Bone mineral density test

MedlinePlus

... density test; Bone densitometry; DEXA scan; DXA; Dual-energy x-ray absorptiometry; p-DEXA; Osteoporosis - BMD ... most common and accurate way uses a dual-energy x-ray absorptiometry (DEXA) scan. DEXA uses low- ...

Osteoporosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Riggs, B.L. Melton III, L.J.

This book contains 20 chapters. Some of the titles are: Radiology of asteoporosis; Quantitative computed tomography in assessment of osteoporosis; Nuclear medicine and densitometry; Assessment of bone turnover by histormorphometry in osteoporosis; and The biochemistry of bone.

Correlation between ultrasound velocity and densitometry in fresh and demineralized cortical bone

PubMed Central

de Mesquita, Alessandro Queiroz; Barbieri, Giuliano; Barbieri, Claudio Henrique

2016-01-01

OBJECTIVE: To compare ultrasound propagation velocity with densitometry in the diaphyseal compact cortical bone of whole sheep metatarsals. METHODS: The transverse ultrasound velocity and bone mineral density of 5-cm-long diaphyseal bone segments were first measured. The bone segments were then divided into four groups of 15 segments each and demineralized in an aqueous 0.5 N hydrochloric acid solution for 6, 12, 24 or 36 hours. All measurements were repeated after demineralization for each time duration and the values measured before and after demineralization were compared. RESULTS: Ultrasound velocity and bone mineral density decreased with demineralization time, and most differences in the pre- and post-demineralization values within each group and between groups were significant: A moderate correlation coefficient (r=0.75956) together with a moderate agreement was determined between both post-demineralization parameters, detected by the Bland-Altman method. CONCLUSION: We conclude that both ultrasound velocity and bone mineral density decrease as a result of demineralization, thus indicating that bone mineral content is of great importance for maintaining the acoustic parameters of cortical bone, as observed for cancellous bone. Ultrasound velocity can be used to evaluate both compact cortical bone quality and bone mineral density. PMID:27982167

Correlation between ultrasound velocity and densitometry in fresh and demineralized cortical bone.

PubMed

Mesquita, Alessandro Queiroz de; Barbieri, Giuliano; Barbieri, Claudio Henrique

2016-11-01

To compare ultrasound propagation velocity with densitometry in the diaphyseal compact cortical bone of whole sheep metatarsals. The transverse ultrasound velocity and bone mineral density of 5-cm-long diaphyseal bone segments were first measured. The bone segments were then divided into four groups of 15 segments each and demineralized in an aqueous 0.5 N hydrochloric acid solution for 6, 12, 24 or 36 hours. All measurements were repeated after demineralization for each time duration and the values measured before and after demineralization were compared. Ultrasound velocity and bone mineral density decreased with demineralization time, and most differences in the pre- and post-demineralization values within each group and between groups were significant: A moderate correlation coefficient (r=0.75956) together with a moderate agreement was determined between both post-demineralization parameters, detected by the Bland-Altman method. We conclude that both ultrasound velocity and bone mineral density decrease as a result of demineralization, thus indicating that bone mineral content is of great importance for maintaining the acoustic parameters of cortical bone, as observed for cancellous bone. Ultrasound velocity can be used to evaluate both compact cortical bone quality and bone mineral density.

Comparison of autogenous cancellous bone grafting and extracorporeal shock wave therapy on osteotomy healing in the tibial tuberosity advancement procedure in dogs. Radiographic densitometric evaluation.

PubMed

Barnes, K; Lanz, O; Werre, S; Clapp, K; Gilley, R

2015-01-01

To compare optical values in the osteotomy gap created after a tibial tuberosity advancement (TTA) treated with autogenous cancellous bone graft, extracorporeal shock wave therapy, a combination of autogenous cancellous bone graft and extracorporeal shock wave therapy, and absence of both autogenous cancellous bone graft and extracorporeal shock wave therapy using densitometry. Dogs that were presented for surgical repair of a cranial cruciate ligament rupture were randomly assigned to one of four groups: TTA with autogenous cancellous bone graft (TTA-G), TTA with autogenous cancellous bone graft and extracorporeal shock wave therapy (TTA-GS), TTA with extracorporeal shock wave therapy (TTA-S), and TTA with no additional therapy (TTA-O). Mediolateral radiographs at zero, four and eight weeks after surgery were evaluated to compare healing of the osteotomy gap via densitometry. An analysis of variance was used to compare the densitometric values between groups. At four weeks after surgery, a significant difference in osteotomy gap density was noted between TTA-GS (8.4 millimetres of aluminium equivalent [mmAleq]) and TTA-S (6.1 mmAleq), and between TTA-GS (8.4 mmAleq) and TTA-O (6.4 mmAleq). There were no significant differences noted between any groups at the eight week re-evaluation. There were no significant differences in the osteotomy gap density at eight weeks after surgery regardless of the treatment modality used. The combination of autogenous cancellous bone graft and extracorporeal shock wave therapy may lead to increased radiographic density of the osteotomy gap in the first four weeks after surgery. Densitometry using an aluminium step wedge is a feasible method for comparison of bone density after TTA in dogs.

Osteopathia striata with cranial sclerosis: clinical, radiological, and bone histological findings in an adolescent girl.

PubMed

Ward, L M; Rauch, F; Travers, R; Roy, M; Montes, J; Chabot, G; Glorieux, F H

2004-08-15

Osteopathia striata with cranial sclerosis (OS-CS) is a rare skeletal dysplasia characterized by linear striations of the long bones, osteosclerosis of the cranium, and extra-skeletal anomalies. We provide a comprehensive description of the skeletal phenotype in a French-Canadian girl with a moderate to severe form of sporadic OS-CS. Multiple medical problems, including anal stenosis and the Pierre-Robin sequence, were evident in the first few years of life. At 14 years, she was fully mobile, with normal intellect and stature. She suffered chronic lower extremity pain in the absence of fractures, as well as severe headaches, unilateral facial paralysis, and bilateral mixed hearing loss. Biochemical indices of bone and mineral metabolism were within normal limits. Bone densitometry showed increased areal bone mineral density in the skull, trunk, and pelvis, but not in the upper and lower extremities. An iliac bone biopsy specimen revealed an increased amount of trabecular bone. Trabeculae were abnormally thick, but there was no evidence of disturbed bone remodeling. In a cranial bone specimen, multiple layers of periosteal bone were found that covered a compact cortical compartment containing tightly packed haversian canals. Bone lamellation was normal in both the iliac and skull samples. Osteoclast differentiation studies showed that peripheral blood osteoclast precursors from this patient formed functional osteoclasts in vitro. Thus, studies of bone metabolism did not explain why bone mass is increased in most skeletal areas of this patient. Cranial histology points to exuberant periosteal bone formation as a potential cause of the cranial sclerosis.

Densitometric and biochemical values of broiler tibias at different ages.

PubMed

Barreiro, F R; Sagula, A L; Junqueira, O M; Pereira, G T; Baraldi-Artoni, S M

2009-12-01

The objective of this experiment was to determine the normal values of bone radiographic density (BRD) by using the optical densitometry in radiographic images and the biochemical values represented by serum calcium, ash percentage, and minerals (calcium, phosphorus, and magnesium) from tibia ash of Cobb broilers at 8, 22, and 43 d of age. A total of 14 broilers were used for densitometric analysis, and 15 were used for biochemical dosages. The BRD values increased (P < 0.05) with age and in all tibia regions (proximal epiphysis, diaphysis, and distal epiphysis), concluding that growth was a determinative factor for bone performance, demanding a higher BRD during broiler development. Tibia proximal epiphysis presented higher BRD values in relation to the other bone regions (P < 0.05), as a result of a possible biomechanical adaptation to ligaments and tension of the muscle tendons at this region, allowing the support of the muscle mass increase. The serum calcium values were kept constant, as a result of the appropriate nutritional levels of the diet that supported the animal homeostasis. The bone ash and mineral percentage increased (P < 0.05) at 22 d of age, due to the higher mineral requirement in this age. The correlation between bone densitometry and the invasive techniques showed that the bone densitometry can substitute the determination of mineral percentage in the ash. This experiment presented normal values of the noninvasive and invasive methods more used in aviculture, allowing us to compare, subsequently, pathological and physiological values or results of broilers fed with different diets.

Comparative effect of soy protein, soy isoflavones, and 17beta-estradiol on bone metabolism in adult ovariectomized rats.

PubMed

Cai, David J; Zhao, Yongdong; Glasier, Jennifer; Cullen, Diane; Barnes, Stephen; Turner, Charles H; Wastney, Meryl; Weaver, Connie M

2005-05-01

This study provided a comprehensive investigation on the effect of soy protein and soy isoflavones on both calcium and bone metabolism in virgin adult rats. The measurements included bone histology, calcium kinetic modeling, calcium balance, bone densitometry, and whole body densitometry. Results confirmed the bone-preserving effect of estrogen but did not support a bone-sparing role of soy isoflavones. Several animal and short-term human studies have indicated that soy protein isolate enriched with isoflavones may be used as an alternative therapy to estrogen replacement therapy. However, none of the previous studies have investigated this estrogenic effect on both calcium and bone metabolism in animals or humans, which is essential in ascertaining the mode of action of isoflavones. This study was designed to determine the effects of soy protein versus isoflavones on calcium and bone metabolism in an ovariectomized rat model. Unmated 6-month-old ovariectomized and sham-operated female Sprague-Dawley rats were randomly assigned to nine groups (16 rats/group) and pair-fed soy- or casein-based diets with or without isoflavones for 8 weeks. A reference group was administered estrogen through subcutaneous implants (20-35 pg/liter plasma). Bone densitometry, histomorphometry, and mechanical testing were used to study bone metabolism and quality. Calcium metabolism was studied using calcium tracer balance and kinetics. After ovariectomy, estrogen prevented bone loss in trabecular bone and suppressed formation on both trabecular and cortical bone surfaces. Isoflavones given as enriched soy protein isolate or supplements did not prevent trabecular bone loss. Combining isoflavones with estrogen had no additional benefits over estrogen alone. There were no differences in response to isoflavones caused by protein source. None of the treatments significantly affected either total Ca balance or (45)Ca absorption. However, soy protein showed significant effects on reducing urinary loss of Ca in animals, irrespective of isoflavone level, perhaps because of the lower amount of sulfur-containing amino acids in soy protein. Estrogen, but not isoflavones at the levels tested, suppressed bone remodeling in both trabecular and cortical bone after ovariectomy.

Long-term therapy in COPD: any evidence of adverse effect on bone?

PubMed Central

Langhammer, Arnulf; Forsmo, Siri; Syversen, Unni

2009-01-01

Patients with COPD have high risk for osteoporosis and fractures. Hip and vertebral fractures might impair mobility, and vertebral fractures further reduce lung function. This review discusses the evidence of bone loss due to medical treatment opposed to disease severity and risk factors for COPD, and therapeutic options for the prevention and treatment of osteoporosis in these patients. A review of the English-language literature was conducted using the MEDLINE database until June 2009. Currently used bronchodilators probably lack adverse effect on bone. Oral corticosteroids (OCS) increase bone resorption and decrease bone formation in a dose response relationship, but the fracture risk is increased more than reflected by bone densitometry. Inhaled corticosteroids (ICS) have been associated with both increased bone loss and fracture risk. This might be a result of confounding by disease severity, but high doses of ICS have similar effects as equipotent doses of OCS. The life-style factors should be modified, use of regular OCS avoided and use of ICS restricted to those with evidenced effect and probably kept at moderate doses. The health care should actively reveal risk factors, include bone densitometry in fracture risk evaluation, and give adequate prevention and treatment for osteoporosis. PMID:19888355

Outcomes of bone density measurements in coeliac disease.

PubMed

Bolland, Mark J; Grey, Andrew; Rowbotham, David S

2016-01-29

Some guidelines recommend that patients with newly diagnosed coeliac disease undergo bone density scanning. We assessed the bone density results in a cohort of patients with coeliac disease. We searched bone density reports over two 5-year periods in all patients from Auckland District Health Board (2008-12) and in patients under 65 years from Counties Manukau District Health Board (2009-13) for the term 'coeliac.' Reports for 137 adults listed coeliac disease as an indication for bone densitometry. The average age was 47 years, body mass index (BMI) 25 kg/m(2), and 77% were female. The median time between coeliac disease diagnosis and bone densitometry was 261 days. The average bone density Z-score was slightly lower than expected (Z-score -0.3 to 0.4) at the lumbar spine, total hip and femoral neck, but 88-93% of Z-scores at each site lay within the normal range. Low bone density was strongly related to BMI: the proportions with Z-score <-2 for BMI <20, 20-25, 25-30, and >30 kg/m(2) were 28%, 15%, 6% and 0% respectively. Average bone density was normal, suggesting that bone density measurement is not indicated routinely in coeliac disease, but could be considered on a case-by-case basis for individuals with strong risk factors for fracture.

The QUALYOR (QUalité Osseuse LYon Orléans) study: a new cohort for non invasive evaluation of bone quality in postmenopausal osteoporosis. Rationale and study design.

PubMed

Chapurlat, Roland; Pialat, Jean-Baptiste; Merle, Blandine; Confavreux, Elisabeth; Duvert, Florence; Fontanges, Elisabeth; Khacef, Farida; Peres, Sylvie Loiseau; Schott, Anne-Marie; Lespessailles, Eric

2017-12-27

The diagnostic performance of densitometry is inadequate. New techniques of non-invasive evaluation of bone quality may improve fracture risk prediction. Testing the value of these techniques is the goal of the QUALYOR cohort. The bone mineral density (BMD) of postmenopausal women who sustain osteoporotic fracture is generally above the World Health Organization definition for osteoporosis. Therefore, new approaches to improve the detection of women at high risk for fracture are warranted. We have designed and recruited a new cohort to assess the predictive value of several techniques to assess bone quality, including high-resolution peripheral quantitative computerized tomography (HRpQCT), hip QCT, calcaneus texture analysis, and biochemical markers. We have enrolled 1575 postmenopausal women, aged at least 50, with an areal BMD femoral neck or lumbar spine T-score between - 1.0 and - 3.0. Clinical risk factors for fracture have been collected along with serum and blood samples. We describe the design of the QUALYOR study. Among these 1575 women, 80% were aged at least 60. The mean femoral neck T-score was - 1.6 and the mean lumbar spine T-score was -1.2. This cohort is currently being followed up. QUALYOR will provide important information on the relationship between bone quality variables and fracture risk in women with moderately decreased BMD.

[Evaluation of bone mineral density in children with sickle cell disease].

PubMed

Garrido Colino, C; Beléndez Bieler, C; Pérez Díaz, M; Cela de Julián, E

2015-04-01

To evaluate bone mineral density (BMD) in children with sickle cell disease (SCD) in the Community of Madrid. The BMD was estimated in 40 children with SCD, and with an age range between 3 and 16 years, using densitometry (DXA), as recommended by the International Society for Clinical Densitometry (ISCD). The mean age at the time of the study was 7.97±3.95 years, the mean value of the DXA expressed in Z -score was -0.91±1.46 with a range of minimum values - 5.30 and 2.30 maximum. More than half (57.5%) of all the children had normal BMD (Z>-1), 25% had low BMD (Z between -1 and -2), and 17.5% showed an abnormal Z -score values of osteoporosis (Z -score<-2). The Pearson linear correlation was statistically significant between Z -score value and the haemoglobin level (r=0.368, p=.019), finding no correlation with the levels of 25 (OH) vitamin D. Prospective studies are needed with a larger number of patients to understand the future implications of bone densitometry changes and associated risk factors. Copyright © 2013 Asociación Española de Pediatría. Published by Elsevier España, S.L.U. All rights reserved.

The soy isoflavones for reducing bone loss study: 3-yr effects on pQCT bone mineral density and strength measures in postmenopausal women.

PubMed

Shedd-Wise, Kristine M; Alekel, D Lee; Hofmann, Heike; Hanson, Kathy B; Schiferl, Dan J; Hanson, Laura N; Van Loan, Marta D

2011-01-01

Soy isoflavones exert inconsistent bone density-preserving effects, but the bone strength-preserving effects in humans are unknown. Our double-blind randomized controlled trial examined 2 soy isoflavone doses (80 or 120mg/d) vs placebo tablets on volumetric bone mineral density (vBMD) and strength (by means of peripheral quantitative computed tomography) in healthy postmenopausal women (46-63yr). We measured 3-yr changes in cortical BMD (CtBMD), cortical thickness (CtThk), periosteal circumference (PC), endosteal circumference (EC), and strength-strain index (SSI) at 1/3 midshaft femur (N=171), and trabecular BMD (TbBMD), PC, and SSI at 4% distal tibia (N=162). We found no treatment effect on femur CtThk, PC, or EC, or tibia TbBMD or PC. The strongest predictors (negative) of tibia TbBMD and SSI and femur CtBMD were timepoint and bone resorption; whole-body fat mass was protective of SSI. As time since last menstrual period (TLMP) increased (p=0.012), 120-mg/d dose was protective of CtBMD. The strongest predictors of femur SSI were timepoint, bone resorption, and TLMP (protective). Isoflavone tablets were negative predictors of SSI, but 80-mg/d dose became protective as bone turnover increased (p=0.011). Soy isoflavone treatment for 3yr was modestly beneficial for midshaft femur vBMD as TLMP increased and for midshaft femur SSI as bone turnover increased. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

[Bone quantitative ultrasound].

PubMed

Matsukawa, Mami

2016-01-01

The conventional ultrasonic bone densitometry system can give us information of bone as ultrasonic wave velocity and attenuation. However, the data reflect both structural and material properties of bone. In order to focus only on the bone matrix properties without the effect of bone structure, studies of microscopic Brillouin scattering technique are introduced. The wave velocity in a trabecula was anisotropic and depended on the position and structure of the cancellous bone. The glycation also affected on the wave velocities in bone. As a new bone quality, the piezoelectricity of bone is also discussed.

Benefits for bone from resistance exercise and nutrition in long-duration spaceflight: Evidence from biochemistry and densitometry.

PubMed

Smith, Scott M; Heer, Martina A; Shackelford, Linda C; Sibonga, Jean D; Ploutz-Snyder, Lori; Zwart, Sara R

2012-09-01

Exercise has shown little success in mitigating bone loss from long-duration spaceflight. The first crews of the International Space Station (ISS) used the "interim resistive exercise device" (iRED), which allowed loads of up to 297 lb(f) (or 1337 N) but provided little protection of bone or no greater protection than aerobic exercise. In 2008, the Advanced Resistive Exercise Device (ARED), which allowed absolute loads of up to 600 lb(f) (1675 N), was launched to the ISS. We report dietary intake, bone densitometry, and biochemical markers in 13 crewmembers on ISS missions from 2006 to 2009. Of these 13, 8 had access to the iRED and 5 had access to the ARED. In both groups, bone-specific alkaline phosphatase tended to increase during flight toward the end of the mission (p = 0.06) and increased 30 days after landing (p < 0.001). Most markers of bone resorption were also increased in both groups during flight and 30 days after landing (p < 0.05). Bone densitometry revealed significant interactions (time and exercise device) for pelvis bone mineral density (BMD) and bone mineral content (p < 0.01), hip femoral neck BMD (p < 0.05), trochanter BMD (p < 0.05), and total hip BMD (p < 0.05). These variables were unchanged from preflight only for ARED crewmembers, who also returned from flight with higher percent lean mass and lower percent fat mass. Body mass was unchanged after flight in both groups. All crewmembers had nominal vitamin D status (75 ± 17 nmol/L) before and during flight. These data document that resistance exercise, coupled with adequate energy intake (shown by maintenance of body mass determined by dual-energy X-ray absorptiometry [DXA]) and vitamin D, can maintain bone in most regions during 4- to 6-month missions in microgravity. This is the first evidence that improving nutrition and resistance exercise during spaceflight can attenuate the expected BMD deficits previously observed after prolonged missions. Copyright © 2012 American Society for Bone and Mineral Research.

Quantitative data standardization of X-ray based densitometry methods

NASA Astrophysics Data System (ADS)

Sergunova, K. A.; Petraikin, A. V.; Petrjajkin, F. A.; Akhmad, K. S.; Semenov, D. S.; Potrakhov, N. N.

2018-02-01

In the present work is proposed the design of special liquid phantom for assessing the accuracy of quantitative densitometric data. Also are represented the dependencies between the measured bone mineral density values and the given values for different X-ray based densitometry techniques. Shown linear graphs make it possible to introduce correction factors to increase the accuracy of BMD measurement by QCT, DXA and DECT methods, and to use them for standardization and comparison of measurements.

Lean mass and fat mass have differing associations with bone microarchitecture assessed by high resolution peripheral quantitative computed tomography in men and women from the Hertfordshire Cohort Study.

PubMed

Edwards, Mark H; Ward, Kate A; Ntani, Georgia; Parsons, Camille; Thompson, Jennifer; Sayer, Avan A; Dennison, Elaine M; Cooper, Cyrus

2015-12-01

Understanding the effects of muscle and fat on bone is increasingly important in the optimisation of bone health. We explored relationships between bone microarchitecture and body composition in older men and women from the Hertfordshire Cohort Study. 175 men and 167 women aged 72-81 years were studied. High resolution peripheral quantitative computed tomography (HRpQCT) images (voxel size 82 μm) were acquired from the non-dominant distal radius and tibia with a Scanco XtremeCT scanner. Standard morphological analysis was performed for assessment of macrostructure, densitometry, cortical porosity and trabecular microarchitecture. Body composition was assessed using dual energy X-ray absorptiometry (DXA) (Lunar Prodigy Advanced). Lean mass index (LMI) was calculated as lean mass divided by height squared and fat mass index (FMI) as fat mass divided by height squared. The mean (standard deviation) age in men and women was 76 (3) years. In univariate analyses, tibial cortical area (p<0.01), cortical thickness (p<0.05) and trabecular number (p<0.01) were positively associated with LMI and FMI in both men and women. After mutual adjustment, relationships between cortical area and thickness were only maintained with LMI [tibial cortical area, β (95% confidence interval (CI)): men 6.99 (3.97,10.01), women 3.59 (1.81,5.38)] whereas trabecular number and density were associated with FMI. Interactions by sex were found, including for the relationships of LMI with cortical area and FMI with trabecular area in both the radius and tibia (p<0.05). In conclusion, LMI and FMI appeared to show independent relationships with bone microarchitecture. Further studies are required to confirm the direction of causality and explore the mechanisms underlying these tissue-specific associations. Copyright © 2015 Elsevier Inc. All rights reserved.

76 FR 55069 - Government-Owned Inventions; Availability for Licensing

Federal Register 2010, 2011, 2012, 2013, 2014

2011-09-06

... health problem primarily affecting the elderly and women after menopause. More specifically, the... automated bone mineral densitometry in a single examination. J Comput Assist Tomogr. 2011 Mar- Apr;35(2):212...

Bone health and adherence to vitamin D and calcium therapy in early breast cancer patients on endocrine therapy with aromatase inhibitors.

PubMed

Bošković, Lidija; Gašparić, Maja; Petković, Marija; Gugić, Damir; Lovasić, Ingrid Belac; Soldić, Željko; Miše, Branka Petrić; Dabelić, Nina; Vazdar, Ljubica; Vrdoljak, Eduard

2017-02-01

Randomized trials involving aromatase inhibitors (AIs) in the adjuvant treatment of breast cancer patients have reported increased osteoporosis risk. Bone loss can be reduced with appropriate life style, vitamin D and calcium supplements, and with bisphosphonate therapy. The aim of this analysis was to investigate adherence to vitamin D and calcium in postmenopausal breast cancer patients receiving adjuvant non-steroidal AIs, and oncologists' adherence to the bone health guidelines. This prospective study included 438 newly diagnosed patients and those who have already been receiving non-steroidal AIs for up to 3.5 years. Median endocrine therapy duration before recruitment in the study was 10.5 months (interquartile 4.8-26.6). Densitometry was performed on 142 patients (32.4%) before initiation of endocrine therapy, and on additional 38 (8.6%) patients at second study visit. Densitometry was not performed on 258 (59%) patients. Vitamin D and calcium were prescribed to 329/438 (75.1%) patients at some point during the study. Patients who took more than 80% of the prescribed dose were considered adherent. Self-reported adherence was 88.4%. Osteoporosis was diagnosed in 24 patients (5.5%) of the total study population, bearing in mind that 258/438 (59%) patients did not have densitometry. Bisphosphonates were prescribed to 54/438 (12.3%) patients, whilst only 19 (35.2%) of those had osteoporosis. In this analysis, lack of oncologists' adherence to the bone health guidelines was observed. In addition, a significant proportion of the patients did not adhere to the vitamin D and calcium. Copyright © 2016 Elsevier Ltd. All rights reserved.

Skeletal changes during and after spaceflight.

PubMed

Vico, Laurence; Hargens, Alan

2018-03-21

Space sojourns are challenging for life. The ability of the human body to adapt to these extreme conditions has been noted since the beginning of human space travel. Skeletal alterations that occur during spaceflight are now better understood owing to tools such as dual-energy X-ray densitometry and high-resolution peripheral quantitative CT, and murine models help researchers to understand cellular and matrix changes that occur in bone and that are difficult to measure in humans. However, questions remain with regard to bone adaptation and osteocyte fate, as well as to interactions of the skeleton with fluid shifts towards the head and with the vascular system. Further investigations into the relationships between the musculoskeletal system, energy metabolism and sensory motor acclimatisation are needed. In this regard, an integrated intervention is required that will address multiple systems simultaneously. Importantly, radiation and isolation-related stresses are gaining increased attention as the prospect of human exploration into deep space draws nearer. Although space is a unique environment, clear parallels exist between the effects of spaceflight, periods of immobilization and ageing, with possibly irreversible features. Space travel offers an opportunity to establish integrated deconditioning and ageing interventions that combine nutritional, physical and pharmaceutical strategies.

The Relevance of Osteoclastic and Osteoblastic Activity Markers Follow-Up in Patients on Antiresorptive Osteoporosis Treatment.

PubMed

Smilic, Tanja N; Novakovic, Tatjana R; Markovic-Jovanovic, Snezana R; Smilic, Ljiljana L J; Mitic, Javorka S; Radunovic, Miodrag L

2017-11-02

In general, markers of bone formation and markers of bone resorption are changing synergistically, so the monitoring of any osteoclastic and any osteoblastic marker should reflect the rate of bone transformation. The aim of the study is to monitor the bone metabolism markers in postmenopausal women with osteoporosis and osteopenia along with the variations caused by the effects of bisphosphonate therapy. The study involved 55 women of average age of 57.95 years, with osteopenia or osteoporosis. The patients with osteoporosis were treated with bisphosphonates (75 mg once a week); the laboratory tests were performed before the treatment and 6 months later. Patients with osteopenia were evaluated at the first assessment and 6 months later. The tests included bone densitometry, dual-energy X-ray absorptiometry, osteocalcin, alkaline phosphatase, collagen 1 N-terminal pro-peptide (P1NP), and beta C telopeptide of type I collagen (CTX). The mean T-score was -2.80 ± 0.63 before therapy and -2.64 ± 0.45 6 months later (p < 0.001). Women with osteoporosis had elevated levels of osteocalcin and P1NP at the first assessment, whereas the alkaline phosphatase level did not change with the treatment. After the introduction of antiresorptive therapy, the levels of osteocalcin and P1NP significantly decreased (p < 0.001). In the group with osteopenia, the biochemical markers activity were increased in both assessments. In patients with osteoporosis, Beta-CTX was increased in the first evaluation, and decreased after treatment (p = 0.001). The results indicate that the assessment of biochemical markers of bone metabolism show excellent results in the assessment of prognosis, monitoring the course and the response to various treatment regimens of osteoporosis and evince strong correlation with standard densitometry and dual-energy X-ray absorptiometry procedures. P1NP and CTX show better diagnostic applicability compared with osteocalcin and alkaline phosphatase. The analysis of the activity of biochemical markers may obtain early information on the therapeutic response, before definitive assessment by bone density measurements. Copyright © 2017 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

30years of DXA technology innovations.

PubMed

Glüer, Claus-C

2017-11-01

As the successor of Dual Photon Absorptiometry (DPA), Dual X-ray Absorptiometry (DXA) has seen 30years of continuous technological innovations. Implementation of measures for standardization and quality assurance made DXA a reliable and clinically useful approach. Its use in clinical multicenter drug studies in osteoporosis lead to general acceptance as the standard technique of bone densitometry. The limitations of DXA are well established. As a measure of areal bone mineral density (aBMD) it depends on bone size and is biased by overlaying soft tissue and calcified structures. To some extent these errors can be reduced by estimation of bone depth and/or lateral imaging. DXA based aBMD can be supplemented by additional information obtainable from DXA scans: geometric indices such as hip axis length or complex models like 2-D finite element analysis have been developed and tested. Given the drastic improvement in image quality current DXA scans can be used for Vertebral Fracture Analysis (VFA) or grading of Abdominal Aortic Calcifications. A textural measure, Trabecular Bone Score (TBS) provides independent information on fracture risk. DXA devices can also be used for assessments beyond bone density. Periprosthetic aBMD changes can be monitored to study the mechanical fitting of bone implants. Total body composition measurements are increasingly being used in studies on nutrition, obesity, and sarcopenia. 30years after its inception DXA is the undisputed standard imaging technique for the assessment of osteoporotic fracture risk with new applications beyond bone densitometry adding to its value. Copyright © 2017 Elsevier Inc. All rights reserved.

Dual Energy X-Ray Densitometry Apparatus and Method Using Single X-Ray Pulse

DTIC Science & Technology

1999-10-13

future bone fracture risk. Bone mineral loss is associated with aging and is more rapid in post-menopausal women. In addition, bone mineral loss is... parameters of the x-ray tube of Figures 1 and 2 illustrating, respectively, the calculated current, voltage and power; and Figures 4(a) and 4(d) are...assumed to be that of water. The bone mineral is hydroxyapatite (Ca5P30i3H) with an assumed density of 0.25 g/cm3 based on the lumbar vertebra metrology

Clinical Guidelines for Management of Bone Health in Rett Syndrome Based on Expert Consensus and Available Evidence.

PubMed

Jefferson, Amanda; Leonard, Helen; Siafarikas, Aris; Woodhead, Helen; Fyfe, Sue; Ward, Leanne M; Munns, Craig; Motil, Kathleen; Tarquinio, Daniel; Shapiro, Jay R; Brismar, Torkel; Ben-Zeev, Bruria; Bisgaard, Anne-Marie; Coppola, Giangennaro; Ellaway, Carolyn; Freilinger, Michael; Geerts, Suzanne; Humphreys, Peter; Jones, Mary; Lane, Jane; Larsson, Gunilla; Lotan, Meir; Percy, Alan; Pineda, Mercedes; Skinner, Steven; Syhler, Birgit; Thompson, Sue; Weiss, Batia; Witt Engerström, Ingegerd; Downs, Jenny

2016-01-01

We developed clinical guidelines for the management of bone health in Rett syndrome through evidence review and the consensus of an expert panel of clinicians. An initial guidelines draft was created which included statements based upon literature review and 11 open-ended questions where literature was lacking. The international expert panel reviewed the draft online using a 2-stage Delphi process to reach consensus agreement. Items describe the clinical assessment of bone health, bone mineral density assessment and technique, and pharmacological and non-pharmacological interventions. Agreement was reached on 39 statements which were formulated from 41 statements and 11 questions. When assessing bone health in Rett syndrome a comprehensive assessment of fracture history, mutation type, prescribed medication, pubertal development, mobility level, dietary intake and biochemical bone markers is recommended. A baseline densitometry assessment should be performed with accommodations made for size, with the frequency of surveillance determined according to individual risk. Lateral spine x-rays are also suggested. Increasing physical activity and initiating calcium and vitamin D supplementation when low are the first approaches to optimizing bone health in Rett syndrome. If individuals with Rett syndrome meet the ISCD criterion for osteoporosis in children, the use of bisphosphonates is recommended. A clinically significant history of fracture in combination with low bone densitometry findings is necessary for a diagnosis of osteoporosis. These evidence and consensus-based guidelines have the potential to improve bone health in those with Rett syndrome, reduce the frequency of fractures, and stimulate further research that aims to ameliorate the impacts of this serious comorbidity.

National protocol for quality assurance in DXA-bone densitometry

NASA Astrophysics Data System (ADS)

Slavchev, A.; Avramova-Cholakova, S.; Vassileva, J.

