A massaging pick or tip for oral hygiene is a rigid, pointed device...

  11. A Preliminary Analysis of the Phenomenology of Skin-Picking in Prader-Willi Syndrome

    ERIC Educational Resources Information Center

    Morgan, Jessica R.; Storch, Eric A.; Woods, Douglas W.; Bodzin, Danielle; Lewin, Adam B.; Murphy, Tanya K.

    2010-01-01

    To examine the nature and psychosocial correlates of skin-picking behavior in youth with Prader-Willi Syndrome (PWS). Parents of 67 youth (aged 5-19 years) with PWS were recruited to complete an internet-based survey that included measures of: skin-picking behaviors, the automatic and/or focused nature of skin-picking, severity of skin-picking…

  12. A Preliminary Analysis of the Phenomenology of Skin-Picking in Prader-Willi Syndrome

    ERIC Educational Resources Information Center

    Morgan, Jessica R.; Storch, Eric A.; Woods, Douglas W.; Bodzin, Danielle; Lewin, Adam B.; Murphy, Tanya K.

    2010-01-01

    To examine the nature and psychosocial correlates of skin-picking behavior in youth with Prader-Willi Syndrome (PWS). Parents of 67 youth (aged 5-19 years) with PWS were recruited to complete an internet-based survey that included measures of: skin-picking behaviors, the automatic and/or focused nature of skin-picking, severity of skin-picking…

  13. Kitt Peak Observes Comet

    NASA Technical Reports Server (NTRS)

    2005-01-01

    The Kitt Peak National Observatory's 2.1-meter telescope observed comet Tempel 1 on April 11, 2005, when the comet was near its closest approach to the Earth. A pinkish dust jet is visible to the southwest, with the broader neutral gas coma surrounding it. North is up, East is to the left, and the field of view is about 80,000 km (50,000 miles) wide. The Sun was almost directly behind the observer at this time. The red, green and blue bars in the background are stars that moved between the individual images.

    This pseudo-color picture was created by combining three black and white images obtained with different filters. The images were obtained with the HB Narrowband Comet Filters, using CN (3870 A - shown in blue), C2 (5140 A - shown in green) and RC (7128 A - shown in red). The CN and C2 filters capture different gas species (along with the underlying dust) while the RC filter captures just the dust.

  14. Generalized Fragment Picking in Rosetta: Design, Protocols and Applications

    PubMed Central

    Gront, Dominik; Kulp, Daniel W.; Vernon, Robert M.; Strauss, Charlie E. M.; Baker, David

    2011-01-01

    The Rosetta de novo structure prediction and loop modeling protocols begin with coarse grained Monte Carlo searches in which the moves are based on short fragments extracted from a database of known structures. Here we describe a new object oriented program for picking fragments that greatly extends the functionality of the previous program (nnmake) and opens the door for new approaches to structure modeling. We provide a detailed description of the code design and architecture, highlighting its modularity, and new features such as extensibility, total control over the fragment picking workflow and scoring system customization. We demonstrate that the program provides at least as good building blocks for ab-initio structure prediction as the previous program, and provide examples of the wide range of applications that are now accessible. PMID:21887241

  15. [Therapies in the Niemann-Pick type C disease].

    PubMed

    Chabrol, B

    2010-06-01

    Niemann-Pick type C disease is a lysosomal storage disease affecting intracellular cholesterol trafficking. Several clinical forms have been described, with a possible onset at all ages of life from the neonatal period to adulthood. The therapeutic approach was symptomatic only until recently, depending on the disability presented by the patient. A global management is essential and often required, taking into account all the problems observed, and includes nutrition care, speech therapy, physiotherapy, psychological support, or psychiatric cares. Improved knowledge on the pathophysiology of Niemann-Pick type C disease has to consider specific therapeutic strategies, the therapeutic target is represented by the progressive brain damage characteristic of this disease. Recently, the use of miglustat allows a number of cases of disease stabilization. The onset of treatment and monitoring will be the best in a reference center expert in the disease.

  16. Positronium in Solids: Computer Simulation of Pick-Off and Self-Annihilation

    SciTech Connect

    Bug, A; Muluneh, M; Waldman, J; Sterne, P

    2003-08-01

    Positronium (Ps) is simulated using Path Integral Monte Carlo (PIMC). This method can reproduce the results of previous simple theories in which a single quantum particle is used to represent Ps within an idealized pore. In addition, the calculations treat the e{sup -} and e{sup +} of Ps exactly and realistically model interactions with solid atoms, thereby correcting and extending the simpler theory. They study the pick-off lifetime of o-Ps and the internal contact density, {kappa}, which controls the self-annihilation behavior, for Ps in model voids (spherical pores), defects in a solid (argon), and microporous solids (zeolites).

  17. The "guitar pick" sign: a novel sign of retrobulbar hemorrhage.

    PubMed

    Theoret, Jonathan; Sanz, Geoffrey E; Matero, David; Guth, Todd; Erickson, Catherine; Liao, Michael M; Kendall, John L

    2011-05-01

    Retrobulbar hemorrhage is a rare complication of blunt ocular trauma. Without prompt intervention, permanent reduction in visual acuity can develop in as little as 90 minutes. We report a novel bedside ultrasound finding of conical deformation of the posterior ocular globe: the "guitar pick" sign. In our elderly patient, the ocular globe shape normalized post-lateral canthotomy and inferior cantholysis. Identifying this sonographic finding may add to the clinical examination when deciding whether to perform decompression.

  18. Premature Ventricular Complex Causing Ice-Pick Headache

    PubMed Central

    Ozturk, Selcuk

    2017-01-01

    Ice pick headache is a momentary, transient, repetitive headache disorder and manifests with the stabbing pains and jolts. The exact mechanism causing this disease is unknown. Premature ventricular contractions are early depolarization of the ventricular myocardium and in the absence of a structural heart disease, it is considered to be a benign disease. In this report, we describe a male patient presenting with the symptom of momentary headache attacks accompanied with instant chest pain which is associated with premature ventricular contraction. PMID:28367337

  19. Direct comparison of three different methods of volcanic edifice identification from bathymetry maps

    NASA Astrophysics Data System (ADS)

    Howell, J.; White, S. M.; Bohnenstiehl, D. R.; Miller, D.

    2009-12-01

    The detection of volcanic edifices from bathymetric sonar data is often used in studies of seamount distribution near arcs, ridges and hotspots to interpret volcanic spacing and alignment. Such studies form the basis for the ongoing debate on the structural controls on volcanism and our understanding of linkages between tectonics and volcanism. Until recently, manually picking closed-contour peaks from maps was the only method of volcanic edifice identification, however this can be subjective and time consuming. In this study we have compared the results from three separate methods: manually picking closed contours, using a peakshed method based on a widely used algorithm for detecting sinkholes in topographic data, and a closed-contour picking computer algorithm. Bathymetry from the western Aleutian backarc collected in 2005, the Galapagos Spreading Centers collected in 2006 and the Mid-Atlantic Ridge collected in 1990 was used as the comparison data. To each dataset, we applied a common set of criteria: minimum peak to base heights must be greater than 25 meters and aspect ratios (long to short axis of the basal contour) must be less than 1.5. The peakshed method begins by looking for local bathymetric peaks remaining after removing regional bathymetry using a median filter. The median filtered bathymetry grid was subtracted from the original bathymetric grid to obtain the residual bathymetry representing the volcanic edifices. We use a novel application of the method used to detect and remove local sinkholes from digital terrain models to define the basal boundary of each edifice. The residual bathymetry is first inverted, so that local peaks become local sinks, and then the area of the basin that drains into each sink is calculated using a GIS algorithm and returned as a closed polygon that represents the basal area of each edifice. This method has the advantage of using the full resolution of the gridded data to determine the volume of an edifice. The closed

  20. Automation of peak-tracking analysis of stepwise perturbed NMR spectra.

    PubMed

    Banelli, Tommaso; Vuano, Marco; Fogolari, Federico; Fusiello, Andrea; Esposito, Gennaro; Corazza, Alessandra

    2017-02-01

    We describe a new algorithmic approach able to automatically pick and track the NMR resonances of a large number of 2D NMR spectra acquired during a stepwise variation of a physical parameter. The method has been named Trace in Track (TINT), referring to the idea that a gaussian decomposition traces peaks within the tracks recognised through 3D mathematical morphology. It is capable of determining the evolution of the chemical shifts, intensity and linewidths of each tracked peak.The performances obtained in term of track reconstruction and correct assignment on realistic synthetic spectra were high above 90% when a noise level similar to that of experimental data were considered. TINT was applied successfully to several protein systems during a temperature ramp in isotope exchange experiments. A comparison with a state-of-the-art algorithm showed promising results for great numbers of spectra and low signal to noise ratios, when the graduality of the perturbation is appropriate. TINT can be applied to different kinds of high throughput chemical shift mapping experiments, with quasi-continuous variations, in which a quantitative automated recognition is crucial.

  1. Pick-up and impact of flexible bodies

    NASA Astrophysics Data System (ADS)

    Singh, H.; Hanna, J. A.

    2017-09-01

    Picking up, laying down, colliding, rolling, and peeling are partial-contact interactions involving moving discontinuities. We examine the balances of momentum and energy across a moving discontinuity in a string, with allowance for injection or dissipation by singular supplies. We split the energy dissipation according to its invariance properties, discuss analogies with systems of particles and connections with the literature on shocks and phase transition fronts in various bodies, and derive a compatibility relation between supplies of momentum and translation-invariant energy. For a moving contact discontinuity between a string and a smooth rigid plane in the presence of gravity, we find a surprising asymmetry between the processes of picking up and laying down, such that steady-state kinks in geometry and associated jumps in tension are not admissible during pick-up. This prediction is consistent with experimental observations. We briefly discuss related problems including the falling folded chain, peeling of an adhesive tape, and the ;chain fountain;. Our approach is applicable to the study of impact and locomotion, and to systems such as moored floating structures and some musical instruments that feature vibrating string and cable elements interacting with a surface.

  2. Clinical correlates of symptom severity in skin picking disorder.

    PubMed

    Grant, Jon E; Chamberlain, Samuel R

    2017-10-01

    Skin picking disorder (SPD) remains poorly understood with limited data regarding its underlying pathophysiology and appropriate treatment choices. One approach to refining our treatment of SPD might be to better understand the range of illness severity and the clinical associations with severity. 125 adults aged 18 to 65 with a primary, current DSM-5 diagnosis of SPD were assessed for the severity of their picking, using the Skin Picking Symptom Assessment Scale, and related mental health symptoms. To identify clinical and demographic measures associated with variation in disease severity, we utilized the statistical technique of partial least squares (PLS). Greater SPD symptom severity was associated with higher Barratt attentional impulsiveness and motor impulsivity, higher Eysenck impulsivity, higher state anxiety/depression, having a current anxiety disorder, and having a lifetime substance use disorder. The present analysis is, to our knowledge, the most complete assessment of clinical variables and their relationship to illness severity in a sample of adults with SPD. Aspects of impulsivity and anxiety are both strongly associated with worse illness severity, and functional disability, in SPD. Treatment approaches should incorporate these as possible treatment targets when developing new treatment approaches to this disorder. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. The Milwaukee Inventory for the Dimensions of Adult Skin Picking (MIDAS): initial development and psychometric properties.

    PubMed

    Walther, Michael R; Flessner, Christopher A; Conelea, Christine A; Woods, Douglas W

    2009-03-01

    This article describes the development and initial psychometric properties of the Milwaukee Inventory for the Dimensions of Adult Skin picking (MIDAS), a measure designed to assess "automatic" and "focused" skin picking. Data were collected from 92 participants who completed an anonymous internet-based survey. Results of an exploratory factor analysis revealed a two-factor solution. Factors 1 ("focused" picking scale) and 2 ("automatic" picking scale) each consisted of 6 items, and preliminary data demonstrated adequate internal consistency, good construct validity, and good discriminant validity. The MIDAS provides researchers with a reliable and valid assessment of "automatic" and "focused" skin picking.

  4. Disgust, shame and the psychosocial impact of skin picking: Evidence from an online support forum.

    PubMed

    Anderson, Suzy; Clarke, Victoria

    2017-04-01

    This article examines the accounts of individuals who problematically pick their skin and explores their subjective experiences. In total, 100 problem disclosure statements were taken from posts made to a publicly accessible online skin picking support forum. These posts were systematically analysed using thematic analysis. Themes of disgust, shame and psychosocial avoidance dominated the analysis and appeared central to the experience of skin picking. Skin picking was shown to be a heterogeneous experience with a complex emotional profile. We argue that disgust, shame and related avoidance behaviour should be considered when conceptualising skin picking and considering treatment interventions.

  5. Modeling the effect of channel number and interaction on consonant recognition in a cochlear implant peak-picking strategy.

    PubMed

    Verschuur, Carl

    2009-03-01

    Difficulties in speech recognition experienced by cochlear implant users may be attributed both to information loss caused by signal processing and to information loss associated with the interface between the electrode array and auditory nervous system, including cross-channel interaction. The objective of the work reported here was to attempt to partial out the relative contribution of these different factors to consonant recognition. This was achieved by comparing patterns of consonant feature recognition as a function of channel number and presence/absence of background noise in users of the Nucleus 24 device with normal hearing subjects listening to acoustic models that mimicked processing of that device. Additionally, in the acoustic model experiment, a simulation of cross-channel spread of excitation, or "channel interaction," was varied. Results showed that acoustic model experiments were highly correlated with patterns of performance in better-performing cochlear implant users. Deficits to consonant recognition in this subgroup could be attributed to cochlear implant processing, whereas channel interaction played a much smaller role in determining performance errors. The study also showed that large changes to channel number in the Advanced Combination Encoder signal processing strategy led to no substantial changes in performance.

  6. Syntabulin regulates the trafficking of PICK1-containing vesicles in neurons.

    PubMed

    Xu, Junyu; Wang, Na; Luo, Jian-Hong; Xia, Jun

    2016-02-12

    PICK1 (protein interacting with C-kinase 1) is a peripheral membrane protein that interacts with diverse membrane proteins. PICK1 has been shown to regulate the clustering and membrane localization of synaptic receptors such as AMPA (α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid) receptors, metabotropic glutamate receptor 7, and ASICs (acid-sensing ion channels). Moreover, recent evidence suggests that PICK1 can mediate the trafficking of various vesicles out from the Golgi complex in several cell systems, including neurons. However, how PICK1 affects vesicle-trafficking dynamics remains unexplored. Here, we show that PICK1 mediates vesicle trafficking by interacting with syntabulin, a kinesin-binding protein that mediates the trafficking of both synaptic vesicles and mitochondria in axons. Syntabulin recruits PICK1 onto microtubule structures and mediates the trafficking of PICK1-containing vesicles along microtubules. In neurons, syntabulin alters PICK1 expression by recruiting PICK1 into axons and regulates the trafficking dynamics of PICK1-containing vesicles. Furthermore, we show that syntabulin forms a complex with PICK1 and ASICs, regulates ASIC protein expression in neurons, and participates in ASIC-induced acidotoxicity.

  7. Skin picking behaviors: An examination of the prevalence and severity in a community sample.

    PubMed

    Hayes, Stephania L; Storch, Eric A; Berlanga, Lissette

    2009-04-01

    Body-focused repetitive behaviors such as skin picking have gained recent attention in the psychiatric literature. Prevalence of skin picking has not been well researched and is difficult to estimate; however, consequences of such behaviors can include severe medical complications and impaired social and occupational functioning. Given this, this study examined: (1) the prevalence and severity of skin picking in a nonclinical community sample, and (2) associations between skin picking and other measures of psychological functioning. Three hundred and fifty-four participants completed measures of psychological functioning and skin picking frequency and severity. A total of 62.7% endorsed some form of skin picking and 5.4% reported clinical levels of skin picking and associated distress/impact. Direct associations were found between skin picking and depressive, anxiety, and obsessive-compulsive symptoms, which may support the emotional regulation model of pathological skin picking. To establish proper diagnostic classification of pathological skin picking and optimize treatment planning and outcome, further investigation of functional relationships between skin picking and affective distress is needed.

  8. Syntabulin regulates the trafficking of PICK1-containing vesicles in neurons

    PubMed Central

    Xu, Junyu; Wang, Na; Luo, Jian-hong; Xia, Jun

    2016-01-01

    PICK1 (protein interacting with C-kinase 1) is a peripheral membrane protein that interacts with diverse membrane proteins. PICK1 has been shown to regulate the clustering and membrane localization of synaptic receptors such as AMPA (α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid) receptors, metabotropic glutamate receptor 7, and ASICs (acid-sensing ion channels). Moreover, recent evidence suggests that PICK1 can mediate the trafficking of various vesicles out from the Golgi complex in several cell systems, including neurons. However, how PICK1 affects vesicle-trafficking dynamics remains unexplored. Here, we show that PICK1 mediates vesicle trafficking by interacting with syntabulin, a kinesin-binding protein that mediates the trafficking of both synaptic vesicles and mitochondria in axons. Syntabulin recruits PICK1 onto microtubule structures and mediates the trafficking of PICK1-containing vesicles along microtubules. In neurons, syntabulin alters PICK1 expression by recruiting PICK1 into axons and regulates the trafficking dynamics of PICK1-containing vesicles. Furthermore, we show that syntabulin forms a complex with PICK1 and ASICs, regulates ASIC protein expression in neurons, and participates in ASIC-induced acidotoxicity. PMID:26868290

  9. Improvement in Excoriation (Skin-Picking) with use of Risperidone in a Patient with Developmental Disability.

    PubMed

    Roi, Cody; Bazzano, Alessandra

    2017-03-22

    Patients with Autism Spectrum Disorder present with a heterogeneous mix of features beyond the core symptoms of the disorder. These features can be emotional, cognitive or behavioral. Behavioral symptoms often include self-injury, and this may take the form of repetitive skin-picking. The prevalence of skin-picking disorder in Autism is unknown. Skin-picking may lead to significant medical and psychosocial complications. Recent data suggest that behavioral interventions may be more effective than medications at reducing skin-picking in neurotypical patients. In this case, an 11-year-old male with intellectual disability and autistic spectrum disorder, with self-injurious skin-picking, was treated with risperidone with complete resolution of skin-picking symptoms. risperidone has been approved for irritability and aggression in Autistic spectrum disorder, and may be a valuable treatment option for skin-picking in pediatric patients with developmental disabilities.

  10. The assessment of skin picking in adolescence: psychometric properties of the Skin Picking Scale-Revised (German version).

    PubMed

    Gallinat, Christina; Keuthen, Nancy J; Stefini, Annette; Backenstrass, Matthias

    2017-02-01

    Skin picking disorder has received growing attention since the release of DSM-5, yet there are no evidence-based assessment instruments for adolescent samples. The present study examines the psychometric properties of the Skin Picking Scale-Revised (SPS-R, German version) in adolescents. A total of 76 adolescents (96% female) completed the SPS-R, the Clinical Psychological Diagnostic System (KPD-38), and a questionnaire assessing demographics and clinical characteristics online. The SPS-R had high internal consistency (α = 0.89) and significant small-to-medium correlations with reduced competence skills, psychological impairment, general life satisfaction, social support, and social problems on the KPD-38. Similar to prior findings for adults, an exploratory factor analysis suggested a two-factor model for the SPS-R in adolescents. Group comparisons failed to show significant differences on SPS-R scores between participants with and without dermatological conditions. The current results suggest that the SPS-R can be useful in adolescent samples as a reliable and valid instrument for the assessment of skin picking severity. Future research investigating scale validity and factor structure in a clinical sample of adolescent skin pickers is warranted.

  11. Single-pulse picking at kHz repetition rates using a Ge plasma switch at the free-electron laser FELBE.

    PubMed

    Schmidt, J; Winnerl, S; Seidel, W; Bauer, C; Gensch, M; Schneider, H; Helm, M

    2015-06-01

    We demonstrate a system for picking of mid-infrared and terahertz (THz) radiation pulses from the free-electron laser (FEL) FELBE operating at a repetition rate of 13 MHz. Single pulses are reflected by a dense electron-hole plasma in a Ge slab that is photoexcited by amplified near-infrared (NIR) laser systems operating at repetition rates of 1 kHz and 100 kHz, respectively. The peak intensity of picked pulses is up to 400 times larger than the peak intensity of residual pulses. The required NIR fluence for picking pulses at wavelengths in the range from 5 μm to 30 μm is discussed. In addition, we show that the reflectivity of the plasma decays on a time scale from 100 ps to 1 ns dependent on the wavelengths of the FEL and the NIR laser. The plasma switch enables experiments with the FEL that require high peak power but lower average power. Furthermore, the system is well suited to investigate processes with decay times in the μs to ms regime, i.e., much longer than the 77 ns long pulse repetition period of FELBE.

  12. Single-pulse picking at kHz repetition rates using a Ge plasma switch at the free-electron laser FELBE

    SciTech Connect

    Schmidt, J. Helm, M.; Winnerl, S.; Seidel, W.; Schneider, H.; Bauer, C.; Gensch, M.

    2015-06-15

    We demonstrate a system for picking of mid-infrared and terahertz (THz) radiation pulses from the free-electron laser (FEL) FELBE operating at a repetition rate of 13 MHz. Single pulses are reflected by a dense electron-hole plasma in a Ge slab that is photoexcited by amplified near-infrared (NIR) laser systems operating at repetition rates of 1 kHz and 100 kHz, respectively. The peak intensity of picked pulses is up to 400 times larger than the peak intensity of residual pulses. The required NIR fluence for picking pulses at wavelengths in the range from 5 μm to 30 μm is discussed. In addition, we show that the reflectivity of the plasma decays on a time scale from 100 ps to 1 ns dependent on the wavelengths of the FEL and the NIR laser. The plasma switch enables experiments with the FEL that require high peak power but lower average power. Furthermore, the system is well suited to investigate processes with decay times in the μs to ms regime, i.e., much longer than the 77 ns long pulse repetition period of FELBE.

  13. Automatic picking and earthquake relocation for the Antilles subduction zone (1972-2013)

    NASA Astrophysics Data System (ADS)

    Massin, F.; Amorèse, D.; Bengoubou-Valerius, M.; Bernard, M.

    2013-12-01

    Locations for earthquake recorded in the Antilles subduction zone are processed separately by regional observatories and ISC. There is no earthquake location catalog available compiling all available first arrival data. We aim to produce a best complete earthquake catalog by merging all available first arrival data for better constrains on earthquake locations. ISC provides the first arrival data of 29243 earthquakes (magnitude range from 1.4 to 6.4) recorded by PRSN (Porto Rico), SRC (British West Indies), and form FUNVISIS (Venezuela). IPGP provided the first arrival data of 68718 earthquakes (magnitude from 0.1 to 7.5) recorded by OVSG (Guadeloupe, 53226 earthquakes since 1981) and by OVSM (Martinique, 29931 earthquakes since 1972). IPGP also provides the accelerometer waveform data of the GIS-RAP network in the Antilles. The final catalog contains 84979 earthquakes between 1972 and 2013, 24528 of which we compiled additional data. We achieved automatic picking using the Component Energy Correlation Method. The CECM provide high precision phase detection, a realistic estimation of picking error and realistic weights that can be used with manual pick weights. The CECM add an average of 3 P-waves and 2 S-waves arrivals to 3846 earthquakes recoded by the GIS-RAP network since 2002. Cluster analysis, earthquake local tomography and relative locations are to be applied in order to image active faulting and migration of seismicity. This will help to understand seismic coupling in the seismogenic zone as well as triggering mechanisms of intermediate depth seismicity like fluid migration beneath the volcanic arc.

  14. Peak flow meter use - slideshow

    MedlinePlus

    ... medlineplus.gov/ency/presentations/100202.htm Peak flow meter use - Series—Peak flow meter use - part one To use the sharing features ... 7 out of 7 Overview A peak flow meter helps you check how well your asthma is ...

  15. Detecting the Enceladus Neutral Torus via Water Group Pick Up Ions

    NASA Astrophysics Data System (ADS)

    Tokar, R. L.; Wilson, R. J.; Henderson, M. G.; Thomsen, M. F.; Sittler, E. C.; Johnson, R. E.

    2007-12-01

    One of the major discoveries1 of Cassini to date is the south polar icy plume at Enceladus (R ~ 4 RS). Models2 predict that this plume may be a source of both the extended (2-8 RS) OH neutral cloud observed by the Hubble space telescope3, and a new feature, a narrow (~0.5 to 1.0 RS) neutral water group torus centered on the Enceladus orbit. As the corotating and magnetically confined thermal plasma (mostly water group ions) streams through the gravitationally bound water group neutrals, charge exchange between the ions and neutrals is expected4 to occur yielding slower ions subsequently "picked up" by Saturn's magnetic field. The phase space density of these ions should show characteristics of a ring velocity distribution within the source, combined with subsequent scattering into a shell and possible adiabatic cooling at larger radial distances. Therefore, via analysis of Cassini in situ ion counting data, it may be possible to indirectly detect the neutral Enceladus torus, confirming the predictions in (2). In this study, Cassini plasma spectrometer (CAPS) data for equatorial orbits with favorable viewing5 are analyzed. The radial distance range of about 3.5 to 6.5 RS is considered covering data across the Enceladus orbit. Assuming flow speeds near co-rotation as reported in (6) yields a modeled water group ion core that is subtracted from the measured data. The resulting residual ion counting data has velocity space signatures resembling pick up ions. The strongest source region is identified about the Enceladus orbit with radial extent at least 1 RS, in qualitative agreement with predictions. Peak phase space density of these ions is perpendicular to the magnetic field, resembling a ring, as expected within the source region. At larger radial distances (e.g. R = 6 RS), the ring signature has evolved to a shell and the expected adiabatic cooling due to transport from the source outward is observed. Similarly strong pick up ion sources are not observed near the

  16. Year-round high physical activity levels in agropastoralists of Bolivian Andes: results from repeated measurements of DLW method in peak and slack seasons of agricultural activities.

