Human sperm bind to the N-terminal domain of ZP2 in humanized zonae pellucidae in transgenic mice
Baibakov, Boris; Boggs, Nathan A.; Yauger, Belinda; Baibakov, Galina
2012-01-01
Fertilization requires taxon-specific gamete recognition, and human sperm do not bind to zonae pellucidae (ZP1–3) surrounding mouse eggs. Using transgenesis to replace endogenous mouse proteins with human homologues, gain-of-function sperm-binding assays were established to evaluate human gamete recognition. Human sperm bound only to zonae pellucidae containing human ZP2, either alone or coexpressed with other human zona proteins. Binding to the humanized matrix was a dominant effect that resulted in human sperm penetration of the zona pellucida and accumulation in the perivitelline space, where they were unable to fuse with mouse eggs. Using recombinant peptides, the site of gamete recognition was located to a defined domain in the N terminus of ZP2. These results provide experimental evidence for the role of ZP2 in mediating sperm binding to the zona pellucida and support a model in which human sperm–egg recognition is dependent on an N-terminal domain of ZP2, which is degraded after fertilization to provide a definitive block to polyspermy. PMID:22734000
Buffone, Mariano G; Zhuang, Tiangang; Ord, Teri S; Hui, Ling; Moss, Stuart B; Gerton, George L
2008-05-02
Many candidates have been proposed as zona pellucida-binding proteins. Without precluding a role for any of those candidates, we focused on mouse sperm protein ZP3R/sp56, which is localized in the acrosomal matrix. The objective of this study was to analyze the role of ZP3R/sp56 in mouse fertilization. We expressed recombinant ZP3R/sp56 as a secreted protein in HEK293 cells and purified it from serum-free, conditioned medium. In the presence of reducing agents, the recombinant ZP3R/sp56 exhibited a molecular weight similar to that observed for the native ZP3R/sp56. Reminiscent of the native protein, recombinant ZP3R/sp56 formed a high molecular weight, disulfide cross-linked oligomer consisting of six or more monomers under non-reducing conditions. Recombinant ZP3R/sp56 bound to the zona pellucida of unfertilized eggs but not to 2-cell embryos, indicating that the changes that take place in the zona pellucida at fertilization affected the interaction of this protein with the zona pellucida. The extent of in vitro fertilization was reduced in a dose-dependent manner when unfertilized eggs were preincubated with recombinant ZP3R/sp56 (74% drop at the maximum concentrations assayed). Eggs incubated with the recombinant protein showed an absence of or very few sperm in the perivitelline space, suggesting that the reduction in the fertilization rate is caused by the inhibition of sperm binding and/or penetration through the zona pellucida. These results indicate that sperm ZP3R/sp56 is important for sperm-zona interactions during fertilization and support the concept that the acrosomal matrix plays an essential role in mediating the binding of sperm to the zona pellucida.
Edenfeld, J; Schöpper, B; Sturm, R; Diedrich, K; Al-Hasani, S
2002-04-01
Laser systems are very promising new technical tools in assisted reproduction. It was investigated if laser radiation can replace the mechanical cutting procedure via micromanipulator in the hemizona assay (HZA), a commonly used bioassay to determine the sperm-zona pellucida binding capacity. An oocyte was bisected precisely into two identical hemizonae with approximately 20 laser pulses (pulse length 30 msec) using a 1.48-microm diode laser. Compared with the conventional method using microscalpels for zona bisection, laser treated hemizonae showed equivalent sperm-binding and within the two groups there was no detectable difference between matching hemizonae in their capacity for tight sperm-binding. To evaluate whether laser radiation affects the outcome of the HZA when effects of certain substances are investigated, the spermatozoa were preincubated with human follicular fluid (hFF), which inhibits the binding of spermatozoa to zona pellucida in vitro. Supplementation with follicular fluid exerted an inhibitory effect in both groups. The hemizona index (HZI) showed no statistical differences between the two methods. Therefore, the 1.48-microm diode laser is a suitable new instrument for generating equally sized hemizonae. There is no use for holding pipettes and microscalpels, on the contrary, for performing the HZA the laser is a precise, very quick and easy to use new working tool.
Mugnier, Sylvie; Boittin, Stéphane; Douet, Cécile; Monget, Philippe; Magistrini, Michèle; Goudet, Ghylène
2008-11-14
In human and rodents, sperm-zona pellucida binding is mediated by a sperm surface Galactosyltransferase that recognizes N-Acetylglucosamine residues on a glycoprotein ZPC. In large domestic mammals, the role of these molecules remains unclear: in bovine, they are involved in sperm-zona pellucida binding, whereas in porcine, they are not necessary. Our aim was to clarify the role of Galactosyltransferase and N-Acetylglucosamine residues in sperm-zona pellucida binding in ungulates. For this purpose, we analyzed the mechanism of sperm-zona pellucida interaction in a third ungulate: the horse, since the Galactosyltransferase and N-Acetylglucosamine residues have been localized on equine gametes. We masked the Galactosyltransferase and N-Acetylglucosamine residues before the co-incubation of gametes. Galactosyltransferase was masked either with an anti-Galactosyltransferase antibody or with the enzyme substrate, UDP Galactose. N-Acetylglucosamine residues were masked either with a purified Galactosyltransferase or with an anti-ZPC antibody. The number of spermatozoa bound to the zona pellucida did not decrease after the masking of Galactosyltransferase or N-Acetylglucosamine. So, these two molecules may not be necessary in the mechanism of in vitro sperm-zona pellucida interaction in the horse. The involvement of Galactosyltransferase and N-Acetylglucosamine residues in sperm-zona pellucida binding may have been lost during evolution in some ungulates, such as porcine and equine species.
Margaryan, Hasmik; Dorosh, Andriy; Capkova, Jana; Manaskova-Postlerova, Pavla; Philimonenko, Anatoly; Hozak, Pavel; Peknicova, Jana
2015-03-08
Sperm proteins are important for the sperm cell function in fertilization. Some of them are involved in the binding of sperm to the egg. We characterized the acrosomal sperm protein detected by a monoclonal antibody (MoAb) (Hs-8) that was prepared in our laboratory by immunization of BALB/c mice with human ejaculated sperms and we tested the possible role of this protein in the binding assay. Indirect immunofluorescence and immunogold labelling, gel electrophoresis, Western blotting and protein sequencing were used for Hs-8 antigen characterization. Functional analysis of GAPDHS from the sperm acrosome was performed in the boar model using sperm/zona pellucida binding assay. Monoclonal antibody Hs-8 is an anti-human sperm antibody that cross-reacts with the Hs-8-related protein in spermatozoa of other mammalian species (boar, mouse). In the immunofluorescence test, Hs-8 antibody recognized the protein localized in the acrosomal part of the sperm head and in the principal piece of the sperm flagellum. In immunoblotting test, MoAb Hs-8 labelled a protein of 45 kDa in the extract of human sperm. Sequence analysis identified protein Hs-8 as GAPDHS (glyceraldehyde 3-phosphate dehydrohenase-spermatogenic). For this reason, commercial mouse anti-GAPDHS MoAb was applied in control tests. Both antibodies showed similar staining patterns in immunofluorescence tests, in electron microscopy and in immunoblot analysis. Moreover, both Hs-8 and anti-GAPDHS antibodies blocked sperm/zona pellucida binding. GAPDHS is a sperm-specific glycolytic enzyme involved in energy production during spermatogenesis and sperm motility; its role in the sperm head is unknown. In this study, we identified the antigen with Hs8 antibody and confirmed its localization in the apical part of the sperm head in addition to the principal piece of the flagellum. In an indirect binding assay, we confirmed the potential role of GAPDHS as a binding protein that is involved in the secondary sperm/oocyte binding.
Sati, Leyla; Cayli, Sevil; Delpiano, Elena; Sakkas, Denny; Huszar, Gabor
2014-05-01
In mammalian species, acquisition of sperm fertilization competence is dependent on the phenomenon of sperm capacitation. One of the key elements of capacitation is protein tyrosine phosphorylation (TP) in various sperm membrane regions. In previous studies performed, the pattern of TP was examined in human sperm bound to zona pellucida of oocytes. In the present comparative study, TP patterns upon sperm binding to the zona pellucida or hyaluronic acid (HA) were investigated in spermatozoa arising from the same semen samples. Tyrosine phosphorylation, visualized by immunofluorescence, was localized within the acrosomal cap, equatorial head region, neck, and the principal piece. Tyrosine phosphorylation has increased in a time-related manner as capacitation progressed, and the phosphorylation pattern was identical within the principal piece and neck, regardless of the sperm bound to the zona pellucida or HA. Thus, the data demonstrated that the patterns of sperm activation-related TP were similar regardless of the spermatozoa bound to zona pellucida or HA. Further, sperm with incomplete development, as detected by excess cytoplasmic retention, failed to exhibit TP.
Sati, Leyla; Cayli, Sevil; Delpiano, Elena; Sakkas, Denny
2014-01-01
In mammalian species, acquisition of sperm fertilization competence is dependent on the phenomenon of sperm capacitation. One of the key elements of capacitation is protein tyrosine phosphorylation (TP) in various sperm membrane regions. In previous studies performed, the pattern of TP was examined in human sperm bound to zona pellucida of oocytes. In the present comparative study, TP patterns upon sperm binding to the zona pellucida or hyaluronic acid (HA) were investigated in spermatozoa arising from the same semen samples. Tyrosine phosphorylation, visualized by immunofluorescence, was localized within the acrosomal cap, equatorial head region, neck, and the principal piece. Tyrosine phosphorylation has increased in a time-related manner as capacitation progressed, and the phosphorylation pattern was identical within the principal piece and neck, regardless of the sperm bound to the zona pellucida or HA. Thus, the data demonstrated that the patterns of sperm activation-related TP were similar regardless of the spermatozoa bound to zona pellucida or HA. Further, sperm with incomplete development, as detected by excess cytoplasmic retention, failed to exhibit TP. PMID:24077441
Autoradiographic visualization of the mouse egg's sperm receptor bound to sperm
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bleil, J.D.; Wassarman, P.M.
1986-04-01
The extracellular coat, or zona pellucida, of mammalian eggs contains species-specific receptors to which sperm bind as a prelude to fertilization. In mice, ZP3, one of only three zona pellucida glycoproteins, serves as sperm receptor. Acrosome-intact, but not acrosome-reacted, mouse sperm recognize and interact with specific O-linked oligosaccharides of ZP3 resulting in sperm-egg binding. Binding, in turn, causes sperm to undergo the acrosome reaction; a membrane fusion event that results in loss of plasma membrane at the anterior region of the head and exposure of inner acrosomal membrane with its associated acrosomal contents. Bound, acrosome-reacted sperm are able to penetratemore » the zona pellucida and fuse with the egg's plasma membrane (fertilization). In the present report, we examined binding of radioiodinated, purified, egg ZP3 to both acrosome intact and acrosome reacted sperm by whole-mount autoradiography. Silver grains due to bound 125I-ZP3 were found localized to the acrosomal cap region of heads of acrosome-reacted sperm. Under the same conditions, 125I-fetuin bound at only background levels to heads of both acrosome-intact and -reacted sperm, and 125I-ZP2, another zona pellucida glycoprotein, bound preferentially to acrosome-reacted sperm. These results provide visual evidence that ZP3 binds preferentially and specifically to heads of acrosome intact sperm; properties expected of the mouse egg's sperm receptor.« less
Determination of the reactivity of cytotoxic immune cells with preimplantation mouse embryos
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ewoldsen, M.A.
1987-01-01
Cytotoxic immune cells were used in an assay, MELIA (mixed embryo leukocyte interaction assay) to test the ability of the cells to kill blastocyst stage embryos. The cytotoxic immune cells generated for use in this study, cytotoxic T lymphocytes (CTLs), natural killer (NK) cells, and lymphokine activated killer (LAK) cells were shown to have phenotypic and cytolytic characteristics similar to those reported by other investigators. The lysis of the blastocysts in the MELIA was determined by measuring the inhibition of blastocoel retention and/or by the inhibition of incorporation of tritiated thymidine (/sup 3/H-TdR) into embryonic DNA. Blastocysts which possess ormore » lack their zonae pellucidae were tested to determine whether the zona pellucida plays an immunoprotective role in preimplantation development. The results indicated that CTLs only lysed embryonic cells when the zona pellucida was absent, but NK and LAK cells lysed embryonic cells whether the zona pellucida was present or absent. The results suggest that the zona pellucida may protect the preimplantation mouse embryo from lysis by CTLs but what protects the embryo from lysis by NK and LAK cells is unclear.« less
Body mass index is not associated with sperm-zona pellucida binding ability in subfertile males.
Sermondade, Nathalie; Dupont, Charlotte; Faure, Céline; Boubaya, Marouane; Cédrin-Durnerin, Isabelle; Chavatte-Palmer, Pascale; Sifer, Christophe; Lévy, Rachel
2013-09-01
Lifestyle factors, such as weight and nutritional status may affect male fertility, including sperm fertilization ability. The objective of this retrospective study was to evaluate the association between body mass index (BMI) and sperm-zona pellucida binding ability assessed according to the zona binding (ZB) test, which has been described to be a relevant diagnostic tool for the prediction of in vitro fertilization (IVF) ability. Three hundred and six male patients from couples diagnosed with primary idiopathic or mild male factor infertility were included. Correlations between BMI and semen parameters according to ZB test indices were assessed, together with frequencies of positive and negative tests across the BMI categories. In this selected population, BMI was not related to conventional semen parameters or sperm quality assessed according to the ability of spermatozoa to bind to the zona pellucida. The previously described poor outcomes of IVF procedures in cases of male obesity could be due to other sperm defects, such as alterations of sperm capacitation or acrosome reaction. The link between male BMI and biological outcomes during IVF procedures, such as fertilization rates, should be further evaluated.
Identification of a ZP3-binding protein on acrosome-intact mouse sperm by photoaffinity crosslinking
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bleil, J.D.; Wassarman, P.M.
1990-07-01
During the process of fertilization in mammals, sperm bind in a relatively species-specific manner to the zona pellucida (ZP) of ovulated eggs. ZP3, a glycoprotein found in the mouse egg zona pellucida, serves as receptor for sperm during gamete adhesion. We report here that a Mr 56,000 protein found on mouse sperm has properties expected for a sperm component that recognizes and binds to ZP3. This sperm protein is radiolabeled preferentially by a photoactivatable heterobifunctional crosslinker (Denny-Jaffee reagent) covalently linked to purified ZP3, binds very tightly to ZP3-affinity columns, and is localized to heads of acrosome-intact but not acrosome-reacted sperm.more » These and other findings suggest that this protein may be a ZP3-binding protein that, together with the sperm receptor, supports species-specific binding of mouse sperm to unfertilized eggs.« less
Differences between antigenic determinants of pig and cat zona pellucida proteins.
Jewgenow, K; Rohleder, M; Wegner, I
2000-05-01
Despite many efforts, the control of reproduction in feral cat populations is still a problem in urban regions around the world. Immunocontraception is a promising approach; thus the present study examined the suitability of the widely used pig zona pellucida proteins (pZP) for contraception in feral domestic cats. Purified zona pellucida proteins obtained from pig and cat ovaries were used to produce highly specific antisera in rabbits. Antibodies against pZP raised in rabbits or lions were not effective inhibitors of either in vitro sperm binding (cat spermatozoa to cat oocytes) or in vitro fertilization in cats, whereas antibodies against feline zona pellucida proteins (fZP) raised in rabbits showed a dose-dependent inhibition of in vitro fertilization. Immunoelectrophoresis, ELISA and immunohistology of ovaries confirmed these results, showing crossreactivity of anti-fZP sera to fZP and to a lesser extent to pZP, but no interaction of anti-pZP sera with fZP. It is concluded that cat and pig zonae pellucidae express a very small number of shared antigenic determinants, making the use of pZP vaccine in cats questionable. A contraceptive vaccine based on feline zona pellucida determinants will be a better choice for the control of reproduction in feral cats if immunogenity can be achieved.
NASA Astrophysics Data System (ADS)
Fachriyah, E.; Ghifari, M. A.; Anam, K.
2018-04-01
The research of the isolation and xanthine oxidation inhibition activity of alkaloid compound from Peperomia pellucida has been carried out. Alkaloid extract is isolated by column chromatography and preparative TLC. Alkaloid isolate is identified spectroscopically by UV-Vis spectrophotometer, FT-IR, and LC-MS/MS. Xanthine oxidase inhibition activity is carried out by in vitro assay. The result showed that the alkaloid isolated probably has piperidine basic structure. The alkaloid isolate has N-H, C-H, C = C, C = O, C-N, C-O-C groups and the aromatic ring. The IC50 values of ethanol and alkaloid extract are 71.6658 ppm and 76.3318 ppm, respectively. Alkaloid extract of Peperomia pellucida showed higher activity than ethanol extract.
Coutinho da Silva, Marco A; Seidel, George E; Squires, Edward L; Graham, James K; Carnevale, Elaine M
2014-11-10
Objectives were to determine the effects of extracellular Ca(2+) and milk proteins on intracellular Ca(2+) concentrations in stallion sperm; and to determine the effects of single caseins on sperm binding to the zona pellucida (ZP). In Experiment I, sperm were incubated in media containing 2 or 4mM Ca(2+) and intracellular Ca(2+) concentration was determined after ionomycin treatment and long-term incubation (3h). Extracellular Ca(2+) concentrations (2 compared with 4mM) did not affect baseline intracellular Ca(2+) concentration of sperm. However, incubating sperm in a medium containing 4 compared with 2mM Ca(2+) resulted in greater (P<0.05) influx of Ca(2+) into sperm. In Experiment II, sperm incubated in media containing 1mg/mL of native phosphocaseinate (NP) or sodium caseinate (SC) showed similar baseline intracellular Ca(2+) and influx of Ca(2+) than control (TALP). In Experiment III, sperm-ZP binding assays were performed in TALP medium containing: no additions (TALP); 1mg/mL SC; 1 or 3mg/mL of α-casein; 1 or 3mg/mL of β-casein; and 1 or 3mg/mL of κ-casein. The number of stallion sperm bound to bovine ZP was greatest (P<0.05) when SC was used. Co-incubation in media containing single caseins (α-, β- or κ-casein) resulted in similar results to TALP; however, a dose effect (P<0.05) was observed for β- and κ-caseins. In conclusion, extracellular Ca(2+) concentration and milk proteins did not affect baseline intracellular calcium in stallion sperm. It appears that β- and κ-caseins may be responsible for enhancing sperm binding to ZP, but the mechanism remains unknown. Copyright © 2014 Elsevier B.V. All rights reserved.
Zinc sparks induce physiochemical changes in the egg zona pellucida that prevent polyspermy
DOE Office of Scientific and Technical Information (OSTI.GOV)
Que, Emily L.; Duncan, Francesca E.; Bayer, Amanda R.
During fertilization or chemically-induced egg activation, the mouse egg releases billions of zinc atoms in brief bursts known as ‘zinc sparks.’ The zona pellucida (ZP), a glycoprotein matrix surrounding the egg, is the first structure zinc ions encounter as they diffuse away from the plasma membrane. Following fertilization, the ZP undergoes changes described as ‘hardening’, which prevent multiple sperm from fertilizing the egg and thereby establish a block to polyspermy. A major event in zona hardening is cleavage of ZP2 proteins by ovastacin; however, the overall physiochemical changes contributing to zona hardening are not well understood. Using x-ray fluorescence microscopy,more » transmission and scanning electron microscopy, and biological function assays, we tested the hypothesis that zinc release contributes to ZP hardening. We found that the zinc content in the ZP increases by 300% following activation and that zinc exposure modulates the architecture of the ZP matrix. Importantly, zinc-induced structural changes of the ZP have a direct biological consequence; namely, they reduce the ability of sperm to bind to the ZP. These results provide a paradigm-shifting model in which fertilization-induced zinc sparks contribute to the polyspermy block by altering conformations of the ZP matrix. Finally, this adds a previously unrecognized factor, namely zinc, to the process of ZP hardening.« less
Zinc sparks induce physiochemical changes in the egg zona pellucida that prevent polyspermy
Que, Emily L.; Duncan, Francesca E.; Bayer, Amanda R.; ...
2017-01-19
During fertilization or chemically-induced egg activation, the mouse egg releases billions of zinc atoms in brief bursts known as ‘zinc sparks.’ The zona pellucida (ZP), a glycoprotein matrix surrounding the egg, is the first structure zinc ions encounter as they diffuse away from the plasma membrane. Following fertilization, the ZP undergoes changes described as ‘hardening’, which prevent multiple sperm from fertilizing the egg and thereby establish a block to polyspermy. A major event in zona hardening is cleavage of ZP2 proteins by ovastacin; however, the overall physiochemical changes contributing to zona hardening are not well understood. Using x-ray fluorescence microscopy,more » transmission and scanning electron microscopy, and biological function assays, we tested the hypothesis that zinc release contributes to ZP hardening. We found that the zinc content in the ZP increases by 300% following activation and that zinc exposure modulates the architecture of the ZP matrix. Importantly, zinc-induced structural changes of the ZP have a direct biological consequence; namely, they reduce the ability of sperm to bind to the ZP. These results provide a paradigm-shifting model in which fertilization-induced zinc sparks contribute to the polyspermy block by altering conformations of the ZP matrix. Finally, this adds a previously unrecognized factor, namely zinc, to the process of ZP hardening.« less
Wei, Lee Seong; Wee, Wendy; Siong, Julius Yong Fu; Syamsumir, Desy Fitrya
2011-01-01
Peperomia pellucida leaf extract was characterized for its anticancer, antimicrobial, antioxidant activities, and chemical compositions. Anticancer activity of P. pellucida leaf extract was determined through Colorimetric MTT (tetrazolium) assay against human breast adenocarcinoma (MCF-7) cell line and the antimicrobial property of the plant extract was revealed by using two-fold broth micro-dilution method against 10 bacterial isolates. Antioxidant activity of the plant extract was then characterized using α, α-diphenyl-β-picrylhydrazyl (DPPH) radical scavenging method and the chemical compositions were screened and identified using gas chromatography-mass spectrometry (GC-MS). The results of present study indicated that P. pellucida leaf extract possessed anticancer activities with half maximal inhibitory concentration (IC(50)) of 10.4 ± 0.06 µg/ml. The minimum inhibitory concentration (MIC) values were ranged from 31.25 to 125 mg/l in which the plant extract was found to inhibit the growth of Edwardsiella tarda, Escherichia coli, Flavobacterium sp., Pseudomonas aeruginosa and Vibrio cholerae at 31.25 mg/l; Klebsiella sp., Aeromonas hydrophila and Vibrio alginolyticus at 62.5 mg/l; and it was able to control the growth of Salmonella sp. and Vibrio parahaemolyticus at 125 mg/l. At the concentration of 0.625 ppt, the plant extract was found to inhibit 30% of DPPH, free radical. Phytol (37.88%) was the major compound in the plant extract followed by 2-Naphthalenol, decahydro- (26.20%), Hexadecanoic acid, methyl ester (18.31%) and 9,12-Octadecadienoic acid (Z,Z)-, methyl ester (17.61%). Findings from this study indicated that methanol extract of P. pellucida leaf possessed vast potential as medicinal drug especially in breast cancer treatment.
Wong, Chi-Wai; Lam, Kevin K W; Lee, Cheuk-Lun; Yeung, William S B; Zhao, Wei E; Ho, Pak-Chung; Ou, Jian-Ping; Chiu, Philip C N
2017-04-01
Are multimeric sperm plasma membrane protein complexes, ERp57 and sperm surface thiol content involved in human spermatozoa-zona pellucida (ZP) interaction? ERp57 is a component of a multimeric spermatozoa-ZP receptor complex involved in regulation of human spermatozoa-ZP binding via up-regulation of sperm surface thiol content. A spermatozoon acquires its fertilization capacity within the female reproductive tract by capacitation. Spermatozoa-ZP receptor is suggested to be a composite structure that is assembled into a functional complex during capacitation. Sperm surface thiol content is elevated during capacitation. ERp57 is a protein disulphide isomerase that modulates the thiol-disulphide status of proteins. The binding ability and components of protein complexes in extracted membrane protein fractions of spermatozoa were studied. The roles of capacitation, thiol-disulphide reagent treatments and ERp57 on sperm functions and sperm surface thiol content were assessed. Spermatozoa were obtained from semen samples from normozoospermic men. Human oocytes were obtained from an assisted reproduction programme. Blue native polyacrylamide gel electrophoresis, western ligand blotting and mass spectrometry were used to identify the components of solubilized ZP/ZP3-binding complexes. The localization and expression of sperm surface thiol and ERp57 were studied by immunostaining and sperm surface protein biotinylation followed by western blotting. Sperm functions were assessed by standard assays. Several ZP-binding complexes were isolated from the cell membrane of capacitated spermatozoa. ERp57 was a component of one of these complexes. Capacitation significantly increased the sperm surface thiol content, acrosomal thiol distribution and ERp57 expression on sperm surface. Sperm surface thiol and ERp57 immunoreactivity were localized to the acrosomal region of spermatozoa, a region responsible for ZP-binding. Up-regulation of the surface thiol content or ERp57 surface expression in vitro stimulated ZP-binding capacity of human spermatozoa. Blocking of ERp57 function by specific antibody or inhibitors against ERp57 reduced the surface thiol content and ZP-binding capacity of human spermatozoa. N/A. The mechanisms by which up-regulation of surface thiol content stimulates spermatozoa-ZP binding have not been depicted. Thiol-disulphide exchange is a crucial event in capacitation. ERp57 modulates the event and the subsequent fertilization process. Modulation of the surface thiol content of the spermatozoa of subfertile men may help to increase fertilization rate in assisted reproduction. This work was supported by The Hong Kong Research Grant Council Grant HKU764611 and HKU764512M to P.C.N.C. The authors have no competing interests. © The Author 2017. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com
Human sperm degradation of zona pellucida proteins contributes to fertilization.
Saldívar-Hernández, Analilia; González-González, María E; Sánchez-Tusié, Ana; Maldonado-Rosas, Israel; López, Pablo; Treviño, Claudia L; Larrea, Fernando; Chirinos, Mayel
2015-09-02
The mammalian oocyte extracellular matrix known as the zona pellucida (ZP) acts as a barrier to accomplish sperm fusion with the female gamete. Although penetration of the ZP is a limiting event to achieve fertilization, this is one of the least comprehended stages of gamete interaction. Even though previous studies suggest that proteases of sperm origin contribute to facilitate the passage of sperm through the ZP, in human this process is not yet fully understood. The aim of this study was to determine the ability of human sperm to degrade recombinant human ZP (rhZPs) proteins and to characterize the proteases involved in this process. Purified rhZP2, rhZP3 and rhZP4 proteins were incubated with capacitated sperm and the proteolytic activity was determined by Western blot analysis. To further characterize the proteases involved, parallel incubations were performed in the presence of the protease inhibitors o-phenanthroline, benzamidine and MG-132 meant to block the activity of metalloproteases, serine proteases and the proteasome, respectively. Additionally, protease inhibitors effect on sperm-ZP binding was evaluated by hemizona assay. The results showed that rhZPs were hydrolyzed in the presence of capacitated sperm. O-phenanthroline inhibited the degradation of rhZP3, MG-132 inhibited the degradation of rhZP4 and benzamidine inhibited the degradation of the three proteins under investigation. Moreover, hemizona assays demonstrated that sperm proteasome inhibition impairs sperm interaction with human native ZP. This study suggests that sperm proteasomes could participate in the degradation of ZP, particularly of the ZP4 protein. Besides, metalloproteases may be involved in specific degradation of ZP3 while serine proteases may contribute to unspecific degradation of the ZP. These findings suggest that localized degradation of ZP proteins by sperm is probably involved in ZP penetration and may be of help in understanding the mechanisms of fertilization in humans.
Lee, S. W.; Sim, K. Y.; Wendy, W.; Zulhisyam, A. K.
2016-01-01
Aim: This study was revealed the potential of Peperomia pellucida leaf extract as an immunostimulator agent in controlling motile aeromonad septicemia due to Aeromonas hydrophila in red hybrid tilapia, Oreochromis sp. Materials and Methods: In the present study, minimum inhibitory concentration (MIC) of P. pellucida leaf extract against A. hydrophila was determined through two-fold microbroth dilution method. The plant extract was screening for its active compound using a gas chromatograph mass spectrometer, and the effectiveness of P. pellucida leaf extract as an immunostimulator agent was evaluated. The experimental fish were fed with medicated feed at three different concentrations (25 mg/kg, PP-25; 50 mg/kg, PP-50; and 100 mg/kg, PP-100) of P. pellucida leaf extract for 1 week before they were intraperitoneally exposed to A. hydrophila. Enzyme-linked immunosorbent assay was carried out to determine the value of antibody response to A. hydrophila in fish from a group of fish that received medicated feed, and the percentage of total cumulative mortality of the experimental fish were observed at the end of the experiment. Results: The results showed that the major bioactive compound is phytol (40%), and the MIC value was 31.5 mg/L. The value of antibody response to A. hydrophila in fish from a group of fish which received medicated feed (PP-25, 0.128±0.014 optical density [OD]; PP-50, 0.132±0.003 OD; and PP-100, 0.171±0.02 OD) was found significantly higher (p<0.05) compared to fish did not receive medicated feed (0.00 OD). Whereas, percentage cumulative mortality of fish from all groups of fish received medicated feed (PP-25, 18.0±3.2%; PP-50, 18.2±2.8%; and PP-100, 17.7±1.8%) were found significantly lower (p<0.05) compared to a group of fish did not receive medicated feed (83.2±1.4%). Conclusion: The findings of the present study indicated the huge potential of P. pellucida leaf extract as natural immunostimulator agent for aquaculture uses. PMID:27057104
Lee, S W; Sim, K Y; Wendy, W; Zulhisyam, A K
2016-03-01
This study was revealed the potential of Peperomia pellucida leaf extract as an immunostimulator agent in controlling motile aeromonad septicemia due to Aeromonas hydrophila in red hybrid tilapia, Oreochromis sp. In the present study, minimum inhibitory concentration (MIC) of P. pellucida leaf extract against A. hydrophila was determined through two-fold microbroth dilution method. The plant extract was screening for its active compound using a gas chromatograph mass spectrometer, and the effectiveness of P. pellucida leaf extract as an immunostimulator agent was evaluated. The experimental fish were fed with medicated feed at three different concentrations (25 mg/kg, PP-25; 50 mg/kg, PP-50; and 100 mg/kg, PP-100) of P. pellucida leaf extract for 1 week before they were intraperitoneally exposed to A. hydrophila. Enzyme-linked immunosorbent assay was carried out to determine the value of antibody response to A. hydrophila in fish from a group of fish that received medicated feed, and the percentage of total cumulative mortality of the experimental fish were observed at the end of the experiment. The results showed that the major bioactive compound is phytol (40%), and the MIC value was 31.5 mg/L. The value of antibody response to A. hydrophila in fish from a group of fish which received medicated feed (PP-25, 0.128±0.014 optical density [OD]; PP-50, 0.132±0.003 OD; and PP-100, 0.171±0.02 OD) was found significantly higher (p<0.05) compared to fish did not receive medicated feed (0.00 OD). Whereas, percentage cumulative mortality of fish from all groups of fish received medicated feed (PP-25, 18.0±3.2%; PP-50, 18.2±2.8%; and PP-100, 17.7±1.8%) were found significantly lower (p<0.05) compared to a group of fish did not receive medicated feed (83.2±1.4%). The findings of the present study indicated the huge potential of P. pellucida leaf extract as natural immunostimulator agent for aquaculture uses.
Loc, Nguyen Hoang; Bach, Nguyen Hoang; Kim, Tae-Geum; Yang, Moon-Sik
2010-07-01
The B subunit of Escherichia coli heat-labile enterotoxin (LTB), a non-toxic molecule with potent biological properties, is a powerful mucosal and parenteral adjuvant that induces a strong immune response against co-administered or coupled antigens. We synthesized a gene encoding the LTB adapted to the optimized coding sequences in plants and fused to the endoplasmic reticulum retention signal SEKDEL to enhance its expression level and protein assembly in plants. The synthetic LTB gene was located into a plant expression vector under the control of CaMV 35S promoter and was introduced into Peperomia pellucida by biolistic transformation method. The integration of synthetic LTB gene into genomic DNA of transgenic plants was confirmed by genomic DNA PCR amplification method. The assembly of plant-produced LTB was detected by western blot analysis. The amount of LTB protein produced in transgenic P. pellucida leaves was approximately 0.75% of the total soluble plant protein. Enzyme-linked immunosorbent assay indicated that plant-synthesized LTB protein bound specifically to GM1-ganglioside, which is receptor for LTB on the cell surface, suggesting that the LTB subunits formed biological active pentamers. Copyright 2010 Elsevier Inc. All rights reserved.
Liu, D Y; Johnston, R; Baker, H W
1995-06-01
To determine the ability of spermatozoa to bind to the zona pellucida (ZP) in testosterone-induced oligozoospermia, previously fertile men participating in the World Heath Organization (WHO) male contraceptive trial in Melbourne were studied while oligozoospermic to various degrees. Semen analysis were performed according to WHO methods. One or two ejaculates from each subject were cryopreserved before commencing weekly intramuscular injections of 200 mg testosterone enanthate. The frozen spermatozoa were used as controls for ZP-binding tests of spermatozoa obtained during testosterone-induced oligozoospermia (< 10 x 10(6)/ml) in either the suppression or efficacy (n = 6) and recovery (n = 3) phases. Two other subjects in the recovery phase with normozoospermia were also tested. Human oocytes that failed to fertilized in vitro from infertile patients were used for the sperm-ZP binding test. Control (frozen) spermatozoa were labelled with fluorescein isothiocyanate and test (oligozoospermic semen) spermatozoa were labelled with tetramethylrhodamine B isothiocyanate. A mixture of equal numbers of labelled motile control and test spermatozoa were incubated with 4-6 ZP. There was a significantly (p < 0.01) lower number of spermatozoa bound per ZP in oligozoospermic samples (65 +/- 7, mean +/- SEM) than in controls (80 +/- 7). However, there were still large numbers of spermatozoa bound to the ZP for all the oligozoospermic samples. Five subjects had similar numbers of spermatozoa bound to the ZP for both control and oligozoospermic samples. Overall, the ZP-binding ratio of test and control spermatozoa averaged 0.82 (range 0.51-1.13).(ABSTRACT TRUNCATED AT 250 WORDS)
Diestel, Uschi; Resch, Marcus; Meinhardt, Kathrin; Weiler, Sigrid; Hellmann, Tina V.; Mueller, Thomas D.; Nickel, Joachim; Eichler, Jutta; Muller, Yves A.
2013-01-01
The zona pellucida (ZP) domain is present in extracellular proteins such as the zona pellucida proteins and tectorins and participates in the formation of polymeric protein networks. However, the ZP domain also occurs in the cytokine signaling co-receptor transforming growth factor β (TGF-β) receptor type 3 (TGFR-3, also known as betaglycan) where it contributes to cytokine ligand recognition. Currently it is unclear how the ZP domain architecture enables this dual functionality. Here, we identify a novel major TGF-β-binding site in the FG loop of the C-terminal subdomain of the murine TGFR-3 ZP domain (ZP-C) using protein crystallography, limited proteolysis experiments, surface plasmon resonance measurements and synthetic peptides. In the murine 2.7 Å crystal structure that we are presenting here, the FG-loop is disordered, however, well-ordered in a recently reported homologous rat ZP-C structure. Surprisingly, the adjacent external hydrophobic patch (EHP) segment is registered differently in the rat and murine structures suggesting that this segment only loosely associates with the remaining ZP-C fold. Such a flexible and temporarily-modulated association of the EHP segment with the ZP domain has been proposed to control the polymerization of ZP domain-containing proteins. Our findings suggest that this flexibility also extends to the ZP domain of TGFR-3 and might facilitate co-receptor ligand interaction and presentation via the adjacent FG-loop. This hints that a similar C-terminal region of the ZP domain architecture possibly regulates both the polymerization of extracellular matrix proteins and cytokine ligand recognition of TGFR-3. PMID:23826237
Cysteine-rich secretory proteins (CRISP) and their role in mammalian fertilization.
Cohen, Débora J; Maldera, Julieta A; Weigel Muñoz, Mariana; Ernesto, Juan I; Vasen, Gustavo; Cuasnicu, Patricia S
2011-01-01
Epididymal protein CRISPI is a member of the CRISP (Cysteine-RIch Secretory proteins) family and is involved in sperm-egg fusion through its interaction with complementary sites on the egg surface. Results from our laboratory have shown that this binding ability resides in a 12-amino-acid region corresponding to a highly conserved motif of the CRISP family, named Signature 2 (S2). In addition to this, our results revealed that CRISP1 could also be involved in the previous step of sperm binding to the zona pellucida, identifying a novel role for this protein in fertilization. As another approach to elucidate the participation of CRISP1 in fertilization, a mouse line containing a targeted disruption of CRISP1 was generated. Although CRISP1-deficient mice exhibited normal fertility, CRISP1-defficient sperm presented a decreased level of protein tyrosine phosphorylation during capacitation, and an impaired ability to fertilize both zona-intact and zona-free eggs in vitro, confirming the proposed roles for the protein in fertilization. Evidence obtained in our laboratory indicated that testicular CRISP2 would also be involved in sperm-egg fusion. Competition assays between CRISP1 and CRISP2, as well as the comparison of their corresponding S2 regions, suggest that both proteins bind to common complementary sites in the egg. Together, these results suggest a functional cooperation between CRISP1 and CRISP2 to ensure the success of fertilization.
Hepatitis B Virus S Protein Enhances Sperm Apoptosis and Reduces Sperm Fertilizing Capacity In Vitro
Huang, JiHua; Zhong, Ying; Fang, XiaoWu; Xie, QingDong; Kang, XiangJin; Wu, RiRan; Li, FangZheng; Xu, XiaoQin; Lu, Hui; Xu, Lan; Huang, TianHua
2013-01-01
Objective Studying the impact of Hepatitis B virus S protein (HBs) on early apoptotic events in human spermatozoa and sperm fertilizing capacity. Methodology/Principal Findings Spermatozoa were exposed to HBs (0, 25, 50, 100 µg/ml) for 3 h, and then fluo-4 AM calcium assay, Calcein/Co2+ assay, protein extraction and ELISA, ADP/ATP ratio assay, sperm motility and hyperactivation and sperm-zona pellucida (ZP) binding and ZP-induced acrosome reaction (ZPIAR) tests were performed. The results showed that in the spermatozoa, with increasing concentration of HBs, (1) average cytosolic free Ca2+ concentration ([Ca2+]i) rose; (2) fluorescence intensity of Cal-AM declined; (3) average levels of cytochrome c decreased in mitochondrial fraction and increased in cytosolic fraction; (4) ADP/ATP ratios rose; (5) average rates of total motility and mean hyperactivation declined; (6) average rate of ZPIAR declined. In the above groups the effects of HBs exhibited dose dependency. However, there was no significant difference in the number of sperms bound to ZP between the control and all test groups. Conclusion HBs could induce early events in the apoptotic cascade in human spermatozoa, such as elevation of [Ca2+]i, opening of mitochondrial permeability transition pore (MPTP), release of cytochrome c (cyt c) and increase of ADP/ATP ratio, but exerted a negative impact on sperm fertilizing capacity. PMID:23874723
Dai, Xiaoxin; Lu, Yajuan; Zhang, Mianqun; Miao, Yilong; Zhou, Changyin; Cui, Zhaokang; Xiong, Bo
2017-03-01
What are the underlying mechanisms of the decline in the fertilization ability of post-ovulatory aged oocytes? Melatonin improves the fertilization ability of post-ovulatory aged oocytes by reducing aging-induced reactive oxygen species (ROS) levels and inhibiting apoptosis and by maintaining the levels and localization of the fertilization proteins, ovastacin and Juno. Following ovulation, the quality of mammalian metaphase II oocytes irreversibly deteriorates over time with a concomitant loss of fertilization ability. Melatonin has been found to prevent post-ovulatory oocyte aging and extend the window for optimal fertilization in mice. Mouse oocytes were randomly assigned to three groups and aged in vitro for 0, 6, 12 and 24 h, respectively. Increasing concentrations of melatonin (10-9 M, 10-7 M, 10-5 M and 10-3 M) were added to the 24 h aging group. Sperm binding assays, in-vitro fertilization, immunofluorescent staining and western blotting were performed to investigate key regulators and events during fertilization of post-ovulatory aged mouse oocytes. We found that the actin cap which promotes a cortical granule (CG) free domain is disrupted with a re-distribution of CGs in the subcortex of aged oocytes. Ovastacin, a CG metalloendoprotease, is mis-located and prematurely exocytosed in aged oocytes with subsequent cleavage of the zona pellucida protein ZP2. This disrupts the sperm recognition domain and dramatically reduces the number of sperm binding to the zona pellucida. The abundance of Juno, the sperm receptor on the oocyte membrane, also is reduced in aged oocytes. Exposure of aged oocytes to melatonin significantly elevates in-vitro fertilization rates potentially by rescuing the above age-associated defects of fertilization, and reducing ROS and inhibiting apoptosis. N/A. We explored the mechanisms of the decline in fertilization ability decline in aged mouse oocytes, in vitro but not in vivo. Our findings may contribute to the development a more efficient method, involving melatonin, for improving IVF success rates. This study was supported by the National Natural Science Foundation (31571545) and the Natural Science Foundation of Jiangsu Province (BK20150677). The authors have no conflict of interest to disclose. © The Author 2017. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com
Aagaard, Jan E.; Vacquier, Victor D.; MacCoss, Michael J.; Swanson, Willie J.
2010-01-01
Identifying fertilization molecules is key to our understanding of reproductive biology, yet only a few examples of interacting sperm and egg proteins are known. One of the best characterized comes from the invertebrate archeogastropod abalone (Haliotis spp.), where sperm lysin mediates passage through the protective egg vitelline envelope (VE) by binding to the VE protein vitelline envelope receptor for lysin (VERL). Rapid adaptive divergence of abalone lysin and VERL are an example of positive selection on interacting fertilization proteins contributing to reproductive isolation. Previously, we characterized a subset of the abalone VE proteins that share a structural feature, the zona pellucida (ZP) domain, which is common to VERL and the egg envelopes of vertebrates. Here, we use additional expressed sequence tag sequencing and shotgun proteomics to characterize this family of proteins in the abalone egg VE. We expand 3-fold the number of known ZP domain proteins present within the VE (now 30 in total) and identify a paralog of VERL (vitelline envelope zona pellucida domain protein [VEZP] 14) that contains a putative lysin-binding motif. We find that, like VERL, the divergence of VEZP14 among abalone species is driven by positive selection on the lysin-binding motif alone and that these paralogous egg VE proteins bind a similar set of sperm proteins including a rapidly evolving 18-kDa paralog of lysin, which may mediate sperm–egg fusion. This work identifies an egg coat paralog of VERL under positive selection and the candidate sperm proteins with which it may interact during abalone fertilization. PMID:19767347
Mokánszki, Attila; Molnár, Zsuzsanna; Ujfalusi, Anikó; Balogh, Erzsébet; Bazsáné, Zsuzsa Kassai; Varga, Attila; Jakab, Attila; Oláh, Éva
2012-12-01
Infertile men with low sperm concentration and/or less motile spermatozoa have an increased risk of producing aneuploid spermatozoa. Selecting spermatozoa by hyaluronic acid (HA) binding may reduce genetic risks such as chromosomal rearrangements and numerical aberrations. Fluorescence in-situ hybridization (FISH) has been used to evaluate the presence of aneuploidies. This study examined spermatozoa of 10 oligozoospermic, 9 asthenozoospermic, 9 oligoasthenozoospermic and 17 normozoospermic men by HA binding and FISH. Mean percentage of HA-bound spermatozoa in the normozoospermic group was 81%, which was significantly higher than in the oligozoospermic (P<0.001), asthenozoospermic (P<0.001) and oligoasthenozoospermic (P<0.001) groups. Disomy of sex chromosomes (P=0.014) and chromosome 17 (P=0.0019), diploidy (P=0.03) and estimated numerical chromosome aberrations (P=0.004) were significantly higher in the oligoasthenozoospermic group compared with the other groups. There were statistically significant relationships (P<0.001) between sperm concentration and HA binding (r=0.658), between sperm concentration and estimated numerical chromosome aberrations (r=-0.668) and between HA binding and estimated numerical chromosome aberrations (r=-0.682). HA binding and aneuploidy studies of spermatozoa in individual cases allow prediction of reproductive prognosis and provision of appropriate genetic counselling. Infertile men with normal karyotypes and low sperm concentrations and/or less motile spermatozoa have significantly increased risks of producing aneuploid (diminished mature) spermatozoa. Selecting spermatozoa by hyaluronic acid (HA) binding, based on a binding between sperm receptors for zona pellucida and HA, may reduce the potential genetic risks such as chromosomal rearrangements and numerical aberrations. In the present study we examined sperm samples of 45 men with different sperm parameters by HA-binding assay and fluorescence in-situ hybridization (FISH). Mean percentage of HA-bound spermatozoa in the normozoospermic group was significantly higher than the oligozoospermic, the asthenozoospermic and the oligoasthenozoospermic groups. Using FISH, disomy of sex chromosomes and chromosome 17, diploidy and estimated numerical chromosome aberration frequencies were significantly higher in the oligoasthenozoospermic group compared with the three other groups. A significant positive correlation was found between the sperm concentration and the HA-binding capacity, and significant negative correlations between the sperm concentration and the estimated numerical chromosomes aberrations as well as between the HA-binding ability and the estimated numerical chromosome aberrations were identified. We conclude that HA-binding assay and sperm aneuploidy study using FISH may help to predict the reproductive ability of selected infertile male patients and to provide appropriate genetic counselling. Crown Copyright © 2012. Published by Elsevier Ltd. All rights reserved.
Dynamic regulation of sperm interactions with the zona pellucida prior to and after fertilisation.
Gadella, B M
2012-01-01
Recent findings have refined our thinking on sperm interactions with the cumulus-oocyte complex (COC) and our understanding of how, at the molecular level, the sperm cell fertilises the oocyte. Proteomic analyses has identified a capacitation-dependent sperm surface reordering that leads to the formation of functional multiprotein complexes involved in zona-cumulus interactions in several mammalian species. During this process, multiple docking of the acrosomal membrane to the plasma membrane takes place. In contrast with the dogma that the acrosome reaction is initiated when spermatozoa bind to the zona pellucida (ZP), it has been established recently that, in mice, the fertilising spermatozoon initiates its acrosome reaction during its voyage through the cumulus before it reaches the ZP. In fact, even acrosome-reacted mouse spermatozoa collected from the perivitelline space can fertilise another ZP-intact oocyte. The oviduct appears to influence the extracellular matrix properties of the spermatozoa as well as the COC. This may influence sperm binding and penetration of the cumulus and ZP, and, in doing so, increase monospermic while decreasing polyspermic fertilisation rates. Structural analysis of the ZP has shed new light on how spermatozoa bind and penetrate this structure and how the cortical reaction blocks sperm-ZP interactions. The current understanding of sperm interactions with the cumulus and ZP layers surrounding the oocyte is reviewed with a special emphasis on the lack of comparative knowledge on this topic in humans, as well as in most farm mammals.
Cysteine protects rabbit spermatozoa against reactive oxygen species-induced damages
Fan, Xiaoteng; Pan, Yang; Lv, Shan; Pan, Chuanying; Lei, Anmin
2017-01-01
The process of cryopreservation results in over-production of reactive oxygen species, which is extremely detrimental to spermatozoa. The aim of this study was to investigate whether addition of cysteine to freezing extender would facilitate the cryosurvival of rabbit spermatozoa, and if so, how cysteine protects spermatozoa from cryodamages. Freshly ejaculated semen was diluted with Tris-citrate-glucose extender supplemented with different concentrations of cysteine. The motility, intact acrosomes, membrane integrity, mitochondrial potentials, 8-hydroxyguanosine level and sperm-zona pellucida binding capacity were examined. Furthermore, glutathione peroxidase (GPx) activity, glutathione content (GSH), and level of reactive oxygen species (ROS) and hydrogen peroxide of spermatozoa were analyzed. The values of motility, intact acrosomes, membrane integrity, mitochondrial potentials and sperm-zona pellucida binding capacity of the frozen-thawed spermatozoa in the treatment of cysteine were significantly higher than those of the control. Addition of cysteine to extenders improved the GPx activity and GSH content of spermatozoa, while lowered the ROS, DNA oxidative alterations and lipid peroxidation level, which makes spermatozoa avoid ROS to attack DNA, the plasma membrane and mitochondria. In conclusion, cysteine protects spermatozoa against ROS-induced damages during cryopreservation and post-thaw incubation. Addition of cysteine is recommended to facilitate the improvement of semen preservation for the rabbit breeding industry. PMID:28700739
Reza, Mohammad; Motlagh, Safari
2015-07-01
Echinochloa spp. are the most important weeds in rice fields. In this research Curvularia lunata and Alternaria pellucida were isolated from these weeds and their pathogenicity effects were compared on these weeds and five rice cultivars in a completely random design with three replications in greenhouse conditions. Fungi were inoculated on weeds and rice cultivars, using spore suspension consisting of 10' spore ml(-1) of distilled water. Results indicated significant effect of Curvularia lunata and Alternaria pellucida on Echinochloa oryzicola and E. crus-galli. In the present study, effect of C. lunata on fresh weight, dry weight and height of Echinochloa species based on variance analysis table, a significant reaction was observed for height and fresh weight, but for dry weight reaction was not significant. The effect of A. pellucida on fresh weight, dry weight and height of Echinochloa species based on variance analysis table, a significant reaction was observed for all the three traits. Also, rice cultivars did not show any significant reaction to C. lunata and A. pellucida. The results showed that in comparison between effect of Curvularia lunata and Alternaria pellucida on Echinochloa spp., disease rating caused by A. pellucida on E. oryzicola and E. crusalli was more than disease rating caused by C. lunata and these species of weed were more susceptible to A. pellucida. However, A. alternata can be considered as a better promising bioherbicide to control Echinochloa spp.
Intracellular activation of ovastacin mediates pre-fertilization hardening of the zona pellucida.
Körschgen, Hagen; Kuske, Michael; Karmilin, Konstantin; Yiallouros, Irene; Balbach, Melanie; Floehr, Julia; Wachten, Dagmar; Jahnen-Dechent, Willi; Stöcker, Walter
2017-09-01
How and where is pro-ovastacin activated and how does active ovastacin regulate zona pellucida hardening (ZPH) and successful fertilization? Ovastacin is partially active before exocytosis and pre-hardens the zona pellucida (ZP) before fertilization. The metalloproteinase ovastacin is stored in cortical granules, it cleaves zona pellucida protein 2 (ZP2) upon fertilization and thereby destroys the ZP sperm ligand and triggers ZPH. Female mice deficient in the extracellular circulating ovastacin-inhibitor fetuin-B are infertile due to pre-mature ZPH. We isolated oocytes from wild-type and ovastacin-deficient (Astlnull) FVB mice before and after fertilization (in vitro and in vivo) and quantified ovastacin activity and cleavage of ZP2 by immunoblot. We assessed ZPH by measuring ZP digestion time using α-chymotrypsin and by determining ZP2 cleavage. We determined cellular distribution of ovastacin by immunofluorescence using domain-specific ovastacin antibodies. Experiments were performed at least in triplicate with a minimum of 20 oocytes. Data were pre-analyzed using Shapiro-Wilk test. In case of normal distribution, significance was determined via two-sided Student's t-test, whereas in case of non-normal distribution via Mann-Whitney U-test. Metaphase II (MII) oocytes contained both inactive pro-ovastacin and activated ovastacin. Immunoblot and ZP digestion assays revealed a partial cleavage of ZP2 even before fertilization in wild-type mice. Partial cleavage coincided with germinal-vesicle breakdown and MII, despite the presence of fetuin-B protein, an endogenous ovastacin inhibitor, in the follicular and oviductal fluid. Upon exocytosis, part of the C-terminal domain of ovastacin remained attached to the plasmalemma, while the N-terminal active ovastacin domain was secreted. This finding may resolve previously conflicting data showing that ovastacin acts both as an oolemmal receptor termed SAS1B (sperm acrosomal SLLP1 binding protein; SLLP, sperm lysozyme like protein) and a secreted protease mediating ZP2 cleavage. For this study, only oocytes isolated from wild-type and ovastacin-deficient FVB mice were investigated. Some experiments involved oocyte activation by the Ca2+ ionophore A23187 to trigger ZPH. This study provides a detailed spatial and temporal view of pre-mature cleavage of ZP2 by ovastacin, which is known to adversely affect IVF rate in mice and humans. None. This work was supported by the Center of Natural Sciences and Medicine and by a start-up grant of the Johannes Gutenberg University Mainz to W.S., and by a grant from Deutsche Forschungsgemeinschaft and by the START program of the Medical Faculty of RWTH Aachen University to J.F. and W.J.D. There are no competing interests to declare. © The Author 2017. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oup.com
Transfer of bovine demi-embryos with and without the zona pellucida.
Warfield, S J; Seidel, G E; Elsden, R P
1987-09-01
Bisected bovine embryos with or without the zona pellucida were transferred to recipients nonsurgically in five field trials. Embryos were collected from superovulated donors 6.5 to 7.5 d after estrus; only embryos of good and excellent quality were bisected. Demi-embryos were transferred either within a zona pellucida, without a zona pellucida, without a zona pellucida, or in the third and fourth trials, without a zona but embedded in 7% gelatin. Pregnancies were diagnosed at 44 to 68 d of gestation. In a preliminary trial, 9/29 zona pellucida-intact demi-embryos developed into fetuses compared with 1/10 zona pellucida-free demi-embryos (P greater than .1). The proportion of zona-free demi-embryos developing to fetuses was not significantly different from the zona-intact group in the second trial either, 24/49 and 5/19, respectively. In trial 3, the proportion of zona pellucida-free demi-embryos developing was 8/25; of zona-enclosed embryos, 29/88; and of zona-free demi-embryos embedded in gelatin, 8/22 (P greater than .1). Similarly, in the fourth trial the rate of development of zona-free demi-embryos to fetuses was 5/12, that of zona-enclosed embryos was 32/81, and that of zona-free demi-embryos embedded in gelatin was 3/12 (P greater than .1). In trial 5, survival of zona-enclosed demi-embryos to fetuses was 40/105, and of zona-free demi-embryos, 46/109 (P greater than .1). Except for trial 2, half of the demi-embryos were twinned, one to each uterine horn; twinning did not significantly affect the proportion developing to fetuses for any of the demi-embryo groups. It is concluded that placing post-compaction demi-embryos into the zona pellucida for transfer does not improve pregnancy rates significantly.
SLXL1, a novel acrosomal protein, interacts with DKKL1 and is involved in fertilization in mice.
Zhuang, Xin-jie; Hou, Xiao-jun; Liao, Shang-Ying; Wang, Xiu-Xia; Cooke, Howard J; Zhang, Ming; Han, Chunsheng
2011-01-01
Spermatogenesis is a complex cellular developmental process which involves diverse families of genes. The Xlr (X-linked, lymphocyte regulated) family includes multiple members, only a few of which have reported functions in meiosis, post-meiotic maturation, and fertilization of germ cells. Slx-like1 (Slxl1) is a member of the Xlr family, whose expression and function in spermatogenesis need to be elucidated. The mRNA and protein expression and localization of Slxl1 were investigated by RT-PCR, Western blotting and immunohistochemistry in different tissues and at different stages of spermatogenesis. The interacting partner of SLXL1 was examined by co-immunoprecipitation and co-localization. Assessment of the role of SLXL1 in capacitation, acrosome reaction, zona pellucida binding/penetration, and fertilization was carried out in vitro using blocking antisera. The results showed that Slxl1 mRNA and protein were specifically expressed in the testis. SLXL1 was exclusively located in the acrosome of post-meiotic germ cells and interacts with DKKL1 (Dickkopf-like1), which is an acrosome-associated protein and plays an important role in fertilization. The rates of zona pellucida binding/penetration and fertilization were significantly reduced by the anti-SLXL1 polyclonal antiserum. SLXL1 is the first identified member of the XLR family that is associated with acrosome and is involved in zona pellucid binding/penetration and subsequent fertilization. These results, together with previous studies, suggest that Xlr family members participate in diverse processes from meiosis to fertilization during spermatogenesis.
Tanihara, Fuminori; Nakai, Michiko; Men, Nguyen Thi; Kato, Noriko; Kaneko, Hiroyuki; Noguchi, Junko; Otoi, Takeshige; Kikuchi, Kazuhiro
2014-04-01
The zona pellucida (ZP) is considered to play important roles in the prevention of polyspermy in mammalian oocytes. However, in pigs we have shown that the presence of the ZP accelerates sperm penetration into the ooplasm during in vitro fertilization (IVF). In the present study, we investigated the effects of the ZP on sperm binding, acrosomal status, and functional exposure of IZUMO, a critical factor involved in sperm-egg fusion, during IVF in pigs. We evaluated the numbers and acrosomal statuses of sperm binding to the ZP and oolemma, and being present in the ZP and perivitelline space (PVS) using ZP-intact and ZP-free oocytes. More sperm bound to the ZP than to the oolemma. The average number of sperm present in the PVS was 0.44-0.51 per oocyte, and all sperm had lost their acrosomes. The proportion of sperm that were immunopositive for anti-IZUMO antibody was significantly higher after they were passing or had passed through the ZP. Furthermore, addition of anti-IZUMO antibody to the fertilization medium significantly inhibited the penetration of sperm into ZP-free oocytes. These results suggest that, in pigs, the ZP induces the acrosome reaction, which is associated with the functional exposure of IZUMO, resulting in completion of fertilization. © 2014 Japanese Society of Animal Science.
DOE Office of Scientific and Technical Information (OSTI.GOV)
East, I.J.; Keenan, A.M.; Larson, S.M.
1984-08-31
The zona pellucida is an extracellular glycocalyx, made of three sulfated glycoproteins, that surrounds mammalian oocytes. Parenterally administered monoclonal antibodies specific for ZP-2, the most abundant zona protein, localize in the zona pellucida. When labeled with iodine-125, these monoclonal antibodies demonstrate a remarkably high target-to-nontarget tissue ratio and provide clear external radioimaging of ovarian tissue.
Louros, Nikolaos N.; Iconomidou, Vassiliki A.; Giannelou, Polina; Hamodrakas, Stavros J.
2013-01-01
Zona pellucida (ZP) is an extracellular matrix surrounding and protecting mammalian and fish oocytes, which is responsible for sperm binding. Mammalian ZP consists of three to four glycoproteins, called ZP1, ZP2, ZP3, ZP4. These proteins polymerize into long interconnected filaments, through a common structural unit, known as the ZP domain, which consists of two domains, ZP-N and ZP-C. ZP is related in function to silkmoth chorion and in an evolutionary fashion to the teleostean fish chorion, also fibrous structures protecting the oocyte and embryo, that both have been proven to be functional amyloids. Two peptides were predicted as ‘aggregation-prone’ by our prediction tool, AMYLPRED, from the sequence of the human ZP1-N domain. Here, we present results from transmission electron microscopy, X-ray diffraction, Congo red staining and attenuated total reflectance Fourier-transform infrared spectroscopy (ATR FT-IR), of two synthetic peptide-analogues of these predicted ‘aggregation-prone’ parts of the human ZP1-N domain, that we consider crucial for ZP protein polymerization, showing that they both self-assemble into amyloid-like fibrils. Based on our experimental data, we propose that human ZP (hZP) might be considered as a novel, putative, natural protective amyloid, in close analogy to silkmoth and teleostean fish chorions. Experiments are in progress to verify this proposal. We also attempt to provide insights into ZP formation, proposing a possible model for hZP1-N domain polymerization. PMID:24069181
Ooi, Der-Jiun; Iqbal, Shahid; Ismail, Maznah
2012-09-17
This study presents the proximate and mineral composition of Peperomia pellucida L., an underexploited weed plant in Malaysia. Proximate analysis was performed using standard AOAC methods and mineral contents were determined using atomic absorption spectrometry. The results indicated Peperomia pellucida to be rich in crude protein, carbohydrate and total ash contents. The high amount of total ash (31.22%)suggests a high-value mineral composition comprising potassium, calcium and iron as the main elements. The present study inferred that Peperomia pellucida would serve as a good source of protein and energy as well as micronutrients in the form of a leafy vegetable for human consumption.
Antibacterial activity of Hygrophila stricta and Peperomia pellucida.
Khan, M R; Omoloso, A D
2002-06-01
The crude methanolic extracts of Hygrophila scricta and Peperomia pellucida were fractionated into petrol, dichloromethane, ethyl acetate and butanol. All the crude extracts and the fractions exhibited a very good level of broad spectrum antibacterial activity. The fractions were more active than the crude extracts. The petrol fraction of H. stricta and the butanol fraction of P. pellucida were particularly good. No activity was noticed for the moulds tested.
Patrat, Catherine; Auer, Jana; Fauque, Patricia; Leandri, Roger L; Jouannet, Pierre; Serres, Catherine
2006-01-01
Background The functions of three zona glycoproteins, ZP1, ZP2 and ZP3 during the sperm-zona pellucida (ZP) interaction are now well established in mice. The expression of an additional zona glycoprotein, ZPB/4, in humans, led us to reconsider the classical mouse model of gamete interaction. We investigated the various functions of human ZP (hZP) during the interaction of spermatozoa with fertilised and unfertilised oocytes. Results The hZP of fertilised oocytes retained their ability to bind sperm (albeit less strongly than that from unfertilised oocytes), to induce an intraspermatic calcium influx through voltage-dependent channels similar to that observed with hZP from unfertilised oocytes and to promote the acrosome reaction at a rate similar to that induced by the ZP of unfertilised oocytes (61.6 ± 6.2% vs60.7 ± 9.1% respectively). Conversely, the rate of hZP penetrated by sperm was much lower for fertilised than for unfertilised oocytes (19% vs 57% respectively, p < 0.01). We investigated the status of ZP2 in the oocytes used in the functional tests, and demonstrated that sperm binding and acrosome reaction induction, but not ZP penetration, occurred whether or not ZP2 was cleaved. Conclusion The change in ZP function induced by fertilisation could be different in human and mouse species. Our results suggest a zona blocking to polyspermy based at the sperm penetration level in humans. PMID:17147816
Bromfield, Elizabeth G; Aitken, R John; Gibb, Zamira; Lambourne, Sarah R; Nixon, Brett
2014-02-01
While IVF has been widely successful in many domesticated species, the development of a robust IVF system for the horse remains an elusive and highly valued goal. A major impediment to the development of equine IVF is the fact that optimised conditions for the capacitation of equine spermatozoa are yet to be developed. Conversely, it is known that stallion spermatozoa are particularly susceptible to damage arising as a consequence of capacitation-like changes induced prematurely in response to semen handling and transport conditions. To address these limitations, this study sought to develop an effective system to both suppress and promote the in vitro capacitation of stallion spermatozoa. Our data indicated that the latter could be achieved in a bicarbonate-rich medium supplemented with a phosphodiesterase inhibitor, a cyclic AMP analogue, and methyl-β-cyclodextrin, an efficient cholesterol-withdrawing agent. The populations of spermatozoa generated under these conditions displayed a number of hallmarks of capacitation, including elevated levels of tyrosine phosphorylation, a reorganisation of the plasma membrane leading to lipid raft coalescence in the peri-acrosomal region of the sperm head, and a dramatic increase in their ability to interact with heterologous bovine zona pellucida (ZP) and undergo agonist-induced acrosomal exocytosis. Furthermore, this functional transformation was effectively suppressed in media devoid of bicarbonate. Collectively, these results highlight the importance of efficient cholesterol removal in priming stallion spermatozoa for ZP binding in vitro.
Survival of sheep demi-embryos in vivo and in vitro.
Shelton, J N; Szell, A
1988-01-01
Sheep embryos (morulae and blastocysts) were bisected either by microscalpel or by microneedle after dissolving the zona pellucida with acidified Tyrode's solution. Fourteen and 11 cryopreserved demi-embryos failed to develop when transferred to recipients or placed in culture, respectively. When fresh demi-embryos were cultured in Dulbecco's phosphate buffered saline (DPBS) plus fetal calf serum (FCS) or Whitten's medium, the survival rate was 26% compared to 68% for whole embryos (P<0.01), and there was a suggestion that the presence of a zona pellucida was beneficial to survival. When two demi-embryos each within a zona pellucida were transferred into each of 10 ewes, six of them lambed to produce a total of eight lambs, including two sets of identical twins. Of 10 ewes receiving two demi-embryos without zonae pellucidae, three lambed to produce a total of four lambs, including one set of identical twins. Of 10 ewes that each received two whole embryos, 10 lambed to produce a total of 16 lambs. There was a suggestion that the zona pellucida might enhance the survival of demi-morulae but not demi-blastocysts.
Morales, P; Vantman, D; Barros, C; Vigil, P
1991-03-01
Several techniques have been used for selecting motile spermatozoa including Percoll and albumin gradients, swim-up, and glass wool filtration. A high yield of motile spermatozoa as well as an enhancement of motility are the most desirable features of a practical method. An equally important consideration is whether or not these techniques select functionally normal spermatozoa. In this study we have compared two methods for separation of motile cells, swim-up and Percoll gradient. Normal semen samples from 12 different men were used in this study. Each sample was simultaneously processed by swim-up and Percoll gradient using modified Tyrode's medium. After the sperm concentration was adjusted to 1 x 10(7) spermatozoa/ml, the suspensions were incubated at 37 degrees C, 5% CO2 in air. In each suspension the percentage of sperm recovery, percentage of motile spermatozoa, percentage of acrosome reacted spermatozoa (either spontaneously or stimulated with human follicular fluid), percentage of zona-free hamster oocytes penetrated, and number of spermatozoa bound to the human zona pellucida were determined. The results obtained indicated that the percentage of sperm recovery was higher with the Percoll gradient than with the swim-up procedure (P less than 0.001). However, no significant differences were found between these two sperm populations in the percentage of motile cells, in the percentage of acrosome reacted spermatozoa, and in the percentage of zona-free hamster oocytes penetrated. In addition, the number of spermatozoa bound per zona pellucida was similar for spermatozoa selected by Percoll or swim-up. We conclude that there were no functional differences between the spermatozoa selected by either method.
Sumigama, Shiho; Mansell, Steven; Miller, Melissa; Lishko, Polina V.; Cherr, Gary N.; Meyers, Stuart A.; Tollner, Theodore
2015-01-01
During transit through the female reproductive tract, mammalian spermatozoa are exposed to increasing concentrations of progesterone (P4) released by the cumulus oophorus. P4 triggers massive calcium influx into human sperm through activation of the sperm-specific calcium channel CatSper. These properties of human spermatozoa are thought to be unique since CatSper is not progesterone sensitive in rodent sperm. Here, by performing patch clamp recording from spermatozoa from rhesus macaque for the first time, we report that they express P4-sensitive CatSper channel identically to human sperm and react to P4 by inducing responsiveness to zona pellucida, unlike human sperm, which respond directly to P4. We have also determined the physiologic levels of P4 capable of inducing capacitation-associated changes in macaque sperm. Progesterone (1 μM) induced up to a 3-fold increase in the percentage of sperm undergoing the zona pellucida-induced acrosome reaction with the lowest threshold as low as 10 nM of P4. Submicromolar levels of P4 induced a dose-dependent increase in curvilinear velocity and lateral head displacement, while sperm protein tyrosine phosphorylation was not altered. Macaque spermatozoa exposed to 10 μM of P4 developed fully hyperactivated motility. Similar to human sperm, on approaching cumulus mass and binding to zona pellucida, macaque spermatozoa display hyperactivation and undergo an acrosome reaction that coincides with the rise in the sperm intracellular calcium. Taken together, these data indicate that P4 accelerates the completion of capacitation and provides evidence of spermatozoa “priming” as they move into a gradient of progesterone in search for the oocyte. PMID:26490839
A structural view of egg coat architecture and function in fertilization.
Monné, Magnus; Jovine, Luca
2011-10-01
Species-restricted interaction between gametes at the beginning of fertilization is mediated by the extracellular coat of the egg, a matrix of cross-linked glycoprotein filaments called the zona pellucida (ZP) in mammals and the vitelline envelope in nonmammals. All egg coat subunits contain a conserved protein-protein interaction module-the "ZP domain"-that allows them to polymerize upon dissociation of a C-terminal propeptide containing an external hydrophobic patch (EHP). Recently, the first crystal structures of a ZP domain protein, sperm receptor ZP subunit zona pellucida glycoprotein 3 (ZP3), have been reported, giving a glimpse of the structural organization of the ZP at the atomic level and the molecular basis of gamete recognition in vertebrates. The ZP module is divided in two related immunoglobulin-like domains, ZP-N and ZP-C, that contain characteristic disulfide bond patterns and, in the case of ZP-C, also incorporate the EHP. This segment lies at the interface between the two domains, which are connected by a long loop carrying a conserved O-glycan important for binding to sperm in vitro. The structures explain several apparently contradictory observations by reconciling the variable disulfide bond patterns found in different homologues of ZP3 as well as the multiple ZP3 determinants alternatively involved in gamete interaction. These findings have implications for our understanding of ZP subunit biogenesis; egg coat assembly, architecture, and interaction with sperm; structural rearrangements leading to postfertilization hardening of the ZP and the block to sperm binding; and the evolutionary origin of egg coats.
[Molecules involved in sperm-zona pellucida interaction in mammals. Role in human fertility].
Serres, Catherine; Auer, Jana; Petit, François; Patrat, Catherine; Jouannet, Pierre
2008-01-01
Fertilization in mammals requires an initial interaction of sperm with the oocyte envelope, the zona pellucida (ZP), before it reaches the oocyte. ZP is a highly glycosylated structure, composed of three (mouse) or four (rabbit, boar, bovine, humans...) glycoproteins. The presence of ZP around the oocyte does not allow heterospecific fertilization. This barrier is principally due to the presence of species-specific glycosylations on ZP proteins. Sperm bind ZP by means of membrane receptors which recognize carbohydrate moieties on ZP glycoproteins according to a well-precised sequential process. Upon initial attachment, spermatozoa bind ZP3/ZP4 which induces the sperm acrosome exocytosis followed by a secondary binding of acrosome reacted spermatozoa to ZP2 and by ZP penetration. The sperm receptors are adhesive proteins or integral plasma membrane proteins linked to intraspermatic signalling pathways activating the acrosome reaction. Over the last twenty years, numerous studies have been carried out to identify sperm receptors to ZP in several species, but the data in humans are still incomplete. Work initiated in our research group has identified several proteins interacting with recombinant human ZP2, ZP3 and ZP4, among which are glycolytic enzymes. These enzymes are involved in the gamete interaction by means of their affinity to sugars and not by their catalytic properties. From a clinical point of view, an observed lack or weak expression of some sperm receptors to ZP3 in cases of idiopathic infertility associated with in vitro fertilization failure suggests that knowing the molecular mechanism driving the gamete recognition can be important at the diagnostic level. Furthermore, it has been shown that proteins that mediate gamete recognition diverge rapidly, as a result of positive darwinian selection. A sexual conflict can drive co-evolution of reproductive molecules in both sexes resulting in reproductive isolation and species emergence.
Sulfogalactosylglycerolipid is involved in human gamete interaction.
Weerachatyanukul, W; Rattanachaiyanont, M; Carmona, E; Furimsky, A; Mai, A; Shoushtarian, A; Sirichotiyakul, S; Ballakier, H; Leader, A; Tanphaichitr, N
2001-12-01
Recent results from our laboratory have revealed the role of sulfogalactosylglycerolipid (SGG) in mouse sperm-zona pellucida (ZP) binding. In this report, we demonstrated the presence of SGG in Percoll-gradient centrifuged (PGC) human sperm by high performance thin layer chromatography with orcinol and Azure A staining, specific for glycolipids and sulfolipids, respectively. SGG in human PGC sperm was quantified by its affinity to Azure A to be 12-15 mol% of sperm lipids. Indirect immunofluorescence revealed that SGG existed on both live and aldehyde fixed human sperm in the head region. Pretreatment of human PGC sperm with affinity purified antiSGG Fab markedly inhibited sperm binding to the ZP in a concentration dependent manner, without any changes in the spontaneous acrosome rate or sperm motility parameters. Fluorescently labeled SGG liposomes also bound uniformly to isolated human ZP, while fluorescently labeled galactosylglycerolipid (GG, SGG's parental lipid) or phosphatidylserine (PS, negatively charged like SGG) liposomes did not. All of these results suggested the role of human sperm SGG in ZP binding. Copyright 2001 Wiley-Liss, Inc.
Cowan, A E; Myles, D G; Koppel, D E
1991-03-01
The redistribution of membrane proteins on the surface of cells is a prevalent feature of differentiation in a variety of cells. In most cases the mechanism responsible for such redistribution is poorly understood. Two potential mechanisms for the redistribution of surface proteins are: (1) passive diffusion coupled with trapping, and (2) active translocation. We have studied the process of membrane protein redistribution for the PH-20 protein of guinea pig sperm, a surface protein required for sperm binding to the egg zona pellucida (P. Primakoff, H. Hyatt, and D. G. Myles (1985). J. Cell Biol. 101, 2239-2244). PH-20 protein is localized to the posterior head plasma menbrane of the mature sperm cell. Following the exocytotic acrosome reaction, PH-20 protein moves into the newly incorporated inner acrosomal membrane (IAM), placing it in a position favorable for a role in binding sperm to the egg zona pellucida (D. G. Myles, and P. Primakoff (1984), J. Cell Biol. 99, 1634-1641). To analyze the mechanistic basis for this protein migration, we have used fluorescence microscopy and digital image processing to characterize PH-20 protein migration in individual cells. PH-20 protein was observed to move against a concentration gradient in the posterior head plasma membrane. This result argues strongly against a model of passive diffusion followed by trapping in the IAM, and instead suggests that an active process serves to concentrate PH-20 protein toward the boundary separating the posterior head and IAM regions. A transient gradient of PH-20 concentration observed in the IAM suggests that once PH-20 protein reaches the IAM, it is freely diffusing. Additionally, we observed that migration of PH-20 protein was calcium dependent.
Liu, De Yi; Liu, Ming Li; Garrett, Claire; Baker, H W Gordon
2007-07-01
The aim of this study was to compare the frequency of defective sperm-zona pellucida (ZP) binding (DSZPB) and defective ZP-induced acrosome reaction (DZPIAR) in subfertile men (i.e. male partners of infertile couples) with normal and abnormal semen analyses. A total of 1030 subfertile men with normal semen analysis (n=255), oligozoospermia (count<20x10(6)/ml, n=136), severe teratozoospermia (strict normal morphology
NASA Astrophysics Data System (ADS)
Hastuti, Utami Sri; Ummah, Yunita Putri Irsadul; Khasanah, Henny Nurul
2017-05-01
This research was done to 1) examine the effect of Piper aduncum leaf ethanol extract at certain concentrations against Candida albicans colony growth inhibition in vitro; 2) examine the effect of Peperomia pellucida leaf ethanol extract at certain concentrations toward Candida albicans colony growth inhibition in vitro; and 3) determine the most effective concentration of P. aduncum and P. pellucida leaves ethanol extract against C. albicans colony growth inhibition in vitro. These plant extracts were prepared by the maceration technique using 95% ethanol, and then sterile filtered and evaporated to obtain the filtrate. The filtrate was diluted with sterile distilled water at certain concentrations, i.e.: 0%, 10%, 20%, 30%, 405, 50%, 60%, 70%, 80%, and 90%. The antifungal effect of each leaf extract concentration was examined by the agar diffusion method on Sabouraud Dextrose Agar medium. The research results are: 1) the P.aduncum leaf ethanol extract at some concentrations has an effect against C. albicans colony growth inhibition in vitro; 2) the P.pellucida leaf ethanol extract at some concentrations has an effect against C. albicans colony growth inhibition in vitro; 3) the P. aduncum leaf ethanol extract at 80% is the most effective for C. albicans colony growth inhibition in vitro; and 4) the P. pellucida leaf ethanol extract at 70% is the most effective for C. albicans colony growth inhibition in vitro.
Florman, H M; First, N L
1988-08-01
The effects of accessory sex gland secretions on the zona pellucida-induced acrosome reaction of bovine spermatozoa were investigated. Soluble extracts of zonae pellucidae initiated exocytosis in ejaculated spermatozoa. This process had an ED50 of 20 ng/microliter zona pellucida protein and saturated at 50 ng/microliter (Florman and First, 1988. Dev. Biol. 128, 453-463). In epididymal sperm this dose-response relationship was shifted toward greater agonist concentrations by at least a factor of 10(3). Reconstitution of high potency agonist response was achieved in vitro by incubation of epididymal sperm with bovine seminal plasma. Reconstitution was dependent on the seminal plasma protein concentration. The ED50 of this process was 62 micrograms protein/10(8) sperm and saturation was observed with 124 micrograms protein/10(8) sperm. Agonist responses in reconstituted epididymal sperm and in ejaculated sperm were indistinguishable with regard to dependence on the zona pellucida protein concentration and the kinetics of induced acrosome reactions. Kinetic studies suggest that reconstitution is due to adsorption of regulatory factors from seminal plasma. In addition to the positive regulatory elements responsible for reconstituting activity, seminal plasma also contains negative regulatory elements which inhibit agonist response. These negative factors are inactivated during sperm capacitation, permitting the expression of positive regulators. Acting together, these regulatory elements could coordinate high affinity agonist response with the availability of eggs in vivo.
Seed germination, phenology, and antiedematogenic activity of Peperomia pellucida (L.) H. B. K.
Arrigoni-Blank, Maria de Fátima; Oliveira, Ricardo Luiz Barros; Mendes, Sandra Santos; Silva, Paulo de Albuquerque; Antoniolli, Ângelo Roberto; Vilar, Jeane Carvalho; Cavalcanti, Sócrates Cabral de Holanda; Blank, Arie Fitzgerald
2002-01-01
Background Peperomia pellucida is popularly known as coraçãozinho in the Brazilian northeast and is used in the treatment of abscesses, furuncles, and conjunctivitis. Our work aimed to determine the term of the development stages and the species cycle in the four seasons of the year (complete development, beginning of bloom, complete bloom, and seed set), verifying the plant's therapeutic profile during the four distinct development phases in order to detect differences in its potency. Pharmacological tests were performed to observe the anti-inflammatory activity. Results Phenological observations were accessed for a 12 month-period, from the Brazilian summer of 1999/2000 to fall 2000. On average the plantules' emergence occurred 15 days after seeding. All plantules grew in a similar manner up to 25 days after transplantation in all seasons. Starting on the 25th day, we observed faster growth during spring, with plants reaching a height of about 60 cm after 100 days of transplantation, unlike other seasons, in which plants reached heights of 40, 40, and 35 cm during winter, summer, and fall, respectively. The P. pellucida aqueous extract showed significant anti-inflammatory activity during phenophases 1 and 2 of winter and spring. Depending on the plant's phenophase there was variation in the potency of edema inhibition. Conclusion P. pellucida has a phenological cycle of approximately 100 days. It is recommended that the P. pellucida aqueous extract is used as an antiedematogenic only during phenophases 1 and 2 of winter and spring. PMID:12019026
Seed germination, phenology, and antiedematogenic activity of Peperomia pellucida (L.) H. B. K.
Arrigoni-Blank, Maria de Fátima; Oliveira, Ricardo Luiz Barros; Mendes, Sandra Santos; Silva, Paulo de Albuquerque; Antoniolli, Angelo Roberto; Vilar, Jeane Carvalho; Cavalcanti, Sócrates Cabral de Holanda; Blank, Arie Fitzgerald
2002-05-09
Peperomia pellucida is popularly known as coraçãozinho in the Brazilian northeast and is used in the treatment of abscesses, furuncles, and conjunctivitis. Our work aimed to determine the term of the development stages and the species cycle in the four seasons of the year (complete development, beginning of bloom, complete bloom, and seed set), verifying the plant's therapeutic profile during the four distinct development phases in order to detect differences in its potency. Pharmacological tests were performed to observe the anti-inflammatory activity. Phenological observations were accessed for a 12 month-period, from the Brazilian summer of 1999/2000 to fall 2000. On average the plantules' emergence occurred 15 days after seeding. All plantules grew in a similar manner up to 25 days after transplantation in all seasons. Starting on the 25th day, we observed faster growth during spring, with plants reaching a height of about 60 cm after 100 days of transplantation, unlike other seasons, in which plants reached heights of 40, 40, and 35 cm during winter, summer, and fall, respectively. The P. pellucida aqueous extract showed significant anti-inflammatory activity during phenophases 1 and 2 of winter and spring. Depending on the plant's phenophase there was variation in the potency of edema inhibition. P. pellucida has a phenological cycle of approximately 100 days. It is recommended that the P. pellucida aqueous extract is used as an antiedematogenic only during phenophases 1 and 2 of winter and spring.
Wang, Ying; Li, Yijie; Zhang, Beibei; Zhang, Fuchun
2018-05-11
Stray dogs are the reservoirs and carriers of rabies and are definitive hosts of echinococcosis. To control the overpopulation of stray dogs, zona pellucida 3 (ZP3), a primary receptor for sperm, is a potential antigen for developing contraceptive vaccines. To enhance the immune responses and contraceptive effects of canine ZP3 (cZP3), dog gonadotropin-releasing hormone (GnRH) and a T cell epitope of chicken ovalbumin (OVA) were selected to construct two fusion proteins with cZP3, ovalbumin-GnRH-ZP3 (OGZ) and ovalbumin-ZP3 (OZ), and their contraceptive effects were evaluated in mice. The synthesized DNA sequences of OGZ and OZ were cloned into plasmid pET-28a respectively. The fusion proteins OGZ and OZ were identified by SDS-PAGE and Western blot. Mice were immunized with OGZ, OZ and cZP3, and the infertility rates were monitored. Mice immunized with mouse ZP3 (mZP3) or adjuvant alone were used as positive control and negative control, respectively. cZP3- and GnRH-specific antibodies (Abs) were detected by ELISA. The bindings of the Abs to oocytes were detected by indirect immunofluorescence assay. The paraffin sections of mice ovaries were observed under microscope for analyzing pathological characteristics. SDS-PAGE and Western blot analyses showed that the two fusion proteins OGZ and OZ were correctly expressed. ELISA results showed that OGZ vaccine induced both cZP3- and GnRH-specific Abs, and OZ vaccine induced cZP3-specific Ab, which lasted for up to 168 days. The levels of follicle stimulating hormone (FSH) and estradiol (E2) in sera were significantly decreased in OGZ immunized mice. Indirect immunofluorescence results showed that Abs induced by cZP3 and mZP3 could bind to the mouse ZP and dog ZP each other. Compared with the adjuvant group, all vaccine immunized groups significantly decreased the fertility rate and mean litter size. Interestingly, the fertility rate in OGZ-immunized group is the lowest, and only 1 mouse out of 10 mice is fertile. Histological analysis of murine ovarian sections indicated that most of the infertile mice in the immunized groups lacked mature follicles as well as accompanied by inflammatory infiltration. Meanwhile, immunization with OGZ decreased the number of corpora lutea in the infertile mice. The fusion protein OGZ resulted in the lowest fertility rate and the least mean litter size in the immunized mice. OGZ might be a promising antigen for developing a new contraceptive vaccine for stray dog controlling.