2008-01-01

Osteoporosis becomes largely one of the most important socially significant and costly diseases. Modern techniques (DXA, US) are applied for bone densitometry. The paper presents a protocol for quality assurance especially of DXA-bone densitometers including quality control made in compliance with international standards (ISCD, IOF). The methodology has been tested in practice by measurements on site-functional assessment, entrance dose, radiation protection, calibration, in-vitro precision. It is expected to raise the quality of the diagnostic process in concert with the EU Medical Directive 97/43 particularly for population screening and sensitive groups. The protocol is an essential part of the National Program for constraining osteoporosis which has been elaborated at the Ministry of Health and at present under implementation throughout the country. It aims at reducing the risk, factors spreading, at diminishing the fracture risk the morbidity and the mortality from osteoporosis. An integral multidisciplinary approach to the problem solving is applied as well as training on three levels — doctors, patients, population, which effectively will contribute for obtaining real results in preventing osteoporosis.

Physician visits and preventive care among Asian American and Pacific Islander long-term survivors of colorectal cancer, USA, 1996-2006.

PubMed

Steele, C Brooke; Townsend, Julie S; Tai, Eric; Thomas, Cheryll C

2014-03-01

Published literature on receipt of preventive healthcare services among Asian American and Pacific Islander (API) cancer survivors is scarce. We describe patterns in receipt of preventive services among API long-term colorectal cancer (CRC) survivors. Surveillance, Epidemiology, and End Results registry-Medicare data were used to identify 9,737 API and white patients who were diagnosed with CRC during 1996-2000 and who survived 5 or more years beyond their diagnoses. We examined receipt of vaccines, mammography (females), bone densitometry (females), and cholesterol screening among the survivors and how the physician specialties they visited for follow-up care correlated to services received. APIs were less likely than whites to receive mammography (52.0 vs. 69.3 %, respectively; P < 0.0001) but more likely to receive influenza vaccine, cholesterol screening, and bone densitometry. These findings remained significant in our multivariable model, except for receipt of bone densitometry. APIs visited PCPs only and both PCPs and oncologists more frequently than whites (P < 0.0001). Women who visited both PCPs and oncologists compared with PCPs only were more likely to receive mammography (odds ratio = 1.40; 95 % confidence interval, 1.05-1.86). Visits to both PCPs and oncologists were associated with increased use of mammography. Although API survivors visited these specialties more frequently than white survivors, API women may need culturally appropriate outreach to increase their use of this test. Long-term cancer survivors need to be aware of recommended preventive healthcare services, as well as who will manage their primary care and cancer surveillance follow-up.

Official Positions for FRAX® Bone Mineral Density and FRAX® simplification from Joint Official Positions Development Conference of the International Society for Clinical Densitometry and International Osteoporosis Foundation on FRAX®.

PubMed

Lewiecki, E Michael; Compston, Juliet E; Miller, Paul D; Adachi, Jonathan D; Adams, Judith E; Leslie, William D; Kanis, John A; Moayyeri, Alireza; Adler, Robert A; Hans, Didier B; Kendler, David L; Diez-Perez, Adolfo; Krieg, Marc-Antoine; Masri, Basel K; Lorenc, Roman R; Bauer, Douglas C; Blake, Glen M; Josse, Robert G; Clark, Patricia; Khan, Aliya A

2011-01-01

Tools to predict fracture risk are useful for selecting patients for pharmacological therapy in order to reduce fracture risk and redirect limited healthcare resources to those who are most likely to benefit. FRAX® is a World Health Organization fracture risk assessment algorithm for estimating the 10-year probability of hip fracture and major osteoporotic fracture. Effective application of FRAX® in clinical practice requires a thorough understanding of its limitations as well as its utility. For some patients, FRAX® may underestimate or overestimate fracture risk. In order to address some of the common issues encountered with the use of FRAX® for individual patients, the International Society for Clinical Densitometry (ISCD) and International Osteoporosis Foundation (IOF) assigned task forces to review the medical evidence and make recommendations for optimal use of FRAX® in clinical practice. Among the issues addressed were the use of bone mineral density (BMD) measurements at skeletal sites other than the femoral neck, the use of technologies other than dual-energy X-ray absorptiometry, the use of FRAX® without BMD input, the use of FRAX® to monitor treatment, and the addition of the rate of bone loss as a clinical risk factor for FRAX®. The evidence and recommendations were presented to a panel of experts at the Joint ISCD-IOF FRAX® Position Development Conference, resulting in the development of Joint ISCD-IOF Official Positions addressing FRAX®-related issues. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Past and current weight change and forearm bone loss in middle-aged women: the Nord-Trøndelag Health Study, Norway.

PubMed

Forsmo, Siri; Langhammer, Arnulf; Schei, Berit

2009-01-01

The aim of this study was to investigate the association between bone loss and weight change before and concurrently to the assessment of forearm bone loss over 4.6 years in a population-based cohort of middle-aged women followed for more than 15 years. Among 8,856 women aged 45 to 60 years attending the first Nord-Trøndelag Health Study study, Norway (1984-1986), a 35% random sample was invited for forearm densitometry at Nord-Trøndelag Health Study 2 (1995-1997), and 2,188 women (78%) attended. After an average period of 4.6 years, they were subsequently invited for follow-up densitometry in 2001, and 1,421 women (67.8%) met. Weight and height were measured on all three occasions. During the total period of observation since baseline (15.5 y), the mean weight had increased by 3.4 kg, mostly in the youngest women. Weight loss had an accelerating and weight gain a decelerating effect on bone loss, and this was observed both for weight change occurring before the bone mineral density follow-up and for concurrent weight change. The relationship between prior weight gain or loss and bone loss seemed to persist, independent of the weight change observed during the period of bone loss assessment. Despite no mechanical impact of body weight on the forearm, weight loss in midlife women seems to be associated with a long-lasting negative effect on bone and vice versa for weight gain. This is presumably explained by humoral factors.

Position statement : executive summary. The Writing Group for the International Society for Clinical Densitometry (ISCD) Position Development Conference.

PubMed

2004-01-01

The International Society for Clinical Densitometry (ISCD) held a Position Development Conference in July 2003, at which time positions developed and researched by the organization's Scientific Advisory Committee were presented to a panel of international experts in the field of bone density testing. This panel reached agreement on a series of positions that were subsequently approved by the Board of Directors of the ISCD and are now official policy of the ISCD. These positions, which are outlined in this article and discussed in greater detail in subsequent articles in this journal, include (1) affirmation of the use of the World Health Organization classification for the diagnosis of osteoporosis in postmenopausal women; (2) the diagnosis of osteoporosis in men; (3) the diagnosis of osteoporosis in premenopausal women; (4) the diagnosis of osteoporosis in children; (5) technical standards for skeletal regions of interest by dual-energy X-ray absorptiometry (DXA); (6) the use of new technologies, such as vertebral fracture assessment; (7) technical standards for quality assurance, including phantom scanning and calibration; (8) technical standards for the performance of precision assessment at bone density testing centers, and for cross-calibration of DXA devices; (9) indications for bone density testing; (10) appropriate information for a bone density report; and (11) nomenclature and decimal places for bone density reporting.

Determination of Small Animal Long Bone Properties Using Densitometry

NASA Technical Reports Server (NTRS)

Breit, Gregory A.; Goldberg, BethAnn K.; Whalen, Robert T.; Hargens, Alan R. (Technical Monitor)

1996-01-01

Assessment of bone structural property changes due to loading regimens or pharmacological treatment typically requires destructive mechanical testing and sectioning. Our group has accurately and non-destructively estimated three dimensional cross-sectional areal properties (principal moments of inertia, Imax and Imin, and principal angle, Theta) of human cadaver long bones from pixel-by-pixel analysis of three non-coplanar densitometry scans. Because the scanner beam width is on the order of typical small animal diapbyseal diameters, applying this technique to high-resolution scans of rat long bones necessitates additional processing to minimize errors induced by beam smearing, such as dependence on sample orientation and overestimation of Imax and Imin. We hypothesized that these errors are correctable by digital image processing of the raw scan data. In all cases, four scans, using only the low energy data (Hologic QDR-1000W, small animal mode), are averaged to increase image signal-to-noise ratio. Raw scans are additionally processed by interpolation, deconvolution by a filter derived from scanner beam characteristics, and masking using a variable threshold based on image dynamic range. To assess accuracy, we scanned an aluminum step phantom at 12 orientations over a range of 180 deg about the longitudinal axis, in 15 deg increments. The phantom dimensions (2.5, 3.1, 3.8 mm x 4.4 mm; Imin/Imax: 0.33-0.74) were comparable to the dimensions of a rat femur which was also scanned. Cross-sectional properties were determined at 0.25 mm increments along the length of the phantom and femur. The table shows average error (+/- SD) from theory of Imax, Imin, and Theta) over the 12 orientations, calculated from raw and fully processed phantom images, as well as standard deviations about the mean for the femur scans. Processing of phantom scans increased agreement with theory, indicating improved accuracy. Smaller standard deviations with processing indicate increased precision and repeatability. Standard deviations for the femur are consistent with those of the phantom. We conclude that in conjunction with digital image enhancement, densitometry scans are suitable for non-destructive determination of areal properties of small animal bones of comparable size to our phantom, allowing prediction of Imax and Imin within 2.5% and Theta within a fraction of a degree. This method represents a considerable extension of current methods of analyzing bone tissue distribution in small animal bones.

Clinical Guidelines for Management of Bone Health in Rett Syndrome Based on Expert Consensus and Available Evidence

PubMed Central

Jefferson, Amanda; Leonard, Helen; Siafarikas, Aris; Woodhead, Helen; Fyfe, Sue; Ward, Leanne M.; Munns, Craig; Motil, Kathleen; Tarquinio, Daniel; Shapiro, Jay R.; Brismar, Torkel; Ben-Zeev, Bruria; Bisgaard, Anne-Marie; Coppola, Giangennaro; Ellaway, Carolyn; Freilinger, Michael; Geerts, Suzanne; Humphreys, Peter; Jones, Mary; Lane, Jane; Larsson, Gunilla; Lotan, Meir; Percy, Alan; Pineda, Mercedes; Skinner, Steven; Syhler, Birgit; Thompson, Sue; Weiss, Batia; Witt Engerström, Ingegerd; Downs, Jenny

2016-01-01

Objectives We developed clinical guidelines for the management of bone health in Rett syndrome through evidence review and the consensus of an expert panel of clinicians. Methods An initial guidelines draft was created which included statements based upon literature review and 11 open-ended questions where literature was lacking. The international expert panel reviewed the draft online using a 2-stage Delphi process to reach consensus agreement. Items describe the clinical assessment of bone health, bone mineral density assessment and technique, and pharmacological and non-pharmacological interventions. Results Agreement was reached on 39 statements which were formulated from 41 statements and 11 questions. When assessing bone health in Rett syndrome a comprehensive assessment of fracture history, mutation type, prescribed medication, pubertal development, mobility level, dietary intake and biochemical bone markers is recommended. A baseline densitometry assessment should be performed with accommodations made for size, with the frequency of surveillance determined according to individual risk. Lateral spine x-rays are also suggested. Increasing physical activity and initiating calcium and vitamin D supplementation when low are the first approaches to optimizing bone health in Rett syndrome. If individuals with Rett syndrome meet the ISCD criterion for osteoporosis in children, the use of bisphosphonates is recommended. Conclusion A clinically significant history of fracture in combination with low bone densitometry findings is necessary for a diagnosis of osteoporosis. These evidence and consensus-based guidelines have the potential to improve bone health in those with Rett syndrome, reduce the frequency of fractures, and stimulate further research that aims to ameliorate the impacts of this serious comorbidity. PMID:26849438

Effects of anticonvulsants and inactivity on bone disease in epileptics

PubMed Central

Murchison, Lilian E.; Bewsher, P. D.; Chesters, Marion; Gilbert, J.; Catto, G.; Law, Elizabeth; McKay, E.; Ross, H. S.

1975-01-01

No significant biochemical or radiological features of vitamin D deficiency were found in groups of juvenile and adult epileptics and control groups of non-epileptic patients in hospitals for the mentally retarded. There was evidence of hepatic enzyme induction in patients on anticonvulsants, in that urinary D-glucaric acid concentration and excretion were raised. No effect was found of prolonged anticonvulsant therapy on bone densitometry, but in children immobility was closely associated with decreased bone density. The evidence suggests that disuse osteoporosis is the major bone disease in these mentally retarded children. PMID:1161672

Preventive Care Screening in the Puerto Rican Geriatric Population: A Formative Evaluation of Patient Knowledge.

PubMed

Sepúlveda-Rivera, Vanessa; Donato-Santana, Christian; Diaz-Vega, Gil

2017-12-01

This study was meant to be the first step in bridging a gap in the literature concerning Puerto Rican geriatric patients' levels of knowledge concerning 4 preventive care screening tests: mammography, bone densitometry, colonoscopy, and lipid panels. Patients 65 years old and older were interviewed at the University of Puerto Rico (UPR), Medical Sciences Campus, primary care clinics. Fisher's exact test was used to assess knowledge status for each screening test. Fifty-three participants, 53% being women, took part in the study. All the women (100%) reported having knowledge about mammography screening as well as about bone densitometry scans (71%); 91% of the participants reported having knowledge concerning colonoscopy. Only 34% understood what information results from a lipid panel. The majority of the participants were not aware of precisely when each of the screening tests under discussion should be undertaken. For all the screenings, level of education and provider recommendation were associated with increased levels of knowledge (though statistically significant only for bone densitometry and lipid panels). Elderly Puerto Ricans appear to have knowledge about screening tests; however, there is an overall lack of knowledge about the timing of screening. Risk factors for this lack of knowledge are having a relatively lower level of education, the lack of healthcare-provider recommendation, and the lack of patient education. Understanding when to have tests is vital for interventions, in order to improve patient outcomes, which can include death from treatable conditions or diseases. Future research should include larger samples as well as studies of outcomes associated with these screening tests. These will help researchers and policymakers better understand this issue and aid in the development and implementation of interventions for both patients and physicians.

Clinical relevance of radiologic examination of the skeleton and bone density measurements in osteoporosis of old age

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuester, W.; Seidl, G.; Linkesch, W.

1981-10-01

For the diagnosis of primary osteoporosis, various semiquantitative radiologic methods were compared in 149 unselected patients, aged over 50 years. Crush fracture syndrome (CFS), lumbar spine index (LSI), and Singh Index (SI) were assessed by three radiologists and after reevaluation, the intra- and interobserver errors were calculated. The reliability of the subjective grading was improved by joint and repeated reading of the radiographs. Additionally, the peripheral trabecular bone content was measured by photon absorption densitometry (PAD). To test the value of the various semiquantitative methods. LSI, Si, and PAD have been compared with sex-matching before and after separation into agemore » in decades in CFS-positive and CFS-negative patients. In an attempt to differentiate osteoporotics and non-osteoporotics by CFS, our results indicate that CFS-positive and CFS-negative males cannot be separated by LSI, Si, and PAD, whereas in females these methods can discriminate irrespective of the age in decades. However, in age related groups, only SI can discriminate significantly between CFS-positive and CFS-negative females. Correlation of the semiquantitative methods, regardless of the diagnosis of a CFS, revealed a significant correlation-between SI and PAD, but no correlation between LSI and SI, and LSI and PAD, respectively.« less

Relationship between metabolic syndrome and its components with bone densitometry in postmenopausal women.

PubMed

Abbasi, Mahnaz; Farzam, Seyed Amir; Mamaghani, Zahra; Yazdi, Zohreh

2017-11-01

Prevention of osteoporosis and bone fracture and the relationship between metabolic syndrome and bone density are controversial issues. The aim of this study was to evaluate the association between metabolic syndrome and its components with bone mineral density in post menopausal women referred for bone mineral density (BMD) test. A total of 143 postmenopausal women with at least one year of menopause experience participated in this cross-sectional study. Demographic and anthropometric characteristics for all participants were collected. Also, biochemical parameters including fasting blood sugar, Cholesterol (HDL and LDL), triglyceride were measured. Association between the components of metabolic syndrome and bone densitometry were analyzed by statistical methods. In this study, 72% of participants did not have metabolic syndrome. Among them, 43.4% and 28.7% had osteoporosis and normal density, respectively. Of remaining participants with metabolic syndrome, 12.6% and 15.4% had osteoporosis and normal density, respectively. Among the metabolic syndrome components, waist circumference, HDL cholesterol, and waist to hip ratio were significantly associated with bone mass (P<0.05). Osteoporotic women had lower waist circumference and waist to hip ratio and higher HDL than women without osteoporosis. On the other hand, women with metabolic syndrome did not have significant differences than women without metabolic syndrome in terms of lumbar and femoral neck density (P>0.05). Results from this study showed that metabolic syndrome and its components did not induce bone mass loss. The discrepancies of the studies in this area call for more large scale studies in population so as to prevent women problems in this area. Copyright © 2016 Diabetes India. Published by Elsevier Ltd. All rights reserved.

Analysis of the effects of growth hormone, exercise and food restriction on cancellous bone in different bone sites in middle-aged female rats.

PubMed

Banu, J; Orhii, P B; Okafor, M C; Wang, L; Kalu, D N

2001-06-01

The aim of this study is to determine the effects of growth hormone (GH), exercise (EX), GH+EX and food restriction on cancellous bone in middle-aged female rats. Female F344 rats aged 13 months were divided into (1) age-matched controls; (2) GH treated (2.5 mg/kg. 5 day/week); (3) EX (voluntary wheel running); (4) GH+EX; and (5) food restricted (FR) (fed 60% of the ad libitum food intake). The animals were treated for 18 weeks, at the end of which they were sacrificed. Cancellous bone and cortical bone in the fourth lumbar vertebra, proximal tibial metaphysis (PTM), distal femoral metaphysis (DFM) and femoral neck (NF) were analyzed using peripheral quantitative computerized tomography (pQCT) densitometry. Growth hormone increased cancellous bone area, cancellous bone mineral content, cortical bone area and cortical bone mineral content in the vertebra, PTM, DFM and NF. The tibial muscle wet weight was increased significantly after GH treatment. Exercise increased the cancellous bone area in the vertebra, PTM and DFM. Cortical bone area and cortical bone mineral content increased after EX in the vertebra, PTM, DFM and NF. No significant change was seen in the tibial muscle wet weight after EX. Growth hormone+EX increased cancellous bone area in the vertebra PTM and DFM but had no effect in neck of the femur. Cancellous bone mineral content, cortical bone area and cortical bone mineral content increased with GH+EX in the vertebra, PTM, DFM and NF. The tibial muscle wet weight was increased significantly with GH+EX. Food restriction decreased cancellous bone area and cancellous bone mineral content in all the bones studied. The decrease was statistically significant only at the distal femoral metaphysis. The tibial muscle wet weight decreased when compared with the age-matched control, but this decrease was not statistically significant. We conclude that the effect of the dose of GH used and the levels of voluntary wheel running EX used increased cancellous bone in intact rats; the effect of GH is much greater and different bones respond with varying intensities. The effects of combined treatment of GH and EX on cancellous bone are not always significantly higher than those of GH alone. FR at the level studied has a mostly negative effect on cancellous bone.

Is bone mineral density measurement using dual-energy X-ray absorptiometry affected by gamma rays?

PubMed

Xie, Liang-Jun; Li, Jian-Fang; Zeng, Feng-Wei; Jiang, Hang; Cheng, Mu-Hua; Chen, Yi

2013-01-01

The objective of this study was to determine whether the gamma rays emitted from the radionuclide effect bone mineral density (BMD) measurement. Nine subjects (mean age: 56 ± 17.96 yr) scheduled for bone scanning underwent BMD measurement using dual-energy X-ray absorptiometry (DXA) (Hologic/Discovery A) before and 1, 2, and 4 h after injection of technetium-99m-methylene diphosphonate (99mTc-MDP). Ten subjects (mean age: 41 ± 15.47 yr) scheduled for therapy of differentiated thyroid carcinoma with iodine-131 underwent BMD measurement before and 2 h after therapeutic radionuclide administration. All patients were given whole body BMD measurement, including head, arm, ribs, lumbar spine, pelvis, and leg sites. Besides, patients who referred to radioiodine therapy were given total hip and femoral neck BMD measurement as well. No statistically significant changes in BMD values were detected after 99mTc-MDP and iodine-131 administration for all measurement sites (p > 0.05), and individual difference of BMD before and after radionuclide imaging or therapy was less than the least significant change in lumbar spine, total hip, and femoral neck. In conclusion, BMD measurements are not influenced by the gamma rays emitted from technetium-99m and iodine-131. DXA bone densitometry may be performed simultaneously with bone scanning and radioiodine therapy. Copyright © 2013 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Validation of Long Bone Mechanical Properties from Densitometry

NASA Technical Reports Server (NTRS)

Whalen, R.; Katz, B.; Cleek, T.; Hargens, Alan R. (Technical Monitor)

1995-01-01

The objective of this study was to assess whether cross-sectional areal properties, calculated from densitometry, correlate to the true flexural properties. Right and left male embalmed tibiae were used in the study. Prior to scanning, the proximal end of each tibia was potted in a fixture with registration pins, flushed thoroughly with water under pressure to remove trapped air, and then placed in a constant thickness water bath attached to a precision indexer. Two sets of three scans of the entire tibia were taken with an Hologic QDR 1000/W densitometer at rotations of 0, 45, and 90 degrees about the tibia long axis. An aluminum step phantom and a bone step phantom, machined from bovine cortical bone, were also in the bath and scanned separately. Pixel attenuation data from the two sets of scans were averaged to reduce noise. Pixel data from the high energy beam were then converted to equivalent thicknesses using calibration equations. Cross-sectional areal properties (centroid, principal area moments and principal angle) along the length were computed from the three registered scans using methods developed in our laboratory. Flexural rigidities. Four strain gages were bonded around the circumference of each of 5 cross-sections encompassing the entire diaphysis. A known transverse load was then applied to the distal end and the bone was rotated 360 degrees in eight increments of 45 degrees each. Strains from the eight orientations were analyzed along with the known applied bending moments at each section to compute section centroids, curvatures, principal flexural rigidities and principal angle. Reference axes between the two methods were maintained within +/- 0.5 degrees using an electronic inclinometer. Principal angles (flexural - areal) differed by -2.0 +/- 4.0 degrees, and 1.0 +/- 2.5 degrees for the right and left tibia, respectively. Section principal flexural rigidities were highly correlated to principal areal moments (right: r(sup 2)= 0.997; left: r(sup 2)= 0.978) indicating a nearly constant effective flexural modulus. Right and left tibia exhibited a very high degree of symmetry when comparing either flexural or areal properties. To our knowledge this is the first study to validate the use of densitometry (DXA) to predict three dimensional structural properties of long bones. Our initial results support the conclusion that bone mineral and its distribution are the primary determinants of flexural modulus and rigidity.

Usefulness of the Trabecular Bone Score for assessing the risk of osteoporotic fracture.

PubMed

Redondo, L; Puigoriol, E; Rodríguez, J R; Peris, P; Kanterewicz, E

2018-04-01

The trabecular bone score (TBS) is an imaging technique that assesses the condition of the trabecular microarchitecture. Preliminary results suggest that TBS, along with the bone mineral density assessment, could improve the calculation of the osteoporotic fracture risk. The aim of this study was to analyse TBS values and their relationship with the clinical characteristics, bone mineral density and history of fractures of a cohort of posmenopausal women. We analysed 2,257 posmenopausal women from the FRODOS cohort, which was created to determine the risk factors for osteoporotic fracture through a clinical survey and bone densitometry with vertebral morphometry. TBS was applied to the densitometry images. TBS values ≤1230 were considered indicative of degraded microarchitecture. We performed a simple and multiple linear regression to determine the factors associated with this index. The mean TBS value in L1-L4 was 1.203±0.121. Some 55.3% of the women showed values indicating degraded microarchitecture. In the multiple linear regression analysis, the factors associated with low TBS values were age, weight, height, spinal T-score, glucocorticoid treatment, presence of type 2 diabetes and a history of fractures due to frailty. TBS showed microarchitecture degradation values in the participants of the FRODOS cohort and was associated with anthropometric factors, low bone mineral density values, the presence of fractures, a history of type 2 diabetes mellitus and the use of glucocorticoids. Copyright © 2017 Elsevier España, S.L.U. and Sociedad Española de Medicina Interna (SEMI). All rights reserved.

Standards and measurements for assessing bone health-workshop report co-sponsored by the International Society for Clinical Densitometry (ISCD) and the National Institute of Standards and Technology (NIST).

PubMed

Bennett, Herbert S; Dienstfrey, Andrew; Hudson, Lawrence T; Oreskovic, Tammy; Fuerst, Thomas; Shepherd, John

2006-01-01

This article reports and discusses the results of the recent ISCD-NIST Workshop on Standards and Measurements for Assessing Bone Health. The purpose of the workshop was to assess the status of efforts to standardize and compare results from dual-energy X-ray absorptiometry (DXA) scans, and then to identify and prioritize ongoing measurement and standards needs.

Effects of Curcumin on Bone Loss and Biochemical Markers of Bone Turnover in Patients with Spinal Cord Injury.

PubMed

Hatefi, Masoud; Ahmadi, Mohammad Reza Hafezi; Rahmani, Asghar; Dastjerdi, Masoud Moghadas; Asadollahi, Khairollah

2018-06-01

Osteoporosis is one of the most common problems of patients with spinal cord injuries (SCIs). The current study aimed to evaluate the antiosteoporotic effects of curcumin on densitometry parameters and biomarkers of bone turnovers among patients with SCI. The current controlled clinical trial was conducted among 100 patients with SCI referred to an outpatient clinic of rehabilitation in Ilam City, Iran, in 2013-2015. The intervention group received 110/mg/kg/day curcumin for 6 months and the control group received placebo. Bone mineral density (BMD) was measured in all patients. The level of procollagen type I N-terminal propeptide, serum carboxy-terminal telopeptide of type I collagen, osteocalcin, and bone-specific alkaline phosphates were compared before and after study. BMD indicators of lumbar, femoral neck, and total hip in the control group significantly decreased compared with the beginning of study. However, in the curcumin group, a significant increase was observed in BMD indicators of lumbar, femoral neck, and hip at the end of study compared with the beginning. There was also a significant difference between interventional and control groups for the mean BMD of femoral neck and hip at the end of study (0.718 ± 0.002 g/cm 2 vs. 0.712 ± 0.003 g/cm 2 and 0.742 ± 0.031 g/cm 2 vs. 0.692 ± 0.016 g/cm 2 , respectively). Curcumin, via modulation of densitometry indices and bone resorption markers, showed inhibitory effects on the process of osteoporosis. Treatment with curcumin was significantly associated with a decrease in the osteoporosis progression and bone turnover markers of patients with SCI after 6 months. Copyright © 2018 Elsevier Inc. All rights reserved.

Three Dimensional Cross-Sectional Properties From Bone Densitometry

NASA Technical Reports Server (NTRS)

Cleek, Tammy M.; Whalen, Robert T.; Dalton, Bonnie P. (Technical Monitor)

2001-01-01

Bone densitometry has previously been used to obtain cross-sectional properties of bone in a single scan plane. Using three non-coplanar scans, we have extended the method to obtain the principal area Moments of inertia and orientations of the principal axes at each cross-section along the length of the scan. Various 5 aluminum phantoms were used to examine scanner characteristics to develop the highest accuracy possible for in vitro non-invasive analysis of mass distribution. Factors considered included X-ray photon energy, initial scan orientation, the included angle of the 3 scans, and Imin/Imax ratios. Principal moments of inertia were accurate to within 3.1% and principal angles were within 1 deg. of the expected value for phantoms scanned with included angles of 60 deg. and 90 deg. at the higher X-ray photon energy. Low standard deviations in error also 10 indicate high precision of calculated measurements with these included angles. Accuracy and precision decreased slightly when the included angle was reduced to 30 deg. The method was then successfully applied to a pair of excised cadaveric tibiae. The accuracy and insensitivity of the algorithms to cross-sectional shape and changing isotropy (Imin/Imax) values when various included angles are used make this technique viable for future in vivo studies.

Cough-induced rib fractures.

PubMed

Hanak, Viktor; Hartman, Thomas E; Ryu, Jay H

2005-07-01

To define the demographic, clinical, and radiological features of patients with cough-induced rib fractures and to assess potential risk factors. For this retrospective, single-center study, we identified all cases of cough-induced rib fractures diagnosed at the Mayo Clinic in Rochester, Minn, over a 9-year period between January 1, 1996, and January 31, 2005. Bone densitometry data from patients' medical records were analyzed, and T scores were used to classify patients into bone density categories. The mean +/- SD age of the 54 study patients at presentation was 55+/-17 years, and 42 patients (78%) were female. Patients presented with chest wall pain after onset of cough. Rib fracture was associated with chronic cough (> or =3 weeks' duration) in 85% of patients. Rib fractures were documented by chest radiography, rib radiography, computed tomography, or bone scan. Chest radiography had been performed in 52 patients and revealed rib fracture in 30 (58%). There were 112 fractured ribs in 54 patients. One half of patients had more than one fractured rib. Right-sided rib fractures alone were present in 17 patients (26 fractured ribs), left-sided in 23 patients (35 fractured ribs), and bilateral in 14 patients (51 fractured ribs). The most commonly fractured rib on both sides was rib 6. The fractures were most common at the lateral aspect of the rib cage. Bone densitometry was done in 26 patients and revealed osteopenia or osteoporosis in 17 (65%). Cough-induced rib fractures occur primarily in women with chronic cough. Middle ribs along the lateral aspect of the rib cage are affected most commonly. Although reduced bone density is likely a risk factor, cough-induced rib fractures can occur in the presence of normal bone density.

[Transversal study on the prevalence of Metabolic Bone Disease (MBD) and Home Parenteral Nutrition (HPN) in Spain: data from NADYA group].

PubMed

Martínez, C; Virgili, N; Cuerda, C; Chicharro, L; Gómez, P; Moreno, J M; Álvarez, J; Martí, E; Matía, P; Penacho, M A; Garde, C; De Luis, D; Gonzalo, M; Lobo, G

2010-01-01

Patients with intestinal failure who receive HPN are at high risk of developing MBD. The origin of this bone alteration is multifactorial and depends greatly on the underlying disease for which the nutritional support is required. Data on the prevalence of this disease in our environment is lacking, so NADYA-SEMPE group has sponsored this transversal study with the aim of knowing the actual MBD prevalence. Retrospective data from 51 patients from 13 hospitals were collected. The questionnaire included demographic data as well as the most clinically relevant for MBD data. Laboratory data (calciuria, PTH, 25 -OH -vitamin D) and the results from the first and last bone densitometry were also registered. Bone mineral density had only been assessed by densitometry in 21 patients at the moment HPN was started. Bone quality is already altered before HPN in a significant percentage of cases (52%). After a mean follow up of 6 years, this percentage increases up to 81%. Due to retrospective nature of the study and the low number of subjects included it has not been possible to determine the role that HPN plays in MBD etiology. Only 35% of patients have vitamin D levels above the recommended limits and the majority of them is not on specific supplementation. HPN is associated with very high risk of MBD, therefore, management protocols that can lead to early detection of the problem as well as guiding for follow up and treatment of these patients are needed.

Fan-beam densitometry of the growing skeleton: are we measuring what we think we are?

PubMed

Cole, Jacqueline H; Scerpella, Tamara A; van der Meulen, Marjolein C H

2005-01-01

Magnification error in fan-beam densitometers varies with distance from the X-ray source to the bone measured and might obscure bone mineral changes in the growing skeleton. Magnification was examined by scanning aluminum rods of different shapes (square, rectangular, solid round, and hollow round) at four distances above the X-ray source in two orientations, with rods aligned parallel (SI) and perpendicular (ML) to the longitudinal axis of the scanning table. Measured area (cm(2)) decreased linearly with distance above the X-ray source for all rods in the SI orientation (p < 0.005). Measured mineral content (g) decreased linearly with distance but only for SI round rods (p < 0.0001) and for ML hollow round rods (p < 0.005). Area and mineral content decreased 1.6-1.8% per centimeter above the source for round rods. Measured mineral density (g/cm(2)) decreased linearly with distance from the source only for ML hollow round rods (p < 0.005). Variation in area, mineral content, and mineral density measurements was 6.6-6.9%, 6.9-7.5%, and 1.9-2.3%, respectively, for SI round rods. Magnification errors of this magnitude are problematic for clinical studies using fan-beam densitometry. Particularly in pediatric subjects, increases in soft tissue during normal growth could increase a bone's distance from the fan-beam source and result in apparent reductions in area and bone mineral content.

Bone mineral measurement using dual energy x ray densitometry

NASA Technical Reports Server (NTRS)

Smith, Steven W.