    PubMed

    Kashiwazaki, Hiroshi; Uenishi, Kazuhiro; Kobayashi, Toshio; Rivera, Jose Orias; Coward, William A; Wright, Antony

    2009-01-01

    By the repeated use of the doubly labeled water method (DLW), this study aimed to investigate (1) the extent of changes in energy expenditure and physical activity level (PAL) in response to increased agricultural work demands, and (2) whether the seasonal work demands induce the changes in the fairly equitable division of work and similarity of energy needs between men and women observed in our previous study (Phase 1 study; Kashiwazaki et al., 1995: Am J Clin Nutr 62: 901-910). In a rural small agropastoral community of the Bolivian Andes, we made the follow-up study (Phase 2, 14 adults; a time of high agricultural activity) of the Phase 1 study (12 adults; a time of low agricultural activity). In the Phase 2 study, both men and women showed very high PAL (mean+/-SD), but there was no significant difference by sex (men; 2.18 +/- 0.23 (age; 64 +/- 11 years, n = 7), women; 2.26 +/- 0.25 (63 +/- 10 years, n = 7)). The increase of PAL by 11% (P = 0.023) in the Phase 2 was equally occurred in both men and women. The factorial approach underestimated PAL significantly by approximately 15% (P < 0.05). High PAL throughout the year ranging on average 2.0 and 2.2 was attributable to everyday tasks for subsistence and domestic works undertaking over 9-11 h (men spent 2.7 h on agricultural work and 4.7 h on animal herding, whereas women spent 7.3 h almost exclusively on animal herding). The seasonal increase in PAL was statistically significant, but it was smaller than those anticipated from published reports. A flexible division of labor played an important role in the equitable energetic increase in both men and women. (c) 2009 Wiley-Liss, Inc.

  17. Year-round high physical activity levels in agropastoralists of Bolivian Andes: Results from repeated measurements of DLW method in peak and slack seasons of agricultural activities

    PubMed Central

    Kashiwazaki, Hiroshi; Uenishi, Kazuhiro; Kobayashi, Toshio; Rivera, Jose Orias; Coward, William A; Wright, Antony

    2009-01-01

    By the repeated use of the doubly labeled water method (DLW), this study aimed to investigate (1) the extent of changes in energy expenditure and physical activity level (PAL) in response to increased agricultural work demands, and (2) whether the seasonal work demands induce the changes in the fairly equitable division of work and similarity of energy needs between men and women observed in our previous study (Phase 1 study; Kashiwazaki et al., 1995: Am J Clin Nutr 62: 901–910). In a rural small agropastoral community of the Bolivian Andes, we made the follow-up study (Phase 2, 14 adults; a time of high agricultural activity) of the Phase 1 study (12 adults; a time of low agricultural activity). In the Phase 2 study, both men and women showed very high PAL (mean±SD), but there was no significant difference by sex (men; 2.18 ± 0.23 (age; 64 ± 11 years, n = 7), women; 2.26 ± 0.25 (63 ± 10 years, n = 7)). The increase of PAL by 11% (P = 0.023) in the Phase 2 was equally occurred in both men and women. The factorial approach underestimated PAL significantly by ≈15% (P < 0.05). High PAL throughout the year ranging on average 2.0 and 2.2 was attributable to everyday tasks for subsistence and domestic works undertaking over 9–11 h (men spent 2.7 h on agricultural work and 4.7 h on animal herding, whereas women spent 7.3 h almost exclusively on animal herding). The seasonal increase in PAL was statistically significant, but it was smaller than those anticipated from published reports. A flexible division of labor played an important role in the equitable energetic increase in both men and women. Am. J. Hum. Biol., 2009. © 2009 Wiley-Liss, Inc. PMID:19127525

  18. Can the proximal isovelocity surface area method calculate stenotic mitral valve area in patients with associated moderate to severe aortic regurgitation? Analysis using low aliasing velocity of 10% of the peak transmitral velocity.

    PubMed

    Ikawa, H; Enya, E; Hirano, Y; Uehara, H; Ozasa, Y; Yamada, S; Ishikawa, K

    2001-02-01

    To assess the ability of the proximal isovelocity surface area (PISA) method to accurately measure the stenotic mitral valve area (MVA), and to assess whether aortic regurgitation (AR) affects the calculation, we compared the accuracy of the PISA method and the pressure half-time (PHT) method for determining MVA in patients with and without associated AR by using two-dimensional echocardiographic planimetry as a standard. The study population consisted of 45 patients with mitral stenosis. Seventeen of the 45 patients had associated moderate-to-severe AR. The PISA method was performed using low aliasing velocity (AV) of 10% of the peak transmitral velocity, which provided the most accurate estimation of MVA when compared with planimetry. The maximal radius r of the PISA was measured from the orifice to blue-red aliasing interface. Using the PISA method, MVA was calculated as (2pir(2)) x theta / 180 x AV/Vmax, where theta was the inflow angle formed by mitral leaflets, AV was the aliasing velocity (cm/sec), and Vmax was the peak transmitral velocity (cm/sec). MVA by the PISA method correlated well with planimetry both in patients with AR (r = 0.90, P < 0.001, SEE = 0.17 cm(2)) and without AR (r = 0.92, P < 0.001, SEE = 0.16 cm(2)). However, MVA by the PHT method did not correlate as well with planimetry (r = 0.57, P < 0.05, SEE = 0.37 cm(2)) in patients with associated AR, and the PHT method produced a significant overestimation (24%) of MVA obtained by planimetry in these patients. We conclude that the PISA method allows accurate estimation of MVA and is not influenced by AR.

  19. Data fusion analysis of a surface direct-current resistivity and well pick data set

    SciTech Connect

    Clayton, E.A.; Lewis, R.E.

    1995-09-01

    Pacific Northwest Laboratory (PNL) has been tasked with testing, debugging, and refining the Hanford Site data fusion workstation (DFW), with the assistance of Coleman Research Corporation (CRC), before delivering the DFW to the environmental restoration client at the Hanford Site. Data fusion is the mathematical combination (or fusion) of disparate data sets into a single interpretation. The data fusion software used in this study was developed by CRC. This report discusses the results of evaluating a surface direct-current (dc) resistivity and well-pick data set using two methods: data fusion technology and commercially available software (i.e., RESIX Plus from Interpex Ltd., Golden, Colorado), the conventional method of analysis. The report compares the two technologies; describes the survey, procedures, and results; and includes conclusions and recommendations. The surface dc resistivity and well-pick data set had been acquired by PNL from a study performed in May 1993 at Eielson Air Force Base near Fairbanks, Alaska. The resistivity survey data were acquired to map the top of permafrost in support of a hydrogeologic study. This data set provided an excellent opportunity to test and refine the dc resistivity capabilities of the DFW; previously, the data fusion software was untested on dc resistivity data. The DFW was used to evaluate the dc resistivity survey data and to produce a 3-dimensional earth model of the study area.

  20. A practical method for determining γ-ray full-energy peak efficiency considering coincidence-summing and self-absorption corrections for the measurement of environmental samples after the Fukushima reactor accident

    NASA Astrophysics Data System (ADS)

    Shizuma, Kiyoshi; Oba, Yurika; Takada, Momo

    2016-09-01

    A method for determining the γ-ray full-energy peak efficiency at positions close to three Ge detectors and at the well port of a well-type detector was developed for measuring environmental volume samples containing 137Cs, 134Cs and 40K. The efficiency was estimated by considering two correction factors: coincidence-summing and self-absorption corrections. The coincidence-summing correction for a cascade transition nuclide was estimated by an experimental method involving measuring a sample at the far and close positions of a detector. The derived coincidence-summing correction factors were compared with those of analytical and Monte Carlo simulation methods and good agreements were obtained. Differences in the matrix of the calibration source and the environmental sample resulted in an increase or decrease of the full-energy peak counts due to the self-absorption of γ-rays in the sample. The correction factor was derived as a function of the densities of several matrix materials. The present method was applied to the measurement of environmental samples and also low-level radioactivity measurements of water samples using the well-type detector.

  1. Wear Assessment of Conical Pick used in Coal Cutting Operation

    NASA Astrophysics Data System (ADS)

    Dewangan, Saurabh; Chattopadhyaya, Somnath; Hloch, Sergej

    2015-09-01

    Conical pick is a widely used tool for cutting coal in mines. It has a cemented carbide tip inserted in a steel body. Cemented carbide has been in use for many years for coal/rock cutting because it has the optimum combination of hardness, toughness and resistance against abrasive wear. As coal/rock is a heterogeneous substance, the cutting tool has to undergo various obstructions at the time of excavation that cause the tool to wear out. The cracks and fractures developing in the cemented carbide limit the life of the tool. For a long time, different wear mechanisms have been studied to develop improved grades of cemented carbide with high wear resistance properties. The research is still continuing. Moreover, due to the highly unpredictable nature of coal/rock, it is not easy to understand the wear mechanisms. In the present work, an attempt has been made to understand the wear mechanisms in four conical picks, which were used in a continuous miner machine for underground mining of coal. The wearing pattern of the conical pick indicates damage in its cemented carbide tip as well as the steel body. The worn out parts of the tools have been critically examined using scanning electron microscopy (SEM) and energy dispersive X-ray (EDX) point analysis. Mainly four types of wear mechanisms, namely, coal/rock intermixing, plastic deformation, rock channel formation and crushing and cracking, have been detected. The presence of coal/rock material and their respective concentrations in the selected area of worn out surface were observed using the spectra generated by EDX analysis.

  2. Pick-up of cometary protons by the solar wind

    SciTech Connect

    Neugebauer, M.; Lazarus, A.J.; Altwegg, K.; Balsiger, H.; Goldstein, B.E.; Goldstein, R.; Neubauer, F.M.; Rosenbauer, H.; Schwenn, R.; Shelley, E.G.

    1987-03-01

    The High Energy Range Spectrometer (HERS) of the Ion Mass Spectrometer on the Giotto spacecraft measured the 3-dimensional distribution of picked-up cometary protons over a distance of approximately 8 million km upstream of the bow shock of Comet Halley. The protons were observed to be elastically scattered out of their original cycloidal trajectories such that they were nonuniformly distributed over a spherical shell in velocity space. The shell radius (relative to its expected radius) and thickness increased as the bow shock was approached. Downstream of the shock, the cometary protons could not be distinguished from the heated solar wind protons.

  3. Collision free pick up and movement of large objects

    SciTech Connect

    Drotning, W.D.; McKee, G.R.

    1998-08-01

    An automated system is described for the sensor-based precision docking and manipulation of large objects. Past work in the remote handling of large nuclear waste containers is extensible to the problems associated with the handling of large objects such as coils of flat steel in industry. Computer vision and ultrasonic proximity sensing as described here are used to control the precision docking of large objects, and swing damped motion control of overhead cranes is used to control the position of the pick up device and suspended payload during movement. Real-time sensor processing and model-based control are used to accurately position payloads.

  4. Robust 3D object localization and pose estimation for random bin picking with the 3DMaMa algorithm

    NASA Astrophysics Data System (ADS)

    Skotheim, Øystein; Thielemann, Jens T.; Berge, Asbjørn; Sommerfelt, Arne

    2010-02-01

    Enabling robots to automatically locate and pick up randomly placed and oriented objects from a bin is an important challenge in factory automation, replacing tedious and heavy manual labor. A system should be able to recognize and locate objects with a predefined shape and estimate the position with the precision necessary for a gripping robot to pick it up. We describe a system that consists of a structured light instrument for capturing 3D data and a robust approach for object location and pose estimation. The method does not depend on segmentation of range images, but instead searches through pairs of 2D manifolds to localize candidates for object match. This leads to an algorithm that is not very sensitive to scene complexity or the number of objects in the scene. Furthermore, the strategy for candidate search is easily reconfigurable to arbitrary objects. Experiments reported in this paper show the utility of the method on a general random bin picking problem, in this paper exemplified by localization of car parts with random position and orientation. Full pose estimation is done in less than 380 ms per image. We believe that the method is applicable for a wide range of industrial automation problems where precise localization of 3D objects in a scene is needed.

  5. Detecting and Locating Seismic Events Without Phase Picks or Velocity Models

    NASA Astrophysics Data System (ADS)

    Arrowsmith, S.; Young, C. J.; Ballard, S.; Slinkard, M.

    2015-12-01

    The standard paradigm for seismic event monitoring is to scan waveforms from a network of stations and identify the arrival time of various seismic phases. A signal association algorithm then groups the picks to form events, which are subsequently located by minimizing residuals between measured travel times and travel times predicted by an Earth model. Many of these steps are prone to significant errors which can lead to erroneous arrival associations and event locations. Here, we revisit a concept for event detection that does not require phase picks or travel time curves and fuses detection, association and location into a single algorithm. Our pickless event detector exploits existing catalog and waveform data to build an empirical stack of the full regional seismic wavefield, which is subsequently used to detect and locate events at a network level using correlation techniques. Because the technique uses more of the information content of the original waveforms, the concept is particularly powerful for detecting weak events that would be missed by conventional methods. We apply our detector to seismic data from the University of Utah Seismograph Stations network and compare our results with the earthquake catalog published by the University of Utah. We demonstrate that the pickless detector can detect and locate significant numbers of events previously missed by standard data processing techniques.

  6. Predicting Peak Flows following Forest Fires

    NASA Astrophysics Data System (ADS)

    Elliot, William J.; Miller, Mary Ellen; Dobre, Mariana

    2016-04-01

    Following forest fires, peak flows in perennial and ephemeral streams often increase by a factor of 10 or more. This increase in peak flow rate may overwhelm existing downstream structures, such as road culverts, causing serious damage to road fills at stream crossings. In order to predict peak flow rates following wildfires, we have applied two different tools. One is based on the U.S.D.A Natural Resource Conservation Service Curve Number Method (CN), and the other is by applying the Water Erosion Prediction Project (WEPP) to the watershed. In our presentation, we will describe the science behind the two methods, and present the main variables for each model. We will then provide an example of a comparison of the two methods to a fire-prone watershed upstream of the City of Flagstaff, Arizona, USA, where a fire spread model was applied for current fuel loads, and for likely fuel loads following a fuel reduction treatment. When applying the curve number method, determining the time to peak flow can be problematic for low severity fires because the runoff flow paths are both surface and through shallow lateral flow. The WEPP watershed version incorporates shallow lateral flow into stream channels. However, the version of the WEPP model that was used for this study did not have channel routing capabilities, but rather relied on regression relationships to estimate peak flows from individual hillslope polygon peak runoff rates. We found that the two methods gave similar results if applied correctly, with the WEPP predictions somewhat greater than the CN predictions. Later releases of the WEPP model have incorporated alternative methods for routing peak flows that need to be evaluated.

  7. Visualization of boundaries in volumetric data sets through a what material you pick is what boundary you see approach.

    PubMed

    Li, Lu; Peng, Hu; Chen, Xun; Cheng, Juan; Gao, Dayong

    2016-04-01

    Transfer function design is a key issue in direct volume rendering. Many sophisticated transfer functions have been proposed to visualize boundaries in volumetric data sets such as computed tomography and magnetic resonance imaging. However, it is still conventionally challenging to reliably detect boundaries. Meanwhile, the interactive strategy is complicated for new users or even experts. In this paper, we first propose the human-centric boundary extraction criteria and our boundary model. Based on the model we present a boundary visualization method through a what material you pick is what boundary you see approach. Users can pick out the material of interest to directly convey semantics. In addition, the 3-D canny edge detection is utilized to ensure the good localization of boundaries. Furthermore, we establish a point-to-material distance measure to guarantee the accuracy and integrity of boundaries. The proposed boundary visualization is intuitive and flexible for the exploration of volumetric data.

  8. Feather-picking psittacines: histopathology and species trends.

    PubMed

    Garner, M M; Clubb, S L; Mitchell, M A; Brown, L

    2008-05-01

    Histologic findings are described for 408 feather-picking or self-mutilating psittacines with the use of biopsies from clinically affected and unaffected skin. Inflammatory skin disease was diagnosed in 210 birds, and traumatic skin disease was diagnosed in 198 birds. Criteria used for the diagnosis of inflammatory skin disease included the presence of perivascular inflammation in the superficial or deep dermis of clinically affected and unaffected sites. The primary histologic criteria for the diagnosis of traumatic skin disease were superficial dermal scarring with or without inflammation in the affected sites and an absence of inflammation in the unaffected sites. The inflammatory cells associated with the lesions were typically lymphocytes and occasionally plasma cells, histiocytes, and granulocytes. A preponderance of inflammatory skin disease was seen in macaws (Ara spp.) and Amazon parrots (Amazona spp.). A preponderance of traumatic skin disease was seen in cockatoos (Cacatua spp.) and African grey parrots (Psittacus erithacus). The prevalence of each was approximately equal in several other species, including conures (Aratinga and Pyrrhura spp.), eclectus parrots (Eclectus roratus), quaker parrots (Myiopsitta monachus), cockatiels (Nymphicus hollandicus), parakeets (Cyanorhamphus and Psittacula spp.), and caiques (Pionites spp.). No geographic or gender-based trends were identified. These findings could be helpful for identifying and treating birds with feather-picking disorders.

  9. Skin picking disorder with co-occurring body dysmorphic disorder.

    PubMed

    Grant, Jon E; Redden, Sarah A; Leppink, Eric W; Odlaug, Brian L

    2015-09-01

    There is clinical overlap between skin picking disorder (SPD) and body dysmorphic disorder (BDD), but little research has examined clinical and cognitive correlates of the two disorders when they co-occur. Of 55 participants with SPD recruited for a neurocognitive study and two pharmacological studies, 16 (29.1%) had co-occurring BDD. SPD participants with and without BDD were compared to each other and to 40 healthy volunteers on measures of symptom severity, social functioning, and cognitive assessments using the Stop-signal task (assessing response impulsivity) and the Intra-dimensional/Extra-dimensional Set Shift task (assessing cognitive flexibility). Individuals with SPD and BDD exhibited significantly worse picking, significantly worse overall psychosocial functioning, and significantly greater dysfunction on aspects of cognitive flexibility. These results indicate that when SPD co-occurs with BDD unique clinical and cognitive aspects of SPD may be more pronounced. Future work should explore possible subgroups in SPD and whether these predict different treatment outcomes. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Embryo production by ovum pick up from live donors.

    PubMed

    Galli, C; Crotti, G; Notari, C; Turini, P; Duchi, R; Lazzari, G

    2001-04-01

    Embryo production by in vitro techniques has increased steadily over the years. For cattle where this technology is more advanced and is applied more, the number of in vitro produced embryos transferred to final recipients was over 30,000 in 1998. An increasing proportion of in vitro produced embryos are coming from oocytes collected from live donors by ultrasound-guided follicular aspiration (ovum pick up, OPU). This procedure allows the repeated production of embryos from live donors of particular value and is a serious alternative to superovulation. Ovum pick up is a very flexible technique. It can be performed twice a week for many weeks without side effects on the donor's reproductive career. The donor can be in almost any physiological status and still be suitable for oocyte recovery. A scanner with a sectorial or convex probe and a vacuum pump are required. Collection is performed with minimal stress to the donor. An average of 8 to 10 oocytes are collected per OPU with an average production of 2 transferable embryos. The laboratory production of embryos from such oocytes does not differ from that of oocytes harvested at slaughter as the results after transfer to final recipients. For other species such as buffalo and horses OPU has been attempted similarly to cattle and data will be presented and reviewed. For small ruminants, laparotomy or laparoscopy seems the only reliable route so far to collect oocytes from live donors.

  11. Structure of human Niemann–Pick C1 protein

    PubMed Central

    Li, Xiaochun; Wang, Jiawei; Coutavas, Elias; Shi, Hang; Hao, Qi; Blobel, Günter

    2016-01-01

    Niemann–Pick C1 protein (NPC1) is a late-endosomal membrane protein involved in trafficking of LDL-derived cholesterol, Niemann–Pick disease type C, and Ebola virus infection. NPC1 contains 13 transmembrane segments (TMs), five of which are thought to represent a “sterol-sensing domain” (SSD). Although present also in other key regulatory proteins of cholesterol biosynthesis, uptake, and signaling, the structure and mechanism of action of the SSD are unknown. Here we report a crystal structure of a large fragment of human NPC1 at 3.6 Å resolution, which reveals internal twofold pseudosymmetry along TM 2–13 and two structurally homologous domains that protrude 60 Å into the endosomal lumen. Strikingly, NPC1's SSD forms a cavity that is accessible from both the luminal bilayer leaflet and the endosomal lumen; computational modeling suggests that this cavity is large enough to accommodate one cholesterol molecule. We propose a model for NPC1 function in cholesterol sensing and transport. PMID:27307437

  12. Integration of image analysis and robotics into a fully automated colony picking and plate handling system.

    PubMed Central

    Jones, P; Watson, A; Davies, M; Stubbings, S

    1992-01-01

    We describe here the integration of image analysis and robotics to produce a fully automated colony picking/plate handling system. Biological tests were performed to verify its performance in terms of sterilisation and accuracy of picking. The machine was then used by a single operative to pick a 36,000 clone cDNA library in approximately 42 hrs over 5 days. Images PMID:1408762

  13. Pick-Up Ion Instabilities at Planetary Magnetospheres

    NASA Technical Reports Server (NTRS)

    Strangeway, Robert J.; Sharber, James (Technical Monitor)

    2001-01-01

    This effort involved the analysis of low frequency waves as observed by the Galileo spacecraft near the Galilean moon, Io. Io is a significant source of material, especially SO2, and various products of dissociation, and further these atoms and molecules are readily ionized. The initial velocity of the ions is essentially that of the neutral species, i.e., the Keplerian velocity. The plasma, on the other hand is co-rotating, and there is a differential flow of the order 57 km/s between the plasma and the neutral particles. Thus pick-up ion instabilities are Rely to occur within the Jovian magnetosphere. Indeed, magnetometer observations from the Galileo spacecraft clearly show ion cyclotron waves that have been identified with a large variety of plasma species, such as O+, S++ (which has the same gyro-frequency as O+), S+, and SO2+. Typically, however, the dominant frequency is near the SO2+ gyro-frequency. The research effort was originally planned to be a team effort between Robert J. Strangeway as the Principal Investigator, and Debbie Huddleston, who was an Assistant Research Geophysicist at UCLA. Unfortunately, Dr. Huddleston took a position within Industry. The effort was therefore descoped, and Dr. Strangeway instead pursued a collaboration with Dr. Xochitl Blanco-Cano, of the Instituto de Geofisica, Universidad Nacional Autonoma de Mexico. This has proved to be a productive collaboration, with several papers and publications arising out of the effort. The magnetic field oscillations near lo generally fall into two types: ion cyclotron waves, with frequencies near an ion gyro-frequency, and lower frequency mirror-mode waves. The ion cyclotron waves are mainly transverse, and frequently propagate along the ambient magnetic field. The mirror-mode waves are compressional waves, and they have essentially zero frequency in the plasma rest frame. One of the purposes of our investigation is to understand what controls the types of wave modes that occur, since both

  14. Amplification of postwildfire peak flow by debris

    NASA Astrophysics Data System (ADS)

    Kean, J. W.; McGuire, L. A.; Rengers, F. K.; Smith, J. B.; Staley, D. M.

    2016-08-01

    In burned steeplands, the peak depth and discharge of postwildfire runoff can substantially increase from the addition of debris. Yet methods to estimate the increase over water flow are lacking. We quantified the potential amplification of peak stage and discharge using video observations of postwildfire runoff, compiled data on postwildfire peak flow (Qp), and a physically based model. Comparison of flood and debris flow data with similar distributions in drainage area (A) and rainfall intensity (I) showed that the median runoff coefficient (C = Qp/AI) of debris flows is 50 times greater than that of floods. The striking increase in Qp can be explained using a fully predictive model that describes the additional flow resistance caused by the emergence of coarse-grained surge fronts. The model provides estimates of the amplification of peak depth, discharge, and shear stress needed for assessing postwildfire hazards and constraining models of bedrock incision.

  15. Amplification of postwildfire peak flow by debris

    USGS Publications Warehouse

    Kean, Jason W.; Mcguire, Luke; Rengers, Francis; Smith, Joel B.; Staley, Dennis M.

    2016-01-01

    In burned steeplands, the peak depth and discharge of postwildfire runoff can substantially increase from the addition of debris. Yet methods to estimate the increase over water flow are lacking. We quantified the potential amplification of peak stage and discharge using video observations of postwildfire runoff, compiled data on postwildfire peak flow (Qp), and a physically based model. Comparison of flood and debris flow data with similar distributions in drainage area (A) and rainfall intensity (I) showed that the median runoff coefficient (C = Qp/AI) of debris flows is 50 times greater than that of floods. The striking increase in Qp can be explained using a fully predictive model that describes the additional flow resistance caused by the emergence of coarse-grained surge fronts. The model provides estimates of the amplification of peak depth, discharge, and shear stress needed for assessing postwildfire hazards and constraining models of bedrock incision.