Impaired sperm fertilizing ability in mice lacking Cysteine-RIch Secretory Protein 1 (CRISP1)
Da Ros, Vanina G.; Maldera, Julieta A.; Willis, William D.; Cohen, Débora J.; Goulding, Eugenia H.; Gelman, Diego M.; Rubinstein, Marcelo; Eddy, Edward M.; Cuasnicu, Patricia S.
2008-01-01
Mammalian fertilization is a complex multi-step process mediated by different molecules present on both gametes. Epididymal protein CRISP1, a member of the Cysteine-RIch Secretory Protein (CRISP) family, was identified by our laboratory and postulated to participate in both sperm-zona pellucida (ZP) interaction and gamete fusion by binding to egg-complementary sites. To elucidate the functional role of CRISP1 in vivo, we disrupted the Crisp1 gene and evaluated the effect on animal fertility and several sperm parameters. Male and female Crisp1−/− animals exhibited no differences in fertility compared to controls. Sperm motility and the ability to undergo a spontaneous or progesterone-induced acrosome reaction were neither affected in Crisp1−/− mice. However, the level of protein tyrosine phosphorylation during capacitation was clearly lower in mutant sperm than in controls. In vitro fertilization assays showed that Crisp1−/− sperm also exhibited a significantly reduced ability to penetrate both ZP-intact and ZP-free eggs. Moreover, when ZP-free eggs were simultaneously inseminated with Crisp1+/+ and Crisp1−/− sperm in a competition assay, the mutant sperm exhibited a greater disadvantage in their fusion ability. Finally, the finding that the fusion ability of Crisp1−/− sperm was further inhibited by the presence of CRISP1 or CRISP2 during gamete co-incubation, supports that another CRISP cooperates with CRISP1 during fertilization and might compensate for its lack in the mutant mice. Together, these results indicate that CRISP proteins are players in the mammalian fertilization process. To our knowledge this is the first knockout mice generated for a CRISP protein. The information obtained might have important functional implications for other members of the widely distributed and evolutionarily conserved CRISP family. PMID:18571638
Anti-inflammatory and analgesic activity of Peperomia pellucida (L.) HBK (Piperaceae).
de Fátima Arrigoni-Blank, Maria; Dmitrieva, Elena G; Franzotti, Elaine Maria; Antoniolli, Angelo Roberto; Andrade, Márcio Roberto; Marchioro, Murilo
2004-04-01
An aqueous extract of the aerial part of Peperomia pellucida (L.) HBK (Piperaceae) was tested for anti-inflammatory (paw edema induced by carrageenin and arachidonic acid) and analgesic activity (abdominal writhes and hot plate) in rats and mice, respectively. Oral administration of 200 and 400 mg/kg of the aqueous extract exhibited an anti-inflammatory activity in the carrageenin test, which was based on interference with prostaglandin synthesis, as confirmed by the arachidonic acid test. In the abdominal writhing test induced by acetic acid, 400 mg/kg of the plant extract had the highest analgesic activity, whereas in the hot-plate test the best dose was 100 mg/kg. The LD(50) showed that Peperomia pellucida (5000 mg/kg) presented low toxicity.
A role for carbohydrate recognition in mammalian sperm-egg binding
DOE Office of Scientific and Technical Information (OSTI.GOV)
Clark, Gary F., E-mail: clarkgf@health.missouri.edu
Highlights: • Mammalian sperm-egg binding as a carbohydrate dependent species recognition event. • The role of carbohydrate recognition in human, mouse and pig sperm-egg binding. • Historical perspective and future directions for research focused on gamete binding. - Abstract: Mammalian fertilization usually requires three sequential cell–cell interactions: (i) initial binding of sperm to the specialized extracellular matrix coating the egg known as the zona pellucida (ZP); (ii) binding of sperm to the ZP via the inner acrosomal membrane that is exposed following the induction of acrosomal exocytosis; and (iii) adhesion of acrosome-reacted sperm to the plasma membrane of the eggmore » cell, enabling subsequent fusion of these gametes. The focus of this review is on the initial binding of intact sperm to the mammalian ZP. Evidence collected over the past fifty years has confirmed that this interaction relies primarily on the recognition of carbohydrate sequences presented on the ZP by lectin-like egg binding proteins located on the plasma membrane of sperm. There is also evidence that the same carbohydrate sequences that mediate binding also function as ligands for lectins on lymphocytes that can inactivate immune responses, likely protecting the egg and the developing embryo up to the stage of blastocyst hatching. The literature related to initial sperm-ZP binding in the three major mammalian models (human, mouse and pig) is discussed. Historical perspectives and future directions for research related to this aspect of gamete adhesion are also presented.« less
Scarpeci, Sonia L; Sanchez, Mercedes L; Cabada, Marcelo O
2008-04-01
The egg envelope is an extracellular matrix that surrounds oocytes. In frogs and mammals, a prominent feature of envelope modification following fertilization is the N-terminal proteolysis of the envelope glycoproteins, ZPA [ZP (zona pellucida) A]. It was proposed that ZPA N-terminal proteolysis leads to a conformational change in egg envelope glycoproteins, resulting in the prevention of polyspermy. Bufo arenarum VE (vitelline envelope) is made up of at least four glycoproteins: gp120 (glycoprotein 120), gp75, gp41 and gp38. The aim of the present study was to identify and characterize the baZPA (B. arenarum ZPA homologue). Also, our aim was to evaluate its integrity and functional significance during fertilization. VE components were labelled with FITC in order to study their sperm-binding capacity. The assay showed that gp75, gp41 and gp38 possess sperm-binding activity. We obtained a full-length cDNA of 2062 bp containing one ORF (open reading frame) with a sequence for 687 amino acids. The predicted amino acid sequence had close similarity to that of mammalian ZPA. This result indicates that gp75 is the baZPA. Antibodies raised against an N-terminal sequence recognized baZPA and inhibited sperm-baZPA extracted from VE binding. This protein does not induce the acrosome reaction in homologue sperm. Northern-blot studies indicated that the transcript is exclusively expressed in the ovary. In situ hybridization studies confirmed this and pointed to previtellogenic oocytes and follicle cells surrounding the oocyte as the source of the transcript. baZPA was cleaved during fertilization and the N-terminal peptide fragment remained disulfide bonded to the glycoprotein moiety following proteolysis. From the sequence analysis, it was possible to consider that gp75 is the baZPA. It is expressed by previtellogenic oocytes and follicle cells. Also, it can be considered as a sperm receptor that undergoes N-terminal proteolysis during fertilization. The N-terminal peptide could be necessary for sperm binding.
Ligtenberg, Antoon J M; Karlsson, Niclas G; Veerman, Enno C I
2010-01-01
Deleted in Malignant Brain Tumors-1 protein (DMBT1), salivary agglutinin (DMBT1(SAG)), and lung glycoprotein-340 (DMBT1(GP340)) are three names for glycoproteins encoded by the same DMBT1 gene. All these proteins belong to the scavenger receptor cysteine-rich (SRCR) superfamily of proteins: a superfamily of secreted or membrane-bound proteins with SRCR domains that are highly conserved down to sponges, the most ancient metazoa. In addition to SRCR domains, all DMBT1s contain two CUB domains and one zona pellucida domain. The SRCR domains play a role in the function of DMBT1s, which is the binding of a broad range of pathogens including cariogenic streptococci, Helicobacter pylori and HIV. Mucosal defense proteins like IgA, surfactant proteins and lactoferrin also bind to DMBT1s through their SRCR domains. The binding motif on the SRCR domains comprises an 11-mer peptide in which a few amino acids are essential for binding (GRVEVLYRGSW). Adjacent to each individual SRCR domain are glycosylation domains, where the attached carbohydrate chains play a role in the binding of influenza A virus and Helicobacter pylori. The composition of the carbohydrate chains is not only donor specific, but also varies between different organs. These data demonstrate a role for DMBT1s as pattern recognition molecules containing various peptide and carbohydrate binding motifs.
Jin, Mayuko; Fujiwara, Eiji; Kakiuchi, Yasutaka; Okabe, Masaru; Satouh, Yuhkoh; Baba, Shoji A.; Chiba, Kazuyoshi; Hirohashi, Noritaka
2011-01-01
To fuse with oocytes, spermatozoa of eutherian mammals must pass through extracellular coats, the cumulus cell layer, and the zona pellucida (ZP). It is generally believed that the acrosome reaction (AR) of spermatozoa, essential for zona penetration and fusion with oocytes, is triggered by sperm contact with the zona pellucida. Therefore, in most previous studies of sperm–oocyte interactions in the mouse, the cumulus has been removed before insemination to facilitate the examination of sperm–zona interactions. We used transgenic mouse spermatozoa, which enabled us to detect the onset of the acrosome reaction using fluorescence microscopy. We found that the spermatozoa that began the acrosome reaction before reaching the zona were able to penetrate the zona and fused with the oocyte's plasma membrane. In fact, most fertilizing spermatozoa underwent the acrosome reaction before reaching the zona pellucida of cumulus-enclosed oocytes, at least under the experimental conditions we used. The incidence of in vitro fertilization of cumulus-free oocytes was increased by coincubating oocytes with cumulus cells, suggesting an important role for cumulus cells and their matrix in natural fertilization. PMID:21383182
Thermal effects in laser-assisted pre-embryo zona drilling
NASA Astrophysics Data System (ADS)
Douglas-Hamilton, Diarmaid H.; Conia, Jerome D.
2001-04-01
Diode lasers ((lambda) equals 1480 nm) are used with in vitro fertilization to dissect the zone pellucida (shell) of pre- embryos. A focused laser beam is applied in vitro to form a channel or trench in the zona pellucida. The procedure is used to facilitate biopsy or as a promoter of embryo hatching. We present examples and measurements of zona pellucida ablation using animal models. In using the laser it is vital not to damage pre-embryo cells, e.g., by overheating. In order to define safe regimes we have derived some thermal side effects of zona pellucida removal. The temperature profile in the beam and vicinity is predicted as function of laser pulse duration and power. In a crossed- beam experiment a HeNe laser probe is used to detect the temperature-induced change in the refractive index of an aqueous solution, and estimate local thermal gradient. We find that the diode laser beam produces superheated water approaching 200 degree(s)C on the beam axis. Thermal histories during and following the laser pulse are given for regions in the neighborhood of the beam. We conclude that an optimum regime exists with pulse duration
Hernández-Pichardo, J E; Ducolomb, Y; Romo, S; Kjelland, M E; Fierro, R; Casillas, F; Betancourt, M
2016-01-01
In order to improve ICSI, appropiate sperm selection and oocyte activation is necessary. The objective of the present study was to determine the efficiency of fertilization using ICSI with chemically activated ovine oocytes and sperm selected by swim up (SU) or swim up + zona pellucida (SU + ZP) binding. Experiment 1, 4-20 replicates with total 821 in vitro matured oocytes were chemically activated with ethanol, calcium ionophore or ionomycin, to determine oocyte activation (precense of one PN). Treatments showed similar results (54, 47, 42 %, respectively) but statistically differents ( P < 0.05) than mechanical activated oocytes in sham, ICSI and sham injection (13, 25, 32 %, respectively) (10-17 replicates; n = 429). Experiment 2: Twelve ejaculates and 28 straws of semen were used (11-19 replicates). Sperm were selected by SU in BSA-TCM 199-H medium. A total of 2,294 fresh sperm and 2,760 from frozen-thawed semen were analyzed after SU or SU + ZP binding. Fresh sperm selected by SU showed acrosome reaction (AR) of 59 %, the sperm selected by SU + ZP binding increased AR to 91 %. In comparison, the AR of frozen-thawed sperm using SU or SU + ZP binding was 77 and 86 %, respectively ( P < 0.05). Experiment 3: fertilization in 200 mechanical activativated oocytes (17 replicates) was 4 %, but fertilization increased in ethanol activated oocytes after ICSI (12-28 %) (5-6 replicates). When fresh sperm only selected by SU were injected to 123 oocytes, a fertilization rate (28 %) was achieved; in sperm selected by SU + ZP was 25 % (73 oocytes). In comparison, in frozen-thawed sperm selected by SU, fertilization was 13 % (70 oocytes), whereas sperm from SU + ZP binding displayed 12 % (51 oocytes) ( P > 0.05). Chemical activation induces higher ovine oocyte activation than mechanical activation. Ethanol slightly displays higher oocyte activation than calcium ionophore and ionomicine. Sperm selection with SU + ZP increased AR/A and AR/D rates in comparison with SU in fresh and frozen-thawed sperm. According to this, in terms of fertilization rates, chemical activation after ICSI increased oocyte PN formation compared to mechanical activation. Also, fresh sperm treated with SU and SU + ZP were significantly different than frozen-thawed sperm, but between sperm treatments no significant differences were obtained.
Ultrastructural Interactions and Genotoxicity Assay of Cerium Dioxide Nanoparticles on Mouse Oocytes
Courbiere, Blandine; Auffan, Mélanie; Rollais, Raphaël; Tassistro, Virginie; Bonnefoy, Aurélie; Botta, Alain; Rose, Jérôme; Orsière, Thierry; Perrin, Jeanne
2013-01-01
Cerium dioxide nanoparticles (CeO2 ENPs) are on the priority list of nanomaterials requiring evaluation. We performed in vitro assays on mature mouse oocytes incubated with CeO2 ENPs to study (1) physicochemical biotransformation of ENPs in culture medium; (2) ultrastructural interactions with follicular cells and oocytes using Transmission Electron Microscopy (TEM); (3) genotoxicity of CeO2 ENPs on follicular cells and oocytes using a comet assay. DNA damage was quantified as Olive Tail Moment. We show that ENPs aggregated, but their crystal structure remained stable in culture medium. TEM showed endocytosis of CeO2 ENP aggregates in follicular cells. In oocytes, CeO2 ENP aggregates were only observed around the zona pellucida (ZP). The comet assay revealed significant DNA damage in follicular cells. In oocytes, the comet assay showed a dose-related increase in DNA damage and a significant increase only at the highest concentrations. DNA damage decreased significantly both in follicular cells and in oocytes when an anti-oxidant agent was added in the culture medium. We hypothesise that at low concentrations of CeO2 ENPs oocytes could be protected against indirect oxidative stress due to a double defence system composed of follicular cells and ZP. PMID:24185910
Hiroi, M
1996-08-01
Fertilization is the process including many events such as maturation of egg and sperm, attachment, binding, acrosomal reaction, penetration, fusion, cortical reaction, zona reaction and nuclear fusion of both gamete, whereby individual gametes from the female and male unite to create offspring. Although the reason for mechanism of fertilization is still not clearly understood, this process may accelerate the rate adaptation in evolution. In this special lecture, I would like to present our experimental and clinical results especially concerning with morphological, physiological, biochemical and molecular approach on the mechanism of fertilization. 1. Development and maturation of follicles and oocytes. It is well known that pituitary FSH, LH control the ovarian function. Follicular development and ovum maturation are also controlled by both pituitary gonadotropins and local factors such as autocrine and paracrine agents. When hMG is injected during 1-6 day of menstrual cycle, several dominant follicles are developed. If hMG is injected after selection of dominant follicles, only one dominant follicle develop in the ovary. When PMS-treated immature rats were injected with immature or mature follicle fluids, rats injected with mature follicular fluid showed strongly suppress in the ovarian weights and numbers of ovulated follicles. Also mature follicle suppress aromatization from and androstenedione to estradiol. These findings mean that mature follicular fluid contains inhibitory factors. Apoptosis of granulosa cells and follicular steroids are related to fertilization. 2. Intracellular calcium of oocyte. Intracellular calcium concentration is known to start to increase in a periodic manner after fertilization in oocytes of mammalians. In 65% of tested mouse oocytes, fertilization occurred during 4 hours observation after sperm insemination in vitro. An initial long lasting intracellular calcium concentration was observed and followed by periodic manner. This calcium oscillation is inhibited by calcium blockers such as verpamil and nifedipine, but increased by high concentration of extracellular calcium concentration in the medium. Role of increase of intracellular calcium are understood to prevent polysperm and activate metabolism of oocytes. 3. Glucose metabolism of oocytes. Mouse embryo utilizes pyruvate as an essential nutrient until the 8-cell stage, and glucose thereafter. We have devised non-radiometrie and enzymatic microassay method to measure glucose, deoxyglucose, deoxyglucose 6-phosphate incorporated into individual mouse oocytes and preimplantation embryo. In parallel, the activities of several enzymes of glycolytic pathway were also determined. In this study, glucose metabolism is necessary to develop in fertilized ova with changing activity of enzymes. 4. Molecular bases of ovarian fluid. The zona pellucida ZP is involved in a number of events in fertilization, all these fertilization events occur in the oviduct. Oviductal glycoprotein 200-240 KD has been identified from oviductal zona pellucida. Monoclonal antibody of oviductal glycoprotein reacted with ZP of oviductal egg but not with the ovarian egg. Anti-ZPO antibody inhibit to bind sperm to ZP. Sequences in mouse and hamster oviduct specific glycoprotein are estimated, this glycoprotein mRNA was observed in only oviduct by northern blotting method. These molecular gene expression was observed by in situ hybridization in the oviduct of estrous cycle of hamster. 5. Microinsemination of sperm. Microinsemination of sperm into oocyte is widely used in clinical medicine. Sperm penetration assay (hamster test) is useful method to estimate fertilization capacity of sperm. But immotile sperm cannot estimate it. So modified micro sperm penetration assay was established to estimate fertilization capacity of sperm by using micro-manipulator. Subzonal sperm injection (SUZI) and intracytoplasmic sperm injection (ICSI) promotes fertilization and cleavage rate in immotile
A dimeric ArC2 compound from Peperomia pellucida.
Bayma, J D; Arruda, M S; Müller, A H; Arruda, A C; Canto, W C
2000-12-01
Pellucidin A, a novel dimeric ArC2 compound, together with dill-apiol have been isolated from the aerial parts of Peperomia pellucida. The structure of pellucidin A was established by 1D and 2D NMR spectroscopy (1H-1H COSY; 1H-13C COSY; DEPT; NOESY and double irradiation) and other spectroscopic techniques. The biogenesis of pellucidin A is also briefly discussed.
Aqueous extract of Peperomia pellucida (L.) HBK accelerates fracture healing in Wistar rats.
Florence, Ngueguim Tsofack; Huguette, Sakouong Talle Suewellyne; Hubert, Donfack Jean; Raceline, Gounoue Kamkumo; Desire, Dzeufiet Djomeni Paul; Pierre, Kamtchouing; Theophile, Dimo
2017-04-04
Peperomia pellucida (L.) HBK is consumed as vegetable and used in Cameroonian traditional medicine for the management of diseases and for fracture healing. Therefore the aim of this study was to evaluate the effects of the aqueous whole plant extract of Peperomia pellucida on fracture healing in female Wistar rats. A drill hole injury was created by inserting a drill bit inthe diaphysis of the femur. The aqueous extract of the whole plant of Peperomia pellucida was administered orally at the doses of 100, 200 and 400 mg/kg to adult female Wistar rats. The vehicle (distilled water) was given to the control. Besides these rats, one group of rats without fracture received the extract (400 mg/kg). After 14 days of treatment, the rats were sacrificed under anesthesia and the effects of the extract were evaluated on body weight, the relative weights of organs (femurs, uteri and ovaries) and on hematology. Bone (calcium, phosphorus, alkaline phosphatase) and serum biochemical parameters (calcium, phosphorus, alkaline phosphatase) were also evaluated. Radiological and histological tests were carried out on the femurs. The mineral content of the plant extract was also investigated. The extract induced an increase in body weight at high dose and in WBCs count at low doses. Aqueous extract from Peperomia pellucida increased bone calcium at lowest dose but maintained this parameter at normal range at high dose in fractured rat. Alkaline phophatase and phosphorus concentrations reduced significantly (p < 0.01) at the dose of 400 mg/kg as compared to fractured rats. Moreover, radiological tests revealed a dose dependent formation of callus at the level of the fracture gap, confirmed by the formation of a highly dense and compact fibrocartilagenous callus. The mineral content of the plant extract revealed the presence of calcium, phosphorus, magnesium, sodium and potassium. The aqueous extract of P. pellucida accelerates bone healing due partly to the mineral content of the extract. These results confirm its traditional use in the treatment of bone fractures.
Torabi, F; Bogle, O A; Estanyol, J M; Oliva, R; Miller, D
2017-12-01
Are there novel hyaladherins in human sperm? Zona pellucida-binding protein 2 (ZPBP2), containing a Link-like hyaluronic acid (HA)-binding domain, and several other proteins containing BX7B motifs, such as ADAM32 and Midkine, may be novel hyaladherins with HA-binding properties. HA-binding proteins (hyaladherins), which can bind HA surrounding the cumulus-oophorus complex, are distinct from hyases such as PH 20 (SPAM1) and are expressed by mature spermatozoa. Although HABP1 and CD44 are reasonably well characterized hyaladherins and the former has been implicated in sperm-oocyte interactions, the overall significance of sperm hyaladherins for male fertility is still poorly understood. This was a laboratory-based investigation into human sperm hyaladherins undertaken as part of a three year PhD programme sponsored by the EU Marie Curie Training network, Reprotrain. Protein homogenates of sperm obtained from young men of unknown fertility (N = 4) were partitioned into HA-binding and non-binding fractions by a protein affinity 'panning' method; their subsequent characterization was by liquid chromatography-tandem mass spectrometry (LC-MS-MS) and partitioning behaviour was confirmed by western blotting. Sequences of proteins from both fractions were submitted to PDBsum to look for orthologous entries (PDB codes) and all returned codes were queried against the matching protein using SAS (Sequences Annotated by Structure) looking for structural similarities between them. A systematic search for other common features of hyaladherins was also undertaken. The presence of BX7B sequence motifs found in several well-described hyaladherins including RHAMM was used to assess efficacy of potential hyaladherin partitioning by the HA substrate. The data showed that 50% (14/28) and 34.5% (28/81) of proteins in the bound and unbound fractions, respectively, contained these motifs (one-tailed Z-score = 1.45; P = 0.074), indicating weak discrimination by the substrate. Querying PDBsum with sequences for all bound proteins returned several PDB codes matching ZPBP2 with the HA-binding Link domain of the hyaladherin, CD44. Western blot analysis confirmed the affinity partitioning of proteins indicated by the LC-MS/MS results, with ADAM32 (containing two BX7B motifs) and ZPBP2 (containing a Link-like HA-binding domain) present only in the binding fraction. There remains the possibility that the putative hyaladherins uncovered by this study were coincidentally enriched by HA-binding. The full proteomics data set is available on request. The protein extraction methods or the HA substrate used to pan them in this study were probably not ideal, as hyaladherins expected to be present in sperm homogenates (such as CD44 and RHAMM) were not detected. The results provide evidence that ZPBP2, found only in the bound fraction, may have hyaladherin-like properties, which could reflect the evolutionary background context of contemporary sperm-oocyte interaction mechanisms. An EU Marie Curie Sklodowska Initial Training Network Scholarship, supporting Ms Torabi, is gratefully acknowledged. This project was also supported and funded by the Efficacy and Mechanism Evaluation Programme, a UK MRC and NIHR partnership (Grant No 11/14/ 34). There is no conflict of interest in relation to this work. © The Author 2017. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oup.com
Microheater as an alternative to lasers for in-vitro fertilization applications
NASA Astrophysics Data System (ADS)
Palanker, Daniel V.; Turovets, Igor; Glazer, Rima; Reubinoff, Benjamin E.; Hilman, Dalia; Lewis, Aaron
1999-06-01
During the last decade various lasers have been applied to drilling of the micrometer-sized holes in the zona pellucida of oocytes for in-vitro fertilization applications. In this paper we describe an alternative approach to laser instrumentation based on microfabricated device capable of precise drilling of uniform holes in the zona pellucida of oocytes. This device consists of a thin (1 micrometer) film microheater built on the tip of glass capillary with a diameter varying between a few to a few tens of micrometers. Duration of the pulse of heat produced by this microheater determines the spatial confinement of the heat wave in the surrounding liquid medium. We have demonstrated that gradual microdrilling of the zona pellucida can be accomplished using a series of pulses with duration of about 300 microseconds when the microheater was held in contact with the zona pellucida. Pulse energy applied to 20 micrometer tip was about 4 (mu) J. In vitro development and hatching of 127 micromanipulated embryos was compared to 103 non-drilled control embryos. The technique was found to be highly efficient in creating round, uniform, well defined holes with a smooth wall surface, matching the size of the heating source. The architecture of the surrounding zona pellucida was unaffected by the drilling, as demonstrated by scanning electron microscopy. Micromanipulated embryos presented no signs of thermal damage under light microscopy. The rate of blastocyst formation and hatching was similar in the micromanipulated and control groups. Following further testing in animal models, this methodology may be used as a cost- effective alternative to laser-based instrumentation in clinical applications such as assisted hatching and embryo biopsy.
Possible mechanisms of mammalian immunocontraception.
Barber, M R; Fayrer-Hosken, R A
2000-03-01
Ecological and conservation programs in ecosystems around the world have experienced varied success in population management. One of the greatest problems is that human expansion has led to the shrinking of wildlife habitat and, as a result, the overpopulation of many different species has occurred. The pressures exerted by the increased number of animals has caused environmental damage. The humane and practical control of these populations has solicited the scientific community to arrive at a safe, effective, and cost-efficient means of population control. Immunocontraception using zona pellucida antigens, specifically porcine zona pellucida (pZP), has become one of the most promising population control tools in the world today, with notable successes in horses and elephants. A conundrum has risen where pZP, a single vaccine, successfully induces an immunocontraceptive effect in multiple species of mammals. This review describes the most current data pertaining to the mammalian zona pellucida and immunocontraception, and from these studies, we suggest several potential mechanisms of immunocontraception.
Comparative Sperm Proteomics in Mouse Species with Divergent Mating Systems
Vicens, Alberto; Borziak, Kirill; Karr, Timothy L.; Roldan, Eduardo R.S.
2017-01-01
Abstract Sexual selection is the pervasive force underlying the dramatic divergence of sperm form and function. Although it has been demonstrated that testis gene expression evolves rapidly, exploration of the proteomic basis of sperm diversity is in its infancy. We have employed a whole-cell proteomics approach to characterize sperm divergence among closely related Mus species that experience different sperm competition regimes and exhibit pronounced variation in sperm energetics, motility and fertilization capacity. Interspecific comparisons revealed significant abundance differences amongst proteins involved in fertilization capacity, including those that govern sperm-zona pellucida interactions, axoneme components and metabolic proteins. Ancestral reconstruction of relative testis size suggests that the reduction of zona pellucida binding proteins and heavy-chain dyneins was associated with a relaxation in sperm competition in the M. musculus lineage. Additionally, the decreased reliance on ATP derived from glycolysis in high sperm competition species was reflected in abundance decreases in glycolytic proteins of the principle piece in M. spretus and M. spicilegus. Comparison of protein abundance and stage-specific testis expression revealed a significant correlation during spermatid development when dynamic morphological changes occur. Proteins underlying sperm diversification were also more likely to be subject to translational repression, suggesting that sperm composition is influenced by the evolution of translation control mechanisms. The identification of functionally coherent classes of proteins relating to sperm competition highlights the utility of evolutionary proteomic analyses and reveals that both intensified and relaxed sperm competition can have a pronounced impact on the molecular composition of the male gamete. PMID:28333336
Possible mechanism of polyspermy block in human oocytes observed by time-lapse cinematography.
Mio, Yasuyuki; Iwata, Kyoko; Yumoto, Keitaro; Kai, Yoshiteru; Sargant, Haruka C; Mizoguchi, Chizuru; Ueda, Minako; Tsuchie, Yuka; Imajo, Akifumi; Iba, Yumiko; Nishikori, Kyoko
2012-09-01
To analyze the fertilization process related to polyspermy block in human oocytes using an in vitro culturing system for time-lapse cinematography. We had 122 oocytes donated for this study from couples that provided informed consent. We recorded human oocytes at 2,000 to 2,800 frames every 10 s during the fertilization process and thereafter every 2 min using a new in vitro culture system originally developed by the authors for time-lapse cinematography. We displayed 30 frames per second for analysis of the polyspermy block during fertilization. Three oocytes showed the leading and following sperm within the zona pellucida in the same microscopic field. The dynamic images obtained during the fertilization process using this new system revealed that once a leading sperm penetrated the zona pellucida and attached to the oocyte membrane, a following sperm was arrested from further penetration into the zona pellucida within 10 s. The present results strongly suggest the existence of a novel mechanism of polyspermy block that takes place at the zona pellucida immediately after fertilization. These findings are clearly different from previous mechanisms describing polyspermy block as the oocyte membrane block to sperm penetration and the zona reaction. The finding presented herein thus represents a novel discovery about the highly complicated polyspermy block mechanism occurring in human oocytes.
Participation of cysteine-rich secretory proteins (CRISP) in mammalian sperm-egg interaction.
Cohen, Débora J; Busso, Dolores; Da Ros, Vanina; Ellerman, Diego A; Maldera, Julieta A; Goldweic, Nadia; Cuasnicu, Patricia S
2008-01-01
Mammalian fertilization is a complex multi-step process mediated by different molecules present on both gametes. CRISP1 (cysteine-rich secretory protein 1) is an epididymal protein thought to participate in gamete fusion through its binding to egg-complementary sites. Structure-function studies using recombinant fragments of CRISP1 as well as synthetic peptides reveal that its egg-binding ability resides in a 12 amino acid region corresponding to an evolutionary conserved motif of the CRISP family, named Signature 2 (S2). Further experiments analyzing both the ability of other CRISP proteins to bind to the rat egg and the amino acid sequence of their S2 regions show that the amino acid sequence of the S2 is needed for CRISP1 to interact with the egg. CRISP1 appears to be involved in the first step of sperm binding to the zona pellucida, identifying a novel role for this protein in fertilization. The observation that sperm testicular CRISP2 is also able to bind to the egg surface suggests a role for this protein in gamete fusion. Subsequent experiments confirmed the participation of CRISP2 in this step of fertilization and revealed that CRISP1 and CRISP2 interact with common egg surface binding sites. Together, these results suggest a functional cooperation between CRISP1 and CRISP2 to ensure the success of fertilization. These observations contribute to a better understanding of the molecular mechanisms underlying mammalian fertilization.
González-Ortega, C; Cancino-Villarreal, P; Alonzo-Torres, V E; Martínez-Robles, I; Pérez-Peña, E; Gutiérrez-Gutiérrez, A M
2016-04-01
Identification of the best embryos to transfer is a key element for success in assisted reproduction. In the last decade, several morphological criteria of oocytes and embryos were evaluated with regard to their potential for predicting embryo viability. The introduction of polarization light microscopy systems has allowed the visualization of the meiotic spindle and the different layers of the zona pellucida in human oocytes on the basis of birefringence in a non-destructive way. Conflicting results have been reported regarding the predictive value in ICSI cycles. To assess the predictive ability of meiotic spindle and zona pellucida of human oocytes to implant by polarized microscopy in ICSI cycles. Prospective and observational clinical study. 903 oocytes from 94 ICSI cycles were analyzed with polarized microscopy. Meiotic spindle visualization and zona pellucida birefringence values by polarized microscopy were correlated with ICSI cycles results. Meiotic spindle visualization and birefringence values of zona pellucida decreased in a direct basis with increasing age. In patients aged over the 35 years, the percentage of a visible spindle and mean zona pellucida birefringence was lower than in younger patients. Fertilization rate were higher in oocytes with visible meiotic spindle (81.3% vs. 64%; p < 0.0001), as well as embryo quality (47.4% vs. 39%; p=0.01). Fertilization rate was higher in oocytes with positive values of birefringence (77.5 % vs. 68.5% p=0.005) with similar embryo quality. Conception cycles showed oocytes with higher mean value of zona birefringence and visible spindle vs. no-conception cycles (p<0.05). Polarized light microscopy improves oocyte selection, which significantly impacts in the development of embryos with greater implantation potential. The use of polarized light microscopy with sperm selection methods, blastocyst culture and deferred embryo transfers will contribute to transfer fewer embryos without diminishing rates of live birth and single embryo transfer will be more feasible.
Ngueguim, Florence Tsofack; Khan, Mohd Parvez; Donfack, Jean Hubert; Tewari, Deepshikha; Dimo, Theophile; Kamtchouing, Pierre; Maurya, Rakesh; Chattopadhyay, Naibedya
2013-06-21
The whole plant or some part of Peperomia pellucida (L.) HBK is used in some parts of Cameroon as a treatment for fracture healing. To evaluate the effect of ethanolic extracts of Peperomia pellucida (L.), a Cameroonian medicinal plant on bone regeneration following bone and marrow injury, and determine the mode of action. Ethanol extract of Peperomia pellucida was administered at 100 and 200mg/kg doses orally to adult female Sprague-Dawley rats having a drill hole injury (0.8mm) in the femur diaphysis. Vehicle (gum-acacia in distilled water) was given to the control group. After 12 days of treatment, animals were euthanized and femur bones collected. Confocal microscopy of calcein labeling at the drill hole site was performed to evaluate bone regeneration. 3-D microarchitecture of drill hole site was analyzed by micorocomputed tomography. Osteogenic effects of the extract were evaluated by assessing mineralized nodule formation of bone marrow stromal cells and expression of osteogenic genes (mRNA level of type-1 collagen, bone morphogenetic protein-2 and osteocalcin genes) in the femur. Ethanol extract from Peperomia Pellucida (L.) dose-dependently induced bone regeneration at the fracture site. At 200mg/kg dose, the extract significantly increased mineral deposition compared to controls. The extract also improved microarchitecture of the regenerating bone evident from increased bone volume fraction, trabecular thickness, trabecular number, and decreased trabecular separation and structure model index. In addition, the extract increased the formation of mineralized nodules from the bone marrow stromal cells. Furthermore, the extract induced the expression of osteogenic genes in the femur including type 1 collagen, osteocalcin and BMP-2, compared to control. Ethanolic extract of P. pellucid (L.) accelerates fracture repair in rats via stimulatory effects on osteoblast differentiation and mineralization, thereby justifying its traditional use. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
Dudek, Magda; Adams, Jessica; Swain, Martin; Hegarty, Matthew; Huws, Sharon; Gallagher, Joe
2014-10-20
This study investigated the microbial diversity associated with the digestive tract of the seaweed grazing marine limpet Patella pellucida. Using a modified indirect DNA extraction protocol and performing metagenomic profiling based on specific prokaryotic marker genes, the abundance of bacterial groups was identified from the analyzed metagenome. The members of three significantly abundant phyla of Proteobacteria, Firmicutes and Bacteroidetes were characterized through the literature and their predicted functions towards the host, as well as potential applications in the industrial environment assessed.
An approach to successful freezing of demi-embryos derived from day-7 bovine embryos.
Niemann, H; Brem, G; Sacher, B; Smidt, D; Kräusslich, H
1986-04-01
The developmental capacity of frozen/thawed bisected embryos (n = 33) derived from day-7 bovine embryos was investigated and compared to ordinary embryos after freezing and thawing (n = 28) and to freshly bisected embryos (n = 19). The freezing and thawing protocol was identical for ordinary and demi-embryos. The percentage of intact embryos classified as excellent, good, or poor after thawing was 92.9 and 96.3% for ordinary and demi-embryos, respectively. Pregnancy rates of 53.8 (8 15 ), 46.2 (6 13 ), and 47.5% (9 19 ) were obtained when frozen/thawed ordinary embryos and frozen/thawed demi-embryos classified as excellent or good and sealed with an additional zona pellucida from hatched pig blastocysts or freshly bisected embryos were transferred. One pair of identical twins resulted from the transfer of frozen/thawed demi-embryos sealed with an additional zona pellucida. Transfer of four frozen/thawed demi-embryos without an additional zona pellucida led to one pregnancy. In contrast, demi-embryos derived from frozen/thawed ordinary embryos (n = 8) as well as frozen/thawed demi-embryos classified as poor (n = 6) did not result in any pregnancies although two halves were transferred per recipient. It is concluded that sealing the punctured zona pellucida improves the developmental capacity of frozen/thawed demi-embryos derived from day-7 bovine embryos, and freezing demi-embryos is more efficient compared to the splitting of frozen/thawed ordinary embryos.
Current concepts of molecular events during bovine and porcine spermatozoa capacitation.
Vadnais, Melissa L; Galantino-Homer, Hannah L; Althouse, Gary C
2007-01-01
Spermatozoa are required to undergo the processes of capacitation before they obtain fertilizing ability. The molecular changes of capacitation are still not fully understood. However, it is accepted that capacitation is a sequential process involving numerous physiological changes including destabilization of the plasma membrane, alterations of intracellular ion concentrations and membrane potential, and protein phosphorylation. There are no known morphological changes that occur to the spermatozoon during capacitation. The purpose of this review is to summarize current evidence on the molecular aspects of capacitation both in vivo and in vitro in bovine and porcine spermatozoa. For the purpose of this review, the process of sperm capacitation will encompass maturational events that occur following ejaculation up to binding to the zona pellucida, that triggers acrosomal exocytosis and initiates fertilization.
Critical ligand binding reagent preparation/selection: when specificity depends on reagents.
Rup, Bonita; O'Hara, Denise
2007-05-11
Throughout the life cycle of biopharmaceutical products, bioanalytical support is provided using ligand binding assays to measure the drug product for pharmacokinetic, pharmacodynamic, and immunogenicity studies. The specificity and selectivity of these ligand binding assays are highly dependent on the ligand binding reagents. Thus the selection, characterization, and management processes for ligand binding reagents are crucial to successful assay development and application. This report describes process considerations for selection and characterization of ligand binding reagents that are integral parts of the different phases of assay development. Changes in expression, purification, modification, and storage of the ligand binding reagents may have a profound effect on the ligand binding assay performance. Thus long-term management of the critical ligand binding assay reagents is addressed including suggested characterization criteria that allow ligand binding reagents to be used in as consistent a manner as possible. Examples of challenges related to the selection, modification, and characterization of ligand binding reagents are included.
Ferrer, Marvin; Rodriguez, Hilma; Zara, Lindsay; Yu, Yang; Xu, Wei; Oko, Richard
2012-09-01
Sperm-zona pellucida (ZP) penetration during fertilization is a process that most likely involves enzymatic digestion of this extracellular coat by spermatozoa. Since the inner acrosomal membrane (IAM) is the leading edge of spermatozoa during penetration and proteins required for secondary binding of sperm to the zona are present on it, the IAM is the likely location of these enzymes. The objectives of this study were to identify and characterize proteinases present on the IAM, confirm their localization and provide evidence for their role in fertilization. Gelatin zymography of detergent extracts of the IAM revealed bands of enzymatic activity identified as serine and matrix metallo-proteinases (MMPs). Specific inhibitors to MMPs revealed that MMP activity was due to MMP2. Immunoblotting determined that the serine protease activity on the zymogram was due to acrosin and also confirmed the MMP2 activity. Immunogold labeling of spermatozoa at the electron microscope level showed that acrosin and MMP2 were confined to the apical and principal segments of the acrosome in association with the IAM, confirming our IAM isolation technique. Immunohistochemical examination of acrosin and MMP2 during spermiogenesis showed that both proteins originate in the acrosomic granule during the Golgi phase and later redistribute to the acrosomal membrane. Anti-MMP2 antibodies and inhibitors incorporated into in vitro fertilization media significantly decreased fertilization rates. This is the first study to demonstrate that MMP2 and acrosin are associated with the IAM and introduces the possibility of their cooperation in enzymatic digestion of the ZP during penetration.
Analysis of Ethylene Receptors: Ethylene-Binding Assays.
Binder, Brad M; Schaller, G Eric
2017-01-01
Plant ethylene receptors bind ethylene with high affinity. Most of the characterization of ethylene binding to the receptors has been carried out using a radioligand-binding assay on functional receptors expressed in yeast. In this chapter, we describe methods for expressing ethylene receptors in yeast and conducting ethylene-binding assays on intact yeast and yeast membranes. The ethylene-binding assays can be modified to analyze ethylene binding to intact plants and other organisms as well as membranes isolated from any biological source.
Monoclonal antibodies to human vitamin D-binding protein.
Pierce, E A; Dame, M C; Bouillon, R; Van Baelen, H; DeLuca, H F
1985-01-01
Monoclonal antibodies to vitamin D-binding protein isolated from human serum have been produced. The antibodies obtained have been shown to be specific for human vitamin D-binding protein by three independent assays. The antibodies recognize human vitamin D-binding protein specifically in an enzyme-linked immunosorbent assay. Human vitamin D-binding protein is detected specifically in both pure and crude samples by a radiometric immunosorbent assay (RISA) and by an immunoprecipitation assay. The anti-human vitamin D-binding protein antibodies cross-react with monkey and pig vitamin D-binding protein, but not with vitamin D-binding protein from rat, mouse, or chicken, as determined by the RISA and immunoprecipitation assays. Images PMID:3936035
Tanphaichitr, Nongnuj; Kongmanas, Kessiri; Kruevaisayawan, Hathairat; Saewu, Arpornrad; Sugeng, Clarissa; Fernandes, Jason; Souda, Puneet; Angel, Jonathan B; Faull, Kym F; Aitken, R John; Whitelegge, Julian; Hardy, Daniel; Berger, Trish; Baker, Mark
2015-01-01
The interaction of sperm with the egg's extracellular matrix, the zona pellucida (ZP) is the first step of the union between male and female gametes. The molecular mechanisms of this process have been studied for the past six decades with the results obtained being both interesting and confusing. In this article, we describe our recent work, which attempts to address two lines of questions from previous studies. First, because there are numerous ZP binding proteins reported by various researchers, how do these proteins act together in sperm–ZP interaction? Second, why do a number of acrosomal proteins have ZP affinity? Are they involved mainly in the initial sperm–ZP binding or rather in anchoring acrosome reacting/reacted spermatozoa to the ZP? Our studies reveal that a number of ZP binding proteins and chaperones, extracted from the anterior sperm head plasma membrane, coexist as high molecular weight (HMW) complexes, and that these complexes in capacitated spermatozoa have preferential ability to bind to the ZP. Zonadhesin (ZAN), known as an acrosomal protein with ZP affinity, is one of these proteins in the HMW complexes. Immunoprecipitation indicates that ZAN interacts with other acrosomal proteins, proacrosin/acrosin and sp32 (ACRBP), also present in the HMW complexes. Immunodetection of ZAN and proacrosin/acrosin on spermatozoa further indicates that both proteins traffic to the sperm head surface during capacitation where the sperm acrosomal matrix is still intact, and therefore they are likely involved in the initial sperm–ZP binding step. PMID:25994642
Viscous forces are predominant in the zona pellucida mechanical resistance
NASA Astrophysics Data System (ADS)
Papi, Massimiliano; Maiorana, Alessandro; Douet, Cécile; Maulucci, Giuseppe; Parasassi, Tiziana; Brunelli, Roberto; Goudet, Ghylène; De Spirito, Marco
2013-01-01
The zona pellucida (ZP) is a multilayer glycoprotein spherical shell surrounding mammalian eggs. The ZP's mechanical response plays a crucial role in mammalian fertilization and is a parameter commonly adopted in "in vitro fertilization" to characterize the oocytes quality. While it is assumed that ZP mechanical response is purely elastic, here we prove that dissipative forces cannot be neglected. Physiologically, this evidence implies that an increase in the spermatozoa motility can induce dramatic changes on the ZP reaction force turning ZP shell in an impenetrable barrier leading to fertility impairments.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Giulliani, S. E.; Frank, A. E.; Collart, F. R.
2008-12-08
We have used a fluorescence-based thermal shift (FTS) assay to identify amino acids that bind to solute-binding proteins in the bacterial ABC transporter family. The assay was validated with a set of six proteins with known binding specificity and was consistently able to map proteins with their known binding ligands. The assay also identified additional candidate binding ligands for several of the amino acid-binding proteins in the validation set. We extended this approach to additional targets and demonstrated the ability of the FTS assay to unambiguously identify preferential binding for several homologues of amino acid-binding proteins with known specificity andmore » to functionally annotate proteins of unknown binding specificity. The assay is implemented in a microwell plate format and provides a rapid approach to validate an anticipated function or to screen proteins of unknown function. The ABC-type transporter family is ubiquitous and transports a variety of biological compounds, but the current annotation of the ligand-binding proteins is limited to mostly generic descriptions of function. The results illustrate the feasibility of the FTS assay to improve the functional annotation of binding proteins associated with ABC-type transporters and suggest this approach that can also be extended to other protein families.« less
Simultaneous Multiple MS Binding Assays Addressing D1 and D2 Dopamine Receptors.
Schuller, Marion; Höfner, Georg; Wanner, Klaus T
2017-10-09
MS Binding Assays are a label-free alternative to radioligand binding assays. They provide basically the same capabilities as the latter, but use a non-labeled reporter ligand instead of a radioligand. In contrast to radioligand binding assays, MS Binding Assays offer-owing to the selectivity of mass spectrometric detection-the opportunity to monitor the binding of different reporter ligands at different targets simultaneously. The present study shows a proof of concept for this strategy as exemplified for MS Binding Assays selectively addressing D 1 and D 2 dopamine receptors in a single binding experiment. A highly sensitive, rapid and robust LC-ESI-MS/MS quantification method capable of quantifying both SCH23390 and raclopride, selectively addressing D 1 and D 2 receptors, respectively, was established and validated for this purpose. Based thereon, simultaneous saturation and competition experiments with SCH23390 and raclopride in the presence of both D 1 and D 2 receptors were performed and analyzed by LC-MS/MS within a single chromatographic cycle. The present study thus demonstrates the feasibility of this strategy and the high versatility of MS Binding Assays that appears to surpass that common for conventional radioligand binding assays. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Comparison of functional assays used in the clinical development of a placental malaria vaccine.
Pehrson, Caroline; Heno, Kristine K; Adams, Yvonne; Resende, Mafalda; Mathiesen, Line; Soegaard, Max; de Jongh, Willem A; Theander, Thor G; Salanti, Ali; Nielsen, Morten A
2017-01-23
Malaria in pregnancy is associated with significant morbidity in pregnant women and their offspring. Plasmodium falciparum infected erythrocytes (IE) express VAR2CSA that mediates binding to chondroitin sulphate A (CSA) in the placenta. Two VAR2CSA-based vaccines for placental malaria are in clinical development. The purpose of this study was to evaluate the robustness and comparability of binding inhibition assays used in the clinical development of placental malaria vaccines. The ability of sera from animals immunised with different VAR2CSA constructs to inhibit IE binding to CSA was investigated in three in vitro assays using 96-well plates, petri dishes, capillary flow and an ex vivo placental perfusion assay. The inter-assay variation was not uniform between assays and ranged from above ten-fold in the flow assay to two-fold in the perfusion assay. The intra-assay variation was highest in the petri dish assay. A positive correlation between IE binding avidity and the level of binding after antibody inhibition in the petri dish assay indicate that high avidity IE binding is more difficult to inhibit. The highest binding inhibition sensitivity was found in the 96-well and petri dish assays compared to the flow and perfusion assays where binding inhibition required higher antibody titers. The inhibitory capacity of antibodies is not easily translated between assays and the high sensitivity of the 96-well and petri dish assays stresses the need for comparing serial dilutions of serum. Furthermore, IE binding avidity must be in the same range when comparing data from different days. There was an overall concordance in the capacity of antibody-mediated inhibition, when comparing the in vitro assays with the perfusion assay, which more closely represents in vivo conditions. Importantly the ID1-ID2a protein in a liposomal formulation, currently in a phase I trial, effectively induced antibodies that inhibited IE adhesion in placental tissue. Copyright © 2016. Published by Elsevier Ltd.
Shi, Wei; Xu, Bo; Wu, Li-Min; Jin, Ren-Tao; Luan, Hong-Bing; Luo, Li-Hua; Zhu, Qing; Johansson, Lars; Liu, Yu-Sheng; Tong, Xian-Hong
2014-01-01
The morphological assessment of oocytes is important for embryologists to identify and select MII oocytes in IVF/ICSI cycles. Dysmorphism of oocytes decreases viability and the developmental potential of oocytes as well as the clinical pregnancy rate. Several reports have suggested that oocytes with a dark zona pellucida (DZP) correlate with the outcome of IVF treatment. However, the effect of DZP on oocyte quality, fertilization, implantation, and pregnancy outcome were not investigated in detail. In this study, a retrospective analysis was performed in 268 infertile patients with fallopian tube obstruction and/or male factor infertility. In 204 of these patients, all oocytes were surrounded by a normal zona pellucida (NZP, control group), whereas 46 patients were found to have part of their retrieved oocytes enclosed by NZP and the other by DZP (Group A). In addition, all oocytes enclosed by DZP were retrieved from 18 patients (Group B). No differences were detected between the control and group A. Compared to the control group, the rates of fertilization, good quality embryos, implantation and clinical pregnancy were significantly decreased in group B. Furthermore, mitochondria in oocytes with a DZP in both of the two study groups (A and B) were severely damaged with several ultrastructural alterations, which were associated with an increased density of the zona pellucida and vacuolization. Briefly, oocytes with a DZP affected the clinical outcome in IVF/ICSI cycles and appeared to contain more ultrastructural alterations. Thus, DZP could be used as a potential selective marker for embryologists during daily laboratory work.
Liu, Ying-Lei; Chen, Ying; Zhou, Cheng-Jie; Wu, Sha-Na; Shen, Jiang-Peng; Liang, Cheng-Guang
2014-01-01
To improve the outcome of assisted reproductive technology (ART) for patients with ovulation problems, it is necessary to retrieve and select germinal vesicle (GV) stage oocytes with high developmental potential. Oocytes with high developmental potential are characterized by their ability to undergo proper maturation, fertilization, and embryo development. In this study, we analyzed morphological traits of GV stage mouse oocytes, including cumulus cell layer thickness, zona pellucida thickness, and perivitelline space width. Then, we assessed the corresponding developmental potential of each of these oocytes and found that it varies across the range measured for each morphological trait. Furthermore, by manipulating these morphological traits in vitro, we were able to determine the influence of morphological variation on oocyte developmental potential. Manually altering the thickness of the cumulus layer showed strong effects on the fertilization and embryo development potentials of oocytes, whereas manipulation of zona pellucida thickness effected the oocyte maturation potential. Our results provide a systematic detailed method for selecting GV stage oocytes based on a morphological assessment approach that would benefit for several downstream ART applications. PMID:25144310
Effect of calcium, bicarbonate, and albumin on capacitation-related events in equine sperm.
Macías-García, B; González-Fernández, L; Loux, S C; Rocha, A M; Guimarães, T; Peña, F J; Varner, D D; Hinrichs, K
2015-01-01
Repeatable methods for IVF have not been established in the horse, reflecting the failure of standard capacitating media to induce changes required for fertilization capacity in equine sperm. One important step in capacitation is membrane cholesterol efflux, which in other species is triggered by cholesterol oxidation and is typically enhanced using albumin as a sterol acceptor. We incubated equine sperm in the presence of calcium, BSA, and bicarbonate, alone or in combination. Bicarbonate induced an increase in reactive oxygen species (ROS) that was abolished by the addition of calcium or BSA. Bicarbonate induced protein tyrosine phosphorylation (PY), even in the presence of calcium or BSA. Incubation at high pH enhanced PY but did not increase ROS production. Notably, no combination of these factors was associated with significant cholesterol efflux, as assessed by fluorescent quantitative cholesterol assay and confirmed by filipin staining. By contrast, sperm treated with methyl-β-cyclodextrin showed a significant reduction in cholesterol levels, but no significant increase in PY or ROS. Presence of BSA increased sperm binding to bovine zonae pellucidae in all three stallions. These results show that presence of serum albumin is not associated with a reduction in membrane cholesterol levels in equine sperm, highlighting the failure of equine sperm to exhibit core capacitation-related changes in a standard capacitating medium. These data indicate an atypical relationship among cholesterol efflux, ROS production, and PY in equine sperm. Our findings may help to elucidate factors affecting failure of equine IVF under standard conditions. © 2015 Society for Reproduction and Fertility.
Arroteia, Kélen Fabíola; Barbieri, Mainara Ferreira; Souza, Gustavo Henrique Martins Ferreira; Tanaka, Hiromitsu; Eberlin, Marcos Nogueira; Hyslop, Stephen; Alvares, Lúcia Elvira; Pereira, Luís Antonio Violin Dias
2014-01-01
The epididymis has an important role in the maturation of sperm for fertilization, but little is known about the epididymal molecules involved in sperm modifications during this process. We have previously described the expression pattern for an antigen in epididymal epithelial cells that reacts with the monoclonal antibody (mAb) TRA 54. Immunohistochemical and immunoblotting analyses suggest that the epitope of the epididymal antigen probably involves a sugar moiety that is released into the epididymal lumen in an androgen-dependent manner and subsequently binds to luminal sperm. Using column chromatography, SDS-PAGE with in situ digestion and mass spectrometry, we have identified the protein recognized by mAb TRA 54 in mouse epididymal epithelial cells. The ∼65 kDa protein is part of a high molecular mass complex (∼260 kDa) that is also present in the sperm acrosomal vesicle and is completely released after the acrosomal reaction. The amino acid sequence of the protein corresponded to that of albumin. Immunoprecipitates with anti-albumin antibody contained the antigen recognized by mAb TRA 54, indicating that the epididymal molecule recognized by mAb TRA 54 is albumin. RT-PCR detected albumin mRNA in the epididymis and fertilization assays in vitro showed that the glycoprotein complex containing albumin was involved in the ability of sperm to recognize and penetrate the egg zona pellucida. Together, these results indicate that epididymal-derived albumin participates in the formation of a high molecular mass glycoprotein complex that has an important role in egg fertilization.
Clinical assessment of the male fertility
Khatun, Amena; Rahman, Md Saidur
2018-01-01
The evaluation of infertility in males consists of physical examination and semen analyses. Standardized semen analyses depend on the descriptive analysis of sperm motility, morphology, and concentration, with a threshold level that must be surpassed to be considered a fertile spermatozoon. Nonetheless, these conventional parameters are not satisfactory for clinicians since 25% of infertility cases worldwide remain unexplained. Therefore, newer tests methods have been established to investigate sperm physiology and functions by monitoring characteristics such as motility, capacitation, the acrosome reaction, reactive oxygen species, sperm DNA damage, chromatin structure, zona pellucida binding, and sperm-oocyte fusion. After the introduction of intracytoplasmic sperm injection technique, sperm maturity, morphology, and aneuploidy conditions have gotten more attention for investigating unexplained male infertility. In the present article, recent advancements in research regarding the utilization of male fertility prediction tests and their role and accuracy are reviewed. PMID:29564308
In Situ Protein Binding Assay Using Fc-Fusion Proteins.
Padmanabhan, Nirmala; Siddiqui, Tabrez J
2017-01-01
This protocol describes an in situ protein-protein interaction assay between tagged recombinant proteins and cell-surface expressed synaptic proteins. The assay is arguably more sensitive than other traditional protein binding assays such as co-immunoprecipitation and pull-downs and provides a visual readout for binding. This assay has been widely used to determine the dissociation constant of binding of trans-synaptic adhesion proteins. The step-wise description in the protocol should facilitate the adoption of this method in other laboratories.
Teh, Huey Fang; Peh, Wendy Y X; Su, Xiaodi; Thomsen, Jane S
2007-02-27
Specific protein-DNA interactions play a central role in transcription and other biological processes. A comprehensive characterization of protein-DNA interactions should include information about binding affinity, kinetics, sequence specificity, and binding stoichiometry. In this study, we have used surface plasmon resonance spectroscopy (SPR) to study the interactions between human estrogen receptors (ER, alpha and beta subtypes) and estrogen response elements (ERE), with four assay schemes. First, we determined the sequence-dependent receptors' binding capacity by monitoring the binding of ER to various ERE sequences immobilized on a sensor surface (assay format denoted as the direct assay). Second, we screened the relative affinity of ER for various ERE sequences using a competition assay, in which the receptors bind to an ERE-immobilized surface in the presence of competitor ERE sequences. Third, we monitored the assembly of ER-ERE complexes on a SPR surface and thereafter the removal and/or dissociation of the ER (assay scheme denoted as the dissociation assay) to determine the binding stoichiometry. Last, a sandwich assay (ER binding to ERE followed by anti-ER recognition of a specific ER subtype) was performed in an effort to understand how ERalpha and ERbeta may associate and compete when binding to the DNA. With these assay schemes, we reaffirmed that (1) ERalpha is more sensitive than ERbeta to base pair change(s) in the consensus ERE, (2) ERalpha and ERbeta form a heterodimer when they bind to the consensus ERE, and (3) the binding stoichiometry of both ERalpha- and ERbeta-ERE complexes is dependent on salt concentration. With this study, we demonstrate the versatility of the SPR analysis. With the involvement of various assay arrangements, the SPR analysis can be further extended to more than kinetics and affinity study.
International Validation of Two Human Recombinant Estrogen ...
An international validation study has been successfully completed for 2 competitive binding assays using human recombinant ERa. Assays evaluated included the Freyberger-Wilson (FW) assay using a full length human ER, and the Chemical Evaluation and Research Institute (CERI) assay using a ligand-binding domain of the human ER. Twenty three compounds were tested in 6 laboratories for the FW assay and 5 for the CERJ assay, which included three controls (used with every run), 9 uncoded, and 14 coded chemicals across 3 subtasks. The overall goal of this validation study was to demonstrate the ability of each of the two assays to reliably classify the test chemicals as binders or non-binders. Laboratories had little trouble with the ER binders that produced a full binding curve when using either the CERI or FW assays. As is typical with all ER competitive binding assays, the weak binders proved to be more challenging. However, overall results from both the FW and CERI assays were consistent and in agreement with expected classifications regardless of the form of the hrER (i.e., full length ER versus an ER ligand binding domain) or the subtle differences in the protocols for conducting each assay. The reproducibility and accuracy for classification of chemicals as potential ER binders and non- binders using the FW and CERI hrER binding assays were comparable to that of the U.S.EPA’s existing ER binding test guideline OPPTS 890.1250, while providing an improved, highe
Hermo, Louis; Pelletier, R-Marc; Cyr, Daniel G; Smith, Charles E
2010-04-01
Spermiogenesis constitutes the steps involved in the metamorphosis of spermatids into spermatozoa. It involves modification of several organelles in addition to the formation of several structures including the flagellum and cytoplasmic droplet. The flagellum is composed of a neck region and middle, principal, and end pieces. The axoneme composed of nine outer microtubular doublets circularly arranged to form a cylinder around a central pair of microtubules is present throughout the flagellum. The middle and principal pieces each contain specific components such as the mitochondrial sheath and fibrous sheath, respectively, while outer dense fibers are common to both. A plethora of proteins are constituents of each of these structures, with each playing key roles in functions related to the fertility of spermatozoa. At the end of spermiogenesis, a portion of spermatid cytoplasm remains associated with the released spermatozoa, referred to as the cytoplasmic droplet. The latter has as its main feature Golgi saccules, which appear to modify the plasma membrane of spermatozoa as they move down the epididymal duct and hence may be partly involved in male gamete maturation. The end product of spermatogenesis is highly streamlined and motile spermatozoa having a condensed nucleus equipped with an acrosome. Spermatozoa move through the female reproductive tract and eventually penetrate the zona pellucida and bind to the egg plasma membrane. Many proteins have been implicated in the process of fertilization as well as a plethora of proteins involved in the development of spermatids and sperm, and these are high lighted in this review. Copyright 2009 Wiley-Liss, Inc.
A Recurrent Missense Mutation in ZP3 Causes Empty Follicle Syndrome and Female Infertility.
Chen, Tailai; Bian, Yuehong; Liu, Xiaoman; Zhao, Shigang; Wu, Keliang; Yan, Lei; Li, Mei; Yang, Zhenglin; Liu, Hongbin; Zhao, Han; Chen, Zi-Jiang
2017-09-07
Empty follicle syndrome (EFS) is defined as the failure to aspirate oocytes from mature ovarian follicles during in vitro fertilization. Except for some cases caused by pharmacological or iatrogenic problems, the etiology of EFS remains enigmatic. In the present study, we describe a large family with a dominant inheritance pattern of female infertility characterized by recurrent EFS. Genome-wide linkage analyses and whole-exome sequencing revealed a paternally transmitted heterozygous missense mutation of c.400 G>A (p.Ala134Thr) in zona pellucida glycoprotein 3 (ZP3). The same mutation was identified in an unrelated EFS pedigree. Haplotype analysis revealed that the disease allele of these two families came from different origins. Furthermore, in a cohort of 21 cases of EFS, two were also found to have the ZP3 c.400 G>A mutation. Immunofluorescence and histological analysis indicated that the oocytes of the EFS female had degenerated and lacked the zona pellucida (ZP). ZP3 is a major component of the ZP filament. When mutant ZP3 was co-expressed with wild-type ZP3, the interaction between wild-type ZP3 and ZP2 was markedly decreased as a result of the binding of wild-type ZP3 and mutant ZP3, via dominant negative inhibition. As a result, the assembly of ZP was impeded and the communication between cumulus cells and the oocyte was prevented, resulting in oocyte degeneration. These results identified a genetic basis for EFS and oocyte degeneration and, moreover, might pave the way for genetic diagnosis of infertile females with this phenotype. Copyright © 2017 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
Effects of porcine zona pellucida immunocontraceptives in zoo felids.
Harrenstien, Lisa A; Munson, Linda; Chassy, Lisa M; Liu, Irwin K M; Kirkpatrick, Jay F
2004-09-01
Methods of contraception are necessary for management of zoo felids; however, the most commonly used contraceptive (melengestrol acetate implant) is associated with serious adverse reactions with long-term use. Porcine zona pellucida (pZP) vaccines are promising as contraceptives, but their safety in zoo felids has not been tested. pZP vaccine was administered to 27 female felids representing 10 species, including African lion (Panthera leo), Asian leopard (P. pardus), jaguar (P. onca), tiger (P. tigris), snow leopard (P. uncia), cougar (Felis concolor), Siberian lynx (F. lynx), Canada lynx (F. canadensis), serval (F. serval), and bobcat (F. rufus), in 15 facilities. Over 6 wk, each animal received three i.m. injections of 65 microg pZP with Freund's complete adjuvant (FCA), Freund's incomplete adjuvant, or carbopol as the adjuvant. Behavioral signs of estrus were seen in 14 of the vaccinated felids. An unacceptably high incidence of adverse reactions was seen including injection site swelling, lameness, limb swelling, or abscessation (or all) in five felids after injection with FCA as the initial adjuvant. Adverse behavioral signs, including increased irritability and aggression, were seen in four felids. Six of the felids were assayed for antibodies against pZP during the 12 mo after vaccination; all showed antibody production. Antibody levels appeared to peak 1-4 mo after vaccination began, although elevated antibody levels persisted in two animals for > 12 mo after the first injection. All vaccinated felids were ovariohysterectomized 3-13 mo after vaccination. Folliculogenesis was present in all treated animals, and there was no histopathologic evidence of inflammatory damage to ovaries. Contraceptive efficacy was not specifically evaluated in this study; however, two of the three felids housed with an intact male became pregnant during the study, one of which gave birth to healthy cubs.
Characterization of binding affinity of CJ-023,423 for human prostanoid EP4 receptor.
Murase, Akio; Nakao, Kazunari; Takada, Junji
2008-01-01
In order to characterize the receptor binding pharmacology of CJ-023,423, a potent and selective EP4 antagonist, we performed a radioligand receptor binding assay under various assay conditions. An acidic (pH 6) and hypotonic buffer is a conventional, well-known buffer for prostaglandin E2 receptor binding assays. CJ-023,423 showed moderate binding affinity for human EP4 receptor under conventional buffer conditions. However, its binding affinity was greatly increased under neutral (pH 7.4) and isotonic buffer conditions. In this report, the binding mechanism between CJ-023,423 and human EP4 receptor is discussed based on the binding affinities determined under various assay conditions. Copyright 2008 S. Karger AG, Basel.
Parallel Force Assay for Protein-Protein Interactions
Aschenbrenner, Daniela; Pippig, Diana A.; Klamecka, Kamila; Limmer, Katja; Leonhardt, Heinrich; Gaub, Hermann E.
2014-01-01
Quantitative proteome research is greatly promoted by high-resolution parallel format assays. A characterization of protein complexes based on binding forces offers an unparalleled dynamic range and allows for the effective discrimination of non-specific interactions. Here we present a DNA-based Molecular Force Assay to quantify protein-protein interactions, namely the bond between different variants of GFP and GFP-binding nanobodies. We present different strategies to adjust the maximum sensitivity window of the assay by influencing the binding strength of the DNA reference duplexes. The binding of the nanobody Enhancer to the different GFP constructs is compared at high sensitivity of the assay. Whereas the binding strength to wild type and enhanced GFP are equal within experimental error, stronger binding to superfolder GFP is observed. This difference in binding strength is attributed to alterations in the amino acids that form contacts according to the crystal structure of the initial wild type GFP-Enhancer complex. Moreover, we outline the potential for large-scale parallelization of the assay. PMID:25546146
Parallel force assay for protein-protein interactions.
Aschenbrenner, Daniela; Pippig, Diana A; Klamecka, Kamila; Limmer, Katja; Leonhardt, Heinrich; Gaub, Hermann E
2014-01-01
Quantitative proteome research is greatly promoted by high-resolution parallel format assays. A characterization of protein complexes based on binding forces offers an unparalleled dynamic range and allows for the effective discrimination of non-specific interactions. Here we present a DNA-based Molecular Force Assay to quantify protein-protein interactions, namely the bond between different variants of GFP and GFP-binding nanobodies. We present different strategies to adjust the maximum sensitivity window of the assay by influencing the binding strength of the DNA reference duplexes. The binding of the nanobody Enhancer to the different GFP constructs is compared at high sensitivity of the assay. Whereas the binding strength to wild type and enhanced GFP are equal within experimental error, stronger binding to superfolder GFP is observed. This difference in binding strength is attributed to alterations in the amino acids that form contacts according to the crystal structure of the initial wild type GFP-Enhancer complex. Moreover, we outline the potential for large-scale parallelization of the assay.
Thys, Mirjan; Nauwynck, Hans; Maes, Dominiek; Hoogewijs, Maarten; Vercauteren, Dries; Rijsselaere, Tom; Favoreel, Herman; Van Soom, Ann
2009-09-01
Fibronectin (Fn) is a 440 kDa glycoprotein assumed to participate in sperm-egg interaction in human. Recently, it has been demonstrated that Fn--when present during bovine IVF--strongly inhibits sperm penetration. The present study was conducted firstly to evaluate the expression of Fn and its integrin receptor (alpha(5)beta(1)) on male and female bovine gametes using indirect immunofluorescence and secondly, to determine the function of Fn during bovine IVF. Endogenous Fn was detected underneath the zona pellucida (ZP) and integrin alpha(5) on the oolemma of cumulus-denuded oocytes. Bovine spermatozoa displayed integrin alpha(5) at their equatorial segment after acrosome reaction. We established that the main inhibitory effect of exogenously supplemented Fn was located at the sperm-oolemma binding, with a (concurrent) effect on fusion, and this can probably be attributed to the binding of Fn to spermatozoa at the equatorial segment, as shown by means of Alexa Fluor 488-conjugated Fn. Combining these results, the inhibitory effect of exogenously supplemented Fn seemed to be exerted on the male gamete by binding to the exposed integrin alpha(5)beta(1) receptor after acrosome reaction. The presence of endogenous Fn underneath the ZP together with integrin alpha(5) expression on oolemma and acrosome-reacted (AR) sperm cell surface suggests a 'velcro' interaction between the endogenous Fn ligand and corresponding receptors on both (AR) sperm cell and oolemma, initiating sperm-egg binding.
Thermal effects in laser-assisted embryo hatching
NASA Astrophysics Data System (ADS)
Douglas-Hamilton, Diarmaid H.; Conia, Jerome D.
2000-08-01
Diode lasers [(lambda) equals 1480 nm] are used with in-vitro fertilization [IVF] as a promoter of embryo hatching. A focused laser beam is applied in vitro to form a channel in the zona pellucida (shell) of the pre-embryo. After transfer into the uterus, the embryo hatches: it extrudes itself through the channel and implants into the uterine wall. Laser-assisted hatching can result in improving implantation and pregnancy success rates. We present examples of zone pellucida ablation using animal models. In using the laser it is vital not to damage pre-embryo cells, e.g. by overheating. In order to define safe regimes we have derived some thermal side-effects of zona pellucida removal. The temperature profile in the beam and vicinity is predicted as function of laser pulse duration and power. In a crossed-beam experiment a HeNe laser probe detects the temperature-induced change in refractive index. We find that the diode laser beam produces superheated water approaching 200 C on the beam axis. Thermal histories during and following the laser pulse are given for regions in the neighborhood of the beam. We conclude that an optimum regime exists with pulse duration
Effects of advanced selection methods on sperm quality and ART outcome.
Yetunde, I; Vasiliki, M
2013-10-01
In assisted reproductive technology (ART), the role of spermatozoa has evolved over the years. In the past, early methods of selecting sperm for ART only focused on selecting motile and morphologically normal appearing sperm. It has become evident that these methods are inefficient in identifying the most suitable sperm for fertilization. Novel methods have thus been created to identify highly motile, morphologically normal, viable non-apoptotic spermatozoa with intact membranes and high DNA integrity for use in ART. These advanced methods of selection utilize our knowledge of unique characteristics of sperm, such as sperm surface charge, the presence of hyaluronic acid binding sites on sperm, sperm ultramorphology, markers of apoptosis and zona pellucida binding on sperm. These methods have shown potential promise in improving ART outcomes. Future developments may include Raman spectroscopy, confocal light absorption and scattering spectroscopic microscopy, and polarization microscopy. While these novel techniques have potential, they come with a cost burden and further studies are required to demonstrate their impact on ART outcomes. Furthermore, clinicians and human reproductive scientists need to continue to gather knowledge about human fertilization and determine the most physiological methods of sperm selection.
Unresolved issues in mammalian fertilization.
Olds-Clarke, Patricia
2003-01-01
This review considers the role of the sperm in fertilization, addressing areas of misunderstanding and unfounded assumptions and taking particular advantage of the large body of data resulting from work with rodent species in vitro. Considerable attention is given to the appropriate use and interpretation of assays for capacitation, acrosomal exocytosis, hyperactivation, and sperm protein phosphorylation, as well as tests for sperm-zona and sperm-oocyte membrane interactions. The lack of general agreement on the means of sperm adhesion to and penetration of the zona pellucida is addressed, and the need for new approaches to this problem is pointed out. Some molecular advances in our understanding of specific steps in the process of fertilization are discussed in the context of intact cell-matrix and cell-cell interaction. This review should provide practical information for researchers just beginning the study of fertilization and interesting but not widely known observations to stimulate new ideas in experienced scientists.
International Validation of Two Human Recombinant Estrogen Receptor (ERa) Binding Assays
An international validation study has been successfully completed for 2 competitive binding assays using human recombinant ERa. Assays evaluated included the Freyberger-Wilson (FW) assay using a full length human ER, and the Chemical Evaluation and Research Institute (CERI) assay...
Adaptive Focused Acoustics (AFA) Improves the Performance of Microtiter Plate ELISAs.
Green, David J; Rudd, Edwin A; Laugharn, James A
2014-08-01
We investigated the use of Adaptive Focused Acoustics (AFA) technology to improve the performance of microtiter plate enzyme-linked immunosorbent assays (ELISAs). Experiments were performed with commercially available AFA instrumentation and off-the-shelf 96-well microtiter plate sandwich ELISAs. AFA was applied over a range of acoustic energies, temperatures, and durations to the antigen/antibody binding step of an ELISA for measuring HIV-1 p24 in tissue culture samples. AFA-mediated antigen/antibody binding was enhanced up to 2-fold over passive binding at comparable temperatures and was superior or comparable at low temperature (8-10 °C) to passive binding at 37 °C. Lower nonspecific binding (NSB), lower inter- and intra-assay coefficients of variation (CVs), higher Z' factors, and lower limits of detection (LODs) were measured in AFA-mediated assays compared with conventional passive binding. In a more limited study, AFA enhancement of antigen/antibody binding and lower NSB was measured in an ELISA for measuring IGFBP-3 in human plasma. We conclude from this study that application of AFA to antigen/antibody binding steps in microtiter plate ELISAs can enhance key assay performance parameters, particularly Z' factors and LODs. These features render AFA-mediated binding assays potentially more useful in applications such as high-throughput screening and in vitro diagnostics than assays processed with conventional passive antigen/antibody binding steps. © 2014 Society for Laboratory Automation and Screening.
Integrated Summary Report: Validation of Two Binding Assays ...
This Integrated Summary Report (ISR) summarizes, in a single document, the results from an international multi-laboratory validation study conducted for two in vitro estrogen receptor (ER) binding assays. These assays both use human recombinant estrogen receptor, alpha subtype (hrERα), to identify chemicals that may impact estrogen signaling through binding to the ER. The purpose of the ISR is to support the peer review of the findings obtained during the validation process.The two assays evaluated during this validation process are: The Freyberger-Wilson Assay (FW) using a full length human ER, and The Chemical Evaluation and Research Institute (CERI) Assay using a ligand-binding domain of the human ER.The two assays are mechanistically and functionally similar in that each measures the ability of a test chemical to competitively inhibit binding of [3H]17β-estradiol to the human recombinant ER. The essential elements of the FW and the CERI assays were developed at the laboratories of Bayer Pharma AG, Wuppertal, Germany (Freyberger et al., 2010) and CERI, Tokyo, Japan (Akahori et al., 2008), respectively.The ER competitive binding assay has long been in use, and is a well characterized approach, but historically uses rodent or other animal tissues as a source of the ER. Validation of the FW and CERI assays using human recombinant estrogen receptors ( subtype) will provide an updated alternative for the Agency’s current test guideline (OPPTS 89
Detection of biotin in individual sea urchin oocytes using a bioluminescence binding assay.
Feltus, A; Grosvenor, A L; Conover, R C; Anderson, K W; Daunert, S
2001-04-01
The ability to detect biomolecules in single cells is important in order to fully understand the processes by which many biochemical events occur. To that end, we have developed a bioluminescence binding assay capable of measuring the intracellular biotin content of individual cells. The assay depends on competition between an aequorin-biotin conjugate (AEQ-biotin) and free biotin within the oocytes for binding sites on the protein avidin. The assay is performed by microinjecting each component into the oocytes and following the resulting bioluminescence within the oocyte upon triggering of aequorin. Results obtained using sea urchin oocytes show that the assay performed within the cells behaves in a manner consistent with assay theory. Using the assay, the individual biotin content of the oocytes is an average of approximately 20 amol. To our knowledge, this is the first reported multicomponent binding assay to be performed inside an intact single cell.
Sussa, Fábio V; Damatto, Sandra R; Alencar, Marcos M; Mazzilli, Barbara P; Silva, Paulo S C
2013-02-01
The concentration of (238)U, (232)Th, (230)Th, (226)Ra, (228)Ra and (210)Pb were determined in samples of Peperomia pellucida and in the surrounding soil, by alpha spectrometry and gross alpha and beta counting. The radionuclide activity concentrations ranged from 4.3 to 38 Bq kg(-1), 1.7-124 Bq kg(-1), 2.1-38 Bq kg(-1), 8.5-37 Bq kg(-1), 3.2-46 Bq kg(-1), 39-93 Bq kg(-1), respectively. In the plant extractions and infusions as used for consumption, the mean recoveries were from 23% to 60% in maceration and 24-75% in infusion. Copyright © 2012 Elsevier Ltd. All rights reserved.
Development of binding assays in microfabricated picoliter vials: an assay for biotin.
Grosvenor, A L; Feltus, A; Conover, R C; Daunert, S; Anderson, K W
2000-06-01
A homogeneous binding assay for the detection of biotin in picoliter vials was developed using the photoprotein aequorin as the label. The binding assay was based on the competition of free biotin with biotinylated aequorin (AEQ-biotin) for avidin. A sequential protocol was used, and modification of the assay to reduce the number of steps was examined. Results showed that detection limits on the order of 10(-14) mol of biotin were possible. Reducing the number of steps provided similar detection limits but only if the amount of avidin used was decreased. These binding assays based on picoliter volumes have potential applications in a variety of fields, including microanalysis and single-cell analysis, where the amount of sample is limited. In addition, these assays are suitable for the high-throughput screening of biopharmaceuticals.
Impact of SPR biosensor assay configuration on antibody: Neonatal Fc receptor binding data
Wang, Xiangdan; McKay, Patrick; Dutina, George; Hass, Philip E.; Nijem, Ihsan; Allison, David; Cowan, Kyra J.; Lin, Kevin; Quarmby, Valerie; Yang, Jihong
2017-01-01
ABSTRACT Binding interactions with the neonatal Fc receptor (FcRn) are one determinant of pharmacokinetic properties of recombinant human monoclonal antibody (rhumAb) therapeutics, and a conserved binding motif in the crystallizable fragment (Fc) region of IgG molecules interacts with FcRn. Surface plasmon resonance (SPR) biosensor assays are often used to characterize interactions between FcRn and rhumAb therapeutics. In such assays, generally either the rhumAb (format 1) or the FcRn protein (format 2) is immobilized on a biosensor chip. However, because evidence suggests that, in some cases, the variable domains of a rhumAb may also affect FcRn binding, we evaluated the effect of SPR assay configuration on binding data. We sought to assess FcRn binding properties of 2 rhumAbs (rhumAb1 and rhumAb2) to FcRn proteins using these 2 biosensor assay formats. The two rhumAbs have greater than 99% sequence identity in the Fc domain but differ in their Fab regions. rhumAb2 contains a positively charged patch in the variable domain that is absent in rhumAb1. Our results showed that binding of rhumAb1 to FcRn was independent of biosensor assay configuration, while binding of rhumAb2 to FcRn was highly SPR assay configuration dependent. Further investigations revealed that the format dependency of rhumAb2-FcRn binding is linked to the basic residues that form a positively charged patch in the variable domain of rhumAb2. Our work highlights the importance of analyzing rhumAb-FcRn binding interactions using 2 alternate SPR biosensor assay configurations. This approach may also provide a simple way to identify the potential for non-Fc-driven FcRn binding interactions in otherwise typical IgGs. PMID:28001487
Bentley, Marvin; Decker, Helena; Luisi, Julie
2015-01-01
Identifying the proteins that regulate vesicle trafficking is a fundamental problem in cell biology. In this paper, we introduce a new assay that involves the expression of an FKBP12-rapamycin–binding domain–tagged candidate vesicle-binding protein, which can be inducibly linked to dynein or kinesin. Vesicles can be labeled by any convenient method. If the candidate protein binds the labeled vesicles, addition of the linker drug results in a predictable, highly distinctive change in vesicle localization. This assay generates robust and easily interpretable results that provide direct experimental evidence of binding between a candidate protein and the vesicle population of interest. We used this approach to compare the binding of Kinesin-3 family members with different endosomal populations. We found that KIF13A and KIF13B bind preferentially to early endosomes and that KIF1A and KIF1Bβ bind preferentially to late endosomes and lysosomes. This assay may have broad utility for identifying the trafficking proteins that bind to different vesicle populations. PMID:25624392
Rojas-Martínez, Raúl; Arrieta, Jesús; Cruz-Antonio, Leticia; Arrieta-Baez, Daniel; Velázquez-Méndez, Antonio Magdiel; Sánchez-Mendoza, María Elena
2013-09-13
Peperomia pellucida is a plant used in traditional medicine to treat gastric ulcers. Although this gastroprotective activity was reported, the active compounds have not been identified. Therefore, the aim herein was to identify the most active compound in the gastroprotective activity of P. pellucida using an ethanol-induced gastric ulcer experimental rat model. A gastroprotective effect was observed when the hexane and dichloromethane extracts were tested, with the higher effect being obtained with the dichloromethane extract (82.3 ± 5.6%) at 100 mg/kg. Dillapiole was identified as the most active compound in this extract. Although there have been previous reports on dillapiole, this is the first on its gastroprotective activity. Rats treated with this compound at 3, 10, 30 and 100 mg/kg showed 23.1, 56.1, 73.2 and 85.5% gastroprotection, respectively. The effect elicited by dillapiole at 100 mg/kg was not attenuated by pretreatment with indomethacin (10 mg/kg, s.c.), a prostaglandin synthesis blocker, NG-nitro-l-arginine methyl ester (70 mg/kg, i.p.), a nitric oxide (NO) synthase inhibitor, or N-ethylmaleimide (10 mg/kg, s.c.), a blocker of sulfhydryl groups. This suggests that the gastroprotective mechanism of action of dillapiole does not involve prostaglandins, NO or sulfhydryl groups.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Moricard, R.; Gothie, S.; Rodriguez-Galindo, M.
1959-10-31
From ovulation to nidation in the uterus, the spermatozoa, the second order ovocyte, and the fertilized egg are free in the genital secretions whose sulfur amount depends on ovarian hormones. The spermatozoa can fix S/sup 35/ in vitro and they seem to be able to metabolize this element during their ascent through the genital tract. In the uterus and in the mucosa of the cervix, there is an intense and fast metabolism of the S/sup 35/ in the guinea pig. In the fallopian tube, fecondation takes place in the secretions in which S/sup 35/ metabolism is at the highest degreemore » at fertilization. As soon as the second polar body is expelled, the pellucida has a very high concentration of S/sup 35/, whether the latter is injected in the form of Na/sub 2/S/sup 35/O/sub 4/ or cystine. This concentration is not only due to fertilization, it appears also in unfertilized eggs. In vitro cultures of ovarian ovocytes, tubal eggs, and uterine blastocytes show the protective part played by the pellucida and its concentrating power, a function which does not seem to be performed by the pellucida of first-order ovocytes. (auth)« less
Chen, Xun; Stout, Steven; Mueller, Uwe; Boykow, George; Visconti, Richard; Siliphaivanh, Phieng; Spencer, Kerrie; Presland, Jeremy; Kavana, Michael; Basso, Andrea D; McLaren, David G; Myers, Robert W
2017-08-01
We have developed and validated label-free, liquid chromatography-mass spectrometry (LC-MS)-based equilibrium direct and competition binding assays to quantitate small-molecule antagonist binding to recombinant human and mouse BLT1 receptors expressed in HEK 293 cell membranes. Procedurally, these binding assays involve (1) equilibration of the BLT1 receptor and probe ligand, with or without a competitor; (2) vacuum filtration through cationic glass fiber filters to separate receptor-bound from free probe ligand; and (3) LC-MS analysis in selected reaction monitoring mode for bound probe ligand quantitation. Two novel, optimized probe ligands, compounds 1 and 2, were identified by screening 20 unlabeled BLT1 antagonists for direct binding. Saturation direct binding studies confirmed the high affinity, and dissociation studies established the rapid binding kinetics of probe ligands 1 and 2. Competition binding assays were established using both probe ligands, and the affinities of structurally diverse BLT1 antagonists were measured. Both binding assay formats can be executed with high specificity and sensitivity and moderate throughput (96-well plate format) using these approaches. This highly versatile, label-free method for studying ligand binding to membrane-associated receptors should find broad application as an alternative to traditional methods using labeled ligands.