1989-01-01

Bone mineral measurements before and after space missions have shown that weightlessness greatly accelerates bone demineralization. Bone mineral losses as high as 1 to 3 percent per month were reported. Highly precise instrumentation is required to monitor this loss and thereby test the efficacy of treatment. During the last year, a significant improvement was made in Dual-Photon Absorptiometry by replacing the radioactive source with an x ray tube. Advantages of this system include: better precision, lower patient dose, better spacial resolution, and shorter scan times. The high precision and low radiation dose of this technique will allow detection of bone mineral changes of less than 1 percent with measurements conducted directly at the sites of interest. This will allow the required bone mineral studies to be completed in a shorter time with greater confidence.

Factors Influencing Quality of Life of Hungarian Postmenopausal Women Screened by Osteodensitometry

ERIC Educational Resources Information Center

Maroti-Nagy, Agnes; Paulik, Edit

2011-01-01

The aim of our study was to evaluate factors influencing health related quality of life in Hungarian postmenopausal women who underwent osteodensitometry. A questionnaire-based cross-sectional study was carried out; 359 women aged over 40 years were involved, attending the outpatient Bone Densitometry Centre of Szeged. Two kinds of tools were…

Inhibition of Breast Cancer-lnduced Bone Pain, Metastasis, and Osteolysis in Nude Mice by LOVAZA and DHA Fatty Acids

DTIC Science & Technology

2012-10-01

ASIC3, TGAGAGCCACCAGCTTACCT/ACATGTCCTCAAGGGAGTGG (30 cycles); mouse TRPV1 , GTGACCCTCTTGGTGGAGAA/ CTTCAGTGTGGGGTGGAGTT (30 cycles), mouse GAPDH...densitometry assisted by the image analysis software MetaMorph Image ( xx). Sizes are as follows: ASIC1a 506bp, ASCI1b 563bp, ASCI3 245pb, TRPV1

Bisphosphonate Treatment for Children With Disabling Conditions

PubMed Central

Boyce, Alison M.; Tosi, Laura L.; Paul, Scott M.

2014-01-01

Fractures are a frequent source of morbidity in children with disabling conditions. The assessment of bone density in this population is challenging, because densitometry is influenced by dynamic forces affecting the growing skeleton and may be further confounded by positioning difficulties and surgical hardware. First-line treatment for pediatric osteoporosis involves conservative measures, including optimizing the management of underlying conditions, maintaining appropriate calcium and vitamin D intake, encouraging weight-bearing physical activity, and monitoring measurements of bone mineral density. Bisphosphonates are a class of medications that increase bone mineral density by inhibiting bone resorption. Although bisphosphonates are commonly prescribed for treatment of adult osteoporosis, their use in pediatric patients is controversial because of the lack of long-term safety and efficacy data. PMID:24368091

Joint Official Positions of the International Society for Clinical Densitometry and International Osteoporosis Foundation on FRAX(®). Executive Summary of the 2010 Position Development Conference on Interpretation and use of FRAX® in clinical practice.

PubMed

Hans, Didier B; Kanis, John A; Baim, Sanford; Bilezikian, John P; Binkley, Neil; Cauley, Jane A; Compston, Juliet E; Cooper, Cyrus; Dawson-Hughes, Bess; El-Hajj Fuleihan, Ghada; Leslie, William D; Lewiecki, E Michael; Luckey, Marjorie M; McCloskey, Eugene V; Papapoulos, Socrates E; Poiana, Catalina; Rizzoli, René

2011-01-01

The International Society for Clinical Densitometry (ISCD) and the International Osteoporosis Foundation (IOF) convened the FRAX(®) Position Development Conference (PDC) in Bucharest, Romania, on November 14, 2010, following a two-day joint meeting of the ISCD and IOF on the "Interpretation and Use of FRAX(®) in Clinical Practice." These three days of critical discussion and debate, led by a panel of international experts from the ISCD, IOF and dedicated task forces, have clarified a number of important issues pertaining to the interpretation and implementation of FRAX(®) in clinical practice. The Official Positions resulting from the PDC are intended to enhance the quality and clinical utility of fracture risk assessment worldwide. Since the field of skeletal assessment is still evolving rapidly, some clinically important issues addressed at the PDCs are not associated with robust medical evidence. Accordingly, some Official Positions are based largely on expert opinion. Despite limitations inherent in such a process, the ISCD and IOF believe it is important to provide clinicians and technologists with the best distillation of current knowledge in the discipline of bone densitometry and provide an important focus for the scientific community to consider. This report describes the methodology and results of the ISCD-IOF PDC dedicated to FRAX(®). Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Recommendations for the clinical evaluation of agents for treatment of osteoporosis: consensus of an expert panel representing the American Society for Bone and Mineral Research (ASBMR), the International Society for Clinical Densitometry (ISCD), and the National Osteoporosis Foundation (NOF).

PubMed

Silverman, Stuart L; Cummings, Steven R; Watts, Nelson B

2008-01-01

A panel of experts representing ASBMR, NOF, and ISCD reviewed evidence and reached consensus that regulatory approval of treatments for osteoporosis should be based on trials with fracture endpoints, lasting 18-24 mo, and extending treatment to 5 yr; other indications could be approved based on BMD and turnover markers. In response to an FDA request for clinical trial guidance in osteoporosis, an expert panel was convened with representatives from the American Society of Bone and Mineral Research, the International Society of Clinical Densitometry, and the National Osteoporosis Foundation. The panel used a validated evidence-based expert panel process (the Rand Appropriateness Method) to address issues of trial duration, trial design, use of intermediate endpoints as outcomes, and use of placebo-controlled trials in high-risk patients. The panel concluded that placebo-controlled trials with fracture endpoints are appropriate and, with informed consent, are ethical for registration of new compounds. Trials may be 18-24 mo in duration for efficacy, assuming longer duration to 5 yr for safety and demonstration of sustained fracture reduction. Once fracture efficacy has been established for a particular agent, intermediate endpoints (e.g., BMD and bone turnover markers) may be used as outcomes for new indications other than corticosteroid-induced osteoporosis.

Cross-sectional structural parameters from densitometry

NASA Technical Reports Server (NTRS)

Cleek, Tammy M.; Whalen, Robert T.

2002-01-01

Bone densitometry has previously been used to obtain cross-sectional properties of bone from a single X-ray projection across the bone width. Using three unique projections, we have extended the method to obtain the principal area moments of inertia and orientations of the principal axes at each scan cross-section along the length of the scan. Various aluminum phantoms were used to examine scanner characteristics to develop the highest accuracy possible for in vitro non-invasive analysis of cross-sectional properties. Factors considered included X-ray photon energy, initial scan orientation, the angle spanned by the three scans (included angle), and I(min)/I(max) ratios. Principal moments of inertia were accurate to within +/-3.1% and principal angles were within +/-1 degrees of the expected value for phantoms scanned with included angles of 60 degrees and 90 degrees at the higher X-ray photon energy (140 kVp). Low standard deviations in the error (0.68-1.84%) also indicate high precision of calculated measurements with these included angles. Accuracy and precision decreased slightly when the included angle was reduced to 30 degrees. The method was then successfully applied to a pair of excised cadaveric tibiae. The accuracy and insensitivity of the algorithms to cross-sectional shape and changing isotropy (I(min)/I(max)) values when various included angles are used make this technique viable for future in vivo studies.

Bone's mechanostat: a 2003 update.

PubMed

Frost, Harold M

2003-12-01

The still-evolving mechanostat hypothesis for bones inserts tissue-level realities into the former knowledge gap between bone's organ-level and cell-level realities. It concerns load-bearing bones in postnatal free-living bony vertebrates, physiologic bone loading, and how bones adapt their strength to the mechanical loads on them. Voluntary mechanical usage determines most of the postnatal strength of healthy bones in ways that minimize nontraumatic fractures and create a bone-strength safety factor. The mechanostat hypothesis predicts 32 things that occur, including the gross anatomical bone abnormalities in osteogenesis imperfecta; it distinguishes postnatal situations from baseline conditions at birth; it distinguishes bones that carry typical voluntary loads from bones that have other chief functions; and it distinguishes traumatic from nontraumatic fractures. It provides functional definitions of mechanical bone competence, bone quality, osteopenias, and osteoporoses. It includes permissive hormonal and other effects on bones, a marrow mediator mechanism, some limitations of clinical densitometry, a cause of bone "mass" plateaus during treatment, an "adaptational lag" in some children, and some vibration effects on bones. The mechanostat hypothesis may have analogs in nonosseous skeletal organs as well. Copyright 2003 Wiley-Liss, Inc.

Reconstruction of Canine Mandibular Bone Defects Using a Bone Transport Reconstruction Plate

PubMed Central

Elsalanty, Mohammed E.; Zakhary, Ibrahim; Akeel, Sara; Benson, Byron; Mulone, Timothy; Triplett, Gilbert R.; Opperman, Lynne A.

2010-01-01

Objectives Reconstruction of mandibular segmental bone defects is a challenging task. This study tests a new device used for reconstructing mandibular defects based on the principle of bone transport distraction osteogenesis. Methods Thirteen beagle dogs were divided into control and experimental groups. In all animals, a 3 cm defect was created on one side of the mandible. In eight control animals, the defect was stabilized with a reconstruction plate without further reconstruction and the animals were sacrificed two to three months after surgery. The remaining five animals were reconstructed with a bone transport reconstruction plate (BTRP), comprising a reconstruction plate with attached intraoral transport unit, and were sacrificed after one month of consolidation. Results Clinical evaluation, cone-beam CT densitometry, three-dimensional histomorphometry, and docking site histology revealed significant new bone formation within the defect in the distracted group. Conclusion The physical dimensions and architectural parameters of the new bone were comparable to the contralateral normal bone. Bone union at the docking site remains a problem. PMID:19770704

The ever-expanding conundrum of primary osteoporosis: aetiopathogenesis, diagnosis, and treatment.

PubMed

Stagi, Stefano; Cavalli, Loredana; Seminara, Salvatore; de Martino, Maurizio; Brandi, Maria Luisa

2014-06-07

In recent years, as knowledge regarding the etiopathogenetic mechanisms of bone involvement characterizing many diseases has increased and diagnostic techniques evaluating bone health have progressively improved, the problem of low bone mass/quality in children and adolescents has attracted more and more attention, and the body evidence that there are groups of children who may be at risk of osteoporosis has grown. This interest is linked to an increased understanding that a higher peak bone mass (PBM) may be one of the most important determinants affecting the age of onset of osteoporosis in adulthood. This review provides an updated picture of bone pathophysiology and characteristics in children and adolescents with paediatric osteoporosis, taking into account the major causes of primary osteoporosis (PO) and evaluating the major aspects of bone densitometry in these patients. Finally, some options for the treatment of PO will be briefly discussed.

Ethnic Differences in Bone Health

PubMed Central

Zengin, Ayse; Prentice, Ann; Ward, Kate Anna

2015-01-01

There are differences in bone health between ethnic groups in both men and in women. Variations in body size and composition are likely to contribute to reported differences. Most studies report ethnic differences in areal bone mineral density (aBMD), which do not consistently parallel ethnic patterns in fracture rates. This suggests that other parameters beside aBMD should be considered when determining fracture risk between and within populations, including other aspects of bone strength: bone structure and microarchitecture, as well as muscle strength (mass, force generation, anatomy) and fat mass. We review what is known about differences in bone-densitometry-derived outcomes between ethnic groups and the extent to which they account for the differences in fracture risk. Studies are included that were published primarily between 1994 and 2014. A “one size fits all approach” should definitely not be used to understand better ethnic differences in fracture risk. PMID:25852642

The ever-expanding conundrum of primary osteoporosis: aetiopathogenesis, diagnosis, and treatment

PubMed Central

2014-01-01

In recent years, as knowledge regarding the etiopathogenetic mechanisms of bone involvement characterizing many diseases has increased and diagnostic techniques evaluating bone health have progressively improved, the problem of low bone mass/quality in children and adolescents has attracted more and more attention, and the body evidence that there are groups of children who may be at risk of osteoporosis has grown. This interest is linked to an increased understanding that a higher peak bone mass (PBM) may be one of the most important determinants affecting the age of onset of osteoporosis in adulthood. This review provides an updated picture of bone pathophysiology and characteristics in children and adolescents with paediatric osteoporosis, taking into account the major causes of primary osteoporosis (PO) and evaluating the major aspects of bone densitometry in these patients. Finally, some options for the treatment of PO will be briefly discussed. PMID:24906390

Current methods and advances in bone densitometry

NASA Technical Reports Server (NTRS)

Guglielmi, G.; Gluer, C. C.; Majumdar, S.; Blunt, B. A.; Genant, H. K.

1995-01-01

Bone mass is the primary, although not the only, determinant of fracture. Over the past few years a number of noninvasive techniques have been developed to more sensitively quantitate bone mass. These include single and dual photon absorptiometry (SPA and DPA), single and dual X-ray absorptiometry (SXA and DXA) and quantitative computed tomography (QCT). While differing in anatomic sites measured and in their estimates of precision, accuracy, and fracture discrimination, all of these methods provide clinically useful measurements of skeletal status. It is the intent of this review to discuss the pros and cons of these techniques and to present the new applications of ultrasound (US) and magnetic resonance (MRI) in the detection and management of osteoporosis.

[Epidemiologic variables in postmenopausal women].

PubMed

Murillo-Uribe, A; Carranza-Lira, S; Martínez-Trejo, N A; Santos González, J E

1999-10-01

The objective was to know the characteristics of presentation, its clinical aspects and the modification in the diagnostic tools in a selected population of Mexican women with spontaneous menopause. The age at menarche, age at menopause, marital status, age at marriage, number of pregnancies and occupation of 1,099 women with spontaneous menopause were studied. In 619 women which were not receiving nor had received hormone replacement therapy the clinical, laboratory such as glucose, lipids, hormones, bone remodeling biochemistry; and X ray studies such as densitometry and mammography were analyzed. The age average of menarche presentation was at 13 years, and that of spontaneous menopause at 48.1 years 78% were married, with an age at marriage of 23 years, 66% had home duties. The screening tests showed that 30% of patients required cardiovascular evaluation, 40% showed alterations on lipids levels and at least 40% had some alteration on bone remodeling biochemistry or in densitometry. The mammography was normal in 81%. This study showed that most of the data in these group of women were similar to those of other populations, and many of them need intensive surveillance and adequate therapeutic prescriptions to diminish risk factors.

FRAX(®) Bone Mineral Density Task Force of the 2010 Joint International Society for Clinical Densitometry & International Osteoporosis Foundation Position Development Conference.

PubMed

Lewiecki, E Michael; Compston, Juliet E; Miller, Paul D; Adachi, Jonathan D; Adams, Judith E; Leslie, William D; Kanis, John A

2011-01-01

FRAX(®) is a fracture risk assessment algorithm developed by the World Health Organization in cooperation with other medical organizations and societies. Using easily available clinical information and femoral neck bone mineral density (BMD) measured by dual-energy X-ray absorptiometry (DXA), when available, FRAX(®) is used to predict the 10-year probability of hip fracture and major osteoporotic fracture. These values may be included in country specific guidelines to aid clinicians in determining when fracture risk is sufficiently high that the patient is likely to benefit from pharmacological therapy to reduce that risk. Since the introduction of FRAX(®) into clinical practice, many practical clinical questions have arisen regarding its use. To address such questions, the International Society for Clinical Densitometry (ISCD) and International Osteoporosis Foundations (IOF) assigned task forces to review the best available medical evidence and make recommendations for optimal use of FRAX(®) in clinical practice. Questions were identified and divided into three general categories. A task force was assigned to investigating the medical evidence in each category and developing clinically useful recommendations. The BMD Task Force addressed issues that included the potential use of skeletal sites other than the femoral neck, the use of technologies other than DXA, and the deletion or addition of clinical data for FRAX(®) input. The evidence and recommendations were presented to a panel of experts at the ISCD-IOF FRAX(®) Position Development Conference, resulting in the development of ISCD-IOF Official Positions addressing FRAX(®)-related issues. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Cortical Porosity Identifies Women with Osteopenia at Increased Risk for Forearm Fractures

PubMed Central

Bala, Yohann; Zebaze, Roger; Ghasem-Zadeh, Ali; Atkinson, Elizabeth J.; Iuliano, Sandra; Peterson, James M.; Amin, Shreyasee; Bjørnerem, Åshild; Melton, L. Joseph; Johansson, Helena; Kanis, John A.; Khosla, Sundeep; Seeman, Ego

2014-01-01

Background Most fragility fractures arise among the many women with osteopenia, not the smaller number with osteoporosis at high risk for fracture. Thus, most women at risk for fracture assessed only by measuring areal bone mineral density (aBMD) will remain untreated. Methods We measured cortical porosity and trabecular bone volume/total volume (BV/TV) of the ultradistal radius (UDR) using high-resolution peripheral quantitative computed tomography, aBMD using densitometry, and 10-year fracture probability using the country-specific FRAX tool in 68 postmenopausal women with forearm fractures and 70 age-matched community controls in Olmsted County, Minnesota. Results Women with forearm fractures had 0.4 standard deviations (SD) higher cortical porosity and 0.6 SD lower trabecular BV/TV. Compact-appearing cortical porosity predicted fracture independent of aBMD; odds ratio [OR] 1.92 (95%CI, 1.10–3.33). In women with osteoporosis at the UDR, cortical porosity did not distinguish those with, from those without, fractures because high porosity was present in 92% and 86% of each group respectively. By contrast, in women with osteopenia at the UDR, high porosity of the compact-appearing cortex conferred an OR for fracture of 4.00 (95%CI, 1.15–13.90). Conclusion In women with osteoporosis, porosity is captured by aBMD and so measuring UDR cortical porosity does not improve diagnostic sensitivity. However, in women with osteopenia, cortical porosity was associated with forearm fractures. PMID:24519558

Clinical Implications of Hip Flexion in the Measurement of Spinal Bone Mineral Density.

PubMed

Ikegami, Shota; Kamimura, Mikio; Uchiyama, Shigeharu; Nakamura, Yukio; Mukaiyama, Keijiro; Kato, Hiroyuki

2016-01-01

The aim of this study was to investigate if differences in leg positioning affect spinal bone mineral density (BMD) measurements and the detection of low bone mass. Subjects included 1039 Japanese patients, 878 women and 161 men (mean ages: 67 and 71 years, respectively). Spinal BMD (L1-4) was measured using dual-energy X-ray absorptiometry (DXA) with patients lying in 2 different positions: (1) supine on the scanning table with hips flexed and knees flexed over a 90° support pad (the standard position) and (2) simply supine (the supine position). Predictive indices were calculated for spinal DXA acquired with patients in the supine position. A BMD T-score of -2.5 or lower was set as the threshold for low bone mass. For the standard and the supine positions during scanning in women, BMDs were 0.911 and 0.915 g/cm(2), respectively; in men, they were 1.117  and 1.124 g/cm(2), respectively. The estimated systematic bias in BMD between the positions was 0.42% (95% confidence interval: 0.24, 0.59; p = 0.009). Random errors in the densitometry measurements for the standard and supine positions were 0.66% and 0.84%, respectively. There was no significant difference between the errors (p= 0.164). The likelihood ratios of a positive and negative test for the detection of low bone mass following supine DXA were 121.0 and 0.066, respectively, compared with results acquired using the standard position. In conclusion, DXA measurements acquired with patients in the supine position slightly overestimated BMD vs the standard position. However, the clinical equivalency between the positioning methods for DXA is preserved to the extent that low bone mass can be reliably detected in the supine position. Copyright © 2016 International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Bone-marrow densitometry: Assessment of marrow space of human vertebrae by single energy high resolution-quantitative computed tomography

DOE Office of Scientific and Technical Information (OSTI.GOV)

Peña, Jaime A.; Damm, Timo; Bastgen, Jan

Purpose: Accurate noninvasive assessment of vertebral bone marrow fat fraction is important for diagnostic assessment of a variety of disorders and therapies known to affect marrow composition. Moreover, it provides a means to correct fat-induced bias of single energy quantitative computed tomography (QCT) based bone mineral density (BMD) measurements. The authors developed new segmentation and calibration methods to obtain quantitative surrogate measures of marrow-fat density in the axial skeleton. Methods: The authors developed and tested two high resolution-QCT (HR-QCT) based methods which permit segmentation of bone voids in between trabeculae hypothesizing that they are representative of bone marrow space. Themore » methods permit calculation of marrow content in units of mineral equivalent marrow density (MeMD). The first method is based on global thresholding and peeling (GTP) to define a volume of interest away from the transition between trabecular bone and marrow. The second method, morphological filtering (MF), uses spherical elements of different radii (0.1–1.2 mm) and automatically places them in between trabeculae to identify regions with large trabecular interspace, the bone-void space. To determine their performance, data were compared ex vivo to high-resolution peripheral CT (HR-pQCT) images as the gold-standard. The performance of the methods was tested on a set of excised human vertebrae with intact bone marrow tissue representative of an elderly population with low BMD. Results: 86% (GTP) and 87% (MF) of the voxels identified as true marrow space on HR-pQCT images were correctly identified on HR-QCT images and thus these volumes of interest can be considered to be representative of true marrow space. Within this volume, MeMD was estimated with residual errors of 4.8 mg/cm{sup 3} corresponding to accuracy errors in fat fraction on the order of 5% both for GTP and MF methods. Conclusions: The GTP and MF methods on HR-QCT images permit noninvasive localization and densitometric assessment of marrow fat with residual accuracy errors sufficient to study disorders and therapies known to affect bone marrow composition. Additionally, the methods can be used to correct BMD for fat induced bias. Application and testing in vivo and in longitudinal studies are warranted to determine the clinical performance and value of these methods.« less

Vitamin D and nutritional status are related to bone fractures in alcoholics.

PubMed

González-Reimers, Emilio; Alvisa-Negrín, Julio; Santolaria-Fernández, Francisco; Candelaria Martín-González, M; Hernández-Betancor, Iván; Fernández-Rodríguez, Camino M; Viña-Rodríguez, J; González-Díaz, Antonieta

2011-01-01

Bone fractures are common in alcoholics. To analyse which factors (ethanol consumption; liver function impairment; bone densitometry; hormone changes; nutritional status, and disrupted social links and altered eating habits) are related to bone fractures in 90 alcoholic men admitted to our hospitalization unit because of organic problems. Bone homoeostasis-related hormones were measured in patients and age- and sex-matched controls. Whole-body densitometry was performed by a Hologic QDR-2000 (Waltham, MA, USA) densitometer, recording bone mineral density (BMD) and fat and lean mass; nutritional status and liver function were assessed. The presence of prevalent fractures was assessed by anamnesis and chest X-ray film. Forty-nine patients presented at least one fracture. We failed to find differences between patients with and without fractures regarding BMD parameters. Differences regarding fat mass were absent, but lean mass was lower among patients with bone fracture. The presence of fracture was significantly associated with impaired subjective nutritional evaluation (χ² = 5.79, P = 0.016), lower vitamin D levels (Z = 2.98, P = 0.003) and irregular eating habits (χ² = 5.32, P = 0.02). Reduced lean mass and fat mass, and altered eating habits were more prevalent among patients with only rib fractures (n = 36) than in patients with multiple fractures and/or fractures affecting other bones (n = 13). These last were more closely related to decompensated liver disease. Serum vitamin D levels showed a significant relationship with handgrip strength (ρ = 0.26, P = 0.023) and lean mass at different parts of the body, but not with fat mass. By logistic regression analysis, only vitamin D and subjective nutritional evaluation were significantly, independently related with fractures. Prevalent fractures are common among heavy alcoholics. Their presence is related more closely to nutritional status, lean mass and vitamin D levels than to BMD. Lean mass is more reduced, nutritional status is more impaired and there is a trend to more altered eating habits among patients with rib fractures, whereas multiple fractures depend more heavily on advanced liver disease.

Review of comparative studies between bone densitometry and quantitative ultrasound of the calcaneus in osteoporosis.

PubMed

Flöter, Michelle; Bittar, Cíntia Kelly; Zabeu, José Luis; Carneiro, Ana Carolina

2011-01-01

To assess the utility of quantitative ultrasound (QUS) of the calcaneus for diagnosing osteoporosis compared to the gold standard, bone densitometry using dual-emission X-ray absorptiometry (DXA), according to published reports. In this systematic review, the Medline/PUBMED, Medline Ovid and Journals@Ovid, and Wilson General Sciences Full Text database were used. The search strategy involved use of the following MeSH descriptors: [osteoporosis AND (densitometry OR ultrasonography)], and 39 articles published between 2001 and April 2010 were assessed. However, only six articles met the inclusion criteria: sensitivity and specificity of QUS, sample (women or men with no treatment or other disease likely to change bone mass index), devices used, comparative T-score between QUS of the calcaneus and DXA. The GE-Lunar Achilles and Hologic Sahara devices were used in most of the tests reported and were effective. All studies assessed compared QUS of the calcaneus to DXA of the lumbar spine or femoral neck, as the gold standard. QUS sensitivity ranged from 79% to 93% and specificity ranged from 28% to 90% when at the lower threshold. It is a controversial parameter, because the gold-standard threshold (T-score < -2.5, DXA) could not be used for QUS without errors in osteoporosis diagnosis. All studies had a threshold determined by the authors’ criteria, with a variability of -1.7 (pDXA T--score) and -2.4 for QUS, leading to the same prevalence of osteoporosis, and a T-score of < -3.65 for QUS was equivalent to a T-score < -2.5 for DXA. Based on the analysis of seven studies, we conclude that QUS of the calcaneus still cannot be used to confirm diagnosis of osteoporosis by comparing the results to those of patients who had already received such a diagnosis based on DXA. However, further research should be conducted in this area, because it is possible to improve the number diagnoses by varying the cutoff T-score. Furthermore, using QUS of the calcaneus was a helpful tool for assessing pathological fractures, whether or not they were associated with osteoporosis.

The anabolic effects of vitamin D-binding protein-macrophage activating factor (DBP-MAF) and a novel small peptide on bone.

PubMed

Schneider, Gary B; Grecco, Kristina J; Safadi, Fayez F; Popoff, Steven N

2003-01-01

Vitamin D-binding protein-macrophage activating factor (DBP-MAF) has previously been shown to stimulate bone resorption and correct the skeletal defects associated with osteopetrosis in two nonallelic mutations in rats. This same protein and a small fragment of the protein have now been shown to demonstrate an anabolic effect on the skeleton of both newborn and young adult, intact rats. The novel peptide fragment was synthetically produced based on the human amino acid sequence at the site of glycosylation in the third domain of the native protein (DBP). The peptide tested is 14 amino acids in length and demonstrates no homologies other than to that region of DBP. Newborn rats were injected i.p. with saline, peptide (0.4 ng/g body wt.) or DBP-MAF (2 ng/g body wt.) every other day from birth to 14 days of age. On day 16 the rats were euthanized and the long bones collected for bone densitometry by pQCT. After 2 weeks of treatment with either the whole protein (DBP-MAF) or the small peptide, bone density was significantly increased in the treated animals compared to the saline controls. Young adult female rats (180 grams) were given s.c. injections of saline or peptide (0.4 ng/g body wt. or 5 ng/g body wt.) every other day for 2 weeks; 2 days after the final injections, the rats were euthanized and the femurs and tibias collected for bone densitometry. Both doses of the peptide resulted in significant increases in bone density as determined by pQCT. Young adult rats were injected locally with a single dose of the peptide (1 microg) or saline into the marrow cavity of the distal femur. One week after the single injection, the bones were collected for radiographic and histological evaluation. The saline controls showed no evidence of new bone formation, whereas the peptide-treated animals demonstrated osteoinduction in the marrow cavity and osteogenesis of surrounding cortical and metaphyseal bone. These data suggest that DBP-MAF and the synthetic peptide represent therapeutic opportunities for the treatment of a number of bone diseases and skeletal disorders. Systemic administration could be used to treat osteoporosis and a number of other osteopenias, and local administration could be effective in fractures, bony defect repairs, spinal surgery, and joint replacement.

[Hearing and balance in metabolic bone diseases].

PubMed

Zatoński, Tomasz; Temporale, Hanna; Krecicki, Tomasz

2012-03-01

There are reports that hearing loss is one of the clinical manifestations of metabolic bone diseases. Demineralization can lead to a reduction in ossicular mass. Paget's disease can reveal loss of mineral density of the cochlear bone. Ear bone remodeling in osteoporosis is similar to the changes in otosclerosis. Moreover, osteoporosis, osteogenesis imperfecta and otosclerosis have a similar genetic mechanism. According to some researchers osteopenia and osteoporosis may well be associated with idiopathic benign positional vertigo (BPV). Dysfunction of the organ of hearing and balance in patients with renal insufficiency may be due to disturbances in calcium phosphate balance and renal osteodystrophy in the course of the disease. Proving the presence of hearing loss in patients with metabolic bone diseases may lead to determining the new indications for bone densitometry in some patients with hearing impairment. Furthermore, audiological examination in patients with osteoporosis may be important because of the impact of hearing loss on prognosis for patients with metabolic bone diseases.

The results of a proximally-coated cementless femoral component in total hip replacement: a five- to 12-year follow-up.

PubMed

Kim, Y-H

2008-03-01

This study reviewed the results of a cementless anatomical femoral component to give immediate post-operative stability, and with a narrow distal section in order not to contact the femoral cortex in the diaphysis, ensuring exclusively metaphyseal loading. A total of 471 patients (601 hips) who had a total hip replacement between March 1995 and February 2002 were included in the study. There were 297 men and 174 women. The mean age at the time of operation was 52.7 years (28 to 63). Clinical and radiological evaluation were performed at each follow-up. Bone densitometry was carried out on all patients two weeks after operation and at the final follow-up examination. The mean follow-up was 8.8 years (5 to 12). The mean pre-operative Harris hip score was 41 points (16 to 54), which improved to a mean of 96 (68 to 100) at the final follow-up. No patient complained of thigh pain at any stage. No acetabular or femoral osteolysis was observed and no hip required revision for aseptic loosening of either component. Deep infection occurred in two hips (0.3%) which required revision. One hip (0.2%) required revision of the acetabular component for recurrent dislocation. Bone mineral densitometry revealed a minimal bone loss in the proximal femur. This cementless anatomical femoral component with metaphyseal loading but without distal fixation produced satisfactory fixation and encourages proximal femoral loading.

Official Positions for FRAX® clinical regarding falls and frailty: can falls and frailty be used in FRAX®? From Joint Official Positions Development Conference of the International Society for Clinical Densitometry and International Osteoporosis Foundation on FRAX®.

PubMed

Masud, Tahir; Binkley, Neil; Boonen, Steven; Hannan, Marian T

2011-01-01

Risk factors for fracture can be purely skeletal, e.g., bone mass, microarchitecture or geometry, or a combination of bone and falls risk related factors such as age and functional status. The remit of this Task Force was to review the evidence and consider if falls should be incorporated into the FRAX® model or, alternatively, to provide guidance to assist clinicians in clinical decision-making for patients with a falls history. It is clear that falls are a risk factor for fracture. Fracture probability may be underestimated by FRAX® in individuals with a history of frequent falls. The substantial evidence that various interventions are effective in reducing falls risk was reviewed. Targeting falls risk reduction strategies towards frail older people at high risk for indoor falls is appropriate. This Task Force believes that further fracture reduction requires measures to reduce falls risk in addition to bone directed therapy. Clinicians should recognize that patients with frequent falls are at higher fracture risk than currently estimated by FRAX® and include this in decision-making. However, quantitative adjustment of the FRAX® estimated risk based on falls history is not currently possible. In the long term, incorporation of falls as a risk factor in the FRAX® model would be ideal. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Performance of clinical referral criteria for bone densitometry in patients under 65 years of age assessed by spine bone mineral density

PubMed Central

Kayan, K; de Takats, D; Ashford, R; Kanis, J; McCloskey, E

2003-01-01

Background: A case finding strategy based on a number of established risk factors has been suggested by Royal College of Physicians' (RCP) guidelines to optimise bone densitometry referrals for assessment of osteoporosis. Objective: The performance of clinical referral criteria was examined in women and men aged <65 years referred for bone mineral density (BMD) assessment. Study design: Cross sectional observational study over six months. Results: Though BMD tended to be lower in patients with multiple criteria for referral, differences from those referred with a single criterion were not statistically significant. The overall prevalence of osteoporosis was higher than expected in both sexes, 11.6% in women and 27.5% in men (expected prevalences were 8% and <1% respectively). BMD was significantly lower in patients referred with a single criterion compatible with the RCP guidelines than in age matched controls or in those patients referred with non-RCP criteria (mean (SD) Z score –0.47(1.38) v 0.35(1.41), p<0.001). Low body mass index was also significantly associated with a lower than expected BMD. In contrast, spine BMD was higher than expected in those with self reported back pain, loss of height, or spinal curvature (p = NS). Conclusion: Most of the criteria recommended by the RCP performed well in identifying relatively younger patients with low BMD and osteoporosis. However, prior fractures and corticosteroid use did not reach statistical significance probably due to inclusion of all energy fractures, and current or past steroid use of unspecified dose or duration. Criteria like loss of height and/or spine curvature perform relatively poorly, reflecting the need for further investigation to better identify those needing BMD assessment. PMID:14612601

Trace metal analysis by laser ablation-inductively coupled plasmamass spectrometry and x-ray K-edge densitometry of forensic samples

DOE Office of Scientific and Technical Information (OSTI.GOV)

Berry, Jonna Elizabeth

This dissertation describes a variety of studies on the determination of trace elements in samples with forensic importance. Laser ablation-inductively coupled plasma-mass spectrometry (LA-ICP-MS) was used to determine the trace element composition of numerous lipstick samples. Lipstick samples were determined to be homogeneous. Most lipstick samples of similar colors were readily distinguishable at a 95% confidence interval based on trace element composition. Numerous strands of a multi-strand speaker cable were analyzed by LA-ICP-MS. The strands in this study are spatially heterogeneous in trace element composition. In actual forensic applications, the possibility of spatial heterogeneity must be considered, especially in casesmore » where only small samples (e.g., copper wire fragments after an explosion) are available. The effects of many unpredictable variables, such as weather, temperature, and human activity, on the retention of gunshot residue (GSR) around projectile wounds were assessed with LAICP- MS. Skin samples around gunshot and stab wounds and larvae feeding in and around the wounds on decomposing pig carcasses were analyzed for elements consistent with GSR (Sb, Pb, Ba, and Cu). These elements were detected at higher levels in skin and larvae samples around the gunshot wounds compared to the stab wounds for an extended period of time throughout decomposition in both a winter and summer study. After decomposition, radiographic images of the pig bones containing possible damage from bullets revealed metallic particles embedded within a number of bones. Metallic particles within the bones were analyzed with x-ray, K-edge densitometry and determined to contain lead, indicating that bullet residue can be retained throughout decomposition and detected within bones containing projectile trauma.« less

An update on childhood bone health: mineral accrual, assessment and treatment.