  16. An order-picking operations system for managing the batching activities in a warehouse

    NASA Astrophysics Data System (ADS)

    Lam, Cathy H. Y.; Choy, K. L.; Ho, G. T. S.; Lee, C. K. M.

    2014-06-01

    Nowadays, customer orders with high product variety in small quantities are often received and requested for timely delivery. However, the order-picking process is a labour-intensive and costly activity to handle those small orders separately. In such cases, small orders are often grouped into batches so that two or more orders can be served at once to increase the picking efficiency and thus reduce the travel distance. In this paper, an order-picking operations system (OPOS) is proposed to assist the formulation of an order-picking plan and batch-handling sequence. The study integrates a mathematical model and fuzzy logic technique to divide the receiving orders into batches and prioritise the batch-handling sequence for picking, respectively. Through the proposed system, the order-picking process can be managed as batches with common picking locations to minimise the travel distance, and the batch-picking sequence can be determined as well. To demonstrate the use of the system, a case study in a third-party logistics warehouse is presented, and the result shows that both the order-picking activity and labour utilisation can be better organised.

  17. A preliminary analysis of the phenomenology of skin-picking in Prader-Willi syndrome.

    PubMed

    Morgan, Jessica R; Storch, Eric A; Woods, Douglas W; Bodzin, Danielle; Lewin, Adam B; Murphy, Tanya K

    2010-08-01

    To examine the nature and psychosocial correlates of skin-picking behavior in youth with Prader-Willi Syndrome (PWS). Parents of 67 youth (aged 5-19 years) with PWS were recruited to complete an internet-based survey that included measures of: skin-picking behaviors, the automatic and/or focused nature of skin-picking, severity of skin-picking symptoms, anxiety symptoms, developmental functioning, symptoms of inattention, impulsivity, and oppositionality, and quality of life. Results indicated that skin-picking was endorsed in 95.5% of youth. Direct associations of moderate strength were found between skin-picking severity and symptoms of anxiety, inattention, oppositionality, developmental functioning, and quality of life. Other descriptive data, such as areas picked, cutaneous factors, antecedents, and consequences related to skin-picking are reported. The prevalence and consequences associated with skin-picking in PWS indicate a greater need for clinician awareness of the behavior and interventions tailored to meet the needs of this population.

  18. The relationship between adolescents' academic stress, impulsivity, anxiety, and skin picking behavior.

    PubMed

    Yeo, Sun Kyung; Lee, Woo Kyeong

    2017-08-01

    Skin picking behavior involves an individual picking or biting their skin repeatedly. Although this behavior commonly occurs at a young age, little research has addressed its harmful effects among the Korean population. Therefore, we examined the characteristics of South Korean adolescents who reported skin picking behavior. South Korean students aged 12-16 years participated (N=410, females=52.2%). They completed questionnaires that addressed skin picking behavior, academic stress, impulsivity, and anxiety. The survey was conducted in Seoul and Gyeonggi-do from February-March 2016. Among participants, 66.8% reported that they had picked their skin and 15.4% did so currently. Skin picking was positively correlated with academic stress, impulsivity, and anxiety. Students who picked their skin more often displayed more anxiety, academic stress, and impulsivity. Future studies should address skin picking adolescents' characteristics, especially regarding anxiety and academic stress. Educational programs should be implemented to help adolescents decrease their anxiety and academic stress and prevent the worsening of skin picking behavior. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Measuring Your Peak Flow Rate

    MedlinePlus

    ... collected in the meter may make your peak flow measurements inaccurate. If you have a cold or other respiratory infection, germs or mucus may also collect in the meter. Proper cleaning with mild detergent in hot water will keep your peak flow meter working accurately and may keep you healthier. ...

  20. Correlated peak relative light intensity and peak current in triggered lightning subsequent return strokes

    NASA Technical Reports Server (NTRS)

    Idone, V. P.; Orville, R. E.

    1985-01-01

    The correlation between peak relative light intensity L(R) and stroke peak current I(R) is examined for 39 subsequent return strokes in two triggered lightning flashes. One flash contained 19 strokes and the other 20 strokes for which direct measurements were available of the return stroke peak current at ground. Peak currents ranged from 1.6 to 21 kA. The measurements of peak relative light intensity were obtained from photographic streak recordings using calibrated film and microsecond resolution. Correlations, significant at better than the 0.1 percent level, were found for several functional relationships. Although a relation between L(R) and I(R) is evident in these data, none of the analytical relations considered is clearly favored. The correlation between L(R) and the maximum rate of current rise is also examined, but less correlation than between L(R) and I(R) is found. In addition, the peak relative intensity near ground is evaluated for 22 dart leaders, and a mean ratio of peak dart leader to peak return stroke relative light intensity was found to be 0.1 with a range of 0.02-0.23. Using two different methods, the peak current near ground in these dart leaders is estimated to range from 0.1 to 6 kA.

  1. Correlated peak relative light intensity and peak current in triggered lightning subsequent return strokes

    NASA Technical Reports Server (NTRS)

    Idone, V. P.; Orville, R. E.

    1985-01-01

    The correlation between peak relative light intensity L(R) and stroke peak current I(R) is examined for 39 subsequent return strokes in two triggered lightning flashes. One flash contained 19 strokes and the other 20 strokes for which direct measurements were available of the return stroke peak current at ground. Peak currents ranged from 1.6 to 21 kA. The measurements of peak relative light intensity were obtained from photographic streak recordings using calibrated film and microsecond resolution. Correlations, significant at better than the 0.1 percent level, were found for several functional relationships. Although a relation between L(R) and I(R) is evident in these data, none of the analytical relations considered is clearly favored. The correlation between L(R) and the maximum rate of current rise is also examined, but less correlation than between L(R) and I(R) is found. In addition, the peak relative intensity near ground is evaluated for 22 dart leaders, and a mean ratio of peak dart leader to peak return stroke relative light intensity was found to be 0.1 with a range of 0.02-0.23. Using two different methods, the peak current near ground in these dart leaders is estimated to range from 0.1 to 6 kA.

  2. Particle picking by segmentation: a comparative study with SPIDER-based manual particle picking.

    PubMed

    Adiga, Umesh; Baxter, William T; Hall, Richard J; Rockel, Beate; Rath, Bimal K; Frank, Joachim; Glaeser, Robert

    2005-12-01

    Boxing hundreds of thousands of particles in low-dose electron micrographs is one of the major bottle-necks in advancing toward achieving atomic resolution reconstructions of biological macromolecules. We have shown that a combination of pre-processing operations and segmentation can be used as an effective, automatic tool for identifying and boxing single-particle images. This paper provides a brief description of how this method has been applied to a large data set of micrographs of ice-embedded ribosomes, including a comparative analysis of the efficiency of the method. Some results on processing micrographs of tripeptidyl peptidase II particles are also shown. In both cases, we have achieved our goal of selecting at least 80% of the particles that an expert would select with less than 10% false positives.

  3. Electric field by pick-up ions and electrons

    NASA Astrophysics Data System (ADS)

    Yamauchi, Masatoshi; Behar, Etienne; Nilsson, Hans; Holmstrom, Mats

    2016-04-01

    Observations by the Rosetta Plasma Consortium (RPC) showed increasing distortion of the solar wind flow as Rosetta approached the Sun, i.e., as the density of the newly born ions increased. This indicates azimuthal momentum transfer from the solar wind to the newly born ions because they are displaced by the solar wind electric field up to the ion gyroradius this the solar wind velocity, and conservation of the momentum (center of the mass) makes the solar wind to azimuthally shift by "counter action" of these pick-up ion motions. To understand this azimuthal momentum transfer, it is inevitable to model the electric field by the displacement of these pick-up ions and electrons. Although the E×B drift does not make charge separation when the scale size is larger than the ion gyroradius, ions and electrons move in the opposite direction to each other within the short distance up to a gyroradius, and therefore, the charge separation occurs. Thus, the newly-ionized neutrals (ion-electron pairs) create the electric field in the opposite (shielding) direction to the solar wind electric field (like the ionopause of Venus and Mars). However, such a newly induced "shielding" electric field will simultaneously be weakened by the solar wind electrons because the solar wind is also moved by this shielding electric field to reduce it, in the same way as the plasma oscillation (time scale of about 10-4 s). In other words, the solar wind tries to maintain the solar wind electric field as far as the momentum allows. These two opposite effects must be combined when modelling the azimuthal electric field, and resultant ion/electron motions within a gyroradius, like the case for ROSETTA. Furthermore, the effect of the induced electric field by the pick-up ions and electrons will be different when the newly born ions are created as the result of photo-ionization and of the charge exchange because the electron effect is different between them. In the presentation, we model the

  4. Description of the main Poaceae pollen season using bi-Gaussian curves, and forecasting methods for the start and peak dates for this type of season in Rzeszów and Ostrowiec Sw. (SE Poland).

    PubMed

    Kasprzyk, Idalia; Walanus, Adam

    2010-04-01

    Grasses characteristically produce a huge amount of small pollen grains, which pose a risk to allergy sufferers. In many aerobiological studies, great variations in the behaviour of the grass pollen season are stressed. We state that in Rzeszów and Ostrowiec Sw. there is some regularity in the pattern of the main grass pollen seasons, which is clearly double-peaked. The aim of our work was to elaborate the algorithm which defines the main grass pollen season. Next, the null hypothesis was tested about the lack of difference between daily pollen concentrations and meteorological parameters. Grass pollen seasons were defined using the method of fitting two bell curves. The estimated grass pollen season is characterised by two periods of high or relatively high concentrations, separated by a period of low concentration. In order to investigate the time dependence of the correlation between pollen concentration and the weather parameters, the Gaussian-weighted correlation coefficient has been calculated. Maximum temperature, mean temperature and sunshine positively correlated with pollen concentrations, but relative air humidity and rainfall on the previous day had a negative effect. The temperatures of the second and third ten-day periods of April were the best independent variables for forecasting the beginning and peak dates of the main pollen seasons. An analysis of the results shows that the pattern of successive flowering in grass species and meadow cutting dates appear to be the factors which cause the characteristic bimodal behaviour of the grass pollen season.

  5. How to use your peak flow meter

    MedlinePlus

    Peak flow meter - how to use; Asthma - peak flow meter; Reactive airway disease - peak flow meter; Bronchial asthma - peak flow meter ... your airways are narrowed and blocked due to asthma, your peak flow values drop. You can check ...

  6. Assessing the impact of waste picking on musculoskeletal disorders among waste pickers in Mumbai, India: a cross-sectional study.

    PubMed

    Singh, Shrikant; Chokhandre, Praveen

    2015-09-24

    To assess the prevalence of musculoskeletal disorders (MSDs) as well as the impact of the occupation of waste picking on complaints of MSDs among waste pickers. The study attempts to understand the risk factors for MSDs in various areas of the body. A cross-sectional household survey was conducted using a case-control design. The survey instrument for measuring musculoskeletal symptoms was adopted from a standardised Nordic questionnaire. The impact of the occupation of waste picking on MSDs was analysed using the propensity score matching (PSM) method. The study population consisted of waste pickers (n=200) who had been working for at least a year and a control group (n=213) selected from among or living close to the same communities. The 12-month prevalence of MSDs was higher among waste pickers (79%) compared to controls (55%) particularly in the lower back (54-36%), knee (48-35%), upper back (40-21%) and shoulder (32-12%). Similar patterns were observed in the 12-month prevalence of MSDs which prevented normal activity inside and outside the home, particularly for the lower back (36-21%), shoulder (21-7%) and upper back (25-12%) for waste pickers and controls. Analysis of the impact of waste picking on complaints of MSDs suggests that the occupation of waste picking raises the risk of MSDs particularly in the shoulder, lower and upper back. Older age and longer duration of work are significant risk factors for MSDs. The findings suggest a relatively higher prevalence of MSDs among waste pickers, particularly in the lower and upper back and shoulder, compared to controls. Preventive measures and treatment to minimise the burden of MSDs among waste pickers are strongly recommended. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  7. Assessing the impact of waste picking on musculoskeletal disorders among waste pickers in Mumbai, India: a cross-sectional study

    PubMed Central

    Singh, Shrikant; Chokhandre, Praveen

    2015-01-01

    Objective To assess the prevalence of musculoskeletal disorders (MSDs) as well as the impact of the occupation of waste picking on complaints of MSDs among waste pickers. The study attempts to understand the risk factors for MSDs in various areas of the body. Design A cross-sectional household survey was conducted using a case-control design. The survey instrument for measuring musculoskeletal symptoms was adopted from a standardised Nordic questionnaire. The impact of the occupation of waste picking on MSDs was analysed using the propensity score matching (PSM) method. Participants The study population consisted of waste pickers (n=200) who had been working for at least a year and a control group (n=213) selected from among or living close to the same communities. Results The 12-month prevalence of MSDs was higher among waste pickers (79%) compared to controls (55%) particularly in the lower back (54–36%), knee (48–35%), upper back (40–21%) and shoulder (32–12%). Similar patterns were observed in the 12-month prevalence of MSDs which prevented normal activity inside and outside the home, particularly for the lower back (36–21%), shoulder (21–7%) and upper back (25–12%) for waste pickers and controls. Analysis of the impact of waste picking on complaints of MSDs suggests that the occupation of waste picking raises the risk of MSDs particularly in the shoulder, lower and upper back. Older age and longer duration of work are significant risk factors for MSDs. Conclusions The findings suggest a relatively higher prevalence of MSDs among waste pickers, particularly in the lower and upper back and shoulder, compared to controls. Preventive measures and treatment to minimise the burden of MSDs among waste pickers are strongly recommended. PMID:26408284

  8. Slope-Area Computation Program Graphical User Interface 1.0—A Preprocessing and Postprocessing Tool for Estimating Peak Flood Discharge Using the Slope-Area Method

    USGS Publications Warehouse

    Bradley, D. Nathan

    2012-01-01

    The slope-area method is a technique for estimating the peak discharge of a flood after the water has receded (Dalrymple and Benson, 1967). This type of discharge estimate is called an “indirect measurement” because it relies on evidence left behind by the flood, such as high-water marks (HWMs) on trees or buildings. These indicators of flood stage are combined with measurements of the cross-sectional geometry of the stream, estimates of channel roughness, and a mathematical model that balances the total energy of the flow between cross sections. This is in contrast to a “direct” measurement of discharge during the flood where cross-sectional area is measured and a current meter or acoustic equipment is used to measure the water velocity. When a direct discharge measurement cannot be made at a gage during high flows because of logistics or safety reasons, an indirect measurement of a peak discharge is useful for defining the high-flow section of the stage-discharge relation (rating curve) at the stream gage, resulting in more accurate computation of high flows. The Slope-Area Computation program (SAC; Fulford, 1994) is an implementation of the slope-area method that computes a peak-discharge estimate from inputs of water-surface slope (from surveyed HWMs), channel geometry, and estimated channel roughness. SAC is a command line program written in Fortran that reads input data from a formatted text file and prints results to another formatted text file. Preparing the input file can be time-consuming and prone to errors. This document describes the SAC graphical user interface (GUI), a crossplatform “wrapper” application that prepares the SAC input file, executes the program, and helps the user interpret the output. The SAC GUI is an update and enhancement of the slope-area method (SAM; Hortness, 2004; Berenbrock, 1996), an earlier spreadsheet tool used to aid field personnel in the completion of a slope-area measurement. The SAC GUI reads survey data

  9. Investor Outlook: Gene Therapy Picking up Steam; At a Crossroads.

    PubMed

    Schimmer, Joshua; Breazzano, Steven

    2016-09-01

    The gene therapy field continues to pick up steam with recent successes in a number of different therapeutic indications that highlight the potential for the platform. As the field continues to make progress, a growing data set of long-term safety and efficacy data will continue to define gene therapy's role, determining ultimately how widely it may be used beyond rare, serious diseases with high unmet needs. New technologies often take unanticipated twists and turns as patient exposure accumulates, and gene therapy may be no exception. That said, with many diseases that have no other treatment options beyond gene therapy and that present considerable morbidity and mortality, the field appears poised to withstand some minor and even major bumps in the road should they emerge.

  10. Neonatal Jaundice with Splenomegaly: Not a Common Pick.

    PubMed

    Gotti, Giacomo; Marseglia, Antonio; De Giacomo, Costantino; Iascone, Maria; Sonzogni, Aurelio; D'Antiga, Lorenzo

    2016-01-01

    The most common conditions causing cholestatic jaundice in infants are biliary atresia, neonatal hepatitis, and Alagille syndrome. In these disorders, the clinical presentation includes jaundice, pale stools, dark urine and hepatomegaly. Splenomegaly is not an early feature since it is due to portal hypertension, a later event. The finding of cholestatic jaundice and a large spleen usually raises the suspicion of Niemann-Pick type C disease (NP-C), a lysosomal storage disorder. We present and discuss here a case of an infant with liver disease and splenomegaly that were not ascribed to NP-C, but to Gaucher disease type 2. Liver biopsy, enzymatic studies and whole exome sequencing allowed to make the diagnosis. Although rare, Gaucher disease can cause neonatal hepatitis. A prompt recognition is advocated.

  11. Pseudohyperglycaemia in a comatose patient after picking cherries.

    PubMed

    Derkenne, Clément; Lamblin, Antoine; Jost, Daniel; Tourtier, Jean-Pierre

    2016-10-28

    We report a case of pseudohyperglycaemia on a capillary blood glucose measurement taken from fingers stained with sugar (fructose). A 76-year-old patient with type 1 diabetes received emergency attention at home because of a coma. The first capillary blood glucose measurement collected from a finger revealed a concentration higher than the reference limits, misleading the clinician. After starting symptomatic treatment, a second blood glucose measurement was taken. This measurement, taken at the earlobe, revealed profound hypoglycaemia (0.89 mmol/L), which prompted the administration of appropriate treatment. The elevated initial capillary blood glucose measurement was linked to the presence of fructose on the fingers of the patient from picking cherries just before the patient fainted. After intravenous administration of glucose, the patient regained normal consciousness and had no sequelae despite the severity of the hypoglycaemia and delayed diagnosis. Pseudohyperglycaemia is rare, and delayed diagnosis frequently results in severe sequelae or death.

  12. Alternative Therapies for Excoriation (Skin Picking) Disorder: A Brief Update.

    PubMed

    Torales, Julio; Barrios, Iván; Villalba, Jorge

    2017-01-01

    Context • Excoriation (skin picking) disorder is characterized by the need or urge to pick, scratch, pinch, touch, rub, scrub, squeeze, bite, or dig the skin, and it can be a perplexing condition for the inexperienced physician. Treatments include pharmacotherapy, psychotherapy, and alternative therapies. Alternative therapies for excoriation disorder and other body-focused repetitive behaviors include yoga, aerobic exercise, acupuncture, biofeedback, hypnosis, and inositol and N-acetylcysteine, among others. Objective • This review article intended to review the current literature on the alternative therapies to provide a brief update on their benefits for the treatment of excoriation disorder for use in conjunction with psychotherapy and pharmacotherapy in the management of a challenging group of patients. Design • This review (focusing on literature published in the last 15 y, selected from a search of PubMed) critically considers the evidence for the use of alternative therapies in the treatment of excoriation disorder. Setting • This review was conducted at the National University of Asunción (San Lorenzo, Paraguay). Results • Results for yoga were as follows: This technique may influence the structure and functioning of the areas of emotional processing involved in the pathophysiology of excoriation disorder and other body-focused repetitive behaviors, such as trichotillomania. Although still limited, the current research team's use of yoga as a treatment has given useful results. Results for aerobic exercise were as follows: People suffering from excoriation disorder and other-body focused repetitive behaviors generally have a worsening of their behaviors in times of negative mood and anxiety. As exercise has qualities that allow individuals to improve their mood and reduce their anxiety, it is likely that it also can help reduce behaviors like hair pulling or scratching, and it should be considered to be an adjunctive therapy. Results for

  13. Who Should Pick the Winners of Climate Change?

    PubMed

    Webster, Michael S; Colton, Madhavi A; Darling, Emily S; Armstrong, Jonathan; Pinsky, Malin L; Knowlton, Nancy; Schindler, Daniel E

    2017-03-01

    Many conservation strategies identify a narrow subset of genotypes, species, or geographic locations that are predicted to be favored under different scenarios of future climate change. However, a focus on predicted winners, which might not prove to be correct, risks undervaluing the balance of biological diversity from which climate-change winners could otherwise emerge. Drawing on ecology, evolutionary biology, and portfolio theory, we propose a conservation approach designed to promote adaptation that is less dependent on uncertain predictions about the identity of winners and losers. By designing actions to facilitate numerous opportunities for selection across biological and environmental conditions, we can allow nature to pick the winners and increase the probability that ecosystems continue to provide services to humans and other species.

  14. Anticipatory Adjustments to Being Picked Up in Infancy

    PubMed Central

    Reddy, Vasudevi; Markova, Gabriela; Wallot, Sebastian

    2013-01-01

    Anticipation of the actions of others is often used as a measure of action understanding in infancy. In contrast to studies of action understanding which set infants up as observers of actions directed elsewhere, in the present study we explored anticipatory postural adjustments made by infants to one of the most common adult actions directed to them – picking them up. We observed infant behavioural changes and recorded their postural shifts on a pressure mat in three phases: (i) a prior Chat phase, (ii) from the onset of Approach of the mother’s arms, and (iii) from the onset of Contact. In Study 1, eighteen 3-month-old infants showed systematic global postural changes during Approach and Contact, but not during Chat. There was an increase in specific adjustments of the arms (widening or raising) and legs (stiffening and extending or tucking up) during Approach and a decrease in thrashing/general movements during Contact. Shifts in postural stability were evident immediately after onset of Approach and more slowly after Contact, with no regular shifts during Chat. In Study 2 we followed ten infants at 2, 3 and 4 months of age. Anticipatory behavioural adjustments during Approach were present at all ages, but with greater differentiation from a prior Chat phase only at 3 and 4 months. Global postural shifts were also more phase differentiated in older infants. Moreover, there was significantly greater gaze to the mother’s hands during Approach at 4 months. Early anticipatory adjustments to being picked up suggest that infants’ awareness of actions directed to the self may occur earlier than of those directed elsewhere, and thus enable infants’ active participation in joint actions from early in life. PMID:23840324

  15. Biomolecular switches: Driven to peak

    NASA Astrophysics Data System (ADS)

    Tu, Yuhai

    2017-07-01

    A curious peak in the distribution describing stochastic switching in bacterial motility had researchers confounded. But a careful study performed under varying mechanical conditions has now revealed that the breaking of detailed balance is to blame.

  16. Flu Season Starting to Peak

    MedlinePlus

    ... page: https://medlineplus.gov/news/fullstory_162917.html Flu Season Starting to Peak More severe strain of ... 6, 2017 FRIDAY, Jan. 6, 2017 (HealthDay News) -- Flu season is in full swing and it's starting ...

  17. Peak Oil: Diverging Discursive Pipelines

    NASA Astrophysics Data System (ADS)

    Doctor, Jeff

    Peak oil is the claimed moment in time when global oil production reaches its maximum rate and henceforth forever declines. It is highly controversial as to whether or not peak oil represents cause for serious concern. My thesis explores how this controversy unfolds but brackets the ontological status of the reality indexed by the peakoil concept. I do not choose a side in the debate; I look at the debate itself. I examine the energy outlook documents of ExxonMobil, Shell, BP, Chevron, Total and the International Energy Agency (IEA) as well as academic articles and documentaries. Through an in-depth analysis of peak-oil controversy via tenets of actor-network theory (ANT), I show that what is at stake are competing framings of reality itself, which must be understood when engaging with the contentious idea of peak oil.

  18. 21 CFR 872.6650 - Massaging pick or tip for oral hygiene.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Massaging pick or tip for oral hygiene. 872.6650 Section 872.6650 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES... hygiene. (a) Identification. A massaging pick or tip for oral hygiene is a rigid, pointed device...

  19. Two new species of Anastrepha Schiner (Diptera, Tephritidae) closely related to Anastrepha pickeli Lima.

    PubMed

    Canal, N A; Uramoto, K; Zucchi, R A

    2013-02-01

    Anastrepha entodonta n. sp. and Anastrepha hadropickeli n. sp. are described and illustrated. The new species belong to the spatulata group. Both species occur sympatrically with Anastrepha pickeli Lima in the semiarid region of the state of Minas Gerais, Brazil. Anastrepha hadropickeli occurs also in the semiarid of the state of Rio Grande do Norte, Brazil, where it was misidentified as A. pickeli.

  20. 7 CFR 51.1236 - U.S. Fancy Hand Picked.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... STANDARDS) United States Standards for Cleaned Virginia Type Peanuts in the Shell Grades § 51.1236 U.S. Fancy Hand Picked. U.S. Fancy Hand Picked shall consist of cleaned Virginia type peanuts in the shell... pops, peanuts having paper ends or damaged shells, loose undamaged peanut kernels, and dirt or other...

  1. 7 CFR 51.1236 - U.S. Fancy Hand Picked.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... STANDARDS) United States Standards for Cleaned Virginia Type Peanuts in the Shell Grades § 51.1236 U.S. Fancy Hand Picked. U.S. Fancy Hand Picked shall consist of cleaned Virginia type peanuts in the shell... pops, peanuts having paper ends or damaged shells, loose undamaged peanut kernels, and dirt or other...