Predicting changes in cardiac myocyte contractility during early drug discovery with in vitro assays
DOE Office of Scientific and Technical Information (OSTI.GOV)
Morton, M.J., E-mail: michael.morton@astrazeneca.com; Armstrong, D.; Abi Gerges, N.
2014-09-01
Cardiovascular-related adverse drug effects are a major concern for the pharmaceutical industry. Activity of an investigational drug at the L-type calcium channel could manifest in a number of ways, including changes in cardiac contractility. The aim of this study was to define which of the two assay technologies – radioligand-binding or automated electrophysiology – was most predictive of contractility effects in an in vitro myocyte contractility assay. The activity of reference and proprietary compounds at the L-type calcium channel was measured by radioligand-binding assays, conventional patch-clamp, automated electrophysiology, and by measurement of contractility in canine isolated cardiac myocytes. Activity inmore » the radioligand-binding assay at the L-type Ca channel phenylalkylamine binding site was most predictive of an inotropic effect in the canine cardiac myocyte assay. The sensitivity was 73%, specificity 83% and predictivity 78%. The radioligand-binding assay may be run at a single test concentration and potency estimated. The least predictive assay was automated electrophysiology which showed a significant bias when compared with other assay formats. Given the importance of the L-type calcium channel, not just in cardiac function, but also in other organ systems, a screening strategy emerges whereby single concentration ligand-binding can be performed early in the discovery process with sufficient predictivity, throughput and turnaround time to influence chemical design and address a significant safety-related liability, at relatively low cost. - Highlights: • The L-type calcium channel is a significant safety liability during drug discovery. • Radioligand-binding to the L-type calcium channel can be measured in vitro. • The assay can be run at a single test concentration as part of a screening cascade. • This measurement is highly predictive of changes in cardiac myocyte contractility.« less
Alleti, Ramesh; Vagner, Josef; Dehigaspitiya, Dilani Chathurika; Moberg, Valerie E; Elshan, N G R D; Tafreshi, Narges K; Brabez, Nabila; Weber, Craig S; Lynch, Ronald M; Hruby, Victor J; Gillies, Robert J; Morse, David L; Mash, Eugene A
2013-09-01
Probes for use in time-resolved fluorescence competitive binding assays at melanocortin receptors based on the parental ligands MSH(4), MSH(7), and NDP-α-MSH were prepared by solid phase synthesis methods, purified, and characterized. The saturation binding of these probes was studied using HEK-293 cells engineered to overexpress the human melanocortin 4 receptor (hMC4R) as well as the human cholecystokinin 2 receptor (hCCK2R). The ratios of non-specific binding to total binding approached unity at high concentrations for each probe. At low probe concentrations, receptor-mediated binding and uptake was discernable, and so probe concentrations were kept as low as possible in determining Kd values. The Eu-DTPA-PEGO-MSH(4) probe exhibited low specific binding relative to non-specific binding, even at low nanomolar concentrations, and was deemed unsuitable for use in competition binding assays. The Eu-DTPA-PEGO probes based on MSH(7) and NDP-α-MSH exhibited Kd values of 27±3.9nM and 4.2±0.48nM, respectively, for binding with hMC4R. These probes were employed in competitive binding assays to characterize the interactions of hMC4R with monovalent and divalent MSH(4), MSH(7), and NDP-α-MSH constructs derived from squalene. Results from assays with both probes reflected only statistical enhancements, suggesting improper ligand spacing on the squalene scaffold for the divalent constructs. The Ki values from competitive binding assays that employed the MSH(7)-based probe were generally lower than the Ki values obtained when the probe based on NDP-α-MSH was employed, which is consistent with the greater potency of the latter probe. The probe based on MSH(7) was also competed with monovalent, divalent, and trivalent MSH(4) constructs that previously demonstrated multivalent binding in competitive binding assays against a variant of the probe based on NDP-α-MSH. Results from these assays confirm multivalent binding, but suggest a more modest increase in avidity for these MSH(4) constructs than was previously reported. Copyright © 2013 Elsevier Ltd. All rights reserved.
Kessler, Jan H; Mommaas, Bregje; Mutis, Tuna; Huijbers, Ivo; Vissers, Debby; Benckhuijsen, Willemien E; Schreuder, Geziena M Th; Offringa, Rienk; Goulmy, Els; Melief, Cornelis J M; van der Burg, Sjoerd H; Drijfhout, Jan W
2003-02-01
We report the development, validation, and application of competition-based peptide binding assays for 13 prevalent human leukocyte antigen (HLA) class I alleles. The assays are based on peptide binding to HLA molecules on living cells carrying the particular allele. Competition for binding between the test peptide of interest and a fluorescein-labeled HLA class I binding peptide is used as read out. The use of cell membrane-bound HLA class I molecules circumvents the need for laborious biochemical purification of these molecules in soluble form. Previously, we have applied this principle for HLA-A2 and HLA-A3. We now describe the assays for HLA-A1, HLA-A11, HLA-A24, HLA-A68, HLA-B7, HLA-B8, HLA-B14, HLA-B35, HLA-B60, HLA-B61, and HLA-B62. Together with HLA-A2 and HLA-A3, these alleles cover more than 95% of the Caucasian population. Several allele-specific parameters were determined for each assay. Using these assays, we identified novel HLA class I high-affinity binding peptides from HIVpol, p53, PRAME, and minor histocompatibility antigen HA-1. Thus these convenient and accurate peptide-binding assays will be useful for the identification of putative cytotoxic T lymphocyte epitopes presented on a diverse array of HLA class I molecules.
Zhu, Li; Hwang, Peter; Witkowska, H. Ewa; Liu, Haichuan; Li, Wu
2014-01-01
Tooth enamel is the hardest tissue in vertebrate animals. Consisting of millions of carbonated hydroxyapatite crystals, this highly mineralized tissue develops from a protein matrix in which amelogenin is the predominant component. The enamel matrix proteins are eventually and completely degraded and removed by proteinases to form mineral-enriched tooth enamel. Identification of the apatite-binding motifs in amelogenin is critical for understanding the amelogenin–crystal interactions and amelogenin–proteinases interactions during tooth enamel biomineralization. A stepwise strategy is introduced to kinetically and quantitatively identify the crystal-binding motifs in amelogenin, including a peptide screening assay, a competitive adsorption assay, and a kinetic-binding assay using amelogenin and gene-engineered amelogenin mutants. A modified enzyme-linked immunosorbent assay on crystal surfaces is also applied to compare binding amounts of amelogenin and its mutants on different planes of apatite crystals. We describe the detailed protocols for these assays and provide the considerations for these experiments in this chapter. PMID:24188774
2015-01-01
The marine dinoflagellate Karenia brevis produces a family of neurotoxins known as brevetoxins. Brevetoxins elicit their effects by binding to and activating voltage-sensitive sodium channels (VSSCs) in cell membranes. K. brevis also produces brevenal, a brevetoxin antagonist, which is able to inhibit and/or negate many of the detrimental effects of brevetoxins. Brevenal binding to VSSCs has yet to be fully characterized, in part due to the difficulty and expense of current techniques. In this study, we have developed a novel fluorescence binding assay for the brevenal binding site. Several fluorescent compounds were conjugated to brevenal to assess their effects on brevenal binding. The assay was validated against the radioligand assay for the brevenal binding site and yielded comparable equilibrium inhibition constants. The fluorescence-based assay was shown to be quicker and far less expensive and did not generate radioactive waste or need facilities for handling radioactive materials. In-depth studies using the brevenal conjugates showed that, while brevenal conjugates do bind to a binding site in the VSSC protein complex, they are not displaced by known VSSC site specific ligands. As such, brevenal elicits its action through a novel mechanism and/or currently unknown receptor site on VSSCs. PMID:25226846
Avoiding false positives and optimizing identification of true ...
The potential for chemicals to affect endocrine signaling is commonly evaluated via in vitro receptor binding and gene activation, but these assays, especially antagonism assays, have potential artifacts that must be addressed for accurate interpretation. Results are presented from screening 94 chemicals from 54 chemical groups for estrogen receptor (ER) activation in a competitive rainbow trout ER (rtER) binding assay and a trout liver slice vitellogenin mRNA expression assay. Results from true competitive agonists and antagonists, and inactive chemicals with little or no indication of ER binding or gene activation were easily interpreted. However, results for numerous industrial chemicals were more challenging to interpret, including chemicals with: (1) apparent competitive binding curves but no gene activation, (2) apparent binding and gene inhibition with evidence of either cytotoxicity or changes in assay media pH, (3) apparent binding but non-competitive gene inhibition of unknown cause, or (4) no rtER binding and gene inhibition not due to competitive ER interaction but due to toxicity, pH change, or some unknown cause. The use of endpoints such as toxicity, pH, precipitate formation, and determination of inhibitor dissociation constants (Ki) for interpreting the results of antagonism and binding assays for diverse chemicals is presented. Of the 94 chemicals tested for antagonism only two, tamoxifen and ICI-182,780, were found to be true competitive
Wang, Jia-Hui; Shao, Xiao-Xia; Hu, Meng-Jun; Wei, Dian; Liu, Ya-Li; Xu, Zeng-Guang; Guo, Zhan-Yun
2017-05-01
Relaxin family peptide receptor 3 (RXFP3) is an A-class G protein-coupled receptor that is implicated in the regulation of food intake and stress response upon activation by its cognate agonist relaxin-3. To study its interaction with various ligands, we developed a novel bioluminescence resonance energy transfer (BRET)-based binding assay using the brightest NanoLuc as an energy donor and a newly developed cyan-excitable orange fluorescent protein (CyOFP) as an energy acceptor. An engineered CyOFP without intrinsic cysteine residues but with an introduced cysteine at the C-terminus was overexpressed in Escherichia coli and chemically conjugated to the A-chain N-terminus of an easily labeled chimeric R3/I5 peptide via an intermolecular disulfide linkage. After the CyOFP-conjugated R3/I5 bound to a shortened human RXFP3 (removal of 33 N-terminal residues) fused with the NanoLuc reporter at the N-terminus, high BRET signals were detected. Saturation binding and real-time binding assays demonstrated that this BRET pair retained high binding affinity with fast association/dissociation. Using this BRET pair, binding potencies of various ligands with RXFP3 were conveniently measured through competition binding assays. Thus, the novel BRET-based binding assay facilitates interaction studies of RXFP3 with various ligands. The engineered CyOFP without intrinsic cysteine residues may also be applied to other BRET-based binding assays in future studies.
Poda, Suresh B; Kobayashi, Masakazu; Nachane, Ruta; Menon, Veena; Gandhi, Adarsh S; Budac, David P; Li, Guiying; Campbell, Brian M; Tagmose, Lena
2015-10-01
Kynurenine 3-monooxygenase (KMO), a pivotal enzyme in the kynurenine pathway, was identified as a potential therapeutic target for treating neurodegenerative and psychiatric disorders. In this article, we describe a surface plasmon resonance (SPR) assay that delivers both kinetics and the mechanism of binding (MoB) data, enabling a detailed characterization of KMO inhibitors for the enzyme in real time. SPR assay development included optimization of the protein construct and the buffer conditions. The stability and inhibitor binding activity of the immobilized KMO were significantly improved when the experiments were performed at 10°C using a buffer containing 0.05% n-dodecyl-β-d-maltoside (DDM) as the detergent. The KD values of the known KMO inhibitors (UPF648 and RO61-8048) from the SPR assay were in good accordance with the biochemical LC/MS/MS assay. Also, the SPR assay was able to differentiate the binding kinetics (k(a) and k(d)) of the selected unknown KMO inhibitors. For example, the inhibitors that showed comparable IC50 values in the LC/MS/MS assay displayed differences in their residence time (τ = 1/k(d)) in the SPR assay. To better define the MoB of the inhibitors to KMO, an SPR-based competition assay was developed, which demonstrated that both UPF648 and RO61-8048 bound to the substrate-binding site. These results demonstrate the potential of the SPR assay for characterizing the affinity, the kinetics, and the MoB profiles of the KMO inhibitors.
Evaluation of potential endocrine activity of 2,4-dichlorophenoxyacetic acid using in vitro assays.
Coady, Katherine K; Kan, H Lynn; Schisler, Melissa R; Gollapudi, B Bhaskar; Neal, Barbara; Williams, Amy; LeBaron, Matthew J
2014-08-01
The herbicide 2,4-dichlorophenoxyacetic acid (2,4-D) was evaluated in five in vitro screening assays to assess the potential for interaction with the androgen, estrogen and steroidogenesis pathways in the endocrine system. The assays were conducted to meet the requirements of the in vitro component of Tier 1 of the United States Environmental Protection Agency's Endocrine Disruptor Screening Program (EDSP), and included assays for estrogen receptor (ER) binding (rat uterine cytosol ER binding assay), ER-mediated transcriptional activation (HeLa-9903-ERα transactivation assay), androgen receptor (AR) binding (rat prostate cytosol AR binding assay), aromatase enzymatic activity inhibition (recombinant human CYP19 aromatase inhibition assay), and interference with steroidogenesis (H295R steroidogenesis assay). Results from these five assays demonstrated that 2,4-D does not have the potential to interact in vitro with the estrogen, androgen, or steroidogenesis pathways. These in vitro data are consistent with a corresponding lack of endocrine effects observed in apical in vivo animal studies, and thus provide important supporting data valuable in a comprehensive weight of evidence evaluation indicating a low potential of 2,4-D to interact with the endocrine system. Copyright © 2014 Elsevier Ltd. All rights reserved.
Wu, Qing-Ping; Zhang, Lei; Shao, Xiao-Xia; Wang, Jia-Hui; Gao, Yu; Xu, Zeng-Guang; Liu, Ya-Li; Guo, Zhan-Yun
2016-04-01
Relaxin is a prototype of the relaxin family peptide hormones and plays important biological functions by binding and activating the G protein-coupled receptor RXFP1. To study their interactions, in the present work, we applied the newly developed bioluminescent ligand-receptor binding assay to the relaxin-RXFP1 system. First, a fully active easily labeled relaxin, in which three Lys residues of human relaxin-2 were replaced by Arg, was prepared through overexpression of a single-chain precursor in Pichia pastoris and in vitro enzymatic maturation. Thereafter, the B-chain N-terminus of the easily labeled relaxin was chemically cross-linked with a C-terminal cysteine residue of an engineered NanoLuc through a disulfide linkage. Receptor-binding assays demonstrated that the NanoLuc-conjugated relaxin retained high binding affinity with the receptor RXFP1 (K d = 1.11 ± 0.08 nM, n = 3) and was able to sensitively monitor binding of a variety of ligands with RXFP1. Using the novel bioluminescent binding assay, we demonstrated that three highly conserved B-chain Arg residues of relaxin-3 had distinct contributions to binding of the receptor RXFP1. In summary, our present work provides a novel bioluminescent ligand-receptor binding assay for the relaxin-RXFP1 system to facilitate their interaction studies, such as characterization of relaxin analogues or screening novel agonists or antagonists of RXFP1.
Bodri, Daniel; Kato, Ryutaro; Kondo, Masae; Hosomi, Naoko; Katsumata, Yoshinari; Kawachiya, Satoshi; Matsumoto, Tsunekazu
2015-05-01
To report time-lapse monitoring of human oocytes in which the damaged zona pellucida was removed, producing zona-free (ZF) oocytes that were cultured until the blastocyst stage in time-lapse incubators. Retrospective case series. Private infertility clinic. Infertile patients (n = 32) undergoing minimal ovarian stimulation or natural cycle IVF treatment between October 2012 and June 2014. Intracytoplasmic sperm injection (ICSI) fertilization of ZF oocytes, prolonged embryo culture in time-lapse incubators, elective vitrification, and subsequent single vitrified-thawed blastocyst transfer (SVBT). Rate of fertilization, cleavage and blastocyst development, live-birth rate per SVBT cycle. In spite of advanced maternal age (39 ± 4.2; range, 30-46 years), good fertilization (94%), cleavage (94%), and blastocyst development rates (38%) were reached after fertilization and culturing of ZF oocytes/embryos. All thawed ZF blastocysts survived, and up to this date seven SVBT transfers were performed, yielding three (43%) term live births with healthy newborns. Time-lapse imagery gives a unique insight into the dynamics of embryo development in ZF embryos. Moreover, our case series demonstrate that an oocyte with a damaged zona pellucida that has been removed could be successfully fertilized with ICSI, cultured until blastocyst stage in a time-lapse incubator and vitrified electively for subsequent use. Copyright © 2015 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.
Mori, Chiemi; Yabuuchi, Akiko; Ezoe, Kenji; Murata, Nana; Takayama, Yuko; Okimura, Tadashi; Uchiyama, Kazuo; Takakura, Kei; Abe, Hiroyuki; Wada, Keiko; Okuno, Takashi; Kobayashi, Tamotsu; Kato, Keiichi
2015-06-01
Hydroxypropyl cellulose (HPC) was investigated as a replacement for serum substitute supplement (SSS) for use in cryoprotectant solutions for embryo vitrification. Mouse blastocysts from inbred (n = 1056), hybrid (n = 128) strains, and 121 vitrified blastocysts donated by infertile patients (n = 102) were used. Mouse and human blastocysts, with or without zona pellucida, were vitrified and warmed in either 1% or 5% HPC or in 5% or 20% SSS-supplemented media using the Cryotop (Kitazato BioPharma Co. Ltd, Fuji, Japan) method, and the survival and oxygen consumption rates were assessed. Viscosity of each vitrification solution was compared. Survival rates of mouse hybrid blastocysts and human zona pellucida-intact blastocysts were comparable among the groups. Mouse and human zona pellucida-free blastocysts, which normally exhibit poor cryoresistance, showed significantly higher survival rates in 5% HPC than 5% SSS (P < 0.05). The 5% HPC-supplemented vitrification solution showed a significantly higher viscosity (P < 0.05). The blastocysts were easily detached from the Cryotop strip during warming when HPC-supplemented vitrification solution was used. The oxygen consumption rates were similar between non-vitrified and 5% HPC groups. The results suggest possible use of HPC for supplementation of cryoprotectant solutions and provide useful information to improve vitrification protocols. Copyright © 2015 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.
Kitchener, Anne L; Harman, Amanda; Kay, David J; McCartney, Carmen A; Mate, Karen E; Rodger, John C
2009-01-01
This study examined the potential of a recombinant marsupial zona pellucida 3 protein as a contraceptive vaccine for the Eastern Grey kangaroo, a marsupial that is locally overabundant in several regions of eastern Australia. First, a pilot study using porcine zona pellucidae (PZP) demonstrated that ZP proteins, primarily the ZP3 component of PZP, are highly immunogenic in the grey kangaroo and produce a long-lasting humoral response to a single immunisation, as found in other marsupials. Immunisation with 300 microg of a non-glycosylated recombinant brushtail possum ZP3 (recBP-ZP3) protein in complete Freund's adjuvant produced a similar, significant and sustained antibody response, and none of the immunised kangaroos (n=7) produced offspring during the following breeding season compared with four out of the six control animals. An epitope analysis of the B-cell response to recBP-ZP3 using a brushtail possum ZP3 identified numerous B-cell epitope regions clustered around the N- and C-terminal regions of the protein. Two regions of interest for further fertility vaccine development based on their immunogenicity and fertility trials and functional studies in other species were found to be immunogenic. These results suggest that immunocontraception based on targeting the ZP3 protein within the zona pellucida may be an effective strategy for fertility reduction in Eastern Grey kangaroos.
Low physiological levels of prostaglandins E2 and F2α improve human sperm functions.
Rios, Mariana; Carreño, Daniela V; Oses, Carolina; Barrera, Nelson; Kerr, Bredford; Villalón, Manuel
2016-03-01
Prostaglandins (PGs) have been reported to be present in the seminal fluid and cervical mucus, affecting different stages of sperm maturation from spermatogenesis to the acrosome reaction. This study assessed the effects of low physiological PGE2 and PGF2α concentrations on human sperm motility and on the ability of the spermatozoa to bind to the zona pellucida (ZP). Human spermatozoa were isolated from seminal samples with normal concentration and motility parameters and incubated with 1μM PGE2, 1μM PGF2α or control solution to determine sperm motility and the ability to bind to human ZP. The effects of both PGs on intracellular calcium levels were determined. Incubation for 2 or 18h with PGE2 or PGF2α resulted in a significant (P<0.05) increase in the percentage of spermatozoa with progressive motility. In contrast with PGF2α, PGE2 alone induced an increase in sperm intracellular calcium levels; however, the percentage of sperm bound to the human ZP was doubled for both PGs. These results indicate that incubation of human spermatozoa with low physiological levels of PGE2 or PGF2α increases sperm functions and could improve conditions for assisted reproduction protocols.
HPV binding assay to Laminin-332/integrin α6β4 on human keratinocytes.
Brendle, Sarah A; Christensen, Neil D
2015-01-01
Human papillomaviruses (HPVs) have been shown to bind to Laminin-332 (Ln-332) on the extracellular matrix (ECM) secreted by human keratinocytes. The assay described here is an important tool to study HPV receptor binding to the ECM. The assay can also be modified to study the receptors required for HPV infection and for binding to tissues. We previously showed that Ln-332 is essential for the binding of HPV11 to human keratinocytes and that infectious entry of HPV11 requires α6β4 integrin for the transfer of HPV11 from ECM to host cells (Culp et al., J Virol 80:8940-8950, 2006). We also demonstrated that several of the high-risk HPV types (16, 18, 31 and 45) bind to Ln-332 and/or other components of the ECM in vitro (Broutian et al., J Gen Virol 91:531-540, 2010). The exact binding and internalization mechanism(s) for HPV are still under investigation. A better understanding of these mechanisms will aid in the design of therapeutics against HPVs and ultimately help prevent many cancers. In this chapter, we describe the HPV binding assay to Ln-332/integrin α6β4 on human keratinocytes (ECM). We also present data and suggestions for modifying the assay for testing the specificity of HPV for receptors (by blocking receptors) and binding to human tissues (basement membrane, BM) in order to study binding mechanisms.
Two subunits of the 55 K porcine zona pellucida glycoprotein family are immunologically distinct
DOE Office of Scientific and Technical Information (OSTI.GOV)
Subramanian, M.G.; Yurewicz, E.C.; Sacco, A.G.
1986-03-01
The 55K glycoprotein family (ZP3) of the porcine zona pellucida is comprised of two subunits of 46 K and 45 K which can be resolved by endo-..beta..-galactosidase digestion of ZP3 followed by reversed phase HPLC on Vydac C4 resin. Gel electrophoresis revealed that the 46 K component (EBDG..cap alpha..) is approx. 95% pure and the 45 K component (EBGD..beta..) is 100% pure. In the present study, these two subunits were evaluated immunologically by RIA. Under similar reaction protocols (chloramine-T iodination procedure) comparable specific activities were obtained for EBGD..cap alpha.. (33.06 +/- 7.5 ..mu..ci/..mu..gm), EBGD..beta.. (30.45 +/- 1.6) and ZP3 (26.3more » +/- 1.3). Antibody (Ab) titration studies revealed that EBGD..cap alpha.. and ..beta.. are potent immunogens and /sup 125/I-EBGD..cap alpha.. showed minimal cross reactivity to EBGD..beta..-Ab (8% bound at 1:500 dilution), whereas, /sup 125/I-EBGD..beta.. showed a greater degree of cross reactivity to EBGD..cap alpha..-Ab (23% bound at 1:500 dilution). Maximum binding for the two labeled antigens against homologous Abs (1:500) was > 60%. Dose response studies revealed that in the /sup 125/I-EBGD..cap alpha.. vs EBGD..cap alpha.. -Ab system, the 50% intercept was 3.25 +/- 0.32 ng for EBGD..cap alpha.. and 472.43 +/- 30.26 ng for EBGD..beta.. (p < 0.01), whereas, in the /sup 125/I-EBGD..beta.. vs EBGD..beta..-Ab system the 50% intercept was 3.51 +/- 0.58 for EBGD..beta.. and 166.77 +/- 49.20 for EBGD..cap alpha.. (p < 0.01). No significant differences were observed in the slopes of the dose response curves. It is concluded that the two subunits of ZP3 possess distinct immunologic characteristics as evaluated by RIA.« less
Enhanced contraception of canine zona pellucida 3 DNA vaccine via targeting DEC-205 in mice.
Wang, Ying; Zhang, Beibei; Li, Jinyao; Aipire, Adila; Li, Yijie; Zhang, Fuchun
2018-06-01
Zona pellucida 3 (ZP3) is a potential antigen for the development of contraceptive vaccines to control animal population. In this study, we designed a canine ZP3 (CZP3) DNA vaccine through targeting DEC-205 (named as pcD-scFv-CZP3c) and investigated its contraceptive effect in mice. Female BALB/c mice were intramuscularly immunized 3 times at 2 weeks intervals. After immunization, humoral and cellular immune responses were detected by ELISA and flow cytometry. The results showed that pcD-CZP3 and pcD-scFv-CZP3c induced CZP3-specific antibody (Ab) responses both in serum and vaginal secretions compared to pcDNA3.1. Additionally, compared to pcD-CZP3, pcD-scFv-CZP3c increased the levels of CZP3-specific Abs after a third immunization. Abs induced by these two DNA vaccines could bind with mice and dogs oocytes. Moreover, pcD-scFv-CZP3c enhanced the activation of CD4 + T cells characterized by the increased frequencies of CD4 + CD44 + T cells. Finally, the contraceptive effect was evaluated in the immunized mice. These two DNA vaccines significantly decreased a mean litter size of mice compared to pcDNA3.1, but pcD-scFv-CZP3c group showed the smallest mean litter size. The mean litter size of pcD-scFv-CZP3 were 3.2 ± 0.742 and 4.6 ± 1.118 in two mating tests, which were significantly lower than pcDNA3.1(P < 0.001 and P < 0.05). Our results suggest that the CZP3 DNA vaccine targeted with DEC-205 may be a potential strategy for developing a contraceptive DNA vaccine. Copyright © 2018 Elsevier Inc. All rights reserved.
A novel assay to identify the trafficking proteins that bind to specific vesicle populations
Bentley, Marvin; Banker, Gary
2016-01-01
Here we describe a method capable of identifying interactions between candidate trafficking proteins and a defined vesicle population in intact cells. The assay involves the expression of an FKBP12-rapamycin–binding domain (FRB)–tagged candidate vesicle-binding protein that can be inducibly linked to an FKBP-tagged molecular motor. If the FRB-tagged candidate protein binds the labeled vesicles, then linking the FRB and FKBP domains recruits motors to the vesicles and causes a predictable, highly distinctive change in vesicle trafficking. We describe two versions of the assay: a general protocol for use in cells with a typical microtubule-organizing center and a specialized protocol designed to detect protein-vesicle interactions in cultured neurons. We have successfully used this assay to identify kinesins and Rabs that bind to a variety of different vesicle populations. In principle, this assay could be used to investigate interactions between any category of vesicle trafficking proteins and any vesicle population that can be specifically labeled. PMID:26621371
Sperm Proteasomes Degrade Sperm Receptor on the Egg Zona Pellucida during Mammalian Fertilization
Zimmerman, Shawn W.; Manandhar, Gaurishankar; Yi, Young-Joo; Gupta, Satish K.; Sutovsky, Miriam; Odhiambo, John F.; Powell, Michael D.; Miller, David J.; Sutovsky, Peter
2011-01-01
Despite decades of research, the mechanism by which the fertilizing spermatozoon penetrates the mammalian vitelline membrane, the zona pellucida (ZP) remains one of the unexplained fundamental events of human/mammalian development. Evidence has been accumulating in support of the 26S proteasome as a candidate for echinoderm, ascidian and mammalian egg coat lysin. Monitoring ZP protein degradation by sperm during fertilization is nearly impossible because those few spermatozoa that penetrate the ZP leave behind a virtually untraceable residue of degraded proteins. We have overcome this hurdle by designing an experimentally consistent in vitro system in which live boar spermatozoa are co-incubated with ZP-proteins (ZPP) solubilized from porcine oocytes. Using this assay, mimicking sperm-egg interactions, we demonstrate that the sperm-borne proteasomes can degrade the sperm receptor protein ZPC. Upon coincubation with motile spermatozoa, the solubilized ZPP, which appear to be ubiquitinated, adhered to sperm acrosomal caps and induced acrosomal exocytosis/formation of the acrosomal shroud. The degradation of the sperm receptor protein ZPC was assessed by Western blotting band-densitometry and proteomics. A nearly identical pattern of sperm receptor degradation, evident already within the first 5 min of coincubation, was observed when the spermatozoa were replaced with the isolated, enzymatically active, sperm-derived proteasomes. ZPC degradation was blocked by proteasomal inhibitors and accelerated by ubiquitin-aldehyde(UBAL), a modified ubiquitin protein that stimulates proteasomal proteolysis. Such a degradation pattern of ZPC is consistent with in vitro fertilization studies, in which proteasomal inhibitors completely blocked fertilization, and UBAL increased fertilization and polyspermy rates. Preincubation of intact zona-enclosed ova with isolated active sperm proteasomes caused digestion, abrasions and loosening of the exposed zonae, and significantly reduced the fertilization/polyspermy rates after IVF, accompanied by en-mass detachment of zona bound sperm. Thus, the sperm borne 26S proteasome is a candidate zona lysin in mammals. This new paradigm has implications for contraception and assisted reproductive technologies in humans, as well as animals. PMID:21383844
Leemans, Bart; Gadella, Bart M; Stout, Tom A E; De Schauwer, Catharina; Nelis, Hilde; Hoogewijs, Maarten; Van Soom, Ann
2016-12-01
In contrast to man and many other mammalian species, conventional in vitro fertilization (IVF) with horse gametes is not reliably successful. The apparent inability of stallion spermatozoa to penetrate the zona pellucida in vitro is most likely due to incomplete activation of spermatozoa (capacitation) because of inadequate capacitating or fertilizing media. In vivo, the oviduct and its secretions provide a microenvironment that does reliably support and regulate interaction between the gametes. This review focuses on equine sperm-oviduct interaction. Equine sperm-oviduct binding appears to be more complex than the presumed species-specific calcium-dependent lectin binding phenomenon; unfortunately, the nature of the interaction is not understood. Various capacitation-related events are induced to regulate sperm release from the oviduct epithelium and most data suggest that exposure to oviduct secretions triggers sperm capacitation in vivo However, only limited information is available about equine oviduct secreted factors, and few have been identified. Another aspect of equine oviduct physiology relevant to capacitation is acid-base balance. In vitro, it has been demonstrated that stallion spermatozoa show tail-associated protein tyrosine phosphorylation after binding to oviduct epithelial cells containing alkaline secretory granules. In response to alkaline follicular fluid preparations (pH 7.9), stallion spermatozoa also show tail-associated protein tyrosine phosphorylation, hyperactivated motility and (limited) release from oviduct epithelial binding. However, these 'capacitating conditions' are not able to induce the acrosome reaction and fertilization. In conclusion, developing a defined capacitating medium to support successful equine IVF will depend on identifying as yet uncharacterized capacitation triggers present in the oviduct. © 2016 Society for Reproduction and Fertility.
Sessions-Bresnahan, D R; Graham, J K; Carnevale, E M
2014-07-15
IVF in horses is rarely successful. One reason for this could be the failure of sperm to fully capacitate or exhibit hyperactive motility. We hypothesized that the zona pellucida (ZP) of equine oocytes prevents fertilization in vitro, and bypassing the ZP would increase fertilization rates. Limited availability of equine oocytes for research has necessitated the use of heterologous oocyte binding assays using bovine oocytes. We sought to validate an assay using bovine oocytes and equine sperm and then to demonstrate that bypassing the ZP using perivitelline sperm injections (PVIs) with equine sperm capacitated with dilauroyl phosphatidylcholine would result in higher fertilization rates than standard IVF in bovine and equine oocytes. In experiment 1, bovine oocytes were used for (1) IVF with bovine sperm, (2) IVF with equine sperm, and (3) intracytoplasmic sperm injections (ICSIs) with equine sperm. Presumptive zygotes were either stained with 4',6-diamidino-2-phenylindole from 18 to 26 hours at 2-hour intervals or evaluated for cleavage at 56 hours after addition of sperm. Equine sperm fertilized bovine oocytes; however, pronuclei formation was delayed compared with bovine sperm after IVF. The delayed pronuclear formation was not seen after ICSI. In experiment 2, bovine oocytes were assigned to the following five groups: (1) cumulus oocyte complexes (COCs) coincubated with bovine sperm; (2) COC exposed to sucrose then coincubated with bovine sperm; (3) COC coincubated with equine sperm; (4) COC exposed to sucrose, and coincubated with equine sperm; and (5) oocytes exposed to sucrose, and 10 to 15 equine sperm injected into the perivitelline (PV) space. Equine sperm tended (P = 0.08) to fertilize more bovine oocytes when injected into the PV space than after IVF. In experiment 3, oocytes were assigned to the following four groups: (1) IVF, equine, and bovine COC coincubated with equine sperm; (2) PVI of equine and bovine oocytes; (3) PVI with equine oocytes pretreated with sucrose; and (4) ICSI of equine oocytes. Oocytes were examined at 24 hours for cleavage. No equine oocytes cleaved after IVF or PVI. However, ICSI conducted with equine sperm treated with dilauroyl phosphatidylcholine resulted in 85% of the oocytes cleaving. Sperm injected into the PV space of equine oocytes did not appear to enter the ooplasm. This study validated the use of bovine oocytes for equine sperm studies and indicates that failure of equine IVF is more than an inability of equine sperm to penetrate the ZP. Copyright © 2014 Elsevier Inc. All rights reserved.
Lectin binding assays for in-process monitoring of sialylation in protein production.
Xu, Weiduan; Chen, Jianmin; Yamasaki, Glenn; Murphy, John E; Mei, Baisong
2010-07-01
Many therapeutic proteins require appropriate glycosylation for their biological activities and plasma half life. Coagulation factor VIII (FVIII) is a glycoprotein which has extensive post-translational modification by N-linked glycosylation. The terminal sialic acid in the N-linked glycans of FVIII is required for maximal circulatory half life. The extent of FVIII sialylation can be determined by high pH anion-exchange chromatography coupled with a pulse electrochemical detector (HPAEC-PED), but this requires a large amount of purified protein. Using FVIII as a model, the objective of the present study was to develop assays that enable detection and prediction of sialylation deficiency at an early stage in the process and thus prevent downstream product quality excursions. Lectin ECA (Erythrina Cristagalli) binds to unsialylated Galbeta1-4 GlcNAc and the ECA-binding level (i.e., terminal Gal(beta1-4) exposure) is inversely proportional to the level of sialylation. By using ECA, a cell-based assay was developed to measure the global sialylation profile in FVIII producing cells. To examine the Galbeta1-4 exposure on the FVIII molecule in bioreactor tissue culture fluid (TCF), an ELISA-based ECA-FVIII binding assay was developed. The ECA-binding specificity in both assays was assessed by ECA-specific sugar inhibitors and neuraminidase digestion. The ECA-binding specificity was also independently confirmed by a ST3GAL4 siRNA knockdown experiment. To establish the correlation between Galbeta1-4 exposure and the HPAEC-PED determined FVIII sialylation value, the FVIII containing bioreactor TCF and the purified FVIII samples were tested with ECA ELISA binding assay. The results indicated an inverse correlation between ECA binding and the corresponding HPAEC-PED sialylation value. The ECA-binding assays are cost effective and can be rapidly performed, thereby making them effective for in-process monitoring of protein sialylation.
Hsieh, Y Y; Chang, C C; Tsai, H D
2001-09-01
The zona pellucida (ZP) plays a protective role during fertilization and early embryonic development. It is related to sperm binding, the acrosome reaction, prevention of polyspermic fertilization, and holding blastomeres together before the morular stage. Zona-free oocytes are accidentally encountered. If these oocytes are healthy, they can be fertilized normally by intracytoplasmic sperm injection (ICSI). We reported on a couple with male infertility undergoing oocyte retrieval after ovarian hyperstimulation. Before the ICSI procedure, cumulus cells surrounding the oocytes were removed, which resulted in one oocyte escaping from its ZP. The zona-free oocyte was fertilized normally with ICSI and developed to the 8-cell stage. We observed that the zona-free zygote had the ability to further divide, despite its loose contact. The zona-free embryo was transferred with other zona-intact embryos, but the implantation failed. We conclude that zona-free oocytes can be rescued, fertilized with ICSI, and cultured for further transfer or cryopreservation.
Jameson, Laramie P; Smith, Nicholas W; Dzyuba, Sergei V
2012-11-21
Dye-binding assays, such as those utilizing Congo red and thioflavin T, are among the most widely used tools to probe the aggregation of amyloidogenic biomolecules and for the evaluation of small molecule inhibitors of amyloid aggregation and fibrillization. A number of recent reports have indicated that these dye-binding assays could be prone to false positive effects when assessing inhibitors' potential toward Aβ peptides, species involved in Alzheimer's disease. Specifically, this review focuses on the application of thioflavin T for determining the efficiency of small molecule inhibitors of Aβ aggregation and addresses potential reasons that might be associated with the false positive effects in an effort to increase reliability of dye-binding assays.
2012-01-01
Dye-binding assays, such as those utilizing Congo red and thioflavin T, are among the most widely used tools to probe the aggregation of amyloidogenic biomolecules and for the evaluation of small molecule inhibitors of amyloid aggregation and fibrillization. A number of recent reports have indicated that these dye-binding assays could be prone to false positive effects when assessing inhibitors’ potential toward Aβ peptides, species involved in Alzheimer’s disease. Specifically, this review focuses on the application of thioflavin T for determining the efficiency of small molecule inhibitors of Aβ aggregation and addresses potential reasons that might be associated with the false positive effects in an effort to increase reliability of dye-binding assays. PMID:23173064
Flow cytometer measurement of binding assays
Saunders, George C.
1987-01-01
A method of measuring the result of a binding assay that does not require separation of fluorescent smaller particles is disclosed. In a competitive binding assay the smaller fluorescent particles coated with antigen compete with antigen in the sample being analyzed for available binding sites on larger particles. In a sandwich assay, the smaller, fluorescent spheres coated with antibody attach themselves to molecules containing antigen that are attached to larger spheres coated with the same antibody. The separation of unattached, fluorescent smaller particles is made unnecessary by only counting the fluorescent events triggered by the laser of a flow cytometer when the event is caused by a particle with a light scatter measurement within a certain range corresponding to the presence of larger particles.
Guarnieri, Michael T.; Blagg, Brian S. J.
2011-01-01
Abstract Bacterial histidine kinases (HK) are members of the GHKL superfamily, which share a unique adenosine triphosphate (ATP)-binding Bergerat fold. Our previous studies have shown that Gyrase, Hsp90, MutL (GHL) inhibitors bind to the ATP-binding pocket of HK and may provide lead compounds for the design of novel antibiotics targeting these kinases. In this article, we developed a competition assay using the fluorescent ATP analog, 2′,3′-O-(2,4,6-trinitrophenyl) adenosine 5′-triphosphate. The method can be used for high-throughput screening of compound libraries targeting HKs or other ATP-binding proteins. We utilized the assay to screen a library of GHL inhibitors targeting the bacterial HK PhoQ, and discuss the applications of the 2′,3′-O-(2,4,6-trinitrophenyl) adenosine 5′-triphosphate competition assay beyond GHKL inhibitor screening. PMID:21050069
Xu, Weifeng; Jiang, Hao; Titsch, Craig; Gadkari, Snaehal; Batog, Alicja; Wang, Bonnie; Hippeli, Lauren; Yamamoto, Brent; Chadwick, Kristina; Wheeler, Jennifer; Thompson, Chris; Stahl, James; Willett, Scott; DeSilva, Binodh S; Myler, Heather; Dodge, Robert W; Pillutla, Renuka C
2018-06-20
A ligand-binding assay (LBA) was used to measure exposure of PRM-151, the recombinant form of human pentraxin-2 (PTX-2), a complex pentamer with multiple binding partners. However, the assay showed a lack of dose-dependent exposure in select preclinical species and it could not differentiate the infused PRM-151 from the endogenous PTX-2 in nonhuman primates. Instead of assessing interference from its multiple binding partners, which could be time consuming and laborious, a LC-MS assay avoid of these interference was implemented to measure 'total' drug without the use of immunoaffinity capture reagents. The resultant LC-MS data confirmed the original data and the lack of dose-dependent exposure is now understood to be due to the multiple and diverse targets and functions and resultant complex biodistribution rather than an assay artifact.
Bhhatarai, Barun; Wilson, Daniel M.; Price, Paul S.; Marty, Sue; Parks, Amanda K.; Carney, Edward
2016-01-01
Background: Integrative testing strategies (ITSs) for potential endocrine activity can use tiered in silico and in vitro models. Each component of an ITS should be thoroughly assessed. Objectives: We used the data from three in vitro ToxCast™ binding assays to assess OASIS, a quantitative structure-activity relationship (QSAR) platform covering both estrogen receptor (ER) and androgen receptor (AR) binding. For stronger binders (described here as AC50 < 1 μM), we also examined the relationship of QSAR predictions of ER or AR binding to the results from 18 ER and 10 AR transactivation assays, 72 ER-binding reference compounds, and the in vivo uterotrophic assay. Methods: NovaScreen binding assay data for ER (human, bovine, and mouse) and AR (human, chimpanzee, and rat) were used to assess the sensitivity, specificity, concordance, and applicability domain of two OASIS QSAR models. The binding strength relative to the QSAR-predicted binding strength was examined for the ER data. The relationship of QSAR predictions of binding to transactivation- and pathway-based assays, as well as to in vivo uterotrophic responses, was examined. Results: The QSAR models had both high sensitivity (> 75%) and specificity (> 86%) for ER as well as both high sensitivity (92–100%) and specificity (70–81%) for AR. For compounds within the domains of the ER and AR QSAR models that bound with AC50 < 1 μM, the QSAR models accurately predicted the binding for the parent compounds. The parent compounds were active in all transactivation assays where metabolism was incorporated and, except for those compounds known to require metabolism to manifest activity, all assay platforms where metabolism was not incorporated. Compounds in-domain and predicted to bind by the ER QSAR model that were positive in ToxCast™ ER binding at AC50 < 1 μM were active in the uterotrophic assay. Conclusions: We used the extensive ToxCast™ HTS binding data set to show that OASIS ER and AR QSAR models had high sensitivity and specificity when compounds were in-domain of the models. Based on this research, we recommend a tiered screening approach wherein a) QSAR is used to identify compounds in-domain of the ER or AR binding models and predicted to bind; b) those compounds are screened in vitro to assess binding potency; and c) the stronger binders (AC50 < 1 μM) are screened in vivo. This scheme prioritizes compounds for integrative testing and risk assessment. Importantly, compounds that are not in-domain, that are predicted either not to bind or to bind weakly, that are not active in in vitro, that require metabolism to manifest activity, or for which in vivo AR testing is in order, need to be assessed differently. Citation: Bhhatarai B, Wilson DM, Price PS, Marty S, Parks AK, Carney E. 2016. Evaluation of OASIS QSAR models using ToxCast™ in vitro estrogen and androgen receptor binding data and application in an integrated endocrine screening approach. Environ Health Perspect 124:1453–1461; http://dx.doi.org/10.1289/EHP184 PMID:27152837
Glucocorticoid receptor ligand binding in monocytic cells using a microplate assay.
Jansen, J; Uitdehaag, B; Koper, J W; van Den Berg, T K
1999-01-01
Glucocorticoids have profound effects on macrophage function and are widely used as anti-inflammatory drugs. Glucocorticoids receptor (GR) ligand binding capacity is a major determinant of cellular glucocorticoid sensitivity. The number and affinity of GR can be measured in a whole cell binding assay using (3)H-dexamethasone. Here, we describe a rapid and simple microplate assay for GR measurement using the human promonocytic cell line THP-1. Copyright 2000 S. Karger AG, Basel.
Huang, W; Feltus, A; Witkowski, A; Daunert, S
1996-05-01
A homogeneous bioluminescence competitive binding assay for folate was developed by using a coupled enzyme system of glucose-6-phosphate dehydrogenase (G6PDH) and bacterial luciferase. A highly substituted G6PDH-folate conjugate was prepared by employing an N-hydroxysuccinimide/carbodiimide method. Folate binding protein inhibits the activity of the conjugate. In the presence of folate, there is a competition between folate and the G6PDH-folate conjugate for the binding site of the folate binding protein, and the activity of the conjugate is recovered. Thus, the concentration of folate can be related to the activity of the G6PDH-folate conjugate, which is directly related to the bioluminescence produced by the coupled enzyme reaction. Using this assay, dose-response curves with a detection limit of 2.5 x 10(-8) M folate were obtained, which is an improvement of an order of magnitude with respect to an assay that monitors G6PDH activity spectrophotometrically. The assay was validated using vitamin tablets and a cell culture medium.
The potential for chemicals to affect endocrine signaling is commonly evaluated via in vitro receptor binding and gene activation, but these assays, especially antagonism assays, have potential artifacts that must be addressed for accurate interpretation. Results are presented fr...
This Integrated Summary Report (ISR) summarizes, in a single document, the results from an international multi-laboratory validation study conducted for two in vitro estrogen receptor (ER) binding assays. These assays both use human recombinant estrogen receptor, alpha subtype (h...
Caffeine delays oocyte aging and maintains the quality of aged oocytes safely in mouse.
Zhang, Xia; Liu, Xiaoyan; Chen, Li; Wu, Dan-Ya; Nie, Zheng-Wen; Gao, Ying-Ying; Miao, Yi-Liang
2017-03-28
Caffeine, as an oocyte aging inhibitor, was used in many different species to control or delay oocyte aging. However, the safety of caffeine and developmental competence of aged oocytes inhibited by caffeine has not been studied systematically. So we detected the spindle morphology, distribution of cortical granules, zona pellucida hardening and pronucleus formation to assess oocyte quality of caffeine treated oocytes. We found that aged oocytes treated by caffeine maintained weak susceptibility to activating stimuli and regained normal competent after aged further 6 hr. Caffeine maintained the spindle morphology, changed cortical granules distribution of aged oocytes and could not prevent zona pellucida hardening. Furthermore, caffeine increased pronucleus formation of aged oocytes and decreased fragmentation after fertilization. These results suggested that caffeine could maintain the quality of aged oocytes safely in mouse.
Louros, Nikolaos N; Chrysina, Evangelia D; Baltatzis, Georgios E; Patsouris, Efstratios S; Hamodrakas, Stavros J; Iconomidou, Vassiliki A
2016-03-01
Human zona pellucida (ZP) is composed of four glycoproteins, namely ZP1, ZP2, ZP3 and ZP4. ZP proteins form heterodimers, which are incorporated into filaments through a common bipartite polymerizing component, designated as the ZP domain. The latter is composed of two individually folded subdomains, named ZP-N and ZP-C. Here, we have synthesized six 'aggregation-prone' peptides, corresponding to a common interface of human ZP2, ZP3 and ZP4. Experimental results utilizing electron microscopy, X-ray diffraction, ATR FT-IR spectroscopy and polarizing microscopy indicate that these peptides self-assemble forming fibrils with distinct amyloid-like features. Finally, by performing detailed modeling and docking, we attempt to shed some light in the self-assembly mechanism of human ZP proteins. © 2016 Federation of European Biochemical Societies.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kurachi, H.; Wakimoto, H.; Sakumoto, T.
1984-02-01
The specific radioimmunoassay system was developed for the titration of the antibodies to porcine zona pellucida (ZP) in human sera by using /sup 125/I-labeled purified porcine ZP as antigen, which is known to have cross-reactivity with human ZP. The antibodies in human sera were detected in 3 of 11 (27%) women with unexplained infertility, in 16 of 48 (33%) amenorrheic patients, in 4 of 12 (33%) fertile women, and in 3 of 10 (30%) men. Moreover, antibody titers in infertile women were no higher than those in fertile women and in men. These results seem to suggest that the antibodiesmore » in human sera that cross-react with porcine ZP may not be an important factor in causing infertility in women.« less
Okumura, Hiroki
2017-01-01
An ovulated egg of vertebrates is surrounded by unique extracellular matrix, the egg coat or zona pellucida, playing important roles in fertilization and early development. The vertebrate egg coat is composed of two to six zona pellucida (ZP) glycoproteins that are characterized by the evolutionarily conserved ZP-domain module and classified into six subfamilies based on phylogenetic analyses. Interestingly, investigations of biochemical and functional features of the ZP glycoproteins show that the roles of each ZP-glycoprotein family member in the egg-coat formation and the egg-sperm interactions seemingly vary across vertebrates. This might be one reason why comprehensive understandings of the molecular basis of either architecture or physiological functions of egg coat still remain elusive despite more than 3 decades of intensive investigations. In this chapter, an overview of avian egg focusing on the oogenesis are provided in the first section, and unique features of avian egg coat, i.e., perivitelline layer, including the morphology, biogenesis pathway, and physiological functions are discussed mainly on chicken and quail in terms of the characteristics of ZP glycoproteins in the following sections. In addition, these features of avian egg coat are compared to mammalian zona pellucida, from the viewpoint that the structural and functional varieties of ZP glycoproteins might be associated with the evolutionary adaptation to their reproductive strategies. By comparing the egg coat of birds and mammals whose reproductive strategies are largely different, new insights into the molecular mechanisms of vertebrate egg-sperm interactions might be provided.
Function and culture requirements of snow leopard (Panthera uncia) spermatozoa in vitro.
Roth, T L; Howard, J G; Donoghue, A M; Swanson, W F; Wildt, D E
1994-08-01
Electroejaculates from eight snow leopards were used to determine how the motility of spermatozoa was influenced by (i) type of media (Ham's F10, PBS, human tubal fluid or RPMI-1640); (ii) holding temperature (23 degrees C versus 37 degrees C); (iii) washing of spermatozoa and (iv) a sperm metabolic enhancer, pentoxifylline. The duration of sperm motility was assessed by evaluating samples in each treatment every hour for 6 h and a sperm motility index (a value combining percentage sperm motility and rate of forward progression) calculated. Spermatozoa from the Ham's F10, PBS and PBS plus pentoxifylline treatments were also co-incubated with zona-intact, domestic cat eggs that were fixed and evaluated for spermatozoa bound to the zona pellucida, penetrating the outer and inner layers of the zona pellucida and within the perivitelline space. During the 6 h co-incubation, the sperm motility index in PBS with pentoxifylline was greater (P < 0.05) than in PBS alone which, in turn, was greater (P < 0.05) than in the other three test media. Washing the spermatozoa enhanced (P < 0.05) motility in both PBS and PBS plus pentoxifylline relative to unwashed samples, but there was no effect (P > 0.05) of holding temperature. Pentoxifylline supplementation enhanced (P < 0.05) the proportion of cat eggs with bound, but not penetrated, snow leopard spermatozoa in the inner layer of the zona pellucida, and there were no spermatozoa in the perivitelline space.(ABSTRACT TRUNCATED AT 250 WORDS)
Takeo, Toru; Nakagata, Naomi
2011-11-01
Sperm cryopreservation is useful for the effective storage of genomic resources derived from genetically engineered mice. However, freezing the sperm of C57BL/6 mice, the most commonly used genetic background for genetically engineered mice, considerably reduces its fertility. We previously reported that methyl-beta-cyclodextrin dramatically improved the fertility of frozen/thawed C57BL/6 mouse sperm. Recently, it was reported that exposing sperm to reduced glutathione may alleviate oxidative stress in frozen/thawed mouse sperm, thereby enhancing in vitro fertilization (IVF); however, the mechanism underlying this effect is poorly understood. In the present study, we examined the combined effects of methyl-beta-cyclodextrin and reduced glutathione on the fertilization rate of IVF with frozen/thawed C57BL/6 mouse sperm and the characteristic changes in the zona pellucida induced by reduced glutathione. Adding reduced glutathione to the fertilization medium increased the fertilization rate. Methyl-beta-cyclodextrin and reduced glutathione independently increased fertilization rates, and their combination produced the strongest effect. We found that reduced glutathione increased the amount of free thiols in the zona pellucida and promoted zona pellucida enlargement. Finally, 2-cell embryos produced by IVF with the addition of reduced glutathione developed normally and produced live offspring. In summary, we have established a novel IVF method using methyl-beta-cyclodextrin during sperm preincubation and reduced glutathione during the IVF procedure to enhance fertility of frozen/thawed C57BL/6 mouse sperm.
Regulation of the aceI multidrug efflux pump gene in Acinetobacter baumannii.
Liu, Qi; Hassan, Karl A; Ashwood, Heather E; Gamage, Hasinika K A H; Li, Liping; Mabbutt, Bridget C; Paulsen, Ian T
2018-06-01
To investigate the function of AceR, a putative transcriptional regulator of the chlorhexidine efflux pump gene aceI in Acinetobacter baumannii. Chlorhexidine susceptibility and chlorhexidine induction of aceI gene expression were determined by MIC and quantitative real-time PCR, respectively, in A. baumannii WT and ΔaceR mutant strains. Recombinant AceR was prepared as both a full-length protein and as a truncated protein, AceR (86-299), i.e. AceRt, which has the DNA-binding domain deleted. The binding interaction of the purified AceR protein and its putative operator region was investigated by electrophoretic mobility shift assays and DNase I footprinting assays. The binding of AceRt with its putative ligand chlorhexidine was examined using surface plasmon resonance and tryptophan fluorescence quenching assays. MIC determination assays indicated that the ΔaceI and ΔaceR mutant strains both showed lower resistance to chlorhexidine than the parental strain. Chlorhexidine-induced expression of aceI was abolished in a ΔaceR background. Electrophoretic mobility shift assays and DNase I footprinting assays demonstrated chlorhexidine-stimulated binding of AceR with two sites upstream of the putative aceI promoter. Surface plasmon resonance and tryptophan fluorescence quenching assays suggested that the purified ligand-binding domain of the AceR protein was able to bind with chlorhexidine with high affinity. This study provides strong evidence that AceR is an activator of aceI gene expression when challenged with chlorhexidine. This study is the first characterization, to our knowledge, of a regulator controlling expression of a PACE family multidrug efflux pump.
Gassner, C; Karlsson, R; Lipsmeier, F; Moelleken, J
2018-05-30
Previously we have introduced two SPR-based assay principles (dual-binding assay and bridging assay), which allow the determination of two out of three possible interaction parameters for bispecific molecules within one assay setup: two individual interactions to both targets, and/or one simultaneous/overall interaction, which potentially reflects the inter-dependency of both individual binding events. However, activity and similarity are determined by comparing report points over a concentration range, which also mirrors the way data is generated by conventional ELISA-based methods So far, binding kinetics have not been specifically considered in generic approaches for activity assessment. Here, we introduce an improved slope-ratio model which, together with a sensorgram comparison based similarity assessment, allows the development of a detailed, USP-conformal ligand binding assay using only a single sample concentration. We compare this novel analysis method to the usual concentration-range approach for both SPR-based assay principles and discuss its impact on data quality and increased sample throughput. Copyright © 2018 Elsevier B.V. All rights reserved.
A Colorimetric Microplate Assay for DNA-Binding Activity of His-Tagged MutS Protein.
Banasik, Michał; Sachadyn, Paweł
2016-09-01
A simple microplate method was designed for rapid testing DNA-binding activity of proteins. The principle of the assay involves binding of tested DNA by his-tagged protein immobilized on a nickel-coated ELISA plate, following colorimetric detection of biotinylated DNA with avidin conjugated to horseradish peroxidase. The method was used to compare DNA mismatch binding activities of MutS proteins from three bacterial species. The assay required relatively low amounts of tested protein (approximately 0.5-10 pmol) and DNA (0.1-10 pmol) and a relatively short time of analysis (up to 60 min). The method is very simple to apply and convenient to test different buffer conditions of DNA-protein binding. Sensitive colorimetric detection enables naked eye observations and quantitation with an ELISA reader. The performance of the assay, which we believe is a distinguishing trait of the method, is based on two strong and specific molecular interactions: binding of a his-tagged protein to a nickel-coated microplate and binding of biotinylated DNA to avidin. In the reported experiments, the solution was used to optimize the conditions for DNA mismatch binding by MutS protein; however, the approach could be implemented to test nucleic acids interactions with any protein of interest.
A robust methodology to subclassify pseudokinases based on their nucleotide-binding properties
Murphy, James M.; Zhang, Qingwei; Young, Samuel N.; Reese, Michael L.; Bailey, Fiona P.; Eyers, Patrick A.; Ungureanu, Daniela; Hammaren, Henrik; Silvennoinen, Olli; Varghese, Leila N.; Chen, Kelan; Tripaydonis, Anne; Jura, Natalia; Fukuda, Koichi; Qin, Jun; Nimchuk, Zachary; Mudgett, Mary Beth; Elowe, Sabine; Gee, Christine L.; Liu, Ling; Daly, Roger J.; Manning, Gerard; Babon, Jeffrey J.; Lucet, Isabelle S.
2017-01-01
Protein kinase-like domains that lack conserved residues known to catalyse phosphoryl transfer, termed pseudokinases, have emerged as important signalling domains across all kingdoms of life. Although predicted to function principally as catalysis-independent protein-interaction modules, several pseudokinase domains have been attributed unexpected catalytic functions, often amid controversy. We established a thermal-shift assay as a benchmark technique to define the nucleotide-binding properties of kinase-like domains. Unlike in vitro kinase assays, this assay is insensitive to the presence of minor quantities of contaminating kinases that may otherwise lead to incorrect attribution of catalytic functions to pseudokinases. We demonstrated the utility of this method by classifying 31 diverse pseudokinase domains into four groups: devoid of detectable nucleotide or cation binding; cation-independent nucleotide binding; cation binding; and nucleotide binding enhanced by cations. Whereas nine pseudokinases bound ATP in a divalent cation-dependent manner, over half of those examined did not detectably bind nucleotides, illustrating that pseudokinase domains predominantly function as non-catalytic protein-interaction modules within signalling networks and that only a small subset is potentially catalytically active. We propose that henceforth the thermal-shift assay be adopted as the standard technique for establishing the nucleotide-binding and catalytic potential of kinase-like domains. PMID:24107129
Yu, Haixiang; Canoura, Juan; Guntupalli, Bhargav; Lou, Xinhui
2017-01-01
Sensors employing split aptamers that reassemble in the presence of a target can achieve excellent specificity, but the accompanying reduction of target affinity mitigates any overall gains in sensitivity. We for the first time have developed a split aptamer that achieves enhanced target-binding affinity through cooperative binding. We have generated a split cocaine-binding aptamer that incorporates two binding domains, such that target binding at one domain greatly increases the affinity of the second domain. We experimentally demonstrate that the resulting cooperative-binding split aptamer (CBSA) exhibits higher target binding affinity and is far more responsive in terms of target-induced aptamer assembly compared to the single-domain parent split aptamer (PSA) from which it was derived. We further confirm that the target-binding affinity of our CBSA can be affected by the cooperativity of its binding domains and the intrinsic affinity of its PSA. To the best of our knowledge, CBSA-5335 has the highest cocaine affinity of any split aptamer described to date. The CBSA-based assay also demonstrates excellent performance in target detection in complex samples. Using this CBSA, we achieved specific, ultra-sensitive, one-step fluorescence detection of cocaine within fifteen minutes at concentrations as low as 50 nM in 10% saliva without signal amplification. This limit of detection meets the standards recommended by the European Union's Driving under the Influence of Drugs, Alcohol and Medicines program. Our assay also demonstrates excellent reproducibility of results, confirming that this CBSA-platform represents a robust and sensitive means for cocaine detection in actual clinical samples. PMID:28451157
Exo-Dye-based assay for rapid, inexpensive, and sensitive detection of DNA-binding proteins.
Chen, Zaozao; Ji, Meiju; Hou, Peng; Lu, Zuhong
2006-07-07
We reported herein a rapid, inexpensive, and sensitive technique for detecting sequence-specific DNA-binding proteins. In this technique, the common exonuclease III (ExoIII) footprinting assay is coupled with simple SYBR Green I staining for monitoring the activities of DNA-binding proteins. We named this technique as ExoIII-Dye-based assay. In this assay, a duplex probe was designed to detect DNA-binding protein. One side of the probe contains one protein-binding site, and another side of it contains five protruding bases at 3' end for protection from ExoIII digestion. If a target protein is present, it will bind to binding sites of probe and produce a physical hindrance to ExoIII, which protects the duplex probe from digestion of ExoIII. SYBR Green I will bind to probe, which results in high fluorescence intensity. On the contrary, in the absence of the target protein, the naked duplex probe will be degraded by ExoIII. SYBR Green I will be released, which results in a low fluorescence intensity. In this study, we employed this technique to successfully detect transcription factor NF-kappaB in crude cell extracts. Moreover, it could also be used to evaluate the binding affinity of NF-kappaB. This technique has therefore wide potential application in research, medical diagnosis, and drug discovery.
Highly variable sensitivity of five binding and two bio-assays for TSH-receptor antibodies.
Diana, T; Wüster, C; Kanitz, M; Kahaly, G J
2016-10-01
TSH-receptor (TSHR) antibodies (Ab) can be measured with binding or bio-assays. Sensitivity and specificity of five binding and two bio-assays were compared. TSHR-blocking (TBAb) and TSHR-stimulating (TSAb) Ab were measured with reporter bio-assays. Blocking activity was defined as percent inhibition of luciferase expression relative to induction with bTSH alone. TSAb was reported as percentage of specimen-to-reference ratio (SRR%). TSHR-binding inhibitory immunoglobulins (TBII) were measured with Kronus, Dynex, Kryptor, Cobas, and Immulite. Sixty patients with Graves' disease (GD), 20 with Hashimoto's thyroiditis (HT), and 20 healthy controls (C) were included. C tested negative in all assays (specificity 100 %) while all 60 hyperthyroid GD patients tested positive in the TSAb bio-assay (sensitivity 100 %). Among these 60 GD patients, 20 had low TSAb positivity (SRR% 140-279), but were TBII positive in only 20 (100 %), 7 (35 %), 9 (45 %), 11 (55 %), and 18 (90 %) using the Kronus, Dynex, Kryptor, Cobas, and Immulite, respectively. In 20 moderate TSAb-positive (SRR% 280-420) patients, TBII tested positive in 20 (100 %), 14 (70 %), 13 (65 %), 16 (80 %), and 19 (95 %), respectively. The high (SRR% > 420) TSAb-positive patients were all TBII positive. All 20 hypothyroid HT patients tested TBAb positive (sensitivity 100 %) in the bio-assay while they tested TBII positive in 20 (100 %), 18 (90 %), 20, 20, and 18, respectively. Results obtained with two luminometers correlated for TSAb positive (r = 0.99, p < 0.001), TBAb positive (r = 0.88, p < 0.001), and C (r = 0.86, p < 0.001). None of the binding assays differentiated between TSAb and TBAb. Sensitivity is highly variable between binding and bio-assays for TSHR-Abs.
Ojeda, Paola; Pérez, Alejandra; Ojeda, Lorena; Vargas-Uribe, Mauricio; Rivas, Coralia I; Salas, Monica; Vera, Juan Carlos; Reyes, Alejandro M
2012-09-01
Glucose transporter (GLUT)1 has become an attractive target to block glucose uptake in malignant cells since most cancer cells overexpress GLUT1 and are sensitive to glucose deprivation. Methylxanthines are natural compounds that inhibit glucose uptake; however, the mechanism of inhibition remains unknown. Here, we used a combination of binding and glucose transport kinetic assays to analyze in detail the effects of caffeine, pentoxifylline, and theophylline on hexose transport in human erythrocytes. The displacement of previously bound cytochalasin B revealed a direct interaction between the methylxanthines and GLUT1. Methylxanthines behave as noncompetitive blockers (inhibition constant values of 2-3 mM) in exchange and zero-trans efflux assays, whereas mixed inhibition with a notable uncompetitive component is observed in zero-trans influx assays (inhibition constant values of 5-12 mM). These results indicate that methylxanthines do not bind to either exofacial or endofacial d-glucose-binding sites but instead interact at a different site accessible by the external face of the transporter. Additionally, infinite-cis exit assays (Sen-Widdas assays) showed that only pentoxifylline disturbed d-glucose for binding to the exofacial substrate site. Interestingly, coinhibition assays showed that methylxanthines bind to a common site on the transporter. We concluded that there is a methylxanthine regulatory site on the external surface of the transporter, which is close but distinguishable from the d-glucose external site. Therefore, the methylxanthine moiety may become an attractive framework for the design of novel specific noncompetitive facilitative GLUT inhibitors.
Antoine, Thomas; Ott, David; Ebell, Katharina; Hansen, Kerrin; Henry, Luc; Becker, Frank; Hannus, Stefan
2016-06-01
G protein-coupled receptors (GPCRs) mediate many important physiological functions and are considered as one of the most successful therapeutic target classes for a wide spectrum of diseases. Drug discovery projects generally benefit from a broad range of experimental approaches for screening compound libraries and for the characterization of binding modes of drug candidates. Owing to the difficulties in solubilizing and purifying GPCRs, assay formats have been so far mainly limited to cell-based functional assays and radioligand binding assays. In this study, we used fluorescence cross-correlation spectroscopy (FCCS) to analyze the interaction of detergent-solubilized receptors to various types of GPCR ligands: endogenous peptides, small molecules, and a large surrogate antagonist represented by a blocking monoclonal antibody. Our work demonstrates the suitability of the homogeneous and time-resolved FCCS assay format for a robust, high-throughput determination of receptor-ligand binding affinities and kinetic rate constants for various therapeutically relevant GPCRs. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Johnson, G G; Geiduschek, E P
1977-04-05
The interaction of the phage SPO1 protein transcription factor 1 (TF1), with DNA has been analyzed by membrane filter binding and by sedimentation methods. Substantially specific binding of TF1 to helical SPO1 DNA can be demonstrated by nitrocellulose filter-binding assays at relatively low ionic strength (0.08). However, TF1-DNA complexes dissociate and reequilibrate relatively rapidly and this makes filter-binding assays unsuitable for quantitative measurements of binding equilibra. Accordingly, the sedimentation properties of TF1-DNA complexes have been explored and a short-column centrifugation assay has been elaborated for quantitative measurements. Preferential binding of TF1 to the hydroxymethyluracil-containing SPO1 DNA has also been demonstrated by short-column centrifugation. TF1 binds relatively weakly and somewhat cooperatively to SPO1 DNA at many sites; TF1-DNA complexes dissociate and reequilibrate rapidly. At 20 degrees C in 0.01 M phosphate, pH 7.5, 0.15 KC1, one molecule of TF1 can bind to approximately every 60 nucleotide pairs of SPO1 DNA.
Ohara, Nobumasa; Kaneko, Masanori; Kitazawa, Masaru; Uemura, Yasuyuki; Minagawa, Shinichi; Miyakoshi, Masashi; Kaneko, Kenzo; Kamoi, Kyuzi
2017-02-06
Graves' disease is an autoimmune thyroid disorder characterized by hyperthyroidism, and patients exhibit thyroid-stimulating hormone receptor antibody. The major methods of measuring circulating thyroid-stimulating hormone receptor antibody include the thyroid-stimulating hormone-binding inhibitory immunoglobulin assays. Although the diagnostic accuracy of these assays has been improved, a minority of patients with Graves' disease test negative even on second-generation and third-generation thyroid-stimulating hormone-binding inhibitory immunoglobulins. We report a rare case of a thyroid-stimulating hormone-binding inhibitory immunoglobulin-positive patient with Graves' disease who showed rapid lowering of thyroid-stimulating hormone-binding inhibitory immunoglobulin levels following administration of the anti-thyroid drug thiamazole, but still experienced Graves' hyperthyroidism. A 45-year-old Japanese man presented with severe hyperthyroidism (serum free triiodothyronine >25.0 pg/mL; reference range 1.7 to 3.7 pg/mL) and tested weakly positive for thyroid-stimulating hormone-binding inhibitory immunoglobulins on second-generation tests (2.1 IU/L; reference range <1.0 IU/L). Within 9 months of treatment with oral thiamazole (30 mg/day), his thyroid-stimulating hormone-binding inhibitory immunoglobulin titers had normalized, but he experienced sustained hyperthyroidism for more than 8 years, requiring 15 mg/day of thiamazole to correct. During that period, he tested negative on all first-generation, second-generation, and third-generation thyroid-stimulating hormone-binding inhibitory immunoglobulin assays, but thyroid scintigraphy revealed diffuse and increased uptake, and thyroid ultrasound and color flow Doppler imaging showed typical findings of Graves' hyperthyroidism. The possible explanations for serial changes in the thyroid-stimulating hormone-binding inhibitory immunoglobulin results in our patient include the presence of thyroid-stimulating hormone receptor antibody, which is bioactive but less reactive on thyroid-stimulating hormone-binding inhibitory immunoglobulin assays, or the effect of reduced levels of circulating thyroid-stimulating hormone receptor antibody upon improvement of thyroid autoimmunity with thiamazole treatment. Physicians should keep in mind that patients with Graves' disease may show thyroid-stimulating hormone-binding inhibitory immunoglobulin assay results that do not reflect the severity of Graves' disease or indicate the outcome of the disease, and that active Graves' disease may persist even after negative results on thyroid-stimulating hormone-binding inhibitory immunoglobulin assays. Timely performance of thyroid function tests in combination with sensitive imaging tests, including thyroid ultrasound and scintigraphy, are necessary to evaluate the severity of Graves' disease and treatment efficacy.
Wilson, Kris; Mole, Damian J; Homer, Natalie Z M; Iredale, John P; Auer, Manfred; Webster, Scott P
2015-02-01
Human kynurenine 3-monooxygenase (KMO) is emerging as an important drug target enzyme in a number of inflammatory and neurodegenerative disease states. Recombinant protein production of KMO, and therefore discovery of KMO ligands, is challenging due to a large membrane targeting domain at the C-terminus of the enzyme that causes stability, solubility, and purification difficulties. The purpose of our investigation was to develop a suitable screening method for targeting human KMO and other similarly challenging drug targets. Here, we report the development of a magnetic bead-based binding assay using mass spectrometry detection for human KMO protein. The assay incorporates isolation of FLAG-tagged KMO enzyme on protein A magnetic beads. The protein-bound beads are incubated with potential binding compounds before specific cleavage of the protein-compound complexes from the beads. Mass spectrometry analysis is used to identify the compounds that demonstrate specific binding affinity for the target protein. The technique was validated using known inhibitors of KMO. This assay is a robust alternative to traditional ligand-binding assays for challenging protein targets, and it overcomes specific difficulties associated with isolating human KMO. © 2014 Society for Laboratory Automation and Screening.
ERIC Educational Resources Information Center
Hicks, Katherine A.
2016-01-01
Fluorescence quenching assays are often used to measure dissociation constants that quantify the binding affinity between small molecules and proteins. In an upper-division undergraduate laboratory course, where students work on projects using a guided inquiry-based approach, a binding titration experiment at physiological pH is performed to…
ERIC Educational Resources Information Center
Mascotti, David P.; Waner, Mark J.
2010-01-01
A protein-ligand binding, guided-inquiry laboratory project with potential application across the advanced undergraduate curriculum is described. At the heart of the project are fluorescence and spectrophotometric assays utilizing biotin-4-fluorescein and streptavidin. The use of the same stock solutions for an assay that may be examined by two…
Screening for endocrine disrupting chemicals (EDCs) that act as estrogens or antiestrogens relies on the use of in vitro binding and gene expression assays coupled with short-term diagnostic in vivo assays. Although binding assays are useful to identify chemicals that are competi...
Lipid A binding sites in membranes of macrophage tumor cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hampton, R.Y.; Golenbock, D.T.; Raetz, C.R.
1988-10-15
Lipopolysaccharide affects a variety of eukaryotic cells and mammalian organisms. These actions are involved in the pathogenesis of Gram-negative septicemia. Many of the actions of lipopolysaccharide are believed to be caused by its active moiety, lipid A. Our laboratory has previously identified a bioactive lipid A precursor, termed lipid IVA, which can be labeled with 32P of high specific activity and purified. In this work we have used the labeled probe, 4'-32P-lipid IVA, to develop a novel assay for the specific binding of lipid IVA to whole cells. We have also demonstrated its use in a ligand blotting assay ofmore » immobilized cellular proteins. Using the whole cell assay, we show that 4'-32P-lipid IVA specifically binds to RAW 264.7 macrophage-like cultured cells. The binding is saturable, is inhibited with excess unlabeled lipid IVA, and is proteinase K-sensitive. It displays cellular and pharmacological specificity. Using the ligand blotting assay, we show that several RAW 264.7 cell proteins can bind 4'-32P-lipid IVA. The two principal binding proteins have Mr values of 31 and 95 kDa, as judged by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Fractionation studies indicate that the 31-kDa protein is enriched in the nuclear fraction and may be a histone, whereas the 95-kDa protein is enriched in the membrane fraction. The binding assays that we have developed should lead to a clearer understanding of lipid A/animal cell interactions.« less
Novel Multiplexed Assay for Identifying SH2 Domain Antagonists of STAT Family Proteins
Takakuma, Kazuyuki; Ogo, Naohisa; Uehara, Yutaka; Takahashi, Susumu; Miyoshi, Nao; Asai, Akira
2013-01-01
Some of the signal transducer and activator of transcription (STAT) family members are constitutively activated in a wide variety of human tumors. The activity of STAT depends on their Src homology 2 (SH2) domain-mediated binding to sequences containing phosphorylated tyrosine. Thus, antagonizing this binding is a feasible approach to inhibiting STAT activation. We have developed a novel multiplexed assay for STAT3- and STAT5b-SH2 binding, based on amplified luminescent proximity homogeneous assay (Alpha) technology. AlphaLISA and AlphaScreen beads were combined in a single-well assay, which allowed the binding of STAT3- and STAT5b-SH2 to phosphotyrosine peptides to be simultaneously monitored. Biotin-labeled recombinant human STAT proteins were obtained as N- and C-terminal deletion mutants. The spacer length of the DIG-labeled peptide, the reaction time, and the concentration of sodium chloride were optimized to establish a HTS system with Z’ values of greater than 0.6 for both STAT3- and STAT5b-SH2 binding. We performed a HTS campaign for chemical libraries using this multiplexed assay and identified hit compounds. A 2-chloro-1,4-naphthalenedione derivative, Compound 1, preferentially inhibited STAT3-SH2 binding in vitro, and the nuclear translocation of STAT3 in HeLa cells. Initial structure activity relationship (SAR) studies using the multiplexed assay showed the 3-substituent effect on both the activity and selectivity of STAT3 and STAT5b inhibition. Therefore, this multiplexed assay is useful for not only searching for potential lead compounds but also obtaining SAR data for developing new STAT3/STAT5b inhibitors. PMID:23977103
Novel multiplexed assay for identifying SH2 domain antagonists of STAT family proteins.
Takakuma, Kazuyuki; Ogo, Naohisa; Uehara, Yutaka; Takahashi, Susumu; Miyoshi, Nao; Asai, Akira
2013-01-01
Some of the signal transducer and activator of transcription (STAT) family members are constitutively activated in a wide variety of human tumors. The activity of STAT depends on their Src homology 2 (SH2) domain-mediated binding to sequences containing phosphorylated tyrosine. Thus, antagonizing this binding is a feasible approach to inhibiting STAT activation. We have developed a novel multiplexed assay for STAT3- and STAT5b-SH2 binding, based on amplified luminescent proximity homogeneous assay (Alpha) technology. AlphaLISA and AlphaScreen beads were combined in a single-well assay, which allowed the binding of STAT3- and STAT5b-SH2 to phosphotyrosine peptides to be simultaneously monitored. Biotin-labeled recombinant human STAT proteins were obtained as N- and C-terminal deletion mutants. The spacer length of the DIG-labeled peptide, the reaction time, and the concentration of sodium chloride were optimized to establish a HTS system with Z' values of greater than 0.6 for both STAT3- and STAT5b-SH2 binding. We performed a HTS campaign for chemical libraries using this multiplexed assay and identified hit compounds. A 2-chloro-1,4-naphthalenedione derivative, Compound 1, preferentially inhibited STAT3-SH2 binding in vitro, and the nuclear translocation of STAT3 in HeLa cells. Initial structure activity relationship (SAR) studies using the multiplexed assay showed the 3-substituent effect on both the activity and selectivity of STAT3 and STAT5b inhibition. Therefore, this multiplexed assay is useful for not only searching for potential lead compounds but also obtaining SAR data for developing new STAT3/STAT5b inhibitors.
Assessment of a recombinant androgen receptor binding assay: initial steps towards validation.
Freyberger, Alexius; Weimer, Marc; Tran, Hoai-Son; Ahr, Hans-Jürgen
2010-08-01
Despite more than a decade of research in the field of endocrine active compounds with affinity for the androgen receptor (AR), still no validated recombinant AR binding assay is available, although recombinant AR can be obtained from several sources. With funding from the European Union (EU)-sponsored 6th framework project, ReProTect, we developed a model protocol for such an assay based on a simple AR binding assay recently developed at our institution. Important features of the protocol were the use of a rat recombinant fusion protein to thioredoxin containing both the hinge region and ligand binding domain (LBD) of the rat AR (which is identical to the human AR-LBD) and performance in a 96-well plate format. Besides two reference compounds [dihydrotestosterone (DHT), androstenedione] ten test compounds with different affinities for the AR [levonorgestrel, progesterone, prochloraz, 17alpha-methyltestosterone, flutamide, norethynodrel, o,p'-DDT, dibutylphthalate, vinclozolin, linuron] were used to explore the performance of the assay. At least three independent experiments per compound were performed. The AR binding properties of reference and test compounds were well detected, in terms of the relative ranking of binding affinities, there was good agreement with published data obtained from experiments using recombinant AR preparations. Irrespective of the chemical nature of the compound, individual IC(50)-values for a given compound varied by not more than a factor of 2.6. Our data demonstrate that the assay reliably ranked compounds with strong, weak, and no/marginal affinity for the AR with high accuracy. It avoids the manipulation and use of animals, as a recombinant protein is used and thus contributes to the 3R concept. On the whole, this assay is a promising candidate for further validation. Copyright 2009 Elsevier Inc. All rights reserved.
77 FR 33766 - Notice of Public Meeting; Wyoming Resource Advisory Council
Federal Register 2010, 2011, 2012, 2013, 2014
2012-06-07
... the BLM's wild horse partnership with Friends of a Legacy and Marathon Oil, water projects, porcine zona pellucida and the overall wild horse program; a RAC business session; and a presentation on fire...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hamazaki, T.S.; Nagahama, Y.; Iuchi, I.
1989-05-01
A glycoprotein from the liver, which shares epitopes with chorion (egg envelope or zona pellucida) glycoproteins, is present only in the spawning female fish, Oryzias latipes, under natural conditions. This spawning female-specific (SF) substance is distinct from vitellogenin but closely resembles a major glycoprotein component, ZI-3, of the inner layer (zona radiata interna) of the ovarian egg envelope with respect to some biochemical and immunochemical characteristics. Here we report that the (/sup 125/I)SF substance, injected into the abdominal cavity of the spawning female fish, was rapidly transported by the blood circulation into the ovary and incorporated into the inner layermore » of egg envelope of the growing oocytes. The result strongly suggests that the SF substance from the liver is a precursor substance of the major component, ZI-3, of the inner layer of egg envelope in the fish.« less
Neiens, Patrick; De Simone, Angela; Ramershoven, Anna; Höfner, Georg; Allmendinger, Lars; Wanner, Klaus T
2018-03-03
MS Binding Assays represent a label-free alternative to radioligand binding assays. In this study, we present an LC-ESI-MS/MS method for the quantification of (R,R)-4-(2-benzhydryloxyethyl)-1-(4-fluorobenzyl)piperidin-3-ol [(R,R)-D-84, (R,R)-1], (S,S)-reboxetine [(S,S)-2], and (S)-citalopram [(S)-3] employed as highly selective nonlabeled reporter ligands in MS Binding Assays addressing the dopamine [DAT, (R,R)-D-84], norepinephrine [NET, (S,S)-reboxetine] and serotonin transporter [SERT, (S)-citalopram], respectively. The developed LC-ESI-MS/MS method uses a pentafluorphenyl stationary phase in combination with a mobile phase composed of acetonitrile and ammonium formate buffer for chromatography and a triple quadrupole mass spectrometer in the multiple reaction monitoring mode for mass spectrometric detection. Quantification is based on deuterated derivatives of all three analytes serving as internal standards. The established LC-ESI-MS/MS method enables fast, robust, selective and highly sensitive quantification of all three reporter ligands in a single chromatographic run. The method was validated according to the Center for Drug Evaluation and Research (CDER) guideline for bioanalytical method validation regarding selectivity, accuracy, precision, calibration curve and sensitivity. Finally, filtration-based MS Binding Assays were performed for all three monoamine transporters based on this LC-ESI-MS/MS quantification method as read out. The affinities determined in saturation experiments for (R,R)-D-84 toward hDAT, for (S,S)-reboxetine toward hNET, and for (S)-citalopram toward hSERT, respectively, were in good accordance with results from literature, clearly demonstrating that the established MS Binding Assays have the potential to be an efficient alternative to radioligand binding assays widely used for this purpose so far. Copyright © 2018 John Wiley & Sons, Ltd.
Birth of kids after artificial insemination with sex-sorted, frozen-thawed goat spermatozoa.
Bathgate, R; Mace, N; Heasman, K; Evans, G; Maxwell, W M C; de Graaf, S P
2013-12-01
Successful sex-sorting of goat spermatozoa and subsequent birth of pre-sexed kids have yet to be reported. As such, a series of experiments were conducted to develop protocols for sperm-sorting (using a modified flow cytometer, MoFlo SX(®) ) and cryopreservation of goat spermatozoa. Saanen goat spermatozoa (n = 2 males) were (i) collected into Salamon's or Tris catch media post-sorting and (ii) frozen in Tris-citrate-glucose media supplemented with 5, 10 or 20% egg yolk in (iii) 0.25 ml pellets on dry ice or 0.25 ml straws in a controlled-rate freezer. Post-sort and post-thaw sperm quality were assessed by motility (CASA), viability and acrosome integrity (PI/FITC-PNA). Sex-sorted goat spermatozoa frozen in pellets displayed significantly higher post-thaw motility and viability than spermatozoa frozen in straws. Catch media and differing egg yolk concentration had no effect on the sperm parameters tested. The in vitro and in vivo fertility of sex-sorted goat spermatozoa produced with this optimum protocol were then tested by means of a heterologous ova binding assay and intrauterine artificial insemination of Saanen goat does, respectively. Sex-sorted goat spermatozoa bound to sheep ova zona pellucidae in similar numbers (p > 0.05) to non-sorted goat spermatozoa, non-sorted ram spermatozoa and sex-sorted ram spermatozoa. Following intrauterine artificial insemination with sex-sorted spermatozoa, 38% (5/13) of does kidded with 83% (3/5) of kids being of the expected sex. Does inseminated with non-sorted spermatozoa achieved a 50% (3/6) kidding rate and a sex ratio of 3 : 1 (F : M). This study demonstrates for the first time that goat spermatozoa can be sex-sorted by flow cytometry, successfully frozen and used to produce pre-sexed kids. © 2013 Blackwell Verlag GmbH.