PubMed

Sopher, Aviva B; Fennoy, Ilene; Oberfield, Sharon E

2015-02-01

To update the reader's knowledge about the factors that influence bone mineral accrual and to review the advances in the assessment of bone health and treatment of bone disorders. Maternal vitamin D status influences neonatal calcium levels, bone mineral density (BMD) and bone size. In turn, BMD z-score tends to track in childhood. These factors highlight the importance of bone health as early as fetal life. Dual-energy x-ray absorptiometry is the mainstay of clinical bone health assessment in this population because of the availability of appropriate reference data. Recently, more information has become available about the assessment and treatment of bone disease in chronically ill pediatric patients. Bone health must become a health focus starting prenatally in order to maximize peak bone mass and to prevent osteoporosis-related bone disease in adulthood. Vitamin D, calcium and weight-bearing activity are the factors of key importance throughout childhood in achieving optimal bone health as BMD z-score tracks through childhood and into adulthood. Recent updates of the International Society for Clinical Densitometry focus on the appropriate use of dual-energy x-ray absorptiometry in children of all ages, including children with chronic disease, and on the treatment of pediatric bone disease.

In situ micropillar compression reveals superior strength and ductility but an absence of damage in lamellar bone

NASA Astrophysics Data System (ADS)

Schwiedrzik, Jakob; Raghavan, Rejin; Bürki, Alexander; Lenader, Victor; Wolfram, Uwe; Michler, Johann; Zysset, Philippe

2014-07-01

Ageing societies suffer from an increasing incidence of bone fractures. Bone strength depends on the amount of mineral measured by clinical densitometry, but also on the micromechanical properties of the hierarchical organization of bone. Here, we investigate the mechanical response under monotonic and cyclic compression of both single osteonal lamellae and macroscopic samples containing numerous osteons. Micropillar compression tests in a scanning electron microscope, microindentation and macroscopic compression tests were performed on dry ovine bone to identify the elastic modulus, yield stress, plastic deformation, damage accumulation and failure mechanisms. We found that isolated lamellae exhibit a plastic behaviour, with higher yield stress and ductility but no damage. In agreement with a proposed rheological model, these experiments illustrate a transition from a ductile mechanical behaviour of bone at the microscale to a quasi-brittle response driven by the growth of cracks along interfaces or in the vicinity of pores at the macroscale.

Please Don't Move-Evaluating Motion Artifact From Peripheral Quantitative Computed Tomography Scans Using Textural Features.

PubMed

Rantalainen, Timo; Chivers, Paola; Beck, Belinda R; Robertson, Sam; Hart, Nicolas H; Nimphius, Sophia; Weeks, Benjamin K; McIntyre, Fleur; Hands, Beth; Siafarikas, Aris

Most imaging methods, including peripheral quantitative computed tomography (pQCT), are susceptible to motion artifacts particularly in fidgety pediatric populations. Methods currently used to address motion artifact include manual screening (visual inspection) and objective assessments of the scans. However, previously reported objective methods either cannot be applied on the reconstructed image or have not been tested for distal bone sites. Therefore, the purpose of the present study was to develop and validate motion artifact classifiers to quantify motion artifact in pQCT scans. Whether textural features could provide adequate motion artifact classification performance in 2 adolescent datasets with pQCT scans from tibial and radial diaphyses and epiphyses was tested. The first dataset was split into training (66% of sample) and validation (33% of sample) datasets. Visual classification was used as the ground truth. Moderate to substantial classification performance (J48 classifier, kappa coefficients from 0.57 to 0.80) was observed in the validation dataset with the novel texture-based classifier. In applying the same classifier to the second cross-sectional dataset, a slight-to-fair (κ = 0.01-0.39) classification performance was observed. Overall, this novel textural analysis-based classifier provided a moderate-to-substantial classification of motion artifact when the classifier was specifically trained for the measurement device and population. Classification based on textural features may be used to prescreen obviously acceptable and unacceptable scans, with a subsequent human-operated visual classification of any remaining scans. Copyright © 2017 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

CONSENSUS STATEMENT BY THE AMERICAN ASSOCIATION OF CLINICAL ENDOCRINOLOGISTS AND AMERICAN COLLEGE OF ENDOCRINOLOGY ON THE QUALITY OF DXA SCANS AND REPORTS.

PubMed

Licata, Angelo A; Binkley, Neil; Petak, Steven M; Camacho, Pauline M

2018-02-01

High-quality dual-energy X-ray absorptiometry (DXA) scans are necessary for accurate diagnosis of osteoporosis and monitoring of therapy; however, DXA scan reports may contain errors that cause confusion about diagnosis and treatment. This American Association of Clinical Endocrinologists/American College of Endocrinology consensus statement was generated to draw attention to many common technical problems affecting DXA report conclusions and provide guidance on how to address them to ensure that patients receive appropriate osteoporosis care. The DXA Writing Committee developed a consensus based on discussion and evaluation of available literature related to osteoporosis and osteodensitometry. Technical errors may include errors in scan acquisition and/or analysis, leading to incorrect diagnosis and reporting of change over time. Although the International Society for Clinical Densitometry advocates training for technologists and medical interpreters to help eliminate these problems, many lack skill in this technology. Suspicion that reports are wrong arises when clinical history is not compatible with scan interpretation (e.g., dramatic increase/decrease in a short period of time; declines in previously stable bone density after years of treatment), when different scanners are used, or when inconsistent anatomic sites are used for monitoring the response to therapy. Understanding the concept of least significant change will minimize erroneous conclusions about changes in bone density. Clinicians must develop the skills to differentiate technical problems, which confound reports, from real biological changes. We recommend that clinicians review actual scan images and data, instead of relying solely on the impression of the report, to pinpoint errors and accurately interpret DXA scan images. AACE = American Association of Clinical Endocrinologists; BMC = bone mineral content; BMD = bone mineral density; DXA = dual-energy X-ray absorptiometry; ISCD = International Society for Clinical Densitometry; LSC = least significant change; TBS = trabecular bone score; WHO = World Health Organization.

The Role of Peripheral Nerve Function in Age-Related Bone Loss and Changes in Bone Adaptation

DTIC Science & Technology

2014-10-01

and peripheral neuropathy has been identified as an in- dependent predictor of low bone mass in the affected limb of diabetic subjects26. Despite...humans. In: Dyck PJ, Thomas PK, Lambert EH, Bunge P, eds. Peripheral Neuropathy . Philadelphia: WB Saunders; 1984:1103-38. 11. Akopian A, Demulder A...Rix M, Andreassen H, Eskildsen P. Impact of peripheral neuropathy on bone density in patients with type 1 dia- betes. Diabetes Care 1999;22:827-31

Official Positions for FRAX® clinical regarding biochemical markers from Joint Official Positions Development Conference of the International Society for Clinical Densitometry and International Osteoporosis Foundation on FRAX®.

PubMed

McCloskey, Eugene V; Vasikaran, Samuel; Cooper, Cyrus

2011-01-01

The best indirect evidence that increased bone turnover contributes to fracture risk is the fact that most of the proven therapies for osteoporosis are inhibitors of bone turnover. The evidence base that we can use biochemical markers of bone turnover in the assessment of fracture risk is somewhat less convincing. This relates to natural variability in the markers, problems with the assays, disparity in the statistical analyses of relevant studies and the independence of their contribution to fracture risk. More research is clearly required to address these deficiencies before biochemical markers might contribute a useful independent risk factor for inclusion in FRAX(®). Copyright © 2011. Published by Elsevier Inc.

Biochemical markers in the assessment of bone disease

NASA Technical Reports Server (NTRS)

Bikle, D. D.

1997-01-01

As the mean age of our population increases, increasing attention has been paid to the diseases associated with aging, including diseases of the skeleton such as osteoporosis. Effective means of treating and possibly preventing such skeletal disorders are emerging, making their early recognition an important goal for the primary care physician. Although bone density measurements and skeletal imaging studies remain of primary diagnostic importance in this regard, a large number of assays for biochemical markers of bone formation and resorption are being developed that promise to complement the densitometry measurements and imaging studies, providing an assessment of the rates of bone turnover and an earlier evaluation of the effects of therapy. In this review, emphasizing the recent literature, the major biochemical markers currently in use or under active investigation are described, and their application in a number of diseases of the skeleton including osteoporosis is evaluated.

Outcomes of Corneal Cross-Linking Correlate With Cone-Specific Lysyl Oxidase Expression in Patients With Keratoconus.

PubMed

Shetty, Rohit; Rajiv Kumar, Nimisha; Pahuja, Natasha; Deshmukh, Rashmi; Vunnava, KrishnaPoojita; Abilash, Valsala Gopalakrishnan; Sinha Roy, Abhijit; Ghosh, Arkasubhra

2018-03-01

To evaluate the correlation of visual and keratometry outcomes after corneal cross-linking (CXL) in patients with keratoconus with cone epithelium-specific gene expression levels. Corneal epithelium was obtained from 35 eyes that underwent accelerated CXL (KXLII, 9 mW/cm for 10 min). Using corneal topography, epithelium over the cone and periphery was obtained separately from each subject. The ratio of gene expression for lysyl oxidase (LOX), matrix metalloproteinase 9 (MMP9), bone morphogenic protein 7, tissue inhibitor of metalloproteinase 1, collagen, type I, alpha 1, and collagen, type IV, alpha 1 (COL IVA1) from the cone and peripheral cornea was correlated with the outcome of cross-linking surgery. Patients were assessed for visual acuity, keratometry, refraction, and corneal densitometry before and 6 months after surgery. Based on the change in corneal flattening indicated by ΔKmax, the outcomes were classified as a higher response or lower response. Reduction in keratometric indices correlated with improved spherical equivalent after CXL. Preoperative levels of cone-specific LOX expression in cases with a higher response were significant (P = 0.001). COL IVA1, bone morphogenic protein 7, and tissue inhibitor of metalloproteinase 1 gene expressions were reduced in the cones of the subjects with a lower response. MMP9 levels were relatively lower in cases with a higher response compared with those with a lower response. Our study demonstrates that preoperative levels of molecular factors such as LOX, MMP9, and COL IVA1 aid in understanding CXL outcomes at the tissue level.

Corneal Densitometry as a Tool to Measure Epithelial Ingrowth After Laser In Situ Keratomileusis.

PubMed

Adran, Daniel; Vaillancourt, Louis; Harissi-Dagher, Mona; Kruh, Jonathan N; Syed, Zeba A; Robinson, Steven; Melki, Samir

2017-04-01

This study evaluates the correlation between corneal densitometry and epithelial ingrowth (EI) after laser in situ keratomileusis (LASIK). Corneal densitometry of 3 patients who developed EI after LASIK was measured with the Oculus Pentacam. Corneal densitometry readings of each patient were obtained preoperatively and postoperatively after ingrowth was discovered. Densitometry was recorded at the central nest of opacity and at the leading edges of EI. For all patients, the most severe stages of EI observed on slit-lamp photographs correlated with the highest densitometry readings, with peak densitometry ranging from 73.3 to 95.1. These values were much higher than preoperative densitometry readings, which ranged from 21.8 to 27.2. In 2 cases, the Pentacam densitometry map revealed progression of EI toward the visual axis that was only faintly detectable or not detectable at all on the corresponding slit-lamp photographs. Corneal densitometry seems to be an objective measure of the severity and progression of EI after LASIK.

BMDO Technology Applications in Biomedicine

DTIC Science & Technology

1996-01-01

capacitance and low- noise detectors. NOVA’s systems could also be used for bone densitometry and panoramic dental X-rays. Potential Use to Medicine Dr...receiver coils, increasing signal-to- noise ratio by a factor of two in some cases. This change is especially important in low-strength MRI fields...ongoing in this area. Receivers for this technology must be even more sensitive than for conventional MRI, because the " noise " level in these tissue

Assessment of bone metabolism in premenopausal females with hyperthyroidism and hypothyroidism.

PubMed

Tuchendler, Dominika; Bolanowski, Marek

2013-01-01

Osteoporosis is one of the commonest metabolic diseases of bone. Its possible causes may include thyroid hormonal dysfunction. The objective of this study was to evaluate the effects of hyperthyroidism and hypothyroidism on osseous tissue metabolism in premenopausal women. 38 women with hyperthyroidism, 40 with hypothyroidism and 41 healthy women participated in this study. Initially after 6 and 12 months, each patient underwent selected hormonal, immunological and biochemical tests, measurement of concentrations of bone turnover markers and densitometry were also performed. On initial evaluation, lower cortical bone density was found in patients with hyperthyroidism (femoral neck). After 12 months, an increase in BMD was seen, but it was still lower than in the control group. Statistically significantly higher concentrations of bone turnover markers, decreasing from the sixth month of treatment, were noted only in the group with hyperthyroidism. Statistically significant differences were not noted in the femoral neck nor in the lumbar spine BMD in patients with hypothyroidism. Hyperthyroidism poses a negative effect on bone metabolism. Hypothyroidism in premenopausal females does not have any influence on bone density.

Spine Trabecular Bone Score as an Indicator of Bone Microarchitecture at the Peripheral Skeleton in Kidney Transplant Recipients.

PubMed

Luckman, Matthew; Hans, Didier; Cortez, Natalia; Nishiyama, Kyle K; Agarawal, Sanchita; Zhang, Chengchen; Nikkel, Lucas; Iyer, Sapna; Fusaro, Maria; Guo, Edward X; McMahon, Donald J; Shane, Elizabeth; Nickolas, Thomas L

2017-04-03

Studies using high-resolution peripheral quantitative computed tomography showed progressive abnormalities in cortical and trabecular microarchitecture and biomechanical competence over the first year after kidney transplantation. However, high-resolution peripheral computed tomography is a research tool lacking wide availability. In contrast, the trabecular bone score is a novel and widely available tool that uses gray-scale variograms of the spine image from dual-energy x-ray absorptiometry to assess trabecular quality. There are no studies assessing whether trabecular bone score characterizes bone quality in kidney transplant recipients. Between 2009 and 2010, we conducted a study to assess changes in peripheral skeletal microarchitecture, measured by high-resolution peripheral computed tomography, during the first year after transplantation in 47 patients managed with early corticosteroid-withdrawal immunosuppression. All adult first-time transplant candidates were eligible. Patients underwent imaging with high-resolution peripheral computed tomography and dual-energy x-ray absorptiometry pretransplantation and 3, 6, and 12 months post-transplantation. We now test if, during the first year after transplantation, trabecular bone score assesses the evolution of bone microarchitecture and biomechanical competence as determined by high-resolution peripheral computed tomography. At baseline and follow-up, among the 72% and 78%, respectively, of patients having normal bone mineral density by dual-energy x-ray absorptiometry, 53% and 50%, respectively, were classified by trabecular bone score as having high fracture risk. At baseline, trabecular bone score correlated with spine, hip, and ultradistal radius bone mineral density by dual-energy x-ray absorptiometry and cortical area, density, thickness, and porosity; trabecular density, thickness, separation, and heterogeneity; and stiffness and failure load by high-resolution peripheral computed tomography. Longitudinally, each percentage increase in trabecular bone score was associated with increases in trabecular number (0.35%±1.4%); decreases in trabecular thickness (-0.45%±0.15%), separation (-0.40%±0.15%), and network heterogeneity (-0.48%±0.20%); and increases in failure load (0.22%±0.09%) by high-resolution peripheral computed tomography (all P <0.05). Trabecular bone score may be a useful method to assess and monitor bone quality and strength and classify fracture risk in kidney transplant recipients. Copyright © 2017 by the American Society of Nephrology.

Spine Trabecular Bone Score as an Indicator of Bone Microarchitecture at the Peripheral Skeleton in Kidney Transplant Recipients

PubMed Central

Luckman, Matthew; Hans, Didier; Cortez, Natalia; Nishiyama, Kyle K.; Agarawal, Sanchita; Zhang, Chengchen; Nikkel, Lucas; Iyer, Sapna; Fusaro, Maria; Guo, Edward X.; McMahon, Donald J.; Shane, Elizabeth

2017-01-01

Background and objectives Studies using high-resolution peripheral quantitative computed tomography showed progressive abnormalities in cortical and trabecular microarchitecture and biomechanical competence over the first year after kidney transplantation. However, high-resolution peripheral computed tomography is a research tool lacking wide availability. In contrast, the trabecular bone score is a novel and widely available tool that uses gray-scale variograms of the spine image from dual-energy x-ray absorptiometry to assess trabecular quality. There are no studies assessing whether trabecular bone score characterizes bone quality in kidney transplant recipients. Design, settings, participants, & measurements Between 2009 and 2010, we conducted a study to assess changes in peripheral skeletal microarchitecture, measured by high-resolution peripheral computed tomography, during the first year after transplantation in 47 patients managed with early corticosteroid–withdrawal immunosuppression. All adult first-time transplant candidates were eligible. Patients underwent imaging with high-resolution peripheral computed tomography and dual-energy x-ray absorptiometry pretransplantation and 3, 6, and 12 months post-transplantation. We now test if, during the first year after transplantation, trabecular bone score assesses the evolution of bone microarchitecture and biomechanical competence as determined by high-resolution peripheral computed tomography. Results At baseline and follow-up, among the 72% and 78%, respectively, of patients having normal bone mineral density by dual-energy x-ray absorptiometry, 53% and 50%, respectively, were classified by trabecular bone score as having high fracture risk. At baseline, trabecular bone score correlated with spine, hip, and ultradistal radius bone mineral density by dual-energy x-ray absorptiometry and cortical area, density, thickness, and porosity; trabecular density, thickness, separation, and heterogeneity; and stiffness and failure load by high-resolution peripheral computed tomography. Longitudinally, each percentage increase in trabecular bone score was associated with increases in trabecular number (0.35%±1.4%); decreases in trabecular thickness (−0.45%±0.15%), separation (−0.40%±0.15%), and network heterogeneity (−0.48%±0.20%); and increases in failure load (0.22%±0.09%) by high-resolution peripheral computed tomography (all P<0.05). Conclusions Trabecular bone score may be a useful method to assess and monitor bone quality and strength and classify fracture risk in kidney transplant recipients. PMID:28348031

The Multifactorial role of Peripheral Nervous System in Bone Growth

NASA Astrophysics Data System (ADS)

Gkiatas, Ioannis; Papadopoulos, Dimitrios; Pakos, Emilios E.; Kostas-Agnantis, Ioannis; Gelalis, Ioannis; Vekris, Marios; Korompilias, Anastasios

2017-09-01

Bone alters its metabolic and anabolic activities in response to the variety of systemic and local factors such as hormones and growth factors. Classical observations describing abundance of the nerve fibers in bone also predict a paradigm that the nervous system influences bone metabolism and anabolism. Since 1916 several investigators tried to analyze the effect of peripheral nervous system in bone growth and most of them advocated for the positive effect of innervation in the bones of growing organisms. Moreover, neuronal tissue controls bone formation and remodeling. The purpose of this mini-review is to present the most recent data concerning the influence of innervation on bone growth, the current understanding of the skeletal innervation and their proposed physiological effects on bone metabolism as well as the implication of denervation in human skeletal biology in the developing organism since the peripheral neural trauma as well as peripheral neuropathies are common and they have impact on the growing skeleton.

Reproducibility of CT bone densitometry: operator versus automated ROI definition.

PubMed

Louis, O; Luypaert, R; Kalender, W; Osteaux, M

1988-05-01

Intrasubject reproducibility with repeated determination of vertebral mineral density from a given set of CT images was investigated. The region of interest (ROI) in 10 patient scans was selected by four independent operators either manually or with an automated procedure separating cortical and spongeous bone, the operators being requested to interact in ROI selection. The mean intrasubject variation was found to be much lower with the automated process (0.3 to 0.6%) than with the conventional method (2.5 to 5.2%). In a second study, 10 patients were examined twice to determine the reproducibility of CT slice selection by the operator. The errors were of the same order of magnitude as in ROI selection.

Official Positions for FRAX® clinical regarding smoking from Joint Official Positions Development Conference of the International Society for Clinical Densitometry and International Osteoporosis Foundation on FRAX®.

PubMed

Dimai, Hans P; Chandran, Manju

2011-01-01

The worldwide prevalence of smoking has been estimated at about 50% in men, and 10% in women, with larger variations among different populations studied. Smoking has been shown to affect many organ systems resulting in severe morbidity and increased mortality. In addition, smoking has been identified as a predictor of ten-year fracture risk in men and women, largely independent of an individual's bone mineral density. This finding has eventually lead to incorporation of this risk factor into FRAX®, an algorithm that has been developed to calculate an individual's ten-year fracture risk. However, only little, or conflicting data is available on a possible association between smoking dose, duration, length of time after cessation, type of tobacco and fracture risk, limiting this risk factor's applicability in the context of FRAX®. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Peripheral-blood stem cells versus bone marrow from unrelated donors.

PubMed

Anasetti, Claudio; Logan, Brent R; Lee, Stephanie J; Waller, Edmund K; Weisdorf, Daniel J; Wingard, John R; Cutler, Corey S; Westervelt, Peter; Woolfrey, Ann; Couban, Stephen; Ehninger, Gerhard; Johnston, Laura; Maziarz, Richard T; Pulsipher, Michael A; Porter, David L; Mineishi, Shin; McCarty, John M; Khan, Shakila P; Anderlini, Paolo; Bensinger, William I; Leitman, Susan F; Rowley, Scott D; Bredeson, Christopher; Carter, Shelly L; Horowitz, Mary M; Confer, Dennis L

2012-10-18

Randomized trials have shown that the transplantation of filgrastim-mobilized peripheral-blood stem cells from HLA-identical siblings accelerates engraftment but increases the risks of acute and chronic graft-versus-host disease (GVHD), as compared with the transplantation of bone marrow. Some studies have also shown that peripheral-blood stem cells are associated with a decreased rate of relapse and improved survival among recipients with high-risk leukemia. We conducted a phase 3, multicenter, randomized trial of transplantation of peripheral-blood stem cells versus bone marrow from unrelated donors to compare 2-year survival probabilities with the use of an intention-to-treat analysis. Between March 2004 and September 2009, we enrolled 551 patients at 48 centers. Patients were randomly assigned in a 1:1 ratio to peripheral-blood stem-cell or bone marrow transplantation, stratified according to transplantation center and disease risk. The median follow-up of surviving patients was 36 months (interquartile range, 30 to 37). The overall survival rate at 2 years in the peripheral-blood group was 51% (95% confidence interval [CI], 45 to 57), as compared with 46% (95% CI, 40 to 52) in the bone marrow group (P=0.29), with an absolute difference of 5 percentage points (95% CI, -3 to 14). The overall incidence of graft failure in the peripheral-blood group was 3% (95% CI, 1 to 5), versus 9% (95% CI, 6 to 13) in the bone marrow group (P=0.002). The incidence of chronic GVHD at 2 years in the peripheral-blood group was 53% (95% CI, 45 to 61), as compared with 41% (95% CI, 34 to 48) in the bone marrow group (P=0.01). There were no significant between-group differences in the incidence of acute GVHD or relapse. We did not detect significant survival differences between peripheral-blood stem-cell and bone marrow transplantation from unrelated donors. Exploratory analyses of secondary end points indicated that peripheral-blood stem cells may reduce the risk of graft failure, whereas bone marrow may reduce the risk of chronic GVHD. (Funded by the National Heart, Lung, and Blood Institute-National Cancer Institute and others; ClinicalTrials.gov number, NCT00075816.).

Whole-body vibration improves fracture healing and bone quality in rats with ovariectomy-induced osteoporosis.

PubMed

Butezloff, Mariana Maloste; Zamarioli, Ariane; Leoni, Graziela Bianchi; Sousa-Neto, Manoel Damião; Volpon, Jose Batista

2015-11-01

To investigate the effect of vibration therapy on the bone callus of fractured femurs and the bone quality of intact femurs in ovariectomized rats. Fifty-six rats aged seven weeks were divided into four groups: control with femoral fracture (CON, n=14), ovariectomized with femoral fracture (OVX, n=14), control with femoral fracture plus vibration therapy (CON+VT, n=14), and ovariectomized with femoral fracture plus vibration therapy (OVX+VT, n=14). Three months after ovariectomy or sham surgery, a complete fracture was produced at the femoral mid-diaphysis and stabilized with a 1-mm-diameter intramedullary Kirschner wire. X-rays confirmed the fracture alignment and fixation. Three days later, the VT groups underwent vibration therapy (1 mm, 60 Hz for 20 minutes, three times per week for 14 or 28 days). The bone and callus quality were assessed by densitometry, three-dimensional microstructure, and mechanical test. Ovariectomized rats exhibited a substantial loss of bone mass and severe impairment in bone microarchitecture, both in the non-fractured femur and the bone callus. Whole-body vibration therapy exerted an important role in ameliorating the bone and fracture callus parameters in the osteoporotic bone. Vibration therapy improved bone quality and the quality of the fracture bone callus in ovariectomized rats.

CORRELATION BETWEEN CALCANEAL BONE ULTRASOUND MEASUREMENTS AND DENSITOMETRY AMONG POSTMENOPAUSAL WOMEN WITH FRACTURES CAUSED BY BONE FRAGILITY

PubMed Central

Moraes, Frederico Barra; Oliveira, Lindomar Guimarães de; Novais, Pierre de Souza; Melo, Murilo Rodrigues; Guimarães, Mara Lúcia Rassi

2015-01-01

Objective: To assess the correlation between ultrasound (US) measurement on the calcaneus and bone densitometry (DEXA), among postmenopausal women who already presented fragility fractures. Methods: 35 postmenopausal women over 40 years of age, with the ability to walk and presenting osteoporotic fractures of the wrist or spine, without previous treatment for osteoporosis, were analyzed in a retrospective cohort. Of these, 16 were under 60 and 19 were over 60. The broadband ultrasound attenuation (BUA) and speed of sound (SOS) were compared using DEXA (L1-L4, total femur, femoral neck and wrist). Two different values of BUA were used as cutoff points for osteoporosis: BUA < 60 dB/MHz and BUA < 64 dB/MHz (P < 0.05); and SOS < 1600 m/s. The confidence interval was 95%. The DEXA and US data were plotted on dispersion graphs and, through linear regression, it was possible to establish correlations. Following this, the sample was stratified according to age (up to 60 years and 60 years and over). Thus, the values were again compared and correlated. Results: The best correlation obtained between DEXA and US was between the T-score of the wrist and BUA < 64 dB/MHz, with 92% sensitivity and 95% specificity. Better sensitivity at all DEXA sites was obtained when US was performed on patients over 60 years of age. The SOS compatible with osteoporosis was < 1592.5 m/s (89% sensitivity and 85% specificity). Conclusion: US on the calcaneus can be used for screening the risk of osteoporosis fractures, using a cutoff of BUA < 64 dB/MHz, especially among patients over 60 years of age. PMID:27027001

CORRELATION BETWEEN CALCANEAL BONE ULTRASOUND MEASUREMENTS AND DENSITOMETRY AMONG POSTMENOPAUSAL WOMEN WITH FRACTURES CAUSED BY BONE FRAGILITY.

PubMed

Moraes, Frederico Barra; Oliveira, Lindomar Guimarães de; Novais, Pierre de Souza; Melo, Murilo Rodrigues; Guimarães, Mara Lúcia Rassi

2011-01-01

To assess the correlation between ultrasound (US) measurement on the calcaneus and bone densitometry (DEXA), among postmenopausal women who already presented fragility fractures. 35 postmenopausal women over 40 years of age, with the ability to walk and presenting osteoporotic fractures of the wrist or spine, without previous treatment for osteoporosis, were analyzed in a retrospective cohort. Of these, 16 were under 60 and 19 were over 60. The broadband ultrasound attenuation (BUA) and speed of sound (SOS) were compared using DEXA (L1-L4, total femur, femoral neck and wrist). Two different values of BUA were used as cutoff points for osteoporosis: BUA < 60 dB/MHz and BUA < 64 dB/MHz (P < 0.05); and SOS < 1600 m/s. The confidence interval was 95%. The DEXA and US data were plotted on dispersion graphs and, through linear regression, it was possible to establish correlations. Following this, the sample was stratified according to age (up to 60 years and 60 years and over). Thus, the values were again compared and correlated. The best correlation obtained between DEXA and US was between the T-score of the wrist and BUA < 64 dB/MHz, with 92% sensitivity and 95% specificity. Better sensitivity at all DEXA sites was obtained when US was performed on patients over 60 years of age. The SOS compatible with osteoporosis was < 1592.5 m/s (89% sensitivity and 85% specificity). US on the calcaneus can be used for screening the risk of osteoporosis fractures, using a cutoff of BUA < 64 dB/MHz, especially among patients over 60 years of age.

Management of hypogonadism in adolescent girls and adult women with Prader-Willi syndrome.

PubMed

Eldar-Geva, Talia; Hirsch, Harry J; Pollak, Yehuda; Benarroch, Fortu; Gross-Tsur, Varda

2013-12-01

Prader-Willi syndrome (PWS) is a neurodevelopmental disorder characterized by an insatiable appetite, dysmorphic features, cognitive and behavioral difficulties, and hypogonadism. The heterogeneous reproductive hormone profiles indicate that some PWS women may have symptoms of hypoestrogenism, while others may potentially be fertile. We describe our experience in the assessment and treatment of hypogonadism in adolescents and adult females with PWS. The study population consisted of 20 PWS females, age ≥16 years (27.3 ± 7.9 years), followed in our clinic (12 deletion, 7 uniparental disomy, 1 imprinting-center defect). General physical examination, pubertal assessment, body mass index (BMI), gynecological examination, ultrasonography, bone densitometry, and hormonal profiles [FSH, LH, inhibin B, estradiol, prolactin, and TSH] were performed. The relevant assessed factors were: FSH and inhibin B, menstrual cycles (oligo/amenorrhea or irregular bleeding), ultrasound findings (endometrial thickness, uterine/ovarian abnormalities), BMI, bone densitometry, and patient/caregivers attitude. We classified seven women with inhibin B >20 ng/ml as potentially fertile. Following the assessment of the above factors, we recommended the individual-specific treatment; contraceptive pills, intra-uterine device, estrogen/progesterone replacement, and cyclic progesterone, in 3, 1, 4, and 1 patients, respectively. Four patients did not follow our recommendations due to poor compliance or family refusal. We recommended contraception pills for one 26-year-old woman with inhibin B and FSH levels 53 ng/ml and 6.4 IU/L; however, she refused treatment, conceived spontaneously and had an abortion. Guidelines for hormonal replacement therapy in PWS need to be tailored individually depending on physical development, hormonal profiles, bone density, and emotional and social needs of each PWS adolescent and adult. © 2013 Wiley Periodicals, Inc.