  2. 7 CFR 51.1235 - U.S. Jumbo Hand Picked.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... STANDARDS) United States Standards for Cleaned Virginia Type Peanuts in the Shell Grades § 51.1235 U.S. Jumbo Hand Picked. U.S. Jumbo Hand Picked shall consist of cleaned Virginia type peanuts in the shell... pops, peanuts having paper ends or damaged shells, loose undamaged peanut kernels, and dirt or other...

  3. 7 CFR 51.1235 - U.S. Jumbo Hand Picked.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... STANDARDS) United States Standards for Cleaned Virginia Type Peanuts in the Shell Grades § 51.1235 U.S. Jumbo Hand Picked. U.S. Jumbo Hand Picked shall consist of cleaned Virginia type peanuts in the shell... pops, peanuts having paper ends or damaged shells, loose undamaged peanut kernels, and dirt or other...

  4. 7 CFR 51.1235 - U.S. Jumbo Hand Picked.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... STANDARDS) United States Standards for Cleaned Virginia Type Peanuts in the Shell Grades § 51.1235 U.S. Jumbo Hand Picked. U.S. Jumbo Hand Picked shall consist of cleaned Virginia type peanuts in the shell... pops, peanuts having paper ends or damaged shells, loose undamaged peanut kernels, and dirt or other...

  5. 7 CFR 51.1236 - U.S. Fancy Hand Picked.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... STANDARDS) United States Standards for Cleaned Virginia Type Peanuts in the Shell Grades § 51.1236 U.S. Fancy Hand Picked. U.S. Fancy Hand Picked shall consist of cleaned Virginia type peanuts in the shell... pops, peanuts having paper ends or damaged shells, loose undamaged peanut kernels, and dirt or other...

  6. Behavioral Treatment of Chronic Skin-Picking in Individuals with Developmental Disabilities: A Systematic Review

    ERIC Educational Resources Information Center

    Lang, Russell; Didden, Robert; Machalicek, Wendy; Rispoli, Mandy; Sigafoos, Jeff; Lancioni, Giulio; Mulloy, Austin; Regester, April; Pierce, Nigel; Kang, Soyeon

    2010-01-01

    Skin-picking is a type of self-injurious behavior involving the pulling, scratching, lancing, digging, or gouging of one's own body. It is associated with social impairment, and increased medical and mental health concerns. While there are several reports showing that skin-picking is common in individuals with developmental disabilities, knowledge…

  7. How 'ground-picked' olive fruits affect virgin olive oil ethanol content, ethyl esters and quality.

    PubMed

    Beltran, Gabriel; Sánchez, Raquel; Sánchez-Ortiz, Araceli; Aguilera, Maria P; Bejaoui, Mohamed A; Jimenez, Antonio

    2016-08-01

    Olives dropped on the ground naturally sometimes are not separated from those fresh and healthy collected from the tree for harvest and processing. In this work we compared the quality, ethanol content and bioactive components of virgin olive oils from ground-picked olives, tree-picked fruits and their mixture. Ground-picked olives produced 'Lampante' virgin olive oils; these are of a lower quality category, because of important alterations in chemical and sensory characteristics. Ethyl esters showed the highest values, although under the regulated limit. The mixture of ground and tree-picked olives gave oils classified as 'virgin' because of sensory defects, although the quality parameters did not exceed the limits for the 'extra' category. Ethanol content showed a significant increase in the oils from ground- picked olives and their mixture with respect to those from tree-picked fruits. Furthermore, bioactive compounds showed a significant decrease as fruit quality was poorer. Ground-picked olives must be harvested and processed separately since they produce low-quality virgin olive oils with sensory defects and lower concentrations of bioactive compounds. The higher acidity and ethanol concentration observed in oils from ground-picked fruits or their mixture may help ethyl ester synthesis during storage. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.

  8. Efficacy of the “pick and roll” offense in top level European basketball teams

    PubMed Central

    Marmarinos, Christos; Kostopoulos, Nikolaos; Apostolidis, Alexandros

    2016-01-01

    Abstract Team offense in basketball games consists of a set of offensive actions carried out with the cooperation of two or more players. Of these actions, the most commonly used in the last decade is the on-ball screen called the “pick and roll.” The aim of this study was to analyze all of the pick and rolls conducted in the Euroleague championship from all of the 24 participating teams and to investigate the possible relationships between success in the pick and roll and overall success of the teams. For this purpose, 12,376 pick and rolls from 502 matches were analyzed and classified in categories according to the end result of the offensive possession. The results showed that the most effective type of pick and roll offense was when a shot was attempted after 2 passes from the pick and roll occurrence, followed by the screener’s shot when he rolled to the basket. Additionally, linear regression analysis confirmed that pick and roll effectiveness could predict the final classification of the teams. Conclusively, coaches of the high level European clubs should focus on training the players to the most efficient phases of the pick and roll offense, so that the chances of winning the championship to be maximized. PMID:28149375

  9. Skin picking in a non-clinical sample of young Polish adults. Prevalence and characteristics.

    PubMed

    Prochwicz, Katarzyna; Kałużna-Wielobób, Alina; Kłosowska, Joanna

    2016-11-01

    The aim of the study was to examine the prevalence and characteristics of skin picking behaviors in a sample of young Polish adults. Five hundred and thirty-four participants completed measurements of skin picking frequency and severity. They also retrospectively rated the intensity of affective states experienced before, during and after skin picking episodes. In total, 46.07% of the participants endorsed some forms of skin picking, and the prevalence of skin picking disorder (SPD) in the study sample amounted to 7.67%. The characteristics of skin picking episodes in young Polish adults were similar to those reported in previous studies conducted on different cultures. The results also showed that for the majority of individuals with skin picking, the intensity of particular emotions (i.e. fear, anxiety, guilt, shame, self-aversion, boredom, and sadness) decreased significantly in the period from before to after picking. Larger community studies are needed to assess the SPD prevalence in Polish general population. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Immunolocalization of an amino-terminal fragment of apolipoprotein E in the Pick's disease brain.

    PubMed

    Rohn, Troy T; Day, Ryan J; Catlin, Lindsey W; Brown, Raquel J; Rajic, Alexander J; Poon, Wayne W

    2013-01-01

    Although the risk factor for apolipoprotein E (apoE) polymorphism in Alzheimer's disease (AD) has been well described, the role that apoE plays in other neurodegenerative diseases, including Pick's disease, is not well established. To examine a possible role of apoE in Pick's disease, an immunohistochemical analysis was performed utilizing a novel site-directed antibody that is specific for an amino-terminal fragment of apoE. Application of this antibody, termed the amino-terminal apoE cleavage fragment (nApoECF) antibody, consistently labeled Pick bodies within area CA1 of the hippocampus in 4 of the 5 cases examined. Co-localization of the nApoECF antibody with PHF-1, a general marker for Pick bodies, as well as with an antibody to caspase-cleaved tau (TauC3) was evident within the hippocampus. While staining of the nApoECF antibody was robust in area CA1, little co-localization with PHF-1 in Pick bodies within the dentate gyrus was observed. A quantitative analysis indicated that approximately 86% of the Pick bodies identified in area CA1 labeled with the nApoECF antibody. The presence of truncated apoE within Pick bodies suggests a broader role of apoE beyond AD and raises the question as to whether this protein contributes to pathogenesis associated with Pick's disease.

  11. Behavioral Treatment of Chronic Skin-Picking in Individuals with Developmental Disabilities: A Systematic Review

    ERIC Educational Resources Information Center

    Lang, Russell; Didden, Robert; Machalicek, Wendy; Rispoli, Mandy; Sigafoos, Jeff; Lancioni, Giulio; Mulloy, Austin; Regester, April; Pierce, Nigel; Kang, Soyeon

    2010-01-01

    Skin-picking is a type of self-injurious behavior involving the pulling, scratching, lancing, digging, or gouging of one's own body. It is associated with social impairment, and increased medical and mental health concerns. While there are several reports showing that skin-picking is common in individuals with developmental disabilities, knowledge…

  12. Analytical compensation of axisymmetric equilibrium fluxes picked up by locked mode detectors in tokamaks.

    PubMed

    Ding, Y H; Wang, N C; Rao, B; Jin, X S; Chen, Z P; Hu, Q M; Jin, H; Jin, W; Li, J C; Xie, S J; Yi, B; Zhuang, G; Pan, Y

    2014-04-01

    In the detection of locked modes using saddle loops, the problem of how to remove the axisymmetric equilibrium flux picked up by the loops has still to be solved. The problem becomes more difficult when there are conductive structures located near the saddle loops. In this paper, we present an analytical model based on lumped eddy current circuits and use it to interpret the measured equilibrium flux and the corresponding eddy current fluxes. Using this model, precise compensation for fluxes induced by the horizontal field coils and the toroidal field coils, with relative errors of less than 1%, has been realized for the saddle loops in the Joint Texas Experimental Tokamak. This paper also presents a new method to compensate for the detection of equilibrium flux by the locked mode detector.

  13. Degeneration of Pick bodies visualized by methenamine-silver staining and immunohistochemistry.

    PubMed

    Odawara, Toshinari; Iseki, Eizo; Furukawa, Yoshiko; Suzuki, Kyoko; Hino, Hiroaki; Kosaka, Kenji

    2002-09-01

    The degeneration process of Pick's bodies (PB) was investigated using methenamine-silver (MS) staining and immunohistochemistry. Methenamine-silver staining sensitively detected extracellular PB as well as intracellular PB in the granular cell layer of the dentate gyrus. Extracellular PB appeared as granular masses with ill-defined boundaries in the neuropil. For MS electron microscopy, the extracellular PB were composed of randomly oriented fibrillary components measuring 9-12 nm in diameter with astroglial processes and degenerated organelles. Tau immunoreactivity of extracellular PB was reduced or abolished. These findings indicate that MS staining is a convenient method for detecting extracellular PB. In addition, it was shown that microglial involvement was associated with PB-bearing neurons at the late stage of the degeneration process and that extracellular PB remained in the neuropil with astroglial reaction.

  14. Velocity distributions of cometary protons picked up by the solar wind

    SciTech Connect

    Neugebauer, M.; Lazarus, A.J.; Balsiger, H.; Fuselier, S.A.; Neubauer, F.M.; Rosenbauer, H.

    1989-05-01

    Velocity space distributions of picked up cometary protons were measured by the ion mass spectrometer on the Giotto spacecraft upstream of the Halley bow shock. Large pitch angle anisotropies were observed at all distances >1.2 x 10/sup 6/ km from the comet. As expected, pitch angle diffusion was much more rapid than energy diffusion. When the field was quasi-parallel to the solar wind velocity vector, it was possible to discern the effect of pitch angles scattering by sunward propagating, field-aligned hydromagnetic waves, but there is evidence for other scattering modes as well. For quasi-perpendicular geometries, the pitch angle distribution was very asymmetric with phase space density peaks near pitch angles of 180/sup 0/. It is suggested that the asymmetric pitch angle distribution may be caused by global rather than local wave-particle interactions. Just outside the shock, the pitch angle distribution was nearly isotropic and the radius of the pickup shell increased significantly. copyright American Geophysical Union 1989

  15. The velocity distributions of cometary protons picked up by the solar wind

    NASA Technical Reports Server (NTRS)

    Neugebauer, M.; Lazarus, A. J.; Balsiger, H.; Fuselier, S. A.; Neubauer, F. M.

    1989-01-01

    Velocity space distributions of picked up cometary protons were measured by the ion mass spectrometer on the Giotto spacecraft upstream of the Halley bow shock. Large pitch angle anisotropies were observed at all distances greater than 1.2 x 10 to the 6th km from the comet. As expected, pitch angle diffusion was much more rapid than energy diffusion. When the field was quasi-parallel to the solar wind velocity vector, it was possible to discern the effect of pitch angle scattering by sunward propagating, field-aligned hydromagnetic waves, but there is evidence for other scattering modes as well. For quasi-perpendicular geometries, the pitch angle distribution was very asymmetric with phase space density peaks near pitch angles of 180 deg. It is suggested that the asymmetric pitch angle distribution may be caused by global rather than local wave-particle interactions. Just outside the shock, the pitch angle distribution was nearly isotropic and the radius of the pickup shell increased significantly.

  16. INTERSTELLAR PICK-UP IONS OBSERVED BETWEEN 11 AND 22 AU BY NEW HORIZONS

    SciTech Connect

    Randol, B. M.; McComas, D. J.; Schwadron, N. A.

    2013-05-10

    We report new observations by the Solar Wind Around Pluto instrument on the New Horizons spacecraft, which measures energy per charge (E/q) spectra of solar wind and interstellar pick-up ions (PUIs) between 11 AU and 22 AU from the Sun. The data provide an unprecedented look at PUIs as there have been very few measurements of PUIs beyond 10 AU. We analyzed the PUI part of the spectra by comparing them to the classic Vasyliunas and Siscoe PUI model. Our analysis indicates that PUIs are usually well-described by this distribution. We derive parameters relevant to PUI studies, such as the ionization rate normalized to 1 AU. Our result for the average ionization rate between 11 and 12 AU agrees with an independently derived average value found during the same time. Later, we find a general increase in the ionization rate, which is consistent with the increase in solar activity. We also calculate the PUI thermal pressure, which appears to be roughly consistent with previous results. Through fitting of the solar wind proton peaks in our spectra, we derive solar wind thermal pressures. Based on our analysis, we predict a ratio of PUI thermal pressure to solar wind thermal pressure just inside the termination shock to be between 100 and >1000.

  17. The velocity distributions of cometary protons picked up by the solar wind

    NASA Technical Reports Server (NTRS)

    Neugebauer, M.; Lazarus, A. J.; Balsiger, H.; Fuselier, S. A.; Neubauer, F. M.

    1989-01-01

    Velocity space distributions of picked up cometary protons were measured by the ion mass spectrometer on the Giotto spacecraft upstream of the Halley bow shock. Large pitch angle anisotropies were observed at all distances greater than 1.2 x 10 to the 6th km from the comet. As expected, pitch angle diffusion was much more rapid than energy diffusion. When the field was quasi-parallel to the solar wind velocity vector, it was possible to discern the effect of pitch angle scattering by sunward propagating, field-aligned hydromagnetic waves, but there is evidence for other scattering modes as well. For quasi-perpendicular geometries, the pitch angle distribution was very asymmetric with phase space density peaks near pitch angles of 180 deg. It is suggested that the asymmetric pitch angle distribution may be caused by global rather than local wave-particle interactions. Just outside the shock, the pitch angle distribution was nearly isotropic and the radius of the pickup shell increased significantly.

  18. Tau-mediated nuclear depletion and cytoplasmic accumulation of SFPQ in Alzheimer's and Pick's disease.

    PubMed

    Ke, Yazi D; Ke, Yazi; Dramiga, Joe; Schütz, Ulrich; Kril, Jillian J; Ittner, Lars M; Schröder, Hannsjörg; Götz, Jürgen

    2012-01-01

    Tau dysfunction characterizes neurodegenerative diseases such as Alzheimer's disease (AD) and frontotemporal lobar degeneration (FTLD). Here, we performed an unbiased SAGE (serial analysis of gene expression) of differentially expressed mRNAs in the amygdala of transgenic pR5 mice that express human tau carrying the P301L mutation previously identified in familial cases of FTLD. SAGE identified 29 deregulated transcripts including Sfpq that encodes a nuclear factor implicated in the splicing and regulation of gene expression. To assess the relevance for human disease we analyzed brains from AD, Pick's disease (PiD, a form of FTLD), and control cases. Strikingly, in AD and PiD, both dementias with a tau pathology, affected brain areas showed a virtually complete nuclear depletion of SFPQ in both neurons and astrocytes, along with cytoplasmic accumulation. Accordingly, neurons harboring either AD tangles or Pick bodies were also depleted of SFPQ. Immunoblot analysis of human entorhinal cortex samples revealed reduced SFPQ levels with advanced Braak stages suggesting that the SFPQ pathology may progress together with the tau pathology in AD. To determine a causal role for tau, we stably expressed both wild-type and P301L human tau in human SH-SY5Y neuroblastoma cells, an established cell culture model of tau pathology. The cells were differentiated by two independent methods, mitomycin C-mediated cell cycle arrest or neuronal differentiation with retinoic acid. Confocal microscopy revealed that SFPQ was confined to nuclei in non-transfected wild-type cells, whereas in wild-type and P301L tau over-expressing cells, irrespective of the differentiation method, it formed aggregates in the cytoplasm, suggesting that pathogenic tau drives SFPQ pathology in post-mitotic cells. Our findings add SFPQ to a growing list of transcription factors with an altered nucleo-cytoplasmic distribution under neurodegenerative conditions.

  19. Laboratory diagnosis of Niemann-Pick disease type C: the filipin staining test.

    PubMed

    Vanier, Marie T; Latour, Philippe

    2015-01-01

    Niemann-Pick disease type C (NPC) is an atypical neurovisceral lysosomal storage disorder resulting from mutations in either the NPC1 or the NPC2 gene, currently conceived as a lipid trafficking disorder. Impaired egress of cholesterol from the late endosomal/lysosomal (LE/L) compartment is a key element of the pathogenesis. The resulting accumulation of unesterified cholesterol in the LE/L compartment can be visualized by fluorescence microscopy after staining with filipin. The "filipin test," performed on cultured fibroblasts, is the historical gold standard method to establish the diagnosis in patients. The authors provide methodological details of the protocol developed and used in their laboratory since 1988, in which two sources of low-density lipoproteins (LDL) (total serum and pure LDL) are used in parallel to facilitate the final interpretation. Methodological caveats and variability of patterns encountered in patients with proven Niemann-Pick C disease (typical "classic" or "intermediate," atypical "variant") are described. An overview of the past 5 years referrals (533 subjects tested, 57 NPC cases, but also 74 mildly/weakly positive tests not due to NPC) is discussed, leading to a proposed algorithm for interpretation of results in the filipin test. This tool takes into account the limits of the method. In up to 15% of all referrals, the filipin test was inconclusive in absence of molecular analysis. Patients diagnosed in the adult age preferentially showed an "intermediate" or "variant" pattern. Well conducted, the filipin test remains an efficient approach for diagnosing NPC, and it is a good functional test to study the pathogenicity of novel mutations. Copyright © 2015 Elsevier Inc. All rights reserved.

  20. Autopiquer - a Robust and Reliable Peak Detection Algorithm for Mass Spectrometry

    NASA Astrophysics Data System (ADS)

    Kilgour, David P. A.; Hughes, Sam; Kilgour, Samantha L.; Mackay, C. Logan; Palmblad, Magnus; Tran, Bao Quoc; Goo, Young Ah; Ernst, Robert K.; Clarke, David J.; Goodlett, David R.

    2017-02-01

    We present a simple algorithm for robust and unsupervised peak detection by determining a noise threshold in isotopically resolved mass spectrometry data. Solving this problem will greatly reduce the subjective and time-consuming manual picking of mass spectral peaks and so will prove beneficial in many research applications. The Autopiquer approach uses autocorrelation to test for the presence of (isotopic) structure in overlapping windows across the spectrum. Within each window, a noise threshold is optimized to remove the most unstructured data, whilst keeping as much of the (isotopic) structure as possible. This algorithm has been successfully demonstrated for both peak detection and spectral compression on data from many different classes of mass spectrometer and for different sample types, and this approach should also be extendible to other types of data that contain regularly spaced discrete peaks.

  1. Development of a novel method for determination of mercury based on its inhibitory effect on horseradish peroxidase activity followed by monitoring the surface plasmon resonance peak of gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Khodaveisi, Javad; Shabani, Ali Mohammad Haji; Dadfarnia, Shayessteh; Moghadam, Masoud Rohani; Hormozi-Nezhad, Mohammad Reza

    2016-01-01

    A highly sensitive and simple indirect spectrophotometric method has been developed for the determination of trace amounts of inorganic mercury (Hg2 +) in aqueous media. The method is based on the inhibitory effect of Hg2 + on the activity of horseradish peroxidase (HRP) in the oxidation of ascorbic acid by hydrogen peroxide followed by the reduction of Au3 + to Au-NPs by unreacted ascorbic acid and the measurement of the absorbance of localized surface plasmon resonance (LSPR) peak of gold nanoparticles (at 530 nm) which is directly proportional to the concentration of Hg2 +. Under the optimum conditions, the calibration curve was linear in the concentration range of 1-220 ng mL- 1. Limits of detection (LOD) and quantification (LOQ) were 0.2 and 0.7 ng mL- 1, respectively and the relative standard deviation at 100 ng mL- 1 level of Hg2 + was 2.6%. The method was successfully applied to the determination of mercury in different water samples.

  2. Development of a novel method for determination of mercury based on its inhibitory effect on horseradish peroxidase activity followed by monitoring the surface plasmon resonance peak of gold nanoparticles.

    PubMed

    Khodaveisi, Javad; Shabani, Ali Mohammad Haji; Dadfarnia, Shayessteh; Moghadam, Masoud Rohani; Hormozi-Nezhad, Mohammad Reza

    2016-01-15

    A highly sensitive and simple indirect spectrophotometric method has been developed for the determination of trace amounts of inorganic mercury (Hg(2+)) in aqueous media. The method is based on the inhibitory effect of Hg(2+) on the activity of horseradish peroxidase (HRP) in the oxidation of ascorbic acid by hydrogen peroxide followed by the reduction of Au(3+) to Au-NPs by unreacted ascorbic acid and the measurement of the absorbance of localized surface plasmon resonance (LSPR) peak of gold nanoparticles (at 530 nm) which is directly proportional to the concentration of Hg(2+). Under the optimum conditions, the calibration curve was linear in the concentration range of 1-220 ng mL(-1). Limits of detection (LOD) and quantification (LOQ) were 0.2 and 0.7 ng mL(-1), respectively and the relative standard deviation at 100 ng mL(-1) level of Hg(2+) was 2.6%. The method was successfully applied to the determination of mercury in different water samples. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Experimental functional analysis of severe skin-picking behavior in Prader-Willi syndrome.

    PubMed

    Hall, Scott S; Hustyi, Kristin M; Chui, Clara; Hammond, Jennifer L

    2014-10-01

    Skin picking is an extremely distressing and treatment resistant behavior commonly shown by individuals with Prader-Willi syndrome (PWS). However, with the exception of a limited number of published single-case and survey studies, little is known about the environmental determinants of skin picking in this population. In this study, functional analyses were conducted with thirteen individuals with PWS, aged 6-23 years, who engaged in severe skin-picking behavior. In addition to the conditions typically employed in a functional analysis (i.e., alone, attention, play, demand), we included an ignore condition to examine potential effects of stimulus control by the presence of an adult. Twelve participants engaged in skin picking during the functional analysis, with the highest levels occurring in the alone and ignore conditions for eight participants, suggesting that skin picking in these participants was maintained by automatic reinforcement. For the remaining four participants, an undifferentiated pattern of low-rate skin picking was observed across conditions. These data confirm previous studies indicating that skin picking in PWS may be maintained most often by automatically produced sensory consequences. There were no associations between demographic characteristics of the participants (e.g., sex, age, IQ or BMI) and levels of skin picking observed in the functional analysis. Additional investigations are needed to identify the nature of the sensory consequences produced during episodes of skin picking in PWS. Behavioral interventions designed to extinguish or compete with the potential sensory consequences arising from skin picking in PWS are also warranted. Copyright © 2014 Elsevier Ltd. All rights reserved.

  4. Migration Based Event Detection and Automatic P- and S-Phase Picking in Hengill, Southwest Iceland

    NASA Astrophysics Data System (ADS)

    Wagner, F.; Tryggvason, A.; Gudmundsson, O.; Roberts, R.; Bodvarsson, R.; Fehler, M.

    2015-12-01

    Automatic detection of seismic events is a complicated process. Common procedures depend on the detection of seismic phases (e.g. P and S) in single trace analyses and their correct association with locatable point sources. The event detection threshold is thus directly related to the single trace detection threshold. Highly sensitive phase detectors detect low signal-to-noise ratio (S/N) phases but also produce a low percentage of locatable events. Short inter-event times of only a few seconds, which is not uncommon during seismic or volcanic crises, is a complication to any event association algorithm. We present an event detection algorithm based on seismic migration of trace attributes into an a-priori three-dimensional (3D) velocity model. We evaluate its capacity as automatic detector compared to conventional methods. Detecting events using seismic migration removes the need for phase association. The event detector runs on a stack of time shifted traces, which increases S/N and thus allows for a low detection threshold. Detected events come with an origin time and a location estimate, enabling a focused trace analysis, including P- and S-phase recognition, to discard false detections and build a basis for accurate automatic phase picking. We apply the migration based detection algorithm to data from a semi-permanent seismic network at Hengill, an active volcanic region with several geothermal production sites in southwest Iceland. The network includes 26 stations with inter-station distances down to 5 km. Results show a high success rate compared to the manually picked catalogue (up to 90% detected). New detections, that were missed by the standard detection routine, show a generally good ratio of true to false alarms, i.e. most of the new events are locatable.

  5. Peak finding using biorthogonal wavelets

    SciTech Connect

    Tan, C.Y.

    2000-02-01

    The authors show in this paper how they can find the peaks in the input data if the underlying signal is a sum of Lorentzians. In order to project the data into a space of Lorentzian like functions, they show explicitly the construction of scaling functions which look like Lorentzians. From this construction, they can calculate the biorthogonal filter coefficients for both the analysis and synthesis functions. They then compare their biorthogonal wavelets to the FBI (Federal Bureau of Investigations) wavelets when used for peak finding in noisy data. They will show that in this instance, their filters perform much better than the FBI wavelets.