Matsuo, Noritaka; Yu-Hua, Wang; Sumiyoshi, Hideaki; Sakata-Takatani, Keiko; Nagato, Hitoshi; Sakai, Kumiko; Sakurai, Mami; Yoshioka, Hidekatsu
2003-08-29
We have characterized the proximal promoter region of the human COL11A1 gene. Transient transfection assays indicate that the segment from -199 to +1 is necessary for the activation of basal transcription. Electrophoretic mobility shift assays (EMSAs) demonstrated that the ATTGG sequence, within the -147 to -121 fragment, is critical to bind nuclear proteins in the proximal COL11A1 promoter. We demonstrated that the CCAAT binding factor (CBF/NF-Y) bound to this region using an interference assay with consensus oligonucleotides and a supershift assay with specific antibodies in an EMSA. In a chromatin immunoprecipitation assay and EMSA using DNA-affinity-purified proteins, CBF/NF-Y proteins directly bound this region in vitro and in vivo. We also showed that four tandem copies of the CBF/NF-Y-binding fragment produced higher transcriptional activity than one or two copies, whereas the absence of a CBF/NF-Y-binding fragment suppressed the COL11A1 promoter activity. Furthermore, overexpression of a dominant-negative CBF-B/NF-YA subunit significantly inhibited promoter activity in both transient and stable cells. These results indicate that the CBF/NF-Y proteins regulate the transcription of COL11A1 by directly binding to the ATTGG sequence in the proximal promoter region.
Development of rapid and sensitive high throughput pharmacologic assays for marine phycotoxins.
Van Dolah, F M; Finley, E L; Haynes, B L; Doucette, G J; Moeller, P D; Ramsdell, J S
1994-01-01
The lack of rapid, high throughput assays is a major obstacle to many aspects of research on marine phycotoxins. Here we describe the application of microplate scintillation technology to develop high throughput assays for several classes of marine phycotoxin based on their differential pharmacologic actions. High throughput "drug discovery" format microplate receptor binding assays developed for brevetoxins/ciguatoxins and for domoic acid are described. Analysis for brevetoxins/ciguatoxins is carried out by binding competition with [3H] PbTx-3 for site 5 on the voltage dependent sodium channel in rat brain synaptosomes. Analysis of domoic acid is based on binding competition with [3H] kainic acid for the kainate/quisqualate glutamate receptor using frog brain synaptosomes. In addition, a high throughput microplate 45Ca flux assay for determination of maitotoxins is described. These microplate assays can be completed within 3 hours, have sensitivities of less than 1 ng, and can analyze dozens of samples simultaneously. The assays have been demonstrated to be useful for assessing algal toxicity and for assay-guided purification of toxins, and are applicable to the detection of biotoxins in seafood.
Hino, Toshiaki; Muro, Yuko; Tamura-Nakano, Miwa; Okabe, Masaru; Tateno, Hiroyuki; Yanagimachi, Ryuzo
2016-09-01
Although 90%-100% of mouse oocytes can be fertilized in vitro with capacitated spermatozoa within 1 h after insemination, oocytes within the oviduct are fertilized one by one over a period of several hours. In vitro experiments showed that both acrosome-intact and acrosome-reacted spermatozoa entered the cumulus oophorus, but that acrosome-reacted spermatozoa reached the surface of oocytes more readily than acrosome-intact spermatozoa. During the period of fertilization within the oviduct, acrosome-reacted spermatozoa were seen throughout the isthmus, but with higher incidence in the upper than in the mid- and lower segments of the isthmus. Very few spermatozoa were present in the ampulla, and almost all were acrosome reacted. Although the cumulus oophorus and zona pellucida are known to be able to induce or facilitate the acrosome reaction of spermatozoa, this picture makes it likely that almost all fertilizing mouse spermatozoa within the oviduct begin to react before ascending from the isthmus to the ampulla. We witnessed a reacted spermatozoon that stayed on the zona pellucida of a fertilized oocyte for a while; it then moved out of the cumulus before reaching the zona pellucida of the nearby unfertilized oocyte. We noted that only a few spermatozoa migrate from the isthmus to the ampulla during the progression of fertilization, and this must be one of the reasons why we do not see many spermatozoa swarming around a single oocyte during in vivo fertilization. © 2016 by the Society for the Study of Reproduction, Inc.
FcUni-RLuc: an engineered Renilla luciferase with Fc binding ability and light emission activity.
Farzannia, A; Roghanian, R; Zarkesh-Esfahani, S H; Nazari, M; Emamzadeh, R
2015-03-07
A novel and advanced Fc-binding probe – FcUni-RLuc namely – has been produced and functionally assayed for labelling IgGs. The Fc antibody binding sequence – HWRGWV – was fused to Renilla luciferase, and the purified probe was employed for bioluminescence enzyme-linked immunoabsorbance assay of Her2 positive cells.
Glaser, Bryan T.; Bergendahl, Veit; Anthony, Larry C.; Olson, Brian; Burgess, Richard R.
2009-01-01
The study of protein-protein interactions is becoming increasingly important for understanding the regulation of many cellular processes. The ability to quantify the strength with which two binding partners interact is desirable but the accurate determination of equilibrium binding constants is a difficult process. The use of Luminescence Resonance Energy Transfer (LRET) provides a homogeneous binding assay that can be used for the detection of protein-protein interactions. Previously, we developed an LRET assay to screen for small molecule inhibitors of the interaction of σ70 with theβ' coiled-coil fragment (amino acids 100–309). Here we describe an LRET binding assay used to monitor the interaction of E. coli σ70 and σ32 with core RNA polymerase along with the controls to verify the system. This approach generates fluorescently labeled proteins through the random labeling of lysine residues which enables the use of the LRET assay for proteins for which the creation of single cysteine mutants is not feasible. With the LRET binding assay, we are able to show that the interaction of σ70 with core RNAP is much more sensitive to NaCl than to potassium glutamate (KGlu), whereas the σ32 interaction with core RNAP is insensitive to both salts even at concentrations >500 mM. We also find that the interaction of σ32 with core RNAP is stronger than σ70 with core RNAP, under all conditions tested. This work establishes a consistent set of conditions for the comparison of the binding affinities of the E.coli sigma factors with core RNA polymerase. The examination of the importance of salt conditions in the binding of these proteins could have implications in both in vitro assay conditions and in vivo function. PMID:19649256
Sapir, A; Shalev, A Hariton; Skalka, N; Bronshtein, A; Altstein, M
2013-03-01
Two approaches for monitoring atenolol (ATL) were applied: an immunochemical assay and a competitive-binding assay, based on the interaction between ATL and its target receptor, β1 adrenergic receptor (β1AR). Polyclonal antibodies (Abs) for ATL were generated, and a highly specific microplate immunochemical assay, that is, an enzyme-linked immunosorbent assay (ELISA), for its detection was developed. The ATL ELISA exhibited I50 and limit of detection (I20) values of 0.15 ± 0.048 and 0.032 ± 0.016 ng/ml, respectively, and the Abs did not cross-react with any of the tested beta-blocker drugs. Furthermore, a human β1AR (h-β1AR) was stably expressed in Spodoptera frugiperda cells (Sf9). The receptor was employed to develop a competitive-binding assay that monitored binding of ATL in the presence of isoproteranol by quantification of secondary messenger, cyclic adenosine monophosphate (cAMP), levels in the transfected cells. The assay showed that the recombinant h-β1AR was functional, could bind the agonistic ligand isoproterenol as well as the antagonist ATL, as indicated by a dose-dependent elevation of cAMP in the presence of isoproteranol, and decrease after ATL addition. The highly efficient and sensitive ELISA and the receptor assay represent two methods suitable for efficient and cost-effective large-scale, high-throughput monitoring of ATL in environmental, agricultural, and biological samples. Copyright © 2012 SETAC.
ApoHRP-based assay to measure intracellular regulatory heme.
Atamna, Hani; Brahmbhatt, Marmik; Atamna, Wafa; Shanower, Gregory A; Dhahbi, Joseph M
2015-02-01
The majority of the heme-binding proteins possess a "heme-pocket" that stably binds to heme. Usually known as housekeeping heme-proteins, they participate in a variety of metabolic reactions (e.g., catalase). Heme also binds with lower affinity to the "Heme-Regulatory Motifs" (HRM) in specific regulatory proteins. This type of heme binding is known as exchangeable or regulatory heme (RH). Heme binding to HRM proteins regulates their function (e.g., Bach1). Although there are well-established methods for assaying total cellular heme (e.g., heme-proteins plus RH), currently there is no method available for measuring RH independent of the total heme (TH). The current study describes and validates a new method to measure intracellular RH. This method is based on the reconstitution of apo-horseradish peroxidase (apoHRP) with heme to form holoHRP. The resulting holoHRP activity is then measured with a colorimetric substrate. The results show that apoHRP specifically binds RH but not with heme from housekeeping heme-proteins. The RH assay detects intracellular RH. Furthermore, using conditions that create positive (hemin) or negative (N-methyl protoporphyrin IX) controls for heme in normal human fibroblasts (IMR90), the RH assay shows that RH is dynamic and independent of TH. We also demonstrated that short-term exposure to subcytotoxic concentrations of lead (Pb), mercury (Hg), or amyloid-β (Aβ) significantly alters intracellular RH with little effect on TH. In conclusion the RH assay is an effective assay to investigate intracellular RH concentration and demonstrates that RH represents ∼6% of total heme in IMR90 cells.
Zumoffen, C M; Gil, R; Caille, A M; Morente, C; Munuce, M J; Ghersevich, S A
2013-05-01
Is lactoferrin (LF) (detected in oviductal secretion) able to bind to oocytes and sperm and modulate gamete interaction? LF binds to zona pellucida (ZP) and spermatozoa (depending upon the capacitation stage and acrosome status) and inhibits gamete interaction in vitro. Proteins from human oviductal tissue secretion modulate gamete interaction and parameters of sperm function in vitro and some of them bind to sperm, but they remain to be isolated and identified. Proteins were isolated from human oviductal tissue secretion using their sperm membrane binding ability. One of the isolated proteins was identified as human LF and immunolocalized in tubal tissues. LF expression was analyzed in native oviductal fluid and oviduct epithelial cells (at different phases of the menstrual cycle: proliferative, periovulatory and secretory). In addition, the LF binding sites on spermatozoa (at different capacitation and acrosome reaction stages) and on ZP and the dose-dependent effect of LF on gamete interaction were investigated. All experiments were performed at least three times. Tubal tissues obtained from premenopausal patients (scheduled for hysterectomy, n = 23) were cultured in DMEM/Ham's F12 medium and conditioned media (CM) were collected. Motile spermatozoa were obtained by swim-up from normozoospermic semen samples from healthy donors (n = 4). An affinity chromatography with sperm membrane extracts was used to isolate proteins from CM. Isolated proteins were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophresis and further identified by nano liquid chromatography tandem mass spectrometry peptide sequencing. The presence of LF in oviductal tissue was investigated by immunohistochemistry and immunofluorescence and was detected in native oviductal fluid and oviduct epithelial cells homogenates by western blot. LF binding sites on gametes were investigated by incubating gametes with the protein coupled to fluorescein isothiocyanate (FITC). The acrosome reaction was assessed with Pisum sativum agglutinin conjugated with rhodamine. The effect of increasing concentrations of LF (0.1-100 µg/ml) on gamete interaction was evaluated by a sperm-ZP binding assay, using human oocytes donated by women undergoing IVF procedures. A protein isolated by the affinity column was identified as human LF. LF was immunolocalized in human oviductal tissue and detected in oviductal fluid and oviduct epithelial cell homogenates. In the latter case, LF expression was highest at the periovulatory phase of the menstrual cycle (P < 0.01). Different LF binding patterns were observed on spermatozoa depending upon capacitation stage and if the acrosome reaction had occurred. Unstained sperm were most prevalent before capacitation, but after incubation for 6 h under capacitating conditions and in acrosome-reacted sperm LF binding was observed, mainly localized in the equatorial segment and post-acrosomal region of the sperm head. LF binding studies on ZP showed homogenous staining. LF caused a dose-dependent significant inhibition of sperm-ZP interaction, and the effect was already significant (P < 0.01) with the lowest LF concentration used. This study has investigated the effect of LF only on human gamete interaction in vitro and thus has some limitations. Further investigations of the potential mechanisms involved in LF action both on gamete function in vitro and in vivo in animal models are needed to confirm the role of this protein in the reproductive process. The present data indicate that human oviductal LF expression is cycle dependent and inhibited gamete interaction in vitro. No previous data were available about potential direct effects of LF on gamete interaction. It could be thought that the protein is involved in the regulation of the reproductive process, perhaps contributing to prevent polyspermy. Thus, further research is needed to clarify the potential role of LF in the regulation of the fertilization process. This study was supported by grants from FONCYT (PICT 01095, S.A.G., M.J.M) and SECyT UNR (PIDBIO238, S.A.G). The authors have no conflict of interest to declare.
Staack, Roland F; Jordan, Gregor; Heinrich, Julia
2012-02-01
For every drug development program it needs to be discussed whether discrimination between free and total drug concentrations is required to accurately describe its pharmacokinetic behavior. This perspective describes the application of mathematical simulation approaches to guide this initial decision based on available knowledge about target biology, binding kinetics and expected drug concentrations. We provide generic calculations that can be used to estimate the necessity of free drug quantification for different drug molecules. In addition, mathematical approaches are used to simulate various assay conditions in bioanalytical ligand-binding assays: it is demonstrated that due to the noncovalent interaction between the binding partners and typical assay-related interferences in the equilibrium, a correct quantification of the free drug concentration is highly challenging and requires careful design of different assay procedure steps.
Dickey, Robert W; Plakas, Steven M; Jester, Edward L E; El Said, Kathleen R; Johannessen, Jan N; Flewelling, Leanne J; Scott, Paula; Hammond, Dan G; Van Dolah, Frances M; Leighfield, Tod A; Bottein Dachraoui, Marie-Yasmine; Ramsdell, John S; Pierce, Richard H; Henry, Mike S; Poli, Mark A; Walker, Calvin; Kurtz, Jan; Naar, Jerome; Baden, Daniel G; Musser, Steve M; White, Kevin D; Truman, Penelope; Miller, Aaron; Hawryluk, Timothy P; Wekell, Marleen M; Stirling, David; Quilliam, Michael A; Lee, Jung K
A thirteen-laboratory comparative study tested the performance of four methods as alternatives to mouse bioassay for the determination of brevetoxins in shellfish. The methods were N2a neuroblastoma cell assay, two variations of the sodium channel receptor binding assay, competitive ELISA, and LC/MS. Three to five laboratories independently performed each method using centrally prepared spiked and naturally incurred test samples. Competitive ELISA and receptor binding (96-well format) compared most favorably with mouse bioassay. Between-laboratory relative standard deviations (RSDR) ranged from 10 to 20% for ELISA and 14 to 31% for receptor binding. Within-laboratory (RSDr) ranged from 6 to 15% for ELISA, and 5 to 31% for receptor binding. Cell assay was extremely sensitive but data variation rendered it unsuitable for statistical treatment. LC/MS performed as well as ELISA on spiked test samples but was inordinately affected by lack of toxin-metabolite standards, uniform instrumental parameters, or both, on incurred test samples. The ELISA and receptor binding assay are good alternatives to mouse bioassay for the determination of brevetoxins in shellfish.
Wischhusen, Jennifer; Padilla, Frederic
2017-07-01
Targeted microbubbles (MBs) are ultrasound contrast agents that are functionalized with a ligand for ultrasound molecular imaging of endothelial markers. Novel targeted MBs are characterized in vitro by incubation in protein-coated wells, followed by binding quantification by microscopy or ultrasound imaging. Both methods provide operator-dependent results: Between 3 and 20 fields of view from a heterogeneous sample are typically selected for analysis by microscopy, and in ultrasound imaging, different acoustic settings affect signal intensities. This study proposes a new method to reproducibly quantify MB binding based on enzyme-linked immunosorbent assay (ELISA), in which bound MBs are revealed with an enzyme-linked antibody. MB-ELISA was adapted to in vitro static binding assays, incubating the MBs in inverted position or by agitation, and compared with microscopy. The specificity and sensitivity of MB-ELISA enable the reliable quantification of MB binding in a rapid, high-throughput and whole-well analysis, facilitating the characterization of new targeted contrast agents. Copyright © 2017 World Federation for Ultrasound in Medicine & Biology. Published by Elsevier Inc. All rights reserved.
Freyberger, Alexius; Wilson, Vickie; Weimer, Marc; Tan, Shirlee; Tran, Hoai-Son; Ahr, Hans-Jürgen
2010-08-01
Despite about two decades of research in the field of endocrine active compounds, still no validated human recombinant (hr) estrogen receptor-alpha (ERalpha) binding assay is available, although hr-ERalpha is available from several sources. In a joint effort, US EPA and Bayer Schering Pharma with funding from the EU-sponsored 6th framework project, ReProTect, developed a model protocol for such a binding assay. Important features of this assay are the use of a full length hr-ERalpha and performance in a 96-well plate format. A full length hr-ERalpha was chosen, as it was considered to provide the most accurate and human-relevant results, whereas truncated receptors could perform differently. Besides three reference compounds [17beta-estradiol, norethynodrel, dibutylphthalate] nine test compounds with different affinities for the ERalpha [diethylstilbestrol (DES), ethynylestradiol, meso-hexestrol, equol, genistein, o,p'-DDT, nonylphenol, n-butylparaben, and corticosterone] were used to explore the performance of the assay. Three independent experiments per compound were performed on different days, and dilutions of test compounds from deep-frozen stocks, solutions of radiolabeled ligand and receptor preparation were freshly prepared for each experiment. The ERalpha binding properties of reference and test compounds were well detected. As expected dibutylphthalate and corticosterone were non-binders in this assay. In terms of the relative ranking of binding affinities, there was good agreement with published data obtained from experiments using a human recombinant ERalpha ligand binding domain. Irrespective of the chemical nature of the compound, individual IC(50)-values for a given compound varied by not more than a factor of 2.5. Our data demonstrate that the assay was robust and reliably ranked compounds with strong, weak, and no affinity for the ERalpha with high accuracy. It avoids the manipulation and use of animals, i.e., the preparation of uterine cytosol as receptor source from ovariectomized rats, as a recombinant protein is used and thus contributes to the 3R concept (reduce, replace, and refine). Furthermore, in contrast to other assays, this assay could be adjusted to an intermediate/high throughput format. On the whole, this assay is a promising candidate for further validation. Copyright 2010 Elsevier Inc. All rights reserved.
Spinaci, M; Bucci, D; Gadani, B; Porcu, E; Tamanini, C; Galeati, G
2017-06-01
As the taste receptor for monosodium glutamate (umami) is expressed in both murine and human spermatozoa and the presence of α-gustducin and α-transducin, G proteins involved in the umami taste signaling, has been described in boar germ cells, the aim of this study was to evaluate if monosodium glutamate (MSG) would exert any effect on sperm-oocyte binding, in vitro fertilization (IVF) and sperm parameters during in vitro induced capacitation. For sperm-zona pellucida binding assay, boar spermatozoa were preincubated for 1 h and then coincubated for 1 h with denuded in vitro matured oocytes in presence of different concentrations of MSG (0, 0.1, 1, 10 mM). MSG 1 and 10 mM significantly (P < 0.05) increased the mean number of sperm bound to ZP compared with control (12.3 ± 9.0, 17.8 ± 11.3, 17.6 ± 10.8, MSG 0, 1 and 10 mM respectively). For in vitro fertilization trials, both sperm preicubation (1 h) and gamete coincubation (1 h) were performed in presence of different concentrations of MSG (0, 0.1, 1, 10 mM). After 19 h of culture in fresh IVF medium, oocytes were fixed. MSG 1 mM significantly (P < 0.05) increased the penetration rate compared with control (53.7 ± 20.4 vs. 36.8 ± 16.2). The addition of MSG during in vitro induced capacitation of boar spermatozoa did not cause any significant difference, compared with control, on the percentage of viable cells, spermatozoa with intact acrosome and the percentage of spermatozoa displaying tyrosine-phosphorylation of sperm tail proteins. In order to evaluate whether the effect elicited by MSG could be due to glutamate uptake in boar spermatozoa, fertilization trials were performed in presence of either 1 mM MSG or 1 mM MSG + 100 μM DL-threo-beta-hydroxyaspartic acid (THA), a non selective inhibitor of glutamate uptake. A significant increase (P < 0.05) in the penetration rate in both MSG and MSG + THA groups compared to control was recorded (39.8 ± 15.7, 53.7 ± 22.1, 52.2 ± 23.7, Control, MSG and MSG + THA respectively) while no difference in penetration rate between MSG and MSG + THA treatment was observed suggesting that sperm glutamate transporters are not involved in the pathway mediating this effect. Our study demonstrates for the first time that glutamate exerts a positive effect on sperm-oocyte binding and fertilization. Further studies are needed to clarify the mechanism by which glutamate exert his effect. Copyright © 2017 Elsevier Inc. All rights reserved.
Smith, Joshua E; Griffin, Daniel K; Leny, Juliann K; Hagen, Joshua A; Chávez, Jorge L; Kelley-Loughnane, Nancy
2014-04-01
The feasibility of using aptamer-gold nanoparticle conjugates (Apt-AuNPs) to design colorimetric assays for in the field detection of small molecules was investigated. An assay to detect cocaine was designed using two clones of a known cocaine-binding aptamer. The assay was based on the AuNPs difference in affinity for single-stranded DNA (non-binding) and double stranded DNA (target bound). In the first assay, a commonly used design was followed, in which the aptamer and target were incubated to allow binding followed by exposure to the AuNPs. Interactions between the non-bound analytes and the AuNPs surface resulted in a number of false positives. The assay was redesigned by incubating the AuNPs and the aptamer prior to target addition to passivate the AuNPs surface. The adsorbed aptamer was able to bind the target while preventing non-specific interactions. The assay was validated with a number of masking and cutting agents and other controlled substances showing minimal false positives. Studies to improve the assay performance in the field were performed, showing that assay activity could be preserved for up to 2 months. To facilitate the assay analysis, an android application for automatic colorimetric characterization was developed. The application was validated by challenging the assay with cocaine standards of different concentrations, and comparing the results to a conventional plate reader, showing outstanding agreement. Finally, the rapid identification of cocaine in mixtures mimicking street samples was demonstrated. This work established that Apt-AuNPs can be used to design robust assays to be used in the field. Copyright © 2013 Elsevier B.V. All rights reserved.
A novel and sensitive radioreceptor assay for serum melatonin levels
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tenn, C.; Niles, L.
A simple and sensitive radioreceptor assay (RRA) has been developed to measure melatonin levels in serum. The assay is based on competition between 2-({sup 125}I)iodomelatonin (({sup 125}I)MEL) and melatonin for binding to high-affinity binding sites in chick forebrain. To measure the amount of melatonin present in a serum sample, it was extracted with dichloromethane and added to the assay medium. The percentage inhibition of radioligand binding in the presence of the extracted serum was determined and compared to the percent displacement by known amounts of melatonin in a standard curve. There was little or no cross-reactivity with other structurally relatedmore » compounds. The sensitivity of the assay is {approximately}1.5pg/0.15 mL and the intra- and inter-assay variations are approximately 8%. Since the RRA results are comparable to that of an established radioimmunoassay (RIA), it provides a sensitive and rapid alternative to the more time consuming RIA.« less
Li, Changqing; Tian, Mi; Yuan, Ye; Zhou, Qinxin
2008-12-01
Human peroxisome proliferator-activated receptors (hPPARs) are ligand-activated transcription factors and are the target for the treatment of many diseases. Screening of their ligands is mainly based on assays of ligand binding to the ligand binding domain (LBD) of hPPARs.However, such assays are difficult because of the preparation of hPPARs LBD. In order to yield functional hPPARs LBD for screening ligands, hPPARs LBD was fused with maltose-binding protein(MBP) using the pMAL-p2x expression system through the gene engineering technique. The radioligand binding assay showed that MBP did not affect ligand binding with hPPARs LBD in the fusion proteins, which means that MBP-hPPARs LBD can be used instead of hPPARs LBD in ligand screening work. The results show that the new strategy using MBP as a fusion tag for preparing hPPARs LBD for screening ligands is a convenient and reliable method. It may be used to easily obtain the other nuclear receptors.
Lectins discriminate between pathogenic and nonpathogenic South American trypanosomes
DOE Office of Scientific and Technical Information (OSTI.GOV)
de Miranda Santos, I.K.; Pereira, M.E.
1984-09-01
Cell surface carbohydrates of Trypanosoma cruzi, Trypanosoma rangeli, and Trypanosoma conorhini were analyzed by a micro-agglutination assay employing 27 highly purified lectins and by binding assays using various /sup 125/I-labeled lectins. The following seven lectins discriminated between the trypanosomes: 1) tomato lectin (an N-acetyl-D-glucosamine-binding protein), both in purified form and as crude tomato juice; 2) Bauhinea purpurea and Sophora japonica lectins (both N-acetyl-D-galactosamine-binding proteins), which selectively agglutinated T. cruzi; 3) Vicia villosa (an N-acetyl-D-galactosamine-binding protein) which was specific for T. rangeli; 4) peanut lectin (a D-galactose-binding protein) both in purified form and as crude saline extract; and 5) Ulex europaeusmore » and Lotus tetragonolobus (both L-fucose-binding proteins) lectins which reacted only with T. conorhini. Binding studies with 125I-labeled lectins were performed to find whether unagglutinated cells of the three different species of trypanosomes might have receptors for these lectins, in which case absence of agglutination could be due to a peculiar arrangement of the receptors. These assays essentially confirmed the agglutination experiments.« less
A versatile assay for RNA-binding proteins in living cells
Strein, Claudia; Alleaume, Anne-Marie; Rothbauer, Ulrich; Hentze, Matthias W.; Castello, Alfredo
2014-01-01
RNA-binding proteins (RBPs) control RNA fate from synthesis to decay. Since their cellular expression levels frequently do not reflect their in vivo activity, methods are needed to assess the steady state RNA-binding activity of RBPs as well as their responses to stimuli. While electrophoresis mobility shift assays (EMSA) have been used for such determinations, their results serve at best as proxies for the RBP activities in living cells. Here, we describe a quantitative dual fluorescence method to analyze protein–mRNA interactions in vivo. Known or candidate RBPs are fused to fluorescent proteins (eGFP, YFP), expressed in cells, cross-linked in vivo to RNA by ultraviolet light irradiation, and immunoprecipitated, after lysis, with a single chain antibody fragment directed against eGFP (GFP-binding protein, GBP). Polyadenylated RNA-binding activity of fusion proteins is assessed by hybridization with an oligo(DT) probe coupled with a red fluorophore. Since UV light is directly applied to living cells, the assay can be used to monitor dynamic changes in RNA-binding activities in response to biological or pharmacological stimuli. Notably, immunoprecipitation and hybridization can also be performed with commercially available GBP-coupled 96-well plates (GFP-multiTrap), allowing highly parallel RNA-binding measurements in a single experiment. Therefore, this method creates the possibility to conduct in vivo high-throughput RNA-binding assays. We believe that this fast and simple radioactivity-free method will find many useful applications in RNA biology. PMID:24664470
Nelson, Kjell E.; Foley, Jennifer O.; Yager, Paul
2008-01-01
We describe a novel microfluidic immunoassay method based on the diffusion of a small molecule analyte into a parallel-flowing stream containing cognate antibody. This interdiffusion results in a steady-state gradient of antibody binding site occupancy transverse to convective flow. In contrast to the diffusion immunoassay (Hatch et al. Nature Biotechnology,19:461−465 (2001)), this antibody occupancy gradient is interrogated by a sensor surface coated with a functional analog of the analyte. Antibodies with at least one unoccupied binding site may specifically bind to this functionalized surface, leading to a quantifiable change in surface coverage by the antibody. SPR imaging is used to probe the spatial distribution of antibody binding to the surface and, therefore, the outcome of the assay. We show that the pattern of antibody binding to the SPR sensing surface correlates with the concentration of a model analyte (phenytoin) in the sample stream. Using an inexpensive disposable microfluidic device, we demonstrate assays for phenytoin ranging in concentration from 75 to 1000 nM in phosphate buffer. At a total volumetric flow rate of 90 nL/sec, the assays are complete within 10 minutes. Inclusion of an additional flow stream on the side of the antibody stream opposite to that of the sample enables simultaneous calibration of the assay. This assay method is suitable for rapid quantitative detection of low-molecular weight analytes for point-of-care diagnostic instrumentation. PMID:17437332
Improved flow cytometer measurement of binding assays
Saunders, G.C.
1984-05-30
The invention relates to a method of measuring binding assays carried out with different size particles wherein the binding assay sample is run through a flow cytometer without separating the sample from the marking agent. The amount of a binding reactant present in a sample is determined by providing particles with a coating of binder and also a known quantity of smaller particles with a coating of binder reactant. The binding reactant is the same as the binding reactant present in the sample. The smaller particles also contain a fluorescent chemical. The particles are combined with the sample and the binding reaction is allowed to occur for a set length of time followed by combining the smaller particles with the mixture of the particles and the sample produced and allowing the binding reactions to proceed to equilibrium. The fluorescence and light scatter of the combined mixture is then measured as the combined mixture passes through a flow cytometer equipped with a laser to bring about fluorescence, and the number and strength of fluorescent events are compared. A similar method is also provided for determining the amount of antigen present in the sample by providing spheres with an antibody coating and some smaller spheres with an antigen coating. (LEW)
Satitsuksanoa, P; Kennedy, M; Gilis, D; Le Mignon, M; Suratannon, N; Soh, W T; Wongpiyabovorn, J; Chatchatee, P; Vangveravong, M; Rerkpattanapipat, T; Sangasapaviliya, A; Piboonpocanun, S; Nony, E; Ruxrungtham, K; Jacquet, A
2016-10-01
The house dust mite (HDM) allergen Der p 13 could be a lipid-binding protein able to activate key innate signaling pathways in the initiation of the allergic response. We investigated the IgE reactivity of recombinant Der p 13 (rDer p 13), its lipid-binding activities, and its capacity to stimulate airway epithelium cells. Purified rDer p 13 was characterized by mass spectrometry, circular dichroism, fluorescence-based lipid-binding assays, and in silico structural prediction. IgE-binding activity and allergenic potential of Der p 13 were examined by ELISA, basophil degranulation assays, and in vitro airway epithelial cell activation assays. Protein modeling and biophysical analysis indicated that Der p 13 adopts a β-barrel structure with a predominately apolar pocket representing a potential binding site for hydrophobic ligands. Fluorescent lipid-binding assays confirmed that the protein is highly selective for ligands and that it binds a fatty acid with a dissociation constant typical of lipid transporter proteins. The low IgE-binding frequency (7%, n = 224) in Thai HDM-allergic patients as well as the limited propensity to activate basophil degranulation classifies Der p 13 as a minor HDM allergen. Nevertheless, the protein with its presumptively associated lipid(s) triggered the production of IL-8 and GM-CSF in respiratory epithelial cells through a TLR2-, MyD88-, NF-kB-, and MAPK-dependent signaling pathway. Although a minor allergen, Der p 13 may, through its lipid-binding capacity, play a role in the initiation of the HDM-allergic response through TLR2 activation. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Zhang, Xu; Zhu, Qing; Tian, Tian; Zhao, Changlong; Zang, Jianye; Xue, Ting; Sun, Baolin
2015-05-15
It has been widely recognized that small RNAs (sRNAs) play important roles in physiology and virulence control in bacteria. In Staphylococcus aureus, many sRNAs have been identified and some of them have been functionally studied. Since it is difficult to identify RNA-binding proteins (RBPs), very little has been known about the RBPs in S. aureus, especially those associated with sRNAs. Here we adopted a tRNA scaffold streptavidin aptamer based pull-down assay to identify RBPs in S. aureus. The tethered RNA was successfully captured by the streptavidin magnetic beads, and proteins binding to RNAIII were isolated and analyzed by mass spectrometry. We have identified 81 proteins, and expressed heterologously 9 of them in Escherichia coli. The binding ability of the recombinant proteins with RNAIII was further analyzed by electrophoresis mobility shift assay, and the result indicates that proteins CshA, RNase J2, Era, Hu, WalR, Pyk, and FtsZ can bind to RNAIII. This study suggests that some proteins can bind to RNA III in S. aureus, and may be involved in RNA III function. And tRSA based pull-down assay is an effective method to search for RBPs in bacteria, which should facilitate the identification and functional study of RBPs in diverse bacterial species.
Furimsky, Anna; Vuong, Ngoc; Xu, Hongbin; Kumarathasan, Premkumari; Xu, Min; Weerachatyanukul, Wattana; Bou Khalil, Maroun; Kates, Morris; Tanphaichitr, Nongnuj
2005-03-01
Although Percoll gradient centrifugation has been used routinely to prepare motile human sperm, its use in preparing motile mouse sperm has been limited. Here, we showed that Percoll gradient-centrifuged (PGC) capacitated mouse sperm had markedly higher fertilizing ability (sperm-zona pellucida [ZP] binding and in vitro fertilization) than washed capacitated mouse sperm. We also showed that the lipid profiles of PGC capacitated sperm and washed capacitated sperm differed significantly. The PGC sperm had much lower contents of cholesterol and phospholipids. This resulted in relative enrichment of male germ cell-specific sulfogalactosylglycerolipid (SGG), a ZP-binding ligand, in PGC capacitated sperm, and this would explain, in part, their increased ZP-binding ability compared with that of washed capacitated sperm. Analyses of phospholipid fatty acyl chains revealed that PGC capacitated sperm were enriched in phosphatidylcholine (PC) molecular species containing highly unsaturated fatty acids (HUFAs), with docosahexaenoic acid (DHA; C22: 6n-3) being the predominant HUFA (42% of total hydrocarbon chains of PC). In contrast, the level of PC-HUFAs comprising arachidonic acid (20:4n-6), docosapentaenoic acid (C22:5n-6), and DHA in washed capacitated sperm was only 27%. Having the highest unsaturation degree among all HUFAs in PC, DHA would enhance membrane fluidity to the uppermost. Therefore, membranes of PGC capacitated sperm would undergo fertilization-related fusion events at higher rates than washed capacitated sperm. These results suggested that PGC mouse sperm should be used in fertilization experiments and that SGG and DHA should be considered to be important biomarkers for sperm fertilizing ability.
Okoh, Sunday O; Iweriebor, Benson C; Okoh, Omobola O; Okoh, Anthony I
2017-10-01
Peperomia pellucida is an annual herbaceous ethnomedicinal plant used in the treatment of a variety of communicable and noncommunicable diseases in the Amazon region. The study aimed at profiling the bioactive constituents of the leaves and stem essential oils (LEO and SEO) of P. pellucida , their in vitro antibacterial and radical scavenging properties as probable lead constituents in the management of oxidative stress and infectious diseases. Materials and. The EOs were obtained from the leaves and stem P. pellucida using modified Clevenger apparatus and characterized by a high-resolution gas chromatography-mass spectrometry, while the radicals scavenging and antibacterial effects on four oxidants and six reference bacteria strains were examined by spectrophotometric and agar diffusion techniques, respectively. The EOs exhibited strong antibacterial activities against six bacteria ( Escherichia coli [180], Enterobacter cloacae, Mycobacterium smegmatis, Listeria ivanovii , Staphylococcus aureus, Streptococcus uberis , and Vibrio paraheamolyticus ) strains. The SEO antibacterial activities were not significantly different ( P < 0.05) from the LEO against most of the test bacteria with minimum inhibitory concentration ranging between 0.15 and 0.20 mg/mL for both EOs. The two oils were bactericidal at 0.20 mg/mL against S. aureus while the minimum bactericidal concentration (0.15 mg/mL) of LEO against L. ivanovii was lower than of SEO (0.20 mg/mL) after 24 h. The LEO IC 50 value (1.67 mg/mL) revealed more radical scavenging activity than the SEO (2.83 mg/mL) and reference compounds against 2,2-diphenyl-1-picrylhydrazyl radical. The EOs also scavenged three other different radicals (2,2'-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt radical, lipid peroxyl radical, and nitric oxide radical) in concentration-dependent manner. Our results suggest that apart from the indigenous uses of the plant extracts, the EO contains strong bioactive compounds with antibacterial and radicals scavenging properties and may be good alternative candidates in the search for novel potent antibiotics in this present era of increasing multidrug-resistant bacterial strains as well as effective antioxidants agents. Established gas chromatography-mass spectrometry technique was applied to quantitatively and qualitatively analyze the volatile constituents in Peperomia pellucida essential oil (EO)The Clinical and Laboratory Standards Institute (2014) guidelines were employed to evaluate the antibacterial effects of the EOsAmong the known prominent bioactive terpenoids, linalool 17.09%, limonene 14.25%, β-caryophyllene 12.52%, and linalyl acetate 10.15% were the main constituents of the EOs in this current studyThe leaf and stem EOs were bactericidal at a concentration below 0.23 mg/mL against three multidrug-resistant bacteria and significantly scavenged known free radicals reported to be associated with contagious and oxidative stress-related disorders. Abbreviations used: GC-MS: Gas chromatography-mass spectrometry, DPPH: 2,2-diphenyl-1-picrylhydrazyl, ABTS: 2,2-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt, DMSO: Dimethyl sulfoxide, LP • : Lipid peroxide radical, NO • : Nitric oxide radical, LEO: Leaf essential oil, SEO: Stem essential oil, RC: Reference compound, TBARS: Thiobarbituric acid.
Okoh, Sunday O.; Iweriebor, Benson C.; Okoh, Omobola O.; Okoh, Anthony I.
2017-01-01
Background: Peperomia pellucida is an annual herbaceous ethnomedicinal plant used in the treatment of a variety of communicable and noncommunicable diseases in the Amazon region. Objective: The study aimed at profiling the bioactive constituents of the leaves and stem essential oils (LEO and SEO) of P. pellucida, their in vitro antibacterial and radical scavenging properties as probable lead constituents in the management of oxidative stress and infectious diseases. Materials and Methods: The EOs were obtained from the leaves and stem P. pellucida using modified Clevenger apparatus and characterized by a high-resolution gas chromatography-mass spectrometry, while the radicals scavenging and antibacterial effects on four oxidants and six reference bacteria strains were examined by spectrophotometric and agar diffusion techniques, respectively. Results: The EOs exhibited strong antibacterial activities against six bacteria (Escherichia coli [180], Enterobacter cloacae, Mycobacterium smegmatis, Listeria ivanovii, Staphylococcus aureus, Streptococcus uberis, and Vibrio paraheamolyticus) strains. The SEO antibacterial activities were not significantly different (P < 0.05) from the LEO against most of the test bacteria with minimum inhibitory concentration ranging between 0.15 and 0.20 mg/mL for both EOs. The two oils were bactericidal at 0.20 mg/mL against S. aureus while the minimum bactericidal concentration (0.15 mg/mL) of LEO against L. ivanovii was lower than of SEO (0.20 mg/mL) after 24 h. The LEO IC50 value (1.67 mg/mL) revealed more radical scavenging activity than the SEO (2.83 mg/mL) and reference compounds against 2,2-diphenyl-1-picrylhydrazyl radical. The EOs also scavenged three other different radicals (2,2’-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt radical, lipid peroxyl radical, and nitric oxide radical) in concentration-dependent manner. Conclusion: Our results suggest that apart from the indigenous uses of the plant extracts, the EO contains strong bioactive compounds with antibacterial and radicals scavenging properties and may be good alternative candidates in the search for novel potent antibiotics in this present era of increasing multidrug-resistant bacterial strains as well as effective antioxidants agents. SUMMARY Established gas chromatography-mass spectrometry technique was applied to quantitatively and qualitatively analyze the volatile constituents in Peperomia pellucida essential oil (EO)The Clinical and Laboratory Standards Institute (2014) guidelines were employed to evaluate the antibacterial effects of the EOsAmong the known prominent bioactive terpenoids, linalool 17.09%, limonene 14.25%, β-caryophyllene 12.52%, and linalyl acetate 10.15% were the main constituents of the EOs in this current studyThe leaf and stem EOs were bactericidal at a concentration below 0.23 mg/mL against three multidrug-resistant bacteria and significantly scavenged known free radicals reported to be associated with contagious and oxidative stress-related disorders. Abbreviations used: GC-MS: Gas chromatography-mass spectrometry, DPPH: 2,2-diphenyl-1-picrylhydrazyl, ABTS: 2,2-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt, DMSO: Dimethyl sulfoxide, LP•: Lipid peroxide radical, NO•: Nitric oxide radical, LEO: Leaf essential oil, SEO: Stem essential oil, RC: Reference compound, TBARS: Thiobarbituric acid PMID:29142389
Xu, Liping; Vagner, Josef; Alleti, Ramesh; Rao, Venkataramanarao; Jagadish, Bhumasamudram; Morse, David L; Hruby, Victor J; Gillies, Robert J; Mash, Eugene A
2010-04-15
A labeled variant of MSH(4), a tetrapeptide that binds to the human melanocortin 4 receptor (hMC4R) with low microM affinity, was prepared by solid-phase synthesis methods, purified, and characterized. The labeled ligand, Eu-DTPA-PEGO-His-dPhe-Arg-Trp-NH(2), exhibited a K(d) for hMC4R of 9.1+/-1.4 microM, approximately 10-fold lower affinity than the parental ligand. The labeled MSH(4) derivative was employed in a competitive binding assay to characterize the interactions of hMC4R with monovalent and divalent MSH(4) constructs derived from squalene. The results were compared with results from a similar assay that employed a more potent labeled ligand, Eu-DTPA-NDP-alpha-MSH. While results from the latter assay reflected only statistical effects, results from the former assay reflected a mixture of statistical, proximity, and/or cooperative binding effects. Copyright 2010 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Rezaei Darestani, Reza; Winter, Philip; Kitova, Elena N.; Tuszynski, Jack A.; Klassen, John S.
2016-05-01
Tubulin, which is the building block of microtubules, plays an important role in cell division. This critical role makes tubulin an attractive target for the development of chemotherapeutic drugs to treat cancer. Currently, there is no general binding assay for tubulin-drug interactions. The present work describes the application of the catch-and-release electrospray ionization mass spectrometry (CaR-ESI-MS) assay to investigate the binding of colchicinoid drugs to αβ-tubulin dimers extracted from porcine brain. Proof-of-concept experiments using positive (ligands with known affinities) and negative (non-binders) controls were performed to establish the reliability of the assay. The assay was then used to screen a library of seven colchicinoid analogues to test their binding to tubulin and to rank their affinities.
Viswanath, Gunda; Halder, Sujata; Divya, Gunda; Majumder, Chandrajeet B; Roy, Partha
2008-11-25
The present work describes the identification of (anti)progestin endocrine disrupting chemicals (EDC) using a two step screening system. In the first step a competitive binding assay was developed using recombinant human progesterone receptor (hPR). The tested chemicals were of various classes like insecticides, their metabolites, industrial chemicals and waste water treatment plant (WWTP) effluents. All the tested chemicals demonstrated a high affinity binding for hPR. The average IC50 values of the test chemicals were within the range of 1-25microM. In the second step of screening, a mammalian cell-based hPR transactivation assay was developed where HEK 293 cells were co-transfected with hPR and luciferase reporter gene under the control of progesterone-response element. Stimulation of the cells with progesterone resulted in about 25-fold up regulation of luciferase activity, with EC50 value of 4nM. Potent anti-progesterone, RU486, significantly inhibited progesterone-induced transactivation and non-progestagenic steroids failed to transactivate hPR till 1microM concentrations. The chemicals showing high binding affinities in competitive binding assays were then tested in transactivation assay and all of them were found to be anti-progestative except WWTP effluents. Transactivation assays using extracted water samples from five different WWTP effluents showed that it was rich in progestative compounds. The levels of induction caused by these effluents were in the range of 15-25% of induction by progesterone and they represented about 6ng/l equivalent progesterone activities. In conclusion, we demonstrated that this two step assay provides an efficient screening tool for the detection of (anti)progestative EDC in various samples.
In-Solution SH2 Domain Binding Assay Based on Proximity Ligation.
Machida, Kazuya
2017-01-01
Protein-protein interactions mediated by SH2 domains confer specificity in tyrosine kinase pathways. Traditional assays for assessing interactions between an SH2 domain and its interacting protein such as far-Western and pull-down are inherently low throughput. We developed SH2-PLA, an in-solution SH2 domain binding assay, that takes advantage of the speed and sensitivity of proximity ligation and real-time PCR. SH2-PLA allows for rapid assessment of SH2 domain binding to a target protein using only a few microliters of cell lysate, thereby making it an attractive new tool to study tyrosine kinase signaling.
Ratio of inner cell mass and trophoblastic cells in demi- and intact pig embryos.
Tao, T; Reichelt, B; Niemann, H
1995-07-01
Pig morulae, early blastocysts and blastocysts were microsurgically bisected to produce zona-free demi-embryos or remained nonbisected with or without zona pellucida, and the presence of inner cell mass cells was determined using a differential fluorochrome staining technique. After 24 h of in vitro culture, all demi-embryos were classified into three categories, based on morphological criteria: 1, excellent; 2, fair; and 3, degenerated. The average number of total cells and inner cell mass cells in intact embryos cultured without zona pellucida for 24 h was higher (P < 0.05) than that for those with zona pellucida in morulae and early blastocysts. The percentage of demi-embryos without inner cell mass cells in these different morphological categories was 18.7%, 22.2% and 29.8% for morulae, respectively; 3.8%, 16.7% and 30.8% for early blastocysts, respectively; and 3.7%, 32.0% and 36.4% for blastocysts, respectively. The percentage of demi-embryos without inner cell mass cells was lower (P < 0.01) in demi-embryos classified in category 1 compared with category 3 in early blastocysts and in category 1 compared with categories 2 and 3 in blastocysts. Significant differences in the total number of cells and the number of inner cell mass cells were apparent among the three morphological categories of demi-embryos derived from morulae, early blastocysts and blastocysts. The ratio of total cells to inner cell mass cells was similar among intact pig embryos and the different morphological categories of demi-embryos derived from morulae, early blastocysts and blastocysts, with the exception of that between demi-blastocysts of category 1 and the other groups.(ABSTRACT TRUNCATED AT 250 WORDS)
Beek, J; Nauwynck, H; Appeltant, R; Maes, D; Van Soom, A
2015-11-01
Serine proteases are involved in mammalian fertilization. Inhibitors of serine proteases can be applied to investigate at which point these enzymes exert their action. We selected two serine protease inhibitors, 4-(2-aminoethyl)benzenesulfonyl fluoride hydrochloride (AEBSF, 100 μM) and soybean trypsin inhibitor (STI, 5 μM) from Glycine max, via previous dose-response IVF experiments and sperm toxicity tests. In the present study, we evaluated how these inhibitors affect porcine fertilization in vitro as calculated on total fertilization rate, polyspermy rate, and the sperm number per fertilized oocyte of cumulus-intact, cumulus-free, and zona-free oocytes. In the control group (no inhibitor), these parameters were 86%, 49%, and 2.2 for cumulus-intact oocytes and 77%, 43%, and 2.2 for cumulus-free oocytes (6-hour gamete incubation period, 1.25 × 10(5) spermatozoa/mL). 4-(2-Aminoethyl)benzenesulfonyl fluoride hydrochloride and STI significantly reduced total fertilization and polyspermy rate in cumulus-intact and cumulus-free oocytes (P < 0.05). Total fertilization rates were respectively 65% and 53% (AEBSF) and 36% and 17% (STI). Inhibition rates were higher in cumulus-free oocytes than in cumulus-intact oocytes, indicating that inhibitors exerted their action after sperm passage through the cumulus. 4-(2-Aminoethyl)benzenesulfonyl fluoride hydrochloride but not STI reduced sperm binding to the ZP. The acrosome reaction was significantly inhibited by both inhibitors. Only 40.4% (AEBSF) and 11.4% (STI) of spermatozoa completed a calcium-induced acrosome reaction compared to 86.7% of spermatozoa in the control group. There was no effect on sperm binding or fertilization parameters in zona-free oocytes. In conclusion, sperm-zona binding and acrosome reaction were inhibited by serine protease inhibitors during porcine IVF. Copyright © 2015 Elsevier Inc. All rights reserved.
Novel Photochrome Aptamer Switch Assay (PHASA) for adaptive binding to aptamers.
Papper, Vladislav; Pokholenko, Oleksandr; Wu, Yuanyuan; Zhou, Yubin; Jianfeng, Ping; Steele, Terry W J; Marks, Robert S
2014-11-01
A novel Photochrome-Aptamer Switch Assay (PHASA) for the detection and quantification of small environmentally important molecules such as toxins, explosives, drugs and pollutants, which are difficult to detect using antibodies-based assays with high sensitivity and specificity, has been developed. The assay is based on the conjugation of a particular stilbene-analyte derivative to any aptamer of interest. A unique feature of the stilbene molecule is its reporting power via trans-cis photoisomerisation (from fluorescent trans-isomer to non-fluorescent cis-isomer) upon irradiation with the excitation light. The resulting fluorescence decay rate for the trans-isomer of the stilbene-analyte depends on viscosity and spatial freedom to rotate in the surrounding medium and can be used to indicate the presence of the analyte. Quantification of the assay is achieved by calibration of the fluorescence decay rate for the amount of the tested analyte. Two different formats of PHASA have been recently developed: direct conjugation and adaptive binding. New stilbene-maleimide derivatives used in the adaptive binding format have been prepared and characterised. They demonstrate effective binding to the model thiol compound and to the thiolated Malachite Green aptamer.
Jia, Zhenzhen; Feng, Zeyang; Wang, Lining; Li, Hao; Wang, Hongyu; Xu, Dingqi; Zhao, Xin; Feng, Daofu; Feng, Xizeng
2018-05-23
Reproductive dysfunction associated with obesity is increasing among women of reproductive age, including infertility and increasing risk of miscarriage. In females, reproductive disorders are linked to declining quality of oocytes. Using a model of diet-induced obesity, we have investigated the possible effects of obesity on oocyte quality, including metabolism, lipid accumulation, ROS levels, meiosis and changes in spindle structure in Metaphase II. Our study showed that obesity induced by a high fat diet can impair oocyte meiosis, destroy spindle assembly, and promote oxidative stress and abnormal mitochondrial distribution. With the addition of resveratrol, the negative impact of diet-induced obesity on the quality of oocytes was alleviated to some extent. In addition, we found that obesity causes mouse oocytes to soften, and resveratrol can restore the zona pellucida of oocytes to the same state as the control group. In conclusion, resveratrol can reverse the adverse effects of obesity on oocytes, which is beneficial for subsequent embryonic development.
Milestones in contraceptive vaccines development and hurdles in their application
Gupta, Satish Kumar; Shrestha, Abhinav; Minhas, Vidisha
2014-01-01
Contraceptive vaccines have been proposed for controlling the growing human population and wildlife population management. Multiple targets such as gonadotropin releasing hormone (GnRH), luteinizing hormone, follicle stimulating hormone, gonadotropin receptors, sperm-specific proteins and zona pellucida glycoproteins have been exploited to develop contraceptive vaccine and their efficacy investigated and shown in various experimental animal models. Vaccines based on GnRH have found application in immuno-castration of male pigs for prevention of boar-taint. Vaccines based on zona pellucida glycoproteins have shown promising results for population management of wild horses and white-tailed deer. Phase II clinical trials in women with β-human chorionic gonadotropin (β-hCG)-based contraceptive vaccine established proof of principle that these can be developed for human application. Block in fertility by β-hCG contraceptive vaccine was reversible. Further research inputs are required to establish the safety of contraceptive vaccines, improve their immunogenicity and to develop novel vaccine delivery platforms for providing long lasting immunity. PMID:24262991
The chewing lice (Phthiraptera: Ischnocera, Amblycera) of the great cormorant (Phalacrocorax carbo).
Leitinger, Jan Phillip; Richter, Stefan
2018-08-01
The Great Cormorant is a widespread bird species with almost worldwide distribution. Accordingly, its general biology has been investigated thoroughly. Less well known, however, are the chewing lice that live inside the plumage of this diving bird. We examined the two known species of Great Cormorant chewing lice, Eidmanniella pellucida (Rudow, 1869) (Amblycera: Menoponidae) and Pectinopygus gyricornis (Denny, 1842) (Ischnocera: Philopteridae). Taking advantage of the autofluorescence of the cuticle, confocal laser scanning microscopy (CLSM) was used to explore the external morphology of all developmental stages of P. gyricornis. Morphometric analyses revealed a standard increase in body size from first larval instar to the adult. In addition, all instars exhibited increasing body segment differentiation, especially in the abdomen and the head. A total of 277 individuals of Pectinopygus gyricornis and 2 individuals of Eidmanniella pellucida were collected from eleven Great Cormorants from Mecklenburg-Western Pomerania, Germany, in 2015. Copyright © 2018 Elsevier B.V. All rights reserved.
Rainbow trout-based assays for estrogenicity are currently being used for development of predictive models based upon quantitative structure activity relationships. A predictive model based on a single species raises the question of whether this information is valid for other spe...
We demonstrate a computational network model that integrates 18 in vitro, high-throughput screening assays measuring estrogen receptor (ER) binding, dimerization, chromatin binding, transcriptional activation and ER-dependent cell proliferation. The network model uses activity pa...
A practical approach to automate randomized design of experiments for ligand-binding assays.
Tsoi, Jennifer; Patel, Vimal; Shih, Judy
2014-03-01
Design of experiments (DOE) is utilized in optimizing ligand-binding assay by modeling factor effects. To reduce the analyst's workload and error inherent with DOE, we propose the integration of automated liquid handlers to perform the randomized designs. A randomized design created from statistical software was imported into custom macro converting the design into a liquid-handler worklist to automate reagent delivery. An optimized assay was transferred to a contract research organization resulting in a successful validation. We developed a practical solution for assay optimization by integrating DOE and automation to increase assay robustness and enable successful method transfer. The flexibility of this process allows it to be applied to a variety of assay designs.
Improved flow cytometer measurement of binding assays
NASA Astrophysics Data System (ADS)
Saunders, G. C.
1984-05-01
A method of measuring binding assays is carried out with different size particles wherein the binding assay sample is run through a flow cytometer without separating the sample from the marking agent. The amount of a binding reactant present in a sample is determined by providing particles with a coating of binder and also known quantity of smaller particles with a coating of binder reactant. The smaller particles also contain a fluorescent chemical. The particles are combined with the sample and the binding reaction is allowed to occur for a set length of time followed by combining the smaller particles with the mixture of the particles and the sample produced and allowing the binding reactions to proceed to equilibrium. The fluorescence and light scatter of the combined mixture is then measured as the combined mixture passes through a flow cytometer equipped with a laser to bring about fluorescence, and the number of fluorescent events are compared. A similar method is also provided for determining the amount of antigen present in the sample by providing spheres with an antibody coating and some smaller spheres with an antigen coating.
Šukalović, V; Roglić, G; Husinec, S; Kostić-Rajaćić, S; Andrić, D; Šoškić, Vukić
2003-11-01
Several tertiary 2-phenylethyl, 2-(1-naphthyl)ethyl and 2-(2-naphthyl)ethyl amines were synthesized and their binding affinities for dopamine D(1), D(2) and serotonin 5-HT(1A) receptors evaluated in radioligand binding assays. All compounds were inactive in D(1) dopamine radioligand binding assay. The 2-(1-naphthyl)ethyl analogues expressed a low but significant binding affinity for the D(2) and moderate one for the 5-HT(1A) receptor subtypes. Most of the remaining compounds expressed binding affinity at the 5-HT(1A) receptor subtype but were inactive in D(2) receptor binding assay. Based on these results and considering the chemical characteristics of the compounds synthesized and evaluated for dopaminergic and serotonergic activity throughout the present study it can be concluded that hydrophobic type of interaction (stacking or edge-to-face) plays a significant role in the formation of receptor-ligand complexes of 2-(1-naphthyl)ethyl amines. This structural motive can be applied to design and synthesize new, more potent dopaminergic/serotonergic ligands by slight chemical modifications.
Detection of Z DNA binding proteins in tissue culture cells.
Leith, I R; Hay, R T; Russell, W C
1988-01-01
A gel electrophoresis DNA binding assay to detect Z DNA binding proteins has been developed utilising [32P] labelled poly [d(G-C)] which was converted to the Z form by incubation in 100 microM Co(NH3)6Cl3. The parameters of the assay were established using a Z DNA antibody as a model system and then applied to extracts of Hela and BHK21 cells. Using an anti-Z DNA antibody conditions were established which allowed resolution of antibody-DNA complexes and free DNA in the presence of 100 microM Co(NH3)6Cl3. The inclusion of unlabelled complementary homopolymers eliminated non-specific binding to the labelled Z-DNA probe. Competition experiments demonstrated that the assay was highly specific for double stranded non-B DNA. Application of the technique to extracts of mammalian cells demonstrated that human and hamster cells contain Z-DNA binding proteins; further characterisation by a blotting technique indicated that a 56,000 molecular weight cell protein preferentially binds Z-DNA. Images PMID:3419919
Binding of environmental carcinogens to asbestos and mineral fibres.
Harvey, G; Pagé, M; Dumas, L
1984-01-01
A rapid method has been developed for measuring the binding capacity of asbestos and other mineral fibres for environmental carcinogens. Benzo(alpha)pyrene (B(alpha)P), nitrosonornicotine (NNN), and N-acetyl-2-aminofluorene (NAAF) were assayed in the presence of Canadian grade 4T30 chrysotile, chrysotile A, amosite, crocidolite, glass microfibres, glasswool, attapulgite, and titanium dioxide. Chrysotile binds significantly more carcinogens than the other mineral fibres. This binding assay is reproducible with coefficients of variation of less than 8% and 6% respectively for inter and intra assay. The influence of pH was also studied, and there is good correlation between the carcinogen binding and the charge of the tested mineral fibres. The in vitro cytotoxicity on macrophage like cell line P388D1 and the haemolytic activity of various mineral fibres were also measured; a good correlation was found between the binding capacity and the cytotoxicity of tested mineral fibres on P388D1 cells. These results give some explanations for the reported synergism between exposure to asbestos and the smoking habits of workers. PMID:6331497
DNA-aptamers binding aminoglycoside antibiotics.
Nikolaus, Nadia; Strehlitz, Beate
2014-02-21
Aptamers are short, single stranded DNA or RNA oligonucleotides that are able to bind specifically and with high affinity to their non-nucleic acid target molecules. This binding reaction enables their application as biorecognition elements in biosensors and assays. As antibiotic residues pose a problem contributing to the emergence of antibiotic-resistant pathogens and thereby reducing the effectiveness of the drug to fight human infections, we selected aptamers targeted against the aminoglycoside antibiotic kanamycin A with the aim of constructing a robust and functional assay that can be used for water analysis. With this work we show that aptamers that were derived from a Capture-SELEX procedure targeting against kanamycin A also display binding to related aminoglycoside antibiotics. The binding patterns differ among all tested aptamers so that there are highly substance specific aptamers and more group specific aptamers binding to a different variety of aminoglycoside antibiotics. Also the region of the aminoglycoside antibiotics responsible for aptamer binding can be estimated. Affinities of the different aptamers for their target substance, kanamycin A, are measured with different approaches and are in the micromolar range. Finally, the proof of principle of an assay for detection of kanamycin A in a real water sample is given.
NASA Astrophysics Data System (ADS)
Aung, Khin Moh Moh; Lim, Michelle Gek Liang; Hong, Shuzhen; Cheung, Edwin; Su, Xiaodi
Forkhead box protein 1 (FoxA1) is a member of the forkhead family of winged-helix transcription factors. It plays crucial roles in the development and differentiation of multiple organs and in the regulation of estrogen-stimulated genes. In this study, in order to determine the regions of FoxA1 necessary for efficient Deoxyribonucleic Acid (DNA) binding, we cloned, expressed and purified a series of FoxA1 constructs that contain either the DNA Binding Domain (DBD), the Transcription Activation Domain (TAD), or both. We determined the DNA binding behavior of these constructs using traditional electrophoretic mobility shift assay (EMSA) and a recently developed gold nanoparticles (AuNPs)-based fast screening method. We conclude that just the DBD region alone is not sufficient for protein-DNA binding activity. Amino acids flanking the upstream of the DBD region are required for maximal DNA binding activity. Through this study, we have also further validated the AuNPs assay for its generality and expanded the existing protocol for comparing the DNA binding behavior of multiple proteins of different charge properties and molecular weights.
Thompson, Christopher M; Bloom, Lee R; Ogiue-Ikeda, Mari; Machida, Kazuya
2015-06-26
There is a great interest in studying phosphotyrosine dependent protein-protein interactions in tyrosine kinase pathways that play a critical role in many aspects of cellular function. We previously established SH2 profiling, a phosphoproteomic approach based on membrane binding assays that utilizes purified Src Homology 2 (SH2) domains as a molecular tool to profile the global tyrosine phosphorylation state of cells. However, in order to use this method to investigate SH2 binding sites on a specific target in cell lysate, additional procedures such as pull-down or immunoprecipitation which consume large amounts of sample are required. We have developed PLA-SH2, an alternative in-solution modular domain binding assay that takes advantage of Proximity Ligation Assay and real-time PCR. The SH2-PLA assay utilizes oligonucleotide-conjugated anti-GST and anti-EGFR antibodies recognizing a GST-SH2 probe and cellular EGFR, respectively. If the GST-SH2 and EGFR are in close proximity as a result of SH2-phosphotyrosine interactions, the two oligonucleotides are brought within a suitable distance for ligation to occur, allowing for efficient complex amplification via real-time PCR. The assay detected signal across at least 3 orders of magnitude of lysate input with a linear range spanning 1-2 orders and a low femtomole limit of detection for EGFR phosphotyrosine. SH2 binding kinetics determined by PLA-SH2 showed good agreement with established far-Western analyses for A431 and Cos1 cells stimulated with EGF at various times and doses. Further, we showed that PLA-SH2 can survey lung cancer tissues using 1 μl lysate without requiring phospho-enrichment. We showed for the first time that interactions between SH2 domain probes and EGFR in cell lysate can be determined in a microliter-scale assay using SH2-PLA. The obvious benefit of this method is that the low sample requirement allows detection of SH2 binding in samples which are difficult to analyze using traditional protein interaction assays. This feature along with short assay runtime makes this method a useful platform for the development of high throughput assays to determine modular domain-ligand interactions which could have wide-ranging applications in both basic and translational cancer research.
Pyrrole-Based Macrocyclic Small-Molecule Inhibitors That Target Oocyte Maturation.
Gunasekaran, Pethaiah; Lee, So-Rim; Jeong, Seung-Min; Kwon, Jeong-Woo; Takei, Toshiki; Asahina, Yuya; Bang, Geul; Kim, Seongnyeon; Ahn, Mija; Ryu, Eun Kyung; Kim, Hak Nam; Nam, Ki-Yub; Shin, Song Yub; Hojo, Hironobu; Namgoong, Suk; Kim, Nam-Hyung; Bang, Jeong Kyu
2017-04-20
Polo-like kinase 1 (PLK1) plays crucial roles in various stages of oocyte maturation. Recently, we reported that the peptidomimetic compound AB103-8, which targets the polo box domain (PBD) of PLK1, affects oocyte meiotic maturation and the resumption of meiosis. However, to overcome the drawbacks of peptidic compounds, we designed and synthesized a series of pyrrole-based small-molecule inhibitors and tested them for their effects on the rates of porcine oocyte maturation. Among them, the macrocyclic compound (E/Z)-3-(2,16-dioxo-19-(4-phenylbutyl)-3,19-diazabicyclo[15.2.1]icosa-1(20),6,17-trien-3-yl)propyl dihydrogen phosphate (4) showed the highest inhibitory activity with enhanced inhibition against embryonic blastocyst formation. Furthermore, the addition of this compound to culture media efficiently blocked the maturation of porcine and mouse oocytes, indicating its ability to penetrate the zona pellucida and cell membrane. We investigated mouse oocytes treated with compound 4, and the resulting impairment of spindle formation confirmed PLK1 inhibition. Finally, molecular modeling studies with PLK1 PBD also confirmed the presence of significant interactions between compound 4 and PLK1 PBD binding pocket residues, including those in the phosphate, tyrosine-rich, and pyrrolidine binding pockets. Collectively, these results suggest that the macrocyclic compound 4 may serve as a promising template for the development of novel contraceptive agents. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Plaza Dávila, M; Bucci, D; Galeati, G; Peña, F J; Mari, G; Giaretta, E; Tamanini, C; Spinaci, M
2015-12-01
Stallion spermatozoa are highly dependent on oxidative phosphorylation for ATP production to achieve normal sperm function and to fuel the motility. The aim of this study was to evaluate the response of equine sperm under capacitating conditions to the inhibition of mitochondrial complex I by rotenone and to test whether epigallocatechin-3-gallate (EGCG), a natural polyphenol component of green tea, could counteract this effect. After 2-h incubation of stallion spermatozoa in modified Tyrode's medium, rotenone (100 nm, 500 nm and 5 μm) and EGCG (10, 20 and 60 μm), alone or in combination, did not induce any significant difference on the percentage of viable cells, live sperm with active mitochondria and spermatozoa with intact acrosome. The inhibition of complex I of mitochondrial respiratory chain of stallion sperm with rotenone exerted a negative effect on heterologous ZP binding ability. EGCG at the concentrations of 10 and 20 μm (but not of 60 μm) induced a significant increase in the number of sperm bound to the ZP compared with that for control. Moreover, when stallion sperm were treated with rotenone 100 nm, the presence of EGCG at all the concentrations tested (10, 20 and 60 μm) significantly increased the number of sperm bound to the ZP up to control levels, suggesting that this green tea polyphenol is able to reduce the toxicity of rotenone. © 2015 Blackwell Verlag GmbH.
Tian, Qingyun; Zhao, Shuai; Liu, Chuanju
2014-01-01
The discovery that TNF receptors (TNFR) serve as the binding receptors for progranulin (PGRN) reveals the significant role of PGRN in inflammatory and autoimmune diseases, including inflammatory arthritis. Herein we describe a simple, antibody-free analytical assay, i.e., a biotin-based solid-phase binding assay, to examine the direct interaction of PGRN/TNFR and the PGRN inhibition of TNF/TNFR interactions. Briefly, a 96-well high-binding microplate is first coated with the first protein (protein A), and after blocking, the coated microplate is incubated with the biotin-labeled second protein (protein B) in the absence or presence of the third protein (protein C). Finally the streptavidin conjugated with a detecting enzyme is added, followed by a signal measurement. Also discussed in this chapter are the advantages of the strategy, key elements to obtain reliable results, and discrepancies among various PGRN proteins in view of the binding activity with TNFR.
Maciel, Milton; Kellathur, Srinivasan N; Chikhlikar, Pryia; Dhalia, Rafael; Sidney, John; Sette, Alessandro; August, Thomas J; Marques, Ernesto T A
2008-08-15
Immunomics research uses in silico epitope prediction, as well as in vivo and in vitro approaches. We inoculated BALB/c (H2d) mice with 17DD yellow fever vaccine to investigate the correlations between approaches used for epitope discovery: ELISPOT assays, binding assays, and prediction software. Our results showed a good agreement between ELISPOT and binding assays, which seemed to correlate with the protein immunogenicity. PREDBALB/c prediction software partially agreed with the ELISPOT and binding assay results, but presented low specificity. The use of prediction software to exclude peptides containing no epitopes, followed by high throughput screening of the remaining peptides by ELISPOT, and the use of MHC-biding assays to characterize the MHC restrictions demonstrated to be an efficient strategy. The results allowed the characterization of 2 MHC class I and 17 class II epitopes in the envelope protein of the YF virus in BALB/c (H2d) mice.
Development of binding assays for the SH2 domain of Grb7 and Grb2 using fluorescence polarization.
Luzy, Jean-Philippe; Chen, Huixiong; Gril, Brunilde; Liu, Wang-Qing; Vidal, Michel; Perdereau, Dominique; Burnol, Anne-Françoise; Garbay, Christiane
2008-02-01
Adaptor proteins Grb7 and Grb2 have been implicated as being 2 potential therapeutic targets in several human cancers, especially those that overexpress ErbB2. These 2 proteins contain both a SH2 domain (Src homology 2) that binds to phosphorylated tyrosine residues contained within ErbB2 and other specific protein targets. Two assays based on enzyme-linked immunosorbent assay and fluorescence polarization methods have been developed and validated to find and rank inhibitors for both proteins binding to the pY(1139). Fluorescence polarization assays allowed the authors to determine quickly and reproducibly affinities of peptides from low nanomolar to high micromolar range and to compare them directly for Grb7 and Grb2. As a result, the assays have identified a known peptidomimetic Grb2 SH2 inhibitor (mAZ-pTyr-(alphaMe)pTyr-Asn-NH(2)) that exhibits the most potent affinity for the Grb7 SH2 domain described to date.
Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A
2007-09-15
We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.
Just, Sarah
2017-02-01
von Willebrand disease (VWD) was first described nearly a century ago in 1924 by Erik Adolf von Willebrand. Diagnostic testing at the time was very limited and it was not until the mid to late 1900s that more tests became available to assist with the diagnosis and classification of VWD. Two of these tests are based on ristocetin, one being ristocetin-induced platelet aggregation (RIPA) and the other the von Willebrand factor (VWF) ristocetin cofactor assay (VWF:RCo). The VWF:RCo assay provides functional assessment of in vitro VWF binding to the platelet glycoprotein (Gp) complex, GPIb-IX-V. Despite some advancements and newer technologies utilizing the principles of the original VWF:RCo assay, the original assay is still referred to as the gold standard for measurement of VWF activity. This article will review the history of VWD diagnostic assays, including RIPA and VWF:RCo over the past 40 years, as well as the newer assays that measure platelet binding with or without ristocetin, and which have been developed with the aim to potentially replace platelet-based ristocetin-dependent assays. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.
Yang, Rui-Nan; Li, Dong-Zhen; Yu, Guangqiang; Yi, Shan-Cheng; Zhang, Yinan; Kong, De-Xin; Wang, Man-Qun
2017-12-01
In light of reverse chemical ecology, the fluorescence competitive binding assays of functional odorant binding proteins (OBPs) is a recent advanced approach for screening behaviorally active compounds of insects. Previous research on Dastareus helophoroides identified a minus-C OBP, DhelOBP21, which preferably binds to several ligands. In this study, only (+)-β-pinene proved attractive to unmated adult beetles. To obtain a more in-depth explanation of the lack of behavioral activity of other ligands we selected compounds with high (camphor) and low (β-caryophyllene) binding affinities. The structural transformation of OBPs was investigated using well-established approaches for studying binding processes, such as fluorescent quenching assays, circular dichroism, and molecular dynamics. The dynamic binding process revealed that the flexibility of DhelOBP21 seems conducive to binding specific ligands, as opposed to broad substrate binding. The compound (+)-β-pinene and DhelOBP21 formed a stable complex through a secondary structural transformation of DhelOBP21, in which its amino-terminus transformed from random coil to an α-helix to cover the binding pocket. On the other hand, camphor could not efficiently induce a stable structural transformation, and its high binding affinities were due to strong hydrogen-bonding, compromising the structure of the protein. The other compound, β-caryophyllene, only collided with DhelOBP21 and could not be positioned in the binding pocket. Studying structural transformation of these proteins through examining the dynamic binding process rather than using approaches that just measure binding affinities such as fluorescence competitive binding assays can provide a more efficient and reliable approach for screening behaviorally active compounds.
Xia, Pengpeng; Quan, Guomei; Yang, Yi; Zhao, Jing; Wang, Yiting; Zhou, Mingxu; Hardwidge, Philip R; Zhu, Jianzhong; Liu, Siguo; Zhu, Guoqiang
2018-02-26
The binding of F4 + enterotoxigenic Escherichia coli (ETEC) and the specific receptor on porcine intestinal epithelial cells is the initial step in F4 + ETEC infection. Porcine aminopeptidase N (APN) is a newly discovered receptor for F4 fimbriae that binds directly to FaeG adhesin, which is the major subunit of the F4 fimbriae variants F4ab, F4ac, and F4ad. We used overlapping peptide assays to map the APN-FaeG binding sites, which has facilitated in the identifying the APN-binding amino acids that are located in the same region of FaeG variants, thereby limiting the major binding regions of APN to 13 peptides. To determine the core sequence motif, a panel of FaeG peptides with point mutations and FaeG mutants were constructed. Pull-down and binding reactivity assays using piglet intestines determined that the amino acids G159 of F4ab, N209 and L212 of F4ac, and A200 of F4ad were the critical residues for APN binding of FaeG. We further show using ELISA and confocal microscopy assay that amino acids 553-568, and 652-670 of the APN comprise the linear epitope for FaeG binding in all three F4 fimbriae variants.
The potential effect of receptor-mediated endocrine modulators across species is of increasing concern. In attempts to address these concerns we are developing androgen and estrogen receptor binding assays using recombinant hormone receptors from a number of species across differ...
Rainbow Trout Androgen Receptor Alpha And Human Androgen Receptor: Comparisons in the COS Whole Cell Binding Assay
Mary C. Cardon, L. Earl Gray, Jr. and Vickie S. Wilson
U.S. Environmental Protection Agency, ORD, NHEERL, Reproductive Toxicology Division, Research Triangle...
Tago, Tetsuro; Furumoto, Shozo; Okamura, Nobuyuki; Harada, Ryuichi; Adachi, Hajime; Ishikawa, Yoichi; Yanai, Kazuhiko; Iwata, Ren; Kudo, Yukitsuka
2016-04-01
Noninvasive imaging of tau and amyloid-β pathologies would facilitate diagnosis of Alzheimer's disease (AD). Recently, we have developed [(18)F]THK-5105 for selective detection of tau pathology by positron emission tomography (PET). The purpose of this study was to clarify biological properties of optically pure [(18)F]THK-5105 enantiomers. Binding for tau aggregates in AD brain section was evaluated by autoradiography (ARG). In vitro binding assays were performed to evaluate the binding properties of enantiomers for AD brain homogenates. The pharmacokinetics in the normal mouse brains was assessed by ex vivo biodistribution assay The ARG of enantiomers showed the high accumulation of radioactivity corresponding to the distribution of tau deposits. In vitro binding assays revealed that (S)-[(18)F]THK-5105 has slower dissociation from tau than (R)-[(18)F]THK-5105. Biodistribution assays indicated that (S)-[(18)F]THK-5105 eliminated faster from the mouse brains and blood compared with (R)-[(18)F]THK-5105. (S)-[(18)F]THK-5105 could be more suitable than (R)-enantiomer for a tau imaging agent.
Odagaki, Yuji; Kinoshita, Masakazu; Ota, Toshio; Meana, J Javier; Callado, Luis F; Matsuoka, Isao; García-Sevilla, Jesús A
2018-06-01
Adenosine signaling plays a complex role in multiple physiological processes in the brain, and its dysfunction has been implicated in pathophysiology of neuropsychiatric diseases such as schizophrenia and affective disorders. In the present study, the coupling between adenosine A 1 receptor and G-protein was assessed by means of two [ 35 S]GTPγS binding assays, i.e., conventional filtration method and [ 35 S]GTPγS binding/immunoprecipitation in rat and human brain membranes. The latter method provides information about adenosine A 1 receptor-mediated Gα i-3 activation in rat as well as human brain membranes. On the other hand, adenosine-stimulated [ 35 S]GTPγS binding determined with conventional assay derives from functional activation of Gα i/o proteins (not restricted only to Gα i-3 ) coupled to adenosine A 1 receptors. The determination of adenosine concentrations in the samples used in the present study indicates the possibility that the assay mixture under our experimental conditions contains residual endogenous adenosine at nanomolar concentrations, which was also suggested by the results on the effects of adenosine receptor antagonists on basal [ 35 S]GTPγS binding level. The effects of adenosine deaminase (ADA) on basal binding also support the presence of adenosine. Nevertheless, the varied patterns of ADA discouraged us from adding ADA into assay medium routinely. The concentration-dependent increases elicited by adenosine were determined in 40 subjects without any neuropsychiatric disorders. The increases in %E max values determined by conventional assay according to aging and postmortem delay should be taken into account in future studies focusing on the effects of psychiatric disorders on adenosine A 1 receptor/G-protein interaction in postmortem human brain tissue.
Abdul Ahmad, Siti Aisyah; Palanisamy, Uma D; Tejo, Bimo A; Chew, Miaw Fang; Tham, Hong Wai; Syed Hassan, Sharifah
2017-11-21
The rapid rise and spread in dengue cases, together with the unavailability of safe vaccines and effective antiviral drugs, warrant the need to discover and develop novel anti-dengue treatments. In this study the antiviral activity of geraniin, extracted from the rind of Nephelium lappaceum, against dengue virus type-2 (DENV-2) was investigated. Geraniin was prepared from Nephelium lappaceum rind by reverse phase C-18 column chromatography. Cytotoxicity of geraniin towards Vero cells was evaluated using MTT assay while IC 50 value was determined by plaque reduction assay. The mode-of-action of geraniin was characterized using the virucidal, attachment, penetration and the time-of-addition assays'. Docking experiments with geraniin molecule and the DENV envelope (E) protein was also performed. Finally, recombinant E Domain III (rE-DIII) protein was produced to physiologically test the binding of geraniin to DENV-2 E-DIII protein, through ELISA competitive binding assay. Cytotoxicity assay confirmed that geraniin was not toxic to Vero cells, even at the highest concentration tested. The compound exhibited DENV-2 plaque formation inhibition, with an IC 50 of 1.75 μM. We further revealed that geraniin reduced viral infectivity and inhibited DENV-2 from attaching to the cells but had little effect on its penetration. Geraniin was observed to be most effective when added at the early stage of DENV-2 infection. Docking experiments showed that geraniin binds to DENV E protein, specifically at the DIII region, while the ELISA competitive binding assay confirmed geraniin's interaction with rE-DIII with high affinity. Geraniin from the rind of Nephelium lappaceum has antiviral activity against DENV-2. It is postulated that the compound inhibits viral attachment by binding to the E-DIII protein and interferes with the initial cell-virus interaction. Our results demonstrate that geraniin has the potential to be developed into an effective antiviral treatment, particularly for early phase dengue viral infection.
Method for screening inhibitors of the toxicity of Bacillus anthracis
Cirino, Nick M.; Jackson, Paul J.; Lehnert, Bruce E.
2001-01-01
The protective antigen (PA) of Bacillus anthracis is integral to the mechanism of anthrax poisoning. The cloning, expression and purification of a 32 kDa B. anthracis PA fragment (PA32) is described. This fragment has also been expressed as a fusion construct to stabilized green fluorescent protein (EGFP-PA32). Both proteins were capable of binding to specific cell surface receptors as determined by fluorescent microscopy and a flow cytometric assay. To confirm binding specificity in the flow cytometric assay, non-fluorescent PA83 or PA32 was used to competitively inhibit fluorescent EGFP-PA32 binding to cell receptors. This assay can be employed as a rapid screen for compounds which disrupts binding of PA to cells. Additionally, the high intracellular expression levels and ease of purification make this recombinant protein an attractive vaccine candidate or therapeutic treatment for anthrax poisoning.
Duo, Jia; Bruno, JoAnne; Kozhich, Alexander; David-Brown, Donata; Luo, Linlin; Kwok, Suk; Santockyte, Rasa; Haulenbeek, Jonathan; Liu, Rong; Hamuro, Lora; Peterson, Jon E; Piccoli, Steven; DeSilva, Binodh; Pillutla, Renuka; Zhang, Yan J
2018-04-01
Ligand-binding assay (LBA) performance depends on quality reagents. Strategic reagent screening and characterization is critical to LBA development, optimization and validation. Application of advanced technologies expedites the reagent screening and assay development process. By evaluating surface plasmon resonance technology that offers high-throughput kinetic information, this article aims to provide perspectives on applying the surface plasmon resonance technology to strategic LBA critical reagent screening and characterization supported by a number of case studies from multiple biotherapeutic programs.
Rudolf, Amalie Frederikke; Skovgaard, Tine; Knapp, Stefan; Jensen, Lars Juhl; Berthelsen, Jens
2014-01-01
Binding assays are increasingly used as a screening method for protein kinase inhibitors; however, as yet only a weak correlation with enzymatic activity-based assays has been demonstrated. We show that the correlation between the two types of assays can be improved using more precise screening conditions. Furthermore a marked improvement in the correlation was found by using kinase constructs containing the catalytic domain in presence of additional domains or subunits. PMID:24915177
Binding Assays Using Recombinant SH2 Domains: Far-Western, Pull-Down, and Fluorescence Polarization.
Machida, Kazuya; Liu, Bernard
2017-01-01
Recognition of phosphotyrosine-containing sequences by SH2 domains confers specificity in tyrosine kinase pathways. By assessing interactions between isolated SH2 domains and their binding proteins, it is possible to gain insight into otherwise inaccessible complex cellular systems. Far-Western, pull-down, and fluorescence polarization (FP) have been frequently used for characterization of phosphotyrosine signaling. Here, we outline standard protocols for these established assays using recombinant SH2 domain, emphasizing the importance of appropriate sample preparation and assay controls.
Pernomian, Larissa; Gomes, Mayara Santos; Moreira, Josimar Dornelas; da Silva, Carlos Henrique Tomich de Paula; Rosa, Joaquin Maria Campos; Cardoso, Cristina Ribeiro de Barros
2017-01-01
One of the cornerstones of rational drug development is the measurement of molecular parameters derived from ligand-receptor interaction, which guides therapeutic windows definition. Over the last decades, radioligand binding has provided valuable contributions in this field as key method for such purposes. However, its limitations spurred the development of more exquisite techniques for determining such parameters. For instance, safety risks related to radioactivity waste, expensive and controlled disposal of radioisotopes, radiotracer separation-dependence for affinity analysis, and one-site mathematical models-based fitting of data make radioligand binding a suboptimal approach in providing measures of actual affinity conformations from ligands and G proteincoupled receptors (GPCR). Current advances on high-throughput screening (HTS) assays have markedly extended the options of sparing sensitive ways for monitoring ligand affinity. The advent of the novel bioluminescent donor NanoLuc luciferase (Nluc), engineered from Oplophorus gracilirostris luciferase, allowed fitting bioluminescence resonance energy transfer (BRET) for monitoring ligand binding. Such novel approach named Nluc-based BRET (NanoBRET) binding assay consists of a real-time homogeneous proximity assay that overcomes radioligand binding limitations but ensures the quality in affinity measurements. Here, we cover the main advantages of NanoBRET protocol and the undesirable drawbacks of radioligand binding as molecular methods that span pharmacological toolbox applied to Drug Discovery. Also, we provide a novel perspective for the application of NanoBRET technology in affinity assays for multiple-state binding mechanisms involving oligomerization and/or functional biased selectivity. This new angle was proposed based on specific biophysical criteria required for the real-time homogeneity assigned to the proximity NanoBRET protocol. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Lipid Microarray Biosensor for Biotoxin Detection.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Singh, Anup K.; Throckmorton, Daniel J.; Moran-Mirabal, Jose C.