Clinical Evaluation of Decellularized Nerve Allograft with Autologous Bone Marrow Stem Cells to Improve Peripheral Nerve Repair and Functional Outcomes

DTIC Science & Technology

2017-07-01

AWARD NUMBER: W81XWH-15-2-0026 TITLE: Clinical Evaluation of Decellularized Nerve Allograft with Autologous Bone Marrow Stem Cells to Improve...of Decellularized Nerve Allograft with 5a. CONTRACT NUMBER Autologous Bone Marrow Stem Cells to Improve Peripheral Nerve 5b. GRANT NUMBER W81XWH...commercially available decellularized processed peripheral nerve allograft scaffold (Avance® Nerve Graft, AxoGen, Alachua FL) with autologous bone marrow

Does a high dietary acid content cause bone loss, and can bone loss be prevented with an alkaline diet?

PubMed

Hanley, David A; Whiting, Susan J

2013-01-01

A popular concept in nutrition and lay literature is that of the role of a diet high in acid or protein in the pathogenesis of osteoporosis. A diet rich in fruit and vegetable intake is thought to enhance bone health as the result of its greater potassium and lower "acidic" content than a diet rich in animal protein and sodium. Consequently, there have been a number of studies of diet manipulation to enhance potassium and "alkaline" content of the diet to improve bone density or other parameters of bone health. Although acid loading or an acidic diet featuring a high protein intake may be associated with an increase in calciuria, the evidence supporting a role of these variables in the development of osteoporosis is not consistent. Similarly, intervention studies with a more alkaline diet or use of supplements of potassium citrate or bicarbonate have not consistently shown a bone health benefit. In the elderly, inadequate protein intake is a greater problem for bone health than protein excess. Copyright © 2013 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Peripheral-Blood Stem Cells versus Bone Marrow from Unrelated Donors

PubMed Central

Anasetti, Claudio; Logan, Brent R.; Lee, Stephanie J.; Waller, Edmund K.; Weisdorf, Daniel J.; Wingard, John R.; Cutler, Corey S.; Westervelt, Peter; Woolfrey, Ann; Couban, Stephen; Ehninger, Gerhard; Johnston, Laura; Maziarz, Richard T.; Pulsipher, Michael A.; Porter, David L.; Mineishi, Shin; McCarty, John M.; Khan, Shakila P.; Anderlini, Paolo; Bensinger, William I.; Leitman, Susan F.; Rowley, Scott D.; Bredeson, Christopher; Carter, Shelly L.; Horowitz, Mary M.; Confer, Dennis L.

2012-01-01

BACKGROUND Randomized trials have shown that the transplantation of filgrastim-mobilized peripheral-blood stem cells from HLA-identical siblings accelerates engraftment but increases the risks of acute and chronic graft-versus-host disease (GVHD), as compared with the transplantation of bone marrow. Some studies have also shown that peripheral-blood stem cells are associated with a decreased rate of relapse and improved survival among recipients with high-risk leukemia. METHODS We conducted a phase 3, multicenter, randomized trial of transplantation of peripheral-blood stem cells versus bone marrow from unrelated donors to compare 2-year survival probabilities with the use of an intention-to-treat analysis. Between March 2004 and September 2009, we enrolled 551 patients at 48 centers. Patients were randomly assigned in a 1:1 ratio to peripheral-blood stem-cell or bone marrow transplantation, stratified according to transplantation center and disease risk. The median follow-up of surviving patients was 36 months (interquartile range, 30 to 37). RESULTS The overall survival rate at 2 years in the peripheral-blood group was 51% (95% confidence interval [CI], 45 to 57), as compared with 46% (95% CI, 40 to 52) in the bone marrow group (P = 0.29), with an absolute difference of 5 percentage points (95% CI, −3 to 14). The overall incidence of graft failure in the peripheral-blood group was 3% (95% CI, 1 to 5), versus 9% (95% CI, 6 to 13) in the bone marrow group (P = 0.002). The incidence of chronic GVHD at 2 years in the peripheral-blood group was 53% (95% CI, 45 to 61), as compared with 41% (95% CI, 34 to 48) in the bone marrow group (P = 0.01). There were no significant between-group differences in the incidence of acute GVHD or relapse. CONCLUSIONS We did not detect significant survival differences between peripheral-blood stem-cell and bone marrow transplantation from unrelated donors. Exploratory analyses of secondary end points indicated that peripheral-blood stem cells may reduce the risk of graft failure, whereas bone marrow may reduce the risk of chronic GVHD. (Funded by the National Heart, Lung, and Blood Institute–National Cancer Institute and others; ClinicalTrials.gov number, NCT00075816.) PMID:23075175

Response of the skeletal system to helicopter-unique vibration.

PubMed

Gearhart, J R

1978-01-01

An 18-month prospective skeletal system study was conducted on flying and nonflying personnel relative to chronic low-frequency vibration as experienced in helicopter flight. The aviators were initial entry students in rotary-wing training while the non-flying participants were beginning basic military training. Comparisons were made on the basis of anthropometric measurements, radiological studies, and bone mineral density changes as measured by photon absorption. The bone mineral densitometry showed no significant variation in the aviator group. A short-term 10% demineralization of the distal ulna in the non-flying group was noted immediately following the physical training. The final bone mineral density of basic training subjects returned to the initial level 18 months after the physical training. It was concluded that the helicopter aircrew members under study were exposed to levels of vibration below the threshold of vibration required to produce a measurable change in the skeletal system.

Osteoporosis: primary prevention in the community.

PubMed

Loh, K Y; Shong, H K

2007-10-01

The incidence of osteoporosis is increasing worldwide. It has great impact on the life of the elderly population. The most significant medical consequence of osteoporosis is fragility fracture which without proper treatment will cause severe medical and psychosocial complications. The overall cost in managing osteoporosis and its related fractures is escalating. Using bone densitometry to measure bone mineral density is useful in the diagnosis of osteoporosis but it is costly and not feasible in the community. Drugs such as estrogen replacement, raloxifene and calcitonin are effective in prevention and treatment of osteoporosis but they are also expensive. Identifying modifiable risk factors such as smoking, lack of exercise, low dietary calcium and vitamin D intake and healthy life style remain strategy in the primary prevention of osteoporosis in the community.

Challenges of Estimating Fracture Risk with DXA: Changing Concepts About Bone Strength and Bone Density.

PubMed

Licata, Angelo A

2015-07-01

Bone loss due to weightlessness is a significant concern for astronauts' mission safety and health upon return to Earth. This problem is monitored with bone densitometry (DXA), the clinical tool used to assess skeletal strength. DXA has served clinicians well in assessing fracture risk and has been particularly useful in diagnosing osteoporosis in the elderly postmenopausal population for which it was originally developed. Over the past 1-2 decades, however, paradoxical and contradictory findings have emerged when this technology was widely employed in caring for diverse populations unlike those for which it was developed. Although DXA was originally considered the surrogate marker for bone strength, it is now considered one part of a constellation of factors-described collectively as bone quality-that makes bone strong and resists fracturing, independent of bone density. These characteristics are beyond the capability of routine DXA to identify, and as a result, DXA can be a poor prognosticator of bone health in many clinical scenarios. New clinical tools are emerging to make measurement of bone strength more accurate. This article reviews the historical timeline of bone density measurement (dual X-ray absorptiometry), expands upon the clinical observations that modified the relationship of DXA and bone strength, discusses some of the new clinical tools to predict fracture risk, and highlights the challenges DXA poses in the assessment of fracture risk in astronauts.

Combination Chemotherapy With or Without Ganitumab in Treating Patients With Newly Diagnosed Metastatic Ewing Sarcoma

ClinicalTrials.gov

2018-06-28

Metastatic Ewing Sarcoma; Metastatic Malignant Neoplasm in the Bone; Metastatic Malignant Neoplasm in the Bone Marrow; Metastatic Malignant Neoplasm in the Lung; Metastatic Peripheral Primitive Neuroectodermal Tumor of Bone; Peripheral Primitive Neuroectodermal Tumor of Soft Tissues

Visualization of newt aragonitic otoconial matrices using transmission electron microscopy

NASA Technical Reports Server (NTRS)

Steyger, P. S.; Wiederhold, M. L.

1995-01-01

Otoconia are calcified protein matrices within the gravity-sensing organs of the vertebrate vestibular system. These protein matrices are thought to originate from the supporting or hair cells in the macula during development. Previous studies of mammalian calcitic, barrel-shaped otoconia revealed an organized protein matrix consisting of a thin peripheral layer, a well-defined organic core and a flocculent matrix inbetween. No studies have reported the microscopic organization of the aragonitic otoconial matrix, despite its protein characterization. Pote et al. (1993b) used densitometric methods and inferred that prismatic (aragonitic) otoconia have a peripheral protein distribution, compared to that described for the barrel-shaped, calcitic otoconia of birds, mammals, and the amphibian utricle. By using tannic acid as a negative stain, we observed three kinds of organic matrices in preparations of fixed, decalcified saccular otoconia from the adult newt: (1) fusiform shapes with a homogenous electron-dense matrix; (2) singular and multiple strands of matrix; and (3) more significantly, prismatic shapes outlined by a peripheral organic matrix. These prismatic shapes remain following removal of the gelatinous matrix, revealing an internal array of organic matter. We conclude that prismatic otoconia have a largely peripheral otoconial matrix, as inferred by densitometry.

Is the assessment of the central skeleton sufficient for osseous staging in breast cancer patients? A retrospective approach using bone scans.

PubMed

Krammer, Julia; Engel, Dorothee; Schnitzer, Andreas; Kaiser, Clemens G; Dinter, Dietmar J; Brade, Joachim; Schoenberg, Stefan O; Wasser, Klaus

2013-06-01

By analyzing bone scans we aimed to determine whether the assessment of the central skeleton is sufficient for osseous staging in breast cancer patients. This might be of interest for future staging modalities, especially positron emission tomography/computed tomography, usually sparing the peripheral extremities, as well as the skull. In this retrospective study, a total of 837 bone scans for initial staging or restaging of breast cancer were included. A total of 291 bone scans in 172 patients were positive for bone metastases. The localization and distribution of the metastases were re-evaluated by two readers in consensus. The extent of the central skeleton involvement was correlated to the incidence of peripheral metastases. In all 172 patients bone metastases were seen in the central skeleton (including the proximal third of humerus and femur). In 34 patients (19.8 %) peripheral metastases of the extremities (distally of the proximal third of humerus and femur) could be detected. Sixty-four patients (37.2 %) showed metastases of the skull. Summarizing the metastases of the distal extremities and skull, 79 patients (45.9 %) had peripheral metastases. None of the patients showed peripheral metastases without any affliction of the central skeleton. The incidence of peripheral metastases significantly correlated with the extent of central skeleton involvement (p<0.001). Regarding bone scans, an isolated metastatic spread to the peripheral skeleton without any manifestation in the central skeleton seems to be the exception. Thus, the assessment of the central skeleton should be sufficient in osseous breast cancer staging and restaging. However, in case of central metastases, additional imaging of the periphery should be considered for staging and restaging.

Circulating hematopoietic progenitor cells in patients affected by Chornobyl accident.

PubMed

Bilko, N M; Dyagil, I S; Russu, I Z; Bilko, D I

2016-12-01

High radiation sensitivity of stem cells and their ability to accumulate sublethal radiation damage provides the basis for investigation of hematopoietic progenitors using in vivo culture methodology. Unique samples of peripheral blood and bone marrow were derived from the patients affected by Chornobyl accident during liquidation campaign. To investigate functional activity of circulating hematopoietic progenitor cells from peripheral blood and bone marrow of cleanup workers in early and remote periods after the accident at Chornobyl nuclear power plant (CNPP). The assessment of the functional activity of circulating hematopoietic progenitor cells was performed in samples of peripheral blood and bone marrow of 46 cleanup workers, who were treated in the National Scientific Center for Radiation Medicine of the Academy of Medical Sciences of Ukraine alongside with 35 non radiated patients, who served as a control. Work was performed by culturing peripheral blood and bone marrow mononuclear cells in the original gel diffusion capsules, implanted into the peritoneal cavity of CBA mice. It was shown that hematopoietic progenitor cells could be identified in the peripheral blood of liquidators of CNPP accident. At the same time the number of functionally active progenitor cells of the bone marrow was significantly decreased and during the next 10 years after the accident, counts of circulating progenitor cells in the peripheral blood as well as functionally active hematopoietic cells in bone marrow returned to normal levels. It was shown that hematopoietic progenitor cells are detected not only in the bone marrow but also in the peripheral blood of liquidators as a consequence of radiation exposure associated with CNPP accident. This article is a part of a Special Issue entitled "The Chornobyl Nuclear Accident: Thirty Years After".

[In vitro study with techniques of imaging of the composition of urinary calculi].

PubMed

Tellez Martínez-Fornés, M; Burgos Revilla, F J; Sáez Garrido, J C; Soria Descalzo, J; Barbero González, J; Sánchez Corral, J; Minaya Minaya, A; Vallejo Herrador, J

1997-02-01

Pre-treatment knowledge of the lithiasic composition can be useful to design the most appropriate therapeutic scheme for each kind of stone. The relationship between the stone's densitometry information provided by the different imaging techniques, conventional radiology (RX), computerized axial tomography (CAT) and dual energy radiographic densitometry (DO) is analyzed, as well as the elemental composition determined by the microanalysis of fragments obtained post-lithotrity using a scanning electronic microscope (SEM) associated to X-ray dispersion energy (XDE). 60 stones, 12 for each pure composition selected (calcium oxalate mono and dihydro, phosphocarbonate, magnesium ammonium phosphate and uric acid), were studied with XR, CAT and DO and were later subjected to lithofragmentation in vitro. Fragments analysis was carried out post-lithotrity with SEM associated to XDE. The X-ray does not allow to establish the composition of some calculi. CAT quantifies the mineral contents of the oxalocalcic and infective calculi and differentiates the uric acid from the other compositions because the mean density values are under 500 Hounsfield Units. DO evaluates the lithiasic content in phosphocarbonate salts which are structurally similar to bone hydroxyapatite.

FRAX(®) Clinical Task Force of the 2010 Joint International Society for Clinical Densitometry & International Osteoporosis Foundation Position Development Conference.

PubMed

McCloskey, Eugene V; Binkley, Neil

2011-01-01

The World Health Organization fracture risk assessment tool, FRAX(®), is an advance in clinical care that can assist in clinical decision-making. However, with increasing clinical utilization, numerous questions have arisen regarding how to best estimate fracture risk in an individual patient. Recognizing the need to assist clinicians in optimal use of FRAX(®), the International Osteoporosis Foundation (IOF) in conjunction with the International Society for Clinical Densitometry (ISCD) assembled an international panel of experts that ultimately developed joint Official Positions of the ISCD and IOF advising clinicians regarding FRAX(®) usage. As part of the process, the charge of the FRAX(®) Clinical Task Force was to review and synthesize data surrounding a number of recognized clinical risk factors including rheumatoid arthritis, smoking, alcohol, prior fracture, falls, bone turnover markers and glucocorticoid use. This synthesis was presented to the expert panel and constitutes the data on which the subsequent Official Positions are predicated. A summary of the Clinical Task Force composition and charge is presented here. Copyright © 2011. Published by Elsevier Inc.

Peripheral-specific y2 receptor knockdown protects mice from high-fat diet-induced obesity.

PubMed

Shi, Yan-Chuan; Lin, Shu; Castillo, Lesley; Aljanova, Aygul; Enriquez, Ronaldo F; Nguyen, Amy D; Baldock, Paul A; Zhang, Lei; Bijker, Martijn S; Macia, Laurence; Yulyaningsih, Ernie; Zhang, Hui; Lau, Jackie; Sainsbury, Amanda; Herzog, Herbert

2011-11-01

Y2 receptors, particularly those in the brain, have been implicated in neuropeptide Y (NPY)-mediated effects on energy homeostasis and bone mass. Recent evidence also indicates a role for Y2 receptors in peripheral tissues in this process by promoting adipose tissue accretion; however their effects on energy balance remain unclear. Here, we show that adult-onset conditional knockdown of Y2 receptors predominantly in peripheral tissues results in protection against diet-induced obesity accompanied by significantly reduced weight gain, marked reduction in adiposity and improvements in glucose tolerance without any adverse effect on lean mass or bone. These changes occur in association with significant increases in energy expenditure, respiratory exchange ratio, and physical activity and despite concurrent hyperphagia. On a chow diet, knockdown of peripheral Y2 receptors results in increased respiratory exchange ratio and physical activity with no effect on lean or bone mass, but decreases energy expenditure without effecting body weight or food intake. These results suggest that peripheral Y2 receptor signaling is critical in the regulation of oxidative fuel selection and physical activity and protects against the diet-induced obesity. The lack of effects on bone mass seen in this model further indicates that bone mass is primarily controlled by non-peripheral Y2 receptors. This study provides evidence that novel drugs that target peripheral rather than central Y2 receptors could provide benefits for the treatment of obesity and glucose intolerance without adverse effects on lean and bone mass, with the additional benefit of avoiding side effects often associated with pharmaceuticals that act on the central nervous system.

Sex- and Age-Related Differences in Bone Microarchitecture in Men Relative to Women Assessed by High-Resolution Peripheral Quantitative Computed Tomography

PubMed Central

Amin, Shreyasee; Khosla, Sundeep

2012-01-01

The trabecular and cortical compartments of bone each contributes to bone strength. Until recently, assessment of trabecular and cortical microstructure has required a bone biopsy. Now, trabecular and cortical microstructure of peripheral bone sites can be determined noninvasively using high-resolution peripheral quantitative computed tomography (HR-pQCT). Studies that have used HR-pQCT to evaluate cohorts of both men and women have provided novel insights into the changes in bone microarchitecture that occur with age between the sexes, which may help to explain the lower fracture incidence in older men relative to women. This review will highlight observations from these studies on both the sex- and age-related differences in trabecular and cortical microstructure that may underlie the differences in bone strength, and thereby fracture risk, between men and women. PMID:22496983

Sheep model for osteoporosis: The effects of peripheral hormone therapy on centrally induced systemic bone loss in an osteoporotic sheep model.

PubMed

Oheim, Ralf; Simon, Maciej J K; Steiner, Malte; Vettorazzi, Eik; Barvencik, Florian; Ignatius, Anita; Amling, Michael; Clarke, Iain J; Pogoda, Pia; Beil, F Timo

2017-04-01

Hypothalamic-pituitary disconnection (HPD) leads to low bone turnover followed by bone loss and reduced biomechanical properties in sheep. To investigate the role of peripheral hormones in this centrally induced systemic bone loss model, we planned a hormone replacement experiment. Therefore, estrogen (OHE), thyroxin (OHT) or a combination of both (OHTE) was substituted in ovariectomized HPD sheep, as both hormones are decreased in HPD sheep and are known to have a significant but yet not fully understood impact on bone metabolism. Bone turnover and structural parameters were analyzed in comparison to different control groups - untreated sheep (C), ovariectomized (O) and ovariectomized+HPD sheep (OH). We performed histomorphometric and HR-pQCT analyses nine months after the HPD procedure, as well as biomechanical testing of all ewes studied. In HPD sheep (OH) the low bone turnover led to a significant bone loss. Treatment with thyroxin alone (OHT) mainly increased bone resorption, leading to a further reduction in bone volume. In contrast, the treatment with estrogen alone (OHE) and the combined treatment with estrogen and thyroxin (OHTE) prevented HPD-induced bone loss completely. In conclusion, peripheral hormone substitution was able to prevent HPD-induced low-turnover osteoporosis in sheep. But only the treatment with estrogen alone or in combination with thyroxin was able to completely preserve bone mass and structure. These findings demonstrate the importance of peripheral hormones for a balanced bone remodeling and a physiological bone turnover. Copyright © 2017 Elsevier Ltd. All rights reserved.

INVESTIGATION OF BONE MINERALIZATION IN PATIENTS WITH CORONARY HEART DISEASE COMPLICATED BY CHRONIC HEART FAILURE, STAGE II-A.

PubMed

Krynytska, I; Marushchak, M; Zaets, T; Savchenko, I; Habor, H

2017-06-01

The majority of the studies have shown that individuals with cardiovascular diseases have a higher risk of experiencing bone loss and thus greater predisposition to risk of fracture. On the other hand there is growing evidence that individuals with low bone mass have higher mortality for cardiovascular events compared to patients with cardiovascular disease with normal bone mass. This research aims to investigate bone mineralization in patients with coronary heart disease complicated by stage II-A chronic heart failure. The study involved 33 men with coronary heart disease complicated by Stage II-A chronic heart failure. Bone mineral density was measured using dual energy x-ray densitometry of lumbar region of spine. Structural and functional changes of bone tissue of the lumbar spine have been found in 49,2% patients with coronary heart disease complicated by Stage II-A chronic heart failure, in particular, I stage of osteopenia - in 44,6%, II stage of osteopenia - in 27,7%, III stage of osteopenia - in 10,8% and osteoporosis - in 16,9%. It was established the same type of downward trend for BMD decreasing in L1 of patients with different stages of osteopenia, but in case of osteoporosis mineralization decreased equally in all vertebrae.

Nandrolone decanoate appears to increase bone callus formation in young adult rats after a complete femoral fracture.

PubMed

Guimarães, Ana Paula Franttini Garcia Moreno; Butezloff, Mariana Maloste; Zamarioli, Ariane; Issa, João Paulo Mardegan; Volpon, José Batista

2017-11-01

To evaluate the influence of nandrolone decanoate on fracture healing and bone quality in normal rats. Male rats were assigned to four groups (n=28/group): Control group consisting of animals without any intervention, Nandrolone decanoate (DN) group consisting of animals that received intramuscular injection of nandrolone decanoate, Fracture group consisting of animals with a fracture at the mid-diaphysis of the femur, and Fracture and nandrolone decanoate group consisting of animals with a femur fracture and treatment with nandrolone decanoate. Fractures were created at the mid-diaphysis of the right femur by a blunt trauma and internally fixed using an intramedullary steel wire. The DN was injected intramuscularly twice per week (10 mg/kg of body mass). The femurs were measured and evaluated by densitometry and mechanical resistance after animal euthanasia. The newly formed bone and collagen type I levels were quantified in the callus. The treated animals had longer femurs after 28 days. The quality of the intact bone was not significantly different between groups. The bone callus did show a larger mass in the treated rats. The administration of nandrolone decanoate did not affect the quality of the intact bone, but might have enhanced the bone callus formation.

Consensus and controversy regarding osteoporosis in the pediatric population.

PubMed

Bachrach, Laura Keyes

2007-09-01

To review current consensus and controversy surrounding the diagnosis and treatment of osteoporosis in childhood and adolescence. The medical literature was reviewed with emphasis on the importance of early skeletal health, risk factors for bone fragility, and the diagnosis and management of children at risk for osteoporosis. Childhood and adolescence are critical periods for optimizing bone growth and mineral accrual. Bone strength is determined by bone size, geometry, quality, and mass-variables that are influenced by genetic factors, activity, nutrition, and hormones. For children with genetic skeletal disorders or chronic disease, bone growth and mineral accrual may be compromised, increasing the lifetime risk of osteoporosis. The goal for the clinician is to identify children at greatest risk for future fragility fracture. Bone densitometry and turnover markers are challenging to interpret in children. Prevention and treatment of bone fragility in children are less well established than in adults. Optimizing nutrition and activity may not restore bone health, but the drug armamentarium is limited. Sex steroid replacement has not proven effective in restoring bone mass in patients with anorexia nervosa or exercise-associated amenorrhea. Bisphosphonates can increase bone mass and may reduce bone pain and fractures, most convincingly in patients with osteogenesis imperfecta. Further studies are needed to establish the safety, efficacy, and optimal drug, duration, and dosage in pediatric patients. Bone health during the first 2 decades contributes to the lifetime risk of osteoporosis. Further research is needed to develop evidence-based recommendations for the diagnosis and treatment of osteoporosis in childhood.

The Influence of Reconstruction Kernel on Bone Mineral and Strength Estimates Using Quantitative Computed Tomography and Finite Element Analysis.

PubMed

Michalski, Andrew S; Edwards, W Brent; Boyd, Steven K

2017-10-17

Quantitative computed tomography has been posed as an alternative imaging modality to investigate osteoporosis. We examined the influence of computed tomography convolution back-projection reconstruction kernels on the analysis of bone quantity and estimated mechanical properties in the proximal femur. Eighteen computed tomography scans of the proximal femur were reconstructed using both a standard smoothing reconstruction kernel and a bone-sharpening reconstruction kernel. Following phantom-based density calibration, we calculated typical bone quantity outcomes of integral volumetric bone mineral density, bone volume, and bone mineral content. Additionally, we performed finite element analysis in a standard sideways fall on the hip loading configuration. Significant differences for all outcome measures, except integral bone volume, were observed between the 2 reconstruction kernels. Volumetric bone mineral density measured using images reconstructed by the standard kernel was significantly lower (6.7%, p < 0.001) when compared with images reconstructed using the bone-sharpening kernel. Furthermore, the whole-bone stiffness and the failure load measured in images reconstructed by the standard kernel were significantly lower (16.5%, p < 0.001, and 18.2%, p < 0.001, respectively) when compared with the image reconstructed by the bone-sharpening kernel. These data suggest that for future quantitative computed tomography studies, a standardized reconstruction kernel will maximize reproducibility, independent of the use of a quantitative calibration phantom. Copyright © 2017 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Vitamin K and bone health.

PubMed

Hamidi, Maryam S; Gajic-Veljanoski, Olga; Cheung, Angela M

2013-01-01

Vitamin K has been purported to play an important role in bone health. It is required for the gamma-carboxylation of osteocalcin (the most abundant noncollagenous protein in bone), making osteocalcin functional. There are 2 main forms (vitamin K1 and vitamin K2), and they come from different sources and have different biological activities. Epidemiologic studies suggest a diet high in vitamin K is associated with a lower risk of hip fractures in aging men and women. However, randomized controlled trials of vitamin K1 or K2 supplementation in white populations did not increase bone mineral density at major skeletal sites. Supplementation with vitamin K1 and K2 may reduce the risk of fractures, but the trials that examined fractures as an outcome have methodological limitations. Large well-designed trials are needed to compare the efficacies of vitamin K1 and K2 on fractures. We conclude that currently there is not enough evidence to recommend the routine use of vitamin K supplements for the prevention of osteoporosis and fractures in postmenopausal women. Copyright © 2013 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Methods and application of bone densitometry in clinical diagnosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wahner, H.W.; Riggs, B.L.

1986-01-01

With the awareness of osteoporosis as a major health problem for an aging population, there is great interest in early recognition and treatment of abnormal bone loss. Effective prevention of bone loss has to occur prior to the occurrence of irreparable damage. Standard radiographic procedures are not sensitive enough for the task. Therefore, a number of alternative procedures to estimate bone loss have been developed over the years, ranging from efforts to quantitate information obtained from radiographic images to sophisticated procedures such as neutron activation analysis or procedures based on the Compton scatter phenomenon. Only two procedures, photon absorptiometry andmore » computed tomography (CT), have emerged as applicable for routine clinical use. In photon absorptiometry the entire bone mineral (cortical and trabecular bone) of a specific skeletal site is measured. CT allows measuring of bone mineral of trabecular or cortical bone alone. Normally, bone mass reaches a maximum in the third decade and then continuously declines. This age-related bone loss is greater in women in whom an accelerated rate of loss occurs at the menopause. When bone density reaches a critical fracture threshold, skeletal fractures occur (spine, hip, and distal long bones). The age at which this critical fracture threshold is reached depends on the maximal bone mass achieved in early adulthood and the rate of loss with increasing age. With the exception of NaF, present-day therapeutic efforts only retard or prevent bone loss but do not significantly add bone mineral to the skeleton. Recognition of high-risk groups and early treatment are therefore required. 79 references.« less

Orexin Regulates Bone Remodeling via a Dominant Positive Central Action and a Subordinate Negative Peripheral Action

PubMed Central

Wei, Wei; Motoike, Toshiyuki; Krzeszinski, Jing Y.; Jin, Zixue; Xie, Xian-Jin; Dechow, Paul C.; Yanagisawa, Masashi; Wan, Yihong

2014-01-01

SUMMARY Orexin neuropeptides promote arousal, appetite, reward, and energy expenditure. However, whether orexin affects bone mass accrual is unknown. Here we show that orexin functions centrally through orexin receptor 2 (OX2R) in the brain to enhance bone formation. OX2R-null mice exhibit low-bone-mass owing to elevated circulating leptin; whereas central administration of an OX2R-selective agonist augments bone mass. Conversely, orexin also functions peripherally through orexin receptor 1 (OX1R) in the bone to suppress bone formation. OX1R-null mice exhibit high-bone-mass owing to a mesenchymal stem cell differentiation shift from adipocyte to osteoblast that results from higher osseous ghrelin expression. The central action is dominant over the peripheral action because bone mass is reduced in orexin-null and OX1R2R-double-null mice but enhanced in orexin over-expressing transgenic mice. These findings reveal orexin as a critical rheostat of skeletal homeostasis that exerts a yin-yang dual regulation, and highlight orexin as a therapeutic target for osteoporosis. PMID:24794976

Establishing a method to measure bone structure using spectral CT

NASA Astrophysics Data System (ADS)

Ramyar, M.; Leary, C.; Raja, A.; Butler, A. P. H.; Woodfield, T. B. F.; Anderson, N. G.

2017-03-01

Combining bone structure and density measurement in 3D is required to assess site-specific fracture risk. Spectral molecular imaging can measure bone structure in relation to bone density by measuring macro and microstructure of bone in 3D. This study aimed to optimize spectral CT methodology to measure bone structure in excised bone samples. MARS CT with CdTe Medipix3RX detector was used in multiple energy bins to calibrate bone structure measurements. To calibrate thickness measurement, eight different thicknesses of Aluminium (Al) sheets were scanned one in air and the other around a falcon tube and then analysed. To test if trabecular thickness measurements differed depending on scan plane, a bone sample from sheep proximal tibia was scanned in two orthogonal directions. To assess the effect of air on thickness measurement, two parts of the same human femoral head were scanned in two conditions (in the air and in PBS). The results showed that the MARS scanner (with 90μm voxel size) is able to accurately measure the Al (in air) thicknesses over 200μm but it underestimates the thicknesses below 200μm because of partial volume effect in Al-air interface. The Al thickness measured in the highest energy bin is overestimated at Al-falcon tube interface. Bone scanning in two orthogonal directions gives the same trabecular thickness and air in the bone structure reduced measurement accuracy. We have established a bone structure assessment protocol on MARS scanner. The next step is to combine this with bone densitometry to assess bone strength.

Zinc deficiency reduces bone mineral density in the spine of young adult rats: a pilot study.

PubMed

Ryz, Natasha R; Weiler, Hope A; Taylor, Carla G

2009-01-01

The objective of this study was to investigate the effects of zinc deficiency initiated during adolescence on skeletal densitometry, serum markers of bone metabolism, femur minerals and morphometry in young adult rats. Ten-week-old male rats were fed a <1-mg Zn/kg diet (9ZD), a 5-mg Zn/kg diet (9MZD) or a 30-mg Zn/kg diet (9CTL) for up to 9 weeks. Analyses included bone mineral density, serum osteocalcin and C-terminal peptides of type I collagen, serum zinc, femur zinc, calcium and phosphorus, and femur morphometry. Bone mineral density was 14% lower in the spine of 9ZD, but was not altered in the whole body, tibia or femur, or in any of the aforementioned sites in 9MZD, compared to 9CTL. When adjusted for size, spine bone mineral apparent density was still 8% lower in 9ZD than 9CTL. Serum osteocalcin, a marker for bone formation, was approximately 33% lower in 9ZD compared to both 9MZD and 9CTL. The 9ZD and 9MZD had 57% lower femur zinc and 56-88% lower serum zinc concentrations compared to 9CTL. These findings indicate that severe zinc deficiency initiated during adolescence may have important implications for future bone health, especially with regards to bone consolidation in the spine. 2009 S. Karger AG, Basel.

Quality initiatives: improving patient flow for a bone densitometry practice: results from a Mayo Clinic radiology quality initiative.

PubMed

Aakre, Kenneth T; Valley, Timothy B; O'Connor, Michael K

2010-03-01

Lean Six Sigma process improvement methodologies have been used in manufacturing for some time. However, Lean Six Sigma process improvement methodologies also are applicable to radiology as a way to identify opportunities for improvement in patient care delivery settings. A multidisciplinary team of physicians and staff conducted a 100-day quality improvement project with the guidance of a quality advisor. By using the framework of DMAIC (define, measure, analyze, improve, and control), time studies were performed for all aspects of patient and technologist involvement. From these studies, value stream maps for the current state and for the future were developed, and tests of change were implemented. Comprehensive value stream maps showed that before implementation of process changes, an average time of 20.95 minutes was required for completion of a bone densitometry study. Two process changes (ie, tests of change) were undertaken. First, the location for completion of a patient assessment form was moved from inside the imaging room to the waiting area, enabling patients to complete the form while waiting for the technologist. Second, the patient was instructed to sit in a waiting area immediately outside the imaging rooms, rather than in the main reception area, which is far removed from the imaging area. Realignment of these process steps, with reduced technologist travel distances, resulted in a 3-minute average decrease in the patient cycle time. This represented a 15% reduction in the initial patient cycle time with no change in staff or costs. Radiology process improvement projects can yield positive results despite small incremental changes.