  6. 75 FR 22423 - Pick-Sloan Missouri Basin Program, Eastern and Western Division Proposed Project Use Power Rate

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-04-28

    ... Bureau of Reclamation Pick-Sloan Missouri Basin Program, Eastern and Western Division Proposed Project... of the Pick-Sloan Missouri Basin Program, Eastern and Western Divisions, Proposed Project Use Power Rate Adjustment. ] SUMMARY: The Bureau of Reclamation is reopening the comment period for the Pick...

  7. 76 FR 52313 - Heavy Forged Hand Tools (i.e., Axes & Adzes, Bars & Wedges, Hammers & Sledges, and Picks...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-22

    ..., and Picks & Mattocks) From the People's Republic of China: Continuation of Antidumping Duty Orders... & Adzes, Bars & Wedges, Hammers & Sledges, and Picks & Mattocks) (``Hand Tools'') from the People's... & Wedges, Hammers & Sledges, and Picks & Mattocks) From the People's Republic of China: Final Results of...

  8. Enhancing seismic P phase arrival picking based on wavelet denoising and kurtosis picker

    NASA Astrophysics Data System (ADS)

    Shang, Xueyi; Li, Xibing; Weng, Lei

    2017-09-01

    P phase arrival picking of weak signals is still challenging in seismology. A wavelet denoising is proposed to enhance seismic P phase arrival picking, and the kurtosis picker is applied on the wavelet-denoised signal to identify P phase arrival. It has been called the WD-K picker. The WD-K picker, which is different from those traditional wavelet-based pickers on the basis of a single wavelet component or certain main wavelet components, takes full advantage of the reconstruction of main detail wavelet components and the approximate wavelet component. The proposed WD-K picker considers more wavelet components and presents a better P phase arrival feature. The WD-K picker has been evaluated on 500 micro-seismic signals recorded in the Chinese Yongshaba mine. The comparison between the WD-K pickings and manual pickings shows the good picking accuracy of the WD-K picker. Furthermore, the WD-K picking performance has been compared with the main detail wavelet component combining-based kurtosis (WDC-K) picker, the single wavelet component-based kurtosis (SW-K) picker, and certain main wavelet component-based maximum kurtosis (MMW-K) picker. The comparison has demonstrated that the WD-K picker has better picking accuracy than the other three-wavelet and kurtosis-based pickers, thus showing the enhanced ability of wavelet denoising.

  9. [Is progressive anarthria a clinical form of Pick complex?].

    PubMed

    Dobato, J L; Barón-Rubio, M; Valle de Juan, M C; Barriga, F J; Sánchez-Sánchez, C; Sánchez del Río, M; Pardo-Moreno, J; Pareja, J A; Vela, L

    Progressive anarthria is defined as a clinical entity with a degenerative origin consisting in progressive difficulty in articulating while grammatical, semantic and graphic aspects of language are preserved. It is included within the group of processes affecting restricted areas of the brain although its exact nosological location is not clear. We report two cases that progressed clinically towards frontotemporal dementia and corticobasal degeneration, respectively. Case 1: a male who, at the age of 72, began with speech difficulties while comprehension and reading/writing skills were preserved. Three years later he developed apathy, bulimia, sexual indiscretions and aggressiveness, with preservation of visual memory, visual-constructional capacity and elementary writing skills. Case 2: a male who, at the age of 70, began with speech disorders, which were associated two years later to generalised slowness with Hoehn and Yahr stage II akinetic-rigid symptoms; another two years later, he developed a dystonic attitude and melokinetic apraxia in the left upper limb. The two cases, which were initially compatible with progressive anarthria, progressed clinically towards frontotemporal dementia and corticobasal degeneration, which are entities that are included in 'Pick complex'. This is a concept that we believe to be useful from a clinical point of view, given the variability that exists in the histology of the entities that have been proposed as members of this syndrome group, together with the progression of the cases described in the literature and the ones we have reported in this work.

  10. Expertise, visual search, and information pick-up in squash.

    PubMed

    Abernethy, B

    1990-01-01

    The visual search characteristics of expert and novice squash players were compared in two experiments. In the first experiment subjects were required to predict the forthcoming direction and force of an opponent's stroke from a film display. This film display was designed to simulate the normal display available to the defending player in squash and involved the use of variable temporal cut-offs to force the subjects to use advance cues in their prediction. Systematic differences in the information pick-up of the experts and novices were observed on the film task but these differences were achieved with only relatively minor between-group variations in visual search strategy. In the second experiment, set in the natural field setting, no expert-novice differences in either fixation distribution, order, or duration were observed on a comparable prediction task. This provided further support for the conclusion that the limiting factor in the perceptual performance of the novices is not an inappropriate search strategy but rather an inability to make full use of the information available from fixated display features. Some practical implications of these findings for the squash coach and player are considered.

  11. Ultrafast UV-Curable Adhesives for Optical Pick-Ups

    NASA Astrophysics Data System (ADS)

    Chung, Chang-Kyu; Jang, Kyung-Woon; Choi, Hyoung Gil; Jang, Jiyoung; Moon, Youngjun; Jeon, Chulho

    2013-08-01

    This paper describes novel ultraviolet (UV)-curable adhesives with an ultrafast curing rate which are fully cured within 8 s for optical pick-up (OPU) applications. Two kinds of oligomers (novolac epoxy acrylate and urethane acrylate), additives, and inorganic fillers were prepared for the formulation of the adhesives. In addition, three kinds of photo-initiator [2,2-dimethoxy-2-phenylacetophenone and 2-hydroxy-2-methylpropiophenone for surface curing and (2,4,6-trimethylbenzoyl) diphenyl phosphine oxide (TMDPO) for deep curing] were mixed to increase the curing rate. Photo-differential scanning calorimetry (photo-DSC) analyses showed that the newly formulated UV adhesives had faster curing rate than conventional UV adhesives. The UV adhesives were applied to OPUs for DVD/CD-RW, and five kinds of reliability tests, i.e., thermal shock, low-temperature storage, high-temperature storage, high temperature/high humidity, and nonoperation shock tests, were conducted to evaluate the adhesive reliability. According to the results of reliability tests and thermal stress simulations, the UV adhesives with lower storage modulus ( E') showed better thermal shock reliability due to lower thermal stresses. In addition, OPUs assembled using the UV adhesives passed all reliability tests. Consequently, the UV adhesives were successfully applied to OPUs in OPU production lines, contributing to mass production.

  12. Adaptive Patterns of Movement during Downward Reach and Pick-up Movements in Knee Osteoarthritis Patients with Mild Low Back Pain

    PubMed Central

    Huang, Hsuan-Ti; Liang, Jing-Min; Hung, Wei-Tso; Guo, Lan-Yuen; Wu, Wen-Lan

    2014-01-01

    [Purpose] Patients with severe bilateral knee osteoarthritis (KOA) often suffer from low back pain (LBP). However, few studies have examined the relationship between LBP and KOA in downward reach and pick-up movements. [Subjects] Eight KOA patients with LBP (LBP group), 8 KOA patients without LBP (NLBP group), and 7 healthy participants (Control group), without osteoarthritis or low back pain, were recruited for this study. [Methods] All subjects were asked to pick up a bottle with one hand, placed at the diagonal on the opposite side of the body. A 3D motion analysis system was used to record trunk and lower limb movements. [Results] The knee flexion angle on the side ipsilateral to the bottle was significantly smaller in both KOA groups than in the controls in the downward reach and pick-up movements. KOA patients showed a significantly lower trunk flexion angle and greater pelvis anterior tilt angle than the controls. In addition, no significant differences were found between the LBP and NLBP group. [Conclusion] We suspect that severe knee pain due to OA determines the priority of movement in strategic planning for the execution of pick-up movements. The knee strategy was abandoned by our severe knee OA patients, even when they had mild LBP. PMID:25364103

  13. Hubbert's Peak -- A Physicist's View

    NASA Astrophysics Data System (ADS)

    McDonald, Richard

    2011-04-01

    Oil, as used in agriculture and transportation, is the lifeblood of modern society. It is finite in quantity and will someday be exhausted. In 1956, Hubbert proposed a theory of resource production and applied it successfully to predict peak U.S. oil production in 1970. Bartlett extended this work in publications and lectures on the finite nature of oil and its production peak and depletion. Both Hubbert and Bartlett place peak world oil production at a similar time, essentially now. Central to these analyses are estimates of total ``oil in place'' obtained from engineering studies of oil reservoirs as this quantity determines the area under the Hubbert's Peak. Knowing the production history and the total oil in place allows us to make estimates of reserves, and therefore future oil availability. We will then examine reserves data for various countries, in particular OPEC countries, and see if these data tell us anything about the future availability of oil. Finally, we will comment on synthetic oil and the possibility of carbon-neutral synthetic oil for a sustainable future.

  14. Peake works on the WPA

    NASA Image and Video Library

    2016-03-22

    ISS047e013845 (03/22/2016) --- ESA (European Space Agency) astronaut Tim Peake works on the Water Processor Assembly (WPA) aboard the International Space Station. The WPA is is responsible for treating waste water aboard the station for recycling back into potable water.

  15. Peak Stress Testing Protocol Framework

    EPA Science Inventory

    Treatment of peak flows during wet weather is a common challenge across the country for municipal wastewater utilities with separate and/or combined sewer systems. Increases in wastewater flow resulting from infiltration and inflow (I/I) during wet weather events can result in op...

  16. Peak Stress Testing Protocol Framework

    EPA Science Inventory

    Treatment of peak flows during wet weather is a common challenge across the country for municipal wastewater utilities with separate and/or combined sewer systems. Increases in wastewater flow resulting from infiltration and inflow (I/I) during wet weather events can result in op...

  17. PICK1 Deficiency Impairs Secretory Vesicle Biogenesis and Leads to Growth Retardation and Decreased Glucose Tolerance

    PubMed Central

    Jansen, Anna M.; Jin, Chunyu; Rickhag, Mattias; Lund, Viktor K.; Jensen, Morten; Bhatia, Vikram; Sørensen, Gunnar; Madsen, Andreas N.; Xue, Zhichao; Møller, Siri K.; Woldbye, David; Qvortrup, Klaus; Huganir, Richard; Stamou, Dimitrios; Kjærulff, Ole; Gether, Ulrik

    2013-01-01

    Secretory vesicles in endocrine cells store hormones such as growth hormone (GH) and insulin before their release into the bloodstream. The molecular mechanisms governing budding of immature secretory vesicles from the trans-Golgi network (TGN) and their subsequent maturation remain unclear. Here, we identify the lipid binding BAR (Bin/amphiphysin/Rvs) domain protein PICK1 (protein interacting with C kinase 1) as a key component early in the biogenesis of secretory vesicles in GH-producing cells. Both PICK1-deficient Drosophila and mice displayed somatic growth retardation. Growth retardation was rescued in flies by reintroducing PICK1 in neurosecretory cells producing somatotropic peptides. PICK1-deficient mice were characterized by decreased body weight and length, increased fat accumulation, impaired GH secretion, and decreased storage of GH in the pituitary. Decreased GH storage was supported by electron microscopy showing prominent reduction in secretory vesicle number. Evidence was also obtained for impaired insulin secretion associated with decreased glucose tolerance. PICK1 localized in cells to immature secretory vesicles, and the PICK1 BAR domain was shown by live imaging to associate with vesicles budding from the TGN and to possess membrane-sculpting properties in vitro. In mouse pituitary, PICK1 co-localized with the BAR domain protein ICA69, and PICK1 deficiency abolished ICA69 protein expression. In the Drosophila brain, PICK1 and ICA69 co-immunoprecipitated and showed mutually dependent expression. Finally, both in a Drosophila model of type 2 diabetes and in high-fat-diet-induced obese mice, we observed up-regulation of PICK1 mRNA expression. Our findings suggest that PICK1, together with ICA69, is critical during budding of immature secretory vesicles from the TGN and thus for vesicular storage of GH and possibly other hormones. The data link two BAR domain proteins to membrane remodeling processes in the secretory pathway of peptidergic endocrine

  18. PICK1 deficiency impairs secretory vesicle biogenesis and leads to growth retardation and decreased glucose tolerance.

    PubMed

    Holst, Birgitte; Madsen, Kenneth L; Jansen, Anna M; Jin, Chunyu; Rickhag, Mattias; Lund, Viktor K; Jensen, Morten; Bhatia, Vikram; Sørensen, Gunnar; Madsen, Andreas N; Xue, Zhichao; Møller, Siri K; Woldbye, David; Qvortrup, Klaus; Huganir, Richard; Stamou, Dimitrios; Kjærulff, Ole; Gether, Ulrik

    2013-01-01

    Secretory vesicles in endocrine cells store hormones such as growth hormone (GH) and insulin before their release into the bloodstream. The molecular mechanisms governing budding of immature secretory vesicles from the trans-Golgi network (TGN) and their subsequent maturation remain unclear. Here, we identify the lipid binding BAR (Bin/amphiphysin/Rvs) domain protein PICK1 (protein interacting with C kinase 1) as a key component early in the biogenesis of secretory vesicles in GH-producing cells. Both PICK1-deficient Drosophila and mice displayed somatic growth retardation. Growth retardation was rescued in flies by reintroducing PICK1 in neurosecretory cells producing somatotropic peptides. PICK1-deficient mice were characterized by decreased body weight and length, increased fat accumulation, impaired GH secretion, and decreased storage of GH in the pituitary. Decreased GH storage was supported by electron microscopy showing prominent reduction in secretory vesicle number. Evidence was also obtained for impaired insulin secretion associated with decreased glucose tolerance. PICK1 localized in cells to immature secretory vesicles, and the PICK1 BAR domain was shown by live imaging to associate with vesicles budding from the TGN and to possess membrane-sculpting properties in vitro. In mouse pituitary, PICK1 co-localized with the BAR domain protein ICA69, and PICK1 deficiency abolished ICA69 protein expression. In the Drosophila brain, PICK1 and ICA69 co-immunoprecipitated and showed mutually dependent expression. Finally, both in a Drosophila model of type 2 diabetes and in high-fat-diet-induced obese mice, we observed up-regulation of PICK1 mRNA expression. Our findings suggest that PICK1, together with ICA69, is critical during budding of immature secretory vesicles from the TGN and thus for vesicular storage of GH and possibly other hormones. The data link two BAR domain proteins to membrane remodeling processes in the secretory pathway of peptidergic endocrine

  19. Picking the Right Horse? Dominant Maneuver in the Twenty-First Century

    DTIC Science & Technology

    1998-06-05

    SUBTITLE Picking the Right Horse ? Dominant Maneuver in the Twenty-First Century 6.AUTH0RIS) Major Steven D. Russell, U.S. Army 7. PERFORMING...Z39-18 298-102 PICKING THE RIGHT HORSE ? DOMINANT MANEUVER IN THE TWENTY-FIRST CENTURY A thesis presented to the Faculty of the U.S. Army Command...unlimited. wc«’*u»»»«aBI PICKING THE RIGHT HORSE ? DOMINANT MANEUVER IN THE TWENTY-FIRST CENTURY A thesis presented to the Faculty of the U.S. Army

  20. The useful preliminary diagnosis of Niemann-Pick disease type C by filipin test in blood smear.

    PubMed

    Takamura, Ayumi; Sakai, Norio; Shinpoo, Michiko; Noguchi, Atsuko; Takahashi, Tsutomu; Matsuda, Shin; Yamamoto, Masanari; Narita, Aya; Ohno, Kosaku; Ohashi, Toya; Ida, Hiroyuki; Eto, Yoshikatsu

    2013-11-01

    Niemann-Pick disease type C (NP-C) is an autosomal recessive lysosomal lipid storage disorder characterized with accumulation of cholesterol in endosomes and lysosomes. The diagnosis of NP-C is difficult due to its heterogeneous group of diseases. Biochemical diagnosis of NP-C is conducted by cholesterol staining with cultured skin fibroblasts and confirmed by the analysis of genetic mutations of NPC1 or NPC2 gene. Here, we report an easier biochemical diagnostic method with blood smear by filipin staining. © 2013 Elsevier Inc. All rights reserved.

  1. High resolution optical shaft encoder for motor speed control based on an optical disk pick-up

    NASA Astrophysics Data System (ADS)

    Yeh, Wei-Hung; Bletscher, Warren; Mansuripur, M.

    1998-08-01

    Using a three-beam optical pick-up from a compact disk player and a flexible, shaft-mounted diffraction grating, we obtain information about the rotation speed and angular position of the motor's spindle. This information may be used for feedback to the motor for smooth operation. Due to the small size of the focused spot and the built-in auto-focus mechanism of the optical head, the proposed encoder can achieve submicrometer resolution. With high resolution, reliable operation, and low-cost elements, the proposed method is suitable for rotary and linear motion control where accurate positioning of an object is required.

  2. Pick's disease with Pick bodies: an unusual autopsy case showing degeneration of the pontine nucleus, dentate nucleus, Clarke's column, and lower motor neuron.

    PubMed

    Oda, Tatsuro; Tsuchiya, Kuniaki; Arai, Tetsuaki; Togo, Takashi; Uchikado, Hirotake; de Silva, Rohan; Lees, Andrew; Akiyama, Haruhiko; Haga, Chie; Ikeda, Kenji; Kato, Motoichiro; Kato, Yuji; Hara, Tsunekatsu; Onaya, Mitsumoto; Hori, Koji; Teramoto, Hiroshi; Tominaga, Itaru

    2007-02-01

    We report a 51-year-old female with Pick's disease with Pick bodies (PDPB) showing a brainweight of 530 g. This case was considered to be a very rare case of PDPB, in which the lesion developed in the temporal and frontal lobes and later spread to the parietal lobe, occipital lobe, brainstem, cerebellum and spinal cord. This case showed very atypical clinicopathological findings. Clinically, bulging eyes and myoclonus were observed. Neuropathologically, Pick bodies were widely distributed beyond the usual distribution areas to the parietal cortices, occipital cortices, dentate nuclei, motor neuron nuclei in the brain stem, and spinal cord. The atypical clinical symptoms and the widespread neuropathological abnormalities observed in this case seem to represent an extremely extended form of PDPB.

  3. Accuracy of peak deconvolution algorithms within chromatographic integrators

    SciTech Connect

    Papas, A.N. ); Tougas, T.P. )

    1990-02-01

    The soundness of present-day algorithms to deconvolve overlapping skewed peaks was investigated. From simulated studies based on the exponentially modified Gaussian model (EMG), chromatographic peak area inaccuracies for unresolved peaks are presented for the two deconvolution methods, the tangent skim and the perpendicular drop method. These inherent inaccuracies, in many cases exceeding 50%, are much greater than those calculated from ideal Gaussian profiles. Multiple linear regression (MLR) was used to build models that predict the relative error for either peak deconvolution method. MLR also provided a means for determining influential independent variables, defining the required chromatographic relationships needed for prediction. Once forecasted errors for both methods are calculated, selection of either peak deconvolution method can be made by minimum errors. These selection boundaries are contrasted to method selection criteria of present data systems algorithms.

  4. Forecasting peaks of seasonal influenza epidemics.

    PubMed

    Nsoesie, Elaine; Mararthe, Madhav; Brownstein, John

    2013-06-21

    We present a framework for near real-time forecast of influenza epidemics using a simulation optimization approach. The method combines an individual-based model and a simple root finding optimization method for parameter estimation and forecasting. In this study, retrospective forecasts were generated for seasonal influenza epidemics using web-based estimates of influenza activity from Google Flu Trends for 2004-2005, 2007-2008 and 2012-2013 flu seasons. In some cases, the peak could be forecasted 5-6 weeks ahead. This study adds to existing resources for influenza forecasting and the proposed method can be used in conjunction with other approaches in an ensemble framework.

  5. Hubbert's Peak: the Impending World oil Shortage

    NASA Astrophysics Data System (ADS)

    Deffeyes, K. S.

    2004-12-01

    Global oil production will probably reach a peak sometime during this decade. After the peak, the world's production of crude oil will fall, never to rise again. The world will not run out of energy, but developing alternative energy sources on a large scale will take at least 10 years. The slowdown in oil production may already be beginning; the current price fluctuations for crude oil and natural gas may be the preamble to a major crisis. In 1956, the geologist M. King Hubbert predicted that U.S. oil production would peak in the early 1970s.1 Almost everyone, inside and outside the oil industry, rejected Hubbert's analysis. The controversy raged until 1970, when the U.S. production of crude oil started to fall. Hubbert was right. Around 1995, several analysts began applying Hubbert's method to world oil production, and most of them estimate that the peak year for world oil will be between 2004 and 2008. These analyses were reported in some of the most widely circulated sources: Nature, Science, and Scientific American.2 None of our political leaders seem to be paying attention. If the predictions are correct, there will be enormous effects on the world economy. Even the poorest nations need fuel to run irrigation pumps. The industrialized nations will be bidding against one another for the dwindling oil supply. The good news is that we will put less carbon dioxide into the atmosphere. The bad news is that my pickup truck has a 25-gallon tank.

  6. Peake in Columbus with sensor

    NASA Image and Video Library

    2016-01-26

    ISS046e024411 (01/26/2016) --- European Space Agency (ESA) astronaut Timothy Peake prepares to install a space acceleration measurement system sensor inside the European Columbus module aboard the International Space Station. The device is used in an ongoing study of the small forces (vibrations and accelerations) on the International Space Station resulting from the operation of hardware, crew activities, dockings and maneuvering. Results generalize the types of vibrations affecting vibration-sensitive experiments.

  7. SPANISH PEAKS PRIMITIVE AREA, MONTANA.

    USGS Publications Warehouse

    Calkins, James A.; Pattee, Eldon C.

    1984-01-01

    A mineral survey of the Spanish Peaks Primitive Area, Montana, disclosed a small low-grade deposit of demonstrated chromite and asbestos resources. The chances for discovery of additional chrome resources are uncertain and the area has little promise for the occurrence of other mineral or energy resources. A reevaluation, sampling at depth, and testing for possible extensions of the Table Mountain asbestos and chromium deposit should be undertaken in the light of recent interpretations regarding its geologic setting.

  8. Twin Peaks (B/W)

    NASA Technical Reports Server (NTRS)

    1997-01-01

    The Twin Peaks are modest-size hills to the southwest of the Mars Pathfinder landing site. They were discovered on the first panoramas taken by the IMP camera on the 4th of July, 1997, and subsequently identified in Viking Orbiter images taken over 20 years ago. The peaks are approximately 30-35 meters (-100 feet) tall. North Twin is approximately 860 meters (2800 feet) from the lander, and South Twin is about a kilometer away (3300 feet). The scene includes bouldery ridges and swales or 'hummocks' of flood debris that range from a few tens of meters away from the lander to the distance of the South Twin Peak. The large rock at the right edge of the scene is nicknamed 'Hippo'. This rock is about a meter (3 feet) across and 25 meters (80 feet) distant.

    Mars Pathfinder is the second in NASA's Discovery program of low-cost spacecraft with highly focused science goals. The Jet Propulsion Laboratory, Pasadena, CA, developed and manages the Mars Pathfinder mission for NASA's Office of Space Science, Washington, D.C. JPL is a division of the California Institute of Technology (Caltech). The IMP was developed by the University of Arizona Lunar and Planetary Laboratory under contract to JPL. Peter Smith is the Principal Investigator.

  9. Twin Peaks (B/W)

    NASA Technical Reports Server (NTRS)

    1997-01-01

    The Twin Peaks are modest-size hills to the southwest of the Mars Pathfinder landing site. They were discovered on the first panoramas taken by the IMP camera on the 4th of July, 1997, and subsequently identified in Viking Orbiter images taken over 20 years ago. The peaks are approximately 30-35 meters (-100 feet) tall. North Twin is approximately 860 meters (2800 feet) from the lander, and South Twin is about a kilometer away (3300 feet). The scene includes bouldery ridges and swales or 'hummocks' of flood debris that range from a few tens of meters away from the lander to the distance of the South Twin Peak. The large rock at the right edge of the scene is nicknamed 'Hippo'. This rock is about a meter (3 feet) across and 25 meters (80 feet) distant.

    Mars Pathfinder is the second in NASA's Discovery program of low-cost spacecraft with highly focused science goals. The Jet Propulsion Laboratory, Pasadena, CA, developed and manages the Mars Pathfinder mission for NASA's Office of Space Science, Washington, D.C. JPL is a division of the California Institute of Technology (Caltech). The IMP was developed by the University of Arizona Lunar and Planetary Laboratory under contract to JPL. Peter Smith is the Principal Investigator.

  10. Peak expiratory flow at altitude.

    PubMed

    Thomas, P S; Harding, R M; Milledge, J S

    1990-08-01

    The mini Wright peak flow meter is a useful, portable instrument for field studies but being sensitive to air density will under-read at altitude. True peak expiratory flow will increase at altitude, however, because of the decreased air density, given that dynamic resistance is unchanged. The effect of simulated altitude on peak expiratory flow (PEF) was determined in six subjects with both the mini Wright meter and a volumetric spirometer (which is unaffected by air density). With increasing altitude PEF as measured by the spirometer increased linearly with decreasing pressure, so that at a barometric pressure of 380 mm Hg* (half an atmosphere, corresponding to an altitude of 5455 m) there was a 20% increase over sea level values. The mini Wright flow meter gave readings 6% below sea level values for this altitude--that is, under-reading by 26%. Measurements of PEF made at altitude with the mini Wright meter should be corrected by adding 6.6% per 100 mm Hg drop in barometric pressure.