2006-05-01
We present the use of micron-sized lipid domains, patterned onto planar substrates and within microfluidic channels, to assay the binding of bacterial toxins via total internal reflection fluorescence microscopy (TIRFM). The lipid domains were patterned using a polymer lift-off technique and consisted of ganglioside-populated DSPC:cholesterol supported lipid bilayers (SLBs). Lipid patterns were formed on the substrates by vesicle fusion followed by polymer lift-off, which revealed micron-sized SLBs containing either ganglioside GT1b or GM1. The ganglioside-populated SLB arrays were then exposed to either Cholera toxin subunit B (CTB) or Tetanus toxin fragment C (TTC). Binding was assayed on planar substrates bymore » TIRFM down to 1 nM concentration for CTB and 100 nM for TTC. Apparent binding constants extracted from three different models applied to the binding curves suggest that binding of a protein to a lipid-based receptor is strongly affected by the lipid composition of the SLB and by the substrate on which the bilayer is formed. Patterning of SLBs inside microfluidic channels also allowed the preparation of lipid domains with different compositions on a single device. Arrays within microfluidic channels were used to achieve segregation and selective binding from a binary mixture of the toxin fragments in one device. The binding and segregation within the microfluidic channels was assayed with epifluorescence as proof of concept. We propose that the method used for patterning the lipid microarrays on planar substrates and within microfluidic channels can be easily adapted to proteins or nucleic acids and can be used for biosensor applications and cell stimulation assays under different flow conditions. KEYWORDS. Microarray, ganglioside, polymer lift-off, cholera toxin, tetanus toxin, TIRFM, binding constant.4« less
Prasada, Rao T; Lakshmi, Prasanth T; Parvathy, R; Murugavel, S; Karuna, Devi; Paritosh, Joshi
2017-02-01
Vitronectin (Vn), a multifunctional protein of blood and extracellular matrix, interacts with complement C9. This interaction may modulate innate immunity. Details of Vn-C9 interactions are limited. Vn-C9 interactions were assessed by employing a goat homologous system and observing Vn binding to C9 in three different assays. Using recombinant fragments, C9 binding was mapped to the N-terminus of Vn. Site directed mutagenesis was performed to alter the second arginine glycine aspartic acid (RGD) sequence (RGD-2) of Vn. Changing R to G or D to A in RGD-2 caused significant decrease in Vn binding to C9 whereas changing of R to G in the first RGD motif (RGD-1) had no effect on Vn binding to C9. These results imply that the RGD-2 of goat Vn is involved in C9 binding. In a competitive binding assay, the presence of soluble RGD peptide inhibited Vn binding to C9 whereas heparin had no effect. Vn binding to C9 was also evaluated in terms of bacterial pathogenesis. Serum dependent inhibition of Escherichia coli growth was significantly reverted when Vn or its N-fragment were included in the assay. The C-fragment, which did not support C9 binding, also partly nullified serum-dependent inhibition of bacterial growth, probably through other serum component(s). © 2017 The Societies and John Wiley & Sons Australia, Ltd.
Circulating Immune Complexes in Lyme Arthritis
Hardin, John A.; Walker, Lesley C.; Steere, Allen C.; Trumble, Thomas C.; Tung, Kenneth S. K.; Williams, Ralph C.; Ruddy, Shaun; Malawista, Stephen E.
1979-01-01
We have found immunoglobulin (Ig) G-containing material consistent with immune complexes in the sera of patients with Lyme arthritis. It was detected in 29 of 55 sera (55%) from 31 patients by at least one of three assays: 125I-C1q binding, C1q solid phase, or Raji cell. The presence of reactive material correlated with clinical aspects of disease activity; it was found early in the illness, was most prominent in sera from the sickest patients, was infrequent during remissions, and often fluctuated in parallel with changes in clinical status. The results in the two C1q assays showed a strong positive correlation (P<0.001). They were each elevated in 45% of the sera and were usually concordant (85%). In contrast, the Raji cell assay was less frequently positive and often discordant with the C1q assays. In sucrose density gradients, putative circulating immune complexes sedimented near 19S; they, too, were detected best by the two assays based on C1q binding. An additional 7S component was found in some sera by the 125I-C1q binding assay. Serum complement was often above the range of normal in patients with mild disease and normal in patients with severe disease but did not correlate significantly with levels of circulating immune complexes. IgM and IgG rheumatoid factors were not detectable. These findings support a role for immune complexes in the pathogenesis of Lyme arthritis. Their measurement, by either the 125I-C1q binding assay or by the C1q solid phase assay, often provides a sensitive index of disease activity. Moreover, the complexes are likely sources of disease-related antigens for further study of this new disorder. PMID:429566
Yan, Wei; Yang, Tao; Yang, Jianhong; Wang, Taijin; Yu, Yamei; Wang, Yuxi; Chen, Qiang; Bai, Peng; Li, Dan; Ye, Haoyu; Qiu, Qiang; Zhou, Yongzhao; Hu, Yiguo; Yang, Shengyong; Wei, Yuquan; Li, Weimin; Chen, Lijuan
2018-05-22
Many tubulin inhibitors are in clinical use as anti-cancer drugs. In our previous study, a novel series of 4-substituted coumarins derivatives were identified as novel tubulin inhibitors. Here, we report the anti-cancer activity and underlying mechanism of one of the 4-substituted coumarins derivatives (SKLB060). The anti-cancer activity of SKLB060 was tested on 13 different cancer cell lines and four xenograft cancer models. Immunofluorescence staining, cell cycle analysis, and tubulin polymerization assay were employed to study the inhibition of tubulin. N, N '-Ethylenebis(iodoacetamide) assay was used to measure binding to the colchicine site. Wound-healing migration and tube formation assays were performed on human umbilical vascular endothelial cells to study anti-vascular activity (the ability to inhibit blood vessel growth). Mitotic block reversibility and structural biology assays were used to investigate the SKLB060-tubulin bound model. SKLB060 inhibited tubulin polymerization and subsequently induced G2/M cell cycle arrest and apoptosis in cancer cells. SKLB060 bound to the colchicine site of β-tubulin and showed antivascular activity in vitro. Moreover, SKLB060 induced reversible cell cycle arrest and reversible inhibition of tubulin polymerization. A mitotic block reversibility assay showed that the effects of SKLB060 have greater reversibility than those of colcemid (a reversible tubulin inhibitor), indicating that SKLB060 binds to tubulin in a totally reversible manner. The crystal structures of SKLB060-tubulin complexes confirmed that SKLB060 binds to the colchicine site, and the natural coumarin ring in SKLB060 enables reversible binding. These results reveal that SKLB060 is a powerful and reversible microtubule inhibitor that binds to the colchicine site and is effective in multidrug-resistant cell lines. © 2018 The Author(s). Published by S. Karger AG, Basel.
Schimmel, Tim; Cohen, Jacques; Saunders, Helen; Alikani, Mina
2014-12-01
Does laser-assisted zona thinning of cleavage stage mouse embryos facilitate hatching in vitro? No, unlike laser zona opening, zona thinning does not facilitate embryo hatching. Artificial opening of the zona pellucida facilitates hatching of mouse and human embryos. Laser-assisted zona thinning has also been used for the purpose of assisted hatching of human embryos but it has not been properly investigated in an animal model; thinning methods have produced inconsistent clinical results. Time-lapse microscopy was used to study the hatching process in the mouse after zona opening and zona thinning; a control group of embryos was not zona-manipulated but exposed to the same laser energy. Eight-cell CB6F1/J mouse embryos were pooled and allocated to three groups (n = 56 per group): A control group of embryos that were exposed to a dose of laser energy focused outside the zona pellucida (zona intact); one experimental group of embryos in which the zona pellucida was opened by complete ablation using the same total number of pulses as the control group; a second experimental group of embryos in which the zona pellucida was thinned to establish a smooth lased area using the same number of pulses as used in the other two groups. The width of the zona opening was 25 μm and width of the thinned area was 35 μm. Development was monitored by time-lapse microscopy. Overall treatment differences for continuous variables were analyzed by analysis of variance and pairwise comparisons using the Student t-test allowing for unequal variances, while for categorical data, a standard chi-squared test was utilized for all pairwise comparisons. The frequency of complete hatching was 33.9% in the control group, 94.4% after zona opening, and 39.3% after zona thinning (overall group comparison, P < 0.0001). Overall, 60.7% of the zona-thinned embryos did not complete the hatching process and remained trapped within the zona; when they did hatch, they did not necessarily hatch from the zona-thinned area. Hatching in about one-third of the zona-intact embryos began with breaches at multiple sites by small groups of cells. Likewise, 53.6% of zona-thinned embryos had multiple breaches, always involving an area outside the thinned zone. Zona opening decreased multiple breaching and led to blastocyst escape an average of 14 h earlier than zona-thinned embryos and 5.5 h before control embryos (P = 0.0003). The experiments presented here were limited to in vitro experiments performed in the mouse. Whether human embryos would behave the same way under similar circumstances is unknown. We postulate that zona thinning is not beneficial in human embryos. The experiments demonstrate that zona thinning is not equivalent to zona opening for assisted hatching. The study provides reason for systematic reviews of assisted hatching trials to take the method of assisted hatching into consideration and not combine the results of zona thinning and zona opening procedures. Institutional funds were used for the study. No competing interests are declared. © The Author 2014. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology.
Steele, J C P; Phelps, R J; Simmonds, M S J; Warhurst, D C; Meyer, D J
2002-07-01
Forty-two compounds isolated from nine plants used within South America for the treatment of malaria were tested for haemin binding using two novel, rapid screening methods. The data obtained were analysed with respect to IC(50) values for in vitro toxicity to Plasmodium falciparum trophozoites. One method, a multiwell assay based on the inhibition of the interaction of haemin with glutathione (GSH), is sensitive in the 10 microM range, takes c. 1 h and is suitable for either a high throughput screen or rapid assay during natural product isolation. Of 19 compounds showing antiplasmodial activity (IC(50) < 40 microM), 16 (84%) showed >40% inhibition of GSH-haemin reaction. The sensitivity and specificity of the assay were 0.85 and 0.82, respectively. The positive predictive value was 0.81 and the negative predictive value 0.86. A more sensitive assay (0.1 microM range) is based on the reversal by haemin-binding compounds of the haemin inhibition of the L-dopachrome-methyl ester tautomerase activity of human macrophage migration inhibitory factor. This assay gives a better idea of the affinity of interaction and uses very small amounts of test compound. The log[RI(50)] of eight of the compounds that tested positive in the above assays together with those of quinine and chloroquine showed a positive correlation with log[antiplasmodial IC(50)] for strain T9-96 (r = 0.824) and strain K1 (r = 0.904). Several of the antimalarial compounds that bind haemin are isoquinolines, a class not shown previously to interact with haemin.
Hayward, C P M; Moffat, K A; Graf, L
2014-06-01
Diagnostic tests for von Willebrand disease (VWD) are important for the assessment of VWD, which is a commonly encountered bleeding disorder worldwide. Technical innovations have been applied to improve the precision and lower limit of detection of von Willebrand factor (VWF) assays, including the ristocetin cofactor activity assay (VWF:RCo) that uses the antibiotic ristocetin to induce plasma VWF binding to glycoprotein (GP) IbIXV on target platelets. VWF-collagen-binding assays, depending on the type of collagen used, can improve the detection of forms of VWD with high molecular weight VWF multimer loss, although the best method is debatable. A number of innovations have been applied to VWF:RCo (which is commonly performed on an aggregometer), including replacing the target platelets with immobilized GPIbα, and quantification by an enzyme-linked immunosorbent assay (ELISA), immunoturbidimetric, or chemiluminescent end-point. Some common polymorphisms in the VWF gene that do not cause bleeding are associated with falsely low VWF activity by ristocetin-dependent methods. To overcome the need for ristocetin, some new VWF activity assays use gain-of-function GPIbα mutants that bind VWF without the need for ristocetin, with an improved precision and lower limit of detection than measuring VWF:RCo by aggregometry. ELISA of VWF binding to mutated GPIbα shows promise as a method to identify gain-of-function defects from type 2B VWD. The performance characteristics of many new VWF activity assays suggest that the detection of VWD, and monitoring of VWD therapy, by clinical laboratories could be improved through adopting newer generation VWF assays. © 2014 John Wiley & Sons Ltd.
Alder, J Tracy; Hacksell, Uli; Strange, Philip G
2003-01-01
Factors influencing agonist affinity and relative efficacy have been studied for the 5-HT1A serotonin receptor using membranes of CHO cells expressing the human form of the receptor and a series of R-and S-2-(dipropylamino)tetralins (nonhydroxylated and monohydroxylated (5-OH, 6-OH, 7-OH, 8-OH) species). Ligand binding studies were used to determine dissociation constants for agonist binding to the 5-HT1A receptor: Ki values for agonists were determined in competition versus the binding of the agonist [3H]-8-OH DPAT. Competition data were all fitted best by a one-binding site model.Ki values for agonists were also determined in competition versus the binding of the antagonist [3H]-NAD-199. Competition data were all fitted best by a two-binding site model, and agonist affinities for the higher (Kh) and lower affinity (Kl) sites were determined. The ability of the agonists to activate the 5-HT1A receptor was determined using stimulation of [35S]-GTPγS binding. Maximal effects of agonists (Emax) and their potencies (EC50) were determined from concentration/response curves for stimulation of [35S]-GTPγS binding. Kl/Kh determined from ligand binding assays correlated with the relative efficacy (relative Emax) of agonists determined in [35S]-GTPγS binding assays. There was also a correlation between Kl/Kh and Kl/EC50 for agonists determined from ligand binding and [35S]-GTPγS binding assays. Simulations of agonist binding and effect data were performed using the Ternary Complex Model in order to assess the use of Kl/Kh for predicting the relative efficacy of agonists. PMID:12684269
Our objectives were to assess whether binding of chemicals differs significantly between recombinant estrogen receptors from fathead minnow (fhERα) and human (hERα) and to evaluate the performance of these receptors using two different in vitro assay systems: a COS whole cell bin...
RAINBOW TROUT ANDROGEN RECEPTOR ALPHA AND HUMAN ANDROGEN RECEPTOR: COMPARISONS IN THE COS WHOLE CELL BINDING ASSAY.
MC Cardon, PC Hartig,LE Gray, Jr. and VS Wilson.
U.S. EPA, ORD, NHEERL, RTD, Research Triangle Park, NC, USA.
Typically, in vitro hazard assessments for ...
USDA-ARS?s Scientific Manuscript database
A quantifiable in situ immune fluorescent assay (IFA) was developed to measure bluetongue virus (BTV) binding to mammalian cells. The utility of the assay was demonstrated with both Chinese hamster ovary (CHO) and bovine pulmonary artery endothelial (CPAE) cells. Since heparin sulfate (HS) has been ...
Characterization of the swine adipocyte A1 adenosine receptor using an optimized assay system.
Dong, Q; Schuchman, J; Carey, G B
1994-07-01
The radioligand binding assay of A1 adenosine receptors in adipocyte crude plasma membrane from Yucatan miniature swine was optimized by evaluating 17 factors involved in the assay. Significant effects of CHAPS, adenosine deaminase, EDTA, pre-rinsing glass fiber filters and pH were found for the binding measurements. Using the optimized procedure, [3H]8-cyclopentyl-1,3-dipropylxanthine, ([3H]-DPCPX) binding to A1 adenosine receptors in swine subcutaneous adipocyte crude plasma membrane was measured; Bmax and Kd values were 479 +/- 77 fmol/mg protein and 0.87 +/- 0.10 nM, respectively. Values for mesenteric adipose tissue from sedentary swine and subcutaneous adipose tissue from exercise-trained swine were also measured.
Sloan, John H; Conway, Richard G; Pottanat, Thomas G; Troutt, Jason S; Higgs, Richard E; Konrad, Robert J; Qian, Yue-Wei
2016-10-01
Immunogenicity testing of biotherapeutic drugs is a regulatory requirement. Herein, we describe a drug-tolerant assay for detecting neutralizing antibodies against a therapeutic antibody. Excess target of the therapeutic antibody was incorporated into the detection step of an affinity capture elution assay. Signal generated from binding of antidrug antibody (ADA) to the therapeutic antibody was compared with signal from binding of ADA to the therapeutic antibody preincubated with its target. The results demonstrated that the target blocked binding of the therapeutic antibody to neutralizing monkey ADA and to two anti-idiotypic antibodies. This highly drug-tolerant novel approach enables the detection of neutralizing antibodies and allows for one basic assay format to achieve complete characterization of ADA responses.
Patzke, Juergen; Budde, Ulrich; Huber, Andreas; Méndez, Adriana; Muth, Heidrun; Obser, Tobias; Peerschke, Ellinor; Wilkens, Matthias; Schneppenheim, Reinhard
2014-12-01
The functional activity of von Willebrand factor (VWF) is most frequently measured by using the ristocetin cofactor assay (VWF:RCo). However, the method's drawbacks include unsatisfactory precision, sensitivity and availability of automated system applications. We have developed an alternative assay (INNOVANCE VWF Ac) that is based on the binding of VWF to recombinant glycoprotein Ib (GPIb). Two gain-of-function mutations were introduced into a GPIb fragment, allowing an assay format without ristocetin. Fully automated assay applications are available for the BCS/BCS XP systems and the Sysmex CS-2000i, Sysmex CA-7000, Sysmex CA-1500 and Sysmex CA-560 systems.The INNOVANCE VWF Ac assay measuring range extends from 4 to 600% VWF for all systems except the Sysmex CA-560 system. Within-device precision values were found to be between 2 and 7%. The limit of detection was below 2.2% VWF. In a study on the BCS XP system, a total number of 580 sample results yielded a correlation to the VWF:RCo assay of r equal to 0.99 (slope = 0.96). Very similar results were observed when von Willebrand disease samples type 1, 2A, 2B, 2M, 2N and 3 were investigated with the new assay and the VWF:RCo assay. The excellent performance data and comparability to VWF:RCo, together with the ease of use, led us to the conclusion that the ristocetin cofactor assay can be replaced by the new GPIb-binding assay to reliably diagnosing patients with von Willebrand disease.
Small Molecule Regulation of Protein Conformation by Binding in the Flap of HIV Protease
Tiefenbrunn, Theresa; Forli, Stefano; Baksh, Michael M.; Chang, Max W.; Happer, Meaghan; Lin, Ying-Chuan; Perryman, Alexander L.; Rhee, Jin-Kyu; Torbett, Bruce E.; Olson, Arthur J.; Elder, John H.; Finn, M. G.; Stout, C. David
2013-01-01
The fragment indole-6-carboxylic acid (1F1), previously identified as a flap site binder in a fragment-based screen against HIV protease (PR), has been co-crystallized with pepstatin-inhibited PR and with apo-PR. Another fragment, 3-indolepropionic acid (1F1-N), predicted by AutoDock calculations and confirmed in a novel ‘inhibition of nucleation’ crystallization assay, exploits the same interactions in the flap site in two crystal structures. Both 1F1 and 1F1-N bind to the closed form of apo-PR and to pepstatin:PR. In solution, 1F1 and 1F1-N raise the Tm of apo-PR by 3.5–5 °C as assayed by differential scanning fluorimetry (DSF), and show equivalent low-micromolar binding constants to both apo-PR and pepstatin:PR, assayed by backscattering interferometry (BSI). The observed signal intensities in BSI are greater for each fragment upon binding to apo-PR than to pepstatin-bound PR, consistent with greater conformational change in the former binding event. Together, these data indicate that fragment binding in the flap site favors a closed conformation of HIV PR. PMID:23540839
Antibody binding in altered gravity: implications for immunosorbent assay during space flight
NASA Technical Reports Server (NTRS)
Maule, Jake; Fogel, Marilyn; Steele, Andrew; Wainwright, Norman; Pierson, Duane L.; McKay, David S.
2003-01-01
A single antibody-incubation step of an indirect, enzyme-linked immunosorbent assay (ELISA) was performed during microgravity, Martian gravity (0.38 G) and hypergravity (1.8 G) phases of parabolic flight, onboard the NASA KC-135 aircraft. Antibody-antigen binding occurred within 15 seconds; the level of binding did not differ between microgravity, Martian gravity and 1 G (Earth's gravity) conditions. During hypergravity and 1 G, antibody binding was directly proportional to the fluid volume (per microtiter well) used for incubation; this pattern was not observed during microgravity. These effects in microgravity may be due to "fluid spread" within the chamber (observed during microgravity with digital photography), leading to greater fluid-surface contact and subsequently antibody-antigen contact. In summary, these results demonstrate that: i) ELISA antibody-incubation and washing steps can be successfully performed by human operators during microgravity, Martian gravity and hypergravity; ii) there is no significant difference in antibody binding between microgravity, Martian gravity and 1 G conditions; and iii) a smaller fluid volume/well (and therefore less antibody) was required for a given level of binding during microgravity. These conclusions indicate that reduced gravity would not present a barrier to successful operation of immunosorbent assays during spaceflight.
Jiang, Jian; Huang, Ying; Shu, Changlong; Soberón, Mario; Bravo, Alejandra; Liu, Chunqing; Song, Fuping; Lai, Jinsheng
2017-01-01
ABSTRACT The Bacillus thuringiensis strain HBF-18 (CGMCC 2070), containing two cry genes (cry8-like and cry8Ga), is toxic to Holotrichia oblita larvae. Both Cry8-like and Cry8Ga proteins are active against this insect pest, and Cry8-like is more toxic. To analyze the characteristics of the binding of Cry8-like and Cry8Ga proteins to brush border membrane vesicles (BBMVs) in H. oblita larvae, binding assays were conducted with a fluorescent DyLight488-labeled Cry8-like toxin. The results of saturation binding assays demonstrated that Cry8-like bound specifically to binding sites on BBMVs from H. oblita, and heterologous competition assays revealed that Cry8Ga shared binding sites with Cry8-like. Furthermore, Cry8-like-binding proteins in the midgut from H. oblita larvae were identified by pulldown assays and liquid chromatography-tandem mass spectrometry (LC-MS/MS). In addition, the H. oblita midgut transcriptome was assembled by high-throughput RNA sequencing and used for identification of Cry8-like-binding proteins. Eight Cry8-like-binding proteins were obtained from pulldown assays conducted with BBMVs. The LC-MS/MS data for these proteins were successfully matched with the H. oblita transcriptome, and BLASTX results identified five proteins as serine protease, transferrin-like, uncharacterized protein LOC658236 of Tribolium castaneum, ATPase catalytic subunit, and actin. These identified Cry8-like-binding proteins were different from those confirmed previously as receptors for Cry1A proteins in lepidopteran insect species, such as aminopeptidase, alkaline phosphatase, and cadherin. IMPORTANCE Holotrichia oblita is one of the main soil-dwelling pests in China. The larvae damage the roots of crops, resulting in significant yield reductions and economic losses. H. oblita is difficult to control, principally due to its soil-dwelling habits. In recent years, some Cry8 toxins from Bacillus thuringiensis were shown to be active against this pest. Study of the mechanism of action of these Cry8 toxins is needed for their effective use in the control of H. oblita and for their future utilization in transgenic plants. Our work provides important basic data and promotes understanding of the insecticidal mechanism of Cry8 proteins against H. oblita larvae. PMID:28389549
A high-throughput fluorescence polarization assay for inhibitors of gyrase B.
Glaser, Bryan T; Malerich, Jeremiah P; Duellman, Sarah J; Fong, Julie; Hutson, Christopher; Fine, Richard M; Keblansky, Boris; Tang, Mary J; Madrid, Peter B
2011-02-01
DNA gyrase, a type II topoisomerase that introduces negative supercoils into DNA, is a validated antibacterial drug target. The holoenzyme is composed of 2 subunits, gyrase A (GyrA) and gyrase B (GyrB), which form a functional A(2)B(2) heterotetramer required for bacterial viability. A novel fluorescence polarization (FP) assay has been developed and optimized to detect inhibitors that bind to the adenosine triphosphate (ATP) binding domain of GyrB. Guided by the crystal structure of the natural product novobiocin bound to GyrB, a novel novobiocin-Texas Red probe (Novo-TRX) was designed and synthesized for use in a high-throughput FP assay. The binding kinetics of the interaction of Novo-TRX with GyrB from Francisella tularensis has been characterized, as well as the effect of common buffer additives on the interaction. The assay was developed into a 21-µL, 384-well assay format and has been validated for use in high-throughput screening against a collection of Food and Drug Administration-approved compounds. The assay performed with an average Z' factor of 0.80 and was able to identify GyrB inhibitors from a screening library.
Method for estimating protein binding capacity of polymeric systems.
Sharma, Vaibhav; Blackwood, Keith A; Haddow, David; Hook, Lilian; Mason, Chris; Dye, Julian F; García-Gareta, Elena
2015-01-01
Composite biomaterials made from synthetic and protein-based polymers are extensively researched in tissue engineering. To successfully fabricate a protein-polymer composite, it is critical to understand how strongly the protein binds to the synthetic polymer, which occurs through protein adsorption. Currently, there is no cost-effective and simple method for characterizing this interfacial binding. To characterize this interfacial binding, we introduce a simple three-step method that involves: 1) synthetic polymer surface characterisation, 2) a quick, inexpensive and robust novel immuno-based assay that uses protein extraction compounds to characterize protein binding strength followed by 3) an in vitro 2D model of cell culture to confirm the results of the immuno-based assay. Fibrinogen, precursor of fibrin, was adsorbed (test protein) on three different polymeric surfaces: silicone, poly(acrylic acid)-coated silicone and poly(allylamine)-coated silicone. Polystyrene surface was used as a reference. Characterisation of the different surfaces revealed different chemistry and roughness. The novel immuno-based assay showed significantly stronger binding of fibrinogen to both poly(acrylic acid) and poly(allylamine) coated silicone. Finally, cell studies showed that the strength of the interaction between the protein and the polymer had an effect on cell growth. This novel immuno-based assay is a valuable tool in developing composite biomaterials of synthetic and protein-based polymers with the potential to be applied in other fields of research where protein adsorption onto surfaces plays an important role.
Calcyclin Binding Protein/Siah-1 Interacting Protein Is a Hsp90 Binding Chaperone
Góral, Agnieszka; Bieganowski, Paweł; Prus, Wiktor; Krzemień-Ojak, Łucja; Kądziołka, Beata; Fabczak, Hanna; Filipek, Anna
2016-01-01
The Hsp90 chaperone activity is tightly regulated by interaction with many co-chaperones. Since CacyBP/SIP shares some sequence homology with a known Hsp90 co-chaperone, Sgt1, in this work we performed a set of experiments in order to verify whether CacyBP/SIP can interact with Hsp90. By applying the immunoprecipitation assay we have found that CacyBP/SIP binds to Hsp90 and that the middle (M) domain of Hsp90 is responsible for this binding. Furthermore, the proximity ligation assay (PLA) performed on HEp-2 cells has shown that the CacyBP/SIP-Hsp90 complexes are mainly localized in the cytoplasm of these cells. Using purified proteins and applying an ELISA we have shown that Hsp90 interacts directly with CacyBP/SIP and that the latter protein does not compete with Sgt1 for the binding to Hsp90. Moreover, inhibitors of Hsp90 do not perturb CacyBP/SIP-Hsp90 binding. Luciferase renaturation assay and citrate synthase aggregation assay with the use of recombinant proteins have revealed that CacyBP/SIP exhibits chaperone properties. Also, CacyBP/SIP-3xFLAG expression in HEp-2 cells results in the appearance of more basic Hsp90 forms in 2D electrophoresis, which may indicate that CacyBP/SIP dephosphorylates Hsp90. Altogether, the obtained results suggest that CacyBP/SIP is involved in regulation of the Hsp90 chaperone machinery. PMID:27249023
Wyhs, Nicolas; Walker, David; Giovinazzo, Hugh; Yegnasubramanian, Srinivasan; Nelson, William G
2014-08-01
Methylated DNA binding proteins such as Methyl-CpG Binding Domain Protein 2 (MBD2) can transduce DNA methylation alterations into a repressive signal by recruiting transcriptional co-repressor complexes. Interfering with MBD2 could lead to reactivation of tumor suppressor genes and therefore represents an attractive strategy for epigenetic therapy. We developed and compared fluorescence polarization (FP) and time-resolved fluorescence resonance energy transfer (TR-FRET)-based high-throughput screening (HTS) assays to identify small-molecule inhibitors of the interaction between the methyl binding domain of MBD2 (MBD2-MBD) and methylated DNA. Although both assays performed well in 96-well format, the TR-FRET assay (Z' factor = 0.58) emerged as a superior screening strategy compared with FP (Z' factor = 0.08) when evaluated in an HTS 384-well plate format. Using TR-FRET, we screened the Sigma LOPAC library for MBD2-MBD inhibitors and identified four compounds that also validated in a dose-response series. This included two known DNA intercalators (mitoxantrone and idarubicin) among two other inhibitory compounds (NF449 and aurintricarboxylic acid). All four compounds also inhibited the binding of SP-1, a transcription factor with a GC-rich binding sequence, to a methylated oligonucleotide, demonstrating that the activity was nonspecific. Our results provide proof of principle for using TR-FRET-based HTS to identify small-molecule inhibitors of MBD2 and other DNA-protein interactions. © 2014 Society for Laboratory Automation and Screening.
Assessment of the nickel-albumin binding assay for diagnosis of acute coronary syndrome.
da Silva, Sandra Huber; Pereira, Renata da Silva; Hausen, Bruna dos Santos; Signor, Cristiane; Gomes, Patrícia; de Campos, Marli Matiko Anraku; Moresco, Rafael Noal
2011-03-01
Myocardial ischemia may alter the metal binding capacity of circulating serum albumin. Thus, the aim of this study was to describe an automated method to measure ischemia-induced alterations in the binding capacity of serum albumin for exogenous nickel, and to evaluate the diagnostic characteristics of this assay for the assessment of acute coronary syndrome (ACS) in patients presenting to the emergency room (ER) with acute chest pain. We assessed the concentrations of cardiac troponin I (cTnI), serum albumin, ischemia-modified albumin (IMA) measured by the cobalt-albumin binding assay (CABA), and by an automated nickel-albumin binding assay (NABA) in the following groups: ACS (n=63) and non-ischemic chest pain (NICP, n=26). Biochemical markers were determined in blood samples obtained from patients within 3 h of ER admission. cTnI, CABA and NABA concentrations were higher in ACS group in comparison to the NICP group. A significant correlation between NABA and CABA was observed (r=0.5387, p<0.001). Areas under the curve for CABA and NABA were 0.7289 and 0.7582, respectively. Both CABA and NABA have the ability to discriminate patients with ACS. However, NABA has a slightly higher ability to discriminate ACS compared with CABA. Patients with ACS have reduced nickel binding to human serum albumin, and NABA may have an important role as an early marker of myocardial ischemia, particularly in patients presenting to the ER with acute chest pain.
Rupesh, Kanchi Ravi; Smith, Aaron; Boehmer, Paul E
2014-11-28
We have adapted the thermal shift assay to measure the ligand binding properties of the herpes simplex virus-1 single-strand DNA binding protein, ICP8. By measuring SYPRO Orange fluorescence in microtiter plates using a fluorescence-enabled thermal cycler, we have quantified the effects of oligonucleotide ligands on the melting temperature of ICP8. We found that single-stranded oligomers raise the melting temperature of ICP8 in a length- and concentration-dependent manner, ranging from 1°C for (dT)5 to a maximum of 9°C with oligomers ⩾10 nucleotides, with an apparent Kd of <1μM for (dT)20. Specifically, the results indicate that ICP8 is capable of interacting with oligomers as short as 5 nucleotides. Moreover, the observed increases in melting temperature of up to 9°C, indicates that single-strand DNA binding significantly stabilizes the structure of ICP8. This assay may be applied to investigate the ligand binding proteins of other single-strand DNA binding proteins and used as a high-throughput screen to identify compounds with therapeutic potential that inhibit single-strand DNA binding. As proof of concept, the single-strand DNA binding agent ciprofloxacin reduces the ligand induced stabilization of the melting temperature of ICP8 in a dose-dependent manner. Copyright © 2014 Elsevier Inc. All rights reserved.
Thekkumkara, Thomas; Snyder, Russell; Karamyan, Vardan T
2016-01-01
The role of 2-methoxyestradiol is becoming a major area of investigation because of its therapeutic utility, though its mechanism is not fully explored. Recent studies have identified the G-protein-coupled receptor 30 (GPR30, GPER) as a high-affinity membrane receptor for 2-methoxyestradiol. However, studies aimed at establishing the binding affinities of steroid compounds for specific targets are difficult, as the tracers are highly lipophilic and often result in nonspecific binding in lipid-rich membrane preparations with low-level target receptor expression. 2-Methoxyestradiol binding studies are essential to elucidate the underlying effects of this novel estrogen metabolite and to validate its targets; therefore, this competitive receptor-binding assay protocol was developed in order to assess the membrane receptor binding and affinity of 2-methyoxyestradiol.
Romero, Francisco; Santana-Calvo, Carmen; Sánchez-Guevara, Yoloxochitl; Nishigaki, Takuya
2017-09-01
The cyclic nucleotide-binding domain (CNBD) functions as a regulatory domain of many proteins involved in cyclic nucleotide signalling. We developed a straightforward and reliable binding assay based on intermolecular fluorescence resonance energy transfer (FRET) between an adenosine-3', 5'-cyclic monophosphate analogue labelled with fluorescein and a recombinant CNBD of human EPAC1 tagged with a cyan fluorescence protein (CFP). The high FRET efficiency of this method (~ 80%) allowed us to perform several types of binding experiments with nanomolar range of sample using conventional equipment. In addition, the CFP tag on the CNBD enabled us to perform a specific binding experiment using an unpurified protein. Considering these advantages, this technique is useful to study poorly characterized CNBDs. © 2017 Federation of European Biochemical Societies.
Yu, Haixiang; Canoura, Juan; Guntupalli, Bhargav; Lou, Xinhui; Xiao, Yi
2017-01-01
Sensors employing split aptamers that reassemble in the presence of a target can achieve excellent specificity, but the accompanying reduction of target affinity mitigates any overall gains in sensitivity. We for the first time have developed a split aptamer that achieves enhanced target-binding affinity through cooperative binding. We have generated a split cocaine-binding aptamer that incorporates two binding domains, such that target binding at one domain greatly increases the affinity of the second domain. We experimentally demonstrate that the resulting cooperative-binding split aptamer (CBSA) exhibits higher target binding affinity and is far more responsive in terms of target-induced aptamer assembly compared to the single-domain parent split aptamer (PSA) from which it was derived. We further confirm that the target-binding affinity of our CBSA can be affected by the cooperativity of its binding domains and the intrinsic affinity of its PSA. To the best of our knowledge, CBSA-5335 has the highest cocaine affinity of any split aptamer described to date. The CBSA-based assay also demonstrates excellent performance in target detection in complex samples. Using this CBSA, we achieved specific, ultra-sensitive, one-step fluorescence detection of cocaine within fifteen minutes at concentrations as low as 50 nM in 10% saliva without signal amplification. This limit of detection meets the standards recommended by the European Union's Driving under the Influence of Drugs, Alcohol and Medicines program. Our assay also demonstrates excellent reproducibility of results, confirming that this CBSA-platform represents a robust and sensitive means for cocaine detection in actual clinical samples.
ERIC Educational Resources Information Center
John, Nancy J.; Firestone, Gary L.
1987-01-01
Describes two complementary laboratory exercises that use the glass fiber assay to assess receptor specificity and hormone binding affinity in rat liver cytoplasmic extracts. Details the methods, materials and protocol of the experiments. Discusses the basic concepts illustrated and the feasibility of using the experiments at the undergraduate…
Shompole, Sankale; Rurangirwa, Fred R.; Wambugu, Anderson; Sitienei, John; Mwangi, Duncan M.; Musoke, Anthony J.; Mahan, Suman; Wells, Clive W.; McGuire, Travis C.
2000-01-01
Monoclonal antibodies (MAb) binding to Cowdria ruminantium elementary bodies (EB) were identified by enzyme-linked immunosorbent assay, and surface binding of one MAb (446.15) to intact EB was determined by immunofluorescence, immunogold labeling, and transmission electron microscopy. MAb 446.15 bound an antigen of approximately 43 kDa in immunoblots of eight geographically distinct strains. The MAb did not react with Ehrlichia canis antigens or uninfected bovine endothelial cell lysate and may be useful in diagnostic assays and vaccine development. PMID:11063511
Newton, Ana S; Deiana, Luca; Puleo, David E; Cisneros, José A; Cutrona, Kara J; Schlessinger, Joseph; Jorgensen, William L
2017-06-08
A competitive fluorescence polarization (FP) assay is reported for determining binding affinities of probe molecules with the pseudokinase JAK2 JH2 allosteric site. The syntheses of the fluorescent 5 and 6 used in the assay are reported as well as K d results for 10 compounds, including JNJ7706621, NVP-BSK805, and filgotinib (GLPG0634). X-ray crystal structures of JAK2 JH2 in complex with NVP-BSK805, filgotinib, and diaminopyrimidine 8 elucidate the binding poses.
2017-01-01
A competitive fluorescence polarization (FP) assay is reported for determining binding affinities of probe molecules with the pseudokinase JAK2 JH2 allosteric site. The syntheses of the fluorescent 5 and 6 used in the assay are reported as well as Kd results for 10 compounds, including JNJ7706621, NVP-BSK805, and filgotinib (GLPG0634). X-ray crystal structures of JAK2 JH2 in complex with NVP-BSK805, filgotinib, and diaminopyrimidine 8 elucidate the binding poses. PMID:28626520
Braaten, B A; Spangrude, G J; Daynes, R A
1984-07-01
Lymphocyte migration from the blood into the lymph nodes in most species occurs across post-capillary high endothelial venules (HEV). In a previous study, we proposed that lymphocyte extravasation involves receptor-mediated binding followed by adenylate cyclase-dependent activation of lymphocyte motility. This hypothesis was, in part, based on observations of in vitro lymphocyte adherence to HEV by employing pertussigen, which is a known inhibitor of lymphocyte recirculation. In vitro lymphocyte-HEV binding requires a cold (6 degrees C) incubation step and binding is poor to nil if the assay is attempted at room (23 degrees C) or physiologic temperature. We decided to investigate why this assay is temperature restricted, because of the possibility that pertussigen or fucoidin -treated lymphocytes might interact with HEV differently at higher temperatures. We now report that O.C.T. compound (OCT), the embedding matrix generally used to cut frozen lymph node sections, is toxic to lymphocytes at temperatures above 6 degrees C. Exclusion of OCT from the assay system will allow lymphocyte-HEV binding to occur at 23 degrees C and to a lesser extent at 37 degrees C. With this modified protocol, lymphocytes treated with either pertussigen, fucoidin , or neuraminidase were tested for adherence to HEV at 23 degrees C. No essential difference in binding properties was observed from what had been reported at 6 degrees C. In contrast, trypsin-treated lymphocytes that did not bind to HEV with the standard technique at 6 degrees C did adhere to a minimal extent to HEV at 23 degrees C using the modified procedure. We also report some preliminary work, using the modified assay, on in vitro lymphocyte-HEV binding of rat, rabbit, and guinea pig lymphocytes to sections of lymph nodes from the respective species.
NASA Astrophysics Data System (ADS)
Damayanti, E.; Istiqomah, L.; Saragih, J. E.; Purwoko, T.; Sardjono
2017-12-01
Our previous studies have selected lactic acid bacteria (LAB) with antifungal activities from traditional fermented foods made from cassava (G7) and silage feed palm leaf (PDS5 and PDS3). In this study we evaluated their ability to bind aflatoxin B1 (AFB1) and probiotic characteristic. The probiotic characteristic assays of LAB consisted of resistance to acidic conditions (pH 3), gastric juice and bile salts 0.3%. We also carried out an in vitro evaluation of LAB aflatoxin binding ability in viable and non-viable cell for 24 and 48 hours of incubation. The measurement of aflatoxin content was performed by ELISA method using AgraQuant Total Aflatoxin Assay kit. The results showed that all isolates were potential as probiotics and the G7 isolate had the highest viability among other isolates in pH 3 (92.61 %) and the bile salts assay (97.71 %). The percentage of aflatoxin reduction between viable and non-viable cell from each LAB isolate were different. The highest aflatoxin reduction in viable cell assay was performed by G7 isolate (69.11 %) whereas in non-viable cell assay was performed by PDS3 isolate (73.75 %) during incubation time 48 hours. In this study, G7 isolate performed the best probiotic characteristics with the highest viability in acid pH assay, bile salt 0.3% assay and percentage of aflatoxin B1 reduction in viable cell condition. Molecular identification using 16S rRNA sequence analysis showed that G7 isolate had homology with Lactobacillus plantarum (99.9%). It was concluded that Lactobacillus plantarum G7 was potential as probiotic with aflatoxin binding activities.
Flexible Label-Free Quantitative Assay for Antibodies to Influenza Virus Hemagglutinins ▿
Carney, Paul J.; Lipatov, Aleksandr S.; Monto, Arnold S.; Donis, Ruben O.; Stevens, James
2010-01-01
During the initial pandemic influenza H1N1 virus outbreak, assays such as hemagglutination inhibition and microneutralization provided important information on the relative protection afforded by the population's cross-reactivity from prior infections and immunizations with seasonal vaccines. However, these assays continue to be limited in that they are difficult to automate for high throughput, such as in pandemic situations, as well as to standardize between labs. Thus, new technologies are being sought to improve standardization, reliability, and throughput by using chemically defined reagents rather than whole cells and virions. We now report the use of a cell-free and label-free flu antibody biosensor assay (f-AbBA) for influenza research and diagnostics that utilizes recombinant hemagglutinin (HA) in conjunction with label-free biolayer interferometry technology to measure biomolecular interactions between the HA and specific anti-HA antibodies or sialylated ligands. We evaluated f-AbBA to determine anti-HA antibody binding activity in serum or plasma to assess vaccine-induced humoral responses. This assay can reveal the impact of antigenic difference on antibody binding to HA and also measure binding to different subtypes of HA. We also show that the biosensor assay can measure the ability of HA to bind a model sialylated receptor-like ligand. f-AbBA could be used in global surveillance laboratories since preliminary tests on desiccated HA probes showed no loss of activity after >2 months in storage at room temperature, indicating that the same reagent lots could be used in different laboratories to minimize interlaboratory assay fluctuation. Future development of such reagents and similar technologies may offer a robust platform for future influenza surveillance activities. PMID:20660137
Aráoz, Rómulo; Ramos, Suzanne; Pelissier, Franck; Guérineau, Vincent; Benoit, Evelyne; Vilariño, Natalia; Botana, Luis M; Zakarian, Armen; Molgó, Jordi
2012-12-04
Cyclic imine neurotoxins constitute an emergent family of neurotoxins of dinoflagellate origin that are potent antagonists of nicotinic acetylcholine receptors. We developed a target-directed functional method based on the mechanism of action of competitive agonists/antagonists of nicotinic acetylcholine receptors for the detection of marine cyclic imine neurotoxins. The key step for method development was the immobilization of Torpedo electrocyte membranes rich in nicotinic acetylcholine receptors on the surface of microplate wells and the use of biotinylated-α-bungarotoxin as tracer. Cyclic imine neurotoxins competitively inhibit biotinylated-α-bungarotoxin binding to Torpedo-nicotinic acetylcholine receptors in a concentration-dependent manner. The microplate-receptor binding assay allowed rapid detection of nanomolar concentrations of cyclic imine neurotoxins directly in shellfish samples. Although highly sensitive and specific for the detection of neurotoxins targeting nicotinic acetylcholine receptors as a class, the receptor binding assay cannot identify a given analyte. To address the low selectivity of the microplate-receptor binding assay, the cyclic imine neurotoxins tightly bound to the coated Torpedo nicotinic receptor were eluted with methanol, and the chemical nature of the eluted ligands was identified by mass spectrometry. The immobilization of Torpedo electrocyte membranes on the surface of microplate wells proved to be a high-throughput format for the survey of neurotoxins targeting nicotinic acetylcholine receptors directly in shellfish matrixes with high sensitivity and reproducibility.
Zhang, Jing-Jing; Zhu, Yi; Zhang, Xiong-Fei; Liang, Wen-Biao; Xie, Kun-Ling; Tao, Jin-Qiu; Peng, Yun-Peng; Xu, Ze-Kuan; Miao, Yi
2013-08-01
The human mucin 4 (MUC4) is aberrantly expressed in pancreatic adenocarcinoma and tumor cell lines, while remaining undetectable in normal pancreas, indicating its important role in pancreatic cancer development. Although its transcriptional regulation has been investigated in considerable detail, some important elements remain unknown. The aim of the present study was to demonstrate the existence of a novel inhibitory element in the MUC4 promoter and characterize some of its binding proteins. By luciferase reporter assay, we located the inhibitory element between nucleotides -2530 and -2521 in the MUC4 promoter using a series of deletion and mutant reporter constructs. Electrophoretic mobility shift assay (EMSA) with Bxpc-3 cell nuclear extracts revealed that one protein or protein complex bind to this element. The proteins binding to this element were purified and identified as Yin Yang 1 (YY1) by mass spectrometry. Supershift assay and chromatin immunoprecipitation (ChIP) assay confirmed that YY1 binds to this element in vitro and in vivo. Moreover, transient YY1 overexpression significantly inhibited MUC4 promoter activity and endogenous MUC4 protein expression. In conclusion, we reported here a novel inhibitory element in the human MUC4 promoter. This provides additional data on MUC4 gene regulation and indicates that YY1 may be a potential target for abnormal MUC4 expression.
Aráoz, Rómulo; Ramos, Suzanne; Pelissier, Franck; Guérineau, Vincent; Benoit, Evelyne; Vilariño, Natalia; Botana, Luis M.; Zakarian, Armen; Molgó, Jordi
2014-01-01
Cyclic imine neurotoxins constitute an emergent family of neurotoxins of dinoflagellate origin that are potent antagonists of nicotinic acetylcholine receptors. We developed a target-directed functional method based on the mechanism of action of competitive agonists/antagonists of nicotinic acetylcholine receptors for the detection of marine cyclic imine neurotoxins. The key step for method development was the immobilization of Torpedo electrocyte membranes rich in nicotinic acetylcholine receptors on the surface of microplate wells and the use of biotinylated-α-bungarotoxin as tracer. Cyclic imine neurotoxins competitively inhibit biotinylated-α-bungarotoxin binding to Torpedo-nicotinic acetylcholine receptors in a concentration-dependent manner. The microplate-receptor binding assay allowed rapid detection of nanomolar concentrations of cyclic imine neurotoxins directly in shellfish samples. Although highly sensitive and specific for the detection of neurotoxins targeting nicotinic acetylcholine receptors as a class, the receptor binding assay cannot identify a given analyte. To address the low selectivity of the microplate-receptor binding assay, the cyclic imine neurotoxins tightly bound to the coated Torpedo nicotinic receptor were eluted with methanol, and the chemical nature of the eluted ligands was identified by mass spectrometry. The immobilization of Torpedo electrocyte membranes on the surface of microplate wells proved to be a high-throughput format for the survey of neurotoxins targeting nicotinic acetylcholine receptors directly in shellfish matrixes with high sensitivity and reproducibility. PMID:23131021
Meng, Q; Li, M; Silberg, M A; Conrad, F; Bettencourt, J; To, R; Huang, C; Ma, J; Meyer, K; Shimizu, R; Cao, L; Tomic, M T; Marks, J D
2012-02-15
Quantitation of individual monoclonal antibodies (mAbs) within a combined antibody drug product is required for preclinical and clinical drug development, including pharmacokinetic (PK), toxicology, stability, and biochemical characterization studies of such drugs. We have developed an antitoxin, XOMA 3AB, consisting of three recombinant mAbs that potently neutralize the known subtypes of type A botulinum neurotoxin (BoNT/A). The three mAbs bind nonoverlapping BoNT/A epitopes with high affinity. XOMA 3AB is being developed as a treatment for botulism resulting from BoNT/A. To develop antibody-specific assays, we cloned, expressed, and purified BoNT/A domains from Escherichia coli. Each mAb bound only to its specific domain with affinity comparable to the binding to holotoxin. mAb-specific domains were used to develop an enzyme-linked immunosorbent assay (ELISA) for characterization of the integrity and binding activity of the three mAbs in the drug product. An electrochemiluminescence bridging assay that is robust to interference from components in serum was also developed, and we demonstrate that it can be used for PK assays. This type of antigen engineering to generate mAb-specific domains is a general method allowing quantitation and characterization of individual mAbs in a mAb cocktail that binds the same protein and is superior to anti-idiotype approaches. Copyright © 2011 Elsevier Inc. All rights reserved.
Laser effects in the manipulation of human eggs and embryos for in vitro fertilization.
Tadir, Yona; Douglas-Hamilton, Diarmaid H
2007-01-01
Gamete manipulations using laser micro beams were introduced in 1991 and testing its application for assisted hatching occurred shortly thereafter. This procedure has now become an accepted modality of penetrating or reducing the thickness of the zona pellucida in human in vitro fertilization (IVF). Lasers used in earlier work are summarized. Although the earliest lasers used pulses as long as 15 ms, the simplest and safest laser presently used in this application is the high-power 1480-nm In GaAsP diode, used in pulses with duration typically < 1 ms. Since prevention of damage to the blastomeres is essential, we specifically discuss this system with particular attention to safety considerations. The laser operates by its thermal effect on the zona pellucida, and the implications for embryo safety are discussed in detail. A thermal model is derived using numerical analysis and the effect on the embryo of laser beam power and pulse duration is indicated. Typical recommended protocols and operating values for various applications in the human IVF laboratory are given.
A Flexure-Guided Piezo Drill for Penetrating the Zona Pellucida of Mammalian Oocytes.
Johnson, Wesley; Dai, Changsheng; Liu, Jun; Wang, Xian; Luu, Devin K; Zhang, Zhuoran; Ru, Changhai; Zhou, Chao; Tan, Min; Pu, Huayan; Xie, Shaorong; Peng, Yan; Luo, Jun; Sun, Yu
2018-03-01
Mammalian oocytes such as mouse oocytes have a highly elastic outer membrane, zona pellucida (ZP) that cannot be penetrated without significantly deforming the oocyte, even with a sharp micropipette. Piezo drill devices leverage lateral and axial vibration of the micropipette to accomplish ZP penetration with greatly reduced oocyte deformation. However, existing piezo drills all rely on a large lateral micropipette vibration amplitude ( 20 ) and a small axial vibration amplitude (0.1 ). The very large lateral vibration amplitude has been deemed to be necessary for ZP penetration although it also induces larger oocyte deformation and more oocyte damage. This paper reports on a new piezo drill device that uses a flexure guidance mechanism and a systematically designed pulse train with an appropriate base frequency. Both simulation and experimental results demonstrate that a small lateral vibration amplitude (e.g., 2 ) and an axial vibration amplitude as large as 1.2 were achieved. Besides achieving 100% effectiveness in the penetration of mouse oocytes (n = 45), the new piezo device during ZP penetration induced a small oocyte deformation of 3.4 versus larger than 10 using existing piezo drill devices.
Mechanics of sperm-egg interaction at the zona pellucida.
Baltz, J M; Katz, D F; Cone, R A
1988-01-01
Mammalian sperm traverse several layers of egg vestments before fertilization can occur. The innermost vestment, the zona pellucida, is a glycoprotein shell, which captures and tethers the sperm before they penetrate it. We report here direct measurements of the force required to tether a motile human sperm as well as independent calculations of this force using flagellar beat parameters observed for sperm of several species on their homologous zonae. We have compared these sperm-generated forces with the calculated tensile strength of sperm-zona bonds, and found that a motile sperm can be tethered, at least temporarily, by a single bond. Therefore, sperm can be captured by the first bond formed and tethered permanently by a few. The sperm cannot subsequently penetrate the zona unless the bonds are first eliminated. However, premature elimination would simply allow the sperm to escape. Therefore, not only must the bonds be eliminated, but the timing of this must be regulated so that the sperm is already oriented toward the egg and beginning to penetrate as the bonds are broken. Images FIGURE 6 PMID:3224150
Solid-phase receptor binding assay for /sup 125/I-hCG
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bortolussi, M.; Selmin, O.; Colombatti, A.
1987-01-01
A solid-phase radioligand-receptor assay (RRA) to measure the binding of /sup 125/I-labelled human chorionic gonadotropin (/sup 125/I-hCG) to target cell membranes has been developed. The binding of /sup 125/I-hCG to membranes immobilized on the wells of microtitration plates reached a maximum at about 3 hours at 37 degrees C, was saturable, displayed a high affinity (Ka = 2.4 X 10(9) M-1) and was specifically inhibited by unlabelled hCG. In comparison with RRAs carried out with membranes in suspension, the solid-phase RRA is significantly simpler and much faster to perform as it avoids centrifugation or filtration procedures. The solid-phase RRA wasmore » adapted profitably to process large numbers of samples at the same time. It proved particularly useful as a screening assay to detect anti-hCG monoclonal antibodies with high inhibitory activity for binding of /sup 125/I-hCG to its receptors.« less
Antiviral and Anticancer Optimization Studies of the DNA-binding Marine Natural Product Aaptamine
Bowling, John J.; Pennaka, Hari K.; Ivey, Kelly; Wahyuono, Subagus; Kelly, Michelle; Schinazi, Raymond F.; Valeriote, Frederick A.; Graves, David E.; Hamann, Mark T.
2016-01-01
Aaptamine has potent cytotoxicity that may be explained by its ability to intercalate DNA. Aaptamine was evaluated for its ability to bind to DNA to validate DNA binding as the primary mechanism of cytotoxicity. Based on UV–vis absorbance titration data, the Kobs for aaptamine was 4.0 (±0.2) × 103 which was essentially equivalent to the known DNA intercalator N-[2-(diethylamino)ethyl]-9-aminoacridine-4-carboxamide. Semi-synthetic core modifications were performed to improve the general structural diversity of known aaptamine analogs and vary its absorption characteristics. Overall, 26 aaptamine derivatives were synthesized which consisted of a simple homologous range of mono and di-N-alkylations as well as some 9-O-sulfonylation and bis-O-isoaaptamine dimer products. Each product was evaluated for activity in a variety of whole cell and viral assays including a unique solid tumor disk diffusion assay. Details of aaptamine's DNA-binding activity and its derivatives’ whole cell and viral assay results are discussed. PMID:18251774
Dye-binding protein assay using a long-wave-absorbing cyanine probe.
Zheng, Hong; Mao, Yu Xia; Li, Dong Hui; Zhu, Chang Qing
2003-07-01
A simple and fast protein assay that involves the binding of water-soluble sulfonate heptamethylene cyanine to protein is described. The binding of the dye to protein causes a shift in the absorption maximum of the dye from 778 to 904 nm, and the increase in absorption at 904 nm is monitored. This assay is very reproducible, of good color stability for at least 80 min, and sensitive at the 100 ng/mL level of human serum albumin (HSA) when a spectrophotometer with near-infrared wavelength is used to measure absorbance. Few chemicals except ionic surfactants such as cetyltrimethylammonium bromide and sodium dodecyl sulfonate interfere with the assay. Purified proteins have different capacities to interact with the dye; under the experimental conditions, the linear ranges of bovine serum albumin (BSA), HSA and gamma-IgG were 200-2000, 100-2400, and 200-3000 ng/mL, respectively. The relative standard deviation for the five replicate determinations of 1200 ng/mL BSA is 2.1%.
Lipid-binding analysis using a fat blot assay.
Munnik, Teun; Wierzchowiecka, Magdalena
2013-01-01
Protein-lipid interactions play an important role in lipid metabolism, membrane trafficking and cell -signaling by regulating protein localization, activation, and function. The Fat Blot assay is a relatively simple and inexpensive method to examine these interactions using nitrocellulose membrane-immobilized lipids. The assay is adapted from the method by Dowler et al. (Sci STKE 129:pl6, 2002) and provides qualitative and quantitative information on the relative affinity with which a protein binds to a particular lipid. To perform a Fat Blot assay, serial dilutions of different phospholipids are spotted onto a nitrocellulose membrane. These membranes are then incubated with a lipid-binding protein possessing a GST (or other epitope) tag. The membranes are washed and the protein, which is bound to the membrane by virtue of its interaction with the lipid's head group, is detected by immunoblotting with an antibody against GST (or other epitope). The procedure only requires a few micrograms of protein and is quick, simple and cheap to perform.
Bruno, Agostino; Lembo, Francesca; Novellino, Ettore; Stornaiuolo, Mariano; Marinelli, Luciana
2014-01-01
Cannabinoid type 1 Receptor (CB1) belongs to the GPCR family and it has been targeted, so far, for the discovery of drugs aimed at the treatment of neuropathic pain, nausea, vomit, and food intake disorders. Here, we present the development of the first fluorescent assay enabling the measurement of kinetic binding constants for CB1orthosteric ligands. The assay is based on the use of T1117, a fluorescent analogue of AM251. We prove that T1117 binds endogenous and recombinant CB1 receptors with nanomolar affinity. Moreover, T1117 binding to CB1 is sensitive to the allosteric ligand ORG27569 and thus it is applicable to the discovery of new allosteric drugs. The herein presented assay constitutes a sustainable valid alternative to the expensive and environmental impacting radiodisplacement techniques and paves the way for an easy, fast and cheap high-throughput drug screening toward CB1 for identification of new orthosteric and allosteric modulators. PMID:24441508
Advantages and application of label-free detection assays in drug screening.
Cunningham, Brian T; Laing, Lance G
2008-08-01
Adoption is accelerating for a new family of label-free optical biosensors incorporated into standard format microplates owing to their ability to enable highly sensitive detection of small molecules, proteins and cells for high-throughput drug discovery applications. Label-free approaches are displacing other detection technologies owing to their ability to provide simple assay procedures for hit finding/validation, accessing difficult target classes, screening the interaction of cells with drugs and analyzing the affinity of small molecule inhibitors to target proteins. This review describes several new drug discovery applications that are under development for microplate-based photonic crystal optical biosensors and the key issues that will drive adoption of the technology. Microplate-based optical biosensors are enabling a variety of cell-based assays, inhibition assays, protein-protein binding assays and protein-small molecule binding assays to be performed with high-throughput and high sensitivity.
Non-Enzymatic Detection of Bacterial Genomic DNA Using the Bio-Barcode Assay
Hill, Haley D.; Vega, Rafael A.; Mirkin, Chad A.
2011-01-01
The detection of bacterial genomic DNA through a non-enzymatic nanomaterials based amplification method, the bio-barcode assay, is reported. The assay utilizes oligonucleotide functionalized magnetic microparticles to capture the target of interest from the sample. A critical step in the new assay involves the use of blocking oligonucleotides during heat denaturation of the double stranded DNA. These blockers bind to specific regions of the target DNA upon cooling, and prevent the duplex DNA from re-hybridizing, which allows the particle probes to bind. Following target isolation using the magnetic particles, oligonucleotide functionalized gold nanoparticles act as target recognition agents. The oligonucleotides on the nanoparticle (barcodes) act as amplification surrogates. The barcodes are then detected using the Scanometric method. The limit of detection for this assay was determined to be 2.5 femtomolar, and this is the first demonstration of a barcode type assay for the detection of double stranded, genomic DNA. PMID:17927207
Stimulation of iodine organification in porcine thyroid cells by thyroid stimulators.
Ginsberg, J; Shewring, G; Howells, R; Smith, B R; Hall, R
Several Graves' sera were simultaneously assessed in a bioassay based on the ability of porcine thyroid cells to organify 125I and in a radioreceptor assay for TSH receptor binding activity. Both assay systems were sensitive to 1 mcU/ml (final concentration) of unlabelled bovine TSH. Six Graves' sera were studied in detail over a wide (0-1.0 mcl sera) dose response range in repeat determinations. Two sera exhibited parallel binding and stimulating. However, two sera revealed significant inhibition of 125I-TSH binding prior to the demonstration of stimulation and the other two sera showed stimulatory capabilities before significant binding was evident. IgG was prepared from one serum by ammonium sulphate precipitation and chromatography on Sepharose 6B and then subjected to preparative isoelectric focusing. The isoelectric distribution of the two activities were found to be identical with major peaks of activity at pl=9.5 and pl=8.5. In summary: 1) each Graves' sera exhibits different dose-response curves with respect to binding and stimulation, 2) at certain concentrations of sera, only binding or stimulation were evident, 3) neither assay was consistently more sensitive for the presence of Graves' immunoglobulins, 4) for one Graves' sera, binding and stimulation could not be separated by isoelectric focusing. These studies would suggest each Graves' immunoglobulin has inherently different characteristics in its interaction with the TSH receptor.
Binding of (/sup 3/H)Forskolin to rat brain membranes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Seamon, K.B.; Vaillancourt, R.; Edwards, M.
1984-08-01
(12-/sup 3/H)Forskolin (27 Ci/mmol) has been used to study binding sites in rat brain tissue by using both centrifugation and filtration assays. The binding isotherm measured in the presence of 5 mM MgCl/sub 2/ by using the centrifugation assay is described best by a two-site model: K/sub d1/ = 15 nM, B/sub max/sub 1// (maximal binding) = 270 fmol/mg of protein; K/sub d2/ = 1.1 ..mu..M; B/sub max/sub 2// = 4.2 pmol/mg of protein. Only the high-affinity binding sites are detected when the binding is determined by using a filtration assay; K/sub d/ = 26 nM, B/sub max/ = 400more » fmol/mg of protein. Analogs of forskolin that do not activate adenylate cyclase (EC 4.6.1.1) do not compete effectively for (/sup 3/H)forskolin binding sites. Analogs of forskolin that are less potent than forskolin in activating adenylate cyclase are also less potent in competing for forskolin binding sites. The presence of 5 mM MgCl/sub 2/ or MnCl/sub 2/ was found to enhance binding. In the presence of 1 mM EDTA the amount of high-affinity binding is reduced to 110 fmol/mg of protein with no change in K/sub d/. There is no effect of CaCl/sub 2/ (20 mM) or NaCl (100 mM) on the binding. No high-affinity binding can be detected in membranes from ram sperm, which contains an adenylate cyclase that is not activated by forskolin. It is proposed that the high-affinity binding sites for forskolin are associated with the activated complex of catalytic subunit and stimulatory guanine nucleotide binding protein. 23 references, 5 figures, 2 tables.« less
The RNA-Binding Site of Poliovirus 3C Protein Doubles as a Phosphoinositide-Binding Domain.
Shengjuler, Djoshkun; Chan, Yan Mei; Sun, Simou; Moustafa, Ibrahim M; Li, Zhen-Lu; Gohara, David W; Buck, Matthias; Cremer, Paul S; Boehr, David D; Cameron, Craig E
2017-12-05
Some viruses use phosphatidylinositol phosphate (PIP) to mark membranes used for genome replication or virion assembly. PIP-binding motifs of cellular proteins do not exist in viral proteins. Molecular-docking simulations revealed a putative site of PIP binding to poliovirus (PV) 3C protein that was validated using nuclear magnetic resonance spectroscopy. The PIP-binding site was located on a highly dynamic α helix, which also functions in RNA binding. Broad PIP-binding activity was observed in solution using a fluorescence polarization assay or in the context of a lipid bilayer using an on-chip, fluorescence assay. All-atom molecular dynamics simulations of the 3C protein-membrane interface revealed PIP clustering and perhaps PIP-dependent conformations. PIP clustering was mediated by interaction with residues that interact with the RNA phosphodiester backbone. We conclude that 3C binding to membranes will be determined by PIP abundance. We suggest that the duality of function observed for 3C may extend to RNA-binding proteins of other viruses. Copyright © 2017 Elsevier Ltd. All rights reserved.
Alkylating derivative of oxotremorine interacts irreversibly with the muscarinic receptor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ehlert, F.J.; Jenden, D.J.; Ringdahl, B.
A 2-chloroethylamine derivative of oxotremorine was studied in pharmacological experiments and muscarinic receptor binding assays. The compound, N-(4-(2-chloroethylmethylamino)-2-butynyl)-2-pyrrolidone (BM 123), forms an aziridinium ion in aqueous solution at neutral pH that stimulates contractions of guinea pig ileum with a potency similar to that of oxotremorine. Following the initial stimulation, there is a long lasting period of lack of sensitivity of the guinea pig ileum to muscarinic agonists. BM 123 also produces muscarinic effects in vivo. When homogenates of the rat cerebral cortex were incubated with BM 123 and assayed subsequently in muscarinic receptor binding assays, a loss of binding capacitymore » for the muscarinic antagonist, (/sup 3/H)N-methylscopolamine ((/sup 3/H)NMS), was noted without a change in affinity. Similar observations were made in (/sup 3/H)1-3-quinuclidinyl benzilate ((/sup 3/H)-QNB) binding assays on the forebrains of mice that had been injected with BM 123 24 hr earlier. The loss in receptor capacity for both (/sup 3/H)NMS and (/sup 3/H)-QNB was prevented by atropine treatment. Kinetic studies of the interaction of BM 123 with homogenates of the rat cerebral cortex in vitro showed that the half-time for the loss of (/sup 3/H)-QNB binding sites increased from 10 to 45 min as the concentration of BM 123 decreased from 10 to 1 ..mu..M. In contrast to the aziridinium ion, the parent 2-chloroethylamine compound and the alcoholic hydrolysis product were largely devoid of pharmacological and binding activity.« less
Lynch, D M; Leali, B A; Howe, S E
1986-08-01
An enzyme-linked immunosorbent assay (ELISA) that quantitates antisperm antibody in serum was compared with standard sperm agglutination and immobilization assays with the use of sera from 40 normal and 292 subfertile individuals. Quantitation of the assay was accomplished by standardizing assay parameters, including the incorporation of a standard reference curve, the number of whole target sperm, the optimal dilution of serum, the selection of microtiter plate, and the time and temperatures involved in the adsorption and incubation phases. With this method, the level of antisperm antibody binding to target sperm in 40 normal fertile individuals was found to be 2.3 (+/- 1.1 standard deviation [SD]) fg immunoglobulin (Ig)/sperm. An increased mean level of 7.4 +/- 3.7 fg Ig/sperm was determined in 84 infertile patients with positive agglutination and/or immobilization tests. In 208 individuals with negative agglutination and immobilization tests the mean concentration of antisperm antibody was 2.5 +/- 1.3 fg Ig/sperm. Postvasectomy patients assayed by this method had a mean Ig binding value of 7.1 +/- 2.4 fg Ig/sperm. The infertile group with positive agglutination and/or immobilization tests had a significantly higher mean antisperm antibody level than the normal fertile group, according to the Student's t-test for independent samples (P less than 0.001). This indirect serum-based assay reproducibly quantitates antisperm antibody binding to whole target sperm, suggests the normal and abnormal levels of antisperm antibody, and correlates with standard functional assays.
A model of high-affinity antibody binding to type III group B Streptococcus capsular polysaccharide.
Wessels, M R; Muñoz, A; Kasper, D L
1987-12-01
We recently reported that the single repeating-unit pentasaccharide of type III group B Streptococcus (GBS) capsular polysaccharide is only weakly reactive with type III GBS antiserum. To further elucidate the relationship between antigen-chain length and antigenicity, tritiated oligosaccharides derived from type III capsular polysaccharide were used to generate detailed saturation binding curves with a fixed concentration of rabbit antiserum in a radioactive antigen-binding assay. A graded increase in affinity of antigen-antibody binding was seen as oligosaccharide size increased from 2.6 repeating units to 92 repeating units. These differences in affinity of antibody binding to oligosaccharides of different molecular size were confirmed by immunoprecipitation and competitive ELISA, two independent assays of antigen-antibody binding. Analysis of the saturation binding experiment indicated a difference of 300-fold in antibody-binding affinity for the largest versus the smallest tested oligosaccharides. Unexpectedly, the saturation binding values approached by the individual curves were inversely related to oligosaccharide chain length on a molar basis but equivalent on a weight basis. This observation is compatible with a model in which binding of an immunoglobulin molecule to an antigenic site on the polysaccharide facilitates subsequent binding of antibody to that antigen.
Altevogt, Dominik; Hrenn, Andrea; Kern, Claudia; Clima, Lilia; Bannwarth, Willi; Merfort, Irmgard
2009-10-07
Herein we report a feasibility study for a new concept to detect DNA binding protein NF-kappaB based on a DNA triple helix formation in combination with a fluorescence resonance energy transfer (FRET). The new principle avoids expensive antibodies and radioactivity and might have implications for assays of other DNA binding proteins.
Automated data processing and radioassays.
Samols, E; Barrows, G H
1978-04-01
Radioassays include (1) radioimmunoassays, (2) competitive protein-binding assays based on competition for limited antibody or specific binding protein, (3) immunoradiometric assay, based on competition for excess labeled antibody, and (4) radioreceptor assays. Most mathematical models describing the relationship between labeled ligand binding and unlabeled ligand concentration have been based on the law of mass action or the isotope dilution principle. These models provide useful data reduction programs, but are theoretically unfactory because competitive radioassay usually is not based on classical dilution principles, labeled and unlabeled ligand do not have to be identical, antibodies (or receptors) are frequently heterogenous, equilibrium usually is not reached, and there is probably steric and cooperative influence on binding. An alternative, more flexible mathematical model based on the probability or binding collisions being restricted by the surface area of reactive divalent sites on antibody and on univalent antigen has been derived. Application of these models to automated data reduction allows standard curves to be fitted by a mathematical expression, and unknown values are calculated from binding data. The vitrues and pitfalls are presented of point-to-point data reduction, linear transformations, and curvilinear fitting approaches. A third-order polynomial using the square root of concentration closely approximates the mathematical model based on probability, and in our experience this method provides the most acceptable results with all varieties of radioassays. With this curvilinear system, linear point connection should be used between the zero standard and the beginning of significant dose response, and also towards saturation. The importance is stressed of limiting the range of reported automated assay results to that portion of the standard curve that delivers optimal sensitivity. Published methods for automated data reduction of Scatchard plots for radioreceptor assay are limited by calculation of a single mean K value. The quality of the input data is generally the limiting factor in achieving good precision with automated as it is with manual data reduction. The major advantages of computerized curve fitting include: (1) handling large amounts of data rapidly and without computational error; (2) providing useful quality-control data; (3) indicating within-batch variance of the test results; (4) providing ongoing quality-control charts and between assay variance.
Dynamics of TBP binding to the TATA box
NASA Astrophysics Data System (ADS)
Schluesche, Peter; Heiss, Gregor; Meisterernst, Michael; Lamb, Don C.
2008-02-01
Gene expression is highly controlled and regulated in living cells. One of the first steps in gene transcription is recognition of the promoter site by the TATA box Binding Protein (TBP). TBP recruits other transcriptions factors and eventually the RNA polymerase II to transcribe the DNA in mRNA. We developed a single pair Förster Resonance Energy Transfer (spFRET) assay to investigate the mechanism of gene regulation. Here, we apply this assay to investigate the initial binding process of TBP to the adenovirus major late (AdML) promoter site. From the spFRET measurements, we were able to identify two conformations of the TBP-DNA complex that correspond to TBP bound in the correct and the opposite orientation. Increased incubation times or the presence of the transcription factor TFIIA improved the alignment of TBP on the promoter site. Binding of TBP to the TATA box shows a rich dynamics with abrupt transitions between multiple FRET states. A frame-wise histogram analysis revealed the presence of at least six discrete states, showing that TBP binding is more complicated than previously thought. Hence, the spFRET assay is very sensitive to the conformation of the TBP-DNA complex and is very promising tool for investigating the pathway of TBP binding in detail.
Engineering and exploitation of a fluorescent HIV-1 gp120 for live cell CD4 binding assays
DOE Office of Scientific and Technical Information (OSTI.GOV)
Costantini, Lindsey M.; Irvin, Susan C.; Department of Microbiology and Immunology, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, NY 10461
The HIV-1 envelope glycoprotein, gp120, binds the host cell receptor, CD4, in the initial step of HIV viral entry and infection. This process is an appealing target for the development of inhibitory drugs and neutralizing antibodies. To study gp120 binding and intracellular trafficking, we engineered a fluorescent fusion of the humanized gp120 JRFL HIV-1 variant and GFP. Gp120-sfGFP is glycosylated with human sugars, robustly expressed, and secreted from cultured human cells. Protein dynamics, quality control, and trafficking can be visualized in live cells. The fusion protein can be readily modified with different gp120 variants or fluorescent proteins. Finally, secreted gp120-sfGFPmore » enables a sensitive and easy binding assay that can quantitatively screen potential inhibitors of gp120-CD4 binding on live cells via fluorescence imaging or laser scanning cytometry. This adaptable research tool should aid in studies of gp120 cell biology and the development of novel anti-HIV drugs. - Highlights: • Development of fluorescent protein labeled HIV-1 envelope gp120. • Imaging of gp120 dynamics and trafficking in live cells. • Quantitative visual assay of antibody-mediated inhibition of gp120 binding to CD4 on live cells.« less
Kryzak, Cassie A.; Moraine, Maia M.; Kyle, Diane D.; Lee, Hyo J.; Cubeñas-Potts, Caelin; Robinson, Douglas N.; Evans, Janice P.
2013-01-01
ABSTRACT Changes occurring as the prophase I oocyte matures to metaphase II are critical for the acquisition of competence for normal egg activation and early embryogenesis. A prophase I oocyte cannot respond to a fertilizing sperm as a metaphase II egg does, including the ability to prevent polyspermic fertilization. Studies here demonstrate that the competence for the membrane block to polyspermy is deficient in prophase I mouse oocytes. In vitro fertilization experiments using identical insemination conditions result in monospermy in 87% of zona pellucida (ZP)-free metaphase II eggs, while 92% of ZP-free prophase I oocytes have four or more fused sperm. The membrane block is associated with a postfertilization reduction in the capacity to support sperm binding, but this reduction in sperm-binding capacity is both less robust and slower to develop in fertilized prophase I oocytes. Fertilization of oocytes is dependent on the tetraspanin CD9, but little to no release of CD9 from the oocyte membrane is detected, suggesting that release of CD9-containing vesicles is not essential for fertilization. The deficiency in membrane block establishment in prophase I oocytes correlates with abnormalities in two postfertilization cytoskeletal changes: sperm-induced cortical remodeling that results in fertilization cone formation and a postfertilization increase in effective cortical tension. These data indicate that cortical maturation is a component of cytoplasmic maturation during the oocyte-to-egg transition and that the egg cortex has to be appropriately primed and tuned to be responsive to a fertilizing sperm. PMID:23863404
Llanos, Ricardo J; Barrera, Daniel; Valz-Gianinet, Jorge N; Miceli, Dora C
2006-10-01
We describe the morphological and biochemical changes in Bufo arenarum coelomic egg envelopes (CE) following passage through the oviduct. In this species, the transformation of the CE into the vitelline envelope (VE) leads to the acquisition of fertilizability and involves the cleavage of a glycoprotein component. Electrophoretic patterns indicate that a pars recta oviductal protease selectively hydrolyzes in vitro the 84 and the 55 kDa glycoproteins of the CE. During the CE to VE transformation, the relative concentrations of gp48, 42 and 39 kDa also change. In in vitro tests, sperm binding to envelope glycoprotein occurs when they are exposed to VE but not when treated with CE, and VE labeled glycoproteins bind to the head and mid piece of the sperm. The gp39 VE component has 100% identity with internal domains of the sequence deduced from ovarian cDNA for the homologous zona pellucida glycoprotein type C (ZPC) protein precursor in B. arenarum. The effects of trypsin as a substitute for oviductal protease were also examined. Trypsin selectively attacks the 84 and the 55 kDa glycoproteins without hydrolyzing other components and renders coelomic eggs fertilizable in a jelly water preparation. Therefore, trypsin can mimic in vitro the biological action of the oviductal protease. However, it does not wholly mimic the biological action of the oviduct which, in B. arenarum at least, exceeds a mere proteolytic effect. This fact was verified by the lower fertility rates and the abnormal embryo development found when trypsin-treated coelomic eggs were fertilized in vitro. 2006 Wiley-Liss, Inc.
Henkel, Ralf
2012-01-01
For assisted reproduction technologies (ART), numerous techniques were developed to isolate spermatozoa capable of fertilizing oocytes. While early methodologies only focused on isolating viable, motile spermatozoa, with progress of ART, particularly intracytoplasmic sperm injection (ICSI), it became clear that these parameters are insufficient for the identification of the most suitable spermatozoon for fertilization. Conventional sperm preparation techniques, namely, swim-up, density gradient centrifugation and glass wool filtration, are not efficient enough to produce sperm populations free of DNA damage, because these techniques are not physiological and not modeled on the stringent sperm selection processes taking place in the female genital tract. These processes only allow one male germ cell out of tens of millions to fuse with the oocyte. Sites of sperm selection in the female genital tract are the cervix, uterus, uterotubal junction, oviduct, cumulus oophorus and the zona pellucida. Newer strategies of sperm preparation are founded on: (i) morphological assessment by means of ‘motile sperm organelle morphological examination (MSOME)' (ii) electrical charge; and (iii) molecular binding characteristics of the sperm cell. Whereas separation methods based on electrical charge take advantage of the sperm's adherence to a test tube surface or separate in an electrophoresis, molecular binding techniques use Annexin V or hyaluronic acid (HA) as substrates. Techniques in this category are magnet-activated cell sorting, Annexin V-activated glass wool filtration, flow cytometry and picked spermatozoa for ICSI (PICSI) from HA-coated dishes and HA-containing media. Future developments may include Raman microspectrometry, confocal light absorption and scattering spectroscopic microscopy and polarization microscopy. PMID:22138904
Data quality in drug discovery: the role of analytical performance in ligand binding assays
NASA Astrophysics Data System (ADS)
Wätzig, Hermann; Oltmann-Norden, Imke; Steinicke, Franziska; Alhazmi, Hassan A.; Nachbar, Markus; El-Hady, Deia Abd; Albishri, Hassan M.; Baumann, Knut; Exner, Thomas; Böckler, Frank M.; El Deeb, Sami
2015-09-01
Despite its importance and all the considerable efforts made, the progress in drug discovery is limited. One main reason for this is the partly questionable data quality. Models relating biological activity and structures and in silico predictions rely on precisely and accurately measured binding data. However, these data vary so strongly, such that only variations by orders of magnitude are considered as unreliable. This can certainly be improved considering the high analytical performance in pharmaceutical quality control. Thus the principles, properties and performances of biochemical and cell-based assays are revisited and evaluated. In the part of biochemical assays immunoassays, fluorescence assays, surface plasmon resonance, isothermal calorimetry, nuclear magnetic resonance and affinity capillary electrophoresis are discussed in details, in addition radiation-based ligand binding assays, mass spectrometry, atomic force microscopy and microscale thermophoresis are briefly evaluated. In addition, general sources of error, such as solvent, dilution, sample pretreatment and the quality of reagents and reference materials are discussed. Biochemical assays can be optimized to provide good accuracy and precision (e.g. percental relative standard deviation <10 %). Cell-based assays are often considered superior related to the biological significance, however, typically they cannot still be considered as really quantitative, in particular when results are compared over longer periods of time or between laboratories. A very careful choice of assays is therefore recommended. Strategies to further optimize assays are outlined, considering the evaluation and the decrease of the relevant error sources. Analytical performance and data quality are still advancing and will further advance the progress in drug development.
Murase, Hirotaka; Noguchi, Tomoharu; Sasaki, Shigeki
2018-06-01
Chromomycin A3 (CMA3) is an aureolic acid-type antitumor antibiotic. CMA3 forms dimeric complexes with divalent cations, such as Mg 2+ , which strongly binds to the GC rich sequence of DNA to inhibit DNA replication and transcription. In this study, the binding property of CMA3 to the DNA sequence containing multiple GC-rich binding sites was investigated by measuring the protection from hydrolysis by the restriction enzymes, AccII and Fnu4HI, for the center of the CGCG site and the 5'-GC↓GGC site, respectively. In contrast to the standard DNase I footprinting method, the DNA substrates are fully hydrolyzed by the restriction enzymes, therefore, the full protection of DNA at all the cleavable sites indicates that CMA3 simultaneously binds to all the binding sites. The restriction enzyme assay has suggested that CMA3 has a high tendency to bind the successive CGCG sites and the CGG repeat. Copyright © 2018 Elsevier Ltd. All rights reserved.
Brockman, Adam H; Oller, Haley R; Moreau, Benoît; Kriksciukaite, Kristina; Bilodeau, Mark T
2015-02-12
Medicinal chemists have been encouraged in recent years to embrace high speed protein binding assays. These methods employ dialysis membranes in 96-well format or spin filters. Membrane-based methods do not separate lipoprotein binding from albumin binding and introduce interference despite membrane binding controls. Ultracentrifugation methods, in contrast, do not introduce interference if density gradients can be avoided and they resolve lipoprotein from albumin. A new generation of compact, fast ultracentrifuges facilitates the rapid and fully informative separation of plasma into albumin, albumin/fatty acid complex, lipoprotein, protein-free, and chylomicron fractions with no need of salt or sugar density gradients. We present a simple and fast ultracentrifuge method here for two platinum compounds and a taxane that otherwise bound irreversibly to dialysis membranes and which exhibited distinctive lipoprotein binding behaviors. This new generation of ultracentrifugation methods underscores a need to further discuss protein binding assessments as they relate to medicinal chemistry efforts.
A Spectrophotometric Assay Optimizing Conditions for Pepsin Activity.
ERIC Educational Resources Information Center
Harding, Ethelynda E.; Kimsey, R. Scott
1998-01-01
Describes a laboratory protocol optimizing the conditions for the assay of pepsin activity using the Coomasie Blue dye binding assay of protein concentration. The dye bonds through strong, noncovalent interactions to basic and aromatic amino acid residues. (DDR)
DiCaprio, Erin; Phantkankum, Nuttapong; Culbertson, Doug; Ma, Yuanmei; Hughes, John H; Kingsley, David; Uribe, Roberto M; Li, Jianrong
2016-09-02
Human norovirus (NoV) is a major cause of fresh produce-associated outbreaks and human NoV in irrigation water can potentially lead to viral internalization in fresh produce. Therefore, there is a need to develop novel intervention strategies to target internalized viral pathogens while maintaining fresh produce quality. In this study electron beam (E-beam) and gamma radiation were evaluated for efficacy against a human NoV GII.4 strain and Tulane virus (TV). Virus survival following ionizing radiation treatments was determined using direct quantitative reverse transcriptase PCR (RT-qPCR), the porcine gastric mucin magnetic bead (PGM-MB) binding assay followed by RT-qPCR, and plaque assay. In simple media, a high dose of E-beam treatment was required to completely abolish the receptor binding ability of human NoV (35.3kGy) and TV (19.5-24.1kGy), as assessed using the PGM-MB binding assay. Both human NoV and TV were more susceptible to gamma irradiation than E-beam, requiring 22.4kGy to achieve complete inactivation. In whole strawberries, no human NoV or TV RNA was detected following 28.7kGy of E-beam treatment using the PGM-MB binding assay. Overall, human NoV and TV are highly resistant to ionizing radiation and therefore the technology may not be suitable to eliminate viruses in fresh produce at the currently approved levels. In addition, the PGM-MB binding assay is an improved method to detect viral infectivity compared to direct RT-qPCR. Copyright © 2016. Published by Elsevier B.V.