[THE COMPARISON OF RESULTS OF DETECTION OF MINIMAL RESIDUAL DISEASE IN PERIPHERAL BLOOD AND MARROW IN CHILDREN OF THE FIRST YEAR OF LIFE WITH ACUTE LYMPHOBLASTIC LEUCOSIS].

PubMed

Tsaur, G A; Riger, T O; Popov, A M; Nasedkina, T V; Kustanovich, A M; Solodovnikov, A G; Streneva, O V; Shorikov, E V; Tsvirenko, S V; Saveliev, L I; Fechina, L G

2015-04-01

The occurrence of minimal residual disease is an important prognostic factor under acute lymphoblastic leucosis in children and adults. In overwhelming majority of research studies bone marrow is used to detect minimal residual disease. The comparative characteristic of detection of minimal residual disease in peripheral blood and bone marrow was carried out. The prognostic role of occurrence of minimal residual disease in peripheral blood and bone marrow under therapy according protocol MLL-Baby was evaluated. The analysis embraced 142 pair samples from 53 patients with acute lymphoblastic leucosis and various displacements of gene MLL younger than 365 days. The minimal residual disease was detected by force of identification of chimeric transcripts using polymerase chain reaction in real-time mode in 7 sequential points of observation established by protocol of therapy. The comparability of results of qualitative detection of minimal residual disease in bone marrow and peripheral blood amounted to 84.5%. At that, in all 22 (15.5%) discordant samples minimal residual disease was detected only in bone marrow. Despite of high level of comparability of results of detection of minimal residual disease in peripheral blood and bone marrow the occurrence of minimal residual disease in peripheral blood at various stages of therapy demonstrated no independent prognostic significance. The established differences had no relationship with sensitivity of method determined by value of absolute expression of gene ABL. Most likely, these differences reflected real distribution of tumor cells. The results of study demonstrated that application of peripheral blood instead of bone marrow for monitoring of minimal residual disease under acute lymphoblastic leucosis in children of first year of life is inappropriate. At the same time, retention of minimal residual disease in TH4 in bone marrow was an independent and prognostic unfavorable factor under therapy of acute lymphoblastic leucosis of children of first year of life according protocol MLL-Baby (OO=7.326, confidence interval 2.378-22.565).

78 FR 60810 - Change to the Definition of “Human Organ” Under Section 301 of the National Organ Transplant Act...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-10-02

... hematopoietic stem cells (HSCs) within peripheral blood in the definition of ``bone marrow.'' This would clarify... of whether they were recovered directly from bone marrow (by aspiration) or from peripheral blood (by... consideration.'' ``Human organ'' is defined to include ``bone marrow * * * or any subpart thereof'' or any organ...

Biomedical technology transfer. Applications of NASA science and technology

NASA Technical Reports Server (NTRS)

Harrison, D. C.

1980-01-01

Ongoing projects described address: (1) intracranial pressure monitoring; (2) versatile portable speech prosthesis; (3) cardiovascular magnetic measurements; (4) improved EMG biotelemetry for pediatrics; (5) ultrasonic kidney stone disintegration; (6) pediatric roentgen densitometry; (7) X-ray spatial frequency multiplexing; (8) mechanical impedance determination of bone strength; (9) visual-to-tactile mobility aid for the blind; (10) Purkinje image eyetracker and stabilized photocoalqulator; (11) neurological applications of NASA-SRI eyetracker; (12) ICU synthesized speech alarm; (13) NANOPHOR: microelectrophoresis instrument; (14) WRISTCOM: tactile communication system for the deaf-blind; (15) medical applications of NASA liquid-circulating garments; and (16) hip prosthesis with biotelemetry. Potential transfer projects include a person-portable versatile speech prosthesis, a critical care transport sytem, a clinical information system for cardiology, a programmable biofeedback orthosis for scoliosis a pediatric long-bone reconstruction, and spinal immobilization apparatus.

Identification, characterization and isolation of a common progenitor for osteoclasts, macrophages and dendritic cells from murine bone marrow and periphery

PubMed Central

Jacome-Galarza, Christian E.; Lee, Sun-Kyeong; Lorenzo, Joseph A.; LeonardoAguila, Hector

2012-01-01

Osteoclasts are specialized bone resorbing cells that derive from monocyte precursors. We have identified three populations of cells with high osteoclastogenic potential in murine bone marrow, which expressed the phenotype: B220−CD3−CD11b−/low CD115+ and either CD117hi, CD117intermediate or CD117low. We have evaluated these populations for their ability to also generate macrophages and dendritic cells. At a single cell level, the population expressing higher CD117 levels was able to generate bone-resorbing osteoclasts, phagocytic macrophages and antigen-presenting dendritic cells in vitro with efficiencies of over 90 percent, indicating that there exists a common developmental pathway for these cell types. Cells with osteoclastogenic potential also exist in blood and peripheral hematopoietic organs. Their functional meaning and/or their relationship with bone marrow progenitors is not well established. Hence, we characterized murine peripheral cell populations for their ability to form osteoclasts, macrophages and dendritic cells in vitro. The spleen and peripheral blood monocyte progenitors share phenotypic markers with bone marrow progenitors, but differ in their expression of CD11b, which was low in bone marrow but high in periphery. We propose that circulating monocyte progenitors are derived from a common bone marrow osteoclasts/macrophage/dendritic cell progenitor (OcMDC), which we have now characterized at a clonal level. However, the lineage relationship between the bone marrow and peripheral monocyte progenitors has yet to be defined. PMID:23165930

Corneal densitometry and its correlation with age, pachymetry, corneal curvature, and refraction.

PubMed

Garzón, Nuria; Poyales, Francisco; Illarramendi, Igor; Mendicute, Javier; Jáñez, Óscar; Caro, Pedro; López, Alfredo; Argüeso, Francisco

2017-12-01

To determine normative corneal densitometry values in relation to age, sex, refractive error, corneal thickness, and keratometry, measured using the Oculus Pentacam system. Three hundred and thirty-eight healthy subjects (185 men; 153 women) with no corneal disease underwent an exhaustive ocular examination. Corneal densitometry was expressed in standardized grayscale units (GSU). The mean corneal densitometry over the total area was 16.46 ± 1.85 GSU. The Pearson correlation coefficient for total densitometry was r = 0.542 (p < 0.001). Statistically significant differences were found between men and women for the total area (p = 0.006), with readings of 16.22 ± 1.54 GSU and 16.60 ± 1.83 GSU, respectively. When the cornea was divided into layers of different depths, a significant correlation was found for all layers and age: r = 0.447 (p < 0.001), r = 0.563 (p < 0.001), and r = 0.520 (p < 0.001) for the anterior, central, and posterior layers, respectively. However, when the cornea was divided into concentric annuli starting from the center of the cornea, densitometry was strongly correlated only with age in the 6-10-mm annulus (p < 0.001). Neither mean keratometry nor spherical equivalent was correlated with corneal densitometry in any zone of the cornea (p > 0.05). This is the first report of normative corneal densitometry values in relation to keratometry, corneal thickness, and spherical equivalent measured with the latest Oculus Pentacam software. Corneal densitometry increases with age, but corneal keratometry and refractive parameters do not affect light scattering in the human cornea.

Comparative evaluation of bovine derived hydroxyapatite and synthetic hydroxyapatite graft in bone regeneration of human maxillary cystic defects: a clinico-radiological study.

PubMed

Kattimani, Vivekanand S; Chakravarthi, Srinivas P; Neelima Devi, K Naga; Sridhar, Meka S; Prasad, L Krishna

2014-01-01

Bone grafts are frequently used in the treatment of bone defects. Bone harvesting can cause postoperative complications and sometimes does not provide a sufficient quantity of bone. Therefore, synthetic biomaterials have been investigated as an alternative to autogenous bone grafts. The aim of this study was to evaluate and compare bovine derived hydroxyapatite (BHA) and synthetic hydroxyapatite (SHA) graft material as bone graft substitute in maxillary cystic bony defects. Patients were analyzed by computerized densitometric study and digital radiography. In this study, 12 patients in each group were included randomly after clinical and radiological evaluation. The integration of hydroxyapatite was assessed with mean bone density, surgical site margin, and radiological bone formation characteristics, of the successful graft cases using computer densitometry and radio-visiograph. Statistical analysis was carried out using Mann-Whitney U-test, Wilcoxon matched pairs test and paired t-test. By the end of 24 th week, the grafted defects radiologically and statistically showed similar volumes of bone formation. However, the significant changes observed in the formation of bone and merging of material and surgical site margin at 1 st week to 1 st month. The results were significant and correlating with all the parameters showing the necessity of the grafting for early bone formation. However, the bone formation pattern is different in both BHA and SHA group at 3 rd month interval with significant P value. Both BHA and SHA graft materials are biocompatible for filling bone defects, showing less resorption and enhanced bone formation with similar efficacy. Our study showed maximum bone healing within 12 weeks of grafting of defects. The BHA is economical; however, price difference between the two is very nominal.

Elevated Levels of Peripheral Kynurenine Decrease Bone Strength in Rats with Chronic Kidney Disease

PubMed Central

Kalaska, Bartlomiej; Pawlak, Krystyna; Domaniewski, Tomasz; Oksztulska-Kolanek, Ewa; Znorko, Beata; Roszczenko, Alicja; Rogalska, Joanna; Brzoska, Malgorzata M.; Lipowicz, Pawel; Doroszko, Michal; Pryczynicz, Anna; Pawlak, Dariusz

2017-01-01

The diagnosis and treatment of bone disorders in patients with chronic kidney disease (CKD) represent a clinical challenge. CKD leads to mineral and bone complications starting early in the course of renal failure. Recently, we have observed the positive relationship between intensified central kynurenine turnover and bone strength in rats with subtotal 5/6 nephrectomy (5/6 Nx)-induced CKD. The aim of the present study was to determine the association between peripheral kynurenine pathway metabolites and bone strength in rats with 5/6 Nx-induced CKD. The animals were sacrificed 1 and 3 months after 5/6 Nx or sham operation. Nephrectomized rats presented higher concentrations of serum creatinine, urea nitrogen, and parathyroid hormone both 1 and 3 months after nephrectomy. These animals revealed higher concentrations of kynurenine and 3-hydroxykynurenine in the serum and higher gene expression of aryl hydrocarbon receptor (AhR) as a physiological receptor for kynurenine and AhR-dependent cytochrome in the bone tissue. Furthermore, nephrectomy significantly increased the number of osteoclasts in the bone without affecting their resorptive activity measured in serum. These changes were particularly evident in rats 1 month after 5/6 Nx. The main bone biomechanical parameters of the tibia were unchanged between nephrectomized and sham-operated rats but were significantly increased in older compared to younger animals. A similar trend was observed for geometrical parameters measured with calipers, bone mineral density based on Archimedes' method and image of bone microarchitecture obtained from micro-computed tomography analyses of tibial cortical bone. In nephrectomized animals, peripheral kynurenine levels correlated negatively with the main parameters of bone biomechanics, bone geometry, and bone mineral density values. In conclusion, our data suggest that CKD-induced elevated levels of peripheral kynurenine cause pathological changes in bone structure via AhR pathway. This finding opens new opportunities for the treatment/prevention of osteoporosis in CKD. PMID:29163188

Dietary supplements and medical foods for osteopenia and osteoporosis.

PubMed

Morgan, Sarah L

2013-01-01

Dietary supplements, medical foods, and pharmaceutical agents are all used in the management of metabolic bone disease. The intended populations, governing regulations, safety standards scientific requirements, physician supervision, and distribution vary markedly between supplements, medical foods, and drugs. This article will review characteristics of dietary supplements and medical foods and their use in osteoporosis care. A study that compares the pharmacokinetics of a supplement and a medical food containing similar ingredients is used to contrast the categories of dietary supplements and medical foods. Copyright © 2013 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Linear Calibration of Radiographic Mineral Density Using Video-Digitizing Methods

NASA Technical Reports Server (NTRS)

Martin, R. Bruce; Papamichos, Thomas; Dannucci, Greg A.

1990-01-01

Radiographic images can provide quantitative as well as qualitative information if they are subjected to densitometric analysis. Using modem video-digitizing techniques, such densitometry can be readily accomplished using relatively inexpensive computer systems. However, such analyses are made more difficult by the fact that the density values read from the radiograph have a complex, nonlinear relationship to bone mineral content. This article derives the relationship between these variables from the nature of the intermediate physical processes, and presents a simple mathematical method for obtaining a linear calibration function using a step wedge or other standard.

Linear Calibration of Radiographic Mineral Density Using Video-Digitizing Methods

NASA Technical Reports Server (NTRS)

Martin, R. Bruce; Papamichos, Thomas; Dannucci, Greg A.

1990-01-01

Radiographic images can provide quantitative as well as qualitative information if they are subjected to densitometric analysis. Using modern video-digitizing techniques, such densitometry can be readily accomplished using relatively inexpensive computer systems. However, such analyses are made more difficult by the fact that the density values read from the radiograph have a complex, nonlinear relationship to bone mineral content. This article derives the relationship between these variables from the nature of the intermediate physical processes, and presents a simple mathematical method for obtaining a linear calibration function using a step wedge or other standard.

Hyperemic peripheral red marrow in a patient with sickle cell anemia demonstrated on Tc-99m labeled red blood cell venography

DOE Office of Scientific and Technical Information (OSTI.GOV)

Heiden, R.A.; Locko, R.C.; Stent, T.R.

1991-03-01

A 25-year-old gravid woman, homozygous for sickle cell anemia, with a history of recent deep venous thrombosis, was examined using Tc-99m labeled red blood cell venography for recurrent thrombosis. Although negative for thrombus, the study presented an unusual incidental finding: the patient's peripheral bone marrow was hyperemic in a distribution consistent with peripheral red bone marrow expansion. Such a pattern has not been documented before using this technique. This report supports other literature that has demonstrated hyperemia of peripheral red bone marrow in other hemolytic anemias. This finding may ultimately define an additional role of scintigraphy in assessing the pathophysiologicmore » status of the sickle cell patient.« less

Application of a novel bone osteotomy plate leads to reduction in heat-induced bone tissue necrosis in sheep.

PubMed

Bekić, Marijo; Davila, Slavko; Hrskanović, Mato; Bekić, Marijana; Seiwerth, Sven; Erdeljić, Viktorija; Capak, Darko; Butković, Vladimir

2008-12-01

Previous studies have shown substantial effect thermal damage can have on new bone formation following osteotomy. In this study we evaluated the extent of thermal damage which occurs in four different methods of osteotomy and the effects it can have on bone healing. We further wanted to test whether a special osteotomy plate we constructed can lead to diminished heat generation during osteotomy and enhanced bone healing. The four methods evaluated included osteotomy performed by chisel, a newly constructed osteotomy plate, Gigly and oscillating saw. Twelve adult sheep underwent osteotomy performed on both tibiae. Bone fragments were stabilized using a fixation plate. Callus size was assessed using standard radiographs. Densitometry and histological evaluation were performed at 8 weeks following osteotomy. Temperature measurements were performed both in vivo during the operation, and ex vivo on explanted tibiae. The defects healed without complications and showed typical course of secondary fracture healing with callus ingrowth into the osteotomy gap. Radiographic examination of bone healing showed a tendency towards more callus formation in bones osteotomized using Gigly and oscillating saw, but this difference lacked significance. Use of Gigly and oscillating saw elicited much higher temperatures at the bone cortex surface, which subsequently lead to slightly impaired bone healing according to histological analysis. BMD was equal among all bones. In conclusion, the time required for complete healing of the defect differed depended greatly on the instruments used. The newly constructed osteotomy plate showed best results based on histological findings of capillary and osteoblast density.

A systematic review of the relationship between subchondral bone features, pain and structural pathology in peripheral joint osteoarthritis.

PubMed

Barr, Andrew J; Campbell, T Mark; Hopkinson, Devan; Kingsbury, Sarah R; Bowes, Mike A; Conaghan, Philip G

2015-08-25

Bone is an integral part of the osteoarthritis (OA) process. We conducted a systematic literature review in order to understand the relationship between non-conventional radiographic imaging of subchondral bone, pain, structural pathology and joint replacement in peripheral joint OA. A search of the Medline, EMBASE and Cochrane library databases was performed for original articles reporting association between non-conventional radiographic imaging-assessed subchondral bone pathologies and joint replacement, pain or structural progression in knee, hip, hand, ankle and foot OA. Each association was qualitatively characterised by a synthesis of the data from each analysis based upon study design, adequacy of covariate adjustment and quality scoring. In total 2456 abstracts were screened and 139 papers were included (70 cross-sectional, 71 longitudinal analyses; 116 knee, 15 hip, six hand, two ankle and involved 113 MRI, eight DXA, four CT, eight scintigraphic and eight 2D shape analyses). BMLs, osteophytes and bone shape were independently associated with structural progression or joint replacement. BMLs and bone shape were independently associated with longitudinal change in pain and incident frequent knee pain respectively. Subchondral bone features have independent associations with structural progression, pain and joint replacement in peripheral OA in the hip and hand but especially in the knee. For peripheral OA sites other than the knee, there are fewer associations and independent associations of bone pathologies with these important OA outcomes which may reflect fewer studies; for example the foot and ankle were poorly studied. Subchondral OA bone appears to be a relevant therapeutic target. PROSPERO registration number: CRD 42013005009.

Lycopene treatment against loss of bone mass, microarchitecture and strength in relation to regulatory mechanisms in a postmenopausal osteoporosis model.

PubMed

Ardawi, Mohammed-Salleh M; Badawoud, Mohammed H; Hassan, Sherif M; Rouzi, Abdulrahim A; Ardawi, Jumanah M S; AlNosani, Nouf M; Qari, Mohammed H; Mousa, Shaker A

2016-02-01

Lycopene supplementation decreases oxidative stress and exhibits beneficial effects on bone health, but the mechanisms through which it alters bone metabolism in vivo remain unclear. The present study aims to evaluate the effects of lycopene treatment on postmenopausal osteoporosis. Six-month-old female Wistar rats (n=264) were sham-operated (SHAM) or ovariectomized (OVX). The SHAM group received oral vehicle only and the OVX rats were randomized into five groups receiving oral daily lycopene treatment (mg/kg body weight per day): 0 OVX (control), 15 OVX, 30 OVX, and 45 OVX, and one group receiving alendronate (ALN) (2μg/kg body weight per day), for 12weeks. Bone densitometry measurements, bone turnover markers, biomechanical testing, and histomorphometric analysis were conducted. Micro computed tomography was also used to evaluate changes in microarchitecture. Lycopene treatment suppressed the OVX-induced increase in bone turnover, as indicated by changes in biomarkers of bone metabolism: serum osteocalcin (s-OC), serum N-terminal propeptide of type 1 collagen (s-PINP), serum crosslinked carboxyterminal telopeptides (s-CTX-1), and urinary deoxypyridinoline (u-DPD). Significant improvement in OVX-induced loss of bone mass, bone strength, and microarchitectural deterioration was observed in lycopene-treated OVX animals. These effects were observed mainly at sites rich in trabecular bone, with less effect in cortical bone. Lycopene treatment down-regulated osteoclast differentiation concurrent with up-regulating osteoblast together with glutathione peroxidase (GPx) catalase (CAT) and superoxide dismutase (SOD) activities. These findings demonstrate that lycopene treatment in OVX rats primarily suppressed bone turnover to restore bone strength and microarchitecture. Copyright © 2015. Published by Elsevier Inc.

Mutiple Spontaneous Rib Fractures in Patient with Cushing's Syndrome.

PubMed

Lee, Hyun Jung; Je, Ji Hye; Seo, Ji Hye; Na, Young Ju; Yoo, Hye Jin

2014-11-01

Glucocorticoid (GC) excess, including Cushing's syndrome, is a common cause of secondary osteoporosis. Thirty to fifty percent of Cushing's syndrome patients experience non-traumatic fractures, which is often the presenting manifestation of Cushing's syndrome. However, there have been rare cases of Cushing's syndrome diagnosed only based upon bone manifestations. We describe a case of Cushing's syndrome that was diagnosed in a 44-year-old woman who initially visited our hospital due to multiple non-traumatic rib fractures. She did not exhibit any other manifestations of Cushing's syndrome such as moon face, buffalo hump or abdominal striae. Initially, we evaluated her for bone metastases from a cancer of unknown origin, but there was no evidence of metastatic cancer. Instead, we found a left adrenal incidentaloma. As a result of the hormone study, she was diagnosed as having Cushing's syndrome. Interestingly, her bony manifestation of Cushing's syndrome, which was evident in the bone scan and bone mineral densitometry, completely recovered after a left adrenalectomy. Therefore, the possibility of Cushing's syndrome as a cause of secondary osteoporosis should be considered in young patients with non-traumatic multiple fractures, with or without any other typical features of Cushing's syndrome.

Life satisfaction and bone mineral density among postmenopausal women: cross-sectional and longitudinal associations.

PubMed

Rauma, Päivi H; Koivumaa-Honkanen, Heli; Williams, Lana J; Tuppurainen, Marjo T; Kröger, Heikki P; Honkanen, Risto J

2014-01-01

The purpose of this study was to determine whether and how global life satisfaction is associated with bone mineral density (BMD) and bone loss. A total of 2167 women from a cohort of Finnish women born in 1932 to 1941 were included in the cross-sectional and 1147 women in the 10-year longitudinal part of the present study. Participants responded to a postal enquiry and underwent femoral BMD densitometry in 1999 (baseline) and 2009 (follow-up). During the follow-up, their life satisfaction was repeatedly measured using a four-item scale. Self-reported data on health, life-style, and medication were used to adjust the multivariate linear regression models. Mean (standard deviation) femoral BMD decreased over the 10-year follow-up from 880 (125) to 846 (122) mg/cm. In the multivariate model, life satisfaction (p = .028) and its improvement (p = .001) predicted reduced bone loss, whereas hospitalization due to depression predicted increased bone loss (B = -0.523 annual % change, standard error = 0.212, p = .014). These effects were independent of each other. Easily assessed global life satisfaction should be taken into account when effects of aging and prevention of osteoporosis as well as health promotion in postmenopausal women are considered.

BIOCHEMICAL ANALYSIS AND BONE REMODELING IN RESPONSE TO OOPHORECTOMY AND AQUATIC TRAINING

PubMed Central

SOUZA, HELENA RIBEIRO; GIROL, ANA PAULA; SCHIAVETO, ADRIANA PAULA SANCHEZ; GEROMEL, MAIRTO ROBERIS; IYOMASA, MELINA MIZUSAKI; ARRUDA, MAURÍCIO FERRAZ DE

2016-01-01

ABSTRACT Objective: To investigate whether swimming could prevent bone loss and could be indicated to assist in treatment of osteoporosis. Methods: Female rats were divided into 4 groups (n=6), two of them were oophorectomized. Animals from two groups, one oophorectomized and another not oophorectomized, underwent aquatic training for eight weeks. After training, the animals were sacrificed and their blood was collected for calcium and alkaline phosphatase serum dosage; the femur was removed and subjected to radiological and histological densitometry analysis to assess bone loss and osteoclast counting on femoral head and neck. Results: Increase in serum calcium was not observed. There was an increasing activity of alkaline phosphatase in the oophorectomized groups. The radiographs suggest that there was a greater bone mass density in the trained groups. Concerning histology, the trained groups had better tissue structural organization than the sedentary groups. In the oophorectomized and sedentary group, higher presence of osteoclasts was observed a. Conclusion: Exercise and oophorectomy did not promote changes in serum calcium levels. The decrease of sex steroids caused by oophorectomy was responsible for severe bone loss, but swimming exercise was able to reduce this loss. Oophorectomy promoted the proliferation of osteoclasts and the exercise proved to be able to diminish it. Level of Evidence I, Experimental Study. PMID:28149187

Official Positions for FRAX® clinical regarding rheumatoid arthritis from Joint Official Positions Development Conference of the International Society for Clinical Densitometry and International Osteoporosis Foundation on FRAX®.

PubMed

Broy, Susan B; Tanner, S Bobo

2011-01-01

Rheumatoid arthritis is the only secondary cause of osteoporosis that is considered independent of bone density in the FRAX(®) algorithm. Although input for rheumatoid arthritis in FRAX(®) is a dichotomous variable, intuitively, one would expect that more severe or active disease would be associated with a greater risk for fracture. We reviewed the literature to determine if specific disease parameters or medication use could be used to better characterize fracture risk in individuals with rheumatoid arthritis. Although many studies document a correlation between various parameters of disease activity or severity and decreased bone density, fewer have associated these variables with fracture risk. We reviewed these studies in detail and concluded that disability measures such as HAQ (Health Assessment Questionnaire) and functional class do correlate with clinical fractures but not morphometric vertebral fractures. One large study found a strong correlation with duration of disease and fracture risk but additional studies are needed to confirm this. There was little evidence to correlate other measures of disease such as DAS (disease activity score), VAS (visual analogue scale), acute phase reactants, use of non-glucocorticoid medications and increased fracture risk. We concluded that FRAX(®) calculations may underestimate fracture probability in patients with impaired functional status from rheumatoid arthritis but that this could not be quantified at this time. At this time, other disease measures cannot be used for fracture prediction. However only a few, mostly small studies addressed other disease parameters and further research is needed. Additional questions for future research are suggested. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Effect of Positioning of the ROI on BMD of the Forearm and Its Subregions.

PubMed

Rosen, Elizabeth O; McNamara, Elizabeth A; Whittaker, LaTarsha G; Malabanan, Alan O; Rosen, Harold N

2018-03-21

Inconsistent positioning of patients and region of interest (ROI) is known to influence the precision of bone mineral density (BMD) measurements in the spine and hip. However, it is unknown whether minor shifts in the positioning of the ROI along the shaft of the radius affect the measurement of forearm BMD and its subregions. The ultradistal (UD-), mid-, one-third, and total radius BMDs of 50 consecutive clinical densitometry patients were acquired. At baseline the distal end of the ROI was placed at the tip of the ulnar styloid as usual, and then the forearm was reanalyzed 10 more times, each time shifting the ROI 1 mm proximally. No corrections for multiple comparisons were necessary since the differences that were significant were significant at p < 0.001. The UD-radius BMD increased as the ROI was shifted proximally; the increase was significant when shifted even 1 mm proximally (p < 0.001). These same findings held true for the mid- and total radius bone density, though the percent increase with moving proximally was significantly greater for the UD radius than for the other subregions. However, there was no significant change in the one-third radius BMD when shifted proximally 1-10 mm. Minor proximal shifts of the forearm ROI substantially affect the BMD of the UD-, mid- and total radius, while having no effect on the one-third radius BMD. Since the one-third radius is the only forearm region usually reported, minor proximal shifts of the ROI should not influence forearm BMD results significantly. Copyright © 2018 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Partial hypopituitarism and Langerhans cell histiocytosis

PubMed Central

Balaguruswamy, S; Chattington, P D

2011-01-01

A case of multisystem Langerhans cell histiocytosis with pituitary involvement nearly 20 years after initial presentation. A 48-year-old man had histiocytosis X 22 years ago initially involving the groin; subsequently his external auditory meatus, scalp, gum, mandibular bone, perineum and axilla were involved and treated. The pituitary gland was involved 4 years ago. A thyrotropin-releasing hormone test showed delayed response suggestive of hypothalamic disease. Prolactin levels were normal. A gonadotropin-releasing hormone test showed impaired testosterone and gonadotrophin response in keeping with pituitary disease. A glucagon stimulation test showed an impaired growth hormone response but a normal cortisol increase. MRI pituitary showed an empty sella. There was no evidence of diabetes insipidus. Bone mineral densitometry was normal. He has partial hypopituitarism needing thyroxine and testosterone replacement. He also developed type 2 diabetes mellitus 9 years ago. He is closely monitored for any development of diabetes insipidus and the need for growth hormone supplementation. PMID:22715201

Analysis of correlation between initial alveolar bone density and apical root resorption after 12 months of orthodontic treatment without extraction

PubMed Central

Scheibel, Paula Cabrini; Ramos, Adilson Luiz; Iwaki, Lilian Cristina Vessoni; Micheletti, Kelly Regina

2014-01-01

OBJECTIVE: The aim of the present study was to investigate the correlation between initial alveolar bone density of upper central incisors (ABD-UI) and external apical root resorption (EARR) after 12 months of orthodontic movement in cases without extraction. METHODS: A total of 47 orthodontic patients 11 years old or older were submitted to periapical radiography of upper incisors prior to treatment (T1) and after 12 months of treatment (T2). ABD-UI and EARR were measured by means of densitometry. RESULTS: No statistically significant correlation was found between initial ABD-UI and EARR at T2 (r = 0.149; p = 0.157). CONCLUSION: Based on the present findings, alveolar density assessed through periapical radiography is not predictive of root resorption after 12 months of orthodontic treatment in cases without extraction. PMID:25715722

Expression of extracellular calcium (Ca2+o)-sensing receptor in human peripheral blood monocytes

NASA Technical Reports Server (NTRS)

Yamaguchi, T.; Olozak, I.; Chattopadhyay, N.; Butters, R. R.; Kifor, O.; Scadden, D. T.; Brown, E. M.; O'Malley, B. W. (Principal Investigator)

1998-01-01

The calcium-sensing receptor (CaR) is a G protein-coupled receptor playing key roles in extracellular calcium ion (Ca2+o) homeostasis in parathyroid gland and kidney. Macrophage-like mononuclear cells appear at sites of osteoclastic bone resorption during bone turnover and may play a role in the "reversal" phase of skeletal remodeling that follows osteoclastic resorption and precedes osteoblastic bone formation. Bone resorption produces substantial local increases in Ca2+o that could provide a signal for such mononuclear cells present locally within the bone marrow microenvironment. Indeed, previous studies by other investigators have shown that raising Ca2+o either in vivo or in vitro stimulated the release of interleukin-6 (IL-6) from human peripheral blood monocytes, suggesting that these cells express a Ca2+o-sensing mechanism. In these earlier studies, however, the use of reverse transcription-polymerase chain reaction (RT-PCR) failed to detect transcripts for the CaR previously cloned from parathyroid and kidney in peripheral blood monocytes. Since we recently found that non-specific esterase-positive, putative monocytes isolated from murine bone marrow express the CaR, we reevaluated the expression of this receptor in human peripheral blood monocytes. Immunocytochemistry, flow cytometry, and Western blot analysis, performed using a polyclonal antiserum specific for the CaR, detected CaR protein in human monocytes. In addition, the use of RT-PCR with CaR-specific primers, followed by nucleotide sequencing of the amplified products, identified CaR transcripts in the cells. Therefore, taken together, our data show that human peripheral blood monocytes possess both CaR protein and mRNA very similar if not identical to those expressed in parathyroid and kidney that could mediate the previously described, direct effects of Ca2+o on these cells. Furthermore, since mononuclear cells isolated from bone marrow also express the CaR, the latter might play some role in the "reversal" phase of bone remodeling, sensing local changes in Ca2+o resulting from osteoclastic bone resorption and secreting osteotropic cytokines or performing other Ca2+o-regulated functions that contribute to the control of bone turnover.

A case of pathological rib fractures: focal osteolysis or osteoporosis?

PubMed

Vrbanić, T S L; Novak, S; Sestan, B; Tudor, A; Gulan, G

2008-03-01

This paper reports on a unique, previously unreported, successful outcome in the case of a patient with focal osteolytic lesions of the ribs as a first sign of osteoporosis. The lesions were detected by chance after acute cough-induced rib fractures were seen on plain chest radiographs. The diagnosis had to be approached as a diagnosis of exclusion since known causes of the osteolytic process had to be eliminated. The authors describe multiple focal osteolytic lesions with rib fractures appearing in a pattern that could be confused with metastases. Laboratory results were normal. Final diagnosis was based on plain radiography, bone scan and bone densitometry. Pharmacomedical treatments for osteoporosis were applied. The patient was observed between the year 2000 and 2005. Five years later radiological and bone scintigraphy revealed resolution of the lesion. We conclude that osteoporosis should be included in the differential diagnosis of asymptomatic focal osteolysis of the ribs with rib fractures as a complication of acute cough. The case suggests that focal osteolytic lesions of the ribs may regress over time and become scintigraphically inactive.