  11. Quantifying peak discharges for historical floods

    USGS Publications Warehouse

    Cook, J.L.

    1987-01-01

    It is usually advantageous to use information regarding historical floods, if available, to define the flood-frequency relation for a stream. Peak stages can sometimes be determined for outstanding floods that occurred many years ago before systematic gaging of streams began. In the United States, this information is usually not available for more than 100-200 years, but in countries with long cultural histories, such as China, historical flood data are available at some sites as far back as 2,000 years or more. It is important in flood studies to be able to assign a maximum discharge rate and an associated error range to the historical flood. This paper describes the significant characteristics and uncertainties of four commonly used methods for estimating the peak discharge of a flood. These methods are: (1) rating curve (stage-discharge relation) extension; (2) slope conveyance; (3) slope area; and (4) step backwater. Logarithmic extensions of rating curves are based on theoretical plotting techniques that results in straight line extensions provided that channel shape and roughness do not change significantly. The slope-conveyance and slope-area methods are based on the Manning equation, which requires specific data on channel size, shape and roughness, as well as the water-surface slope for one or more cross-sections in a relatively straight reach of channel. The slope-conveyance method is used primarily for shaping and extending rating curves, whereas the slope-area method is used for specific floods. The step-backwater method, also based on the Manning equation, requires more cross-section data than the slope-area ethod, but has a water-surface profile convergence characteristic that negates the need for known or estimated water-surface slope. Uncertainties in calculating peak discharge for historical floods may be quite large. Various investigations have shown that errors in calculating peak discharges by the slope-area method under ideal conditions for

  12. An Experimental Study of Cutting Performances of Worn Picks

    NASA Astrophysics Data System (ADS)

    Dogruoz, Cihan; Bolukbasi, Naci; Rostami, Jamal; Acar, Cemil

    2016-01-01

    The best means to assess rock cuttability and efficiency of cutting process for using mechanical excavation is specific energy (SE), measured in full-scale rock cutting test. This is especially true for the application of roadheaders, often fitted with drag-type cutting tools. Radial picks or drag bits are changed during the operation as they reach a certain amount of wear and become blunt. In this study, full-scale cutting tests in different sedimentary rock types with bits having various degree of wear were used to evaluate the influence of bit wear on cutting forces and specific energy. The relationship between the amount of wear as represented by the size of the wear flats at the tip of the bit, and cutting forces as well as specific energy was examined. The influence of various rock properties such as mineral content, uniaxial compressive strength, tensile strength, indentation index, shore hardness, Schmidt hammer hardness, and density with required SE of cutting using different levels of tool wear was also studied. The preliminary analysis of the data shows that the mean cutting forces increase 2-3 times and SE by 4-5 times when cutting with 4 mm wear flat as compared to cutting with new or sharp wedge shape bits. The grain size distribution of the muck for cutting different rock types and different level of bit wear was analyzed and discussed. The best fit prediction models for SE based on statistical analysis of laboratory test results are introduced. The model can be used for estimating the performance of mechanical excavators using radial tools, especially roadheaders, continuous miners and longwall drum shearers.

  13. A Case of Skin Picking Disorder of a Patient with a History of Childhood Abuse

    PubMed Central

    OKAN İBİLOĞLU, Aslıhan; ATLI, Abdullah; KAYA, Mehmet Cemal; DEMİR, Süleyman; BULUT, Mahmut; SIR, Aytekin

    2016-01-01

    Skin picking (excoriation) disorder is the recurrent excoriation of one’s own skin, resulting in noticeable skin damage. People pick their skin for different reasons. For the majority of patients, first skin picking is associated with a history of childhood abuse and personal problems. Subjects who moderately to severely cause injurious self-harm are more likely to have a history of exposure to domestic violence and childhood abuse than those who do not self-harm. At the same time, these conditions could be related to the etiology for majority of other psychiatric disorders. We report herein, a case of a patient with skin picking disorder who had a history of childhood physical and emotional abuse with borderline personality disorder. PMID:28360794

  14. PAL-XFEL cavity beam position monitor pick-up design and beam test

    NASA Astrophysics Data System (ADS)

    Lee, Sojeong; Park, Young Jung; Kim, Changbum; Kim, Seung Hwan; Shin, Dong Cheol; Han, Jang-Hui; Ko, In Soo

    2016-08-01

    As an X-ray Free Electron Laser, PAL-XFEL is about to start beam commissioning. X-band cavity beam position monitor (BPM) is used in the PAL-XFEL undulator beam line. Prototypes of cavity BPM pick-up were designed and fabricated to test the RF characteristics. Also, the beam test of a cavity BPM pick-up was done in the Injector Test Facility (ITF). In the beam test, the raw signal properties of the cavity BPM pick-up were measured at a 200 pC bunch charge. According to the RF test and beam test results, the prototype cavity BPM pick-up design was confirmed to meet the requirements of the PAL-XFEL cavity BPM system.

  15. A Case of Skin Picking Disorder of a Patient with a History of Childhood Abuse.

    PubMed

    Okan Ibiloğlu, Aslıhan; Atli, Abdullah; Kaya, Mehmet Cemal; Demir, Süleyman; Bulut, Mahmut; Sir, Aytekin

    2016-06-01

    Skin picking (excoriation) disorder is the recurrent excoriation of one's own skin, resulting in noticeable skin damage. People pick their skin for different reasons. For the majority of patients, first skin picking is associated with a history of childhood abuse and personal problems. Subjects who moderately to severely cause injurious self-harm are more likely to have a history of exposure to domestic violence and childhood abuse than those who do not self-harm. At the same time, these conditions could be related to the etiology for majority of other psychiatric disorders. We report herein, a case of a patient with skin picking disorder who had a history of childhood physical and emotional abuse with borderline personality disorder.

  16. Clinicopathological characterization of Pick's disease versus frontotemporal lobar degeneration with ubiquitin/TDP-43-positive inclusions.

    PubMed

    Yokota, Osamu; Tsuchiya, Kuniaki; Arai, Tetsuaki; Yagishita, Saburo; Matsubara, Osamu; Mochizuki, Akihide; Tamaoka, Akira; Kawamura, Mitsuru; Yoshida, Hidetoshi; Terada, Seishi; Ishizu, Hideki; Kuroda, Shigetoshi; Akiyama, Haruhiko

    2009-04-01

    Although frontotemporal lobar degeneration with ubiquitin/TDP-43-positive inclusions (FTLD-TDP) and Pick's disease are common pathological substrates in sporadic FTLD, clinical differentiation of these diseases is difficult. We performed a retrospective review of medical records and semiquantitative examination of neuronal loss of 20 sporadic FTLD-TDP and 19 Pick's disease cases. Semantic dementia as the first syndrome developed only in FTLD-TDP patients. Impaired speech output in the early stage was five times more frequent in Pick's disease than in FTLD-TDP. The total frequency of asymmetric motor disturbances (e.g., parkinsonism, pyramidal signs, and contracture) during the course was significantly more frequent in FTLD-TDP (78%) than in Pick's disease cases (14%). Asymmetric pyramidal signs were found in 7 of 13 FTLD-TDP cases with corticospinal tract degeneration similar to primary lateral sclerosis. Frontotemporal dementia as the first syndrome was noted in both FTLD-TDP (28%) and Pick's disease cases (64%); however, only FTLD-TDP cases subsequently developed asymmetric motor disturbances, and some of the cases further exhibited hemineglect. Concordant with these clinical findings, degeneration in the temporal cortex, caudate nucleus, putamen, globus pallidus, substantia nigra, and corticospinal tract was significantly more severe in FTLD-TDP, and degeneration in the frontal cortex tended to be more severe in Pick's disease. Given these findings, the initial impairment of semantic memory or comprehension and subsequent asymmetric motor disturbances in sporadic FTLD patients predict sporadic FTLD-TDP rather than Pick's disease, while initial behavioral symptoms or non-fluent aphasia without subsequent asymmetric motor disturbances predict Pick's disease rather than sporadic FTLD-TDP.

  17. Habit Reversal as a Treatment for Chronic Skin Picking: A Pilot Investigation

    ERIC Educational Resources Information Center

    Teng, Ellen J.; Woods, Douglas W.; Twohig, Michael P.

    2006-01-01

    The purpose of this study was to compare the effectiveness of habit reversal (HR) to a wait-list control as a treatment for chronic skin picking in adults. Twenty-five adults with a chronic skin-picking problem were randomly assigned to a wait-list control or HR group. At pretreatment, posttreatment, and a 3-month follow-up, self-reported skin…

  18. Use of Topiramate in Skin-Picking Disorder: A Pilot Study.

    PubMed

    Jafferany, Mohammad; Osuagwu, Ferdnand C

    2017-01-26

    Repetitive skin picking that culminates in skin lesions and excoriations has a fairly common prevalence and causes clinically significant distress. Myriads of agents have been used to treat the condition with no convincing results. Ten patients (8 women and 2 men) with skin-picking disorder (per DSM-5 criteria) were enrolled in the study. The study was conducted from December 1, 2013, to December 29, 2014. The patients were treated with 12-week open-label topiramate in a titrating-upward dose (25-200 mg/d). Different measures to evaluate the efficacy of topiramate included subjective and objective assessment, photographs, the Skin Picking Scale modified after the Yale-Brown Obsessive-Compulsive Scale (SPS-Y-BOCS), the Skin Picking Impact Scale, the Clinical Global Impressions-Improvement (CGI-I) and CGI-Severity scales, and the Beck Anxiety Inventory and Beck Depression Inventory. Topiramate improved time spent skin picking from 85 minutes to 30 minutes per day. Seven patients (70%) were very much improved (n = 4) and much improved (n = 30) on the CGI-I. The scores on the Skin Picking Impact Scale and SPS-Y-BOCS also improved. The mean time to respond to topiramate was about 8 to 10 weeks. Anxiety and depression symptoms improved after reduction in skin-picking symptoms (the Beck Anxiety Inventory score improved from a mean of 38.8 to 13.8 and the Beck Depression Inventory score from 28.9 to 10.1). Topiramate appears to be a promising agent in the treatment of skin-picking symptoms. Double-blind controlled trials are needed to further evaluate the safety and efficacy of topiramate in larger population samples. ISRCTN registry identifier: ISRCTN15791118.

  19. Habit Reversal as a Treatment for Chronic Skin Picking: A Pilot Investigation

    ERIC Educational Resources Information Center

    Teng, Ellen J.; Woods, Douglas W.; Twohig, Michael P.

    2006-01-01

    The purpose of this study was to compare the effectiveness of habit reversal (HR) to a wait-list control as a treatment for chronic skin picking in adults. Twenty-five adults with a chronic skin-picking problem were randomly assigned to a wait-list control or HR group. At pretreatment, posttreatment, and a 3-month follow-up, self-reported skin…

  20. Not Just Being Lifted: Infants are Sensitive to Delay During a Pick-Up Routine

    PubMed Central

    Fantasia, Valentina; Markova, Gabriela; Fasulo, Alessandra; Costall, Alan; Reddy, Vasudevi

    2016-01-01

    In the present study we observed whether infants show online adjustments to the mother’s incipient action by looking at their sensitivity to changes as the pick-up unfolded. Twenty-three 3-month-old infants and their mothers were observed in the lab, where mothers were instructed (1) to pick-up their infants as they usually did (normal pick-up), and then (2) to delay the pick-up for 6 s after placing their hands on the infants’ waist (delayed pick-up). In both Normal and Delayed conditions infant’s body tension, affective displays and gaze shifts were coded during three phases: Approach, Contact, and Lift. Additionally, a measure of infants’ head support in terms of head lag at the beginning and end of Lift was computed. Results showed that during normal pick-up infants tensed up their body during the Approach phase and increased their tension during contact, maintaining it through Lift; their head was also supported and in line with their body during Lift. When the pick-up was delayed, infants also tensed their body during Approach, yet this tension did not increase during the Contact phase and was significantly lower at Lift. Their head support was also lower in the Delayed condition and they shifted their gazes away from their mothers’ face more often than in the Normal condition. These results suggest that infants are sensitive to changes of the timing of the pick-up sequence, which in turn may have affected their contribution to the interaction. PMID:26834674

  1. Semi-Automated Digital Image Analysis of Pick's Disease and TDP-43 Proteinopathy.

    PubMed

    Irwin, David J; Byrne, Matthew D; McMillan, Corey T; Cooper, Felicia; Arnold, Steven E; Lee, Edward B; Van Deerlin, Vivianna M; Xie, Sharon X; Lee, Virginia M-Y; Grossman, Murray; Trojanowski, John Q

    2016-01-01

    Digital image analysis of histology sections provides reliable, high-throughput methods for neuropathological studies but data is scant in frontotemporal lobar degeneration (FTLD), which has an added challenge of study due to morphologically diverse pathologies. Here, we describe a novel method of semi-automated digital image analysis in FTLD subtypes including: Pick's disease (PiD, n=11) with tau-positive intracellular inclusions and neuropil threads, and TDP-43 pathology type C (FTLD-TDPC, n=10), defined by TDP-43-positive aggregates predominantly in large dystrophic neurites. To do this, we examined three FTLD-associated cortical regions: mid-frontal gyrus (MFG), superior temporal gyrus (STG) and anterior cingulate gyrus (ACG) by immunohistochemistry. We used a color deconvolution process to isolate signal from the chromogen and applied both object detection and intensity thresholding algorithms to quantify pathological burden. We found object-detection algorithms had good agreement with gold-standard manual quantification of tau- and TDP-43-positive inclusions. Our sampling method was reliable across three separate investigators and we obtained similar results in a pilot analysis using open-source software. Regional comparisons using these algorithms finds differences in regional anatomic disease burden between PiD and FTLD-TDP not detected using traditional ordinal scale data, suggesting digital image analysis is a powerful tool for clinicopathological studies in morphologically diverse FTLD syndromes. © The Author(s) 2015.

  2. ["Pit picking" surgery for patients with pilonidal disease : mid-term results and risk factors].

    PubMed

    Iesalnieks, I; Deimel, S; Schlitt, H J

    2015-05-01

    Minimally invasive procedures have increasingly been used to treat pilonidal disease; however, the mid-term and long-term results have not been evaluated extensively yet. All patients underwent "pit picking" surgery. The surgery was performed under local anesthesia. The technique of "pit picking" was: all midline pits were removed by excising a margin of skin of < 1 mm. An incision of 1 cm parallel to one side of the natal cleft opened the chronic abscess cavity. No specific postoperative wound care was given. A total of 153 patients (126 males) underwent "pit picking" surgery between June 2007 and November 2010. Follow-up information was available for 148 patients (97 %). Of the patients 74% had no recurrence after a median follow-up time of 30 months and 8 more patients (5 %) remained asymptomatic after a second"pit picking" procedure. By multivariate analysis, smoking (hazard ratio [HR] 2.1) and occurrence of an abscess during the course of disease (HR 2.7) were statistically significantly associated with the disease recurrence after "pit picking" surgery. Approximately three quarters of selected patients with pilonidal disease benefit from minimally invasive "pit picking" surgery.

  3. Implicit processes in pathological skin picking: responses to skin irregularities predict symptom severity and treatment susceptibility.

    PubMed

    Schuck, Kathrin; Keijsers, Ger; Rinck, Mike

    2012-03-01

    Implicit cognitive processes are relevant in understanding the development and maintenance of psychopathology and dysfunctional behaviours. The present study investigated the role of implicit processes in pathological skin picking (PSP). Using an Approach-Avoidance Task (AAT), we examined automatic response tendencies towards skin picking-related photographs in a sample of 34 college students who suffered from PSP and participated in a randomized, waiting-list controlled treatment study. In comparison to a control sample (n = 49), PSP patients displayed significantly decelerated reaction times (distraction) in response to photographs of skin irregularities and a tendency to respond with avoidance to photographs of skin irregularities. Both distraction and avoidance in reaction to photographs of skin irregularities were significantly associated with current skin picking severity. Moreover, the strength of distraction in response to skin irregularities predicted unique variance in skin picking severity at post-measurement, over and above the effect of skin picking severity at pre-measurement and the effect of treatment condition. For the treatment condition, higher initial distraction predicted better treatment outcome (lower skin picking severity at post-measurement), whereas it predicted symptom deterioration at post-treatment for untreated participants. The specific characteristics of PSP patients (mainly female university students) and the relatively small sample size may compromise generalizability of findings. In PSP, affective distraction in response to skin irregularities seems to characterize an important process related to symptom severity as well as treatment susceptibility. Copyright © 2011 Elsevier Ltd. All rights reserved.

  4. GLACIER PEAK ROADLESS AREA, WASHINGTON.

    USGS Publications Warehouse

    Church, S.E.; Johnson, F.L.

    1984-01-01

    A mineral survey outlined areas of mineral-resource potential in the Glacier Peak Roadless Area, Washington. Substantiated resource potential for base and precious metals has been identified in four mining districts included in whole or in part within the boundary of the roadless area. Several million tons of demonstrated base- and precious-metal resources occur in numerous mines in these districts. Probable resource potential for precious metals exists along a belt of fractured and locally mineralized rock extending northeast from Monte Cristo to the northeast edge of the roadless area.

  5. GRANITE PEAK ROADLESS AREA, CALIFORNIA.

    USGS Publications Warehouse

    Huber, Donald F.; Thurber, Horace K.

    1984-01-01

    The Granite Peak Roadless Area occupies an area of about 5 sq mi in the southern part of the Trinity Alps of the Klamath Mountains, about 12 mi north-northeast of Weaverville, California. Rock and stream-sediment samples were analyzed. All streams draining the roadless area were sampled and representative samples of the rock types in the area were collected. Background values were established for each element and anomalous values were examined within their geologic settings and evaluated for their significance. On the basis of mineral surveys there seems little likelihood for the occurrence of mineral or energy resources.

  6. WHEELER PEAK ROADLESS AREA, NEVADA.

    USGS Publications Warehouse

    Whitebread, Donald H.; Kluender, Steven E.

    1984-01-01

    Field investigations to evaluate the mineral-resource potential of the Wheeler Peak Roadless Area in east-central Nevada were conducted. The field studies included geologic mapping, geochemical sampling, geophysical surveys, and a survey of mines and prospects. Several areas in the sedimentary and granitic rocks in the lower plate of the Snake Range decollement have probable mineral-resource potential for tungsten, beryllium, and lead. A small area of gravels near the north border of the area has a probable mineral-resource potential for placer gold. The geologic setting is not conducive for the occurrence of energy resources.

  7. Pontine-to-midbrain ratio indexes ocular-motor function and illness stage in adult Niemann-Pick disease type C.

    PubMed

    Walterfang, M; Macfarlane, M D; Looi, J C L; Abel, L; Bowman, E; Fahey, M C; Desmond, P; Velakoulis, D

    2012-03-01

    Niemann-Pick disease type C (NPC) is a progressive neurovisceral disorder associated with dystonia, ataxia and a characteristic gaze palsy. Neuropathological studies have demonstrated brainstem atrophy associated with neuronal inclusions and loss, and neurofibrillary tangles, although it is not known whether this pathology can be detected in vivo or how these changes relate to illness variables, particularly ocular-motor changes. Our aim was to utilize a method for brainstem atrophy, validated in progressive supranuclear palsy (PSP), in a group of adult patients with NPC, and explore its relationship to illness variables and ocular-motor functioning. We calculated the midbrain and pontine area, and pontine-to-midbrain ratio (PMR) from midsagittal images of 10 adult patients with NPC and 27 age- and gender-matched controls. Measures were correlated with illness variables, and measures of horizontal saccadic functioning. Pontine-to-midbrain ratio was 14% higher in the NPC group, but this difference was not significant. However, PMR showed a significant positive correlation with duration of illness and a measure of illness severity. Furthermore, PMR was significantly negatively correlated with saccadic peak velocity and gain, and self-paced saccadic performance. Pontine-to-midbrain ratio was increased in adult patients with NPC compared to controls, although not to the same degree as previously described in PSP, which also presents with significant gaze palsy. These changes were driven predominantly by progressive midbrain atrophy. The strong correlation with illness and ocular-motor variables suggests that it may be a useful marker for illness progression in NPC. © 2011 The Author(s). European Journal of Neurology © 2011 EFNS.

  8. Peakompactons: Peaked compact nonlinear waves

    DOE PAGES

    Christov, Ivan C.; Kress, Tyler; Saxena, Avadh

    2017-04-20

    This paper is meant as an accessible introduction to/tutorial on the analytical construction and numerical simulation of a class of nonstandard solitary waves termed peakompactons. We present that these peaked compactly supported waves arise as solutions to nonlinear evolution equations from a hierarchy of nonlinearly dispersive Korteweg–de Vries-type models. Peakompactons, like the now-well-known compactons and unlike the soliton solutions of the Korteweg–de Vries equation, have finite support, i.e., they are of finite wavelength. However, unlike compactons, peakompactons are also peaked, i.e., a higher spatial derivative suffers a jump discontinuity at the wave’s crest. Here, we construct such solutions exactly bymore » reducing the governing partial differential equation to a nonlinear ordinary differential equation and employing a phase-plane analysis. Lastly, a simple, but reliable, finite-difference scheme is also designed and tested for the simulation of collisions of peakompactons. In addition to the peakompacton class of solutions, the general physical features of the so-called K#(n,m) hierarchy of nonlinearly dispersive Korteweg–de Vries-type models are discussed as well.« less

  9. Peakompactons: Peaked compact nonlinear waves

    NASA Astrophysics Data System (ADS)

    Christov, Ivan C.; Kress, Tyler; Saxena, Avadh

    2017-04-01

    This paper is meant as an accessible introduction to/tutorial on the analytical construction and numerical simulation of a class of nonstandard solitary waves termed peakompactons. These peaked compactly supported waves arise as solutions to nonlinear evolution equations from a hierarchy of nonlinearly dispersive Korteweg-de Vries-type models. Peakompactons, like the now-well-known compactons and unlike the soliton solutions of the Korteweg-de Vries equation, have finite support, i.e., they are of finite wavelength. However, unlike compactons, peakompactons are also peaked, i.e., a higher spatial derivative suffers a jump discontinuity at the wave’s crest. Here, we construct such solutions exactly by reducing the governing partial differential equation to a nonlinear ordinary differential equation and employing a phase-plane analysis. A simple, but reliable, finite-difference scheme is also designed and tested for the simulation of collisions of peakompactons. In addition to the peakompacton class of solutions, the general physical features of the so-called K#(n,m) hierarchy of nonlinearly dispersive Korteweg-de Vries-type models are discussed as well.

  10. Solar cycle variation of interstellar neutral He, Ne, O density and pick-up ions along the Earth's orbit

    NASA Astrophysics Data System (ADS)

    Sokół, Justyna M.; Bzowski, Maciej; Kubiak, Marzena A.; Möbius, Eberhard

    2016-06-01

    We simulated the modulation of the interstellar neutral (ISN) He, Ne, and O density and pick-up ion (PUI) production rate and count rate along the Earth's orbit over the solar cycle (SC) from 2002 to 2013 to verify if SC-related effects may modify the inferred ecliptic longitude of the ISN inflow direction. We adopted the classical PUI model with isotropic distribution function and adiabatic cooling, modified by time- and heliolatitude-dependent ionization rates and non-zero injection speed of PUIs. We found that the ionization losses have a noticeable effect on the derivation of the ISN inflow longitude based on the Gaussian fit to the crescent and cone peak locations. We conclude that the non-zero radial velocity of the ISN flow and the energy range of the PUI distribution function that is accumulated are of importance for a precise reproduction of the PUI count rate along the Earth orbit. However, the temporal and latitudinal variations of the ionization in the heliosphere, and particularly their variation on the SC time-scale, may significantly modify the shape of PUI cone and crescent and also their peak positions from year to year and thus bias by a few degrees the derived longitude of the ISN gas inflow direction.

  11. Automatic quality assessment and peak identification of auditory brainstem responses with fitted parametric peaks.

    PubMed

    Valderrama, Joaquin T; de la Torre, Angel; Alvarez, Isaac; Segura, Jose Carlos; Thornton, A Roger D; Sainz, Manuel; Vargas, Jose Luis

    2014-05-01

    The recording of the auditory brainstem response (ABR) is used worldwide for hearing screening purposes. In this process, a precise estimation of the most relevant components is essential for an accurate interpretation of these signals. This evaluation is usually carried out subjectively by an audiologist. However, the use of automatic methods for this purpose is being encouraged nowadays in order to reduce human evaluation biases and ensure uniformity among test conditions, patients, and screening personnel. This article describes a new method that performs automatic quality assessment and identification of the peaks, the fitted parametric peaks (FPP). This method is based on the use of synthesized peaks that are adjusted to the ABR response. The FPP is validated, on one hand, by an analysis of amplitudes and latencies measured manually by an audiologist and automatically by the FPP method in ABR signals recorded at different stimulation rates; and on the other hand, contrasting the performance of the FPP method with the automatic evaluation techniques based on the correlation coefficient, FSP, and cross correlation with a predefined template waveform by comparing the automatic evaluations of the quality of these methods with subjective evaluations provided by five experienced evaluators on a set of ABR signals of different quality. The results of this study suggest (a) that the FPP method can be used to provide an accurate parameterization of the peaks in terms of amplitude, latency, and width, and (b) that the FPP remains as the method that best approaches the averaged subjective quality evaluation, as well as provides the best results in terms of sensitivity and specificity in ABR signals validation. The significance of these findings and the clinical value of the FPP method are highlighted on this paper. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  12. PICK1 interacts with PACSIN to regulate AMPA receptor internalization and cerebellar long-term depression.