Insight into the novel inhibition mechanism of apigenin to Pneumolysin by molecular modeling
NASA Astrophysics Data System (ADS)
Niu, Xiaodi; Yang, Yanan; Song, Meng; Wang, Guizhen; Sun, Lin; Gao, Yawen; Wang, Hongsu
2017-11-01
In this study, the mechanism of apigenin inhibition was explored using molecular modelling, binding energy calculation, and mutagenesis assays. Energy decomposition analysis indicated that apigenin binds in the gap between domains 3 and 4 of PLY. Using principal component analysis, we found that binding of apigenin to PLY weakens the motion of domains 3 and 4. Consequently, these domains cannot complete the transition from monomer to oligomer, thereby blocking oligomerisation of PLY and counteracting its haemolytic activity. This inhibitory mechanism was confirmed by haemolysis assays, and these findings will promote the future development of an antimicrobial agent.
Wang, Jianhao; Zhu, Zhilan; Qiu, Lin; Wang, Jianpeng; Wang, Xiang; Xiao, Qicai; Xia, Jiang; Liu, Li; Liu, Xiaoqian; Feng, Wei; Wang, Jinmei; Miao, Peng; Gao, Liqian
2018-07-06
Small molecules with free thiol groups always show high binding affinity to quantum dots (QDs). However, it is still highly challenging to detect the binding capacity between thiol-containing molecules and QDs inside a capillary. To conquer this limitation, a capillary electrophoresis with fluorescence detection (CE-FL) based assay was proposed and established to investigate the binding capacity between QDs and a poly-thiolated peptide (ATTO 590-DDSSGGCCPGCC, ATTO-C4). Interestingly, the results showed that interval time had a great influence on QDs and ATTO-C4 self-assembly, which can be attributed to longer interval time benefitting the binding of QDs to ATTO-C4. The stability assays on ATTO-C4-QD assembly indicated that high concentration of imidazole or GSH had a high capability of competing with the bound ATTO-C4, evidenced by dramatically dropping of S 625 /S 565 ratio from 0.78 to 0.30 or 0.29. Therefore, all these results above suggested that this novel CE-FL based detection assay could be successfully applied to the binding studies between QDs and thiol-containing biomolecules.
Transcriptional regulation of podoplanin expression by Prox1 in lymphatic endothelial cells.
Pan, Yanfang; Wang, Wen-di; Yago, Tadayuki
2014-07-01
Transcription factor prospero homeobox 1 (Prox-1) and podoplanin (PDPN), mucin-type transmembane protein, are both constantly expressed in lymphatic endothelial cells (LECs) and appear to function in an LEC-autonomous manner. Mice globally lacking PDPN (Pdpn(-/-)) develop abnormal and blood-filled lymphatic vessels that highly resemble those in inducible mice lacking Prox-1 (Prox1(-/-)). Prox1 has also been reported to induce PDPN expression in cultured ECs. Thus, we hypothesize that PDPN functions downstream of Prox1 and that its expression is regulated by Prox1 in LECs at the transcriptional level. We first identified four putative binding elements for Prox1 in the 5' upstream regulatory region of Pdpn gene and found that Prox1 directly binds to the 5' regulatory sequence of Pdpn gene in LECs by chromatin immunoprecipitation assay. DNA pull down assay confirmed that Prox1 binds to the putative binding element. In addition, luciferase reporter assay indicated that Prox1 binding to the 5' regulatory sequence of Pdpn regulates Pdpn gene expression. We are therefore the first to experimentally demonstrate that Prox1 regulates PDPN expression at the transcriptional level in the lymphatic vascular system. Copyright © 2014 Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Wang, Jianhao; Zhu, Zhilan; Qiu, Lin; Wang, Jianpeng; Wang, Xiang; Xiao, Qicai; Xia, Jiang; Liu, Li; Liu, Xiaoqian; Feng, Wei; Wang, Jinmei; Miao, Peng; Gao, Liqian
2018-07-01
Small molecules with free thiol groups always show high binding affinity to quantum dots (QDs). However, it is still highly challenging to detect the binding capacity between thiol-containing molecules and QDs inside a capillary. To conquer this limitation, a capillary electrophoresis with fluorescence detection (CE-FL) based assay was proposed and established to investigate the binding capacity between QDs and a poly-thiolated peptide (ATTO 590-DDSSGGCCPGCC, ATTO-C4). Interestingly, the results showed that interval time had a great influence on QDs and ATTO-C4 self-assembly, which can be attributed to longer interval time benefitting the binding of QDs to ATTO-C4. The stability assays on ATTO-C4-QD assembly indicated that high concentration of imidazole or GSH had a high capability of competing with the bound ATTO-C4, evidenced by dramatically dropping of S 625/S 565 ratio from 0.78 to 0.30 or 0.29. Therefore, all these results above suggested that this novel CE-FL based detection assay could be successfully applied to the binding studies between QDs and thiol-containing biomolecules.
Wei, Yanli; Chen, Yanxia; Li, Huanhuan; Shuang, Shaomin; Dong, Chuan; Wang, Gufeng
2015-01-15
A novel aptamer-based label-free assay for sensitive and selective detection of ATP was developed. This assay employs a new aptamer/fluorescent probe system that shows resistance to exonuclease I (Exo I) digestion upon binding to ATP molecules. In the absence of ATP, the complex between the ATP-binding aptamer (ATP-aptamer) and a DNA binding dye, berberine, is digested upon the addition of exonuclease I, leading to the release of berberine into solution and consequently, quenched berberine fluorescence. In the presence of ATP, the ATP-binding aptamer folds into a G-quadruplex structure that is resistant to Exo I digestion. Accordingly, berberine is protected in the G-quadruplex structure and high fluorescence intensity is observed. As such, based on the fluorescence signal change, a label-free fluorescence assay for ATP was developed. Factors affecting the analysis of ATP including the concentration of ATP-binding aptamer, reaction time, temperature and the concentration of Exo I were comprehensively investigated. Under optimal conditions, the fluorescence intensity of the sensing system displayed a response for ATP in a wide range up to 17.5 mM with a detection limit of 140 nM.
Arnold, A R; Burnham, C-A D; Ford, B A; Lawhon, S D; McAllister, S K; Lonsway, D; Albrecht, V; Jerris, R C; Rasheed, J K; Limbago, B; Burd, E M; Westblade, L F
2016-03-01
The performance of a rapid penicillin-binding protein 2a (PBP2a) detection assay, the Alere PBP2a culture colony test, was evaluated for identification of PBP2a-mediated beta-lactam resistance in human and animal clinical isolates of Staphylococcus intermedius group, Staphylococcus lugdunensis, and Staphylococcus schleiferi. The assay was sensitive and specific, with all PBP2a-negative and PBP2a-positive strains testing negative and positive, respectively. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
LaFrate, Andrew L; Gunther, Jillian R; Carlson, Kathryn E; Katzenellenbogen, John A
2008-12-01
Most patients with hormone-responsive breast cancer eventually develop resistance to traditional antiestrogens such as tamoxifen, and this has become a major obstacle in their treatment. We prepared and characterized the activity of a series of 16 guanylhydrazone small molecules that are designed to block estrogen receptor (ER) activity through a non-traditional mechanism, by directly interfering with coactivator binding to agonist-liganded ER. The inhibitory activity of these compounds was determined in cell-based transcription assays using ER-responsive reporter gene and mammalian two-hybrid assays. Several of the compounds gave IC(50) values in the low micromolar range. Two secondary assays were used to confirm that these compounds were acting through the proposed non-traditional mode of estrogen inhibitory action and not as conventional antagonists at the ligand binding site.
Ribosomal targets for antibiotic drug discovery
Blanchard, Scott C.; Feldman, Michael Brian; Wang, Leyi; Doudna Cate, James H.; Pulk, Arto; Altman, Roger B.; Wasserman, Michael R
2016-09-13
The present invention relates to methods to identify molecules that binds in the neomycin binding pocket of a bacterial ribosome using structures of an intact bacterial ribosome that reveal how the ribosome binds tRNA in two functionally distinct states, determined by x-ray crystallography. One state positions tRNA in the peptidyl-tRNA binding site. The second, a fully rotated state, is stabilized by ribosome recycling factor (RRF) and binds tRNA in a highly bent conformation in a hybrid peptidyl/exit (P/E) site. Additionally, the invention relates to various assays, including single-molecule assay for ribosome recycling, and methods to identify compounds that interfere with ribosomal function by detecting newly identified intermediate FRET states using known and novel FRET pairs on the ribosome. The invention also provides vectors and compositions with an N-terminally tagged S13 protein.
BiFC Assay to Detect Calmodulin Binding to Plant Receptor Kinases.
Fischer, Cornelia; Sauter, Margret; Dietrich, Petra
2017-01-01
Plant receptor-like kinases (RLKs) are regulated at various levels including posttranscriptional modification and interaction with regulatory proteins. Calmodulin (CaM) is a calcium-sensing protein that was shown to bind to some RLKs such as the PHYTOSULFOKINE RECEPTOR1 (PSKR1). The CaM-binding site is embedded in subdomain VIa of the kinase domain. It is possible that many more of RLKs interact with CaM than previously described. To unequivocally confirm CaM binding, several methods exist. Bimolecular fluorescence complementation (BiFC) and pull-down assays have been successfully used to study CaM binding to PSKR1 and are described in this chapter (BiFC) and in Chapter 15 (pull down). The two methods are complementary. BiFC is useful to show localization and interaction of soluble as well as of membrane-bound proteins in planta.
Schöttner, M; Gansser, D; Spiteller, G
1997-12-01
Polar extracts of the stinging nettle (Urtica dioica L.) roots contain the ligans (+)-neoolivil, (-)-secoisolariciresinol, dehydrodiconiferyl alcohol, isolariciresinol, pinoresinol, and 3,4-divanillyltetrahydrofuran. These compounds were either isolated from Urtica roots, or obtained semisynthetically. Their affinity to human sex hormone binding globulin (SHBG) was tested in an in vitro assay. In addition, the main intestinal transformation products of plant lignans in humans, enterodiol and enterolactone, together with enterofuran were checked for their activity. All lignans except (-)-pinoresinol developed a binding affinity to SHBG in the in vitro assay. The affinity of (-)-3,4-divanillyltetrahydrofuran was outstandingly high. These findings are discussed with respect to potential beneficial effects of plant lignans on benign prostatic hyperplasia (BPH).
Tissue Specific and Hormonal Regulation of Gene Expression
1997-08-01
interference assays were performed. These assays identify DNA bases that, when modified, interfere with the binding of the nuclear factor to the hCRH promoter...thymidine residues. The DNA bases that when modified affected the binding of the protein are noted with arrows, and their location in the hCRH...indicated. B. Methylation interference. The fragments were partially methylated using dimethyl sulfate. The DNA bases that when modified affected the
Styriak, I; Lauková, A; Fallgren, C; Wadström, T
1999-12-01
Thirty-three enterococcal strains and 10 Streptococcus bovis strains were investigated for their protein-binding cell surface components. Seven extracellular matrix (ECM) proteins were immobilized on Difco latex beads to detect these components on the surface of all enterococcal strains and eight non-autoaggregating S. bovis strains by a particle agglutination assay (PAA). Twenty-three selected strains were also examined in microtiter plate assays. According to the absorbance readings (A(570nm)), 11 strains were classified as nonadherent (A(570nm) < 0.1), 10 strains as weakly adherent (0.1 < A(570nm) > 0.3), and 2 strains as strongly adherent (A(570nm) > 0.3) in these assays. A direct correlation was found between the values obtained in PAA and A(570nm) readings of microtiter plate assays. Binding of (125)I-labeled bovine lactoferrin to enterococci and streptococci was in the range of 6%-30% and of (125)I-labeled human vitronectin in the range of 9%-33% to streptococci. The binding of(125)I-labeled ECM proteins to selected strains was much more effectively inhibited by sulfated carbohydrates than by non-sulfated hyaluronic acid, indicating the importance of the sulfate groups of these inhibitors. An inhibition effect of heparin on bLf binding to four selected strains was higher in comparison with fucoidan in the microtiter plates. Thirty-five out of 44 strains had agglutinated rabbit erythrocytes. However, these strains showed no ability to agglutinate bovine or sheep erythrocytes.
Receptor binding sites for atrial natriuretic factor are expressed by brown adipose tissue
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bacay, A.C.; Mantyh, C.R.; Vigna, S.R.
1988-09-01
To explore the possibility that atrial natriuretic factor (ANF) is involved in thermoregulation we used quantitative receptor autoradiography and homogenate receptor binding assays to identify ANF bindings sites in neonatal rat and sheep brown adipose tissue, respectively. Using quantitative receptor autoradiography were were able to localize high levels of specific binding sites for {sup 125}I-rat ANF in neonatal rat brown adipose tissue. Homogenate binding assays on sheep brown fat demonstrated that the radioligand was binding to the membrane fraction and that the specific binding was not due to a lipophilic interaction between {sup 125}I-rat ANF and brown fat. Specific bindingmore » of {sup 125}I-rat ANF to the membranes of brown fat cells was inhibited by unlabeled rat ANF with a Ki of 8.0 x 10(-9) M, but not by unrelated peptides. These studies demonstrate that brown fat cells express high levels of ANF receptor binding sites in neonatal rat and sheep and suggest that ANF may play a role in thermoregulation.« less
Chiaraviglio, Lucius
2014-01-01
Abstract Interpretation of high throughput screening (HTS) data in cell-based assays may be confounded by cytotoxic properties of screening compounds. Therefore, assessing cell toxicity in real time during the HTS process itself would be highly advantageous. Here, we investigate the potential of putatively impermeant, fluorescent, DNA-binding dyes to give cell toxicity readout during HTS. Amongst 19 DNA-binding dyes examined, three classes were identified that were (1) permeant, (2) cytotoxic, or (3) neither permeant nor cytotoxic during 3-day incubation with a macrophage cell line. In the last class, four dyes (SYTOX Green, CellTox Green, GelGreen, and EvaGreen) gave highly robust cytotoxicity data in 384-well screening plates. As proof of principle, successful combination with a luminescence-based assay in HTS format was demonstrated. Here, both intracellular growth of Legionella pneumophila (luminescence) and host cell viability (SYTOX Green exclusion) were assayed in the same screening well. Incorporation of membrane-impermeant, DNA-binding, fluorescent dyes in HTS assays should prove useful by allowing evaluation of cytotoxicity in real time, eliminating reagent addition steps and effort associated with endpoint cell viability analysis, and reducing the need for follow-up cytotoxicity screening. PMID:24831788
Competitive Binding to Cuprous Ions of Protein and BCA in the Bicinchoninic Acid Protein Assay
Huang, Tao; Long, Mian; Huo, Bo
2010-01-01
Although Bicinchoninic acid (BCA) has been widely used to determine protein concentration, the mechanism of interaction between protein, copper ion and BCA in this assay is still not well known. Using the Micro BCA protein assay kit (Pierce Company), we measured the absorbance at 562 nm of BSA solutions with different concentrations of protein, and also varied the BCA concentration. When the concentration of protein was increased, the absorbance exhibited the known linear and nonlinear increase, and then reached an unexpected plateau followed by a gradual decrease. We introduced a model in which peptide chains competed with BCA for binding to cuprous ions. Formation of the well-known chromogenic complex of BCA-Cu1+-BCA was competed with the binding of two peptide bonds (NTPB) to cuprous ion, and there is the possibility of the existence of two new complexes. A simple equilibrium equation was established to describe the correlations between the substances in solution at equilibrium, and an empirical exponential function was introduced to describe the reduction reaction. Theoretical predictions of absorbance from the model were in good agreement with the measurements, which not only validated the competitive binding model, but also predicted a new complex of BCA-Cu1+-NTPB that might exist in the final solution. This work provides a new insight into understanding the chemical bases of the BCA protein assay and might extend the assay to higher protein concentration. PMID:21625379
Positive selection on human gamete-recognition genes
Stover, Daryn A.; Guerra, Vanessa; Mozaffari, Sahar V.; Ober, Carole; Mugal, Carina F.; Kaj, Ingemar
2018-01-01
Coevolution of genes that encode interacting proteins expressed on the surfaces of sperm and eggs can lead to variation in reproductive compatibility between mates and reproductive isolation between members of different species. Previous studies in mice and other mammals have focused in particular on evidence for positive or diversifying selection that shapes the evolution of genes that encode sperm-binding proteins expressed in the egg coat or zona pellucida (ZP). By fitting phylogenetic models of codon evolution to data from the 1000 Genomes Project, we identified candidate sites evolving under diversifying selection in the human genes ZP3 and ZP2. We also identified one candidate site under positive selection in C4BPA, which encodes a repetitive protein similar to the mouse protein ZP3R that is expressed in the sperm head and binds to the ZP at fertilization. Results from several additional analyses that applied population genetic models to the same data were consistent with the hypothesis of selection on those candidate sites leading to coevolution of sperm- and egg-expressed genes. By contrast, we found no candidate sites under selection in a fourth gene (ZP1) that encodes an egg coat structural protein not directly involved in sperm binding. Finally, we found that two of the candidate sites (in C4BPA and ZP2) were correlated with variation in family size and birth rate among Hutterite couples, and those two candidate sites were also in linkage disequilibrium in the same Hutterite study population. All of these lines of evidence are consistent with predictions from a previously proposed hypothesis of balancing selection on epistatic interactions between C4BPA and ZP3 at fertilization that lead to the evolution of co-adapted allele pairs. Such patterns also suggest specific molecular traits that may be associated with both natural reproductive variation and clinical infertility. PMID:29340252
Chiang, Wei-Chung; Wei, Yongjie; Kuo, Yi-Chun; Wei, Shuguang; Zhou, Anwu; Zou, Zhongju; Yehl, Jenna; Ranaghan, Matthew J; Skepner, Adam; Bittker, Joshua A; Perez, Jose R; Posner, Bruce A; Levine, Beth
2018-06-21
Autophagy, a lysosomal degradation pathway, plays a crucial role in cellular homeostasis, development, immunity, tumor suppression, metabolism, prevention of neurodegeneration, and lifespan extension. Thus, pharmacological stimulation of autophagy may be an effective approach for preventing or treating certain human diseases and/or aging. We sought to establish a method for developing new chemical compounds that specifically induce autophagy. To do this, we developed two assays to identify compounds that target a key regulatory node of autophagy induction-specifically, the binding of Bcl-2 (a negative regulator of autophagy) to Beclin 1 (an allosteric modulator of the Beclin 1/VPS34 lipid kinase complex that functions in autophagy initiation). These assays use either a split-luciferase assay to measure Beclin 1/Bcl-2 binding in cells or an AlphaLISA assay to directly measure direct Beclin 1/Bcl-2 binding in vitro. We screened two different chemical compound libraries, comprising ∼300 K compounds, to identify small molecules that disrupt Beclin 1/Bcl-2 binding and induce autophagy. Three novel compounds were identified that directly inhibit Beclin 1/Bcl-2 interaction with an IC 50 in the micromolar range and increase autophagic flux. These compounds do not demonstrate significant cytotoxicity, and they exert selectivity for disruption of Bcl-2 binding to the BH3 domain of Beclin 1 compared with the BH3 domain of the pro-apoptotic Bcl-2 family members, Bax and Bim. Thus, we have identified candidate molecules that serve as lead templates for developing potent and selective Beclin 1/Bcl-2 inhibitors that may be clinically useful as autophagy-inducing agents.
Ferrero, Maximiliano R; Heins, Anja M; Soprano, Luciana L; Acosta, Diana M; Esteva, Mónica I; Jacobs, Thomas; Duschak, Vilma G
2016-02-01
In order to investigate the involvement of sulfated groups in the Trypanosoma cruzi host-parasite relationship, we studied the interaction between the major cysteine proteinase of T. cruzi, cruzipain (Cz), a sulfate-containing sialylated molecule and the sialic acid-binding immunoglobulin like lectin-E (Siglec-E). To this aim, ELISA, indirect immunofluorescence assays and flow cytometry, using mouse Siglec-E-Fc fusion molecules and glycoproteins of parasites, were performed. Competition assays verified that the lectins, Maackia amurensis II (Mal II) and Siglec-E-Fc, compete for the same binding sites. Taking into account that Mal II binding remains unaltered by sulfation, we established this lectin as sialylation degree control. Proteins of an enriched microsomal fraction showed the highest binding to Siglec-E as compared with those from the other parasite subcellular fractions. ELISA assays and the affinity purification of Cz by a Siglec-E column confirmed the interaction between both molecules. The significant decrease in binding of Siglec-E-Fc to Cz and to its C-terminal domain (C-T) after desulfation of these molecules suggests that sulfates contribute to the interaction between Siglec-E-Fc and these glycoproteins. Competitive ELISA assays confirmed the involvement of sulfated epitopes in the affinity between Siglec-E and Cz, probably modified by natural protein environment. Interestingly, data from flow cytometry of untreated and chlorate-treated parasites suggested that sulfates are not primary receptors, but enhance the binding of Siglec-E to trypomastigotic forms. Altogether, our findings support the notion that sulfate-containing sialylated glycoproteins interact with Siglec-E, an ortholog protein of human Siglec-9, and might modulate the immune response of the host, favoring parasitemia and persistence of the parasite.
Ramsey, Simeon J; Attkins, Neil J; Fish, Rebecca; van der Graaf, Piet H
2011-01-01
BACKGROUND AND PURPOSE A series of novel non-peptide corticotropin releasing factor type-1 receptor (CRF1) antagonists were found to display varying degrees of insurmountable and non-competitive behaviour in functional in vitro assays. We describe how we attempted to relate this behaviour to ligand receptor-binding kinetics in a quantitative manner and how this resulted in the development and implementation of an efficient pharmacological screening method based on principles described by Motulsky and Mahan. EXPERIMENTAL APPROACH A non-equilibrium binding kinetic assay was developed to determine the receptor binding kinetics of non-peptide CRF1 antagonists. Nonlinear, mixed-effects modelling was used to obtain estimates of the compounds association and dissociation rates. We present an integrated pharmacokinetic–pharmacodynamic (PKPD) approach, whereby the time course of in vivo CRF1 receptor binding of novel compounds can be predicted on the basis of in vitro assays. KEY RESULTS The non-competitive antagonist behaviour appeared to be correlated to the CRF1 receptor off-rate kinetics. The integrated PKPD model suggested that, at least in a qualitative manner, the in vitro assay can be used to triage and select compounds for further in vivo investigations. CONCLUSIONS AND IMPLICATIONS This study provides evidence for a link between ligand offset kinetics and insurmountable/non-competitive antagonism at the CRF1 receptor. The exact molecular pharmacological nature of this association remains to be determined. In addition, we have developed a quantitative framework to study and integrate in vitro and in vivo receptor binding kinetic behaviour of CRF1 receptor antagonists in an efficient manner in a drug discovery setting. PMID:21449919
A mutagenic analysis of the RNase mechanism of the bacterial Kid toxin by mass spectrometry.
Diago-Navarro, Elizabeth; Kamphuis, Monique B; Boelens, Rolf; Barendregt, Arjan; Heck, Albert J; van den Heuvel, Robert H; Díaz-Orejas, Ramón
2009-09-01
Kid, the toxin of the parD (kis, kid) maintenance system of plasmid R1, is an endoribonuclease that preferentially cleaves RNA at the 5' of A in the core sequence 5'-UA(A/C)-3'. A model of the Kid toxin interacting with the uncleavable mimetic 5'-AdUACA-3' is available. To evaluate this model, a significant collection of mutants in some of the key residues proposed to be involved in RNA binding (T46, A55, T69 and R85) or RNA cleavage (R73, D75 and H17) were analysed by mass spectrometry in RNA binding and cleavage assays. A pair of substrates, 5'-AUACA-3', and its uncleavable mimetic 5'-AdUACA-3', used to establish the model and structure of the Kid-RNA complex, were used in both the RNA cleavage and binding assays. A second RNA substrate, 5'-UUACU-3' efficiently cleaved by Kid both in vivo and in vitro, was also used in the cleavage assays. Compared with the wild-type protein, mutations in the residues of the catalytic site abolished RNA cleavage without substantially altering RNA binding. Mutations in residues proposed to be involved in RNA binding show reduced binding efficiency and a corresponding decrease in RNA cleavage efficiency. The cleavage profiles of the different mutants were similar with the two substrates used, but RNA cleavage required much lower protein concentrations when the 5'-UUACU-3' substrate was used. Protein synthesis and growth assays are consistent with there being a correlation between the RNase activity of Kid and its inhibitory potential. These results give important support to the available models of Kid RNase and the Kid-RNA complex.
Nuñez, S B; Medin, J A; Braissant, O; Kemp, L; Wahli, W; Ozato, K; Segars, J H
1997-03-14
Estrogen receptors regulate transcription of genes essential for sexual development and reproductive function. Since the retinoid X receptor (RXR) is able to modulate estrogen responsive genes and both 9-cis RA and fatty acids influenced development of estrogen responsive tumors, we hypothesized that estrogen responsive genes might be modulated by RXR and the fatty acid receptor (peroxisome proliferator-activated receptor, PPAR). To test this hypothesis, transfection assays in CV-1 cells were performed with an estrogen response element (ERE) coupled to a luciferase reporter construct. Addition of expression vectors for RXR and PPAR resulted in an 11-fold increase in luciferase activity in the presence of 9-cis RA. Furthermore, mobility shift assays demonstrated binding of RXR and PPAR to the vitellogenin A2-ERE and an ERE in the oxytocin promoter. Methylation interference assays demonstrated that specific guanine residues required for RXR/PPAR binding to the ERE were similar to residues required for ER binding. Moreover, RXR domain-deleted constructs in transfection assays showed that activation required RXR since an RXR delta AF-2 mutant completely abrogated reporter activity. Oligoprecipitation binding studies with biotinylated ERE and (35)S-labeled in vitro translated RXR constructs confirmed binding of delta AF-2 RXR mutant to the ERE in the presence of baculovirus-expressed PPAR. Finally, in situ hybridization confirmed RXR and PPAR mRNA expression in estrogen responsive tissues. Collectively, these data suggest that RXR and PPAR are present in reproductive tissues, are capable of activating estrogen responsive genes and suggest that the mechanism of activation may involve direct binding of the receptors to estrogen response elements.
Replacing antibodies with modified DNA aptamers in vaccine potency assays.
Trausch, Jeremiah J; Shank-Retzlaff, Mary; Verch, Thorsten
2017-10-04
Vaccine in vitro potency assays are vital regulatory tests that are used to confirm the presence and concentration of an antigen of interest in a form that directly or indirectly relates to protective activity in patients. Current assays come in many forms, but they almost exclusively use antibody reagents for selective detection of the target antigen. Antibodies provide specific recognition of vaccine antigens but also exhibit drawbacks such as stability limitations, cost, and lot-to-lot variation, which can make it challenging to maintain the reagent throughout the lifetime of the vaccine. We explored replacing antibodies with aptamers. Aptamers are macromolecules, such as nucleic acids, which can bind to their targets with high specificity and affinity, similar to that of antibodies. Some of the advantages of using aptamers over antibodies is that aptamers can be more stable, smaller, less expensive to produce, synthesized in vitro, and logistically easier to supply throughout the multi-decade lifespan of a commercial vaccine. We created modified DNA aptamers against the common vaccine carrier protein, CRM 197 . Several aptamers were discovered and one was chosen for further characterization. The binding kinetics of the aptamer revealed an off-rate 16-fold slower than anti-CRM 197 antibodies used for comparison. The aptamers were more sensitive than available antibodies in some assay formats and comparable in others. The aptamer epitope was mapped to the receptor-binding domain of CRM 197 , a site adjacent to a known antibody binding site. These data address some key aspects for a path forward in replacing antibodies with aptamers for use as critical reagents in vaccine assays. We further highlight the possibility of using nucleic acid reagents to develop next generation potency assays. Copyright © 2017 Elsevier Ltd. All rights reserved.
Parween, Shahila; Nahar, Pradip
2013-10-15
In this communication, we report ELISA technique on an activated polypropylene microtest plate (APPµTP) as an illustrative example of a low cost diagnostic assay. Activated test zone in APPµTP binds a capture biomolecule through covalent linkage thereby, eliminating non-specific binding often prevalent in absorption based techniques. Efficacy of APPµTP is demonstrated by detecting human immunoglobulin G (IgG), human immunoglobulin E (IgE) and Aspergillus fumigatus antibody in patient's sera. Detection is done by taking the image of the assay solution by a desktop scanner and analyzing the color of the image. Human IgE quantification by color saturation in the image-based assay shows excellent correlation with absorbance-based assay (Pearson correlation coefficient, r=0.992). Significance of the relationship is seen from its p value which is 4.087e-11. Performance of APPµTP is also checked with respect to microtiter plate and paper-based ELISA. APPµTP can quantify an analyte as precisely as in microtiter plate with insignificant non-specific binding, a necessary prerequisite for ELISA assay. In contrast, paper-ELISA shows high non-specific binding in control sera (false positive). Finally, we have carried out ELISA steps on APPµTP by ultrasound waves on a sonicator bath and the results show that even in 8 min, it can convincingly differentiate a test sample from a control sample. In short, spectrophotometer-free image-based miniaturized ELISA on APPµTP is precise, reliable, rapid, and sensitive and could be a good substitute for conventional immunoassay procedures widely used in clinical and research laboratories. Copyright © 2013 Elsevier B.V. All rights reserved.
Rawat, Reetika; Xu, Zeng-Fu; Yao, Kwok-Ming; Chye, Mee-Len
2005-03-01
We have previously shown that the expression of SmCP which encodes Solanum melongena cysteine proteinase is ethylene-inducible and is under circadian control. To understand the regulation of SmCP, a 1.34-kb SmCP 5'-flanking region and its deletion derivatives were analyzed for cis-elements using GUS and luc fusions and by in vitro binding assays. Analysis of transgenic tobacco transformed with SmCP promoter-GUS constructs confirmed that the promoter region -415/+54 containing Ethylene Responsive Element ERE(-355/-348) conferred threefold ethylene-induction of GUS expression, while -827/+54 which also contains ERE(-683/-676), produced fivefold induction. Using gel mobility shift assays, we demonstrated that each ERE binds nuclear proteins from both ethephon-treated and untreated 5-week-old seedlings, suggesting that different transcriptions factors bind each ERE under varying physiological conditions. Binding was also observed in extracts from senescent, but not young, fruits. The variation in binding at the EREs in fruits and seedlings imply that organ-specific factors may participate in binding. Analysis of transgenic tobacco expressing various SmCP promoter-luc constructs containing wild-type or mutant Evening Elements (EEs) confirmed that both conserved EEs at -795/-787 and -785/-777 are important in circadian control. We confirmed the binding of total nuclear proteins to EEs in gel mobility shift assays and in DNase I footprinting. Our results suggest that multiple proteins bind the EEs which are conserved in plants other than Arabidopsis and that functional EEs and EREs are present in the 5'-flanking region of a gene encoding cysteine proteinase.
Characterization of 12 GnRH peptide agonists - a kinetic perspective.
Nederpelt, Indira; Georgi, Victoria; Schiele, Felix; Nowak-Reppel, Katrin; Fernández-Montalván, Amaury E; IJzerman, Adriaan P; Heitman, Laura H
2016-01-01
Drug-target residence time is an important, yet often overlooked, parameter in drug discovery. Multiple studies have proposed an increased residence time to be beneficial for improved drug efficacy and/or longer duration of action. Currently, there are many drugs on the market targeting the gonadotropin-releasing hormone (GnRH) receptor for the treatment of hormone-dependent diseases. Surprisingly, the kinetic receptor-binding parameters of these analogues have not yet been reported. Therefore, this project focused on determining the receptor-binding kinetics of 12 GnRH peptide agonists, including many marketed drugs. A novel radioligand-binding competition association assay was developed and optimized for the human GnRH receptor with the use of a radiolabelled peptide agonist, [(125) I]-triptorelin. In addition to radioligand-binding studies, a homogeneous time-resolved FRET Tag-lite™ method was developed as an alternative assay for the same purpose. Two novel competition association assays were successfully developed and applied to determine the kinetic receptor-binding characteristics of 12 high-affinity GnRH peptide agonists. Results obtained from both methods were highly correlated. Interestingly, the binding kinetics of the peptide agonists were more divergent than their affinities with residence times ranging from 5.6 min (goserelin) to 125 min (deslorelin). Our research provides new insights by incorporating kinetic, next to equilibrium, binding parameters in current research and development that can potentially improve future drug discovery targeting the GnRH receptor. © 2015 The British Pharmacological Society.
Characterization of 12 GnRH peptide agonists – a kinetic perspective
Nederpelt, Indira; Georgi, Victoria; Schiele, Felix; Nowak‐Reppel, Katrin; Fernández‐Montalván, Amaury E.; IJzerman, Adriaan P.
2015-01-01
Background and Purpose Drug‐target residence time is an important, yet often overlooked, parameter in drug discovery. Multiple studies have proposed an increased residence time to be beneficial for improved drug efficacy and/or longer duration of action. Currently, there are many drugs on the market targeting the gonadotropin‐releasing hormone (GnRH) receptor for the treatment of hormone‐dependent diseases. Surprisingly, the kinetic receptor‐binding parameters of these analogues have not yet been reported. Therefore, this project focused on determining the receptor‐binding kinetics of 12 GnRH peptide agonists, including many marketed drugs. Experimental Approach A novel radioligand‐binding competition association assay was developed and optimized for the human GnRH receptor with the use of a radiolabelled peptide agonist, [125I]‐triptorelin. In addition to radioligand‐binding studies, a homogeneous time‐resolved FRET Tag‐lite™ method was developed as an alternative assay for the same purpose. Key Results Two novel competition association assays were successfully developed and applied to determine the kinetic receptor‐binding characteristics of 12 high‐affinity GnRH peptide agonists. Results obtained from both methods were highly correlated. Interestingly, the binding kinetics of the peptide agonists were more divergent than their affinities with residence times ranging from 5.6 min (goserelin) to 125 min (deslorelin). Conclusions and Implications Our research provides new insights by incorporating kinetic, next to equilibrium, binding parameters in current research and development that can potentially improve future drug discovery targeting the GnRH receptor. PMID:26398856
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ransom, R.W.; Wai-si Eng; Burns, H.D.
1990-01-01
Synthetic methods have been established for preparing high specific activity (+)-3-({sup 123}I)Iodo-MK-801 in high radiochemical yield. The binding of the radiotracer to rat cortical membranes has been examine to assess its potential use as an in vivo imaging agent for the N-methyl-D-aspartate (NMDA) receptor-ion channel complex. Under the conditions of the assay, specific (+)-3-({sup 123}I)Iodo-MK-801 binding to membrane homogenates represented greater than 95% of the total binding. Several structurally distinct, noncompetitive NMDA receptor antagonists inhibited binding with potencies in accordance with their reported inhibitory activity at the receptor complex. The concentration of ({plus minus})-3-Iodo-MK-801 required to inhibit 50% of (+)-3-({supmore » 123}I)Iodo-MK-801 binding (IC{sub 50}) was 3.4 nM when using a low ionic strength assay buffer and 5.5 nM in a physiological buffer. In a thoroughly washed membrane preparation, (+)-3-({sup 123}I)Iodo-MK-801 binding was enhanced by L-glutamate and glycine at concentrations known to activate the NMDA receptor. The results indicate that (+)-3-({sup 123}I)Iodo-MK-801 specifically labels the NMDA receptor complex in rat brain membranes and the retention of high affinity under near physiological assay conditions suggests that it may be useful as a SPECT imaging agent for the receptor in vivo.« less
Liu, Zhihui; Lam, Norris; Thiele, Carol J
2015-09-29
The zinc finger transcription factor CASZ1 has been found to control neural fate-determination in flies, regulate murine and frog cardiac development, control murine retinal cell progenitor expansion and function as a tumor suppressor gene in humans. However, the molecular mechanism by which CASZ1 regulates gene transcription to exert these diverse biological functions has not been described. Here we identify co-factors that are recruited by CASZ1b to regulate gene transcription using co-immunoprecipitation (co-IP) and mass spectrometry assays. We find that CASZ1b binds to the nucleosome remodeling and histone deacetylase (NuRD) complex, histones and DNA repair proteins. Mutagenesis of the CASZ1b protein assay demonstrates that the N-terminus of CASZ1b is required for NuRD binding, and a poly(ADP-ribose) binding motif in the CASZ1b protein is required for histone H3 and DNA repair proteins binding. The N-terminus of CASZ1b fused to an artificial DNA-binding domain (GAL4DBD) causes a significant repression of transcription (5xUAS-luciferase assay), which could be blocked by treatment with an HDAC inhibitor. Realtime PCR results show that the transcriptional activity of CASZ1b mutants that abrogate NuRD or histone H3/DNA binding is significantly decreased. This indicates a model in which CASZ1b binds to chromatin and recruits NuRD complexes to orchestrate epigenetic-mediated transcriptional programs.
Ren, Xiao-Min; Guo, Liang-Hong; Gao, Yu; Zhang, Bin-Tian; Wan, Bin
2013-05-01
Polybrominated diphenyl ethers (PBDEs) have been shown to disrupt thyroid hormone (TH) functions in experimental animals, and one of the proposed disruption mechanisms is direct binding of hydroxylated PBDE (OH-PBDE) to TH receptors (TRs). However, previous data on TH receptor binding and TH activity of OH-PBDEs were very limited and sometimes inconsistent. In the present paper, we examined the binding potency of ten OH-PBDEs with different degrees of bromination to TR using a fluorescence competitive binding assay. The results showed that the ten OH-PBDEs bound to TR with potency that correlated to their bromination level. We further examined their effect on TR using a coactivator binding assay and GH3 cell proliferation assay. Different TR activities of OH-PBDEs were observed depending on their degree of bromination. Four low-brominated OH-PBDEs (2'-OH-BDE-28, 3'-OH-BDE-28, 5-OH-BDE-47, 6-OH-BDE-47) were found to be TR agonists, which recruited the coactivator peptide and enhanced GH3 cell proliferation. However, three high-brominated OH-PBDEs (3-OH-BDE-100, 3'-OH-BDE-154, 4-OH-BDE-188) were tested to be antagonists. Molecular docking was employed to simulate the interactions of OH-PBDEs with TR and identify the structural determinants for TR binding and activity. According to the docking results, low-brominated OH-PBDEs, which are weak binders but TR agonists, bind with TR at the inner side of its binding pocket, whereas high-brominated compounds, which are potent binders but TR antagonists, reside at the outer region. These results indicate that OH-PBDEs have different activities on TR (agonistic or antagonistic), possibly due to their different binding geometries with the receptor. Copyright © 2013 Elsevier Inc. All rights reserved.
Wilkinson, Kim; Boyd, Justin D.; Glicksman, Marcie; Moore, Kathryn J.; El Khoury, Joseph
2011-01-01
A pathological hallmark of Alzheimer disease (AD) is deposition of amyloid β (Aβ) in the brain. Aβ binds to microglia via a receptor complex that includes CD36 leading to production of proinflammatory cytokines and neurotoxic reactive oxygen species and subsequent neurodegeneration. Interruption of Aβ binding to CD36 is a potential therapeutic strategy for AD. To identify pharmacologic inhibitors of Aβ binding to CD36, we developed a 384-well plate assay for binding of fluorescently labeled Aβ to Chinese hamster ovary cells stably expressing human CD36 (CHO-CD36) and screened an Food and Drug Administration-approved compound library. The assay was optimized based on the cells' tolerance to dimethyl sulfoxide, Aβ concentration, time required for Aβ binding, reproducibility, and signal-to-background ratio. Using this assay, we identified four compounds as potential inhibitors of Aβ binding to CD36. These compounds were ursolic acid, ellipticine, zoxazolamine, and homomoschatoline. Of these compounds, only ursolic acid, a naturally occurring pentacyclic triterpenoid, successfully inhibited binding of Aβ to CHO-CD36 cells in a dose-dependent manner. The ursolic acid effect reached a plateau at ∼20 μm, with a maximal inhibition of 64%. Ursolic acid also blocked binding of Aβ to microglial cells and subsequent ROS production. Our data indicate that cell-based high-content screening of small molecule libraries for their ability to block binding of Aβ to its receptors is a useful tool to identify novel inhibitors of receptors involved in AD pathogenesis. Our data also suggest that ursolic acid is a potential therapeutic agent for AD via its ability to block Aβ-CD36 interactions. PMID:21835916
A receptor binding assay for paralytic shellfish poisoning toxins: recent advances and applications.
Powell, C L; Doucette, G J
1999-01-01
We recently described a high throughput receptor binding assay for paralytic shellfish poisoning (PSP) toxins, the use of the assay for detecting toxic activity in shellfish and algal extracts, and the validation of 11-[3H]-tetrodotoxin as an alternative radioligand to the [3H]-saxitoxin conventionally employed in the assay. Here, we report a dramatic increase in assay efficiency through application of microplate scintillation technology, resulting in an assay turn around time of 4 h. Efforts are now focused on demonstrating the range of applications for which this receptor assay can provide data comparable to the more time consuming, technically demanding HPLC analysis of PSP toxins, currently the method of choice for researchers. To date, we have compared the results of both methods for a variety of sample types, including different genera of PSP toxin producing dinoflagellates (e.g. Alexandrium lusitanicum, r2 = 0.9834, n = 12), size-fractioned field samples of Alexandrium spp. (20-64 microm; r2 = 0.9997, n = 10) as well as its associated zooplankton grazer community (200-500 microm: r2 = 0.6169, n = 10; >500 microm: r2 = 0.5063, n = 10), and contaminated human fluids (r2 = 0.9661, n = 7) from a PSP outbreak. Receptor-based STX equivalent values for all but the zooplankton samples were highly correlated and exhibited close quantitative agreement with those produced by HPLC. While the PSP receptor binding assay does not provide information on toxin composition obtainable by HPLC, it does represent a robust and reliable means of rapidly assessing PSP-like toxicity in laboratory and field samples. Moreover, this assay should be effective as a screening tool for use by public health officials in responding to suspected cases of PSP intoxication.
NASA Technical Reports Server (NTRS)
Lynes, Michael A. (Inventor); Fernandez, Salvador M. (Inventor)
2010-01-01
An assay technique for label-free, highly parallel, qualitative and quantitative detection of specific cell populations in a sample and for assessing cell functional status, cell-cell interactions and cellular responses to drugs, environmental toxins, bacteria, viruses and other factors that may affect cell function. The technique includes a) creating a first array of binding regions in a predetermined spatial pattern on a sensor surface capable of specifically binding the cells to be assayed; b) creating a second set of binding regions in specific spatial patterns relative to the first set designed to efficiently capture potential secreted or released products from cells captured on the first set of binding regions; c) contacting the sensor surface with the sample, and d) simultaneously monitoring the optical properties of all the binding regions of the sensor surface to determine the presence and concentration of specific cell populations in the sample and their functional status by detecting released or secreted bioproducts.
DNA-binding activity of TNF-{alpha} inducing protein from Helicobacter pylori
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kuzuhara, T.; Suganuma, M.; Oka, K.
2007-11-03
Tumor necrosis factor-{alpha} (TNF-{alpha}) inducing protein (Tip{alpha}) is a carcinogenic factor secreted from Helicobacter pylori (H. pylori), mediated through both enhanced expression of TNF-{alpha} and chemokine genes and activation of nuclear factor-{kappa}B. Since Tip{alpha} enters gastric cancer cells, the Tip{alpha} binding molecules in the cells should be investigated. The direct DNA-binding activity of Tip{alpha} was observed by pull down assay using single- and double-stranded genomic DNA cellulose. The surface plasmon resonance assay, indicating an association between Tip{alpha} and DNA, revealed that the affinity of Tip{alpha} for (dGdC)10 is 2400 times stronger than that of del-Tip{alpha}, an inactive Tip{alpha}. This suggestsmore » a strong correlation between DNA-binding activity and carcinogenic activity of Tip{alpha}. And the DNA-binding activity of Tip{alpha} was first demonstrated with a molecule secreted from H. pylori.« less
Radioligand Recognition of Insecticide Targets.
Casida, John E
2018-04-04
Insecticide radioligands allow the direct recognition and analysis of the targets and mechanisms of toxic action critical to effective and safe pest control. These radioligands are either the insecticides themselves or analogs that bind at the same or coupled sites. Preferred radioligands and their targets, often in both insects and mammals, are trioxabicyclooctanes for the γ-aminobutyric acid (GABA) receptor, avermectin for the glutamate receptor, imidacloprid for the nicotinic receptor, ryanodine and chlorantraniliprole for the ryanodine receptor, and rotenone or pyridaben for NADH + ubiquinone oxidoreductase. Pyrethroids and other Na + channel modulator insecticides are generally poor radioligands due to lipophilicity and high nonspecific binding. For target site validation, the structure-activity relationships competing with the radioligand in the binding assays should be the same as that for insecticidal activity or toxicity except for rapidly detoxified or proinsecticide analogs. Once the radioligand assay is validated for relevance, it will often help define target site modifications on selection of resistant pest strains, selectivity between insects and mammals, and interaction with antidotes and other chemicals at modulator sites. Binding assays also serve for receptor isolation and photoaffinity labeling to characterize the interactions involved.
Streptomyces coelicolor SCO4226 Is a Nickel Binding Protein
Jin, Hua; Zhang, Rong-Guang; Virolle, Marie-Joelle; Chen, Yuxing; Zhou, Cong-Zhao
2014-01-01
The open reading frame SCO4226 of Streptomyces coelicolor A3(2) encodes an 82-residue hypothetical protein. Biochemical assays revealed that each SCO4226 dimer binds four nickel ions. To decipher the molecular function, we solved the crystal structures of SCO4226 in both apo- and nickel-bound (Ni-SCO4226) forms at 1.30 and 2.04 Å resolution, respectively. Each subunit of SCO4226 dimer adopts a canonical ferredoxin-like fold with five β-strands flanked by two α-helices. In the structure of Ni-SCO4226, four nickel ions are coordinated at the surface of the dimer. Further biochemical assays suggested that the binding of Ni2+ triggers the self-aggregation of SCO4226 in vitro. In addition, RT-qPCR assays demonstrated that the expression of SCO4226 gene in S. coelicolor is specifically up-regulated by the addition of Ni2+, but not other divalent ions such as Cu2+, Mn2+ or Co2+. All these results suggested that SCO4226 acts as a nickel binding protein, probably required for nickel sequestration and/or detoxification. PMID:25285530
Sugiyama, Yuka; Ikeshita, Nobuko; Shibahara, Hiromi; Yamamoto, Daisuke; Kawagishi, Mayuko; Iguchi, Genzo; Iida, Keiji; Takahashi, Yutaka; Kaji, Hidesuke; Chihara, Kazuo; Okimura, Yasuhiko
2013-08-25
PROP1 mutation causes combined pituitary hormone deficiency (CPHD). Several mutations are located in a transactivation domain (TAD) of Prop1, and the loss of TAD binding to cofactors is likely the cause of CPHD. PROP1 cofactors have not yet been identified. In the present study, we aimed to identify the PROP1-interacting proteins from the human brain cDNA library. Using a yeast two-hybrid assay, we cloned nine candidate proteins that may bind to PROP1. Of those nine candidates, amino-terminal enhancer of split (AES) was the most abundant, and we analyzed the AES function. AES dose-dependently decreased the PROP1-induced Pit-1 reporter gene expression. An immunoprecipitation assay revealed the relationship between AES and PROP1. In a mammalian two-hybrid assay, a leucine zipper-like motif of the AES Q domain was identified as a region that interacted with TAD. These results indicated that AES was a corepressor of PROP1. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
Salas-Sarduy, Emir; Guerra, Yasel; Covaleda Cortés, Giovanni; Avilés, Francesc Xavier; Chávez Planes, María A.
2017-01-01
Natural products from marine origin constitute a very promising and underexplored source of interesting compounds for modern biotechnological and pharmaceutical industries. However, their evaluation is quite challenging and requires specifically designed assays to reliably identify the compounds of interest in a highly heterogeneous and interfering context. In the present study, we describe a general strategy for the confident identification of tight-binding protease inhibitors in the aqueous extracts of 62 Cuban marine invertebrates, using Plasmodium falciparum hemoglobinases Plasmepsin II and Falcipain 2 as model enzymes. To this end, we first developed a screening strategy that combined enzymatic with interaction-based assays and then validated screening conditions using five reference extracts. Interferences were evaluated and minimized. The results from the massive screening of such extracts, the validation of several hits by a variety of interaction-based assays and the purification and functional characterization of PhPI, a multifunctional and reversible tight-binding inhibitor for Plasmepsin II and Falcipain 2 from the gorgonian Plexaura homomalla, are presented. PMID:28430158
Structural Requirements For Bone Sialoprotein Binding And Modulation Of Matrix Metalloproteinase-2
Jain, Alka; Karadag, Abdullah; Fisher, Larry W.; Fedarko, Neal S.
2008-01-01
Bone sialoprotein (BSP) has been shown to induce limited gelatinase activity in latent matrix metalloproteinase-2 (MMP-2) without removal of the propeptide and to restore enzymatic activity to MMP-2 previously inhibited by tissue inhibitor of matrix metalloproteinase-2 (TIMP2). The current study identifies structural domains in human BSP and MMP-2 that contribute to these interactions. The 26 amino acid domain encoded by exon 4 of BSP is shown by a series of binding and activity assays to be involved in the displacement of MMP-2′s propeptide from the active site and thereby inducing the protease activity. Binding assays in conjunction with enzyme activity assays demonstrate that both amino- and carboxy-terminal domains of BSP contribute to restoration of activity to TIMP2-inhibited MMP-2, while the MMP-2 hemopexin domain is not required for reactivation. PMID:18729384
Structural requirements for bone sialoprotein binding and modulation of matrix metalloproteinase-2.
Jain, Alka; Karadag, Abdullah; Fisher, Larry W; Fedarko, Neal S
2008-09-23
Bone sialoprotein (BSP) has been shown to induce limited gelatinase activity in latent matrix metalloproteinase-2 (MMP-2) without removal of the propeptide and to restore enzymatic activity to MMP-2 previously inhibited by tissue inhibitor of matrix metalloproteinase-2 (TIMP2). The current study identifies structural domains in human BSP and MMP-2 that contribute to these interactions. The 26 amino acid domain encoded by exon 4 of BSP is shown by a series of binding and activity assays to be involved in the displacement of MMP-2's propeptide from the active site and thereby inducing the protease activity. Binding assays in conjunction with enzyme activity assays demonstrate that both amino- and carboxy-terminal domains of BSP contribute to restoration of activity to TIMP2-inhibited MMP-2, while the MMP-2 hemopexin domain is not required for reactivation.
Addressing matrix effects in ligand-binding assays through the use of new reagents and technology.
Chilewski, Shannon D; Mora, Johanna R; Gleason, Carol; DeSilva, Binodh
2014-04-01
Ligand-binding assays (LBAs) used in the quantification of biotherapeutics for pharmacokinetic determinations rely on interactions between reagents (antibodies or target molecule) and the biotherapeutic. Most LBAs do not employ an analyte extraction procedure and are susceptible to matrix interference. Here, we present a case study on the development of a LBA for the quantification of a PEGylated domain antibody where matrix interference was observed. The assay used to support the single ascending dose study was a plate-based electrochemiluminescent assay with a lower limit of quantification of 80 ng/mL. To meet sensitivity requirements of future studies, new reagents and the Gyrolab™ Workstation were evaluated. Assay sensitivity improved nearly threefold in the final method utilizing new antibody reagents, a buffer containing blockers to human anti-animal antibodies, and the Gyrolab Workstation. Experimental data indicate that all factors changed played a role in overcoming matrix effects.
Goussard, J
1998-10-23
The importance of the receptor level in breast cancer as an indicator of hormone response has been extensively studied for more than 20 years. Besides cytosol-based ligand-binding assays (dextran-coated charcoal assay, DCC), new methods using monoclonal antibodies raised against estrogen and progesterone receptors allow for the detection of receptors both in cytosol extracts (enzyme immunoassay, EIA) and in tissue sections (immunocytochemical assay, ICA). The biochemical assays (DCC and EIA) as well as the immunochemical detection (ICA) have specific qualities and produce original information which is useful for the therapeutic decision. While DCC gives a measure of the receptor level, whatever the real source of synthesis (normal and/or neoplastic tissue), ICA locates the positive cells and their relative proportion in the tumor. Both methods present their own advantages and disadvantages which are summarized in this study.
Cheow, Lih Feng; Viswanathan, Ramya; Chin, Chee-Sing; Jennifer, Nancy; Jones, Robert C; Guccione, Ernesto; Quake, Stephen R; Burkholder, William F
2014-10-07
Homogeneous assay platforms for measuring protein-ligand interactions are highly valued due to their potential for high-throughput screening. However, the implementation of these multiplexed assays in conventional microplate formats is considerably expensive due to the large amounts of reagents required and the need for automation. We implemented a homogeneous fluorescence anisotropy-based binding assay in an automated microfluidic chip to simultaneously interrogate >2300 pairwise interactions. We demonstrated the utility of this platform in determining the binding affinities between chromatin-regulatory proteins and different post-translationally modified histone peptides. The microfluidic chip assay produces comparable results to conventional microtiter plate assays, yet requires 2 orders of magnitude less sample and an order of magnitude fewer pipetting steps. This approach enables one to use small samples for medium-scale screening and could ease the bottleneck of large-scale protein purification.
Fei, Yiyan; Sun, Yung-Shin; Li, Yanhong; Yu, Hai; Lau, Kam; Landry, James P.; Luo, Zeng; Baumgarth, Nicole; Chen, Xi; Zhu, Xiangdong
2015-01-01
A key step leading to influenza viral infection is the highly specific binding of a viral spike protein, hemagglutinin (HA), with an extracellular glycan receptor of a host cell. Detailed and timely characterization of virus-receptor binding profiles may be used to evaluate and track the pandemic potential of an influenza virus strain. We demonstrate a label-free glycan microarray assay platform for acquiring influenza virus binding profiles against a wide variety of glycan receptors. By immobilizing biotinylated receptors on a streptavidin-functionalized solid surface, we measured binding curves of five influenza A virus strains with 24 glycans of diverse structures and used the apparent equilibrium dissociation constants (avidity constants, 10–100 pM) as characterizing parameters of viral receptor profiles. Furthermore by measuring binding kinetic constants of solution-phase glycans to immobilized viruses, we confirmed that the glycan-HA affinity constant is in the range of 10 mM and the reaction is enthalpy-driven. PMID:26193329
Fei, Yiyan; Sun, Yung-Shin; Li, Yanhong; Yu, Hai; Lau, Kam; Landry, James P; Luo, Zeng; Baumgarth, Nicole; Chen, Xi; Zhu, Xiangdong
2015-07-16
A key step leading to influenza viral infection is the highly specific binding of a viral spike protein, hemagglutinin (HA), with an extracellular glycan receptor of a host cell. Detailed and timely characterization of virus-receptor binding profiles may be used to evaluate and track the pandemic potential of an influenza virus strain. We demonstrate a label-free glycan microarray assay platform for acquiring influenza virus binding profiles against a wide variety of glycan receptors. By immobilizing biotinylated receptors on a streptavidin-functionalized solid surface, we measured binding curves of five influenza A virus strains with 24 glycans of diverse structures and used the apparent equilibrium dissociation constants (avidity constants, 10-100 pM) as characterizing parameters of viral receptor profiles. Furthermore by measuring binding kinetic constants of solution-phase glycans to immobilized viruses, we confirmed that the glycan-HA affinity constant is in the range of 10 mM and the reaction is enthalpy-driven.
Quantitation of proteins using a dye-metal-based colorimetric protein assay.
Antharavally, Babu S; Mallia, Krishna A; Rangaraj, Priya; Haney, Paul; Bell, Peter A
2009-02-15
We describe a dye-metal (polyhydroxybenzenesulfonephthalein-type dye and a transition metal) complex-based total protein determination method. The binding of the complex to protein causes a shift in the absorption maximum of the dye-metal complex from 450 to 660 nm. The dye-metal complex has a reddish brown color that changes to green on binding to protein. The color produced from this reaction is stable and increases in a proportional manner over a broad range of protein concentrations. The new Pierce 660 nm Protein Assay is very reproducible, rapid, and more linear compared with the Coomassie dye-based Bradford assay. The assay reagent is room temperature stable, and the assay is a simple and convenient mix-and-read format. The assay has a moderate protein-to-protein variation and is compatible with most detergents, reducing agents, and other commonly used reagents. This is an added advantage for researchers needing to determine protein concentrations in samples containing both detergents and reducing agents.
Ho, C L; Li, C H
1985-03-01
Three synthetic analogs of human beta-endorphin (beta h-EP) (I, [Gln8, Gly31]-beta h-EP-Gly-Gly-NH2; II, [Arg9,12,24,28,29]-beta h-EP and III, [Cys11,26, Phe27, Gly31]-beta h-EP), which have been shown to possess potent inhibiting activity to beta h-EP-induced analgesia, were assayed in rat vas deferens and guinea pig ileum bioassay systems. In the rat vas deferens assay, relative potencies of these analogs were beta h-EP, 100; I, 30; II, 40; III, 1, whereas in the guinea pig ileum assay: beta h-EP, 100; I, 184; II, 81; III, 163. From previous studies on their analgesia potency in mice and opiate receptor-binding activity in rat brain membranes, their activity in rat vas deferens correlates well with the analgesic potency and the activity from guinea pig ileum assay shows good correlations with that from the opiate receptor-binding assay.
Naik, Subhashchandra; Kumru, Ozan S; Cullom, Melissa; Telikepalli, Srivalli N; Lindboe, Elizabeth; Roop, Taylor L; Joshi, Sangeeta B; Amin, Divya; Gao, Phillip; Middaugh, C Russell; Volkin, David B; Fisher, Mark T
2014-10-01
The ability of a GroEL-based bio-layer interferometry (BLI) assay to detect structurally altered and/or aggregated species of pharmaceutically relevant proteins is demonstrated. Assay development included optimizing biotinylated-GroEL immobilization to streptavidin biosensors, combined with biophysical and activity measurements showing native and biotinylated GroEL are both stable and active. First, acidic fibroblast growth factor (FGF-1) was incubated under conditions known to promote (40°C) and inhibit (heparin addition) molten globule formation. Heat exposed (40°C) FGF-1 exhibited binding to GroEL-biosensors, which was significantly diminished in the presence of heparin. Second, a polyclonal human IgG solution containing 6-8% non-native dimer showed an increase in higher molecular weight aggregates upon heating by size exclusion chromatography (SEC). The poly IgG solution displayed binding to GroEL-biosensors initially with progressively increased binding upon heating. Enriched preparations of the IgG dimers or monomers showed significant binding to GroEL-biosensors. Finally, a thermally treated IgG1 monoclonal antibody (mAb) solution also demonstrated increased GroEL-biosensor binding, but with different kinetics. The bound complexes could be partially to fully dissociated after ATP addition (i.e., specific GroEL binding) depending on the protein, environmental stress, and the assay's experimental conditions. Transmission electron microscopy (TEM) images of GroEL-mAb complexes, released from the biosensor, also confirmed interaction of bound complexes at the GroEL binding site with heat-stressed mAb. Results indicate that the GroEL-biosensor-BLI method can detect conformationally altered and/or early aggregation states of proteins, and may potentially be useful as a rapid, stability-indicating biosensor assay for monitoring the structural integrity and physical stability of therapeutic protein candidates. © 2014 The Protein Society.
De Souza, Melissa; Matthews, Hayden; Lee, Jodi A; Ranson, Marie; Kelso, Michael J
2011-04-15
Binding of the urokinase-type plasminogen activator (uPA) to its cell-surface-bound receptor uPAR and upregulation of the plasminogen activation system (PAS) correlates with increased metastasis and poor prognosis in several tumour types. Disruptors of the uPA:uPAR interaction represent promising anti-tumour/metastasis agents and several approaches have been explored for this purpose, including the use of small molecule antagonists. Two highly potent non-peptidic antagonists 1 and 2 (IC(50)1=0.8 nM, IC(50)2=33 nM) from the patent literature were reportedly identified using competition assays employing radiolabelled uPAR-binding uPA fragments and appeared as useful pharmacological tools for studying the PAS. Before proceeding to such studies, confirmation was sought that 1 and 2 retained their potencies in physiologically relevant cell-based competition assays employing uPAR's native binding partner high molecular weight uPA (HMW-uPA). This study describes a new solution phase synthesis of 1, a mixed solid/solution phase synthesis of 2 and reports the activities of 1 and 2 in semi-quantitative competition flow cytometry assays and quantitative cell-based uPA activity assays that employed HMW-uPA as the competing ligand. The flow cytometry experiments revealed that high concentrations of 2 (10-100 μM) are required to compete with HMW-uPA for uPAR binding and that 1 shows no antagonist effects at 100 μM. The cell-based enzyme activity assays similarly revealed that 1 and 2 are poor inhibitors of cell surface-bound HMW-uPA activity (IC(50) >100 μM for 1 and 2). The report highlights the dangers of identifying false-positive lead uPAR antagonists from competition assays employing labelled competing ligands other than the native HMW-uPA. Copyright © 2011 Elsevier Ltd. All rights reserved.
[Radiolabelling and assay of Chinese agkistrodon acutus venom with carrier-free Na 125I].
Gong, Y; Deng, C; Li, S; Li, L; Guan, J
1995-03-01
Chinese agkistroden acutus venom (CAAV) was radiolabelled with carrier-free Na 125I by the method of Iodogen. The specific activity and radiochemical purity for radiolabelled products were 4236.5 x 10(10) Bq/mmol and 98%, respectively. Each CAAV molecule carried 0.52 125I atom. Physical and chemical characterization of radiolabelled CAAV was similar to unradiolabelled CAAV. Binding analysis showed that 125I-CAAV was bound to platelet in a saturable manner. Binding sites per platelet were 13,255 +/- 6292/platelet. The dissociation constant (Kd) was 3.2 +/- 0.69 x 10(-10) mol/L. These results are similar to binding sites of other snake venom on platelet. The investigation showed that radiolabelled CAAV made by our laboratory was useful for radioligand binding assay.
Lefor Bradford, Julia
2015-01-01
This perspective article discusses key points to address in the establishment of sound partnerships between sponsors and bioanalytical CROs to assure the timeliness, quality and consistency of bioanalysis throughout biological therapeutic development. The performance of ligand-binding assays can be greatly impacted by low-grade reagents, lot-to-lot variability and lack of stability of the analyte in matrix, impacting both timelines and cost. Thorough characterization of the biologic of interest and its assay-enabling critical reagents will lend itself well to conservation of materials and continuity of assay performance. When unplanned events occur, such as performance declines or premature depletion of material, structured procedures are paramount to supplement the current loosely defined regulatory guidance on critical reagent characterization and method bridging.
Chen, Changmin; Shanmugasundaram, Kumaran; Rigby, Alan C; Kung, Andrew L
2013-04-11
To search for compounds that disrupt binding of the EWS-FLI1 fusion protein to its cognate targets, we developed a homogeneous high-throughput proximity assay and screened 5200 small molecule compounds. Many well-known DNA-binding chemotherapeutic agents, such as actinomycin D, cisplatin, doxorubicin, daunorubicin, and epirubicin scored in the assay and not surprising also disrupted the binding of other transcription factors. Unexpectedly, we found that Shikonin, a natural product from the root of Lithospermum erythrorhizon, similarly disrupted protein-DNA interactions. Mechanistic studies demonstrated that Shikonin displaces SYBR green from binding to the minor groove of DNA and is able to inhibit topoisomerase mediated DNA relaxation. In cells, Shikonin blocked the binding of EWS-FLI1 to the NR0B1 promoter, and attenuated gene expression. Shikonin rapidly induced G2/M arrest and apoptosis in Ewing sarcoma cells. These results demonstrate that contrary to other purported mechanisms of action, Shikonin is a DNA-binding cytotoxic agent. Copyright © 2013 Elsevier B.V. All rights reserved.
Horsfall, A C; Venables, P J; Mumford, P A; Maini, R N
1981-01-01
The Raji cell assay is regarded as a test for the detection and quantitation of immune complexes. It is frequently positive in sera from patients with SLE. We have demonstrated a relationship between Raji cell binding and antibodies to DNA and soluble cellular antigens. In five sera containing high titres of antibodies of known single specificity, most of the Raji cell binding occurred in the 7S IgG fraction where the majority of anti-nuclear antibody was also found. When each of these sera was incubated with its specific antigen, Raji cell binding increased. Subsequent fractionation showed that this binding was in the high molecular weight fraction (greater than 200,000 daltons) and that Raji cell binding and antibody activity were abolished in the 7S fraction. These data confirm that Raji cell bind immune complexes but also indicate that 7S anti-nuclear antibodies may interact directly with Raji cells by an unknown mechanism. Therefore, in sera of patients with anti-nuclear antibodies, binding to Raji cells does not necessarily imply the presence of immune complexes alone. PMID:6975676
Selb, R.; Eckl-Dorna, J.; Vrtala, S.; Valenta, R.; Niederberger, V.
2017-01-01
Background It has been shown that birch pollen immunotherapy can induce IgG antibodies which enhance IgE binding to Bet v 1. We aimed to develop a serological assay to predict the development of antibodies which enhance IgE binding to Bet v 1 during immunotherapy. Methods In 18 patients treated by Bet v 1-fragment-specific immunotherapy, the effects of IgG antibodies specific for the fragments on the binding of IgE antibodies to Bet v 1 were measured by ELISA. Blocking and possible enhancing effects on IgE binding were compared with skin sensitivity to Bet v 1 after treatment. Results We found that fragment-specific IgG enhanced IgE binding to Bet v 1 in two patients who also showed an increase of skin sensitivity to Bet v 1. Conclusion Our results indicate that it may be possible to develop serological tests which predict the induction of unfavourable IgG antibodies enhancing the binding of IgE to Bet v 1 during immunotherapy. PMID:23998344
Dey, Biswajit; Mukherjee, Priyanka; Mondal, Ranjan Kumar; Chattopadhyay, Asoke Prasun; Hauli, Ipsit; Mukhopadhyay, Subhra Kanti; Fleck, Michel
2014-12-14
A highly selective femtomolar level sensing of inorganic arsenic(III) as arsenious acid has been accomplished in water medium and in living-systems (on pollen grains of Tecoma stans; Candida albicans cells (IMTECH No. 3018) and Peperomia pellucida stem section) using a non-toxic fluorescent probe of a Cu(II)-complex.
Microanatomical diversification of the zona pellucida in aplochelioid killifishes.
Thompson, A W; Furness, A I; Stone, C; Rade, C M; Ortí, G
2017-07-01
This study investigates zona pellucida (ZP) ultrastructure in fertilized eggs of annual killifishes (suborder Aplocheiloidei), a group of highly specialized fishes that are able to survive desiccation for several weeks to months before they hatch. Little is known about ZP or chorionic ultrastructure sustaining these life-history modes, so scanning electron microscopy (SEM) was used to describe this trait in a large number of aplocheiloids with a focus on the family Rivulidae and the genus Hypsolebias. New images of ZP ultrastructure for 52 aplocheiloid species are provided, more than doubling the number characterized thus far. The evolution of chorionic structure within this group is studied using these new data. Characters were coded into a morphological matrix and optimized onto a consensus phylogeny to assess phylogenetic signal and reconstruct ancestral character states. Although ZP characters seem highly homoplastic and exhibit a large amount of structural convergence among lineages, aplocheiloid killifishes have evolved a number of unique structures associated with the chorion. Some annual species seem to have lost long filaments because eggs are deposited in the soil instead of being adhered to aquatic plants. © 2017 The Fisheries Society of the British Isles.
Targeting the zona pellucida for immunocontraception: a minireview.
Tesarik, J
1995-12-01
This minireview summarizes the main data relevant to the development of contraceptive vaccines based on zona pellucida (ZP) antigens, as well as the pros and the cons of this immunocontraceptive strategy. Even though the antifertility efficacy of anti-ZP antibodies in humans is not corroborated by a clear relationship between spontaneous autoimmunization against the ZP and infertility, passive and active immunization studies in laboratory animals have provided convincing results. The contraceptive action of anti-ZP antibodies, targeting events situated upstream of gamete fusion, is devoid of potential ethical concerns related to the destruction of early embryos. The high protein content of the mammalian ZP, knowledge of the complete amino acid sequence of the major ZP proteins, and the high degree of sequence homology between individual species all favour the rapid advancement of anti-ZP vaccine projects. However, certain sequences of ZP proteins, when incorporated into the vaccine construct, activate CD4+ T cells of the recipient organism to direct a cellular immune attack (autoimmune oophoritis) to other functionally relevant ovarian components (primordial follicles, steroidogenic cells). The search for the optimal combination of B cell and T cell epitopes in the vaccine construct will hopefully overcome this problem.
Cold laser technique for cell surgery
NASA Astrophysics Data System (ADS)
Palanker, Daniel V.; Ohad, Shoshanit; Lewis, Aaron; Laufer, Neri
1992-08-01
A new cell surgery technique has been developed to produce well-defined alterations in cells and tissues without detectable heating and/or other structural damage in the surroundings. The technique involves the use of a 193 nm argon fluoride excimer laser which is guided through a glass pipette filled with a positive air pressure. To demonstrate the method holes were drilled in the zona pellucida of mouse oocytes. The diameter of the drilled hole was determined by the pipette tip size, and its depth by an energy emitted per pulse and number of pulses. Scanning electron microscopy of the drilled mouse oocytes showed uniform, round, well circumscribed holes with sharp edges. Oocytes that had their zona pellucida drilled with this new method fertilized in vitro and developed to the blastocyst stage in a rate similar to that of control group. These results demonstrate the non-perturbing nature of this cold laser microsurgical procedure. In addition to the extension of our results for clinical in vitro fertilization purposes, such as enhancement of fertilization and embryo biopsy, there are wide ranging possible uses of our method in fundamental and applied investigations that require sub-micron accuracy in cellular alteration.
Characterization of oocyte retrieval cycles with empty zona pellucida.
Oride, Aki; Kanasaki, Haruhiko; Hara, Tomomi; Ohta, Hiroko; Kyo, Satoru
2018-01-01
To identify the factors that characterize cycles with empty zona pellucida (EZP). Thirty-six oocyte retrieval cycles from which EZP were collected and another 36 cycles from which no EZP was collected were compared. The patients were divided into three groups: those with no EZP collected during any cycle, those with EZP collected during all cycles, and those experiencing cycles both with and without EZP. The mean number of oocytes collected per cycle was higher in the cycles with EZP than without EZP. The fertilization rate of the collected oocytes and the rate of good embryo formation were significantly lower in the cycles with EZP. No significant difference was observed between the three groups in terms of age, number of oocytes collected, or hormone levels before and after the oocyte retrieval. The fertilization and pregnancy rates were highest in the patients with no EZP being collected during any cycle, followed by those experiencing cycles both with and without EZP, and then by those with EZP collected during all cycles. The observation of lower fertilization, poor embryo formation, and a low pregnancy rate in the patients with EZP suggests the poor quality of oocytes that were collected with EZP in the same cycle.
Essential oil composition of three Peperomia species from the Amazon, Brazil.
de Lira, Patricia Natália B; da Silva, Joyce Kelly R; Andrade, Eloisa Helena A; Sousa, Pergentino José; Silva, Nayla N S; Maia, José Guilherme S
2009-03-01
The essential oils of three species of Peperomia from the Amazon, Brazil, were hydrodistilled and their 96 volatile constituents identified by GC and GC-MS. The main constituents found in the oil of P. macrostachya were epi-alpha-bisabolol (15.9%), caryophyllene oxide (12.9%), myristicin (7.6%), an aromatic compound (6.6%) and limonene (5.4%). The oil of P. pellucida was dominated by dillapiole (55.3%), (E)-caryophyllene (14.3%) and carotol (8.1%). The major volatile found in the oil of P. rotundifolia was decanal (43.3%), probably a fatty acid-derived compound, followed by dihydro-P3-santalol (9.0%), (E)-nerolidol (7.9%) and limonene (7.7%). The aromatic compounds elemicin, myristicin, apiole, dillapiole and safrole identified in these Peperomia species has been found also in Amazon Piper species. The oils and methanol extracts showed high brine shrimp larvicidal activities. The oil of P. rotundifolia (LC50 = 1.9 +/- 0.1 microg/mL) was the more toxic, followed by the extract of P. pellucida (LC50 = 2.4 +/- 0.5 microg/mL) and the oil of P. macrostachya (LC50 = 9.0 +/- 0.4 microg/mL), therefore with important biological properties.
Bioactive compounds from Peperomia pellucida.
Xu, Su; Li, Na; Ning, Meng-Meng; Zhou, Cai-Hong; Yang, Qiao-Rong; Wang, Ming-Wei
2006-02-01
Five new compounds (1-5), including two secolignans, two tetrahydrofuran lignans, and one highly methoxylated dihydronaphthalenone, were isolated from the whole plant of Peperomia pellucida. These compounds were accompanied by the known peperomins A, B, C, and E, 7,8-trans-8,8'-trans-7',8'-cis-7,7'-bis(5-methoxy-3,4-methylenedioxyphenyl)-8-acetoxymethyl-8'-hydroxymethyltetrahydrofuran, 7,8-trans-8,8'-trans-7',8'-cis-7-(5-methoxy-3,4-methylenedioxyphenyl)-7'-(4-hydroxy-3,5-dimethoxyphenyl)-8,8'-diacetoxymethyltetrahydrofuran, sesamin, and isoswertisin. New structures were elucidated mainly by NMR and MS techniques, and anticancer activities evaluated in HL-60, MCF-7, and HeLa cell lines. Compound 1 and peperomin E show growth inhibitory effects on the three cancer cell lines with IC(50) values ranging between 1.4 and 9.1 and between 1.8 and 11.1 microM, respectively. Compound 2 has a weak suppressive activity on HL-60 cells (IC(50) = 10.8 microM), while 7,8-trans-8,8'-trans-7',8'-cis-7,7'-bis(5-methoxy-3,4-methylenedioxyphenyl)-8-acetoxymethyl-8'-hydroxymethyltetrahydrofuran exhibits estrogen-like properties (EC(50) = 3.1 microM) in CV-1 cells transfected with human estrogen receptor (ERalpha).
In this work, a 96-well plate estrogen receptor binding assay was developed to facilitate the direct comparison of chemical binding to full-length recombinant estrogen receptors across vertebrate classes. Receptors were generated in a baculovirus expression system. This approach ...
Anti-DNA antibodies--quintessential biomarkers of SLE.
Pisetsky, David S
2016-02-01
Antibodies that recognize and bind to DNA (anti-DNA antibodies) are serological hallmarks of systemic lupus erythematosus (SLE) and key markers for diagnosis and disease activity. In addition to common use in the clinic, anti-DNA antibody testing now also determines eligibility for clinical trials, raising important questions about the nature of the antibody-antigen interaction. At present, no 'gold standard' for serological assessment exists, and anti-DNA antibody binding can be measured with a variety of assay formats, which differ in the nature of the DNA substrates and in the conditions for binding and detection of antibodies. A mechanism called monogamous bivalency--in which high avidity results from simultaneous interaction of IgG Fab sites with a single polynucleotide chain--determines anti-DNA antibody binding; this mechanism might affect antibody detection in different assay formats. Although anti-DNA antibodies can promote pathogenesis by depositing in the kidney or driving cytokine production, they are not all alike, pathologically, and anti-DNA antibody expression does not necessarily correlate with active disease. Levels of anti-DNA antibodies in patients with SLE can vary over time, distinguishing anti-DNA antibodies from other pathogenic antinuclear antibodies. Elucidation of the binding specificities and the pathogenic roles of anti-DNA antibodies in SLE should enable improvements in the design of informative assays for both clinical and research purposes.
Lee, Dong-Kee; Suh, Dongchul; Edenberg, Howard J; Hur, Man-Wook
2002-07-26
The POZ domain is a protein-protein interaction motif that is found in many transcription factors, which are important for development, oncogenesis, apoptosis, and transcription repression. We cloned the POZ domain transcription factor, FBI-1, that recognizes the cis-element (bp -38 to -22) located just upstream of the core Sp1 binding sites (bp -22 to +22) of the ADH5/FDH minimal promoter (bp -38 to +61) in vitro and in vivo, as revealed by electrophoretic mobility shift assay and chromatin immunoprecipitation assay. The ADH5/FDH minimal promoter is potently repressed by the FBI-1. Glutathione S-transferase fusion protein pull-down showed that the POZ domains of FBI-1, Plzf, and Bcl-6 directly interact with the zinc finger DNA binding domain of Sp1. DNase I footprinting assays showed that the interaction prevents binding of Sp1 to the GC boxes of the ADH5/FDH promoter. Gal4-POZ domain fusions targeted proximal to the GC boxes repress transcription of the Gal4 upstream activator sequence-Sp1-adenovirus major late promoter. Our data suggest that POZ domain represses transcription by interacting with Sp1 zinc fingers and by interfering with the DNA binding activity of Sp1.
Zhao, Tao; Liu, Ran; Ding, Xiaofan; Zhao, Juncai; Yu, Haixiang; Wang, Lei; Xu, Qing; Wang, Xuan; Lou, Xinhui; He, Miao; Xiao, Yi
2015-08-04
It is quite challenging to improve the binding affinity of antismall molecule aptamers. We report that the binding affinity of anticocaine split aptamer pairs improved by up to 66-fold by gold nanoparticles (AuNP)-attached aptamers due to the substantially increased local concentration of aptamers and multiple and simultaneous ligand interactions. The significantly improved binding affinity enables the detection of small molecule targets with unprecedented sensitivity, as demonstrated in nanoprobe-enhanced split aptamer-based electrochemical sandwich assays (NE-SAESA). NE-SAESA replaces the traditional molecular reporter probe with AuNPs conjugated to multiple reporter probes. The increased binding affinity allowed us to use 1,000-fold lower reporter probe concentrations relative to those employed in SAESA. We show that the near-elimination of background in NE-SAESA effectively improves assay sensitivity by ∼1,000-100,000-fold for ATP and cocaine detection, relative to equivalent SAESA. With the ongoing development of new strategies for the selection of aptamers, we anticipate that our sensor platform should offer a generalizable approach for the high-sensitivity detection of diverse targets. More importantly, we believe that NE-SAESA represents a novel strategy to improve the binding affinity between a small molecule and its aptamer and potentially can be extended to other detection platforms.
Inhibition of HMGA2 binding to DNA by netropsin
Miao, Yi; Cui, Tengjiao; Leng, Fenfei; Wilson, W. David
2008-01-01
The design of small synthetic molecules that can be used to affect gene expression is an area of active interest for development of agents in therapeutic and biotechnology applications. Many compounds that target the minor groove in AT sequences in DNA are well characterized and are promising reagents for use as modulators of protein-DNA complexes. The mammalian high mobility group transcriptional factor, HMGA2, also targets the DNA minor groove and plays critical roles in disease processes from cancer to obesity. Biosensor-surface plasmon resonance methods were used to monitor HMGA2 binding to target sites on immobilized DNA and a competition assay for inhibition of the HMGA2-DNA complex was designed. HMGA2 binds strongly to the DNA through AT hook domains with KD values of 20 - 30 nM depending on the DNA sequence. The well-characterized minor groove binder, netropsin, was used to develop and test the assay. The compound has two binding sites in the protein-DNA interaction sequence and this provides an advantage for inhibition. An equation for analysis of results when the inhibitor has two binding sites in the biopolymer recognition surface is presented with the results. The assay provides a platform for discovery of HMGA2 inhibitors. PMID:18023407
Tung, Tran Thanh; Nagaosa, Kaz; Fujita, Yu; Kita, Asana; Mori, Hiroki; Okada, Ryo; Nonaka, Saori; Nakanishi, Yoshinobu
2013-05-01
The membrane phospholipid phosphatidylserine is exposed on the cell surface during apoptosis and acts as an eat-me signal in the phagocytosis of apoptotic cells in mammals and nematodes. However, whether this is also true in insects was unclear. When milk fat globule-epidermal growth factor 8, a phosphatidylserine-binding protein of mammals, was ectopically expressed in Drosophila, the level of phagocytosis was reduced, whereas this was not the case for the same protein lacking a domain responsible for the binding to phosphatidylserine. We found that the extracellular region of Draper, an engulfment receptor of Drosophila, binds to phosphatidylserine in an enzyme-linked immunosorbent assay-like solid-phase assay and in an assay for surface plasmon resonance. A portion of Draper containing domains EMI and NIM located close to the N-terminus was required for binding to phosphatidylserine, and a Draper protein lacking this region was not active in Drosophila. Finally, the level of tyrosine-phosphorylated Draper, indicative of the activation of Draper, in a hemocyte-derived cell line was increased after treatment with phosphatidylserine-containing liposome. These results indicated that phosphatidylserine serves as an eat-me signal in the phagocytic removal of apoptotic cells in Drosophila and that Draper is a phosphatidylserine-binding receptor for phagocytosis.
NASA Astrophysics Data System (ADS)
Wang, Xing; Zhang, Yuxin; Yang, Ying; Wu, Xia; Fan, Hantian; Qiao, Yanjiang
2017-03-01
Thrombin acts as a key enzyme in the blood coagulation cascade and represents a potential drug target for the treatment of several cardiovascular diseases. The aim of this study was to identify small-molecule direct thrombin inhibitors from herbs used in traditional Chinese medicine (TCM). A pharmacophore model and molecular docking were utilized to virtually screen a library of chemicals contained in compositions of traditional Chinese herbs, and these analyses were followed by in vitro bioassay validation and binding studies. Berberine (BBR) was first confirmed as a thrombin inhibitor using an enzymatic assay. The BBR IC50 value for thrombin inhibition was 2.92 μM. Direct binding studies using surface plasmon resonance demonstrated that BBR directly interacted with thrombin with a KD value of 16.39 μM. Competitive binding assay indicated that BBR could bind to the same argartroban/thrombin interaction site. A platelet aggregation assay demonstrated that BBR had the ability to inhibit thrombin-induced platelet aggregation in washed platelets samples. This study proved that BBR is a direct thrombin inhibitor that has activity in inhibiting thrombin-induced platelet aggregation. BBR may be a potential candidate for the development of safe and effective thrombin-inhibiting drugs.
High-throughput screening and mechanism-based evaluation of estrogenic botanical extracts
Overk, Cassia R.; Yao, Ping; Chen, Shaonong; Deng, Shixing; Imai, Ayano; Main, Matthew; Schinkovitz, Andreas; Farnsworth, Norman R.; Pauli, Guido F.; Bolton, Judy L.