Doping dose of salbutamol and exercise training: impact on the skeleton of ovariectomized rats.

PubMed

Bonnet, N; Laroche, N; Beaupied, H; Vico, L; Dolleans, E; Benhamou, C L; Courteix, D

2007-08-01

Previous studies in healthy rats have demonstrated a deleterious bone impact of beta-agonist treatment. The purpose of this study was to examine the trabecular and cortical effects of beta(2)-agonists at doping dose on treadmill exercising rats with estrogen deficiency. Adult female rats were ovariectomized (OVX; n = 44) or sham operated (n = 12). Then, OVX rats received a subcutaneous injection of salbutamol (SAB) or vehicle with (EXE) or without treadmill exercise for 10 wk. Bone mineral density (BMD) was analyzed by densitometry. Microcomputed tomography and histomorphometric analysis were performed to study trabecular bone structure and bone cell activities. After 10 wk, SAB rats presented a much more marked decrease of BMD and trabecular parameters. Exercise did not change the high level of bone resorption in OVX EXE SAB compared with OVX SAB group (both on COOH-terminal collagen cross-links and osteoclast number). These results confirm the deleterious effect of beta(2)-agonists on bone quantity (femoral BMD gain: OVX EXE, +6.8%, vs. OVX EXE SAB, -1.8%; P < 0.01) and quality (-8.0% of femoral trabecular thickness in OVX EXE SAB vs. OVX EXE), indicating that SAB suppresses the effect of EXE in OVX rats. Furthermore, we notice that the slight beneficial effect of exercise was mainly localized in the tibia. These findings indicate the presence of a bone alteration threshold below which there is no more alteration in structural bone quantity and quality. The negative effects of SAB on bone observed in this study in trained rats may indicate potential complications in doping female athletes with exercise-induced amenorrhea.

A high-fat diet can affect bone healing in growing rats.

PubMed

Yamanaka, Jéssica Suzuki; Yanagihara, Gabriela Rezende; Carlos, Bruna Leonel; Ramos, Júnia; Brancaleon, Brígida Batista; Macedo, Ana Paula; Issa, João Paulo Mardegan; Shimano, Antônio Carlos

2018-05-01

A high-fat diet (HFD) can have a negative effect on bone quality in young and old people. Although bone healing in children is normally efficient, there is no evidence that children who have a diet rich in fat have compromised bone fracture regeneration compared with children with recommended dietary fat levels. The purpose of the present study was to evaluate the effects of an HFD on bone healing in growing female rats. Twenty-six postweaning female Wistar rats were divided into two groups (13 animals per group): a standard diet (SD) group and an HFD (with 60% of energy from fat) group. The rats received the assigned diets for 5 weeks, and in the third week they were submitted to an osteotomy procedure of the left tibia. Body mass and feed intake were recorded during the experiment. One day before euthanasia, an insulin tolerance test was performed. After euthanasia, the tibiae were removed and analyzed by densitometry, mechanical testing, histomorphometry, stereology and immunohistochemistry. An HFD caused an adaptive response to maintain energetic balance by decreasing feed intake and causing insulin insensitivity. There was no change in bone mineral density, collagen amount and immunostaining for bone formation, but maximal load and stiffness were decreased in the HFD group. In addition, bone volume had a tendency to be higher in the SD group than in the HFD group. Compared with rats receiving an SD, growing rats receiving an HFD for 5 weeks had similar bone mineral density but altered mechanical properties at the osteotomy defect site.

Evaluation of factors related to bone disease in Polish children and adolescents with cystic fibrosis.

PubMed

Sands, Dorota; Mielus, Monika; Umławska, Wioleta; Lipowicz, Anna; Oralewska, Beata; Walkowiak, Jarosław

2015-09-01

The aim of the study was to evaluate factors related to bone formation and resorption in Polish children and adolescents with cystic fibrosis and to examine the effect of nutritional status, biochemical parameters and clinical status on bone mineral density. The study group consisted of 100 children and adolescents with cystic fibrosis with a mean age 13.4 years old. Anthropometric measurements, included body height, body mass and body mass index (BMI); bone mineral densitometry and biochemical testing were performed. Bone mineral density was measured using a dual-energy X-ray absorption densitometer. Biochemical tests included serum calcium, phosphorus, parathyroid hormone and vitamin D concentrations, as well as 24-h urine calcium and phosphorus excretion. Pulmonary function was evaluated using FEV1%, and clinical status was estimated using the Shwachman-Kulczycki score. Standardized body height, body mass and BMI were significantly lower than in the reference population. Mean serum vitamin D concentration was decreased. Pulmonary disease was generally mild, with a mean FEV1% of 81%. Multivariate linear regression revealed that the only factors that had a significant effect on bone marrow density were BMI and FEV1%. There were no significant correlations between bone mineral density and the results of any of the biochemical tests performed. Nutritional status and bone mineral density were significantly decreased in children and adolescents with cystic fibrosis. In spite of abnormalities in biochemical testing, the factors that were found to have the strongest effect on bone mineral density were standardized BMI and clinical status. Copyright © 2015. Published by Elsevier Urban & Partner Sp. z o.o.

Factors associated with nonunion, delayed union, and malunion in foot and ankle surgery in diabetic patients.

PubMed

Shibuya, Naohiro; Humphers, Jon M; Fluhman, Benjamin L; Jupiter, Daniel C

2013-01-01

The incidence of bone healing complications in diabetic patients is believed to be high after foot and ankle surgery. Although the association of hyperglycemia with bone healing complications has been well documented, little clinical information is available to show which diabetes-related comorbidities directly affect bone healing. Our goal was to better understand the risk factors associated with poor bone healing in the diabetic population through an exploratory, observational, retrospective, cohort study. To this end, 165 diabetic patients who had undergone arthrodesis, osteotomy, or fracture reduction were enrolled in the study to assess the risk factors associated with nonunion, delayed union, and malunion after elective and nonelective foot and/or ankle surgery. Bivariate analyses showed that a history of foot ulcer, peripheral neuropathy, and surgery duration were statistically significantly associated with bone healing complications. After adjusting for other covariates, only peripheral neuropathy, surgery duration, and hemoglobin A1c levels >7% were significantly associated statistically with bone healing complications. Of the risk factors we considered, peripheral neuropathy had the strongest association with bone healing complications. Copyright © 2013 American College of Foot and Ankle Surgeons. Published by Elsevier Inc. All rights reserved.

Factors affecting bone mineral density in postmenopausal women.

PubMed

Heidari, Behzad; Hosseini, Reza; Javadian, Yahya; Bijani, Ali; Sateri, Mohammad Hassan; Nouroddini, Haj Ghorban

2015-01-01

This study aimed to determine the relationship between bone mineral density (BMD) and demographic, biochemical, and clinical features according to BMD measurement sites. The results indicated that BMD correlates negatively with menopause duration, parity, and history of fractures but positively correlates with obesity, physical activity, education, and serum ferritin. Osteoporosis (OP) is an important cause of morbidity and mortality in the elderly people. The impacts of various factors on bone mineral density (BMD) differ across diverse population. We hypothesized that the influences of factors which affect BMD vary according to BMD measurement sites. The aim of this study was to determine the relationship between BMD in the femoral neck (FN) and lumbar spine (LS) with some common clinical, demographic, and biochemical parameters in postmenopausal women. In this cross-sectional case-control study, all postmenopausal women of the Amirkola Health and Ageing Project (AHAP) who performed bone densitometry were included. BMD at FN and LS was measured by DXA method. Data regarding clinical, demographic, and biochemical characteristics were provided. OP was diagnosed by the International Society for Clinical Densitometry criteria. Pearson correlation and multivariate regression analyses with simultaneous adjustment were performed to determine relationship. Five hundred thirty-seven women with mean age of 67.9 ± 6.7 years and mean menopause duration (MD) of 15.8 ± 5.1 years were studied. MD correlated negatively with FN-BMD and LS-BMD g/cm(2) (r = -0.405, p = 0.001 and r = -0.217, p = 0.001). Body mass index (BMI) correlated positively with FN and LS-BMD g/cm(2) (r = 0.397, p = 0.001 and r = 0.311, p = 0.001). The association of MD with risk of FN-OP was stronger than LS-OP. Obesity and metabolic syndrome (MS) and higher serum ferritin reduced the risk of OP at both LS and FN similarly, whereas the impacts of parity, prior fracture, high level of education, and physical activity were significantly different across BMD measurement sites. The results of this study indicated a significant association between OP and MD, obesity, parity, MS, history of fracture, serum ferritin, level of education, and physical activity. However, the direction and the strength of association varied across BMD measurement sites.

Dual-energy imaging of bone marrow edema on a dedicated multi-source cone-beam CT system for the extremities

NASA Astrophysics Data System (ADS)

Zbijewski, W.; Sisniega, A.; Stayman, J. W.; Thawait, G.; Packard, N.; Yorkston, J.; Demehri, S.; Fritz, J.; Siewerdsen, J. H.

2015-03-01

Purpose: Arthritis and bone trauma are often accompanied by bone marrow edema (BME). BME is challenging to detect in CT due to the overlaying trabecular structure but can be visualized using dual-energy (DE) techniques to discriminate water and fat. We investigate the feasibility of DE imaging of BME on a dedicated flat-panel detector (FPD) extremities cone-beam CT (CBCT) with a unique x-ray tube with three longitudinally mounted sources. Methods: Simulations involved a digital BME knee phantom imaged with a 60 kVp low-energy beam (LE) and 105 kVp high-energy beam (HE) (+0.25 mm Ag filter). Experiments were also performed on a test-bench with a Varian 4030CB FPD using the same beam energies as the simulation study. A three-source configuration was implemented with x-ray sources distributed along the longitudinal axis and DE CBCT acquisition in which the superior and inferior sources operate at HE (and collect half of the projection angles each) and the central source operates at LE. Three-source DE CBCT was compared to a double-scan, single-source orbit. Experiments were performed with a wrist phantom containing a 50 mg/ml densitometry insert submerged in alcohol (simulating fat) with drilled trabeculae down to ~1 mm to emulate the trabecular matrix. Reconstruction-based three-material decomposition of fat, soft tissue, and bone was performed. Results: For a low-dose scan (36 mAs in the HE and LE data), DE CBCT achieved combined accuracy of ~0.80 for a pattern of BME spherical lesions ranging 2.5 - 10 mm diameter in the knee phantom. The accuracy increased to ~0.90 for a 360 mAs scan. Excellent DE discrimination of the base materials was achieved in the experiments. Approximately 80% of the alcohol (fat) voxels in the trabecular phantom was properly identified both for single and 3-source acquisitions, indicating the ability to detect edemous tissue (water-equivalent plastic in the body of the densitometry insert) from the fat inside the trabecular matrix (emulating normal trabecular bone with significant fraction of yellow marrow). Conclusion: Detection of BME and quantification of water and fat content were achieved in extremities DE CBCT with a longitudinal configuration of sources providing DE imaging in a single gantry rotation. The findings support the development of DE imaging capability for CBCT of the extremities in areas conventionally in the domain of MRI.

Dual-Energy Imaging of Bone Marrow Edema on a Dedicated Multi-Source Cone-Beam CT System for the Extremities

PubMed Central

Zbijewski, W.; Sisniega, A.; Stayman, J. W.; Thawait, G.; Packard, N.; Yorkston, J.; Demehri, S.; Fritz, J.; Siewerdsen, J. H.

2015-01-01

Purpose Arthritis and bone trauma are often accompanied by bone marrow edema (BME). BME is challenging to detect in CT due to the overlaying trabecular structure but can be visualized using dual-energy (DE) techniques to discriminate water and fat. We investigate the feasibility of DE imaging of BME on a dedicated flat-panel detector (FPD) extremities cone-beam CT (CBCT) with a unique x-ray tube with three longitudinally mounted sources. Methods Simulations involved a digital BME knee phantom imaged with a 60 kVp low-energy beam (LE) and 105 kVp high-energy beam (HE) (+0.25 mm Ag filter). Experiments were also performed on a test-bench with a Varian 4030CB FPD using the same beam energies as the simulation study. A three-source configuration was implemented with x-ray sources distributed along the longitudinal axis and DE CBCT acquisition in which the superior and inferior sources operate at HE (and collect half of the projection angles each) and the central source operates at LE. Three-source DE CBCT was compared to a double-scan, single-source orbit. Experiments were performed with a wrist phantom containing a 50 mg/ml densitometry insert submerged in alcohol (simulating fat) with drilled trabeculae down to ~1 mm to emulate the trabecular matrix. Reconstruction-based three-material decomposition of fat, soft tissue, and bone was performed. Results For a low-dose scan (36 mAs in the HE and LE data), DE CBCT achieved combined accuracy of ~0.80 for a pattern of BME spherical lesions ranging 2.5 – 10 mm diameter in the knee phantom. The accuracy increased to ~0.90 for a 360 mAs scan. Excellent DE discrimination of the base materials was achieved in the experiments. Approximately 80% of the alcohol (fat) voxels in the trabecular phantom was properly identified both for single and 3-source acquisitions, indicating the ability to detect edemous tissue (water-equivalent plastic in the body of the densitometry insert) from the fat inside the trabecular matrix (emulating normal trabecular bone with significant fraction of yellow marrow). Conclusion Detection of BME and quantification of water and fat content were achieved in extremities DE CBCT with a longitudinal configuration of sources providing DE imaging in a single gantry rotation. The findings support the development of DE imaging capability for CBCT of the extremities in areas conventionally in the domain of MRI. PMID:26045631

Dual-Energy Imaging of Bone Marrow Edema on a Dedicated Multi-Source Cone-Beam CT System for the Extremities.

PubMed

Zbijewski, W; Sisniega, A; Stayman, J W; Thawait, G; Packard, N; Yorkston, J; Demehri, S; Fritz, J; Siewerdsen, J H

2015-02-21

Arthritis and bone trauma are often accompanied by bone marrow edema (BME). BME is challenging to detect in CT due to the overlaying trabecular structure but can be visualized using dual-energy (DE) techniques to discriminate water and fat. We investigate the feasibility of DE imaging of BME on a dedicated flat-panel detector (FPD) extremities cone-beam CT (CBCT) with a unique x-ray tube with three longitudinally mounted sources. Simulations involved a digital BME knee phantom imaged with a 60 kVp low-energy beam (LE) and 105 kVp high-energy beam (HE) (+0.25 mm Ag filter). Experiments were also performed on a test-bench with a Varian 4030CB FPD using the same beam energies as the simulation study. A three-source configuration was implemented with x-ray sources distributed along the longitudinal axis and DE CBCT acquisition in which the superior and inferior sources operate at HE (and collect half of the projection angles each) and the central source operates at LE. Three-source DE CBCT was compared to a double-scan, single-source orbit. Experiments were performed with a wrist phantom containing a 50 mg/ml densitometry insert submerged in alcohol (simulating fat) with drilled trabeculae down to ~1 mm to emulate the trabecular matrix. Reconstruction-based three-material decomposition of fat, soft tissue, and bone was performed. For a low-dose scan (36 mAs in the HE and LE data), DE CBCT achieved combined accuracy of ~0.80 for a pattern of BME spherical lesions ranging 2.5 - 10 mm diameter in the knee phantom. The accuracy increased to ~0.90 for a 360 mAs scan. Excellent DE discrimination of the base materials was achieved in the experiments. Approximately 80% of the alcohol (fat) voxels in the trabecular phantom was properly identified both for single and 3-source acquisitions, indicating the ability to detect edemous tissue (water-equivalent plastic in the body of the densitometry insert) from the fat inside the trabecular matrix (emulating normal trabecular bone with significant fraction of yellow marrow). Detection of BME and quantification of water and fat content were achieved in extremities DE CBCT with a longitudinal configuration of sources providing DE imaging in a single gantry rotation. The findings support the development of DE imaging capability for CBCT of the extremities in areas conventionally in the domain of MRI.

Growth, body composition, and bone density following pediatric liver transplantation.

PubMed

Sheikh, Amin; Cundy, Tim; Evans, Helen Maria

2018-04-24

Patients transplanted for cholestatic liver disease are often significantly fat-soluble vitamin deficient and malnourished pretransplant, with significant corticosteroid exposure post-transplant, with increasing evidence of obesity and metabolic syndrome post-LT. Our study aimed to assess growth, body composition, and BMD in patients post-pediatric LT. Body composition and bone densitometry scans were performed on 21 patients. Pre- and post-transplant anthropometric data were analyzed. Bone health was assessed using serum ALP, calcium, phosphate, and procollagen-1-N-peptide levels. Median ages at transplant and at this assessment were 2.7 and 10.6 years, respectively. Physiological markers of bone health, median z-scores for total body, and lumbar spine aBMD were normal. Bone area was normal for height and BMAD at L3 was normal for age, indicating, respectively, normal cortical and trabecular bone accrual. Median z-scores for weight, height, and BMI were 0.6, -0.9, 1.8 and 0.6, 0.1, 0.8 pre- and post-transplant, respectively. Total body fat percentages measured on 21 body composition scans revealed 2 underweight, 7 normal, 6 overweight, and 6 obese. Bone mass is preserved following pediatric LT with good catch-up height. About 52% of patients were either overweight/obese post-transplant, potentially placing them at an increased risk of metabolic syndrome and its sequelae in later life. BMI alone is a poor indicator of nutritional status post-transplant. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Bisphosphonate effects in rat unloaded hindlimb bone loss model: three-dimensional microcomputed tomographic, histomorphometric, and densitometric analyses.

PubMed

Barou, O; Lafage-Proust, M H; Martel, C; Thomas, T; Tirode, F; Laroche, N; Barbier, A; Alexandre, C; Vico, L

1999-10-01

The effects of antiresorptive drugs on bone loss remain unclear. Using three-dimensional microtomography, dual X-ray/densitometry, and histomorphometry, we evaluated tiludronate effects in the bone loss model of immobilization in tail-suspended rats after 7, 13, and 23 days. Seventy-eight 12-week-old Wistar male rats were assigned to 13 groups: 1 baseline group, and for each time point, 1 control group treated with vehicle and three tail-suspended groups treated with either tiludronate (0.5 or 5 mg/kg) or vehicle, administered s. c. every other day, during the last week before sacrifice. In primary spongiosa (ISP), immobilization-induced bone loss plateaued after day 7 and was prevented by tiludronate. In secondary spongiosa (IISP), bone loss appeared at day 13 with a decrease in trabecular thickness and trabecular number (Tb.N) as assessed by three-dimensional microtomography. Osteoclastic parameters did not differ in tail-suspended rats versus control rats, whereas bone formation showed a biphasic pattern: after a marked decrease at day 7, osteoblastic activity and recruitment normalized at days 13 and 23, respectively. At day 23, the 80% decrease in bone mass was fully prevented by high-dose tiludronate with an increase in Tb.N without preventing trabecular thinning. In summary, at day 7, tiludronate prevented bone loss in ISP. After day 13, tiludronate prevented bone loss in ISP and IISP despite a further decrease in bone formation. Thus, the preventive effects of tiludronate in this model may be related to the alteration in bone modeling with an increase in Tb.N in ISP and subsequently in IISP.

DNA content determination of micronucleated polychromatic erythrocytes induced by clastogens and spindle poisons in mouse bone marrow and peripheral blood

DOE Office of Scientific and Technical Information (OSTI.GOV)

Grawe, J.; Amneus, H.; Zetterberg, G.

1993-01-01

The frequencies and DNA distributions of micronuclei in polychromatic erythrocytes from the bone marrow and peripheral blood of mice after four different treatments were determined by flow cytometry. Polychromatic erthrocytes were detected using the fluorescent RNA stain thiazole orange, while micronuclei were detected with the DNA stain Hoechst 33342. The treatments were X-irradiation (1 Gy), cyclophosphamide (30 mg/kg), vincristine sulfphate (0.08 mg/kg), and cochicine (1 mg/kg). All treatments showed increased frequencies of micronucleated polychromatic erythrocytes at 30h after treatment in the bone marrow (colchicine 50h) and at 50h in the peripheral blood. The clostogenic agents X-irradiation and cyclophosphamide and themore » spindle poisons vincristine sulphate and cochicine could be grouped according to the fluorescent characteristics of the induced micronuclei as well as the relative frequency of small (0.5-2% if the diploid G1 DNA content) and large (2-10%) micronuclei. In the peripheral blood the relative frequency of large micronuclei was lower than in the bone marrow, indicating that they were partly eliminated before entrance into the peripheral circulation. The nature of presumed micronuclei was verified by sorting. The potential of this approach to give information on the mechanism of induction of micronuclei is discussed.« less

Increased oxidative stress and apoptosis in peripheral blood mononuclear cells of fructose-fed rats.

PubMed

Porto, Marcella L; Lírio, Layla M; Dias, Ananda T; Batista, Alan T; Campagnaro, Bianca P; Mill, José G; Meyrelles, Silvana S; Baldo, Marcelo P

2015-12-01

Measuring of oxidative stress in peripheral blood mononuclear cells is a suitable model of dietary induced systemic oxidative stress. Thus, we aimed to evaluate whether a chronic high fructose intake could induce oxidative damage in peripheral blood and bone marrow mononuclear cells of rats. Animals were randomly assigned to the following groups: Control group (standard rat chow and tap water n=8), and Fructose group (standard rat chow and a 10% fructose solution in the drinking water n=8). Reactive oxygen species and cytokines were measure using flow cytometry in peripheral blood and bone-marrow mononuclear cells. Apoptotic cell death and the advanced oxidation protein products (AOPP) were also determined. We observed a significant increase in ROS production in peripheral blood mononuclear cells of fructose group as compared to control rats. Apoptosis and the AOPP were higher in those animals underwent high fructose intake. Serum levels of IL-6 and IL-12 were also increased after 12 weeks of high fructose intake. We concluded that fructose intake leads to systemic oxidative stress and pro-inflammatory condition which affect peripheral blood mononuclear cells and bone-marrow mononuclear cells viability. Copyright © 2015 Elsevier B.V. All rights reserved.

Collection of wood quality data by X-ray densitometry: a case study with three southern pines

Treesearch

Thomas L. Eberhardt; Lisa J. Samuelson

2015-01-01

X-ray densitometry is a technique often used in tree growth and wood quality studies to incrementally measure density (specific gravity) along a radial strip of wood. Protocols for this technique vary between laboratories because of differences in species, equipment, tree age, and other factors. Here, the application of X-ray densitometry is discussed in terms of a...

Clinical Evaluation of Decellularized Nerve Allograft with Autologous Bone Marrow Stem Cells to Improve Peripheral Nerve Repair and Functional Outcomes

DTIC Science & Technology

2016-07-01

AWARD NUMBER: W81XWH-15-2-0026 TITLE: Clinical Evaluation of Decellularized Nerve Allograft With Autologous Bone Marrow Stem Cells To Improve...5b. GRANT NUMBER W81XWH-15-2-0026 CClinical Evaluation of Decellularized Nerve Allograft With Autologous Bone Marrow Stem Cells To Improve...co- treatments of a commercially available decellularized processed peripheral nerve allograft scaffold (Avance® Nerve Graft, AxoGen, Alachua FL) with

Leptin: a potential mediator for protective effects of fat mass on bone tissue.

PubMed

Thomas, Thierry

2003-02-01

Body weight is among the most powerful predictors of bone status, and adipose tissue plays a substantial role in weight-related protective effects on bone. An understanding of the mechanisms underlying the relation between adipose tissue and bone may open up new perspectives for treatment. Leptin, which is known to regulate appetite and energy expenditures, may also contribute to mediate the effects of fat mass on bone. Although reported data are somewhat conflicting, there is some evidence that leptin may decrease bone formation via a central nervous effect and may stimulate both bone formation and bone resorption via direct peripheral effects on stromal precursor cells. The net result of these central and peripheral effects may depend on serum leptin levels and blood-brain barrier permeability, of which the first increase and the second decrease as obesity develops. Further work is needed to improve our understanding of these effects.

Social determinants of bone densitometry uptake for osteoporosis risk in patients aged 50yr and older: a systematic review.

PubMed

Brennan, Sharon L; Wluka, Anita E; Gould, Haslinda; Nicholson, Geoffrey C; Leslie, William D; Ebeling, Peter R; Oldenburg, Brian; Kotowicz, Mark A; Pasco, Julie A

2012-01-01

The World Health Organization identifies that osteoporosis is one of the leading health problems in the Western world. An increased risk of fragility fracture is observed in more socially disadvantaged individuals in most Western countries. Dual-energy X-ray absorptiometry (DXA) is currently the procedure of choice to diagnose osteoporosis and assess fracture risk. We systematically reviewed the literature regarding social determinants of DXA utilization for osteoporosis detection in patients aged 50yr and older using a computer-aided search of MEDLINE, EMBASE, CINAHL, and PsychINFO from January 1994 to December 2010. Five cross-sectional studies, incorporating 16 separate analyses, were identified for inclusion in this review. The best evidence analysis identified limited evidence for a positive association between either income or education with DXA utilization; furthermore, the best evidence analysis found no evidence for an association between either marital status or working status and DXA utilization. Further research is required to identify whether a relationship exists and elucidate reasons for disparities in DXA utilization between different social groups, such as choice and referral processes, as a necessary precursor in identifying modifiable determinants and appropriate strategies to promote preventive screening to identify fracture risk. Copyright © 2012 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Relationship between CT densitometry with a slice thickness of 0.5 mm and audiometry in otosclerosis.

PubMed

Kawase, Setsuko; Naganawa, Shinji; Sone, Michihiko; Ikeda, Mitsuru; Ishigaki, Takeo

2006-06-01

The appropriate cutoff Hounsfield unit (HU) value for the diagnosis of otosclerosis was determined and the correlation between the bone conduction threshold and the findings of computed tomography (CT) densitometry investigated. CT images, 0.5-mm thick, were evaluated in 24 ears with otosclerosis and 19 control ears. Eight regions of interest were set around the otic capsule. The mean HU values in the area anterior to the oval window (A-OW) and anterior to the internal auditory canal (A-IAC) were significantly lower in otosclerosis than in controls. Based on receiver operating characteristic (ROC) analysis, the cutoff HU value in A-OW was determined to be 2,187.3 HU. The mean HU value in retrofenestral otosclerosis was significantly lower in the area A-OW, A-IAC and around the cochlea than in controls. Based on ROC analysis, the cutoff HU value in the latter was determined to be 2,045 HU. A statistically significant correlation was found between the density of the area A-OW and the hearing level at 500 and 1,000 Hz, and between the density of the area around the cochlea and the hearing level at most frequencies. These results suggest the semi-automated diagnosis of otosclerosis may be possible.

Bone age in children with obstetrical brachial plexus palsy: effect of peripheral nerve injury on skeletal maturation.

PubMed

Oktay, Fügen; Cömert, Didem; Gökkaya, Nilüfer Kutay Ordu; Ozbudak, Sibel Demir; Uysal, Hilmi

2014-02-01

The purpose of this retrospective study was to analyze the effect of peripheral nerve injury on the skeletal maturation process. The bone ages of the affected and unaffected hand-wrists of 42 children with obstetrical brachial palsy were determined according to the Greulich and Pyle atlas. In 23 patients, the bone ages of the both sides were identical (bone-age-symmetrical group), in 19 patients the bone age of the affected side was delayed (bone-age-delayed group). The mean bone age of the affected side was delayed 0.48 ± 0.25 years that of the unaffected side (P = .000), and the delay of bone age was inversely correlated with chronological age (R (2) = .45, P < .02) in the bone-age-delayed group. Skeletal retardation can be recognized after appearance of ossification centers by plain radiography, dating from the third month of life, in early infancy. Thus, bone age determination method might be helpful for predicting potential future limb shortness.

CD133: Enhancement of Bone Healing by Local Transplantation of Peripheral Blood Cells in a Biologically Delayed Rat Osteotomy Model

PubMed Central

Preininger, Bernd; Duda, Georg; Gerigk, Hinnerk; Bruckner, Jonas; Ellinghaus, Agnes; Sass, F. Andrea; Perka, Carsten; Schmidt-Bleek, Katharina; Dienelt, Anke

2013-01-01

Sufficient angiogenesis is crucial during tissue regeneration and therefore also pivotal in bone defect healing. Recently, peripheral blood derived progenitor cells have been identified to have in addition to their angiogenic potential also osteogenic characteristics, leading to the hypothesis that bone regeneration could be stimulated by local administration of these cells. The aim of this study was to evaluate the angiogenic potential of locally administered progenitor cells to improve bone defect healing. Cells were separated from the peripheral blood of donor animals using the markers CD34 and CD133. Results of the in vitro experiments confirmed high angiogenic potential in the CD133(+) cell group. CD34(+) and CD133(+) cells were tested in an in vivo rat femoral defect model of delayed healing for their positive effect on the healing outcome. An increased callus formation and higher bone mineral density of callus tissue was found after the CD133(+) cell treatment compared to the group treated with CD34(+) cells and the control group without cells. Histological findings confirmed an increase in vessel formation and mineralization at day 42 in the osteotomy gap after CD133(+) cell transplantation. The higher angiogenic potential of CD133(+) cells from the in vitro experients therefore correlates with the in vivo data. This study demonstrates the suitability of angiogenic precursors to further bone healing and gives an indication that peripheral blood is a promising source for progenitor cells circumventing the problems associated with bone marrow extraction. PMID:23457441

Physical activity and dark skin tone: protective factors against low bone mass in Mexican men.

PubMed

Vivanco-Muñoz, Nalleli; Jo, Talavera; Gerardo, Huitron-Bravo; Juan, Tamayo; Clark, Patricia

2012-01-01

A cross-sectional study was conducted on 268 Mexican men between the ages of 13 and 80 yr to evaluate the association of clinical factors related with bone mass. Men from high schools, universities, and retirement homes were invited to participate. Body mass index (BMI) was measured, and bone mineral density (BMD) was assessed using dual-energy X-ray absorptiometry for L1-L4 and total hip. Factors related to bone mass were assessed by questionnaire and analyzed using a logistic regression model. Demographic factors (age, education, and occupation), clinical data (BMI, skin tone, previous fracture, history of osteoporosis [OP], and history of fractures), and lifestyle variables (diet, physical activity, sun exposure, and smoking) were evaluated. Physical activity (≥ 60 min/5 times a week) reduced the risk for low BMD for age, osteopenia, and OP at the spine and total hip (odds ratio [OR]: 0.276; 95% confidence interval [CI]: 0.099-0.769; p=0.014; and OR: 0.184; 95% CI: 0.04-0.849; p=0.03, respectively). Dark skin tone was a protective factor, decreasing the risk by up to 70%. In this population of healthy Mexican men (aged 13-80 yr), dark skin and physical activity were protective factors against low bone mass. Copyright © 2012 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Work- and travel-related physical activity and alcohol consumption: relationship with bone mineral density and calcaneal quantitative ultrasonometry.

PubMed

Sritara, Chanika; Thakkinstian, Ammarin; Ongphiphadhanakul, Boonsong; Pornsuriyasak, Prapaporn; Warodomwichit, Daruneewan; Akrawichien, Tawatchai; Vathesatogkit, Prin; Sritara, Piyamitr

2015-01-01

A number of healthy workers rarely exercise because of a lack of time or resources. Physical activity related to work and everyday travel may be more feasible, but evidence of its beneficial effect on bone health is scarce. We assessed if this form of physical activity was associated with higher bone mineral density (BMD) and stiffness index (SI) when adjusted for recreational physical activity, age, body mass index, smoking, alcohol consumption, education, and serum level of 25-hydroxyvitamin D. Healthy workers, aged 25-54 yr, of the Electricity Generating Authority of Thailand were surveyed. The outcomes were BMD (lumbar spine, femoral neck, and total hip) and calcaneal SI. Physical activity was estimated using the global physical activity questionnaire and considered active when >600 metabolic equivalent tasks (min). Of 2268 subjects, 74% were men. Active male subjects had significantly higher BMD at the femoral neck and total hip (p<0.005). However, the association was not significant with male lumbar spine BMD, male SI, or any bone parameters in women (p>0.05). In men, work and travel physical activity seems beneficial to male bone health; hence, it should be encouraged. Furthermore, smoking appeared harmful while moderate alcohol consumption was beneficial. Copyright © 2015 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Percutaneous Augmented Peripheral Osteoplasty in Long Bones of Oncologic Patients for Pain Reduction and Prevention of Impeding Pathologic Fracture: The Rebar Concept

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kelekis, A., E-mail: akelekis@med.uoa.gr; Filippiadis, D., E-mail: dfilippiadis@yahoo.gr; Anselmetti, G., E-mail: gc.anselmetti@fastwebnet.it

PurposeTo evaluate clinical efficacy/safety of augmented peripheral osteoplasty in oncologic patients with long-term follow-up.Materials and MethodsPercutaneous augmented peripheral osteoplasty was performed in 12 patients suffering from symptomatic lesions of long bones. Under extensive local sterility measures, anesthesiology care, and fluoroscopic guidance, direct access to lesion was obtained and coaxially a metallic mesh consisting of 25–50 medical grade stainless steel micro-needles (22 G, 2–6 cm length) was inserted. PMMA for vertebroplasty was finally injected under fluoroscopic control. CT assessed implant position 24-h post-treatment.ResultsClinical evaluation included immediate and delayed follow-up studies of patient’s general condition, NVS pain score, and neurological status. Imaging assessedmore » implant’s long-term stability. Mean follow-up was 16.17 ± 10.93 months (range 2–36 months). Comparing patients’ scores prior (8.33 ± 1.67 NVS units) and post (1.42 ± 1.62 NVS units) augmented peripheral osteoplasty, there was a mean decrease of 6.92 ± 1.51 NVS units. Overall mobility improved in 12/12 patients. No complication was observed.ConclusionPercutaneous augmented peripheral osteoplasty (rebar concept) for symptomatic malignant lesions in long bones seems to be a possible new technique for bone stabilization. This combination seems to provide necessary stability against shearing forces applied in long bones during weight bearing.« less

Lead exposure is a risk for worsening bone mineral density in middle-aged male workers.