    PubMed

    Anggono, Victor; Koç-Schmitz, Yeliz; Widagdo, Jocelyn; Kormann, Jan; Quan, Annie; Chen, Chih-Ming; Robinson, Phillip J; Choi, Se-Young; Linden, David J; Plomann, Markus; Huganir, Richard L

    2013-08-20

    The dynamic trafficking of AMPA receptors (AMPARs) into and out of synapses is crucial for synaptic transmission, plasticity, learning, and memory. The protein interacting with C-kinase 1 (PICK1) directly interacts with GluA2/3 subunits of the AMPARs. Although the role of PICK1 in regulating AMPAR trafficking and multiple forms of synaptic plasticity is known, the exact molecular mechanisms underlying this process remain unclear. Here, we report a unique interaction between PICK1 and all three members of the protein kinase C and casein kinase II substrate in neurons (PACSIN) family and show that they form a complex with AMPARs. Our results reveal that knockdown of the neuronal-specific protein, PACSIN1, leads to a significant reduction in AMPAR internalization following the activation of NMDA receptors in hippocampal neurons. The interaction between PICK1 and PACSIN1 is regulated by PACSIN1 phosphorylation within the variable region and is required for AMPAR endocytosis. Similarly, the binding of PICK1 to the ubiquitously expressed PACSIN2 is also regulated by the homologous phosphorylation sites within the PACSIN2-variable region. Genetic deletion of PACSIN2, which is highly expressed in Purkinje cells, eliminates cerebellar long-term depression. This deficit can be fully rescued by overexpressing wild-type PACSIN2, but not by a PACSIN2 phosphomimetic mutant, which does not bind PICK1 efficiently. Taken together, our data demonstrate that the interaction of PICK1 and PACSIN is required for the activity-dependent internalization of AMPARs and for the expression of long-term depression in the cerebellum.

  13. Effects of Sabbagh Universal Spring 2 fixed functional appliance on class II/1 patients at their postpubertal-peak growth period compared with the extraction method : A randomized clinical trial.

    PubMed

    Hemmatpour, Siamak; Mokhtar, Ali; Rakhshan, Vahid

    2017-01-01

    The aim of this study was to evaluate the therapeutic effects of the Sabbagh Universal Spring 2 (SUS 2) fixed functional appliance compared to the premolar extraction method in correcting class II/1 malocclusion in patients who had passed their peak of postpubertal growth (stages 4-6 of Cervical Vertebral Maturation Index). In all, 40 class II/1 patients were randomized to receive SUS 2 application (7 males, 13 females, age 15.75 ± 1.02 years) or maxillary premolar extraction (8 males, 12 females, age 15.40 ± 0.99 years). Pre- and posttreatment digital cephalographs were traced at least twice. A paired t test was used to compare the pre- and posttreatment measurements. Treatment changes were compared using an independent samples t test (P ≤ 0.05). The extent of change was significant in the following variables: ANB, nasolabial angle, Mand1-ML, 1L-NB, anterior and posterior facial heights, N-A-Pog, 1U-NF, 6L-MP, Ar-Go, OP-HP, A-B, A-Sn, B-Sm, APDI, NAPog, AB-NPog, POr-DOP, SN-OcP, POr-OcP, Wits, 1 l-APog, 1LMeLm, S-Go:N-Me, N-ANS-Pog, Ap1LAp1u-DOP, ANS-Cond, Pog-Cond, SS-Ls, A-N-Pog, Pog-Pog', MeGoOcP, 1L-Npog, Go-Me, Go-Me:N-S, S-Me, Ls-(Sn-Pog'), Stms-Stmi, N'-Gn', N'NsPog', 6u-PTV, 1u-NA, FMIA, and IMPA. SUS 2 corrected class II/1 malocclusion of patients in the postpubertal growth period by inhibiting the maxilla's forward growth, advancing the mandible, decreasing the nasolabial and interincisal angles, proclining the incisors, increasing the facial height, and clockwise rotation of the occlusal plane. Extraction reduced the interincisal angle and protruded the lower incisors. However, it did not change the soft tissue thickness and did not cause a clockwise rotation in the occlusal plane.

  14. Impactor control of central peak and peak-ring formation

    NASA Astrophysics Data System (ADS)

    Schultz, Peter H.; Gault, D. E.

    1993-03-01

    The relation between the depth and diameter of excavation for impacts typically is assumed to be proportional. Such an assumption is consistent with the constant aspect ratio (diameter:depth) observed for simple craters found in a wide range of planetary settings and crater-scaling laws derived from laboratory experiments. Although complex craters exhibit evidence for floor uplift and rim collapse of a transient profile, they are typically thought to resemble initially smaller, simple craters. At large scales, however, early-time processes consume a greater fraction of crater growth and the assumption of late-time equivalence of energy release as a point source becomes inappropriate. The authors propose instead that crater diameter, depth, and impactor penetration represent separable dependent variables that underscore the fundamental difference between impact and point-source explosion excavation processes. An important consequence of this perspective is that central pits, peaks, and rings may represent contrasting target responses to impactor penetration and could provide an important indicator of impactor dimensions.

  15. A new mathematical procedure to evaluate peaks in complex chromatograms.

    PubMed

    Steffen, B; Müller, K P; Komenda, M; Koppmann, R; Schaub, A

    2005-04-15

    Automatic peak evaluation in chromatograms and subsequent quantification of compound concentrations is still a challenge in the analysis of complex samples containing hundreds or thousands of compounds. Although a number of software packages for peak evaluation exist, baseline definition and overlapping peaks of different shapes are the main reasons which prevent reliable automatic analysis of complex chromatograms. A new mathematical procedure is presented which uses peak shapes extracted from the chromatogram itself and modified by nonlinear (in fact, hyperbolic) stretching of the peak head and tail. With this approach, the peak parameters are position, height, scale of front, scale of tail, and smoothness of transition from front to tail scaling. This approach is found to give a substantially better fit than traditional analytically defined peak shapes. Together with a good peak finding heuristic and nonlinear optimization of parameters this allows a reliable automatic analysis of chromatograms with a large number of peaks, even with large groups of overlapping peaks. The analysis matches the quality of standard interactive methods, but still permits interactive refinement. This approach has been implemented and tested on a large set of data from chromatography of hydrocarbons in ambient air samples.

  16. Peaked Periodic Wave Solutions to the Broer–Kaup Equation

    NASA Astrophysics Data System (ADS)

    Jiang, Bo; Bi, Qin-Sheng

    2017-01-01

    By qualitative analysis method, a sufficient condition for the existence of peaked periodic wave solutions to the Broer–Kaup equation is given. Some exact explicit expressions of peaked periodic wave solutions are also presented. Supported by National Nature Science Foundation of China under Grant No. 11102076 and Natural Science Fund for Colleges and Universities in Jiangsu Province under Grant No. 15KJB110005

  17. GABAergic neuroaxonal dystrophy and other cytopathological alterations in feline Niemann-Pick disease type C.

    PubMed

    March, P A; Thrall, M A; Brown, D E; Mitchell, T W; Lowenthal, A C; Walkley, S U

    1997-08-01

    Feline Niemann-Pick disease type C (NPC) is an autosomal recessive lysosomal storage disease which shares many of the clinical, biochemical and pathological features of the corresponding human disorder. Cytopathological alterations in distinct neuronal cell populations were investigated in this animal model to gain a better understanding of the pathogenesis of brain dysfunction. Golgi and immunocytochemical methods were employed to characterize the cell architectural changes occurring in neuronal somata, dendrites and axons at different stages of disease progression. Cortical pyramidal neurons in laminae II, III, and V exhibited various degrees of meganeurite and/or swollen axon hillock formation with or without ectopic dendritogenesis. Enlarged axon hillock regions with neuritic processes and spines were recognized early in the progression of feline NPC but were less prevalent in mid to late stages of the disease. Glutamic acid decarboxylase (GAD) immunocytochemistry demonstrated immunoreactive spheroids in numerous GABAergic axons in neocortex, subcortical areas, and cerebellum. Parvalbumin-immunoreactive axonal spheroid distribution in brain closely mirrored results from the GAD studies, whereas calbindin D-28k-immunoreactive spheroids were conspicuously absent in most cortical and subcortical areas examined. Purkinje cell axonal spheroid formation progressed in a distal to proximal direction, with eventual involvement of recurrent axon collaterals. Purkinje cell death and a concomitant decrease in the numbers of spheroids in the cerebellum were observed late in the disease course. Clinical neurological signs in feline NPC occur in parallel with neuronal structural alterations and suggest that GABAergic neuroaxonal dystrophy is a contributor to brain dysfunction in this disease.

  18. Pick up, move and release of nanoparticles utilizing co-non-solvency of PNIPAM brushes.

    PubMed

    Yu, Yunlong; Lopez de la Cruz, Ricardo A; Kieviet, Bernard D; Gojzewski, Hubert; Pons, Adeline; Julius Vancso, G; de Beer, Sissi

    2017-01-26

    A critical complication in handling nanoparticles is the formation of large aggregates when particles are dried e.g. when they need to be transferred from one liquid to another. The particles in these aggregates need to disperse into the destined liquid medium, which has been proven difficult due to the relatively large interfacial interaction forces between nanoparticles. We present a simple method to capture, move and release nanoparticles without the formation of large aggregates. To do so, we employ the co-non-solvency effect of poly(N-isopropylacrylamide) (PNIPAM) brushes in water-ethanol mixtures. In pure water or ethanol, the densely end-anchored macromolecules in the PNIPAM brush stretch and absorb the solvent. We show that under these conditions, the adherence between the PNIPAM brush and a silicon oxide, gold, polystyrene or poly(methyl methacrylate) colloid attached to an atomic force microscopy cantilever is low. In contrast, when the PNIPAM brushes are in a collapsed state in a 30-70 vol% ethanol-water mixture, the adhesion between the brush and the different counter surfaces is high. For potential application, we demonstrate that this difference in adhesion can be utilized to pick up, move and release 900 silicon oxide nanoparticles of diameter 80 nm using only 10 × 10 μm(2) PNIPAM brush.

  19. Skin Picking Disorder in University Students: Health Correlates and Gender Differences

    PubMed Central

    Odlaug, Brian L.; Lust, Katherine; Schreiber, Liana R.N.; Christenson, Gary; Derbyshire, Katherine; Grant, Jon E.

    2012-01-01

    Objective This study sought to examine the prevalence of skin picking disorder (SPD) in a university sample and assess associated physical and mental health correlates. Methods A 54-item anonymous, voluntary survey was distributed via random email generation to a sample of 6,000 university students. Current psychological and physical status was assessed, along with academic performance. Positive screens for SPD were determined based upon individuals meeting full proposed DSM-V criteria. Results A total of 1,916 participants (31.9%; mean age 22.7±5.1; 58.1% female) responded and were included in the analysis. The overall prevalence of SPD was 4.2% (females=5.8%; males=2.0%). SPD was associated with significantly higher lifetime rates of affective, anxiety, eating, substance use, and impulse control disorders. Men with SPD had significantly higher BMI ratings and perceived themselves as significantly less attractive to others while women had significantly higher depressive symptoms. Conclusion SPD is common in both genders and is associated with significant mental and physical health detriments, including as higher levels of stress, more psychiatric comorbidity, and poorer perceived health. Academic institutions, clinicians, and public health officials should be aware of the multimodal presentation of SPD and screen for it in primary care and dermatologic settings. PMID:23123103

  20. Calculating weighted estimates of peak streamflow statistics

    USGS Publications Warehouse

    Cohn, Timothy A.; Berenbrock, Charles; Kiang, Julie E.; Mason, Jr., Robert R.

    2012-01-01

    According to the Federal guidelines for flood-frequency estimation, the uncertainty of peak streamflow statistics, such as the 1-percent annual exceedance probability (AEP) flow at a streamgage, can be reduced by combining the at-site estimate with the regional regression estimate to obtain a weighted estimate of the flow statistic. The procedure assumes the estimates are independent, which is reasonable in most practical situations. The purpose of this publication is to describe and make available a method for calculating a weighted estimate from the uncertainty or variance of the two independent estimates.

  1. UNCERTAINTY IN PHASE ARRIVAL TIME PICKS FOR REGIONAL SEISMIC EVENTS: AN EXPERIMENTAL DESIGN

    SciTech Connect

    A. VELASCO; ET AL

    2001-02-01

    The detection and timing of seismic arrivals play a critical role in the ability to locate seismic events, especially at low magnitude. Errors can occur with the determination of the timing of the arrivals, whether these errors are made by automated processing or by an analyst. One of the major obstacles encountered in properly estimating travel-time picking error is the lack of a clear and comprehensive discussion of all of the factors that influence phase picks. This report discusses possible factors that need to be modeled to properly study phase arrival time picking errors. We have developed a multivariate statistical model, experimental design, and analysis strategy that can be used in this study. We have embedded a general form of the International Data Center(IDC)/U.S. National Data Center (USNDC) phase pick measurement error model into our statistical model. We can use this statistical model to optimally calibrate a picking error model to regional data. A follow-on report will present the results of this analysis plan applied to an implementation of an experiment/data-gathering task.

  2. The Impact of Visual Guided Order Picking on Ocular Comfort, Ocular Surface and Tear Function.

    PubMed

    Klein-Theyer, Angelika; Horwath-Winter, Jutta; Rabensteiner, Dieter Franz; Schwantzer, Gerold; Wultsch, Georg; Aminfar, Haleh; Heidinger, Andrea; Boldin, Ingrid

    2016-01-01

    We investigated the effects of a visual picking system on ocular comfort, the ocular surface and tear function compared to those of a voice guided picking solution. Prospective, observational, cohort study. Institutional. A total of 25 young asymptomatic volunteers performed commissioning over 10 hours on two consecutive days. The operators were guided in the picking process by two different picking solutions, either visually or by voice while their subjective symptoms and ocular surface and tear function parameters were recorded. The visual analogue scale (VAS) values, according to subjective dry eye symptoms, in the visual condition were significantly higher at the end of the commissioning than the baseline measurements. In the voice condition, the VAS values remained stable during the commissioning. The tear break-up time (BUT) values declined significantly in the visual condition (pre-task: 16.6 sec and post-task: 9.6 sec) in the right eyes, that were exposed to the displays, the left eyes in the visual condition showed only a minor decline, whereas the BUT values in the voice condition remained constant (right eyes) or even increased (left eyes) over the time. No significant differences in the tear meniscus height values before and after the commissioning were observed in either condition. In our study, the use of visually guided picking solutions was correlated with post-task subjective symptoms and tear film instability.

  3. Peak load management: Potential options

    SciTech Connect

    Englin, J.E.; De Steese, J.G.; Schultz, R.W.; Kellogg, M.A.

    1989-10-01

    This report reviews options that may be alternatives to transmission construction (ATT) applicable both generally and at specific locations in the service area of the Bonneville Power Administration (BPA). Some of these options have potential as specific alternatives to the Shelton-Fairmount 230-kV Reinforcement Project, which is the focus of this study. A listing of 31 peak load management (PLM) options is included. Estimated costs and normalized hourly load shapes, corresponding to the respective base load and controlled load cases, are considered for 15 of the above options. A summary page is presented for each of these options, grouped with respect to its applicability in the residential, commercial, industrial, and agricultural sectors. The report contains comments on PLM measures for which load shape management characteristics are not yet available. These comments address the potential relevance of the options and the possible difficulty that may be encountered in characterizing their value should be of interest in this investigation. The report also identifies options that could improve the efficiency of the three customer utility distribution systems supplied by the Shelton-Fairmount Reinforcement Project. Potential cogeneration options in the Olympic Peninsula are also discussed. These discussions focus on the options that appear to be most promising on the Olympic Peninsula. Finally, a short list of options is recommended for investigation in the next phase of this study. 9 refs., 24 tabs.

  4. Relationship between height and width of resonance peaks in a whispering gallery mode resonator immersed in water and sucrose solutions

    NASA Astrophysics Data System (ADS)

    Teraoka, Iwao; Yao, Haibei; Huiyi Luo, Natalie

    2017-06-01

    We employed a recently developed whispering gallery mode (WGM) dip sensor made of silica to obtain spectra for many resonance peaks in water and solutions of sucrose at different concentrations and thus having different refractive indices (RI). The apparent Q factor was estimated by fitting each peak profile in the busy resonance spectrum by a Lorentzian or a sum of Lorentzians. A plot of the Q factor as a function the peak height for all the peaks analyzed indicates a straight line with a negative slope as the upper limit, for each of water and the solutions. A coupling model for a resonator and a pair of fiber tapers to feed and pick up light, developed here, supports the presence of the upper limit. We also found that the round-trip attenuation of WGM was greater than the one estimated from light absorption by water, and the difference increased with the concentration of sucrose.

  5. Reference Values for Peak Exercise Cardiac Output in Healthy Individuals.

    PubMed

    Agostoni, Piergiuseppe; Vignati, Carlo; Gentile, Piero; Boiti, Costanza; Farina, Stefania; Salvioni, Elisabetta; Mapelli, Massimo; Magrì, Damiano; Paolillo, Stefania; Corrieri, Nicoletta; Sinagra, Gianfranco; Cattadori, Gaia

    2017-06-01

    Cardiac output (Q˙) is a key parameter in the assessment of cardiac function, its measurement being crucial for the diagnosis, treatment, and prognostic evaluation of all heart diseases. Until recently, Q˙ determination at peak exercise has been possible through invasive methods, so that normal values were obtained in studies based on small populations. Nowadays, peak Q˙ can be measured noninvasively by means of the inert gas rebreathing (IGR) technique. The present study was undertaken to provide reference values for peak Q˙ in the normal general population and to obtain a formula able to estimate peak exercise Q˙ from measured peak oxygen uptake (V˙o2). We studied 500 normal subjects (age, 44.9 ± 1.5 years; range, 18-77 years; 260 men, 240 women) who underwent a maximal cardiopulmonary exercise test with peak Q˙ measurement by IGR. In the overall study sample, peak Q˙ was 13.2 ± 3.5 L/min (men, 15.3 ± 3.3 L/min; women, 11.0 ± 2.0 L/min; P < .001) and peak V˙o2 was 95% ± 18% of the maximum predicted value (men, 95% ± 19%; women, 95% ± 18%). Peak V˙o2 and peak Q˙ progressively decreased with age (R(2), 0.082; P < .001; and R(2), 0.144; P < .001, respectively). The V˙o2-derived formula to measure Q˙ at peak exercise was (4.4 × peak V˙o2) + 4.3 in the overall study cohort, (4.3 × peak V˙o2) + 4.5 in men, and (4.9 × peak V˙o2) + 3.6 in women. The simultaneous measurement of Q˙ and V˙o2 at peak exercise in a large sample of healthy subjects provided an equation to predict peak Q˙ from peak V˙o2 values. Copyright © 2017 American College of Chest Physicians. Published by Elsevier Inc. All rights reserved.

  6. Skills and offensive tactics used in pick-up basketball games.

    PubMed

    Wang, Jianyu; Liu, Wenhao; Moffit, Jeffrey

    2009-10-01

    The purpose of this study was to describe skills and offensive tactics frequently used in pick-up basketball games. 65 participants were recruited from public basketball courts. An observational instrument was developed to analyze the performances of pick-up games. Participants' performances were videotaped and coded. Results indicated that the passing skills most frequently observed in the games were chest pass, overhead pass, and bounce pass. For dribbling, crossover dribble and change-of-pace dribble were frequently observed. Jump shot, set shot, and layup were also frequently used. The offensive tactics frequently used included drive, cut, and set screen. The study may be beneficial for helping young people prepare to play pick-up basketball games.

  7. Niemann-Pick type C disease: molecular mechanisms and potential therapeutic approaches

    PubMed Central

    Rosenbaum, Anton I.; Maxfield, Frederick R.

    2010-01-01

    Cholesterol is an important lipid of mammalian cells. Its unique physicochemical properties modulate membrane behavior and it serves as the precursor for steroid hormones, oxysterols and vitamin D. Cholesterol is effluxed from the late endosomes/lysosomes via the concerted action of at least two distinct proteins: Niemann-Pick C1 and Niemann-Pick C2. Mutations in these two proteins manifest as Niemann-Pick type C disease – a very rare, usually fatal, autosomal, recessive, neurovisceral, lysosomal storage disorder. In this review we discuss the possible mechanisms of action for NPC1 and NPC2 in mediating cholesterol efflux, as well as the different therapeutic approaches being pursued for the treatment of this lipid storage disorder. PMID:20807315

  8. Hepatic Primary and Secondary Cholesterol Deposition and Damage in Niemann-Pick Disease.

    PubMed

    Bosch, Marta; Fajardo, Alba; Alcalá-Vida, Rafael; Fernández-Vidal, Andrea; Tebar, Francesc; Enrich, Carlos; Cardellach, Francesc; Pérez-Navarro, Esther; Pol, Albert

    2016-03-01

    Niemann-Pick C disease is a neurovisceral disorder caused by mutations in the NPC gene that result in systemic accumulation of intracellular cholesterol. Although neurodegeneration defines the disease's severity, in most patients it is preceded by hepatic complications such as cholestatic jaundice or hepatomegaly. To analyze the contribution of the hepatic disease in Niemann-Pick C disease progression and to evaluate the degree of primary and secondary hepatic damage, we generated a transgenic mouse with liver-selective expression of NPC1 from embryonic stages. Hepatic NPC1 re-expression did not ameliorate the onset and progression of neurodegeneration of the NPC1-null animal. However, the mice showed reduced hepatomegalia and dramatic, although not complete, reduction of hepatic cholesterol and serum bile salts, bilirubin, and transaminase levels. Therefore, hepatic primary and secondary cholesterol deposition and damage occur simultaneously during Niemann-Pick C disease progression.

  9. Detection of singly ionized energetic lunar pick-up ions upstream of earth's bow shock

    NASA Technical Reports Server (NTRS)

    Hilchenbach, M.; Hovestadt, D.; Klecker, B.; Moebius, E.

    1992-01-01

    Singly ionized suprathermal ions upstream of the earth's bow shock have been detected by using the time-of-flight spectrometer SULEICA on the AMPTE/IRM satellite. The data were collected between August and December 1985. The flux of the ions in the mass range between 23 and 37 amu is highly anisotropic towards the earth. The ions are observed with a period of about 29 days around new moon (+/- 3 days). The correlation of the energy of the ions with the solar wind speed and the interplanetary magnetic field orientation indicates the relation to the pick-up process. We conclude that the source of these pick-up ions is the moon. We argue that due to the impinging solar wind, atoms are sputtered off the lunar surface, ionized in the sputtering process or by ensuing photoionization and picked up by the solar wind.

  10. Haloperidol augmentation of fluvoxamine in skin picking disorder: a case report

    PubMed Central

    2012-01-01

    Introduction Compulsive skin picking, being part of the broader category of impulse control disorders, is considered a residual diagnosis in the Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition, Text Revision. It is characterized by excessive scratching or picking of normal skin, or skin with minor surface irregularities, and occurs in 2% of patients attending dermatology clinics. Despite the clinical relevance of this disorder, no clear guidelines are available yet; clinical management is, therefore, compromised and the day-to-day clinical practice is burdened by difficulties. Studies on selective serotonin reuptake inhibitors and anti-epileptic drugs have provided limited results. The association between anti-depressants and anti-epileptics has been found to be beneficial in some impulse control disorders, but in skin picking no previous studies have been conducted on this pharmacological approach. There are very few reports on the efficacy of anti-psychotics in skin picking. Case presentation The therapeutic path described in this case report produced good results for a 59-year-old Caucasian woman. The first therapeutic approach, with fluvoxamine and oxcarbazepine was partially effective; then, the suspension of oxcarbazepine and haloperidol augmentation of fluvoxamine were adopted. After 10 weeks, a significant improvement of the disease was observed: the clinical picture and the associated symptoms were nearly solved. Conclusions To the best of our knowledge, this is the first article reporting the association of fluvoxamine and haloperidol in skin picking disorder. It might be useful to perform further research regarding the treatment of skin picking disorder: in clinical practice, several variables might limit the choice of certain drugs. Therefore, it would be useful for the clinician to be aware of other therapeutic options. PMID:22834980

  11. Haloperidol augmentation of fluvoxamine in skin picking disorder: a case report.

    PubMed

    Luca, Maria; Vecchio, Costanza; Luca, Antonina; Calandra, Carmela

    2012-07-26

    Compulsive skin picking, being part of the broader category of impulse control disorders, is considered a residual diagnosis in the Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition, Text Revision. It is characterized by excessive scratching or picking of normal skin, or skin with minor surface irregularities, and occurs in 2% of patients attending dermatology clinics. Despite the clinical relevance of this disorder, no clear guidelines are available yet; clinical management is, therefore, compromised and the day-to-day clinical practice is burdened by difficulties. Studies on selective serotonin reuptake inhibitors and anti-epileptic drugs have provided limited results. The association between anti-depressants and anti-epileptics has been found to be beneficial in some impulse control disorders, but in skin picking no previous studies have been conducted on this pharmacological approach. There are very few reports on the efficacy of anti-psychotics in skin picking. The therapeutic path described in this case report produced good results for a 59-year-old Caucasian woman. The first therapeutic approach, with fluvoxamine and oxcarbazepine was partially effective; then, the suspension of oxcarbazepine and haloperidol augmentation of fluvoxamine were adopted. After 10 weeks, a significant improvement of the disease was observed: the clinical picture and the associated symptoms were nearly solved. To the best of our knowledge, this is the first article reporting the association of fluvoxamine and haloperidol in skin picking disorder. It might be useful to perform further research regarding the treatment of skin picking disorder: in clinical practice, several variables might limit the choice of certain drugs. Therefore, it would be useful for the clinician to be aware of other therapeutic options.