2009-01-01
Symptoms associated with menopause can greatly affect the quality of life for women. Botanical dietary supplements have been viewed by the public as safe and effective despite a lack of evidence indicating a urgent necessity to standardize these supplements chemically and biologically. Seventeen plants were evaluated for estrogenic biological activity using standard assays: competitive estrogen receptor (ER) binding assay for both alpha and beta subtypes, transient transfection of the estrogen response element luciferase plasmid into MCF-7 cells expressing either ER alpha or ER beta, and the Ishikawa alkaline phosphatase induction assay for both estrogenic and antiestrogenic activities. Based on the combination of data pooled from these assays, the following was determined: a) a high rate of false positive activity for the competitive binding assays, b) some extracts had estrogenic activity despite a lack of ability to bind the ER, c) one extract exhibited selective estrogen receptor modulator (SERM) activity, and d) several extracts show additive/synergistic activity. Taken together, these data indicate a need to reprioritize the order in which the bioassays are performed for maximal efficiency of programs involving bioassay-guided fractionation. In addition, possible explanations for the conflicts in the literature over the estrogenicity of Cimicifuga racemosa (black cohosh) are suggested. PMID:18473738
Ni, Y; Nesrallah, J; Agnew, M; Geske, F J; Favaloro, E J
2013-01-01
Introduction Laboratory diagnosis of von Willebrand disease (VWD) requires determination of both von Willebrand factor (VWF) protein levels and activity. Current VWF activity tests include the ristocetin cofactor assay and the collagen-binding assay (VWF:CB). The goal of this investigation is to characterize a new collagen-binding assay and to determine its effectiveness in identifying VWD. Methods Analytical studies were carried out to characterize the performance of a new VWF:CB ELISA. Additionally, samples from a normal population were tested as were well-characterized type 1 and type 2 VWD samples. Results Repeatability and within-laboratory precision studies resulted in coefficients of variation (CVs) of ≤11%. A linear range of 1–354% (0.01–3.54 IU/mL) was determined, along with a limit of detection and a lower limit of quantitation of 1.6% and 4.0% (0.016 and 0.04 IU/mL), respectively. Samples tested from apparently healthy individuals resulted in a normal range of 54–217% (0.54–2.17 IU/mL). Known VWD type 1 and type 2 samples were also analyzed by the ELISA, with 99% of samples having VWF:CB below the normal reference range and an estimated 96% sensitivity and 87% specificity using a VWF collagen-binding/antigen cutoff ratio of 0.50. Conclusion This new VWF:CB ELISA provides an accurate measure of collagen-binding activity that aids in the diagnosis and differentiation of type 1 from type 2 VWD. PMID:23107512
Wolf, Gabriele; Hessabi, Behnam; Karkour, Anke; Henrion, Ulrike; Dahlhaus, Meike; Ostmann, Annett; Giese, Bernd; Fraunholz, Martin; Grabarczyk, Piotr; Jack, Robert; Walther, Reinhard
2010-01-01
The transcriptional transactivator Pax6 binds the pancreatic islet cell-specific enhancer sequence (PISCES) of the rat insulin I gene. However the human, mouse, and rat insulin gene II promoters do not contain a PISCES element. To analyze the role of Pax6 in those PISCES-less promoters, we investigated its influence on rat insulin gene II expression and included in our studies the main activators: pancreatic and duodenal homeobox protein-1 (PDX-1) and BETA2/E47. Luciferase assays, Northern blots, and RIA were used to study effects of Pax6 overexpression, gel shift and chromatin precipitation assays to study its binding to the DNA, and yeast two-hybrid assays and glutathione S transferase capture assays to investigate its interactions with PDX-1 and BETA2. Finally, glucose-dependent intracellular transport of Pax6 was demonstrated by fluorescence microscopy. Overexpression of Pax6 prevents activation of the rat insulin II gene by BETA2 and PDX-1 and hence suppresses insulin synthesis and secretion. In vitro, Pax6 binds to the A-boxes, thereby blocking binding of PDX-1, and at the same time, its paired domain interacts with BETA2. Fluorescence microscopy demonstrated that the nuclear-cytoplasmic localization of Pax6 and PDX-1 are oppositely regulated by glucose. From the results, it is suggested that at low concentrations of glucose, Pax6 is localized in the nucleus and prevents the activation of the insulin gene by occupying the PDX-1 binding site and by interacting with BETA2. PMID:20943817
Agglutination Assays of the Plasmodium falciparum-Infected Erythrocyte.
Tan, Joshua; Bull, Peter C
2015-01-01
The agglutination assay is used to determine the ability of antibodies to recognize parasite variant antigens on the surface of Plasmodium falciparum-infected erythrocytes. In this technique, infected erythrocytes are selectively labelled with a DNA-binding fluorescent dye and mixed with antibodies of interest to allow antibody-surface antigen binding. Recognition of surface antigens by the antibodies can result in the formation of agglutinates containing multiple parasite-infected erythrocytes. These can be viewed and quantified using a fluorescence microscope.
Meng, Q.; Li, M.; Silberg, M.A.; Conrad, F.; Bettencourt, J.; To, R.; Huang, C.; Ma, J.; Meyer, K.; Shimizu, R.; Cao, L.; Tomic, M.T.; Marks, J.D.
2014-01-01
Quantitation of individual mAbs within a combined antibody drug product is required for preclinical and clinical drug development including pharmacokinetics (PK), toxicology, stability and biochemical characterization studies of such drugs. We have developed an antitoxin (XOMA 3AB) consisting of three recombinant monoclonal antibodies (mAbs) that potently neutralizes the known subtypes of type A botulinum neurotoxin (BoNT/A). The three mAbs bind non-overlapping BoNT/A epitopes with high affinity. XOMA3AB is being developed as a treatment for botulism resulting from BoNT/A. To develop antibody-specific assays, we cloned, expressed, and purified BoNT/A domains from E. coli. Each mAb bound only to its specific domain with affinity comparable to the binding to holotoxin. MAb specific domains were used to develop an ELISA for characterization of the integrity and binding activity of the three mAbs in the drug product. An electrochemiluminescence bridging assay was also developed that is robust to interference from components in serum and we demonstrate that it can be used for PK assays. This type of antigen engineering to generate mAb-specific domains is a general method allowing quantitation and characterization of individual mAbs in a mAb cocktail that bind the same protein and is superior to anti-idiotype approaches. PMID:22037290
De Silva, Channa R.; Vagner, Josef; Lynch, Ronald; Gillies, Robert J.; Hruby, Victor J.
2010-01-01
Lanthanide-based luminescent ligand binding assays are superior to traditional radiolabel assays due to improved sensitivity and affordability in high throughput screening while eliminating the use of radioactivity. Despite significant progress using lanthanide(III)-coordinated chelators such as DTPA derivatives, dissociation-enhanced lanthanide fluoroimmunoassays (DELFIA) have not yet been successfully used with more stable chelators, e.g. DOTA derivatives, due to the incomplete release of lanthanide(III) ions from the complex. Here, a modified and an optimized DELFIA procedure incorporating an acid treatment protocol is introduced for use with Eu(III)-DOTA labeled peptides. Complete release of Eu(III) ions from DOTA labeled ligands was observed using hydrochloric acid (2.0 M) prior to the luminescent enhancement step. NDP-α-MSH labeled with Eu(III)-DOTA was synthesized and the binding affinity to cells overexpressing the human melanocortin-4 receptors (hMC4R) was evaluated using the modified protocol. Binding data indicate that the Eu(III)-DOTA linked peptide bound to these cells with an affinity similar to its DTPA analogue. The modified DELFIA procedure was further used to monitor the binding of an Eu(III)-DOTA labeled heterobivalent peptide to the cells expressing both hMC4R and CCK-2 (Cholecystokinin) receptors. The modified assay provides superior results and is appropriate for high-throughput screening of ligand libraries. PMID:19852924
miR-128 modulates chemosensitivity and invasion of prostate cancer cells through targeting ZEB1.
Sun, Xianglun; Li, Youkong; Yu, Jie; Pei, Hong; Luo, Pengcheng; Zhang, Jie
2015-05-01
Recent reports strongly suggest the profound role of miRNAs in cancer therapeutic response and progression, including invasion and metastasis. The sensitivity to therapy and invasion is the major obstacle for successful treatment in prostate cancer. We aimed to investigate the regulative effect of miR-128/zinc-finger E-box-binding homeobox 1 axis on prostate cancer cell chemosensitivity and invasion. The miR-128 expression pattern of prostate cancer cell lines and tissues was detected by real-time reverse transcriptase-polymerase chain reaction, while the mRNA and protein expression levels of zinc-finger E-box-binding homeobox 1 were measured by real-time reverse transcriptase-polymerase chain reaction and western blot assay, respectively. Dual-luciferase reporter gene assay was used to find the direct target of miR-128. Furthermore, prostate cancer cells were treated with miR-128 mimic or zinc-finger E-box-binding homeobox 1-siRNA, and then the cells' chemosensitivity and invasion were detected by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay and transwell assay, respectively. We found miR-128 expression obviously decreased in prostate cancer tissues compared with paired normal tissues. Restored miR-128 expression sensitized prostate cancer cells to cisplatin and inhibited the invasion. Furthermore, there was an inverse expression pattern between miR-128 and zinc-finger E-box-binding homeobox 1 in prostate cancer cells and tissues, and zinc-finger E-box-binding homeobox 1 was identified as a direct target of miR-128 in prostate cancer. Knockdown of zinc-finger E-box-binding homeobox 1 expression efficiently sensitized prostate cancer cells to cisplatin and inhibited the invasion. However, ectopic zinc-finger E-box-binding homeobox 1 expression impaired the effects of miR-128 on chemosensitivity and invasion in prostate cancer cells. miR-128 functions as a potential cancer suppressor in prostate cancer progression and rational therapeutic strategies for prostate cancer would be developed based on miR-128/zinc-finger E-box-binding homeobox 1 axis. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
NASA Astrophysics Data System (ADS)
Lin, Hong; Kitova, Elena N.; Klassen, John S.
2014-01-01
Direct electrospray ionization mass spectrometry (ESI-MS) assay was used to investigate the stepwise binding of the GM1 pentasaccharide β- D-Gal p-(1→3)-β-D-Gal pNAc-(1→4)[α-D-Neu5Ac-(2→3)]-β- D-Gal p-(1→4)-β-D-Glc p (GM1os) to the cholera toxin B subunit homopentamer (CTB5) and to establish conclusively whether GM1os binding is cooperative. Apparent association constants were measured for the stepwise addition of one to five GM1os to CTB5 at pH 6.9 and 22 °C. The intrinsic association constant, which was established from the apparent association constant for the addition of a single GM1os to CTB5, was found to be (3.2 ± 0.2) × 106 M-1. This is in reasonable agreement with the reported value of (6.4 ± 0.3) × 106 M-1, which was measured at pH 7.4 and 25 °C using isothermal titration calorimetry (ITC). Analysis of the apparent association constants provides direct and unambiguous evidence that GM1os binding exhibits small positive cooperativity. Binding was found to be sensitive to the number of ligand-bound nearest neighbor subunits, with the affinities enhanced by a factor of 1.7 and 2.9 when binding occurs next to one or two ligand-bound subunits, respectively. These findings, which provide quantitative support for the binding model proposed by Homans and coworkers [14], highlight the unique strengths of the direct ESI-MS assay for measuring cooperative ligand binding.
Estrogenicity of halogenated bisphenol A: in vitro and in silico investigations.
Zhang, Jie; Li, Tiezhu; Wang, Tuoyi; Yuan, Cuiping; Zhong, Shuning; Guan, Tianzhu; Li, Zhuolin; Wang, Yongzhi; Yu, Hansong; Luo, Quan; Wang, Yongjun; Zhang, Tiehua
2018-03-01
The binding interactions of bisphenol A (BPA) and its halogenated derivatives (halogenated BPAs) to human estrogen receptor α ligand binding domain (hERα-LBD) was investigated using a combined in vitro and in silico approach. First, the recombinant hERα-LBD was prepared as a soluble protein in Escherichia coli BL21(DE3)pLysS. A native fluorescent phytoestrogen, coumestrol, was employed as tracer for the fluorescence polarization assay. The results of the in vitro binding assay showed that bisphenol compounds could bind to hERα-LBD as the affinity ligands. All the tested halogenated BPAs exhibited weaker receptor binding than BPA, which might be explained by the steric effect of substituents. Molecular docking studies elucidated that the halogenated BPAs adopted different conformations in the flexible hydrophobic ligand binding pocket (LBP), which is mainly dependent on their distinct halogenation patterns. The compounds with halogen substituents on the phenolic rings and on the bridging alkyl moiety acted as agonists and antagonists for hERα, respectively. Interestingly, all the compounds in the agonist conformation of hERα formed a hydrogen bond with His524, while the compounds in the antagonist conformation formed a hydrogen bond with Thr347. These docking results suggested a pivotal role of His524/Thr347 in maintaining the hERα structure in the biologically active agonist/antagonist conformation. Comparison of the calculated binding energies vs. experimental binding affinities yielded a good correlation, which might be applicable for the structure-based design of novel bisphenol compounds with reduced toxicities and for environmental risk assessment. In addition, based on hERα-LBD as a recognition element, the proposed fluorescence polarization assay may offer an alternative to chromatographic techniques for the multi-residue determination of bisphenol compounds.
The development of a predictive model based upon a single aquatic species inevitably raises the question of whether this information is valid for other species. To partially address this question, relative binding affinities (RBA) for six alkylphenols (para-substituted, n- and b...
Alpert, Michael D.; Heyer, Lisa N.; Williams, David E. J.; Harvey, Jackson D.; Greenough, Thomas; Allhorn, Maria
2012-01-01
The resistance of human immunodeficiency virus type 1 (HIV-1) to antibody-mediated immunity often prevents the detection of antibodies that neutralize primary isolates of HIV-1. However, conventional assays for antibody functions other than neutralization are suboptimal. Current methods for measuring the killing of virus-infected cells by antibody-dependent cell-mediated cytotoxicity (ADCC) are limited by the number of natural killer (NK) cells obtainable from individual donors, donor-to-donor variation, and the use of nonphysiological targets. We therefore developed an ADCC assay based on NK cell lines that express human or macaque CD16 and a CD4+ T-cell line that expresses luciferase from a Tat-inducible promoter upon HIV-1 or simian immunodeficiency virus (SIV) infection. NK cells and virus-infected targets are mixed in the presence of serial plasma dilutions, and ADCC is measured as the dose-dependent loss of luciferase activity. Using this approach, ADCC titers were measured in plasma samples from HIV-infected human donors and SIV-infected macaques. For the same plasma samples paired with the same test viruses, this assay was approximately 2 orders of magnitude more sensitive than optimized assays for neutralizing antibodies—frequently allowing the measurement of ADCC in the absence of detectable neutralization. Although ADCC correlated with other measures of Env-specific antibodies, neutralizing and gp120 binding titers did not consistently predict ADCC activity. Hence, this assay affords a sensitive method for measuring antibodies capable of directing ADCC against HIV- or SIV-infected cells expressing native conformations of the viral envelope glycoprotein and reveals incomplete overlap of the antibodies that direct ADCC and those measured in neutralization and binding assays. PMID:22933282
Darwish, Ibrahim A; Al-Obaid, Abdul-Rahman M; Al-Malaq, Hamoud A
2009-11-15
For the first time, an enzyme-linked immunosorbent assay (ELISA) has been developed and validated for the determination of fluvastatin (FLV) in plasma samples at picogram level. The assay employed a polyclonal antibody that specifically recognizes FLV with high affinity, and FLV conjugate of bovine serum albumin (FLV-BSA) immobilized onto microplate wells as a solid-phase. The assay involved a competitive binding reaction between FLV, in plasma sample, and the immobilized FLV-BSA for the binding sites on a limited amount of the anti-FLV antibody. The bound anti-FLV antibody was quantified with horseradish peroxidase-labeled second anti-rabbit IgG antibody (HRP-IgG) and 3,3',5,5'-tetramethylbenzidine (TMB) as a substrate for the peroxidase enzyme. The concentration of FLV in the sample was quantified by its ability to inhibit the binding of the anti-FLV antibody to the immobilized FLV-BSA and subsequently the color intensity in the assay wells. The conditions for the proposed ELISA were investigated and the optimum conditions were employed in the determination of FLV in plasma samples. The assay limit of detection was 10 pg mL(-1) and the effective working range at relative standard deviations (RSD) of
76 FR 4920 - Government-Owned Inventions; Availability for Licensing
Federal Register 2010, 2011, 2012, 2013, 2014
2011-01-27
... appear to be distinct from each other. Available for licensing is a Plk1 ELISA assay using peptide... binding property, an easy and reliable ELISA assay has been developed to quantify Plk1 expression levels... sequence. ELISA assay to quantify Plk1 expression and kinase activity. Advantages: Rapid, highly sensitive...
Edwards, Katie A; Baeumner, Antje J
2013-03-05
A periplasmic binding protein (PBP) was investigated as a novel binding species in a similar manner to an antibody in a competitive enzyme linked immunosorbent assay (ELISA), resulting in a highly sensitive and specific assay utilizing liposome-based signal amplification. PBPs are located at high concentrations (10(-4) M) between the inner and outer membranes of gram negative bacteria and are involved in the uptake of solutes and chemotaxis of bacteria toward nutrient sources. Previous sensors relying on PBPs took advantage of the change in local environment or proximity of site-specific fluorophore labels resulting from the significant conformational shift of these proteins' two globular domains upon target binding. Here, rather than monitoring conformational shifts, we have instead utilized the maltose binding protein (MBP) in lieu of an antibody in an ELISA. To our knowledge, this is the first PBP-based sensor without the requirement for engineering site-specific modifications within the protein. MBP conjugated fluorescent dye-encapsulating liposomes served to provide recognition and signal amplification in a competitive assay for maltose using amylose magnetic beads in a microtiter plate-based format. The development of appropriate binding buffers and competitive surfaces are described, with general observations expected to extend to PBPs for other analytes. The resulting assay was specific for d-(+)-maltose versus other sugar analogs including d-(+)-raffinose, sucrose, d-trehalose, d-(+)-xylose, d-fructose, 1-thio-β-d-glucose sodium salt, d-(+)-galactose, sorbitol, glycerol, and dextrose. Cross-reactivity with d-lactose and d-(+)-glucose occurred only at concentrations >10(4)-fold greater than d-(+)-maltose. The limit of detection was 78 nM with a dynamic range covering over 3 orders of magnitude. Accurate detection of maltose as an active ingredient in a pharmaceutical preparation was demonstrated. This method offers a significant improvement over existing enzymatic detection approaches that cannot discriminate between maltose and glucose and over existing fluorescence resonance energy transfer (FRET)-based detection methods that are sensitivity limited. In addition, it opens up a new strategy for the development of biosensors to difficult analytes refractory to immunological detection.
DOE Office of Scientific and Technical Information (OSTI.GOV)
ARIMURA, A.; SATO, H.; KUMASAKA, T.
1973-11-01
Repeated injections of synthetic LH -- RH decapeptide, adsorbed on polyvinylpyrrolidone and emulsified with complete Freund's adjuvant, resulted in the production of a specific antiserum to LH-- RH in two of three rabbits. The animals that produced this antiserum showed a reduction of pituitary LH content and marked atrophy of the testes. The antiserum-antibody complex was detected by the complement flxation test. The antiserum was capable of binding /sup 125/I- labeled LH--RH. After iodination of LHRH (using /sup 125/I and either the chloramine T or lactoperoxidase method) separation of the iodination products on CMC yielded three main peaks of radioactivity:more » The first was free iodide, the second was labeled peptide with low immunoreactivity, and the third was immunoreactive peptide. This 3rd peak consisted of two or three subpeaks; the leading subpeak(s) were more readily bound by antiserum than the trailing one(s). Binding of these fractions to antiserum was increased in the presence of small amounts of unlabeled LH--RH (a phenomenon called paradoxical binding or hock effect) but inhibited by larger amounts. Both the augmentation and the inhibition effects were dose-related, allowing the development of two different radioimmunoassay (RIA) systems for LH--RH. An ordinary (coinpetitive) type of RIA was developed in which a small amount (0.31 ng/assay tube) of unlabeled LH-- RH was added to the labeled peptide. This saturated the antiserum's capacity for paradoxical binding, so that further addition of LH-- RH (from 0.04 to 2.5 ng/ tube) inhibited binding of labeled LH--RH. The assay developed using paradoxical binding omitted the premixing of labeled and unlabeled LH--RH; in this assay addition of very small amounts (0.5 to 310 pg) of unlabeled LH--RH to the assay tubes increased the amount of label bound to antiserum and allowed construction of a parabolic curve of positive slope when B/T was plotted against arithmetic dose. The assays seem to be highly specific for LH--RH although both polymers and degradation products of LH--RH appeared to have some immunoreactivity.« less
Dimeric PROP1 binding to diverse palindromic TAAT sequences promotes its transcriptional activity.
Nakayama, Michie; Kato, Takako; Susa, Takao; Sano, Akiko; Kitahara, Kousuke; Kato, Yukio
2009-08-13
Mutations in the Prop1 gene are responsible for murine Ames dwarfism and human combined pituitary hormone deficiency with hypogonadism. Recently, we reported that PROP1 is a possible transcription factor for gonadotropin subunit genes through plural cis-acting sites composed of AT-rich sequences containing a TAAT motif which differs from its consensus binding sequence known as PRDQ9 (TAATTGAATTA). This study aimed to verify the binding specificity and sequence of PROP1 by applying the method of SELEX (Systematic Evolution of Ligands by EXponential enrichment), EMSA (electrophoretic mobility shift assay) and transient transfection assay. SELEX, after 5, 7 and 9 generations of selection using a random sequence library, showed that nucleotides containing one or two TAAT motifs were accumulated and accounted for 98.5% at the 9th generation. Aligned sequences and EMSA demonstrated that PROP1 binds preferentially to 11 nucleotides composed of an inverted TAAT motif separated by 3 nucleotides with variation in the half site of palindromic TAAT motifs and with preferential requirement of T at the nucleotide number 5 immediately 3' to a TAAT motif. Transient transfection assay demonstrated first that dimeric binding of PROP1 to an inverted TAAT motif and its cognates resulted in transcriptional activation, whereas monomeric binding of PROP1 to a single TAAT motif and an inverted ATTA motif did not mediate activation. Thus, this study demonstrated that dimeric binding of PROP1 is able to recognize diverse palindromic TAAT sequences separated by 3 nucleotides and to exhibit its transcriptional activity.
Parker, Lauren; Wharton, Stephen A; Martin, Stephen R; Cross, Karen; Lin, Yipu; Liu, Yan; Feizi, Ten; Daniels, Rodney S; McCauley, John W
2016-06-01
Influenza A virus (subtype H3N2) causes seasonal human influenza and is included as a component of influenza vaccines. The majority of vaccine viruses are isolated and propagated in eggs, which commonly results in amino acid substitutions in the haemagglutinin (HA) glycoprotein. These substitutions can affect virus receptor-binding and alter virus antigenicity, thereby, obfuscating the choice of egg-propagated viruses for development into candidate vaccine viruses. To evaluate the effects of egg-adaptive substitutions seen in H3N2 vaccine viruses on sialic acid receptor-binding, we carried out quantitative measurement of virus receptor-binding using surface biolayer interferometry with haemagglutination inhibition (HI) assays to correlate changes in receptor avidity with antigenic properties. Included in these studies was a panel of H3N2 viruses generated by reverse genetics containing substitutions seen in recent egg-propagated vaccine viruses and corresponding cell culture-propagated wild-type viruses. These assays provide a quantitative approach to investigating the importance of individual amino acid substitutions in influenza receptor-binding. Results show that viruses with egg-adaptive HA substitutions R156Q, S219Y, and I226N, have increased binding avidity to α2,3-linked receptor-analogues and decreased binding avidity to α2,6-linked receptor-analogues. No measurable binding was detected for the viruses with amino acid substitution combination 156Q+219Y and receptor-binding increased in viruses where egg-adaptation mutations were introduced into cell culture-propagated virus. Substitutions at positions 156 and 190 appeared to be primarily responsible for low reactivity in HI assays with post-infection ferret antisera raised against 2012-2013 season H3N2 viruses. Egg-adaptive substitutions at position 186 caused substantial differences in binding avidity with an insignificant effect on antigenicity.
Lee, Donald W.; Hsu, Hung-Lun; Bacon, Kaitlyn B.; Daniel, Susan
2016-01-01
With the development of single-particle tracking (SPT) microscopy and host membrane mimics called supported lipid bilayers (SLBs), stochastic virus-membrane binding interactions can be studied in depth while maintaining control over host receptor type and concentration. However, several experimental design challenges and quantitative image analysis limitations prevent the widespread use of this approach. One main challenge of SPT studies is the low signal-to-noise ratio of SPT videos, which is sometimes inevitable due to small particle sizes, low quantum yield of fluorescent dyes, and photobleaching. These situations could render current particle tracking software to yield biased binding kinetic data caused by intermittent tracking error. Hence, we developed an effective image restoration algorithm for SPT applications called STAWASP that reveals particles with a signal-to-noise ratio of 2.2 while preserving particle features. We tested our improvements to the SPT binding assay experiment and imaging procedures by monitoring X31 influenza virus binding to α2,3 sialic acid glycolipids. Our interests lie in how slight changes to the peripheral oligosaccharide structures can affect the binding rate and residence times of viruses. We were able to detect viruses binding weakly to a glycolipid called GM3, which was undetected via assays such as surface plasmon resonance. The binding rate was around 28 folds higher when the virus bound to a different glycolipid called GD1a, which has a sialic acid group extending further away from the bilayer surface than GM3. The improved imaging allowed us to obtain binding residence time distributions that reflect an adhesion-strengthening mechanism via multivalent bonds. We empirically fitted these distributions using a time-dependent unbinding rate parameter, koff, which diverges from standard treatment of koff as a constant. We further explain how to convert these models to fit ensemble-averaged binding data obtained by assays such as surface plasmon resonance. PMID:27695072
Kinetic Analyses of Data from a Human Serum Albumin Assay Using the liSPR System.
Henseleit, Anja; Pohl, Carolin; Kaltenbach, Hans-Michael; Hettwer, Karina; Simon, Kirsten; Uhlig, Steffen; Haustein, Natalie; Bley, Thomas; Boschke, Elke
2015-01-19
We used the interaction between human serum albumin (HSA) and a high-affinity antibody to evaluate binding affinity measurements by the bench-top liSPR system (capitalis technology GmbH). HSA was immobilized directly onto a carboxylated sensor layer, and the mechanism of interaction between the antibody and HSA was investigated. The bivalence and heterogeneity of the antibody caused a complex binding mechanism. Three different interaction models (1:1 binding, heterogeneous analyte, bivalent analyte) were compared, and the bivalent analyte model best fit the curves obtained from the assay. This model describes the interaction of a bivalent analyte with one or two ligands (A + L ↔ LA + L ↔ LLA). The apparent binding affinity for this model measured 37 pM for the first reaction step, and 20 pM for the second step.
Kinetic Analyses of Data from a Human Serum Albumin Assay Using the liSPR System
Henseleit, Anja; Pohl, Carolin; Kaltenbach, Hans-Michael; Hettwer, Karina; Simon, Kirsten; Uhlig, Steffen; Haustein, Natalie; Bley, Thomas; Boschke, Elke
2015-01-01
We used the interaction between human serum albumin (HSA) and a high-affinity antibody to evaluate binding affinity measurements by the bench-top liSPR system (capitalis technology GmbH). HSA was immobilized directly onto a carboxylated sensor layer, and the mechanism of interaction between the antibody and HSA was investigated. The bivalence and heterogeneity of the antibody caused a complex binding mechanism. Three different interaction models (1:1 binding, heterogeneous analyte, bivalent analyte) were compared, and the bivalent analyte model best fit the curves obtained from the assay. This model describes the interaction of a bivalent analyte with one or two ligands (A + L ↔ LA + L ↔ LLA). The apparent binding affinity for this model measured 37 pM for the first reaction step, and 20 pM for the second step. PMID:25607476
NASA Astrophysics Data System (ADS)
Blank, K.; Mai, T.; Gilbert, I.; Schiffmann, S.; Rankl, J.; Zivin, R.; Tackney, C.; Nicolaus, T.; Spinnler, K.; Oesterhelt, F.; Benoit, M.; Clausen-Schaumann, H.; Gaub, H. E.
2003-09-01
A parallel assay for the quantification of single-molecule binding forces was developed based on differential unbinding force measurements where ligand-receptor interactions are compared with the unzipping forces of DNA hybrids. Using the DNA zippers as molecular force sensors, the efficient discrimination between specific and nonspecific interactions was demonstrated for small molecules binding to specific receptors, as well as for protein-protein interactions on protein arrays. Finally, an antibody sandwich assay with different capture antibodies on one chip surface and with the detection antibodies linked to a congruent surface via the DNA zippers was used to capture and quantify a recombinant hepatitis C antigen from solution. In this case, the DNA zippers enable not only discrimination between specific and nonspecific binding, but also allow for the local application of detection antibodies, thereby eliminating false-positive results caused by cross-reactive antibodies and nonspecific binding.
Nishio, Shunsuke; Kohno, Yoshinori; Iwata, Yuki; Arai, Mayumi; Okumura, Hiroki; Oshima, Kenzi; Nadano, Daita; Matsuda, Tsukasa
2014-11-01
Vertebrate eggs are surrounded by an egg coat, which is a specific extracellular egg matrix consisting of several glycoproteins with a conserved zona pellucida (ZP) domain. Two mammalian egg coat subunits, ZP2 and ZP3, have been suggested to act as sperm receptors. In bird eggs, however, ZP2 has never been identified in the egg coat of mature oocytes and ovulated eggs. Here we report that chicken ZP2 is expressed in immature small follicles and remains as an egg-coat component locally in the germinal disc region of mature eggs. RT-PCR analysis indicated marked expression of the ZP2 and ZP4 genes in the granulosa cells of immature white follicles, whereas the ZP3 and ZPD genes showed marked expression in the cells of maturing yellow follicles. ZP2 was identified in the egg coat isolated from immature follicles as a heavily N-glycosylated glycoprotein of ∼200 kDa, which was enzymatically converted to a 70-kDa deglycosylated form. Immunoblotting and immunohistological analyses showed that ZP2 was localized around the germinal disc region of mature follicles. ZP2 was accumulated in the egg coat of immature white follicles at the earlier stages of oocyte development and became a minor component in the egg coat of maturing yellow follicles, except for the germinal disc region. Localization of ZP2 in the germinal disc region of mature eggs, where sperm bind to the egg coat at high density, suggests some role for ZP2 in the preferential binding and penetration of sperm in the germinal disc region of bird eggs. © 2014 by the Society for the Study of Reproduction, Inc.
Cofilin is correlated with sperm quality and influences sperm fertilizing capacity in humans.
Chen, S M; Chen, X M; Lu, Y L; Liu, B; Jiang, M; Ma, Y X
2016-11-01
Spermatozoa should undergo a series of biochemical modifications in female reproduction tract, which is collectively called sperm capacitation. The capacitated spermatozoa can bind to the egg zona pellucida, resulting in the occurrence of acrosome reaction which enabled spermatozoa penetrate into the egg. The formation of actin plays an important role in these processes. Actin polymerized during sperm capacitation, but the polymers dispersed before acrosome reaction. In this study, we take our focus on actin-binding protein, cofilin. Our results showed that the % and intensity of sperm expressing cofilin in normal sperm were significantly higher than in abnormal sperm, and the sperm expressing cofilin was correlated with sperm quality. Furthermore, treatment with anti-cofilin antibody increased the percentage of sperm capacitation and inhibited progesterone- or A23187- induced acrosome reaction in a dose-dependent manner. The presence of 100 ng/mL anti-cofilin antibodies markedly blocked the sperm penetration of zona-free hamster eggs. Besides, immunofluorescence results revealed that cofilin was colocalized with F-actin in the midpiece of spermatozoa; however, phospho-cofilin was expressed in the tail rather than in the midpiece of spermatozoa, which was not colocalized with F-actin in spermatozoa. Moreover, western blot revealed that phospho-cofilin increased in sperm capacitation, and the total cofilin and cofilin in insoluble fraction increased in acrosome reaction; immunofluorescence results showed that the amount of cofilin in acrosome increased in sperm capacitation. In conclusion, our study revealed that cofilin expression in human sperm is correlated with sperm quality and the alterations of cofilin and phospho-cofilin in fertilization affects sperm capacitation, acrosome reaction, and spermatozoa-oocyte fusion. © 2016 American Society of Andrology and European Academy of Andrology.
Oocyte Activation and Fertilisation: Crucial Contributors from the Sperm and Oocyte.
Yeste, Marc; Jones, Celine; Amdani, Siti Nornadhirah; Coward, Kevin
2017-01-01
This chapter intends to summarise the importance of sperm- and oocyte-derived factors in the processes of sperm-oocyte binding and oocyte activation. First, we describe the initial interaction between sperm and the zona pellucida, with particular regard to acrosome exocytosis. We then describe how sperm and oocyte membranes fuse, with special reference to the discovery of the sperm protein IZUMO1 and its interaction with the oocyte membrane receptor JUNO. We then focus specifically upon oocyte activation, the fundamental process by which the oocyte is alleviated from metaphase II arrest by a sperm-soluble factor. The identity of this sperm factor has been the source of much debate recently, although mounting evidence, from several different laboratories, provides strong support for phospholipase C ζ (PLCζ), a sperm-specific phospholipase. Herein, we discuss the evidence in support of PLCζ and evaluate the potential role of other candidate proteins, such as post-acrosomal WW-binding domain protein (PAWP/WBP2NL). Since the cascade of downstream events triggered by the sperm-borne oocyte activation factor heavily relies upon specialised cellular machinery within the oocyte, we also discuss the critical role of oocyte-borne factors, such as the inositol trisphosphate receptor (IP 3 R), protein kinase C (PKC), store-operated calcium entry (SOCE) and calcium/calmodulin-dependent protein kinase II (CaMKII), during the process of oocyte activation. In order to place the implications of these various factors and processes into a clinical context, we proceed to describe their potential association with oocyte activation failure and discuss how clinical techniques such as the in vitro maturation of oocytes may affect oocyte activation ability. Finally, we contemplate the role of artificial oocyte activating agents in the clinical rescue of oocyte activation deficiency and discuss options for more endogenous alternatives.
Hanaue, Mayu; Miwa, Naofumi; Uebi, Tatsuya; Fukuda, Yusuke; Katagiri, Yukiko; Takamatsu, Ken
2011-02-01
We recently found that Xenopus dicalcin, present in the extracellular egg-coating envelope, suppresses the efficiency of fertilization in vitro through binding to envelope-constituent glycoproteins. In the present study, we explored the mouse counterpart of Xenopus dicalcin, specifically its localization in the female reproductive tract and its action on mouse fertilization. Our homology and phylogenetic analyses using known S100 proteins showed that S100A11 is most closely related to Xenopus dicalcin. S100A11 was localized in the cytosol of luteal cells, but not in the follicle, in the mouse ovary, and also in the cytosol of the oviductal epithelial cells. In addition, our quantitative analyses revealed preferential expression of S100A11 in the ampullary region of the oviduct and at the estrus stage during the mouse estrous cycle. In the cumulus cell-oocyte complex dissected from the oviduct following ovulation, S100A11 was present in the plasma membrane of cumulus cells, but not in the zona pellucida, which is comparable with Ca(2+) -dependent binding of exogenously applied S100A11 to the plasma membrane of cumulus cells. Pretreatment of the cumulus cell-oocyte complex with recombinant S100A11 substantially reduced the efficiency of in vitro fertilization, but S100A10, the next closest S100 protein to Xenopus dicalcin, had no effect. These results suggested that S100A11 is the mouse counterpart of Xenopus dicalcin, suppresses the fertilization process through its action on cumulus cells, and thereby plays a key role in fertilization success in the mouse. Copyright © 2010 Wiley-Liss, Inc.
What Do Chaotrope-Based Avidity Assays for Antibodies to HIV-1 Envelope Glycoproteins Measure?
Alexander, Marina R.; Ringe, Rajesh; Sanders, Rogier W.; Voss, James E.; Moore, John P.
2015-01-01
ABSTRACT When HIV-1 vaccine candidates that include soluble envelope glycoproteins (Env) are tested in humans and other species, the resulting antibody responses to Env are sifted for correlates of protection or risk. One frequently used assay measures the reduction in antibody binding to Env antigens by an added chaotrope (such as thiocyanate). Based on that assay, an avidity index was devised for assessing the affinity maturation of antibodies of unknown concentration in polyclonal sera. Since a high avidity index was linked to protection in animal models of HIV-1 infection, it has become a criterion for evaluating antibody responses to vaccine candidates. But what does the assay measure and what does an avidity index mean? Here, we have used a panel of monoclonal antibodies to well-defined epitopes on Env (gp120, gp41, and SOSIP.664 trimers) to explore how the chaotrope acts. We conclude that the chaotrope sensitivity of antibody binding to Env depends on several properties of the epitopes (continuity versus tertiary- and quaternary-structural dependence) and that the avidity index has no simple relationship to antibody affinity for functional Env spikes on virions. We show that the binding of broadly neutralizing antibodies against quaternary-structural epitopes is particularly sensitive to chaotrope treatment, whereas antibody binding to epitopes in variable loops and to nonneutralization epitopes in gp41 is generally resistant. As a result of such biases, the avidity index may at best be a mere surrogate for undefined antibody or other immune responses that correlate weakly with protection. IMPORTANCE An effective HIV-1 vaccine is an important goal. Such a vaccine will probably need to induce antibodies that neutralize typically transmitted variants of HIV-1, preventing them from infecting target cells. Vaccine candidates have so far failed to induce such antibody responses, although some do protect weakly against infection in animals and, possibly, humans. In the search for responses associated with protection, an avidity assay based on chemical disruption is often used to measure the strength of antibody binding. We have analyzed this assay mechanistically and found that the epitope specificity of an antibody has a greater influence on the outcome than does its affinity. As a result, the avidity assay is biased toward the detection of some antibody specificities while disfavoring others. We conclude that the assay may yield merely indirect correlations with weak protection, specifically when Env vaccination has failed to induce broad neutralizing responses. PMID:25810537
Fernández-Sierra, Mónica; Quiñones, Edwin
2015-03-15
Here we characterize the fluorescence of the YOYO dye as a tool for studying DNA-protein interactions in real time and present two continuous YOYO-based assays for sensitively monitoring the kinetics of DNA digestion by λ-exonuclease and the endonuclease EcoRV. The described assays rely on the different fluorescence intensities between single- and double-stranded DNA-YOYO complexes, allowing straightforward determination of nuclease activity and quantitative determination of reaction products. The assays were also employed to assess the effect of single-stranded DNA-binding proteins on the λ-exonuclease reaction kinetics, showing that the extreme thermostable single-stranded DNA-binding protein (ET-SSB) significantly reduced the reaction rate, while the recombination protein A (RecA) displayed no effect. Copyright © 2015 Elsevier Inc. All rights reserved.
Schwartz, F; Hadas, E; Harnik, M; Solomon, B
1990-01-01
Two enzyme-linked immunosorbent assays were established and compared for the estimation of plasma aldosterone. In the first method immobilized aldosterone-protein complexes on the ELISA plates compete with aldosterone to be determined for the binding of certain amount of anti-aldosterone antibodies. The sensitivity of this method depends on the protein carrier used to conjugate with aldosterone. In the second method, anti-aldosterone antibodies adsorbed on ELISA plates compete for binding of known amount of the enzyme-labeled aldosterone and aldosterone to be determined. The highly specific rabbit anti-aldosterone antibodies were obtained by injection of aldosterone-oxime thyroglobulin. The detection limit of aldosterone in both methods ranged between 2-20 pg. The proposed assays are suitable for the determination of aldosterone in biological fluids compared with other reported ELISA assays, as well as with RIA.
Production and assay of forskolin antibodies
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ho, L.T.; Ho, R.J.
1986-05-01
Forskolin (Fo), a cardiovascular active diterpene of plant origin, has been widely used as a research tool in regulation of the catalytic activity of adenylate cyclase (AC). A linear relationship of Fo binding to plasma membrane with activation of AC has been reported. The present abstract describes the production and assay of Fo antibodies (AB). 7-0-Hemisuccinyl-7-deacetyl Fo, coupled to either human serum albumin or goat IgG, was injected into goats to elicit AB to Fo haptan. AB to Fo in antiserum or an isolated IgG fraction was tested by two assay methods, a radioimmunoassay using /sup 3/H-Fo as a tracermore » and a colorimetric enzyme-linked immunosorbent assay (ELISA) using horse radish peroxidase-rabbit anti goat IgG as indicator. The titers for Fo antiserum were 4000-10,000. In the defined assay condition, approximately 20-25% of the added /sup 3/H-Fo was found to bind to AB. The bound radioactivity was displaced by Fo-HSA or Fo-goat IgG or free unlabelled Fo ranging from 0.5-50 pmol/tube, or 5-500 nM. The IC/sub 50/ was approximately 8-10 pmol/tube or 80-100 nM. The binding of HRP-rabbit anti goat IgG in the ELISA was inhibited by proper Fo conjugate. The development of methods for production and assay for Fo AB may be useful in the study of mechanism of activation of AC by Fo and Fo-like compound.« less
Guo, Dong; Mulder-Krieger, Thea; IJzerman, Adriaan P; Heitman, Laura H
2012-01-01
BACKGROUND AND PURPOSE The adenosine A2A receptor belongs to the superfamily of GPCRs and is a promising therapeutic target. Traditionally, the discovery of novel agents for the A2A receptor has been guided by their affinity for the receptor. This parameter is determined under equilibrium conditions, largely ignoring the kinetic aspects of the ligand-receptor interaction. The aim of this study was to assess the binding kinetics of A2A receptor agonists and explore a possible relationship with their functional efficacy. EXPERIMENTAL APPROACH We set up, validated and optimized a kinetic radioligand binding assay (a so-called competition association assay) at the A2A receptor from which the binding kinetics of unlabelled ligands were determined. Subsequently, functional efficacies of A2A receptor agonists were determined in two different assays: a novel label-free impedance-based assay and a more traditional cAMP determination. KEY RESULTS A simplified competition association assay yielded an accurate determination of the association and dissociation rates of unlabelled A2A receptor ligands at their receptor. A correlation was observed between the receptor residence time of A2A receptor agonists and their intrinsic efficacies in both functional assays. The affinity of A2A receptor agonists was not correlated to their functional efficacy. CONCLUSIONS AND IMPLICATIONS This study indicates that the molecular basis of different agonist efficacies at the A2A receptor lies within their different residence times at this receptor. PMID:22324512
Metal-amplified Density Assays, (MADAs), including a Density-Linked Immunosorbent Assay (DeLISA).
Subramaniam, Anand Bala; Gonidec, Mathieu; Shapiro, Nathan D; Kresse, Kayleigh M; Whitesides, George M
2015-02-21
This paper reports the development of Metal-amplified Density Assays, or MADAs - a method of conducting quantitative or multiplexed assays, including immunoassays, by using Magnetic Levitation (MagLev) to measure metal-amplified changes in the density of beads labeled with biomolecules. The binding of target analytes (i.e. proteins, antibodies, antigens) to complementary ligands immobilized on the surface of the beads, followed by a chemical amplification of the binding in a form that results in a change in the density of the beads (achieved by using gold nanoparticle-labeled biomolecules, and electroless deposition of gold or silver), translates analyte binding events into changes in density measureable using MagLev. A minimal model based on diffusion-limited growth of hemispherical nuclei on a surface reproduces the dynamics of the assay. A MADA - when performed with antigens and antibodies - is called a Density-Linked Immunosorbent Assay, or DeLISA. Two immunoassays provided a proof of principle: a competitive quantification of the concentration of neomycin in whole milk, and a multiplexed detection of antibodies against Hepatitis C virus NS3 protein and syphilis T. pallidum p47 protein in serum. MADAs, including DeLISAs, require, besides the requisite biomolecules and amplification reagents, minimal specialized equipment (two permanent magnets, a ruler or a capillary with calibrated length markings) and no electrical power to obtain a quantitative readout of analyte concentration. With further development, the method may be useful in resource-limited or point-of-care settings.
Wyant, Tim; Estevam, Jose; Yang, Lili; Rosario, Maria
2016-03-01
Vedolizumab is a monoclonal antibody approved for use in ulcerative colitis and Crohn's disease. By specifically binding to α4 β7 integrin, vedolizumab prevents trafficking of lymphocytes to the gut, thereby interfering with disease pathology. During the clinical development program, the pharmacodynamic effect of vedolizumab was evaluated by 2 flow cytometry receptor occupancy assays: act-1 (ACT-1) and mucosal addressin cell adhesion molecule-1 (MAdCAM-1). Here we describe the development and validation of these assays. The ACT-1 assay is a receptor occupancy free-site assay that uses a monoclonal antibody with the same binding epitope as vedolizumab to detect free (unbound) sites on α4 β7 integrin. The MAdCAM-1 assay used a soluble version of the natural ligand for α4 β7 integrin to detect free sites. The assays were validated using a fit-for-purpose approach throughout the clinical development of vedolizumab. Both the ACT-1 assay and the MAdCAM-1 assay demonstrated acceptable reproducibility and repeatability. The assays were sufficiently stable to allow for clinical use. During clinical testing the assays demonstrated that vedolizumab was able to saturate peripheral cells at all doses tested. Two pharmacodynamic receptor occupancy assays were developed and validated to assess the effect of vedolizumab on peripheral blood cells. The results of these assays demonstrated the practical use of flow cytometry to examine pharmacodynamic response in clinical trials. © 2015 International Clinical Cytometry Society.
Krasitskaya, V V; Korneeva, S I; Kudryavtsev, A N; Markova, S V; Stepanyuk, G A; Frank, L A
2011-11-01
The recombinant Ca(2+)-triggered coelenterazine-binding protein (CBP) from Renilla muelleri was investigated as a biospecifically labeled molecule for in vitro assay applications. The protein was shown to be stable in solutions in the frozen state, as well as stable under heating and to chemical modifications. Conjugates with biotin, oligonucleotide, and proteins were obtained and applied as biospecific molecules in a solid-phase microassay. CBP detection was performed with intact (no modifications were made) Renilla luciferase in the presence of calcium, and the detection limit was found to be 75 amol. Model experiments indicate that this approach shows much promise, especially with regard to the development of multianalytical systems.
Beta-Endorphin: dissociation of receptor binding activity from analgesic potency.
Li, C H; Tseng, L F; Ferrara, P; Yamashiro, D
1980-04-01
Biological activities of synthetic camel beta-endorphin and human beta-endorphin (beta h-EP) have been measured by the radioreceptor binding assay, using [Tyr27-3H]-beta h-EP as the primary ligand and by the tail-flick test for analgesic potency. Four synthetic analogs of beta h-EP, namely [Gly31]-beta h-EP-Gly-NH2, [Gly31]-beta h-EP-Gly-Gly-NH2, [Gln8,Gly31]-beta h-EP-Gly-Gly-NH2, and [CH3(CH2)4NH231]-beta h-EP, have also been assayed by the same procedures. Results indicate a clear dissociation of radioreceptor binding activity from analgesic potency.
Beta-Endorphin: dissociation of receptor binding activity from analgesic potency.
Li, C H; Tseng, L F; Ferrara, P; Yamashiro, D
1980-01-01
Biological activities of synthetic camel beta-endorphin and human beta-endorphin (beta h-EP) have been measured by the radioreceptor binding assay, using [Tyr27-3H]-beta h-EP as the primary ligand and by the tail-flick test for analgesic potency. Four synthetic analogs of beta h-EP, namely [Gly31]-beta h-EP-Gly-NH2, [Gly31]-beta h-EP-Gly-Gly-NH2, [Gln8,Gly31]-beta h-EP-Gly-Gly-NH2, and [CH3(CH2)4NH231]-beta h-EP, have also been assayed by the same procedures. Results indicate a clear dissociation of radioreceptor binding activity from analgesic potency. PMID:6246537
Le Saux, Thomas; Hisamoto, Hideaki; Terabe, Shigeru
2006-02-03
Measurement of binding constant by chip electrophoresis is a very promising technique for the high throughput screening of non-covalent interactions. Among the different electrophoretic methods available that yield the binding parameters, continuous frontal analysis is the most appropriate for a transposition from capillary electrophoresis (CE) to microchip electrophoresis. Implementation of this methodology in microchip was exemplified by the measurement of inclusion constants of 2-naphtalenesulfonate and neutral phenols (phenol, 4-chlorophenol and 4-nitrophenol) into beta-cyclodextrin by competitive assays. The issue of competitor choice is discussed in relation to its appropriateness for proper monitoring of the interaction.
Koh, Chung-Yan; Piccini, Matthew E.; Singh, Anup K.
2017-09-19
Examples are described including measurement systems for conducting competition assays. A first chamber of an assay device may be loaded with a sample containing a target antigen. The target antigen in the sample may be allowed to bind to antibody-coated beads in the first chamber. A control layer separating the first chamber from a second chamber may then be opened to allow a labeling agent loaded in a first portion of the second chamber to bind to any unoccupied sites on the antibodies. A centrifugal force may then be applied to transport the beads through a density media to a detection region for measurement by a detection unit.
Koh, Chung-Yan; Piccini, Matthew E.; Singh, Anup K.
2017-07-11
Examples are described including measurement systems for conducting competition assays. A first chamber of an assay device may be loaded with a sample containing a target antigen. The target antigen in the sample may be allowed to bind to antibody-coated beads in the first chamber. A control layer separating the first chamber from a second chamber may then be opened to allow a labeling agent loaded in a first portion of the second chamber to bind to any unoccupied sites on the antibodies. A centrifugal force may then be applied to transport the beads through a density media to a detection region for measurement by a detection unit.
Talbot, Prue; Lin, Sabrina
2011-01-01
Numerous studies have repeatedly shown that women who smoke experience problems establishing and maintaining pregnancies, and recent work has further demonstrated that the in utero effects of smoke may not be manifested until months or even years after birth. The purpose of this review is to examine the recent literature dealing with the effects of cigarette smoke on the earliest stages of human prenatal development. Studies in this area have included the use of animal models, patients undergoing in vitro fertilization, and embryonic stem cell models. Events leading to fertilization, such as cumulus expansion, hyperactivation of sperm motility, and oocyte pick-up by the oviduct are all impaired by smoke exposure in animal models. Steps crucial to fertilization such as the acrosome reaction and sperm binding to the zona pellucida are likewise inhibited by cigarette smoke. Preimplantation embryos and stem cells that model embryos show a number of adverse responses to smoke exposure, including poor adhesion to extracellular matrices, diminished survival and proliferation, and increased apoptosis. The current literature demonstrates that the earliest stages of prenatal development are sensitive to smoke exposure and indicates that pregnant women should be advised not to smoke during this time.
Zhou, Yu S; Webb, Sheila; Lettice, Laura; Tardif, Steve; Kilanowski, Fiona; Tyrrell, Christine; Macpherson, Heather; Semple, Fiona; Tennant, Peter; Baker, Tina; Hart, Alan; Devenney, Paul; Perry, Paul; Davey, Tracey; Barran, Perdita; Barratt, Chris L; Dorin, Julia R
2013-10-01
β-defensin peptides are a family of antimicrobial peptides present at mucosal surfaces, with the main site of expression under normal conditions in the male reproductive tract. Although they kill microbes in vitro and interact with immune cells, the precise role of these genes in vivo remains uncertain. We show here that homozygous deletion of a cluster of nine β-defensin genes (DefbΔ9) in the mouse results in male sterility. The sperm derived from the mutants have reduced motility and increased fragility. Epididymal sperm isolated from the cauda should require capacitation to induce the acrosome reaction but sperm from the mutants demonstrate precocious capacitation and increased spontaneous acrosome reaction compared to wild-types but have reduced ability to bind the zona pellucida of oocytes. Ultrastructural examination reveals a defect in microtubule structure of the axoneme with increased disintegration in mutant derived sperm present in the epididymis cauda region, but not in caput region or testes. Consistent with premature acrosome reaction, sperm from mutant animals have significantly increased intracellular calcium content. Thus we demonstrate in vivo that β-defensins are essential for successful sperm maturation, and their disruption leads to alteration in intracellular calcium, inappropriate spontaneous acrosome reaction and profound male infertility.
Zhou, Yu S.; Webb, Sheila; Lettice, Laura; Tardif, Steve; Kilanowski, Fiona; Tyrrell, Christine; MacPherson, Heather; Semple, Fiona; Tennant, Peter; Baker, Tina; Hart, Alan; Devenney, Paul; Perry, Paul; Davey, Tracey; Barran, Perdita; Barratt, Chris L.; Dorin, Julia R.
2013-01-01
β-defensin peptides are a family of antimicrobial peptides present at mucosal surfaces, with the main site of expression under normal conditions in the male reproductive tract. Although they kill microbes in vitro and interact with immune cells, the precise role of these genes in vivo remains uncertain. We show here that homozygous deletion of a cluster of nine β-defensin genes (DefbΔ9) in the mouse results in male sterility. The sperm derived from the mutants have reduced motility and increased fragility. Epididymal sperm isolated from the cauda should require capacitation to induce the acrosome reaction but sperm from the mutants demonstrate precocious capacitation and increased spontaneous acrosome reaction compared to wild-types but have reduced ability to bind the zona pellucida of oocytes. Ultrastructural examination reveals a defect in microtubule structure of the axoneme with increased disintegration in mutant derived sperm present in the epididymis cauda region, but not in caput region or testes. Consistent with premature acrosome reaction, sperm from mutant animals have significantly increased intracellular calcium content. Thus we demonstrate in vivo that β-defensins are essential for successful sperm maturation, and their disruption leads to alteration in intracellular calcium, inappropriate spontaneous acrosome reaction and profound male infertility. PMID:24204287
Farkona, Sofia; Soosaipillai, Antoninus; Filippou, Panagiota; Korbakis, Dimitrios; Serra, Stefano; Rückert, Felix; Diamandis, Eleftherios P; Blasutig, Ivan M
2017-12-01
CUB and zona pellucida-like domain-containing protein 1 (CUZD1) was identified as a pancreas-specific protein and was proposed as a candidate biomarker for pancreatic related disorders. CUZD1 protein levels in tissues and biological fluids have not been extensively examined. The purpose of the present study was to generate specific antibodies targeting CUZD1 to assess CUZD1 expression within tissues and biological fluids. Mouse monoclonal antibodies against CUZD1 were generated and used to perform immunohistochemical analyses and to develop a sensitive and specific enzyme-linked immunosorbent assay (ELISA). CUZD1 protein expression was assessed in various human tissue extracts and biological fluids and in gel filtration chromatography-derived fractions of pancreatic tissue extract, pancreatic juice and recombinant protein. Immunohistochemical staining of CUZD1 in pancreatic tissue showed that the protein is localized to the acinar cells and the lumen of the acini. Western blot analysis detected the protein in pancreatic tissue extract and pancreatic juice. The newly developed ELISA measured CUZD1 in high levels in pancreas and in much lower but detectable levels in several other tissues. In the biological fluids tested, CUZD1 expression was detected exclusively in pancreatic juice. The analysis of gel filtration chromatography-derived fractions of pancreatic tissue extract, pancreatic juice and recombinant CUZD1 suggested that the protein exists in high molecular weight protein complexes. This study describes the development of tools targeting CUZD1 protein, its tissue expression pattern and levels in several biological fluids. These new tools will facilitate future investigations aiming to delineate the role of CUZD1 in physiology and pathobiology. Copyright © 2017 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.
Detection of molecular interactions
Groves, John T [Berkeley, CA; Baksh, Michael M [Fremont, CA; Jaros, Michal [Brno, CH
2012-02-14
A method and assay are described for measuring the interaction between a ligand and an analyte. The assay can include a suspension of colloidal particles that are associated with a ligand of interest. The colloidal particles are maintained in the suspension at or near a phase transition state from a condensed phase to a dispersed phase. An analyte to be tested is then added to the suspension. If the analyte binds to the ligand, a phase change occurs to indicate that the binding was successful.
Targeting the UPR to Circumvent Endocrine Resistance in Breast Cancer
2015-10-01
were submitted for the screen. Kinase assay protocol (DiscoverX): For most assays, kinase-tagged T7 phage strains were grown in parallel in 24-well...blocks in an E. coli host derived from the BL21 strain. E. coli were grown to log-phase and infected with T7 phage from a frozen stock (multiplicity of...unbound ligand and to reduce non-specific phage binding. Binding reactions were assembled by combining kinases, liganded affinity beads, and test
Udby, Lene; Bjartell, Anders; Malm, Johan; Egesten, Arne; Lundwall, Ake; Cowland, Jack B; Borregaard, Niels; Kjeldsen, Lars
2005-01-01
Mammalian members of the cysteine-rich secretory protein (CRISP) family are expressed predominantly in the male reproductive tract and are implicated in the process of reproduction from spermiogenesis, posttesticular sperm maturation, and capacitation to oocyte-sperm fusion, and possibly also penetration of the zona pellucida. Rodents express only 2 CRISPs (CRISP-1 and CRISP-2) in their male reproductive system, whereas humans and horses express an additional third member named CRISP-3. We have previously demonstrated that this protein is present in human seminal plasma as well as in other exocrine secretions, in blood plasma, and in neutrophilic granulocytes. To characterize the protein in seminal plasma and localize the production of CRISP-3 in the human male reproductive tract, we performed immunoblotting and enzyme-linked immunosorbent assay measurements of seminal plasma and immunohistochemistry and in situ hybridization of tissue specimens. We were able to show that human CRISP-3 is a quantitatively minor seminal plasma protein not associated with prostasomes. Furthermore, CRISP-3 expression was found in the secretory epithelium throughout the male genital tract, with particularly high expression in the cauda epididymis and ampulla vas deferens. Examination of seminal plasma from vasectomized males indicates that organs downstream of the epididymis are probably the major sources of seminal plasma CRISP-3.
Putta, Priya; Rankenberg, Johanna; Korver, Ruud A; van Wijk, Ringo; Munnik, Teun; Testerink, Christa; Kooijman, Edgar E
2016-11-01
Phosphatidic acid (PA) is a crucial membrane phospholipid involved in de novo lipid synthesis and numerous intracellular signaling cascades. The signaling function of PA is mediated by peripheral membrane proteins that specifically recognize PA. While numerous PA-binding proteins are known, much less is known about what drives specificity of PA-protein binding. Previously, we have described the ionization properties of PA, summarized in the electrostatic-hydrogen bond switch, as one aspect that drives the specific binding of PA by PA-binding proteins. Here we focus on membrane curvature stress induced by phosphatidylethanolamine and show that many PA-binding proteins display enhanced binding as a function of negative curvature stress. This result is corroborated by the observation that positive curvature stress, induced by lyso phosphatidylcholine, abolishes PA binding of target proteins. We show, for the first time, that a novel plant PA-binding protein, Arabidopsis Epsin-like Clathrin Adaptor 1 (ECA1) displays curvature-dependence in its binding to PA. Other established PA targets examined in this study include, the plant proteins TGD2, and PDK1, the yeast proteins Opi1 and Spo20, and, the mammalian protein Raf-1 kinase and the C2 domain of the mammalian phosphatidylserine binding protein Lact as control. Based on our observations, we propose that liposome binding assays are the preferred method to investigate lipid binding compared to the popular lipid overlay assays where membrane environment is lost. The use of complex lipid mixtures is important to elucidate further aspects of PA binding proteins. Copyright © 2016. Published by Elsevier B.V.
SivaRaman, L; Subramanian, S; Thimmappaya, B
1986-01-01
Utilizing the gel electrophoresis/DNA binding assay, a factor specific for the upstream transcriptional control sequence of the EIA-inducible adenovirus EIIA-early promoter has been detected in HeLa cell nuclear extract. Analysis of linker-scanning mutants of the promoter by DNA binding assays and methylation-interference experiments show that the factor binds to the 17-nucleotide sequence 5' TGGAGATGACGTAGTTT 3' located between positions -66 and -82 upstream from the cap site. This sequence has been shown to be essential for transcription of this promoter. The EIIA-early-promoter specific factor was found to be present at comparable levels in uninfected HeLa cells and in cells infected with either wild-type adenovirus or the EIA-deletion mutant dl312 under conditions in which the EIA proteins are induced to high levels [7 or 20 hr after infection in the presence of arabinonucleoside (cytosine arabinoside)]. Based on the quantitation in DNA binding assays, it appears that the mechanism of EIA-activated transcription of the EIIA-early promoter does not involve a net change in the amounts of this factor. Images PMID:2942943
Expression and purification of RHC-EGFP fusion protein and its application in hyaluronic acid assay.
Duan, Ningjun; Lv, Wansheng; Zhu, Lingli; Zheng, Weijuan; Hua, Zichun
2017-03-16
Hyaluronan is a widely distributed glycosaminoglycan which has multiple functions. Hyaluronic acid (HA) accumulation has been reported in many human diseases. Understanding the role of hyaluronan and its binding proteins in the pathobiology of disease will facilitate the development of novel therapeutics for many critical diseases. Current techniques described for the analysis of HA are mainly for HA quantification in solutions, not for the direct detection of HA in tissues or on cell surfaces. In our study, a fusion protein, named C-terminal domain of RHAMM-enhanced green fluorescence protein (RHC-EGFP), combined the HA-binding domain, C-terminal of receptor for hyaluronan-mediated motility, with EGFP, a widely used enhanced green fluorescence protein, was expressed and purified from Escherichia coli with high purity. Based on the sensitivity and convenience of fluorescence detection, methods for direct assay of HA in solutions, on cell surface or in tissues were established using RHC-EGFP. The binding specificity was also confirmed by competitive binding experiment and hyaluronidase degradation experiment. Our results provide an alternative choice for the specific and convenient assay of HA in various samples, and maybe helpful for further understanding of the fundamental and comprehensive functions of HA.
Effects of Vitrification on Outcomes of In Vivo-Mature, In Vitro-Mature and Immature Human Oocytes.
Song, Wen-Yan; Peng, Zhao-Feng; Chen, Xue-Mei; Jin, Hai-Xia; Yao, Gui-Dong; Shi, Sen-Lin; Yang, Hong-Yi; Zhang, Xiang-Yang; Sun, Ying-Pu
2016-01-01
To observe the effects of vitrification on spindle, zona pellucida, embryonic aneuploidy and DNA injury in in vivo-maruted, in vitro-mature and immature human oocytes. Between January 2009 and February 2015, 223 immature oocytes from 450 infertile patients, and 31 in vivo-mature oocytes from 3 infertile couples were collected. Of the 223 immature oocytes, 113 were used for in vitro culture before vitrification. Some oocytes were randomly divided into in vivo-mature group (group A, n = 15), in vitro-mature group (group B, n = 88) and immature group (group C, n = 85), and then the oocytes with spindle in these three groups after freezing-thawing were selected to use for Polscope imaging, embryonic aneuploidy screening and embryo development evaluation. Other oocytes were randomly divided into group A (n = 16), group B (n = 25) and group C (n = 25) for detecting DNA injury. After thawing, spindle occurrence rate, spindle Retardance value, and cleavage rate were significantly higher in groups A and B than in group C (all P < 0.05), but there were no statistical differences in fertility rate, high-quality embryo rate, blastulation rate and aneuploidy rate amongst the three groups (all P > 0.05). Zona pellucida density (ZPD) was significantly lower in group A than in groups B and C both before and after vitrification (all P < 0.05). ZPD was significantly higher after thawing than before vitrification (all P < 0.05), but zona pellucida thickness (ZPT) was not significantly changed in all the three groups (all P > 0.05). Rate of comet cells was significantly lower in group A than in groups B and C (all P < 0.01). Comet tail was significantly longer in group C than in groups B and A (all P < 0.05). In vivo- and in vitro-mature human oocytes are more suitable to vitrification than immature human oocytes. Spindle Retardance value has more predictive value for embryonic development potential than ZPD and ZPT. © 2016 The Author(s) Published by S. Karger AG, Basel.
Schepp, Rutger M; Berbers, Guy A M; Ferreira, José A; Reimerink, Johan H; van der Klis, Fiona R
2017-03-01
Large-scale serosurveillance or vaccine studies for poliovirus using the "gold standard" WHO neutralisation test (NT) are very laborious and time consuming. With the polio eradication at hand and with the removal of live attenuated Sabin strains from the oral poliovirus vaccine (OPV), starting with type 2 (as of April 2016), laboratories will need to conform to much more stringent laboratory biosafety regulations when handling live poliovirus strains. In this study, a poliovirus binding inhibition multiplex immunoassay (polio MIA) using inactivated poliovirus vaccine (IPV-Salk) was developed for simultaneous quantification of serum antibodies directed to all three poliovirus types. Our assay shows a good correlation with the NT and an excellent correlation with the ELISA-based binding inhibition assay (POBI). The assay is highly type-specific and reproducible. Additionally, serum sample throughput increases about fivefold relative to NT and POBI and the amount of serum needed is reduced by more than 90%. In conclusion, the polio MIA can be used as a safe and high throughput application, especially for large-scale surveillance and vaccine studies, reducing laboratory time and serum amounts needed. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Caselli, G.; Ferrari, M.P.; Tonon, G.
1991-02-01
A sensitive method for the quantitation of small amounts of nuvenzepine, a new M1-selective antimuscarinic drug, in plasma is described. The analytical method involves the use of a radioreceptor binding assay based on {sup 3}Hpirenzepine displacement in rat cerebral cortex homogenates; no previous extraction is required. The method is reliable, with an interassay CV ranging from 5 to 10%, and allows the analysis of greater than 100 samples/experiment. The limit of detection is {approximately} 0.1 ng/assay. Using this method we have determined the plasma levels of nuvenzepine in eight healthy volunteers treated PO with 15 or 25 mg of nuvenzepine.HCl.more » The pharmacokinetic parameters obtained were (for 15 and 25 mg): Cmax, 64 and 131 ng/mL; AUC0-infinity, 851 and 1379 ng.h/mL; t1/2, 8.6 and 7.2 h. These values are in good agreement with those obtained using an HPLC method. Therefore, this radioreceptor binding assay proved to be simple, rapid, and specific for the determination of low levels of nuvenzepine in human plasma.« less
Identification of a p53-response element in the promoter of the proline oxidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-05-02
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less
Acetylcholinesterase affinity-based screening assay on Lippia gracilis Schauer extracts.
Vanzolini, K L; da F Sprenger, R; Leme, G M; de S Moraes, V R; Vilela, A F L; Cardoso, C L; Cass, Q B
2018-05-10
The use of affinity-based protein assay produced by covalently linking acetylcholinesterase to magnetic beads, followed by chemical characterization of the selective binders using Liquid Chromatography with tandem High-Resolution Mass Spectrometry (LC-HRMS) is herein described for profiling crude aqueous natural product extracts. The fishing assay was first modulated using galanthamine as a reference ligand and then, the assay condition was adjusted for the aqueous leaves extracts obtained from Lippia gracilis Schauer (genotype 201) that was used as the natural combinatory library. From the experiments, a selective binder has been undisclosed with an accurate mass of 449.1131 m/z and identified as eriodictyol 2'-O-glucoside or eriodictyol 3'-O-glucoside. The selectivity of the binding assay was demonstrated, as much as, that erydictiol 7-O-glucoside was not fished, although it was present in the crude aqueous extract. The binding assay platform exhibited high specificity and did not require any sample pretreatment, making it appropriate for profiling binders at natural libraries. Copyright © 2018 Elsevier B.V. All rights reserved.
Quantifying domain-ligand affinities and specificities by high-throughput holdup assay
Vincentelli, Renaud; Luck, Katja; Poirson, Juline; Polanowska, Jolanta; Abdat, Julie; Blémont, Marilyne; Turchetto, Jeremy; Iv, François; Ricquier, Kevin; Straub, Marie-Laure; Forster, Anne; Cassonnet, Patricia; Borg, Jean-Paul; Jacob, Yves; Masson, Murielle; Nominé, Yves; Reboul, Jérôme; Wolff, Nicolas; Charbonnier, Sebastian; Travé, Gilles
2015-01-01
Many protein interactions are mediated by small linear motifs interacting specifically with defined families of globular domains. Quantifying the specificity of a motif requires measuring and comparing its binding affinities to all its putative target domains. To this aim, we developed the high-throughput holdup assay, a chromatographic approach that can measure up to a thousand domain-motif equilibrium binding affinities per day. Extracts of overexpressed domains are incubated with peptide-coated resins and subjected to filtration. Binding affinities are deduced from microfluidic capillary electrophoresis of flow-throughs. After benchmarking the approach on 210 PDZ-peptide pairs with known affinities, we determined the affinities of two viral PDZ-binding motifs derived from Human Papillomavirus E6 oncoproteins for 209 PDZ domains covering 79% of the human PDZome. We obtained exquisite sequence-dependent binding profiles, describing quantitatively the PDZome recognition specificity of each motif. This approach, applicable to many categories of domain-ligand interactions, has a wide potential for quantifying the specificities of interactomes. PMID:26053890
Correnti, Colin; Clifton, Matthew C.; Abergel, Rebecca J.; Allred, Ben; Hoette, Trisha M.; Ruiz, Mario; Cancedda, Ranieri; Raymond, Kenneth N.; Descalzi, Fiorella; Strong, Roland K.
2011-01-01
SUMMARY Galline Ex-FABP was identified as another candidate antibacterial, catecholate siderophore binding lipocalin (siderocalin) based on structural parallels with the family archetype, mammalian Siderocalin. Binding assays show that Ex-FABP retains iron in a siderophore-dependent manner in both hypertrophic and dedifferentiated chondrocytes, where Ex-FABP expression is induced after treatment with proinflammatory agents, and specifically binds ferric complexes of enterobactin, parabactin, bacillibactin and, unexpectedly, monoglucosylated enterobactin, which does not bind to Siderocalin. Growth arrest assays functionally confirm the bacteriostatic effect of Ex-FABP in vitro under iron-limiting conditions. The 1.8Å crystal structure of Ex-FABP explains the expanded specificity, but also surprisingly reveals an extended, multi-chambered cavity extending through the protein and encompassing two separate ligand specificities, one for bacterial siderophores (as in Siderocalin) at one end and one specifically binding co-purified lysophosphatidic acid, a potent cell signaling molecule, at the other end, suggesting Ex-FABP employs dual functionalities to explain its diverse endogenous activities. PMID:22153502
Determining ERβ Binding Affinity to Singly Mutant ERE Using Dual Polarization Interferometry
NASA Astrophysics Data System (ADS)
Song, Hong Yan; Su, Xiaodi
In a classic mode of estrogen action, estrogen receptors (ERs) bind to estrogen responsive element (ERE) to activate gene transcription. A perfect ERE contains a 13-base pair sequence of a palindromic repeat separated by a three-base spacer, 5‧-GGTCAnnnTGACC-3‧. In addition to the consensus or wild-type ERE (wtERE), naturally occurring EREs often have one or two base pairs’ alternation. Based on the newly constructed Thermodynamic Modeling of ChIP-seq (TherMos) model, binding energy between ERβ and a series of 34-bp mutant EREs (mutERE) was simulated to predict the binding affinity between ERs and EREs with single base pair deviation at different sites of the 13-bp inverted sequence. Experimentally, dual polarization interferometry (DPI) method was developed to measure ERβ-mutEREs binding affinity. On a biotin-NeutrAvidin (NA)-biotin treated DPI chip, wtERE is immobilized. In a direct binding assay, ERβ-wtERE binding affinity is determined. In a competition assay, ERβ was preincubated with mutant EREs before being added for competitive binding to the immobilized wtERE. This competition strategy provided a successful platform to evaluate the binding affinity variation among large number of ERE with different base mutations. The experimental result correlates well with the mathematically predicted binding energy with a Spearman correlation coefficient of 0.97.
Exploring blocking assays using Octet, ProteOn, and Biacore biosensors.
Abdiche, Yasmina N; Malashock, Dan S; Pinkerton, Alanna; Pons, Jaume
2009-03-15
We demonstrate the use of label-free real-time optical biosensors in competitive binding assays by epitope binning a panel of antibodies. We describe three assay orientations that we term in tandem, premix, and classical sandwich blocking, and we perform each of them on three platforms: ForteBio's Octet QK, Bio-Rad's ProteOn XPR36, and GE Healthcare's Biacore 3000. By testing whether antibodies block one another's binding to their antigen in a pairwise fashion, we establish a blocking profile for each antibody relative to the others in the panel. The blocking information is then used to create "bins" of antibodies with similar epitopes. The advantages and disadvantages of each biosensor, factors to consider when deciding on the most appropriate blocking assay orientation for a particular interaction system, and tips for dealing with ambiguous data are discussed. The data from our different assay orientations and biosensors agree very well, establishing these machines as valuable tools for characterizing antibody epitopes and multiprotein complexes of biological significance.
Horswill, J G; Bali, U; Shaaban, S; Keily, J F; Jeevaratnam, P; Babbs, A J; Reynet, C; Wong Kai In, P
2007-11-01
Rimonabant (Acomplia, SR141716A), a cannabinoid CB1 receptor inverse agonist, has recently been approved for the treatment of obesity. There are, however, concerns regarding its side effect profile. Developing a CB1 antagonist with a different pharmacological mechanism may lead to a safer alternative. To this end we have screened a proprietary small molecule library and have discovered a novel class of allosteric antagonist at CB1 receptors. Herein, we have characterized an optimized prototypical molecule, PSNCBAM-1, and its hypophagic effects in vivo. A CB1 yeast reporter assay was used as a primary screen. PSNCBAM-1 was additionally characterized in [35S]-GTPgammaS, cAMP and radioligand binding assays. An acute rat feeding model was used to evaluate its effects on food intake and body weight in vivo. In CB1 receptor yeast reporter assays, PSNCBAM-1 blocked the effects induced by agonists such as CP55,940, WIN55212-2, anandamide (AEA) or 2-arachidonoyl glycerol (2-AG). The antagonist characteristics of PSNCBAM-1 were confirmed in [35S]-GTPgammaS binding and cAMP assays and was shown to be non-competitive by Schild analyses. PSNCBAM-1 did not affect CB2 receptors. In radioligand binding assays, PSNCBAM-1 increased the binding of [3H]CP55,940 despite its antagonist effects. In an acute rat feeding model, PSNCBAM-1 decreased food intake and body weight. PSNCBAM-1 exerted its effects through selective allosteric modulation of the CB1 receptor. The acute effects on food intake and body weight induced in rats provide a first report of in vivo activity for an allosteric CB1 receptor antagonist.
Horswill, J G; Bali, U; Shaaban, S; Keily, J F; Jeevaratnam, P; Babbs, A J; Reynet, C; Wong Kai In, P
2007-01-01
Background and purpose: Rimonabant (AcompliaTM, SR141716A), a cannabinoid CB1 receptor inverse agonist, has recently been approved for the treatment of obesity. There are, however, concerns regarding its side effect profile. Developing a CB1 antagonist with a different pharmacological mechanism may lead to a safer alternative. To this end we have screened a proprietary small molecule library and have discovered a novel class of allosteric antagonist at CB1 receptors. Herein, we have characterized an optimized prototypical molecule, PSNCBAM-1, and its hypophagic effects in vivo. Experimental approach: A CB1 yeast reporter assay was used as a primary screen. PSNCBAM-1 was additionally characterized in [35S]-GTPγS, cAMP and radioligand binding assays. An acute rat feeding model was used to evaluate its effects on food intake and body weight in vivo. Key results: In CB1 receptor yeast reporter assays, PSNCBAM-1 blocked the effects induced by agonists such as CP55,940, WIN55212-2, anandamide (AEA) or 2-arachidonoyl glycerol (2-AG). The antagonist characteristics of PSNCBAM-1 were confirmed in [35S]-GTPγS binding and cAMP assays and was shown to be non-competitive by Schild analyses. PSNCBAM-1 did not affect CB2 receptors. In radioligand binding assays, PSNCBAM-1 increased the binding of [3H]CP55,940 despite its antagonist effects. In an acute rat feeding model, PSNCBAM-1 decreased food intake and body weight. Conclusions and implications: PSNCBAM-1 exerted its effects through selective allosteric modulation of the CB1 receptor. The acute effects on food intake and body weight induced in rats provide a first report of in vivo activity for an allosteric CB1 receptor antagonist. PMID:17592509
Lytton, Simon David; Schluter, Anke; Banga, Paul J
2018-06-01
Autoantibodies to the thyrotropin hormone receptor (TSH-R) are directly responsible for the hyperthyroidism in Graves' disease and mediate orbital manifestations in Graves' orbitopathy (otherwise known as thyroid eye disease). These autoantibodies are heterogeneous in their function and collectively referred to as TRAbs. Measurement of TRAbs is clinically important for diagnosis of a variety of conditions and different commercial assays with high sensitivity and specificity are available for diagnostic purposes. This review provides overwhelming evidence that the TRAbs detected in binding assays by mainly the automated electrochemical luminescence immunoassays (ECLIA) do not distinguish TRAbs that stimulate the TSH-R (called TSIs or TSAbs) and TRAbs that just inhibit the binding of TSH without stimulating the TSH-R (called TBAbs). However, TSAbs and TBAbs have divergent pathogenic roles, and depending which fraction predominates cause different clinical symptoms and engender different therapeutic regimen. Therefore, diagnostic distinction of TSAbs and TBAbs is of paramount clinical importance. To date, only bioassays such as the Mc4 TSH-R bioassay (Thyretain TM , Quidel) and the Bridge assay (Immulite 2000, Siemens) can measure TSAbs, with only the former being able to distinguish between TSAbs and TBAbs. On this note, it is strongly recommended to only use the term TSI or TSAb when reporting the results of bioassays, whereas the results of automated TRAb binding assays should be reported as TRAbs (of undetermined functional significance). This review aims to present a technical and analytical account of leading commercial diagnostic methods of anti-TSH-R antibodies, a metaanalysis of their clinical performance and a perspective for the use of cell based TSH-R bioassays in the clinical diagnostics of Graves' disease.
Song, J; Doucette, C; Hanniford, D; Hunady, K; Wang, N; Sherf, B; Harrington, J J; Brunden, K R; Stricker-Krongrad, A
2005-06-01
Target-based high-throughput screening (HTS) plays an integral role in drug discovery. The implementation of HTS assays generally requires high expression levels of the target protein, and this is typically accomplished using recombinant cDNA methodologies. However, the isolated gene sequences to many drug targets have intellectual property claims that restrict the ability to implement drug discovery programs. The present study describes the pharmacological characterization of the human histamine H3 receptor that was expressed using random activation of gene expression (RAGE), a technology that over-expresses proteins by up-regulating endogenous genes rather than introducing cDNA expression vectors into the cell. Saturation binding analysis using [125I]iodoproxyfan and RAGE-H3 membranes revealed a single class of binding sites with a K(D) value of 0.77 nM and a B(max) equal to 756 fmol/mg of protein. Competition binding studies showed that the rank order of potency for H3 agonists was N(alpha)-methylhistamine approximately (R)-alpha- methylhistamine > histamine and that the rank order of potency for H3 antagonists was clobenpropit > iodophenpropit > thioperamide. The same rank order of potency for H3 agonists and antagonists was observed in the functional assays as in the binding assays. The Fluorometic Imaging Plate Reader assays in RAGE-H3 cells gave high Z' values for agonist and antagonist screening, respectively. These results reveal that the human H3 receptor expressed with the RAGE technology is pharmacologically comparable to that expressed through recombinant methods. Moreover, the level of expression of the H3 receptor in the RAGE-H3 cells is suitable for HTS and secondary assays.
Flavonoid Regulation of HCN2 Channels*
Carlson, Anne E.; Rosenbaum, Joel C.; Brelidze, Tinatin I.; Klevit, Rachel E.; Zagotta, William N.
2013-01-01
The hyperpolarization-activated cyclic nucleotide-modulated (HCN) channels are pacemaker channels whose currents contribute to rhythmic activity in the heart and brain. HCN channels open in response to hyperpolarizing voltages, and the binding of cAMP to their cyclic nucleotide-binding domain (CNBD) facilitates channel opening. Here, we report that, like cAMP, the flavonoid fisetin potentiates HCN2 channel gating. Fisetin sped HCN2 activation and shifted the conductance-voltage relationship to more depolarizing potentials with a half-maximal effective concentration (EC50) of 1.8 μm. When applied together, fisetin and cAMP regulated HCN2 gating in a nonadditive fashion. Fisetin did not potentiate HCN2 channels lacking their CNBD, and two independent fluorescence-based binding assays reported that fisetin bound to the purified CNBD. These data suggest that the CNBD mediates the fisetin potentiation of HCN2 channels. Moreover, binding assays suggest that fisetin and cAMP partially compete for binding to the CNBD. NMR experiments demonstrated that fisetin binds within the cAMP-binding pocket, interacting with some of the same residues as cAMP. Together, these data indicate that fisetin is a partial agonist for HCN2 channels. PMID:24085296
The pig CYP2E1 promoter is activated by COUP-TF1 and HNF-1 and is inhibited by androstenone.
Tambyrajah, Winston S; Doran, Elena; Wood, Jeffrey D; McGivan, John D
2004-11-15
Functional analysis of the pig cytochrome P4502E1 (CYP2E1) promoter identified two major activating elements. One corresponded to the hepatic nuclear factor 1 (HNF-1) consensus binding sequence at nucleotides -128/-98 and the other was located in the region -292/-266. The binding of proteins in pig liver nuclear extracts to a synthetic double-stranded oligonucleotide corresponding to this more distal activating sequence was studied by electrophoretic mobility shift assay. The minimum protein binding sequence was identified as TGTTCTGACCTCTGGG. Gel super-shift assays identified the protein binding to this site as chick ovalbumin upstream promoter transcription factor 1 (COUP-TF1). Androstenone inhibited promoter activity in transfection experiments only with constructs which included the COUP-TF1 binding site. Androstenone inhibited COUP-TF1 binding to synthetic oligonucleotides but did not affect HNF-1 binding. The results offer an explanation for the inhibition of CYP2E1 protein expression by androstenone in isolated pig hepatocytes and may be relevant to the low expression of hepatic CYP2E1 in those pigs which accumulate high levels of androstenone in vivo.
NASA Astrophysics Data System (ADS)
Woods, Christopher J.; Malaisree, Maturos; Long, Ben; McIntosh-Smith, Simon; Mulholland, Adrian J.
2013-12-01
The emergence of a novel H7N9 avian influenza that infects humans is a serious cause for concern. Of the genome sequences of H7N9 neuraminidase available, one contains a substitution of arginine to lysine at position 292, suggesting a potential for reduced drug binding efficacy. We have performed molecular dynamics simulations of oseltamivir, zanamivir and peramivir bound to H7N9, H7N9-R292K, and a structurally related H11N9 neuraminidase. They show that H7N9 neuraminidase is structurally homologous to H11N9, binding the drugs in identical modes. The simulations reveal that the R292K mutation disrupts drug binding in H7N9 in a comparable manner to that observed experimentally for H11N9-R292K. Absolute binding free energy calculations with the WaterSwap method confirm a reduction in binding affinity. This indicates that the efficacy of antiviral drugs against H7N9-R292K will be reduced. Simulations can assist in predicting disruption of binding caused by mutations in neuraminidase, thereby providing a computational `assay.'