  12. Robust detection of peak signals for lateral flow immunoassays

    NASA Astrophysics Data System (ADS)

    Kim, Jongwon; Kim, Jong Dae; Nahm, Kie Bong; Choi, Eui Yul; Lee, Geumyoung

    2011-02-01

    Template matching method is presented to identify the peaks from the scanned signals of lateral flow immunoassay strips. The template is composed of two pulses separated by the distance of the control and the target ligand line in the assay, and is convolved with the scanned signal to deliver the maximum at the center of the two peaks. The peak regions were identified with the predefined distances from the center. Glycosylated haemoglobin immunoassay strips and fluorescent strip readers from Boditechmed Inc. were tested to estimate the lot and reader variations of the concentration measurands. The results showed the robustness of the propose method.

  13. Visual enhancements in pick-and-place tasks: Human operators controlling a simulated cylindrical manipulator

    NASA Technical Reports Server (NTRS)

    Kim, Won S.; Tendick, Frank; Stark, Lawrence

    1989-01-01

    A teleoperation simulator was constructed with vector display system, joysticks, and a simulated cylindrical manipulator, in order to quantitatively evaluate various display conditions. The first of two experiments conducted investigated the effects of perspective parameter variations on human operators' pick-and-place performance, using a monoscopic perspective display. The second experiment involved visual enhancements of the monoscopic perspective display, by adding a grid and reference lines, by comparison with visual enhancements of a stereoscopic display; results indicate that stereoscopy generally permits superior pick-and-place performance, but that monoscopy nevertheless allows equivalent performance when defined with appropriate perspective parameter values and adequate visual enhancements.

  14. Detection of interstellar pick-up hydrogen in the solar system

    NASA Technical Reports Server (NTRS)

    Gloeckler, G.; Geiss, J.; Balsiger, H.; Fisk, L. A.; Galvin, A. B.; Ipavich, F. M.; Ogilvie, K. W.; Von Steiger, R.; Wilken, B.

    1993-01-01

    Interstellar hydrogen ionized primarily by the solar wind has been detected by the Solar Wind Ion Composition Spectrometer instrument on the Ulysses spacecraft at a distance of 4.8 AUs from the sun. This 'pick-up' hydrogen is identified by its distinct velocity distribution function, which drops abruptly at twice the local solar wind speed. From the measured fluxes of pick-up protons and singly charged helium, the number densities of neutral hydrogen and helium in the distant regions of the solar system are estimated to be 0.077 +/- 0.015 and 0.013 +/- 0.003 per cu cm, respectively.

  15. Detection of interstellar pick-up hydrogen in the solar system.

    PubMed

    Gloeckler, G; Galvin, A B; Ipavich, F M; Geiss, J; Balsiger, H; von Steiger, R; Fisk, L A; Ogilvie, K W; Wilken, B

    1993-07-02

    Interstellar hydrogen ionized primarily by the solar wind has been detected by the SWICS instrument on the Ulysses spacecraft at a distance of 4.8 astronomical units from the sun. This "pick-up" hydrogen is identified by its distinct velocity distribution function, which drops abruptly at twice the local solar wind speed. From the measured fluxes of pick-up protons and singly charged helium, the number densities of neutral hydrogen and helium in the distant regions of the solar system are estimated to be 0.077 +/- 0.015 and 0.013 +/- 0.003 per cubic centimeter, respectively.

  16. [Clinical and genetic special features of Niemann-Pick disease, type C].

    PubMed

    Zakharova, E Iu; Mikhaĭlova, S V; Proshliakova, T Iu; Rudenskaia, G E

    2012-01-01

    Niemann-Pick disease, type C is a rare hereditary disorder of the group of lisosomal storage diseases, caused by mutations in the genes NPC1 or NPC2. Depending on the onset age, several clinical forms of this disease, which differs by manifestation age, main clinical signs and clinical course, are distinguished. Niemann-Pick disease type C can imitate other hereditary and acquired diseases, which complicates its early diagnostics. Clinical and genetic diversity of this disorder, considered on the clinical cases diagnosed at the FSI "RCMG" of RAMS, are discussed in this review.

  17. Peak Wind Tool for General Forecasting

    NASA Technical Reports Server (NTRS)

    Barrett, Joe H., III

    2010-01-01

    The expected peak wind speed of the day is an important forecast element in the 45th Weather Squadron's (45 WS) daily 24-Hour and Weekly Planning Forecasts. The forecasts are used for ground and space launch operations at the Kennedy Space Center (KSC) and Cape Canaveral Air Force Station (CCAFS). The 45 WS also issues wind advisories for KSC/CCAFS when they expect wind gusts to meet or exceed 25 kt, 35 kt and 50 kt thresholds at any level from the surface to 300 ft. The 45 WS forecasters have indicated peak wind speeds are challenging to forecast, particularly in the cool season months of October - April. In Phase I of this task, the Applied Meteorology Unit (AMU) developed a tool to help the 45 WS forecast non-convective winds at KSC/CCAFS for the 24-hour period of 0800 to 0800 local time. The tool was delivered as a Microsoft Excel graphical user interface (GUI). The GUI displayed the forecast of peak wind speed, 5-minute average wind speed at the time of the peak wind, timing of the peak wind and probability the peak speed would meet or exceed 25 kt, 35 kt and 50 kt. For the current task (Phase II ), the 45 WS requested additional observations be used for the creation of the forecast equations by expanding the period of record (POR). Additional parameters were evaluated as predictors, including wind speeds between 500 ft and 3000 ft, static stability classification, Bulk Richardson Number, mixing depth, vertical wind shear, temperature inversion strength and depth and wind direction. Using a verification data set, the AMU compared the performance of the Phase I and II prediction methods. Just as in Phase I, the tool was delivered as a Microsoft Excel GUI. The 45 WS requested the tool also be available in the Meteorological Interactive Data Display System (MIDDS). The AMU first expanded the POR by two years by adding tower observations, surface observations and CCAFS (XMR) soundings for the cool season months of March 2007 to April 2009. The POR was expanded

  18. The clinical value of peak nasal inspiratory flow, peak oral inspiratory flow, and the nasal patency index.

    PubMed

    Tsounis, Michael; Swart, Karin M A; Georgalas, Christos; Markou, Konstantinos; Menger, Dirk J

    2014-12-01

    The aim of this study was to ascertain the most reliable objective measurement for the assessment of nasal patency by investigating the relationship between peak nasal inspiratory flow, peak oral inspiratory flow, and the nasal patency index in relation to the patient's subjective perception regarding nasal obstruction. Prospective cohort study. This study included 131 volunteers of both genders, aged 18 years or older, with or without nasal symptoms, who were able to give informed consent, completed the study protocol, and could speak and write Dutch fluently. Peak nasal inspiratory flow and peak oral inspiratory flow were performed and nasal patency index was computed. The results were evaluated and compared with the subjective perception of nasal passage, using the validated Nasal Obstruction Symptom Evaluation scale and visual analog scale for nasal passage. Our study showed that peak nasal inspiratory flow, nasal patency index and nasal patency visual analog scale correlate with the Nasal Obstruction Symptom Evaluation scale in contrast to peak oral inspiratory flow. Peak nasal inspiratory flow and nasal patency index also showed significant association with the Nasal Obstruction Symptom Evaluation scale after adjustment for confounders. Peak nasal inspiratory flow is the most reliable method for the assessment of nasal patency. It is quick, inexpensive, and easy to perform, and correlates significantly with the subjective feeling of nasal obstruction. There is no clinical need to measure peak oral inspiratory flow or to calculate the nasal patency index in the evaluation of nasal patency. 4 © 2014 The American Laryngological, Rhinological and Otological Society, Inc.

  19. Measuring non-local Lagrangian peak bias

    NASA Astrophysics Data System (ADS)

    Biagetti, Matteo; Chan, Kwan Chuen; Desjacques, Vincent; Paranjape, Aseem

    2014-06-01

    We investigate non-local Lagrangian bias contributions involving gradients of the linear density field, for which we have predictions from the excursion set peak formalism. We begin by writing down a bias expansion which includes all the bias terms, including the non-local ones. Having checked that the model furnishes a reasonable fit to the halo mass function, we develop a one-point cross-correlation technique to measure bias factors associated with χ2-distributed quantities. We validate the method with numerical realizations of peaks of Gaussian random fields before we apply it to N-body simulations. We focus on the lowest (quadratic) order non-local contributions -2χ _{10}(k_1\\cdot k_2) and χ _{01}[3(k_1\\cdot k_2)^2-k_1^2 k_2^2], where k_1, k_2 are wave modes. We can reproduce our measurement of χ10 if we allow for an offset between the Lagrangian halo centre-of-mass and the peak position. The sign and magnitude of χ10 is consistent with Lagrangian haloes sitting near linear density maxima. The resulting contribution to the halo bias can safely be ignored for M = 1013 M⊙ h-1, but could become relevant at larger halo masses. For the second non-local bias χ01 however, we measure a much larger magnitude than predicted by our model. We speculate that some of this discrepancy might originate from non-local Lagrangian contributions induced by non-spherical collapse.

  20. Selective Neurodegeneration, Without Neurofibrillary Tangles, in a Mouse Model of Niemann-Pick C Disease

    PubMed Central

    German, Dwight C.; Quintero, E. Matthew; Liang, Chang-Lin; Ng, Benton; Punia, Surender; Xie, Chonglun; Dietschy, John M.

    2012-01-01

    The BALB/c mouse model of Niemann-Pick type C (NPC) disease exhibits neuropathological similarities to the human condition. There is an age-related cerebral atrophy, demyelination of the corpus callosum, and degeneration of cerebellar Purkinje cells in the NPC mouse. In human NPC, many cortical and subcortical neurons contain neurofibrillary tangles, which are thought by some investigators to play an important role in the neurodegenerative process. The purpose of the present study was to determine whether neurodegeneration occurs in the NPC mouse, in brain regions other than the cerebellum and whether the degeneration is related to the presence of neurofibrillary tangles. Using light microscopic methods with immunohistochemistry, electron microscopy, and cell counting methods, 11-week-old NPC+/+ and NPC−/− animals were examined. In the NPC−/− mice, there were 96% fewer Purkinje cells, 28% fewer neurons in the prefrontal cortex, 20% fewer neurons in the thalamus, and 63% fewer glial cells in the corpus callosum. On the other hand, previous studies indicate normal numbers of neurons and glial cells in these same neuroanatomical regions in young NPC−/− mice. There were normal numbers of cholinergic neurons in sections assessed in the striatum and basal forebrain in the 11-week-old animals and no evidence of neurofibrillary tangles within cells. The present data indicate that both neurons and glial cells die in the NPC mouse but that all cells are not equally vulnerable. There was no evidence for neurofibrillary tangles in the NPC mouse, and therefore the degenerative process in the mouse is unrelated to the neurofibrillary tangle. PMID:11298365

  1. 27 CFR 9.140 - Atlas Peak.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ...). (c) Boundaries. The Atlas Peak viticultural area is located in Napa County, California. It lies entirely within the Napa Valley viticultural area. The beginning point is Haystack (peak) found in...

  2. The Phenomenology of Aesthetic Peak Experiences.

    ERIC Educational Resources Information Center

    Panzarella, Robert

    1980-01-01

    Descriptions of music and visual art peak experiences obtained from persons were content analyzed and factor analyzed. The peak experience accounts for mirrored conflicts in aesthetic norms and suggests a greater role for individual differences in aesthetic theories. (Author)

  3. Improvement of a picking algorithm real-time P-wave detection by kurtosis

    NASA Astrophysics Data System (ADS)

    Ishida, H.; Yamada, M.

    2016-12-01

    Earthquake early warning (EEW) requires fast and accurate P-wave detection. The current EEW system in Japan uses the STA/LTAalgorithm (Allen, 1978) to detect P-wave arrival.However, some stations did not trigger during the 2011 Great Tohoku Earthquake due to the emergent onset. In addition, accuracy of the P-wave detection is very important: on August 1, 2016, the EEW issued a false alarm with M9 in Tokyo region due to a thunder noise.To solve these problems, we use a P-wave detection method using kurtosis statistics. It detects the change of statistic distribution of the waveform amplitude. This method was recently developed (Saragiotis et al., 2002) and used for off-line analysis such as making seismic catalogs. To apply this method for EEW, we need to remove an acausal calculation and enable a real-time processing. Here, we propose a real-time P-wave detection method using kurtosis statistics with a noise filter.To avoid false triggering by a noise, we incorporated a simple filter to classify seismic signal and noise. Following Kong et al. (2016), we used the interquartilerange and zero cross rate for the classification. The interquartile range is an amplitude measure that is equal to the middle 50% of amplitude in a certain time window. The zero cross rate is a simple frequency measure that counts the number of times that the signal crosses baseline zero. A discriminant function including these measures was constructed by the linear discriminant analysis.To test this kurtosis method, we used strong motion records for 62 earthquakes between April, 2005 and July, 2015, which recorded the seismic intensity greater equal to 6 lower in the JMA intensity scale. The records with hypocentral distance < 200km were used for the analysis. An attached figure shows the error of P-wave detection speed for STA/LTA and kurtosis methods against manual picks. It shows that the median error is 0.13 sec and 0.035 sec for STA/LTA and kurtosis method. The kurtosis method tends to be

  4. Constraining cosmology with shear peak statistics: tomographic analysis

    NASA Astrophysics Data System (ADS)

    Martinet, Nicolas; Bartlett, James G.; Kiessling, Alina; Sartoris, Barbara

    2015-09-01

    The abundance of peaks in weak gravitational lensing maps is a potentially powerful cosmological tool, complementary to measurements of the shear power spectrum. We study peaks detected directly in shear maps, rather than convergence maps, an approach that has the advantage of working directly with the observable quantity, the galaxy ellipticity catalog. Using large numbers of numerical simulations to accurately predict the abundance of peaks and their covariance, we quantify the cosmological constraints attainable by a large-area survey similar to that expected from the Euclid mission, focusing on the density parameter, Ωm, and on the power spectrum normalization, σ8, for illustration. We present a tomographic peak counting method that improves the conditional (marginal) constraints by a factor of 1.2 (2) over those from a two-dimensional (i.e., non-tomographic) peak-count analysis. We find that peak statistics provide constraints an order of magnitude less accurate than those from the cluster sample in the ideal situation of a perfectly known observable-mass relation; however, when the scaling relation is not known a priori, the shear-peak constraints are twice as strong and orthogonal to the cluster constraints, highlighting the value of using both clusters and shear-peak statistics.

  5. 76 FR 47180 - Pick-Sloan Missouri Basin Program-Eastern Division-2021 Power Marketing Initiative Proposal

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-04

    ... Area Power Administration Pick-Sloan Missouri Basin Program--Eastern Division--2021 Power Marketing... marketing agency of the Department of Energy (DOE) published the proposed 2021 Power Marketing Initiative... marketing the long-term firm hydroelectric resources of the Pick-Sloan Missouri Basin Program--Eastern...

  6. Baseline studies on the feasibility of detecting a coal/shale interface with a self-powered sensitized pick

    NASA Technical Reports Server (NTRS)

    Anderson, G. R., II

    1981-01-01

    The feasibility of utilizing a sensitized pick to discriminate between cutting coal and roof material during the longwall mining process was investigated. A conventional longwall mining pick was instrumented and cutting force magnitudes were determined for a variety of materials, including Illinois #6 coal, shale type materials, and synthetic coal/shale materials.

  7. Continuous Access to Competing Stimulation as Intervention for Self-Injurious Skin Picking in a Child with Autism

    ERIC Educational Resources Information Center

    Ladd, Mara V.; Luiselli, James K.; Baker, Lorianne

    2009-01-01

    Children with autism frequently display self-injurious behavior (SIB), but skin picking--a less severe topography of SIB--has not been the focus of much clinical research. The present study evaluated a home-based intervention that was implemented with a 9-year-old girl who had autism and picked her fingers with resulting tissue damage. The…

  8. The class characteristic mark of the H&M Mul-T-Lock picking tool in toolmarks examination.

    PubMed

    Volkov, Nikolai; Finkelstein, Nir; Novoselsky, Yehuda; Tsach, Tsadok

    2014-07-01

    Mul-T-Lock is a high security lock cylinder distinguished by the use of a telescoping "pin-in-pin"-tumbler design. Picking the Mul-T-Lock cylinder with a traditional picking tool is highly complicated because it can get stuck between the inner and outer pins. The H&M Mul-T-Lock picking tool was designed to overcome this problem and facilitate the picking of the "pin-in-pin" cylinder. The purpose of this research is to determine whether H&M Mul-T-Lock picking tool leaves class characteristic mark and whether it can be distinguished from traditional picking tools marks and from regular key marks. It also describes and determines the class characteristic mark left on telescopic pins, its origin, recurrence, and its benefit to the toolmarks examiner. When receiving a Mul-T-Lock from a crime scene, a toolmarks examiner can quickly determine whether or not it was picked by an H&M Mul-T-Lock picking tool by noticing the class characteristic mark which this typical tool leaves. © 2014 American Academy of Forensic Sciences.

  9. 41 CFR 102-41.230 - May SASPs pick up or store donated drug paraphernalia in their distribution centers?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false May SASPs pick up or store donated drug paraphernalia in their distribution centers? 102-41.230 Section 102-41.230 Public... SASPs pick up or store donated drug paraphernalia in their distribution centers? No, you must release...

  10. Continuous Access to Competing Stimulation as Intervention for Self-Injurious Skin Picking in a Child with Autism

    ERIC Educational Resources Information Center

    Ladd, Mara V.; Luiselli, James K.; Baker, Lorianne

    2009-01-01

    Children with autism frequently display self-injurious behavior (SIB), but skin picking--a less severe topography of SIB--has not been the focus of much clinical research. The present study evaluated a home-based intervention that was implemented with a 9-year-old girl who had autism and picked her fingers with resulting tissue damage. The…

  11. PDZ binding to the BAR domain of PICK1 is elucidated by coarse-grained molecular dynamics

    PubMed Central

    He, Yi; Liwo, Adam; Weinstein, Harel; Scheraga, Harold A.

    2010-01-01

    A key regulator of AMPA (α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid) receptor traffic, PICK1 is also known to interact with over 40 other proteins, including receptors, transporters, and ionic channels, and to be active mostly as a homodimer. The current lack of a complete PICK1 structure determined at atomic resolution hinders the elucidation of its functional mechanisms. Here, we identify interactions between the component PDZ and BAR domains of PICK1 by calculating possible binding sites for the PDZ domain of PICK1, PICK1-PDZ, to the homology-modeled crescent-shaped dimer of the PICK1-BAR domain using multiplexed replica-exchange molecular dynamics (MREMD) and canonical molecular dynamics (MD) simulations with the coarse-grained UNRES force field. The MREMD results show that the preferred binding site for the single PDZ domain is the concave cavity of the BAR dimer. A second possible binding site is near the N-terminus of the BAR domain that is linked directly to the PDZ domain. Subsequent short MD simulations, used to determine how the PICK1-PDZ domain moves to the preferred binding site on the BAR domain of PICK1, revealed that initial hydrophobic interactions drive the progress of the simulated binding. Thus, the concave face of the BAR dimer accommodates the PDZ domain first by weak hydrophobic interactions, and then the PDZ domain slides to the center of the concave face, where more favorable hydrophobic interactions take over. PMID:21050858

  12. Abnormal brain activation in excoriation (skin-picking) disorder: evidence from an executive planning fMRI study

    PubMed Central

    Odlaug, Brian L.; Hampshire, Adam; Chamberlain, Samuel R.; Grant, Jon E.

    2016-01-01

    Background Excoriation (skin-picking) disorder (SPD) is a relatively common psychiatric condition whose neurobiological basis is unknown. Aims To probe the function of fronto-striatal circuitry in SPD. Method Eighteen participants with SPD and 15 matched healthy controls undertook an executive planning task (Tower of London) during functional magnetic resonance imaging (fMRI). Activation during planning was compared between groups using region of interest and whole-brain permutation cluster approaches. Results The SPD group exhibited significant functional underactivation in a cluster encompassing bilateral dorsal striatum (maximal in right caudate), bilateral anterior cingulate and right medial frontal regions. These abnormalities were, for the most part, outside the dorsal planning network typically activated by executive planning tasks. Conclusions Abnormalities of neural regions involved in habit formation, action monitoring and inhibition appear involved in the pathophysiology of SPD. Implications exist for understanding the basis of excessive grooming and the relationship of SPD with putative obsessive–compulsive spectrum disorders. PMID:26159604

  13. A non-dominated sorting genetic algorithm for a bi-objective pick-up and delivery problem

    NASA Astrophysics Data System (ADS)

    Velasco, N.; Dejax, P.; Guéret, C.; Prins, C.

    2012-03-01

    Some companies must transport their personnel within facilities. This is especially the case for oil companies that use helicopters to transport engineers, technicians and assistant personnel from platform to platform. This operation has the potential to become expensive if the transportation routes are not correctly planned and provide a bad quality of service. Here this issue is modelled as a pick-up and delivery problem where a set of transportation requests should be scheduled in routes, minimizing the total transportation cost while the most urgent requests are satisfied by priority. To solve the problem, a method based on a Non-dominated Sorting Genetic Algorithm (NSGA-II) is proposed. This algorithm is tested on both randomly generated and real instances provided by a petroleum company. The results show that the proposed algorithm improves the best-known solutions.

  14. PolyaPeak: detecting transcription factor binding sites from ChIP-seq using peak shape information.

    PubMed

    Wu, Hao; Ji, Hongkai

    2014-01-01

    ChIP-seq is a powerful technology for detecting genomic regions where a protein of interest interacts with DNA. ChIP-seq data for mapping transcription factor binding sites (TFBSs) have a characteristic pattern: around each binding site, sequence reads aligned to the forward and reverse strands of the reference genome form two separate peaks shifted away from each other, and the true binding site is located in between these two peaks. While it has been shown previously that the accuracy and resolution of binding site detection can be improved by modeling the pattern, efficient methods are unavailable to fully utilize that information in TFBS detection procedure. We present PolyaPeak, a new method to improve TFBS detection by incorporating the peak shape information. PolyaPeak describes peak shapes using a flexible Pólya model. The shapes are automatically learnt from the data using Minorization-Maximization (MM) algorithm, then integrated with the read count information via a hierarchical model to distinguish true binding sites from background noises. Extensive real data analyses show that PolyaPeak is capable of robustly improving TFBS detection compared with existing methods. An R package is freely available.

  15. 76 FR 71015 - Pick-Sloan Missouri Basin Program-Eastern Division-2021 Power Marketing Initiative

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-11-16

    ... Area Power Administration Pick-Sloan Missouri Basin Program--Eastern Division--2021 Power Marketing Initiative AGENCY: Western Area Power Administration, DOE. ACTION: Notice of Final 2021 Power Marketing... marketing agency of the Department of Energy (DOE), announces the 2021 Power Marketing Initiative (2021 PMI...

  16. White Speck, A Dye Defect in Mechanically and Hand Picked Cottons

    USDA-ARS?s Scientific Manuscript database

    The textile industry is often caught off guard by white specks showing up in dyed fabrics. The current grading system does not always pick up the level of maturity that causes white specks. Research using international cottons is aimed at finding high-speed measurement systems that can be used to ...

  17. 1990 Fuel consumption guide: Ratings for new cars, pick-up trucks and vans. Annual publication

    SciTech Connect

    Not Available

    1989-01-01

    This guide has been prepared to assist the consumer in purchasing the most fuel-efficient new vehicle. Information on automobiles includes factors affecting fuel consumption, the fuel consumption labelling program, and the car economy book. Consumption for pick-up trucks, vans and special purpose vehicles is also provided.

  18. A Normative Study of the Person Picking an Apple from a Tree (PPAT) Assessment

    ERIC Educational Resources Information Center

    Bucciarelli, Amy

    2011-01-01

    The Person Picking an Apple from a Tree (PPAT) is an art therapy assessment task that is scored using the Formal Elements Art Therapy Scale (FEATS) to identify a client's mental health symptoms and progress in art therapy. Normative data are needed to empirically validate assumptions about the PPAT. This report summarizes a normative study of the…

  19. Phenomenological Characteristics, Social Problems, and the Economic Impact Associated with Chronic Skin Picking

    ERIC Educational Resources Information Center

    Flessner, Christopher A.; Woods, Douglas W.

    2006-01-01

    In this study, the authors collected data on the demographic characteristics, phenomenology, and social and economic impact of skin picking. A total of 92 participants completed an anonymous, Internet-based survey through a link to the Trichotillomania Learning Center's home page. Results indicated that skin pickers experienced social,…

  20. Description of third instar larvae of Anastrepha curitis, Anastrepha pickeli and Anastrepha pulchra (Diptera: Tephritidae)

    USDA-ARS?s Scientific Manuscript database

    We describe and illustrate for the first time the third instar larvae of three Anastrepha species, Anastrepha pickeli Lima, Anastrepha pulchra Stone, and Anastrepha curitis Stone, and also the second instar of A. curitis. Internal structures, such as the cephalopharyngeal skeleton and spiracles, and...