Zhang, Jie; Zhang, Tiehua; Guan, Tianzhu; Ruan, Ping; Ren, Dayong; Dai, Weichang; Yu, Hansong; Li, Tiezhu
2017-08-01
A fluorescence polarization (FP) assay for the simultaneous determination of bisphenol A (BPA), bisphenol F (BPF), bisphenol A diglycidyl ether (BADGE) and bisphenol F diglycidyl ether (BFDGE) was developed. The method was based on the competition between bisphenols (BPs) and fluorescein-labeled dexamethasone derivative (Dex-fl) for mouse peroxisome proliferator-activated receptor α ligand binding domain (mPPARα-LBD). A recombinant soluble protein derivative mPPARα-LBD* was prepared, then in vitro binding of 4 BPs to mPPARα-LBD* was investigated. Fluorescence polarization assay showed that these compounds exhibited different binding potencies with mPPARα-LBD*. Additionally, molecular dynamics simulations were performed to further understand the mechanism of BPs binding affinity for mPPARα-LBD*. Docking results elucidated that the driving forces for the binding of BPs to mPPARα-LBD* were predominantly dependent on hydrophobic and hydrogen-bonding interactions. Comparison of the calculated binding energies vs. experimental binding affinities yielded a good correlation (R 2 = 0.7258). The proposed method has potential for multi-residue detection of BPA, BPF, BADGE, and BFDGE. Copyright © 2017 Elsevier Ltd. All rights reserved.
Characterization of the receptor-binding domain of Ebola glycoprotein in viral entry.
Wang, Jizhen; Manicassamy, Balaji; Caffrey, Michael; Rong, Lijun
2011-06-01
Ebola virus infection causes severe hemorrhagic fever in human and non-human primates with high mortality. Viral entry/infection is initiated by binding of glycoprotein GP protein on Ebola virion to host cells, followed by fusion of virus-cell membrane also mediated by GP. Using an human immunodeficiency virus (HIV)-based pseudotyping system, the roles of 41 Ebola GP1 residues in the receptor-binding domain in viral entry were studied by alanine scanning substitutions. We identified that four residues appear to be involved in protein folding/structure and four residues are important for viral entry. An improved entry interference assay was developed and used to study the role of these residues that are important for viral entry. It was found that R64 and K95 are involved in receptor binding. In contrast, some residues such as I170 are important for viral entry, but do not play a major role in receptor binding as indicated by entry interference assay and/or protein binding data, suggesting that these residues are involved in post-binding steps of viral entry. Furthermore, our results also suggested that Ebola and Marburg viruses share a common cellular molecule for entry.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Grøftehauge, Morten K., E-mail: m.k.groftehauge@durham.ac.uk; Hajizadeh, Nelly R.; Swann, Marcus J.
2015-01-01
The biophysical characterization of protein–ligand interactions in solution using techniques such as thermal shift assay, or on surfaces using, for example, dual polarization interferometry, plays an increasingly important role in complementing crystal structure determinations. Over the last decades, a wide range of biophysical techniques investigating protein–ligand interactions have become indispensable tools to complement high-resolution crystal structure determinations. Current approaches in solution range from high-throughput-capable methods such as thermal shift assays (TSA) to highly accurate techniques including microscale thermophoresis (MST) and isothermal titration calorimetry (ITC) that can provide a full thermodynamic description of binding events. Surface-based methods such as surface plasmonmore » resonance (SPR) and dual polarization interferometry (DPI) allow real-time measurements and can provide kinetic parameters as well as binding constants. DPI provides additional spatial information about the binding event. Here, an account is presented of new developments and recent applications of TSA and DPI connected to crystallography.« less
Niescierowicz, Katarzyna; Caro, Lydia; Cherezov, Vadim; Vivaudou, Michel; Moreau, Christophe J
2014-01-07
Structural studies of G protein-coupled receptors (GPCRs) extensively use the insertion of globular soluble protein domains to facilitate their crystallization. However, when inserted in the third intracellular loop (i3 loop), the soluble protein domain disrupts their coupling to G proteins and impedes the GPCRs functional characterization by standard G protein-based assays. Therefore, activity tests of crystallization-optimized GPCRs are essentially limited to their ligand binding properties using radioligand binding assays. Functional characterization of additional thermostabilizing mutations requires the insertion of similar mutations in the wild-type receptor to allow G protein-activation tests. We demonstrate that ion channel-coupled receptor technology is a complementary approach for a comprehensive functional characterization of crystallization-optimized GPCRs and potentially of any engineered GPCR. Ligand-induced conformational changes of the GPCRs are translated into electrical signal and detected by simple current recordings, even though binding of G proteins is sterically blocked by the added soluble protein domain. Copyright © 2014 Elsevier Ltd. All rights reserved.
Hong, Huixiao; Branham, William S; Ng, Hui Wen; Moland, Carrie L; Dial, Stacey L; Fang, Hong; Perkins, Roger; Sheehan, Daniel; Tong, Weida
2015-02-01
One endocrine disruption mechanism is through binding to nuclear receptors such as the androgen receptor (AR) and estrogen receptor (ER) in target cells. The concentration of a chemical in serum is important for its entry into the target cells to bind the receptors, which is regulated by the serum proteins. Human sex hormone-binding globulin (SHBG) is the major transport protein in serum that can bind androgens and estrogens and thus change a chemical's availability to enter the target cells. Sequestration of an androgen or estrogen in the serum can alter the chemical elicited AR- and ER-mediated responses. To better understand the chemical-induced endocrine activity, we developed a competitive binding assay using human pregnancy plasma and measured the binding to the human SHBG for 125 structurally diverse chemicals, most of which were known to bind AR and ER. Eighty seven chemicals were able to bind the human SHBG in the assay, whereas 38 chemicals were nonbinders. Binding data for human SHBG are compared with that for rat α-fetoprotein, ER and AR. Knowing the binding profiles between serum and nuclear receptors will improve assessment of a chemical's potential for endocrine disruption. The SHBG binding data reported here represent the largest data set of structurally diverse chemicals tested for human SHBG binding. Utilization of the SHBG binding data with AR and ER binding data could enable better evaluation of endocrine disrupting potential of chemicals through AR- and ER-mediated responses since sequestration in serum could be considered. Published by Oxford University Press on behalf of the Society of Toxicology 2014. This work is written by US Government employees and is in the public domain in the US.
Lebani, Kebaneilwe; Jones, Martina L; Watterson, Daniel; Ranzoni, Andrea; Traves, Renee J; Young, Paul R; Mahler, Stephen M
2017-01-01
The multidimensional nature of dengue virus (DENV) infections, which can be caused by four distinct serotypes of the virus, complicates the sensitivity of assays designed for the diagnosis of infection. Different viral markers can be optimally detected at different stages of infection. Of particular clinical importance is the early identification of infection, which is pivotal for disease management and the development of blood screening assays. Non-structural protein 1 (NS1) is an early surrogate marker of infection and its detection in serum coincides with detectable viraemia. The aim of this work was to isolate and characterise serotype-specific monoclonal antibodies that bind to NS1 for each of the four DENV serotypes. This was achieved using phage display and a subtractive biopanning strategy to direct the antibody selection towards serotype-specific epitopes. This antibody isolation strategy has advantages over immunisation techniques where it is difficult to avoid antibody responses to cross-reactive, immunodominant epitopes. Serotype specificity to recombinant antigen for each of the antibodies was confirmed by Enzyme Linked Immunosorbent Assay (ELISA) and Surface Plasmon Resonance. Confirmation of binding to native DENV NS1 was achieved using ELISA and immunofluorescence assay on DENV infected Vero cells. No cross-reactivity with Zika or Kunjin viruses was observed. A previously isolated pan-reactive antibody that binds to an immunodominant epitope was able to pair with each of the serotype-specific antibodies in a sandwich ELISA, indicating that the serotype specific antibodies bind to epitopes which are all spatially distinct from the immunodominant epitope. These antibodies were suitable for use in a multiplexed assay for simultaneous detection and serotyping of DENV NS1 in human serum. This work demonstrates that phage display coupled with novel biopanning strategies is a valuable in vitro methodology for isolation of binders that can discern amongst antigens with high homology for diagnostic applicability.
Molecular interactions between general anesthetics and the 5HT2B receptor.
Matsunaga, Felipe; Gao, Lu; Huang, Xi-Ping; Saven, Jeffery G; Roth, Bryan L; Liu, Renyu
2015-01-01
Serotonin modulates many processes through a family of seven serotonin receptors. However, no studies have screened for interactions between general anesthetics currently in clinical use and serotonergic G-protein-coupled receptors (GPCRs). Given that both intravenous and inhalational anesthetics have been shown to target other classes of GPCRs, we hypothesized that general anesthetics might interact directly with some serotonin receptors and thus modify their function. Radioligand binding assays were performed to screen serotonin receptors for interactions with propofol and isoflurane as well as for affinity determinations. Docking calculations using the crystal structure of 5-HT2B were performed to computationally confirm the binding assay results and locate anesthetic binding sites. The 5-HT2B class of receptors interacted significantly with both propofol and isoflurane in the primary screen. The affinities for isoflurane and propofol were determined to be 7.78 and .95 μM, respectively, which were at or below the clinical concentrations for both anesthetics. The estimated free energy derived from docking calculations for propofol (-6.70 kcal/mol) and isoflurane (-5.10 kcal/mol) correlated with affinities from the binding assay. The anesthetics were predicted to dock at a pharmacologically relevant binding site of 5HT2B. The molecular interactions between propofol and isoflurane with the 5-HT2B class of receptors were discovered and characterized. This finding implicates the serotonergic GPCRs as potential anesthetic targets.
Naudin, Clément; Schumski, Ariane; Salo-Ahen, Outi M H; Herwald, Heiko; Smeds, Emanuel
2017-05-01
Species tropism constitutes a serious problem for developing relevant animal models of infection. Human pathogens can express virulence factors that show specific selectivity to human proteins, while their affinity for orthologs from other species can vary significantly. Suitable animal species must be used to analyse whether virulence factors are potential targets for drug development. We developed an assay that rapidly predicts applicable animal species for studying virulence factors binding plasma proteins. We used two well-characterized Staphylococcus aureus proteins, SSL7 and Efb, to develop an ELISA-based inhibition assay using plasma from different animal species. The interaction between SSL7 and human C5 and the binding of Efb to human fibrinogen and human C3 was studied. Affinity experiments and Western blot analyses were used to validate the assay. Human, monkey and cat plasma interfered with binding of SSL7 to human C5. Binding of Efb to human fibrinogen was blocked in human, monkey, gerbil and pig plasma, while human, monkey, gerbil, rabbit, cat and guinea pig plasma inhibited the binding of Efb to human C3. These results emphasize the importance of choosing correct animal models, and thus, our approach is a rapid and cost-effective method that can be used to prevent unnecessary animal experiments. © 2017 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.
Zinzula, Luca; Esposito, Francesca; Pala, Daniela; Tramontano, Enzo
2012-03-01
The Ebola viruses (EBOVs) VP35 protein is a multifunctional major virulence factor involved in EBOVs replication and evasion of the host immune system. EBOV VP35 is an essential component of the viral RNA polymerase, it is a key participant of the nucleocapsid assembly and it inhibits the innate immune response by antagonizing RIG-I like receptors through its dsRNA binding function and, hence, by suppressing the host type I interferon (IFN) production. Insights into the VP35 dsRNA recognition have been recently revealed by structural and functional analysis performed on its C-terminus protein. We report the biochemical characterization of the Zaire ebolavirus (ZEBOV) full-length recombinant VP35 (rVP35)-dsRNA binding function. We established a novel in vitro magnetic dsRNA binding pull down assay, determined the rVP35 optimal dsRNA binding parameters, measured the rVP35 equilibrium dissociation constant for heterologous in vitro transcribed dsRNA of different length and short synthetic dsRNA of 8bp, and validated the assay for compound screening by assessing the inhibitory ability of auryntricarboxylic acid (IC(50) value of 50μg/mL). Furthermore, we compared the dsRNA binding properties of full length wt rVP35 with those of R305A, K309A and R312A rVP35 mutants, which were previously reported to be defective in dsRNA binding-mediated IFN inhibition, showing that the latter have measurably increased K(d) values for dsRNA binding and modified migration patterns in mobility shift assays with respect to wt rVP35. Overall, these results provide the first characterization of the full-length wt and mutants VP35-dsRNA binding functions. Copyright © 2012 Elsevier B.V. All rights reserved.
A simple method for determining polymeric IgA-containing immune complexes.
Sancho, J; Egido, J; González, E
1983-06-10
A simplified assay to measure polymeric IgA-immune complexes in biological fluids is described. The assay is based upon the specific binding of a secretory component for polymeric IgA. In the first step, multimeric IgA (monomeric and polymeric) immune complexes are determined by the standard Raji cell assay. Secondly, labeled secretory component added to the assay is bound to polymeric IgA-immune complexes previously fixed to Raji cells, but not to monomeric IgA immune complexes. To avoid false positives due to possible complement-fixing IgM immune complexes, prior IgM immunoadsorption is performed. Using anti-IgM antiserum coupled to CNBr-activated Sepharose 4B this step is not time-consuming. Polymeric IgA has a low affinity constant and binds weakly to Raji cells, as Scatchard analysis of the data shows. Thus, polymeric IgA immune complexes do not bind to Raji cells directly through Fc receptors, but through complement breakdown products, as with IgG-immune complexes. Using this method, we have been successful in detecting specific polymeric-IgA immune complexes in patients with IgA nephropathy (Berger's disease) and alcoholic liver disease, as well as in normal subjects after meals of high protein content. This new, simple, rapid and reproducible assay might help to study the physiopathological role of polymeric IgA immune complexes in humans and animals.
Identifying Metabolically Active Chemicals Using a Consensus ...
Endocrine disrupting chemicals (EDCs) are abundant throughout the environment and can alter neurodevelopment, behavior, and reproductive success of humans and other species by perturbing signaling pathways related to the estrogen receptor (ER). A recent study compared results across 18 ER-related assays in the ToxCast™ in vitro screening program to predict the likelihood of a chemical exhibiting in vivo estrogenic activity, with the purpose of eliminating chemicals that may produce a false signal by interfering with the technological attributes of an individual assay. However, flaws in in vitro assay design can also prevent induction of signal activity by EDCs. Another reason for not observing activity for some EDCs in in vitro assays is that metabolic activation is required to perturb ER-related pathways. In the current study, 1,024 chemicals were identified as lacking ER activity after establishing a consensus across each of the 18 ER-related in vitro assays, and nearly 2,000 primary and 3,700 secondary unique metabolites were predicted for these chemicals. The ER binding activity for each metabolite was then predicted using an existing ER activity quantitative structure activity relationship (QSAR) consensus model. Binding activity was predicted for 2-3% of the metabolites within each generation. Of the inactive parent compounds generating at least one metabolite predicted to have ER-binding activity, nearly 30% were found to have metabolites from both gene
The hURAT1 rs559946 polymorphism and the incidence of gout in Han Chinese men.
Li, C; Yu, Q; Han, L; Wang, C; Chu, N; Liu, S
2014-01-01
Our previous study identified rs559946, a human urate transporter 1 (hURAT1) single nucleotide polymorphism (SNP), as being significantly associated with risk of primary hyperuricaemia (HUA) in a Han Chinese population. In the current study we aimed to identify the genetic effects of rs559946 on gout susceptibility in Han Chinese men. A total of 335 patients with gout and 376 healthy controls were recruited for a case-control association study. To examine the functional effect of rs559946, we performed luciferase reporter assays and an electrophoretic mobility shift assay (EMSA). rs559946 was found to be significantly associated with gout susceptibility (p = 0.004), with T-allele carriers showing a decreased risk of gout [odds ratio (OR) 0.70, 95% confidence interval (CI) 0.55-0.89]. Multiple linear regression analysis identified a significant association between rs559946 genotypes and tophi. Luciferase reporter assays show increased transcriptional activity of the hURAT1 promoter with the C allele of rs559946. EMSA detected binding of nuclear proteins to both the T and C alleles, although increased binding was observed with the T allele. Cold competition assays suggest that rs559946 may bind within a glucocorticoid receptor (GR) binding motif. Our study suggests that the rs559946 polymorphism is associated with increased HUA risk and may also contribute to gout development in Han Chinese men. The T to C substitution within rs559946 increased the transcriptional activity, and potentially increases gout susceptibility.
Naklua, Wanpen; Suedee, Roongnapa; Lieberzeit, Peter A
2016-07-15
Molecularly imprinted polymers (MIPs) have been successfully applied as selective materials for assessing the binding activity of agonist and antagonist of dopamine D1 receptor (D1R) by using quartz crystal microbalance (QCM). In this study, D1R derived from rat hypothalamus was used as a template and thus self-organized on stamps. Those were pressed into an oligomer film consisting of acrylic acid: N-vinylpyrrolidone: N,N'-(1,2-dihydroxyethylene) bis-acrylamide in a ratio of 2:3:12 spin coated onto a dual electrode QCM. Such we obtained one D1R-MIP-QCM electrode, whereas the other electrode carried the non-imprinted control polymer (NIP) that had remained untreated. Successful imprinting of D1R was confirmed by AFM. The polymer can re-incorporate D1R leading to frequency responses of 100-1200Hz in a concentration range of 5.9-47.2µM. In a further step such frequency changes proved inherently useful for examining the binding properties of test ligands to D1R. The resulting mass-sensitive measurements revealed Kd of dopamine∙HCl, haloperidol, and (+)-SCH23390 at 0.874, 25.6, and 0.004nM, respectively. These results correlate well with the values determined in radio ligand binding assays. Our experiments revealed that D1R-MIP sensors are useful for estimating the strength of ligand binding to the active single site. Therefore, we have developed a biomimetic surface imprinting strategy for QCM studies of D1R-ligand binding and presented a new method to ligand binding assay for D1R. Copyright © 2016 Elsevier B.V. All rights reserved.
Isolation and characterization of target sequences of the chicken CdxA homeobox gene.
Margalit, Y; Yarus, S; Shapira, E; Gruenbaum, Y; Fainsod, A
1993-01-01
The DNA binding specificity of the chicken homeodomain protein CDXA was studied. Using a CDXA-glutathione-S-transferase fusion protein, DNA fragments containing the binding site for this protein were isolated. The sources of DNA were oligonucleotides with random sequence and chicken genomic DNA. The DNA fragments isolated were sequenced and tested in DNA binding assays. Sequencing revealed that most DNA fragments are AT rich which is a common feature of homeodomain binding sites. By electrophoretic mobility shift assays it was shown that the different target sequences isolated bind to the CDXA protein with different affinities. The specific sequences bound by the CDXA protein in the genomic fragments isolated, were determined by DNase I footprinting. From the footprinted sequences, the CDXA consensus binding site was determined. The CDXA protein binds the consensus sequence A, A/T, T, A/T, A, T, A/G. The CAUDAL binding site in the ftz promoter is also included in this consensus sequence. When tested, some of the genomic target sequences were capable of enhancing the transcriptional activity of reporter plasmids when introduced into CDXA expressing cells. This study determined the DNA sequence specificity of the CDXA protein and it also shows that this protein can further activate transcription in cells in culture. Images PMID:7909943
Evaluation of the In Vivo and Ex Vivo Binding of Novel BC1 Cannabinoid Receptor Radiotracers
DOE Office of Scientific and Technical Information (OSTI.GOV)
Miller, A.; Gatley, J.; Gifford, A.
The primary active ingredient of marijuana, 9-tetrahydrocannabinol, exerts its psychoactive effects by binding to cannabinoid CB1 receptors. These receptors are found throughout the brain with high concentrations in the hippocampus and cerebellum. The current study was conducted to evaluate the binding of a newly developed putative cannabinoid antagonist, AM630, and a classical cannabinoid 8-tetrahydrocannabinol as potential PET and/or SPECT imaging agents for brain CB1 receptors. For both of these ligands in vivo and ex vivo studies in mice were conducted. AM630 showed good overall brain uptake (as measure by %IA/g) and a moderately rapid clearance from the brain with amore » half-clearance time of approximately 30 minutes. However, AM630 did not show selective binding to CB1 cannabinoid receptors. Ex vivo autoradiography supported the lack of selective binding seen in the in vivo study. Similar to AM630, 8-tetrahydrocanibol also failed to show selective binding to CB1 receptor rich brain areas. The 8-tetrahydrocanibol showed moderate overall brain uptake and relatively slow brain clearance as compared to AM630. Further studies were done with AM2233, a cannabinoid ligand with a similar structure as AM630. These studies were done to develop an ex vivo binding assay to quantify the displacement of [131I]AM2233 binding by other ligands in Swiss-Webster and CB1 receptor knockout mice. By developing this assay we hoped to determine the identity of an unknown binding site for AM2233 present in the hippocampus of CB1 knockout mice. Using an approach based on incubation of brain slices prepared from mice given intravenous [131I]AM2233 in either the presence or absence of AM2233 (unlabelled) it was possible to demonstrate a significant AM2233-displacable binding in the Swiss-Webster mice. Future studies will determine if this assay is appropriate for identifying the unknown binding site for AM2233 in the CB1 knockout mice.« less
Development of an assay for a biomarker of pregnancy and early fetal loss
DOE Office of Scientific and Technical Information (OSTI.GOV)
Canfield, R.E.; O'Connor, J.F.; Birken, S.
1987-10-01
Human chorionic gonadotropin (hCG) is a glycoprotein hormone, secreted by the syncytiotrophoblast cells of the fertilized ovum, that enters the maternal circulation at the time of endometrial implantation. It is composed of two nonidentical subunits; ..cap alpha.. and ..beta.., with molecular weights of 14 kD and 23 kD, respectively. Human chorionic gonadotropin binds to the same receptor as hLH and displays the same biological response, namely, to stimulate the declining function of the corpus luteum to produce progestins and estrogen late in the menstrual cycle. The differences in the structures of hCG and hLH have been exploited to develop antibodiesmore » that can measure hCG specifically in the presence of hLH. Two-site antibody binding assays have been developed, based on a surface immunological concept of hCG epitopes, that involve four distinct regions to which antibodies against hCG can bind simultaneously. Antibody cooperative effects, in conjunction with kinetic advantages derived from the concentration factors by use of the sandwich assay technique (immunoradiometric assay, IRMA), have enabled development of extremely sensitive and specific measurement protocols for urinary hCG. The assay described herein permits the detection of pregnancy on an average 25.4 days after the first day of the preceding menses, as opposed to 29.5 days for conventional radioimmunoassay techniques. In addition, the greater sensitivity and specificity of this assay method has permitted the detection of episodes of fetal loss not detected by radioimmunoassay of urine specimens. A large scale epidemiological study is in progress using this assay technique as a way to identify pregnancies that are lost before becoming clinically apparent.« less
Fate of wastewater effluent hER-agonists and hER-antagonists during soil aquifer treatment.
Otakuye, Conroy; Quanrud, David M; Ela, Wendell P; Wicke, Daniel; Lansey, Kevin E; Arnold, Robert G
2005-04-01
Estrogen activity was measured in wastewater effluent before and after polishing via soil-aquifer treatment (SAT) using both a (hER-beta) competitive binding assay and a transcriptional activation (yeast estrogen screen, YES) assay. From the competitive binding assay, the equivalent 17alpha-ethinylestradiol (EE2) concentration in secondary effluent was 4.7 nM but decreased to 0.22 nM following SAT. The YES assay indicated that the equivalent EE2 concentration in the same effluent sample was below the method-detection limit (<2.5 x 10(-3) nM) but increased to 0.68 nM in effluent polished via SAT processes. It was hypothesized thattest-dependent differences arose because the competitive binding assay responds positively to both estrogen mimics and anti-estrogens; the YES assay responds to estrogen mimics, but test response is inhibited by anti-estrogens. The hypothesis was supported when organics extracted from wastewater effluent inhibited the YES test response to EE2 (anti-estrogenic effect). A similar extract prepared from SAT-polished effluent augmented the EE2 curve (agonist response). When hydrophobic organics in secondary effluent were fractionated, assay results indicated that several physically distinct anti-estrogens were present in the sample. From this work, it is evident that transcription-activation bioassays alone should not be relied upon to measure estrogenic activity in complex environmental samples because the simultaneous presence of both agonists and antagonist compounds can yield false negatives. Multiple in vitro bioassays, sample fractionation or tests designed to measure anti-estrogenic activity can be used to overcome this problem. It is also clear that there are circumstances under which SAT does not completely remove estrogenic activity during municipal wastewater effluent polishing.
Wang, Xiangdan; Quarmby, Valerie; Ng, Carl; Chuntharapai, Anan; Shek, Theresa; Eigenbrot, Charles; Kelley, Robert F; Shia, Steven; McCutcheon, Krista; Lowe, John; Leddy, Cecilia; Coachman, Kyle; Cain, Gary; Chu, Felix; Hotzel, Isidro; Maia, Mauricio; Wakshull, Eric; Yang, Jihong
2013-01-01
Pharmacokinetic (PK) and immunohistochemistry (IHC) assays are essential to the evaluation of the safety and efficacy of therapeutic monoclonal antibodies (mAb) during drug development. These methods require reagents with a high degree of specificity because low concentrations of therapeutic antibody need to be detected in samples containing high concentrations of endogenous human immunoglobulins. Current assay reagent generation practices are labor-intensive and time-consuming. Moreover, these practices are molecule-specific and so only support one assay for one program at a time. Here, we describe a strategy to generate a unique assay reagent, 10C4, that preferentially recognizes a panel of recombinant human mAbs over endogenous human immunoglobulins. This "panel-specific" feature enables the reagent to be used in PK and IHC assays for multiple structurally-related therapeutic mAbs. Characterization revealed that the 10C4 epitope is conformational, extensive and mainly composed of non-CDR residues. Most key contact residues were conserved among structurally-related therapeutic mAbs, but the combination of these residues exists at low prevalence in endogenous human immunoglobulins. Interestingly, an indirect contact residue on the heavy chain of the therapeutic appears to play a critical role in determining whether or not it can bind to 10C4, but has no affect on target binding. This may allow us to improve the binding of therapeutic mAbs to 10C4 for assay development in the future. Here, for the first time, we present a strategy to develop a panel-specific reagent that can expedite the development of multiple clinical assays for structurally-related therapeutic mAbs.
Brady, Pamlea N; Macnaughtan, Megan A
2015-12-15
Colorimetric protein assays, such as the Coomassie blue G-250 dye-binding (Bradford) and bicinchoninic acid (BCA) assays, are commonly used to quantify protein concentration. The accuracy of these assays depends on the amino acid composition. Because of the extensive use of reductive methylation in the study of proteins and the importance of biological methylation, it is necessary to evaluate the impact of lysyl methylation on the Bradford and BCA assays. Unmodified and reductively methylated proteins were analyzed using the absorbance at 280 nm to standardize the concentrations. Using model compounds, we demonstrate that the dimethylation of lysyl ε-amines does not affect the proteins' molar extinction coefficients at 280 nm. For the Bradford assay, the responses (absorbance per unit concentration) of the unmodified and reductively methylated proteins were similar, with a slight decrease in the response upon methylation. For the BCA assay, the responses of the reductively methylated proteins were consistently higher, overestimating the concentrations of the methylated proteins. The enhanced color formation in the BCA assay may be due to the lower acid dissociation constants of the lysyl ε-dimethylamines compared with the unmodified ε-amine, favoring Cu(II) binding in biuret-like complexes. The implications for the analysis of biologically methylated samples are discussed. Copyright © 2015 Elsevier Inc. All rights reserved.
Brady, Pamlea N.; Macnaughtan, Megan A.
2015-01-01
Colorimetric protein assays, such as the Coomassie blue G-250 dye-binding (Bradford) and bicinchoninic acid (BCA) assays, are commonly used to quantify protein concentration. The accuracy of these assays depends on the amino acid composition. Because of the extensive use of reductive methylation in the study of proteins and the importance of biological methylation, it is necessary to evaluate the impact of lysyl methylation on the Bradford and BCA assays. Unmodified and reductively methylated proteins were analyzed using the absorbance at 280 nm to standardize the concentrations. Using model compounds, we demonstrate that the dimethylation of lysyl ε-amines does not affect the proteins’ molar extinction coefficients at 280 nm. For the Bradford assay, the response (absorbance per unit concentration) of the unmodified and reductively methylated proteins were similar with a slight decrease in the response upon methylation. For the BCA assay, the responses of the reductively methylated proteins were consistently higher, overestimating the concentrations of the methylated proteins. The enhanced color-formation in the BCA assay may be due to the lower acid dissociation constants of the lysyl ε-dimethylamines, compared to the unmodified ε-amine, favoring Cu(II) binding in biuret-like complexes. The implications for the analysis of biologically methylated samples are discussed. PMID:26342307
An assay to image neuronal microtubule dynamics in mice.
Kleele, Tatjana; Marinković, Petar; Williams, Philip R; Stern, Sina; Weigand, Emily E; Engerer, Peter; Naumann, Ronald; Hartmann, Jana; Karl, Rosa M; Bradke, Frank; Bishop, Derron; Herms, Jochen; Konnerth, Arthur; Kerschensteiner, Martin; Godinho, Leanne; Misgeld, Thomas
2014-09-12
Microtubule dynamics in neurons play critical roles in physiology, injury and disease and determine microtubule orientation, the cell biological correlate of neurite polarization. Several microtubule binding proteins, including end-binding protein 3 (EB3), specifically bind to the growing plus tip of microtubules. In the past, fluorescently tagged end-binding proteins have revealed microtubule dynamics in vitro and in non-mammalian model organisms. Here, we devise an imaging assay based on transgenic mice expressing yellow fluorescent protein-tagged EB3 to study microtubules in intact mammalian neurites. Our approach allows measurement of microtubule dynamics in vivo and ex vivo in peripheral nervous system and central nervous system neurites under physiological conditions and after exposure to microtubule-modifying drugs. We find an increase in dynamic microtubules after injury and in neurodegenerative disease states, before axons show morphological indications of degeneration or regrowth. Thus increased microtubule dynamics might serve as a general indicator of neurite remodelling in health and disease.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kovtun, Oleg; Ross, Emily J.; Tomlinson, Ian D.
Here we present the development and validation of a flow cytometry-based dopamine transporter (DAT) binding assay that uses antagonist-conjugated quantum dots (QDs). Our anticipation is that our QD-based assay is of immediate value to the high throughput screening of novel DAT modulators.
Assay for Arf GTP-binding Proteins | NCI Technology Transfer Center | TTC
The National Cancer Institute's Laboratory of Cellular and Molecular Biology is seeking statements of capability or interest from parties interested in collaborative research to further develop, evaluate, or commercialize an antibody-based proteomics assay.
Spectroscopy on the wing: naturally inspired SERS substrates for biochemical analysis.
Garrett, Natalie L; Vukusic, Peter; Ogrin, Feodor; Sirotkin, Evgeny; Winlove, C Peter; Moger, Julian
2009-03-01
We show that naturally occurring chitinous nanostructures found on the wings of the Graphium butterfly can be used as substrates for surface-enhanced Raman scattering when coated with a thin film of gold or silver. The substrates were found to exhibit excellent biocompatibility and sensitivity, making them ideal for protein assaying. An assay using avidin/biotin binding showed that the substrates could be used to quantify protein binding directly from changes in the surface-enhanced Raman scattering (SERS) spectra and were sensitive over a concentration range comparable with a typical enzyme-linked immunosorbent assays (ELISA) assay. A biomimetic version of the wing nanostructures produced using a highly reproducible, large-scale fabrication process, yielded comparable enhancement factors and biocompatibility. The excellent biocompatibility of the wings and biomimetic substrates is unparalleled by other lithographically produced substrates, and this could pave the way for widespread application of ultrasensitive SERS-based bioassays.
Respiratory Syncytial Virus (RSV): Neutralizing Antibody, a Correlate of Immune Protection.
Piedra, Pedro A; Hause, Anne M; Aideyan, Letisha
2016-01-01
Assays that measure RSV-specific neutralizing antibody activity are very useful for evaluating vaccine candidates, performing seroprevalence studies, and detecting infection. Neutralizing antibody activity is normally measured by a plaque reduction neutralization assay or by a microneutralization assay with or without complement. These assays measure the functional capacity of serum (or other fluids) to neutralize virus infectivity in cells as compared to ELISA assays that only measure the binding capacity against an antigen. This chapter discusses important elements in standardization of the RSV-specific microneutralization assay for use in the laboratory.
NASA Astrophysics Data System (ADS)
Pihlasalo, S.; Mariani, L.; Härmä, H.
2016-03-01
Homogeneous simple assays utilizing luminescence quenching and time-resolved luminescence resonance energy transfer (TR-LRET) were developed for the quantification of nucleic acids without sequence information. Nucleic acids prevent the adsorption of a protein to europium nanoparticles which is detected as a luminescence quenching of europium nanoparticles with a soluble quencher or as a decrease of TR-LRET from europium nanoparticles to the acceptor dye. Contrary to the existing methods based on fluorescent dye binding to nucleic acids, equal sensitivities for both single- (ssDNA) and double-stranded DNA (dsDNA) were measured and a detection limit of 60 pg was calculated for the quenching assay. The average coefficient of variation was 5% for the quenching assay and 8% for the TR-LRET assay. The TR-LRET assay was also combined with a nucleic acid dye selective to dsDNA in a single tube assay to measure the total concentration of DNA and the ratio of ssDNA and dsDNA in the mixture. To our knowledge, such a multiplexed assay is not accomplished with commercially available assays.Homogeneous simple assays utilizing luminescence quenching and time-resolved luminescence resonance energy transfer (TR-LRET) were developed for the quantification of nucleic acids without sequence information. Nucleic acids prevent the adsorption of a protein to europium nanoparticles which is detected as a luminescence quenching of europium nanoparticles with a soluble quencher or as a decrease of TR-LRET from europium nanoparticles to the acceptor dye. Contrary to the existing methods based on fluorescent dye binding to nucleic acids, equal sensitivities for both single- (ssDNA) and double-stranded DNA (dsDNA) were measured and a detection limit of 60 pg was calculated for the quenching assay. The average coefficient of variation was 5% for the quenching assay and 8% for the TR-LRET assay. The TR-LRET assay was also combined with a nucleic acid dye selective to dsDNA in a single tube assay to measure the total concentration of DNA and the ratio of ssDNA and dsDNA in the mixture. To our knowledge, such a multiplexed assay is not accomplished with commercially available assays. Electronic supplementary information (ESI) available: The labeling of amino modified polystyrene nanoparticles with Eu3+ chelate and the experimental details and results for the optimization of nucleic acid binding protein and for the ratiometric measurement of DNA and RNA with quenching assay. See DOI: 10.1039/c5nr09252c
Reed, Michael L; Ezeh, Peace C; Hamic, Amanda; Thompson, Douglas J; Caperton, Charles L
2009-11-01
Semen specimens (one ejaculate from each of 20 consenting study participants) were subjected to routine semen analysis, an in vitro sperm binding assay (HBA), and a sperm chromatin dispersion assay (HaloSperm), both before and after cryopreservation using cryoprotectant media supplemented with either egg yolk or soy lecithin. Comparing the equivalency of the two phospholipid cryopreservation supplements with regard to postthaw functional parameters demonstrated that there were no statistically significant differences between the two supplements for [1] recovery of motile sperm, [2] maintenance of sperm cell morphology, [3] maintenance of the ability of sperm to bind to hyaluronate in vitro, or [4] maintenance of sperm DNA integrity.
Grøftehauge, Morten K; Hajizadeh, Nelly R; Swann, Marcus J; Pohl, Ehmke
2015-01-01
Over the last decades, a wide range of biophysical techniques investigating protein-ligand interactions have become indispensable tools to complement high-resolution crystal structure determinations. Current approaches in solution range from high-throughput-capable methods such as thermal shift assays (TSA) to highly accurate techniques including microscale thermophoresis (MST) and isothermal titration calorimetry (ITC) that can provide a full thermodynamic description of binding events. Surface-based methods such as surface plasmon resonance (SPR) and dual polarization interferometry (DPI) allow real-time measurements and can provide kinetic parameters as well as binding constants. DPI provides additional spatial information about the binding event. Here, an account is presented of new developments and recent applications of TSA and DPI connected to crystallography.
Grøftehauge, Morten K.; Hajizadeh, Nelly R.; Swann, Marcus J.; Pohl, Ehmke
2015-01-01
Over the last decades, a wide range of biophysical techniques investigating protein–ligand interactions have become indispensable tools to complement high-resolution crystal structure determinations. Current approaches in solution range from high-throughput-capable methods such as thermal shift assays (TSA) to highly accurate techniques including microscale thermophoresis (MST) and isothermal titration calorimetry (ITC) that can provide a full thermodynamic description of binding events. Surface-based methods such as surface plasmon resonance (SPR) and dual polarization interferometry (DPI) allow real-time measurements and can provide kinetic parameters as well as binding constants. DPI provides additional spatial information about the binding event. Here, an account is presented of new developments and recent applications of TSA and DPI connected to crystallography. PMID:25615858
Is there a link between selectivity and binding thermodynamics profiles?
Tarcsay, Ákos; Keserű, György M
2015-01-01
Thermodynamics of ligand binding is influenced by the interplay between enthalpy and entropy contributions of the binding event. The impact of these binding free energy components, however, is not limited to the primary target only. Here, we investigate the relationship between binding thermodynamics and selectivity profiles by combining publicly available data from broad off-target assay profiling and the corresponding thermodynamics measurements. Our analysis indicates that compounds binding their primary targets with higher entropy contributions tend to hit more off-targets compared with those ligands that demonstrated enthalpy-driven binding. Copyright © 2014 Elsevier Ltd. All rights reserved.
ERIC Educational Resources Information Center
Huisman, Andrew J.; Hartsell, Lydia R.; Krueger, Brent P.; Pikaart, Michael J.
2010-01-01
We developed a modular pair of experiments for use in the undergraduate physical chemistry and biochemistry laboratories. Both experiments examine the thermodynamics of the binding of a small molecule, eosin Y, to the protein lysozyme. The assay for binding is the quenching of lysozyme fluorescence by eosin through resonant energy transfer. In…
Tumor necrosis factor interaction with gold nanoparticles
NASA Astrophysics Data System (ADS)
Tsai, De-Hao; Elzey, Sherrie; Delrio, Frank W.; Keene, Athena M.; Tyner, Katherine M.; Clogston, Jeffrey D.; Maccuspie, Robert I.; Guha, Suvajyoti; Zachariah, Michael R.; Hackley, Vincent A.
2012-05-01
We report on a systematic investigation of molecular conjugation of tumor necrosis factor-α (TNF) protein onto gold nanoparticles (AuNPs) and the subsequent binding behavior to its antibody (anti-TNF). We employ a combination of physical and spectroscopic characterization methods, including electrospray-differential mobility analysis, dynamic light scattering, polyacrylamide gel electrophoresis, attenuated total reflectance-Fourier transform infrared spectroscopy, fluorescence assay, and enzyme-linked immunosorbent assay. The native TNF used in this study exists in the active homotrimer configuration prior to conjugation. After binding to AuNPs, the maximum surface density of TNF is (0.09 +/- 0.02) nm-2 with a binding constant of 3 × 106 (mol L-1)-1. Dodecyl sulfate ions induce desorption of monomeric TNF from the AuNP surface, indicating a relatively weak intermolecular binding within the AuNP-bound TNF trimers. Anti-TNF binds to both TNF-conjugated and citrate-stabilized AuNPs, showing that non-specific binding is significant. Based on the number of anti-TNF molecules adsorbed, a substantially higher binding affinity was observed for the TNF-conjugated surface. The inclusion of thiolated polyethylene glycol (SH-PEG) on the AuNPs inhibits the binding of anti-TNF, and the amount of inhibition is related to the number ratio of surface bound SH-PEG to TNF and the way in which the ligands are introduced. This study highlights the challenges in quantitatively characterizing complex hybrid nanoscale conjugates, and provides insight on TNF-AuNP formation and activity.We report on a systematic investigation of molecular conjugation of tumor necrosis factor-α (TNF) protein onto gold nanoparticles (AuNPs) and the subsequent binding behavior to its antibody (anti-TNF). We employ a combination of physical and spectroscopic characterization methods, including electrospray-differential mobility analysis, dynamic light scattering, polyacrylamide gel electrophoresis, attenuated total reflectance-Fourier transform infrared spectroscopy, fluorescence assay, and enzyme-linked immunosorbent assay. The native TNF used in this study exists in the active homotrimer configuration prior to conjugation. After binding to AuNPs, the maximum surface density of TNF is (0.09 +/- 0.02) nm-2 with a binding constant of 3 × 106 (mol L-1)-1. Dodecyl sulfate ions induce desorption of monomeric TNF from the AuNP surface, indicating a relatively weak intermolecular binding within the AuNP-bound TNF trimers. Anti-TNF binds to both TNF-conjugated and citrate-stabilized AuNPs, showing that non-specific binding is significant. Based on the number of anti-TNF molecules adsorbed, a substantially higher binding affinity was observed for the TNF-conjugated surface. The inclusion of thiolated polyethylene glycol (SH-PEG) on the AuNPs inhibits the binding of anti-TNF, and the amount of inhibition is related to the number ratio of surface bound SH-PEG to TNF and the way in which the ligands are introduced. This study highlights the challenges in quantitatively characterizing complex hybrid nanoscale conjugates, and provides insight on TNF-AuNP formation and activity. Electronic supplementary information (ESI) available: Experimental procedures, instrumentation, materials and calculations. See DOI: 10.1039/c2nr30415e
Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes.
Cockburn, Darrell; Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte
2016-01-01
Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data.
Schmidt, Florian; Gasparoni, Nina; Gasparoni, Gilles; Gianmoena, Kathrin; Cadenas, Cristina; Polansky, Julia K.; Ebert, Peter; Nordström, Karl; Barann, Matthias; Sinha, Anupam; Fröhler, Sebastian; Xiong, Jieyi; Dehghani Amirabad, Azim; Behjati Ardakani, Fatemeh; Hutter, Barbara; Zipprich, Gideon; Felder, Bärbel; Eils, Jürgen; Brors, Benedikt; Chen, Wei; Hengstler, Jan G.; Hamann, Alf; Lengauer, Thomas; Rosenstiel, Philip; Walter, Jörn; Schulz, Marcel H.
2017-01-01
The binding and contribution of transcription factors (TF) to cell specific gene expression is often deduced from open-chromatin measurements to avoid costly TF ChIP-seq assays. Thus, it is important to develop computational methods for accurate TF binding prediction in open-chromatin regions (OCRs). Here, we report a novel segmentation-based method, TEPIC, to predict TF binding by combining sets of OCRs with position weight matrices. TEPIC can be applied to various open-chromatin data, e.g. DNaseI-seq and NOMe-seq. Additionally, Histone-Marks (HMs) can be used to identify candidate TF binding sites. TEPIC computes TF affinities and uses open-chromatin/HM signal intensity as quantitative measures of TF binding strength. Using machine learning, we find low affinity binding sites to improve our ability to explain gene expression variability compared to the standard presence/absence classification of binding sites. Further, we show that both footprints and peaks capture essential TF binding events and lead to a good prediction performance. In our application, gene-based scores computed by TEPIC with one open-chromatin assay nearly reach the quality of several TF ChIP-seq data sets. Finally, these scores correctly predict known transcriptional regulators as illustrated by the application to novel DNaseI-seq and NOMe-seq data for primary human hepatocytes and CD4+ T-cells, respectively. PMID:27899623
Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes
Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte
2016-01-01
Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data. PMID:27504624
Kerényi, Adrienne; Beke Debreceni, Ildikó; Oláh, Zsolt; Ilonczai, Péter; Bereczky, Zsuzsanna; Nagy, Béla; Muszbek, László; Kappelmayer, János
2017-09-01
Heparin-induced thrombocytopenia (HIT) is a severe side effect of heparin treatment caused by platelet activating IgG antibodies generated against the platelet factor 4 (PF4)-heparin complex. Thrombocytopenia and thrombosis are the leading clinical symptoms of HIT. The clinical pretest probability of HIT was evaluated by the 4T score system. Laboratory testing of HIT was performed by immunological detection of antibodies against PF4-heparin complex (EIA) and two functional assays. Heparin-dependent activation of donor platelets by patient plasma was detected by flow cytometry. Increased binding of Annexin-V to platelets and elevated number of platelet-derived microparticles (PMP) were the indicators of platelet activation. EIA for IgG isotype HIT antibodies was performed in 405 suspected HIT patients. Based on negative EIA results, HIT was excluded in 365 (90%) of cases. In 40 patients with positive EIA test result functional tests were performed. Platelet activating antibodies were detected in 17 cases by Annexin V binding. PMP count analysis provided nearly identical results. The probability of a positive flow cytometric assay result was higher in patients with elevated antibody titer. 71% of patients with positive EIA and functional assay had thrombosis. EIA is an important first line laboratory test in the diagnosis of HIT; however, HIT must be confirmed by a functional test. Annexin V binding and PMP assays using flow cytometry are functional HIT tests convenient in a clinical diagnostic laboratory. The positive results of functional assays may predict the onset of thrombosis. © 2016 International Clinical Cytometry Society. © 2016 International Clinical Cytometry Society.
LeBaron, Matthew J; Coady, Katie K; O'Connor, John C; Nabb, Diane L; Markell, Lauren K; Snajdr, Suzanne; Sue Marty, M
2014-02-01
Tier 1 of the U.S. EPA Endocrine Disruptor Screening Program comprises 11 studies: five in vitro assays, four in vivo mammalian assays, and two in vivo nonmammalian assays. The battery is designed to detect compounds with the potential to interact with the estrogen, androgen, or thyroid signaling pathways. This article examines the procedures, results, and data interpretation for the five Tier 1 in vitro assays: estrogen receptor (ER) and androgen receptor binding assays, an ER transactivation assay, an aromatase assay, and a steroidogenesis assay. Data are presented from two laboratories that have evaluated approximately 11 compounds in the Tier 1 in vitro assays. Generally, the ER and androgen receptor binding assays and the aromatase assay showed good specificity and reproducibility. As described in the guideline for the ER transactivation assay, a result is considered positive when the test compound induces a reporter gene signal that reaches 10% of the response seen with 1 nM 17β-estradiol (positive control). In the experience of these laboratories, this cutoff criterion may result in false-positive responses. For the steroidogenesis assay, there is variability in the basal and stimulated production of testosterone and estradiol by the H295R cells. This variability in responsiveness, coupled with potential cell stress at high concentrations of test compound, may make it difficult to discern whether hormone alterations are specific steroidogenesis alterations (i.e., endocrine active). Lastly, both laboratories had difficulty meeting some recommended performance criteria for each Tier 1 in vitro assay. Data with only minor deviations were deemed valid. © 2014 Wiley Periodicals, Inc.
Selective labelling of diazepam-insensitive GABAA receptors in vivo using [3H]Ro 15-4513.
Pym, Luanda J; Cook, Susan M; Rosahl, Thomas; McKernan, Ruth M; Atack, John R
2005-11-01
Classical benzodiazepines (BZs), such as diazepam, bind to GABAA receptors containing alpha1, alpha2, alpha3 or alpha5 subunits that are therefore described as diazepam-sensitive (DS) receptors. However, the corresponding binding site of GABAA receptors containing either an alpha4 or alpha6 subunit do not bind the classical BZs and are therefore diazepam-insensitive (DIS) receptors; a difference attributable to a single amino acid (histidine in alpha1, alpha2, alpha3 and alpha5 subunits and arginine in alpha4 and alpha6). Unlike classical BZs, the imidazobenzodiazepines Ro 15-4513 and bretazenil bind to both DS and DIS populations of GABAA receptors. In the present study, an in vivo assay was developed using lorazepam to fully occupy DS receptors such that [3H]Ro 15-4513 was then only able to bind to DIS receptors. When dosed i.v., [3H]Ro 15-4513 rapidly entered and was cleared from the brain, with approximately 70% of brain radioactivity being membrane-bound. Essentially all membrane binding to DS+DIS receptors could be displaced by unlabelled Ro 15-4513 or bretazenil, with respective ID50 values of 0.35 and 1.2 mg kg(-1). A dose of 30 mg kg(-1) lorazepam was used to block all DS receptors in a [3H]Ro 15-1788 in vivo binding assay. When predosed in a [3H]Ro 15-4513 binding assay, lorazepam blocked [3H]Ro 15-4513 binding to DS receptors, with the remaining binding to DIS receptors accounting for 5 and 23% of the total (DS plus DIS) receptors in the forebrain and cerebellum, respectively. The in vivo binding of [3H]Ro 15-4513 to DIS receptors in the presence of lorazepam was confirmed using alpha1H101R knock-in mice, in which alpha1-containing GABAA receptors are rendered diazepam insensitive by mutation of the histidine that confers diazepam sensitivity to arginine. In these mice, and in the presence of lorazepam, there was an increase of in vivo [3H]Ro 15-4513 binding in the forebrain and cerebellum from 4 and 15% to 36 and 59% of the total (i.e. DS plus DIS) [3H]Ro 15-4513 binding observed in the absence of lorazepam.
The practical side of immunocontraception: zona proteins and wildlife.
Kirkpatrick, J F; Rowan, A; Lamberski, N; Wallace, R; Frank, K; Lyda, R
2009-12-01
With shrinking habitat, the humane control of certain wildlife populations is relevant. The contraceptive vaccine based on native porcine zona pellucida (PZP) has been applied to various wildlife populations for 20 years. Prominent efforts include wild horses, urban deer, zoo animals and African elephants, among others. This approach has been successful in managing entire populations and to date, no significant debilitating short- or long-term health effects have been documented.
Proteoform-specific protein binding of small molecules in complex matrices
USDA-ARS?s Scientific Manuscript database
Characterizing the specific binding between protein targets and small molecules is critically important for drug discovery. Conventional assays require isolation and purification of small molecules from complex matrices through multistep chromatographic fractionation, which may alter their original ...
Koch, Cameron J
2018-05-10
Hypoxia in tumors has many well-characterized effects that are known to prevent optimal cancer treatment. Despite the existence of a large number of assays that have supported hypoxia as an important diagnostic, there is no routine clinical assay in use, and anti-hypoxia therapies have often not included parallel hypoxia measurements. Even with a functioning hypoxia assay, it is difficult to match the oxygen dependence of treatment resistance to that of the assay, and this mismatch can vary substantially from assay to assay and even from tumor to tumor [e.g., caused by endogenous variations in non-protein sulfhydryls (NPSH)]. An underlying concern is the current inability to measure the three types of hypoxia; in particular, cycling hypoxia can affect all aspects of detection and treatment strategy. Here we present data that help validate a new two-component hypoxia assay recently suggested by our laboratory. This assay incorporates the long-term bioreduction of the 2-nitroimidazole, EF5, and the short-term production of γ-H2AX (e.g., time of ionizing radiation exposure). The former can be calibrated to provide the average tissue pO 2 over the EF5 exposure time while the latter provides the combined sum of microenvironmental radiation response modifiers (e.g., oxygen and NPSH) at the time of irradiation. Importantly, formation of γ-H2AX is not dependent on blood flow, while EF5 binding is only minimally so, due to the rapid and extensive diffusion characteristics of lipophilic compounds. While both individual assays have their limitations, which are addressed in this article, their combination can dissect the type of hypoxia present. In particular, a mismatch between the two assays can directly detect cycling hypoxia in a therapeutically relevant manner. Preliminary use of this two-component assay in small PC3 tumors showed essentially no binding of EF5. Similarly, there were no tumor regions (for uniform irradiation with 12 Gy) with the low levels of γ-H2AX expected for a condition of cycling hypoxia. Thus, both assays were consistent with an essentially aerobic, radiation-responsive tumor. In a larger PC3 tumor, all regions of high EF5 binding had low levels of γ-H2AX.
Gardner, R L; Davies, T J
2006-02-01
Preliminary observations revealed that advanced zygotes of the PO strain mouse are often bilaterally symmetrical, and suggested that both the plane of first cleavage and features of the blastocyst bear a consistent relationship to the zygote's bilateral plane. Spaced oil drops were injected into the zona pellucida to delineate the bilateral plane in pronuclear zygotes, and a distinct cluster of drops then placed over the second polar body. Such non-invasive marking was combined with gelation of the perivitelline space to prevent rotation of the zygotes within the zona pellucida. Nearly two-thirds of advanced pronuclear stage zygotes were bilaterally symmetrical and, regardless of whether first cleavage was meridional, it was almost invariably orthogonal to the bilateral plane. Moreover, both the axis of polarity and bilateral plane of the blastocyst bore a consistent relationship to the zygote's bilateral plane. Haploid parthenotes also exhibited bilateral symmetry, although in the absence of fertilization, first cleavage was less consistently orthogonal to the bilateral plane. Bilateral symmetry may be an intrinsic property of the oocyte that is induced by its activation and, from the reproducible way it maps on both the 2-cell conceptus and blastocyst, seems to play a role in early patterning.
Khalilian, Morteza; Navidbakhsh, Mahdi; Valojerdi, Mojtaba Rezazadeh; Chizari, Mahmoud; Yazdi, Poopak Eftekhari
2010-01-01
The zona pellucida (ZP) is the spherical layer that surrounds the mammalian oocyte. The physical hardness of this layer plays a crucial role in fertilization and is largely unknown because of the lack of appropriate measuring and modelling methods. The aim of this study is to measure the biomechanical properties of the ZP of human/mouse ovum and to test the hypothesis that Young's modulus of the ZP varies with fertilization. Young's moduli of ZP are determined before and after fertilization by using the micropipette aspiration technique, coupled with theoretical models of the oocyte as an elastic incompressible half-space (half-space model), an elastic compressible bilayer (layered model) or an elastic compressible shell (shell model). Comparison of the models shows that incorporation of the layered geometry of the ovum and the compressibility of the ZP in the layered and shell models may provide a means of more accurately characterizing ZP elasticity. Evaluation of results shows that although the results of the models are different, all confirm that the hardening of ZP will increase following fertilization. As can be seen, different choices of models and experimental parameters can affect the interpretation of experimental data and lead to differing mechanical properties. PMID:19828504
Analysis of ZP1 gene reveals differences in zona pellucida composition in carnivores.
Moros-Nicolás, C; Leza, A; Chevret, P; Guillén-Martínez, A; González-Brusi, L; Boué, F; Lopez-Bejar, M; Ballesta, J; Avilés, M; Izquierdo-Rico, M J
2018-01-01
The zona pellucida (ZP) is an extracellular envelope that surrounds mammalian oocytes. This coat participates in the interaction between gametes, induction of the acrosome reaction, block of polyspermy and protection of the oviductal embryo. Previous studies suggested that carnivore ZP was formed by three glycoproteins (ZP2, ZP3 and ZP4), with ZP1 being a pseudogene. However, a recent study in the cat found that all four proteins were expressed. In the present study, in silico and molecular analyses were performed in several carnivores to clarify the ZP composition in this order of mammals. The in silico analysis demonstrated the presence of the ZP1 gene in five carnivores: cheetah, panda, polar bear, tiger and walrus, whereas in the Antarctic fur seal and the Weddell seal there was evidence of pseudogenisation. Molecular analysis showed the presence of four ZP transcripts in ferret ovaries (ZP1, ZP2, ZP3 and ZP4) and three in fox ovaries (ZP2, ZP3 and ZP4). Analysis of the fox ZP1 gene showed the presence of a stop codon. The results strongly suggest that all four ZP genes are expressed in most carnivores, whereas ZP1 pseudogenisation seems to have independently affected three families (Canidae, Otariidae and Phocidae) of the carnivore tree.
Small molecule and peptide-mediated inhibition of Epstein-Barr virus nuclear antigen 1 dimerization
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, Sun Young; Song, Kyung-A; Samsung Biomedical Research Institute
Highlights: Black-Right-Pointing-Pointer Evidence that targeting EBNA1 dimer, an EBV onco-antigen, can be achievable. Black-Right-Pointing-Pointer A small molecule and a peptide as EBNA1 dimerization inhibitors identified. Black-Right-Pointing-Pointer Both inhibitors associated with EBNA1 and blocked EBNA1 DNA binding activity. Black-Right-Pointing-Pointer Also, prevented its dimerization, and repressed viral gene transcription. -- Abstract: Latent Epstein-Barr virus (EBV) infection is associated with human B cell lymphomas and certain carcinomas. EBV episome persistence, replication, and gene expression are dependent on EBV-encoded nuclear antigen 1 (EBNA1)'s DNA binding domain (DBD)/dimerization domain (DD)-mediated sequence-specific DNA binding activity. Homodimerization of EBNA1 is essential for EBNA1 DNA binding and transactivation.more » In this study, we characterized a novel small molecule EBNA1 inhibitor EiK1, screened from the previous high throughput screening (HTS). The EiK1 compound specifically inhibited the EBNA1-dependent, OriP-enhanced transcription, but not EBNA1-independent transcription. A Surface Plasmon Resonance Biacore assay revealed that EiK1 associates with EBNA1 amino acid 459-607 DBD/DD. Consistent with the SPR data, in vitro gel shift assays showed that EiK1 suppressed the activity of EBNA1 binding to the cognate familial repeats (FR) sequence, but not control RBP-J{kappa} binding to the J{kappa} site. Subsequently, a cross-linker-mediated in vitro multimerization assay and EBNA1 homodimerization-dependent yeast two-hybrid assay showed that EiK1 significantly inhibited EBNA1 dimerization. In an attempt to identify more highly specific peptide inhibitors, small peptides encompassing the EBNA1 DBD/DD were screened for inhibition of EBNA1 DBD-mediated DNA binding function. The small peptide P85, covering EBNA1 a.a. 560-574, significantly blocked EBNA1 DNA binding activity in vitro, prevented dimerization in vitro and in vivo, associated with EBNA1 in vitro, and repressed EBNA1-dependent transcription in vivo. Collectively, this study describes two novel inhibitors of EBNA1 dimerization. This study demonstrates that EBNA1 homodimerization can be effectively targeted by a small molecule or peptide.« less
Armour, Kathryn L; Smith, Cheryl S; Clark, Michael R
2010-03-31
The efficacy of a therapeutic IgG molecule may be as dependent on the optimisation of the constant region to suit its intended indication as on the selection of its variable regions. A crucial effector function to be maximised or minimised is antibody-dependent cell-mediated cytotoxicity by natural killer cells. Traditional assays of ADCC activity suffer from considerable inter-donor and intra-donor variability, which makes the measurement of antibody binding to human FcgammaRIIIa, the key receptor for ADCC, an attractive alternative method of assessment. Here, we describe the development of cell lines and assays for this purpose. The transmembrane receptor, FcgammaRIIIa, requires co-expression with signal transducing subunits to prevent its degradation, unlike the homologous receptor FcgammaRIIIb that is expressed as a GPI-anchored molecule. Therefore, to simplify the production of cell lines as reliable assay components, we expressed FcgammaRIIIa as a GPI-anchored molecule. Separate, stable CHO cell lines that express either the 158F or the higher-affinity 158V allotype of FcgammaRIIIa were isolated using fluorescence-activated cell sorting. The identities of the expressed receptors were confirmed using a panel of monoclonal antibodies that distinguish between subclasses and allotypes of FcgammaRIII and the cell lines were shown to have slightly higher levels of receptor than FcgammaRIII-positive peripheral blood mononuclear cells. Because the affinity of FcgammaRIIIa for IgG is intermediate amongst the receptors that bind IgG, we were able to use these cell lines to develop flow cytometric assays to measure the binding of both complexed and monomeric immunoglobulin. Thus, by choosing the appropriate method, weakly- or strongly-binding IgG can be efficiently compared. We have quantified the difference in the binding of wildtype IgG1 and IgG3 molecules to the two functional allotypes of the receptor and report that the FcgammaRIIIa-158V-antibody interaction is 3- to 4-fold stronger that the interaction with FcgammaRIIIa-158F. Overall, these robust assays should be valuable for batch-testing clinical material as well as providing tools for improving the design of therapeutic IgG. 2010 Elsevier B.V. All rights reserved.
2014-01-01
Background Acetylation of lysine residues in histone tails plays an important role in the regulation of gene transcription. Bromdomains are the readers of acetylated histone marks, and, consequently, bromodomain-containing proteins have a variety of chromatin-related functions. Moreover, they are increasingly being recognised as important mediators of a wide range of diseases. The first potent and selective bromodomain inhibitors are beginning to be described, but the diverse or unknown functions of bromodomain-containing proteins present challenges to systematically demonstrating cellular efficacy and selectivity for these inhibitors. Here we assess the viability of fluorescence recovery after photobleaching (FRAP) assays as a target agnostic method for the direct visualisation of an on-target effect of bromodomain inhibitors in living cells. Results Mutation of a conserved asparagine crucial for binding to acetylated lysines in the bromodomains of BRD3, BRD4 and TRIM24 all resulted in reduction of FRAP recovery times, indicating loss of or significantly reduced binding to acetylated chromatin, as did the addition of known inhibitors. Significant differences between wild type and bromodomain mutants for ATAD2, BAZ2A, BRD1, BRD7, GCN5L2, SMARCA2 and ZMYND11 required the addition of the histone deacetylase inhibitor suberoylanilide hydroxamic acid (SAHA) to amplify the binding contribution of the bromodomain. Under these conditions, known inhibitors decreased FRAP recovery times back to mutant control levels. Mutation of the bromodomain did not alter FRAP recovery times for full-length CREBBP, even in the presence of SAHA, indicating that other domains are primarily responsible for anchoring CREBBP to chromatin. However, FRAP assays with multimerised CREBBP bromodomains resulted in a good assay to assess the efficacy of bromodomain inhibitors to this target. The bromodomain and extraterminal protein inhibitor PFI-1 was inactive against other bromodomain targets, demonstrating the specificity of the method. Conclusions Viable FRAP assays were established for 11 representative bromodomain-containing proteins that broadly cover the bromodomain phylogenetic tree. Addition of SAHA can overcome weak binding to chromatin, and the use of tandem bromodomain constructs can eliminate masking effects of other chromatin binding domains. Together, these results demonstrate that FRAP assays offer a potentially pan-bromodomain method for generating cell-based assays, allowing the testing of compounds with respect to cell permeability, on-target efficacy and selectivity. PMID:25097667
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ren, Xiao-Min, E-mail: rxm200318@gmail.com; Guo, Liang-Hong, E-mail: LHGuo@rcees.ac.cn; Gao, Yu, E-mail: francesscototti@gmail.com
2013-05-01
Polybrominated diphenyl ethers (PBDEs) have been shown to disrupt thyroid hormone (TH) functions in experimental animals, and one of the proposed disruption mechanisms is direct binding of hydroxylated PBDE (OH-PBDE) to TH receptors (TRs). However, previous data on TH receptor binding and TH activity of OH-PBDEs were very limited and sometimes inconsistent. In the present paper, we examined the binding potency of ten OH-PBDEs with different degrees of bromination to TR using a fluorescence competitive binding assay. The results showed that the ten OH-PBDEs bound to TR with potency that correlated to their bromination level. We further examined their effectmore » on TR using a coactivator binding assay and GH3 cell proliferation assay. Different TR activities of OH-PBDEs were observed depending on their degree of bromination. Four low-brominated OH-PBDEs (2′-OH-BDE-28, 3′-OH-BDE-28, 5-OH-BDE-47, 6-OH-BDE-47) were found to be TR agonists, which recruited the coactivator peptide and enhanced GH3 cell proliferation. However, three high-brominated OH-PBDEs (3-OH-BDE-100, 3′-OH-BDE-154, 4-OH-BDE-188) were tested to be antagonists. Molecular docking was employed to simulate the interactions of OH-PBDEs with TR and identify the structural determinants for TR binding and activity. According to the docking results, low-brominated OH-PBDEs, which are weak binders but TR agonists, bind with TR at the inner side of its binding pocket, whereas high-brominated compounds, which are potent binders but TR antagonists, reside at the outer region. These results indicate that OH-PBDEs have different activities on TR (agonistic or antagonistic), possibly due to their different binding geometries with the receptor. - Highlights: ► Thyroid hormone (TH) activity of OH-PBDEs with different Br number was evaluated. ► Four different experimental approaches were employed to investigate the mechanism. ► Low-brominated OH-PBDEs were agonists, but high-brominated ones were antagonists. ► Low-brominated OH-PBDEs bind to TH receptor differently than high-brominated ones.« less
Riond, B; Steffen, F; Schmied, O; Hofmann-Lehmann, R; Lutz, H
2014-03-01
In veterinary clinical laboratories, qualitative tests for total protein measurement in canine cerebrospinal fluid (CSF) have been replaced by quantitative methods, which can be divided into dye-binding assays and turbidimetric methods. There is a lack of validation data and reference intervals (RIs) for these assays. The aim of the present study was to assess agreement between the turbidimetric benzethonium chloride method and 2 dye-binding methods (Pyrogallol Red-Molybdate method [PRM], Coomassie Brilliant Blue [CBB] technique) for measurement of total protein concentration in canine CSF. Furthermore, RIs were determined for all 3 methods using an indirect a posteriori method. For assay comparison, a total of 118 canine CSF specimens were analyzed. For RIs calculation, clinical records of 401 canine patients with normal CSF analysis were studied and classified according to their final diagnosis in pathologic and nonpathologic values. The turbidimetric assay showed excellent agreement with the PRM assay (mean bias 0.003 g/L [-0.26-0.27]). The CBB method generally showed higher total protein values than the turbidimetric assay and the PRM assay (mean bias -0.14 g/L for turbidimetric and PRM assay). From 90 of 401 canine patients, nonparametric reference intervals (2.5%, 97.5% quantile) were calculated (turbidimetric assay and PRM method: 0.08-0.35 g/L (90% CI: 0.07-0.08/0.33-0.39); CBB method: 0.17-0.55 g/L (90% CI: 0.16-0.18/0.52-0.61). Total protein concentration in canine CSF specimens remained stable for up to 6 months of storage at -80°C. Due to variations among methods, RIs for total protein concentration in canine CSF have to be calculated for each method. The a posteriori method of RIs calculation described here should encourage other veterinary laboratories to establish RIs that are laboratory-specific. ©2014 American Society for Veterinary Clinical Pathology and European Society for Veterinary Clinical Pathology.
Schulz, Sebastian; Doller, Anke; Pendini, Nicole R; Wilce, Jacqueline A; Pfeilschifter, Josef; Eberhardt, Wolfgang
2013-12-01
The ubiquitous mRNA binding protein human antigen R (HuR) participates in the post-transcriptional regulation of many AU-rich element (ARE)-bearing mRNAs. Previously, by using in vitro kinase assay, we have identified serines (Ser) 158, 221 and 318 as targets of protein kinase C (PKC)-triggered phosphorylation. In this study, we tested whether GFP- or GST-tagged HuR constructs bearing a phosphomimetic Ser (S)-to-Asp (D) substitution at the different PKC target sites, would affect different HuR functions including HuR nucleo-cytoplasmic redistribution and binding to different types of ARE-containing mRNAs. The phosphomimetic GFP-tagged HuR protein bearing a phosphomimetic substitution in the hinge region of HuR (HuR-S221D) showed an increased cytoplasmic abundance when compared to wild-type HuR. Conversely, data from in vitro kinase assay and electrophoretic mobility shift assay (EMSA), implicates that phosphorylation at Ser 221 is not relevant for mRNA binding of HuR. Quantification of in vitro binding affinities of GST-tagged wild-type HuR and corresponding HuR proteins bearing a phosphomimetic substitution in either RRM2 (HuR-S158D) or in RRM3 (HuR-S318D) by microscale thermophoresis (MST) indicates a specific binding of wild-type HuR to type I, II or type III-ARE-oligonucleotides in the high nanomolar range. Interestingly, phosphomimetic mutation at position 158 or 318 had a negative influence on HuR binding to type I- and type II-ARE-mRNAs whereas it significantly enhanced HuR affinity to a type III-ARE substrate. Our data suggest that differential phosphorylation of HuR by PKCs at different HuR domains coordinates subcellular HuR distribution and leads to a preferential binding to U-rich bearing target mRNA. © 2013.
Phytoestrogens and Mycoestrogens Induce Signature Structure Dynamics Changes on Estrogen Receptor α
Chen, Xueyan; Uzuner, Ugur; Li, Man; Shi, Weibing; Yuan, Joshua S.; Dai, Susie Y.
2016-01-01
Endocrine disrupters include a broad spectrum of chemicals such as industrial chemicals, natural estrogens and androgens, synthetic estrogens and androgens. Phytoestrogens are widely present in diet and food supplements; mycoestrogens are frequently found in grains. As human beings and animals are commonly exposed to phytoestrogens and mycoestrogens in diet and environment, it is important to understand the potential beneficial or hazardous effects of estrogenic compounds. Many bioassays have been established to study the binding of estrogenic compounds with estrogen receptor (ER) and provided rich data in the literature. However, limited assays can offer structure information with regard to the ligand/ER complex. Our current study surveys the global structure dynamics changes for ERα ligand binding domain (LBD) when phytoestrogens and mycoestrogens bind. The assay is based on the structure dynamics information probed by hydrogen deuterium exchange mass spectrometry and offers a unique viewpoint to elucidate the mechanism how phytoestrogens and mycoestrogens interact with estrogen receptor. The cluster analysis based on the hydrogen deuterium exchange (HDX) assay data reveals a unique pattern when phytoestrogens and mycoestrogens bind with ERα LBD compared to that of estradiol and synthetic estrogen modulators. Our study highlights that structure dynamics could play an important role in the structure function relationship when endocrine disrupters interact with estrogen receptors. PMID:27589781
Autoregulation and Virulence Control by the Toxin-Antitoxin System SavRS in Staphylococcus aureus
Wen, Wen; Liu, Banghui; Xue, Lu; Zhu, Zhongliang; Niu, Liwen
2018-01-01
ABSTRACT Toxin-antitoxin (TA) systems play diverse physiological roles, such as plasmid maintenance, growth control, and persister cell formation, but their involvement in bacterial pathogenicity remains largely unknown. Here, we have identified a novel type II toxin-antitoxin system, SavRS, and revealed the molecular mechanisms of its autoregulation and virulence control in Staphylococcus aureus. Electrophoretic mobility shift assay and isothermal titration calorimetry data indicated that the antitoxin SavR acted as the primary repressor bound to its own promoter, while the toxin SavS formed a complex with SavR to enhance the ability to bind to the operator site. DNase I footprinting assay identified the SavRS-binding site containing a short and long palindrome in the promoter region. Further, mutation and DNase I footprinting assay demonstrated that the two palindromes were crucial for DNA binding and transcriptional repression. More interestingly, genetic deletion of the savRS system led to the increased hemolytic activity and pathogenicity in a mouse subcutaneous abscess model. We further identified two virulence genes, hla and efb, by real-time quantitative reverse transcription-PCR and demonstrated that SavR and SavRS could directly bind to their promoter regions to repress virulence gene expression. PMID:29440365
Empirically Optimized Flow Cytometric Immunoassay Validates Ambient Analyte Theory
Parpia, Zaheer A.; Kelso, David M.
2010-01-01
Ekins’ ambient analyte theory predicts, counter intuitively, that an immunoassay’s limit of detection can be improved by reducing the amount of capture antibody. In addition, it also anticipates that results should be insensitive to the volume of sample as well as the amount of capture antibody added. The objective of this study is to empirically validate all of the performance characteristics predicted by Ekins’ theory. Flow cytometric analysis was used to detect binding between a fluorescent ligand and capture microparticles since it can directly measure fractional occupancy, the primary response variable in ambient analyte theory. After experimentally determining ambient analyte conditions, comparisons were carried out between ambient and non-ambient assays in terms of their signal strengths, limits of detection, and their sensitivity to variations in reaction volume and number of particles. The critical number of binding sites required for an assay to be in the ambient analyte region was estimated to be 0.1VKd. As predicted, such assays exhibited superior signal/noise levels and limits of detection; and were not affected by variations in sample volume and number of binding sites. When the signal detected measures fractional occupancy, ambient analyte theory is an excellent guide to developing assays with superior performance characteristics. PMID:20152793
Hansen, Randi Westh; Wang, Xiaole; Golab, Agnieszka; Bornert, Olivier; Oswald, Christine; Wagner, Renaud; Martinez, Karen Laurence
2016-01-01
Long-term functional stability of isolated membrane proteins is crucial for many in vitro applications used to elucidate molecular mechanisms, and used for drug screening platforms in modern pharmaceutical industry. Compared to soluble proteins, the understanding at the molecular level of membrane proteins remains a challenge. This is partly due to the difficulty to isolate and simultaneously maintain their structural and functional stability, because of their hydrophobic nature. Here we show, how scintillation proximity assay can be used to analyze time-resolved high-affinity ligand binding to membrane proteins solubilized in various environments. The assay was used to establish conditions that preserved the biological function of isolated human kappa opioid receptor. In detergent solution the receptor lost high-affinity ligand binding to a radiolabelled ligand within minutes at room temperature. After reconstitution in Nanodiscs made of phospholipid bilayer the half-life of high-affinity ligand binding to the majority of receptors increased 70-fold compared to detergent solubilized receptors—a level of stability that is appropriate for further downstream applications. Time-resolved scintillation proximity assay has the potential to screen numerous conditions in parallel to obtain high levels of stable and active membrane proteins, which are intrinsically unstable in detergent solution, and with minimum material consumption. PMID:27035823
Koh, Hye Ran; Wang, Xinlei; Myong, Sua
2016-08-01
TRBP, one of double strand RNA binding proteins (dsRBPs), is an essential cofactor of Dicer in the RNA interference pathway. Previously we reported that TRBP exhibits repetitive diffusion activity on double strand (ds)RNA in an ATP independent manner. In the TRBP-Dicer complex, the diffusion mobility of TRBP facilitates Dicer-mediated RNA cleavage. Such repetitive diffusion of dsRBPs on a nucleic acid at the nanometer scale can be appropriately captured by several single molecule detection techniques. Here, we provide a step-by-step guide to four different single molecule fluorescence assays by which the diffusion activity of dsRBPs on dsRNA can be detected. One color assay, termed protein induced fluorescence enhancement enables detection of unlabeled protein binding and diffusion on a singly labeled RNA. Two-color Fluorescence Resonance Energy Transfer (FRET) in which labeled dsRBPs is applied to labeled RNA, allows for probing the motion of protein along the RNA axis. Three color FRET reports on the diffusion movement of dsRBPs from one to the other end of RNA. The single molecule pull down assay provides an opportunity to collect dsRBPs from mammalian cells and examine the protein-RNA interaction at single molecule platform. Copyright © 2016 Elsevier Inc. All rights reserved.
Fluorescence Immunofiltration Assay of Brucella Melitensis.
1995-01-01
second urease -labelled antibody directed against fluorescein. The assay system is useful for measuring protein, virus and bacteria in aqueous...binding site for the signal-generating urease -labelled antibody, it is a highly fluorescent molecule and has signal-generating capacity of its own
Human Nup98 regulates the localization and activity of DExH/D-box helicase DHX9
Capitanio, Juliana S; Montpetit, Ben; Wozniak, Richard W
2017-01-01
Beyond their role at nuclear pore complexes, some nucleoporins function in the nucleoplasm. One such nucleoporin, Nup98, binds chromatin and regulates gene expression. To gain insight into how Nup98 contributes to this process, we focused on identifying novel binding partners and understanding the significance of these interactions. Here we report on the identification of the DExH/D-box helicase DHX9 as an intranuclear Nup98 binding partner. Various results, including in vitro assays, show that the FG/GLFG region of Nup98 binds to N- and C-terminal regions of DHX9 in an RNA facilitated manner. Importantly, binding of Nup98 stimulates the ATPase activity of DHX9, and a transcriptional reporter assay suggests Nup98 supports DHX9-stimulated transcription. Consistent with these observations, our analysis revealed that Nup98 and DHX9 bind interdependently to similar gene loci and their transcripts. Based on our results, we propose that Nup98 functions as a co-factor that regulates DHX9 and, potentially, other RNA helicases. DOI: http://dx.doi.org/10.7554/eLife.18825.001 PMID:28221134
Chemical and genetic wrappers for improved phage and RNA display.
Lamboy, Jorge A; Tam, Phillip Y; Lee, Lucie S; Jackson, Pilgrim J; Avrantinis, Sara K; Lee, Hye J; Corn, Robert M; Weiss, Gregory A
2008-11-24
An Achilles heel inherent to all molecular display formats, background binding between target and display system introduces false positives into screens and selections. For example, the negatively charged surfaces of phage, mRNA, and ribosome display systems bind with unacceptably high nonspecificity to positively charged target molecules, which represent an estimated 35% of proteins in the human proteome. Here we report the first systematic attempt to understand why a broad class of molecular display selections fail, and then solve the underlying problem for both phage and RNA display. Firstly, a genetic strategy was used to introduce a short, charge-neutralizing peptide into the solvent-exposed, negatively charged phage coat. The modified phage (KO7(+)) reduced or eliminated nonspecific binding to the problematic high-pI proteins. In the second, chemical approach, nonspecific interactions were blocked by oligolysine wrappers in the cases of phage and total RNA. For phage display applications, the peptides Lys(n) (where n=16 to 24) emerged as optimal for wrapping the phage. Lys(8), however, provided effective wrappers for RNA binding in assays against the RNA binding protein HIV-1 Vif. The oligolysine peptides blocked nonspecific binding to allow successful selections, screens, and assays with five previously unworkable protein targets.
Tõntson, Lauri; Kopanchuk, Sergei; Rinken, Ago
2014-02-01
Bodipy-FL-NAN-190 was found to be well suited for characterization of ligand binding to 5-HT1A receptors expressed in budded baculovirus particles, as binding is accompanied by large increases in fluorescence intensity and anisotropy. This ligand appears to bind rapidly (t1/2,ass<1 min), reversibly (t1/2,diss∼6 min) and has high affinity (Kd=0.30 ± 0.13 nM). This fluorescence anisotropy assay based on Bodipy-FL-NAN-190 binding to baculovirus particles was also a suitable assay system for the pharmacological characterization of non-labelled serotonergic ligands, as well as being sensitive to the presence of G-proteins and guanine nucleotides. Coexpression of αi subunits of human G-proteins in baculovirus particles resulted in the appearance of significantly greater proportion of nucleotide sensitive high affinity agonist binding sites. There were no significant differences between αi1 and αi3 subtypes, while ligand binding in the presence of αi2 had higher sensitivity to GDP and Mn(2+). Copyright © 2014 Elsevier Ltd. All rights reserved.
The LacI family protein GlyR3 co-regulates the celC operon and manB in Clostridium thermocellum
Choi, Jinlyung; Klingeman, Dawn M.; Brown, Steven D.; ...
2017-06-24
In this paper, we demonstrate that the GlyR3 protein mediates the regulation of manB. We first identify putative GlyR3 binding sites within or just upstream of the coding regions of manB and celT. Using an electrophoretic mobility shift assay (EMSA), we determined that a higher concentration of GlyR3 is required to effectively bind to the putative manB site in comparison to the celC site. Neither the putative celT site nor random DNA significantly binds GlyR3. While laminaribiose interfered with GlyR3 binding to the celC binding site, binding to the manB site was unaffected. In the presence of laminaribiose, in vivomore » transcription of the celC–glyR3–licA gene cluster increases, while manB expression is repressed, compared to in the absence of laminaribiose, consistent with the results from the EMSA. An in vitro transcription assay demonstrated that GlyR3 and laminaribiose interactions were responsible for the observed patters of in vivo transcription.« less
NASA Astrophysics Data System (ADS)
Missailidis, Sotiris; de Oliveira, Renata Carvalho; Silva, Dilson; Cortez, Célia Martins; Guterres, Alexandro; Vicente, Luciana Helena Bassan; de Godoy, Daniela Tupy; Lemos, Elba
2015-12-01
In this study we have aimed to develop novel aptamers against the Hantavirus nucleoprotein N, a valid antigen already used in the Hantavirus reference laboratory of the Institute Oswaldo Cruz in Rio de Janeiro, Brazil. Such aptamers, if they are found to bind with high affinity and specificity for the selected hantavirus antigen, they could be translated into novel diagnostic assays with the ability to provide early detection for hantaviroses and their related disease syndromes. In a preliminary screening, we have managed to identify three aptamer species. We have analyzed a short and a long version of these aptamer using fluorescence spectroscopy and modelled their binding. We have identified Stern-Volmer constants for the selected aptamers, which have shown affinity for their target, with a different binding between the short and the long versions of them. Short aptamers have shown to have a higher Stern-Volmer constant and the ability to potentially bind to more than one binding site on the antigen. The information provided by the spectroscopic screening has been invaluable in allowing us to define candidates for further development into diagnostic assays.
Fluorescent Receptor Binding Assay for Detecting Ciguatoxins in Fish
Hardison, D. Ransom; Holland, William C.; McCall, Jennifer R.; Bourdelais, Andrea J.; Baden, Daniel G.; Darius, H. Taiana; Chinain, Mireille; Tester, Patricia A.; Shea, Damian; Flores Quintana, Harold A.; Morris, James A.; Litaker, R. Wayne
2016-01-01
Ciguatera fish poisoning is an illness suffered by > 50,000 people yearly after consumption of fish containing ciguatoxins (CTXs). One of the current methodologies to detect ciguatoxins in fish is a radiolabeled receptor binding assay (RBA(R)). However, the license requirements and regulations pertaining to radioisotope utilization can limit the applicability of the RBA(R) in certain labs. A fluorescence based receptor binding assay (RBA(F)) was developed to provide an alternative method of screening fish samples for CTXs in facilities not certified to use radioisotopes. The new assay is based on competition binding between CTXs and fluorescently labeled brevetoxin-2 (BODIPY®- PbTx-2) for voltage-gated sodium channel receptors at site 5 instead of a radiolabeled brevetoxin. Responses were linear in fish tissues spiked from 0.1 to 1.0 ppb with Pacific ciguatoxin-3C (P-CTX-3C) with a detection limit of 0.075 ppb. Carribean ciguatoxins were confirmed in Caribbean fish by LC-MS/MS analysis of the regional biomarker (C-CTX-1). Fish (N = 61) of six different species were screened using the RBA(F). Results for corresponding samples analyzed using the neuroblastoma cell-based assay (CBA-N2a) correlated well (R2 = 0.71) with those of the RBA(F), given the low levels of CTX present in positive fish. Data analyses also showed the resulting toxicity levels of P-CTX-3C equivalents determined by CBA-N2a were consistently lower than the RBA(F) affinities expressed as % binding equivalents, indicating that a given amount of toxin bound to the site 5 receptors translates into corresponding lower cytotoxicity. Consequently, the RBA(F), which takes approximately two hours to perform, provides a generous estimate relative to the widely used CBA-N2a which requires 2.5 days to complete. Other RBA(F) advantages include the long-term (> 5 years) stability of the BODIPY®- PbTx-2 and having similar results as the commonly used RBA(R). The RBA(F) is cost-effective, allows high sample throughput, and is well-suited for routine CTX monitoring programs. PMID:27073998