PubMed

Akbal, Ayla; Tutkun, Engin; Yılmaz, Hınç

2014-09-01

Lead exposure linked to osteoporosis in women. However, there is no direct evidence whether lead exposure has effects on bone metabolism in middle-aged male subjects. Therefore, the present study investigated the relationship between bone mineral densitometry measurements, bone markers, endocrine hormones and blood lead levels. The present study included lead exposure patients (n: 30) and control subjects (n: 32). We recorded information on patient demographics and risk factors of osteoporosis. Blood lead levels were evaluated using Varian AA 240Z atomic absorption spectrophotometry. Bone mineral density measurements were measured using dual-energy X-ray absorptiometry. Each lumbar T and Z scores in the lead exposure group were lower than the control group. There were no significant differences in femur neck and femur total T and Z scores between two groups. Blood lead levels were also negatively correlated with lumbar 2-4 T score, total lumbar T score, lumbar 2-4 Z score and total lumbar Z score. Urinary hydroxyproline and urinary deoxypyridinoline levels in the lead exposure group were significantly higher compared to controls. Blood lead levels were strong, positively correlated with urinary deoxypyridinoline. Endocrine hormone levels and 1,25-dihydroxy-vitamin D3 levels were comparable between lead exposure and control group. Lead exposure in male workers is an important factor for deterioration in bone mineral density. We should be screening blood lead levels and history of lead exposure in male osteoporosis.

Comparison of the relationship between bone marrow adipose tissue and volumetric bone mineral density in children and adults.

PubMed

Shen, Wei; Velasquez, Gilbert; Chen, Jun; Jin, Ye; Heymsfield, Steven B; Gallagher, Dympna; Pi-Sunyer, F Xavier

2014-01-01

Several large-scale studies have reported the presence of an inverse relationship between bone mineral density (BMD) and bone marrow adipose tissue (BMAT) in adults. We aim to determine if there is an inverse relationship between pelvic volumetric BMD (vBMD) and pelvic BMAT in children and to compare this relationship in children and adults. Pelvic BMAT and bone volume (BV) was evaluated in 181 healthy children (5-17yr) and 495 healthy adults (≥18yr) with whole-body magnetic resonance imaging (MRI). Pelvic vBMD was calculated using whole-body dual-energy X-ray absorptiometry to measure pelvic bone mineral content and MRI-measured BV. An inverse correlation was found between pelvic BMAT and pelvic vBMD in both children (r=-0.374, p<0.001) and adults (r=-0.650, p<0.001). In regression analysis with pelvic vBMD as the dependent variable and BMAT as the independent variable, being a child or adult neither significantly contribute to the pelvic BMD (p=0.995) nor did its interaction with pelvic BMAT (p=0.415). The inverse relationship observed between pelvic vBMD and pelvic BMAT in children extends previous findings that found the inverse relationship to exist in adults and provides further support for a reciprocal relationship between adipocytes and osteoblasts. Copyright © 2014 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Infant milk feeding influences adult bone health: a prospective study from birth to 32 years.

PubMed

Pirilä, Satu; Taskinen, Mervi; Viljakainen, Heli; Kajosaari, Merja; Turanlahti, Maila; Saarinen-Pihkala, Ulla M; Mäkitie, Outi

2011-04-27

Peak bone mass, attained by early adulthood, is influenced by genetic and life-style factors. Early infant feeding and duration of breastfeeding in particular, associate with several health-related parameters in childhood. The aim of this study was to examine whether the effects of early infant feeding extend to peak bone mass and other bone health characteristics at adult age. A cohort of 158 adults (76 males) born in Helsinki, Finland, 1975, prospectively followed up from birth, underwent physical examination and bone densitometry to study bone area, bone mineral content (BMC), and bone mineral density (BMD) at 32 years of age. Life-style factors relevant for bone health were recorded. For data analysis the cohort was divided into three equal-size groups according to the total duration of breastfeeding (BF): Short (≤3 months), Intermediate and Prolonged (≥7 months) BF groups. In males short BF is associated with higher bone area, BMC, and BMD compared to longer BF. Males in the Short BF group had on average 4.7% higher whole body BMD than males in the Prolonged BF group. In multivariate analysis, after controlling for multiple confounding factors, the influence of BF duration on adult bone characteristics persisted in males. Differences between the three feeding groups were observed in lumbar spine bone area and BMC, and whole body BMD (MANCOVA; p = 0.025, p = 0.013, and p = 0.048, respectively), favoring the Short BF group. In women no differences were observed. In men, early infant milk feeding may have a significant impact on adult bone health. A potential explanation is that the calcium and phosphate contents were strikingly higher in formula milk and commercial cow milk/cow milk dilutions as opposed to human milk. Our novel finding merits further studies to determine means to ensure optimal bone mass development in infants with prolonged breastfeeding.

Associated Factors of Bone Mineral Density and Osteoporosis in Elderly Males

PubMed Central

Heidari, Behzad; Muhammadi, Abdollah; Javadian, Yahya; Bijani, Ali; Hosseini, Reza; Babaei, Mansour

2016-01-01

Background Low bone mineral density and osteoporosis is prevalent in elderly subjects. This study aimed to determine the associated factors of bone mineral density and osteoporosis in elderly males. Methods All participants of the Amirkola health and ageing project cohort aged 60 years and older entered the study. Bone mineral density at femoral neck and lumbar spine was assessed by the dual energy X-ray absorptiometry (DXA) method. Osteoporosis was diagnosed by the international society for clinical densitometry criteria and the association of bone mineral density and osteoporosis with several clinical, demographic and biochemical parameters. Multiple logistic regression analysis was used to determine independent associations. Results A total of 553 patients were studied and 90 patients (16.2%) had osteoporosis at either femoral neck or lumbar spine. Diabetes, obesity, metabolic syndrome, overweight, and quadriceps muscle strength > 30 kg, metabolic syndrome, abdominal obesity and education level were associated with higher bone mineral density and lower prevalence of osteoporosis, whereas age, anemia, inhaled corticosteroids and fracture history were associated with lower bone mineral density and higher prevalence of osteoporosis (P = 0.001). After adjustment for all covariates, osteoporosis was negatively associated only with diabetes, obesity, overweight, and QMS > 30 kg and positively associated with anemia and fracture history. The association of osteoporosis with other parameters did not reach a statistical level. Conclusions The findings of the study indicate that in elderly males, diabetes, obesity and higher muscle strength was associated with lower prevalence of osteoporosis and anemia, and prior fracture with higher risk of osteoporosis. This issue needs further longitudinal studies. PMID:28835759

The role of bone shape in determining gender differences in vertebral bone mass.

PubMed

Barlow, Tricia; Carlino, Will; Blades, Heather Z; Crook, Jon; Harrison, Rachel; Arundel, Paul; Bishop, Nick J

2011-01-01

Dual-energy X-ray absorptiometry (DXA) measures of bone mineral density (BMD) in children fail to account for growth because bone depth is unmeasured. While multiple adjustment methods have been proposed using body or bone size, the effect of vertebral shape is relatively unknown. Our study aimed to determine gender differences in vertebral shape and their impact on areal BMD (aBMD). We recruited 189 children, including 107 boys, aged 4-17 years, who attended the emergency department due to trauma. None had fractured. Height, weight, Tanner stage, and DXA measurements of the lumbar spine (LS) and total body were obtained. Cylindrical models were used to predict relationships between vertebral width (VW) and areal density for a given vertebral area assuming uniform volumetric density. The actual relationships between VW, bone area, and aBMD for the LS in the children were then determined. The theoretical models predicted a positive relationship between width and areal density for a constant vertebral area. Actual vertebral measurements demonstrated that boys had greater VW for a given vertebral area but lower aBMD for a given VW than girls at any age. The most likely explanation for the apparent paradox was that vertebral cortical thickness relative to width was greater in girls. This difference remained after adjusting for lean mass, suggesting that bone's response to mechanical stimulation may vary between the sexes during growth with consequent evolutionary advantage for girls approaching reproductive age. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Analysis of fracture healing in osteopenic bone caused by disuse: experimental study.

PubMed

Paiva, A G; Yanagihara, G R; Macedo, A P; Ramos, J; Issa, J P M; Shimano, A C

2016-03-01

Osteoporosis has become a serious global public health issue. Hence, osteoporotic fracture healing has been investigated in several previous studies because there is still controversy over the effect osteoporosis has on the healing process. The current study aimed to analyze two different periods of bone healing in normal and osteopenic rats. Sixty, 7-week-old female Wistar rats were randomly divided into four groups: unrestricted and immobilized for 2 weeks after osteotomy (OU2), suspended and immobilized for 2 weeks after osteotomy (OS2), unrestricted and immobilized for 6 weeks after osteotomy (OU6), and suspended and immobilized for 6 weeks after osteotomy (OS6). Osteotomy was performed in the middle third of the right tibia 21 days after tail suspension, when the osteopenic condition was already set. The fractured limb was then immobilized by orthosis. Tibias were collected 2 and 6 weeks after osteotomy, and were analyzed by bone densitometry, mechanical testing, and histomorphometry. Bone mineral density values from bony calluses were significantly lower in the 2-week post-osteotomy groups compared with the 6-week post-osteotomy groups (multivariate general linear model analysis, P<0.000). Similarly, the mechanical properties showed that animals had stronger bones 6 weeks after osteotomy compared with 2 weeks after osteotomy (multivariate general linear model analysis, P<0.000). Histomorphometry indicated gradual bone healing. Results showed that osteopenia did not influence the bone healing process, and that time was an independent determinant factor regardless of whether the fracture was osteopenic. This suggests that the body is able to compensate for the negative effects of suspension.

Handball Practice Enhances Bone Mass in Specific Sites Among Prepubescent Boys.

PubMed

Missawi, Kawther; Zouch, Mohamed; Chakroun, Yosra; Chaari, Hamada; Tabka, Zouhair; Bouajina, Elyès

2016-01-01

This investigation's purpose is to focus on the effects of practicing handball for at least 2 yr on bone acquisition among prepubescent boys. One hundred prepubescent boys aged 10.68 ± 0.85 yr were divided into 2 groups: 50 handball players (HP group) and 50 controls (C group). Bone mineral density (BMD), bone mineral content (BMC), and bone area (BA) were evaluated by using dual-photon X-ray absorptiometry on the whole body, lumbar spine (L2-L4), legs, arms, femoral necks, hips and radiuses. Results showed greater values of BMD in both right and left femoral neck and total hip in handball players than in controls. In addition, handball players had higher values of legs and right total hip BMC than controls without any obvious variation of BA measurement in all sites between groups. All results of the paired t-test displayed an obviously marked variation of bone mass parameters between the left and right sides in the trained group without any marked variation among controls. Data showed an increased BMD of the supporting sites between the left and the right leg among handball players. However, "BMC" results exhibited higher values in the right than in the left total hip, and in the right total radius than in the left correspondent site. In addition, differences in the "BA" measurements were observed in the left total hip and in the right arm. Specific bone sites are markedly stimulated by handball training in prepubescent boys. Copyright © 2016 International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Effect of age and disease on bone mass in Japanese patients with schizophrenia.

PubMed

Sugawara, Norio; Yasui-Furukori, Norio; Umeda, Takashi; Tsuchimine, Shoko; Fujii, Akira; Sato, Yasushi; Saito, Manabu; Furukori, Hanako; Danjo, Kazuma; Matsuzaka, Masashi; Takahashi, Ippei; Kaneko, Sunao

2012-02-20

There have been a limited number of studies comparing bone mass between patients with schizophrenia and the general population. The aim of this study was to compare the bone mass of schizophrenia patients with that of healthy subjects in Japan. We recruited patients (n = 362), aged 48.8 ± 15.4 (mean ± SD) years who were diagnosed with schizophrenia or schizoaffective disorder based on the Diagnostic and Statistical Manual of Mental Disorders, fourth edition (DSM-IV). Bone mass was measured using quantitative ultrasound densitometry of the calcaneus. The osteosono-assessment index (OSI) was calculated as a function of the speed of sound and the transmission index. For comparative analysis, OSI data from 832 adults who participated in the Iwaki Health Promotion Project 2009 was used as representative of the general community. Mean OSI values among male schizophrenic patients were lower than those in the general population in the case of individuals aged 40 and older. In females, mean OSI values among schizophrenic patients were lower than those in the general community in those aged 60 and older. In an analysis using the general linear model, a significant interaction was observed between subject groups and age in males. Older schizophrenic patients exhibit lower bone mass than that observed in the general population. Our data also demonstrate gender and group differences among schizophrenic patients and controls with regard to changes in bone mass associated with aging. These results indicate that intervention programs designed to delay or prevent decreased bone mass in schizophrenic patients might be tailored according to gender.

Growth of erythroid burst-forming units (BFU-E) in cultures of canine bone marrow and peripheral blood cells: effect of serum from irradiated dogs

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kreja, L.; Baltschukat, K.; Nothdurft, W.

1988-08-01

Erythroid burst-forming units (BFU-E) from canine bone marrow and peripheral blood could be grown in methylcellulose in the presence of an appropriate batch of fetal calf serum (FCS), transferrin, and erythropoietin (Epo). However, improved colony formation (size and number of bursts) was obtained when serum from total body irradiated dogs was present in the culture. This serum, obtained from dogs at day 9 after total body irradiation with a dose of 3.9 Gy, reduced markedly the Epo requirement of BFU-E. Furthermore, it allowed the omission of FCS from the culture medium if cholesterol and bovine serum albumin (BSA) were usedmore » as FCS substitutes. BFU-E concentrations were found to be rather different in the peripheral blood and in bone marrow samples from different sites (i.e., iliac crest, sternum, and humerus) of normal beagles. The studies further show that canine bone marrow BFU-E can be cryopreserved in liquid nitrogen.« less

Noninvasive markers of bone metabolism in the rhesus monkey: normal effects of age and gender

NASA Technical Reports Server (NTRS)

Cahoon, S.; Boden, S. D.; Gould, K. G.; Vailas, A. C.

1996-01-01

Measurement of bone turnover in conditions such as osteoporosis has been limited by the need for invasive iliac bone biopsy to reliably determine parameters of bone metabolism. Recent advances in the area of serum and urinary markers of bone metabolism have raised the possibility for noninvasive measurements; however, little nonhuman primate data exist for these parameters. The purpose of this experiment was to define the normal range and variability of several of the newer noninvasive bone markers which are currently under investigation in humans. The primary intent was to determine age and gender variability, as well as provide some normative data for future experiments in nonhuman primates. Twenty-four rhesus macaques were divided into equal groups of male and female according to the following age groupings: 3 years, 5-10 years, 15-20 years, and > 25 years. Urine was collected three times daily for a four-day period and measured for several markers of bone turnoverm including pyridinoline (PYD), deoxypyrodinoline (DPD), hydroxyproline, and creatinine. Bone mineral density measurements of the lumbar spine were performed at the beginning and end of the study period. Serum was also obtained at the time of bone densitometry for measurement of osteocalcin levels by radioimmunoassay. There were no significant differences in bone mineral density, urine PYD, or urine DPD based on gender. Bone density was lowest in the youngest animals, peaked in the 15-20-year group, but again decreased in the oldest animals. The osteocalcin, PYD, and DPD levels followed an inversely related pattern to bone density. The most important result was the relative age insensitivity of the ratio of PYD:DPD in monkeys up to age 20 years. Since bone density changes take months or years to become measurable and iliac biopsies are invasive, the PYD/DPD marker ratio may have important implications for rapid noninvasive measurement of the effects of potential treatments for osteoporosis in the non-human primate model.

Single dose of filgrastim (rhG-CSF) increases the number of hematopoietic progenitors in the peripheral blood of adult volunteers.

PubMed

Schwinger, W; Mache, C; Urban, C; Beaufort, F; Töglhofer, W

1993-06-01

Hematopoietic progenitor cell levels were monitored in the peripheral blood of ten healthy adults receiving a single dose of recombinant human granulocyte colony-stimulating factor (rhG-CSF). The objective was to determine the time and number of progenitor cells released into the peripheral blood, induced by a single dose of 15 micrograms/kg rhG-CSF administered intravenously. In all cases the absolute number of circulating progenitor cells including granulocyte-macrophage and erythroid lineages increased up to 12-fold (median 9.4-fold) 4 days after treatment. These findings were based on flow cytometric quantification of CD34+ cells and on progenitor assays. The relative distribution of granulocyte/macrophage and erythroid progenitors remained unchanged. rhG-CSF was well tolerated; mild to moderate bone pain was the most common side-effect and was noted in 6 of 10 subjects. Thus a single dose of rhG-CSF is effective in mobilizing progenitor cells into the peripheral blood in healthy adults. If these progenitors are capable of reconstituting bone marrow, peripheral progenitor cell separation following rhG-CSF administration could be a reasonable alternative to conventional bone marrow harvest in healthy adults.

The first radiographic image of a peripheral nerve disorder? Lipomatous macrodactyly (unrecognized lipomatosis of nerve).

PubMed

Mahan, Mark A; Prasad, Nikhil; Spinner, Robert J

2015-06-01

Lipomatosis of nerves (LN) involves benign fibro-fatty infiltration and is often associated with territorial overgrowth of soft tissue and bone; this distinctive disease pattern can be visualized on plain radiographs. We recently discovered a case (presented by Sir Robert Jones in 1898 to the Pathological Society of London) that indirectly represents a historical landmark in the imaging of peripheral nerves. The clinical findings and image, with obvious soft tissue and bone overgrowth, are pathognomonic for LN, making this one of the earliest radiological observations of a peripheral nerve lesion.

Clinical Forms of Canine Visceral Leishmaniasis in Naturally Leishmania infantum–Infected Dogs and Related Myelogram and Hemogram Changes

PubMed Central

Roatt, Bruno Mendes; Aguiar-Soares, Rodrigo Dian de Oliveira; Reis, Levi Eduardo Soares; Carvalho, Maria das Graças; Carneiro, Cláudia Martins; Giunchetti, Rodolfo Cordeiro; Bouillet, Leoneide Erica Maduro; Lemos, Denise Silveira; Coura-Vital, Wendel; Reis, Alexandre Barbosa

2013-01-01

Hematological analysis has limited applications for disease diagnosis in Leishmania infantum–infected dogs, but it can be very important in evaluating the clinical forms of the disease and in understanding the evolution of canine visceral leishmaniasis (CVL) pathogenesis. Recently, we demonstrated that alterations in leucopoiesis and erythropoiesis are related to clinical status and bone marrow parasite density in dogs naturally infected by L. infantum. To further characterize these alterations, we evaluated the association between the hematological parameters in bone marrow and peripheral blood alterations in groups of L. infantum–infected dogs: asymptomatic I (AD-I: serum negative/PCR+), asymptomatic II (AD-II: serum positive), oligosymptomatic (OD), and symptomatic (SD). Results were compared with those from noninfected dogs (NID). The SD group was found to present a decrease in erythropoietic lineage with concomitant reductions in erythrocytes, hemoglobin, and hematocrit parameters, resulting in anemia. The SD group also had increased neutrophils and precursors and decreased band eosinophils and eosinophils, leading to peripheral blood leucopenia. In the AD-II group, lymphocytosis occurred in both the peripheral blood and the bone marrow compartments. The SD group exhibited lymphocytosis in the bone marrow, with lymphopenia in the peripheral blood. In contrast, the AD-I group, showed no significant changes suggestive of CVL, presenting normal counts in bone marrow and peripheral blood. Our results showed for the first time that important changes in hematopoiesis and hematological parameters occur during ongoing CVL in naturally infected dogs, mainly in symptomatic disease. Taken together, our results based on myelogram and hemogram parameters enable better understanding of the pathogenesis of the anemia, lymphocytosis, and lymphopenia, as well as the leucopenia (eosinopenia and monocytopenia), that contribute to CVL prognosis. PMID:24376612

Hypervitaminosis D: case report of pediatric osteoporosis secondary to cystic fibrosis.

PubMed

Cialdella, Pietro; Carella, Francesco

2011-09-01

The objective of the study is to evaluate alterations of bone metabolism in adolescence and adult CF, determining the rate of osteoporosis, osteopenia and vertebral and non-vertebral fractures. We took into account the clinical case of a child who right from the age of seven years has presented joint pain.The little girl was diagnosed with osteopenia taken with therapy of calcium and vitamin D; after few years despite treatment nephrocalcinosis and osteoporosis take over.It was examined a cohort of patients with cystic fibrosis of the southern Italy, 24 patients aged between 12 and 44 years, 12 females and 12 males with BMD assessment methods like dual energy X-rays (DXA) and calcaneal ultrasound densitometry in a few cases, ultrasonography was used jointly.From this case study we tried to establish the relationship between cystic fibrosis and osteoporosis etiopathogenetic, the adoptive therapy and the impact of therapies on patients.It was concluded that, given the high number of unrecognized patients with impaired bone mineralization, we must implement and integrate a more aggressive treatment with bisphosphonates and prevention programs that can combat the lifestyle and new eating habits of our young people that facilitate the loss of bone mass.

The study of indicators of bone marrow and peripheral blood of rats with diabetes and transplanted liver tumor after intravenous injection of gold nanorods

NASA Astrophysics Data System (ADS)

Dikht, Nataliya I.; Bucharskaya, Alla B.; Maslyakova, Galina N.; Terentyuk, Georgy S.; Matveeva, Olga V.; Navolokin, Nikita A.; Khlebtsov, Boris N.; Khlebtsov, Nikolai G.

2015-03-01

In study the evaluation of the influence of gold nanorods on morphological indicators of red bone marrow and peripheral blood of rats with diabetes and transplanted liver tumor after intravenous administration of gold nanorods was conducted. We used gold nanorods with length 41 ± 8 nm and diameter of 10.2±2 nm, synthesized in the laboratory of nanobiotechnology IBPPM RAS (Saratov). After intravenous administration of gold nanorods the decrease of leukocytes, platelets and lymphocytes was observed in animals of control group in blood. It was marked the decrease of the number of mature cellular elements of the leukocyte germ in bone marrow - stab neutrophils and segmented leukocytes, and the increase of immature elements- metamyelocytes, indicating the activation of leukocyte germ after nanoparticle administration. The decrease of leukocyte amount was noted in blood and the increase of cellular elements of the leukocyte germ was revealed in bone marrow, indicating the activation of leukocyte germ in rats with alloxan diabetes and transplanted tumors. The changes of morphological indicators of blood and bone marrow testify about stimulation of myelocytic sprouts of hemopoiesis in bone marrow as a result of reduction of mature cells in peripheral blood after gold nanoparticle administration.

Effect of the “protein diet” and bone tissue.

PubMed

Nascimento da Silva, Zoraide; Azevedo de Jesuz, Vanessa; De Salvo Castro, Eduardo; Soares da Costa, Carlos Alberto; Teles Boaventura, Gilson; Blondet de Azeredo, Vilma

2014-01-01

The aim of this study is to evaluate the effect of the hyperproteic diet consumption on bone tissue. The study was conducted during sixty days. Twenty eight Wistar albinus rats, adults, originated from Laboratory of Experimental Nutrition were divided in four groups: (n = 7); Control 1 (C1), Control 2 (C2), Hyperproteic 1 (HP1) e Hyperproteic 2 (HP2). The C2 and HP2 groups were submitted to 30% of food restriction. The hyperproteic diet was based on the Atkins diet and prepared to simulate the protein diet. At the end of the study the animals were anesthetized to performer bone densitometry analyses by DEXA and blood and tissue collection. Serum and bone minerals analyses were conducted by colorimetric methods in automated equipment. The total bone mineral density (BMD) of the pelvis and the spine of the food restriction groups (HP2 e C2) were lower (p < 0.05) than C1 e HP1 groups. While the femur BMD of the HP2 was lower (p < 0.05) related to others groups. It had been observed reduction (p < 0.05) in the medium point of the width of femur diaphysis and in bone calcium level in the hyperproteic groups (HP1 e HP2). It was observed similar effect on the osteocalcin level, that presented lower (p < 0.05) in the hyperproteic groups. The insulin level was lower only in HP2 and serum calcium of the HP1 and HP2 groups was lower than C1. The protein diet promotes significant bone change on femur and in the hormones levels related to bone synthesis and maintenance of this tissue.

[Relationship between weight, body composition and bone mass in peritoneal dialysis].

PubMed

Negri, A L; Barone, R; Bogado, C E; Zanchetta, J R

2005-01-01

Patients in chronic dialysis show a decrease in total bone mass. The factors that determine this decrease are not well known. In normal populations weight and its compartments are important determinants of bone mass. We studied total bone mineral content (TBMC), a measure of bone mass, and body composition using DEXA densitometry in 65 patients (45 females and 20 males) who had been in peritoneal dialysis for a mean of 40.3 +/- 23.2 months. Forty-eight patients (73.8%) had been previously in hemodialysis. The mean total time in dialysis for these patients was 76.8 months. As a group patients showed a very significant positive correlation between TBMC and weight, height, and lean body mass. A negative correlation was found between TBMC with the time in dialysis and iPTH. In men we found significant simple positive correlations between TBMC and weight, height and lean body mass. In women we found simple positive correlations of TBMC with weight, height and lean body mass and a negative correlation with iPTH. In the multiple regression analysis, lean body mass was the only body composition parameter that had a significantly positive correlation with TBMC in men; in women only height correlated positively with TBMC and iPTH continued to correlate negatively with bone mass. When we considered pre and postmenopausal women separately, bone mass was correlated positively with height and lean body mass and negatively with iPTH in postmenopausal women and only with height in pre-menopausal females. We conclude that the lean body mass compartment. is the most important component of weight that determines TBMC in peritoneal dialysis patients particularly in males and postmenopausal women. In postmenopausal women, secondary hyperparathyroidism seems to be particularly detrimental on bone mass.

Granulocyte-mobilized bone marrow.

PubMed

Arcese, William; De Angelis, Gottardo; Cerretti, Raffaella

2012-11-01

In the last few years, mobilized peripheral blood has overcome bone marrow as a graft source, but, despite the evidence of a more rapid engraftment, the incidence of chronic graft-versus-host disease is significantly higher with, consequently, more transplant-related mortality on the long follow-up. Overall, the posttransplant outcome of mobilized peripheral blood recipients is similar to that of patients who are bone marrow grafted. More recently, the use of bone marrow after granulocyte colony-stimulating factor (G-CSF) donor priming has been introduced in the transplant practice. Herein, we review biological acquisitions and clinical results on the use of G-CSF-primed bone marrow as a source of hematopoietic stem cells (HSC) for allogeneic stem cell transplantation. G-CSF the increases the HSC compartment and exerts an intense immunoregulatory effect on marrow T-cells resulting in the shift from Th1 to Th2 phenotype with higher production of anti-inflammatory cytokines. The potential advantages of these biological effects have been translated in the clinical practice by using G-CSF primed unmanipulated bone marrow in the setting of transplant from human leukocyte antigen (HLA)-haploidentical donor with highly encouraging results. For patients lacking an HLA-identical sibling, the transplant of G-CSF primed unmanipulated bone marrow from a haploidentical donor combined with an intense in-vivo immunosuppression is a valid alternative achieving results that are well comparable with those reported for umbilical cord blood, HLA-matched unrelated peripheral blood/bone marrow or T-cell-depleted haploidentical transplant.

Bone Metabolism on ISS Missions

NASA Technical Reports Server (NTRS)

Smith, S. M.; Heer, M. A.; Shackelford, L. C.; Zwart, S. R.

2014-01-01

Spaceflight-induced bone loss is associated with increased bone resorption (1, 2), and either unchanged or decreased rates of bone formation. Resistive exercise had been proposed as a countermeasure, and data from bed rest supported this concept (3). An interim resistive exercise device (iRED) was flown for early ISS crews. Unfortunately, the iRED provided no greater bone protection than on missions where only aerobic and muscular endurance exercises were available (4, 5). In 2008, the Advanced Resistive Exercise Device (ARED), a more robust device with much greater resistance capability, (6, 7) was launched to the ISS. Astronauts who had access to ARED, coupled with adequate energy intake and vitamin D status, returned from ISS missions with bone mineral densities virtually unchanged from preflight (7). Bone biochemical markers showed that while the resistive exercise and adequate energy consumption did not mitigate the increased bone resorption, bone formation was increased (7, 8). The typical drop in circulating parathyroid hormone did not occur in ARED crewmembers. In 2014, an updated look at the densitometry data was published. This study confirmed the initial findings with a much larger set of data. In 42 astronauts (33 male, 9 female), the bone mineral density response to flight was the same for men and women (9), and those with access to the ARED did not have the typical decrease in bone mineral density that was observed in early ISS crewmembers with access to the iRED (Figure 1) (7). Biochemical markers of bone formation and resorption responded similarly in men and women. These data are encouraging, and represent the first in-flight evidence in the history of human space flight that diet and exercise can maintain bone mineral density on long-duration missions. However, the maintenance of bone mineral density through bone remodeling, that is, increases in both resorption and formation, may yield a bone with strength characteristics different from those that existed before space flight. Studies to assess bone strength after flight are underway at NASA, to better understand the results of bone remodeling. Studies are also underway to evaluate optimized exercise protocols and nutritional countermeasures. Regardless, there is clear evidence of progress being made to protect bone during spaceflight.

Bone metabolism of male rats chronically exposed to cadmium

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brzoska, Malgorzata M.; Moniuszko-Jakoniuk, Janina

2005-09-15

Recently, based on a female rat model of human exposure, we have reported that low-level chronic exposure to cadmium (Cd) has an injurious effect on the skeleton. The purpose of the current study was to investigate whether the exposure may also affect bone metabolism in a male rat model and to estimate the gender-related differences in the bone effect of Cd. Young male Wistar rats received drinking water containing 0, 1, 5, or 50 mg Cd/l for 12 months. The bone effect of Cd was evaluated using bone densitometry and biochemical markers of bone turnover. Renal handling of calcium (Ca)more » and phosphate, and serum concentrations of vitamin D metabolites, calcitonin, and parathormone were estimated as well. At treatment with 1 mg Cd/l, corresponding to the low environmental exposure in non-Cd-polluted areas, the bone mineral content (BMC) and density (BMD) at the femur and lumbar spine (L1-L5) and the total skeleton BMD did not differ compared to control. However, from the 6th month of the exposure, the Z score BMD indicated osteopenia in some animals and after 12 months the bone resorption very clearly tended to an increase. The rats' exposure corresponding to human moderate (5 mg Cd/l) and especially relatively high (50 mg Cd/l) exposure dose- and duration-dependently disturbed the processes of bone turnover and bone mass accumulation leading to formation of less dense than normal bone tissue. The effects were accompanied by changes in the serum concentration of calciotropic hormones and disorders in Ca and phosphate metabolism. It can be concluded that low environmental exposure to Cd may be only a subtle risk factor for skeletal demineralization in men. The results together with our previous findings based on an analogous model using female rats give clear evidence that males are less vulnerable to the bone effects of Cd compared to females.« less

Locally Produced BDNF Promotes Sclerotic Change in Alveolar Bone after Nerve Injury

PubMed Central

Ida-Yonemochi, Hiroko; Yamada, Yurie; Yoshikawa, Hiroyuki

2017-01-01

Brain-derived neurotrophic factor (BDNF), which is released due to nerve injury, is known to promote the natural healing of injured nerves. It is often observed that damage of mandibular canal induces local sclerotic changes in alveolar bone. We reported that peripheral nerve injury promotes the local production of BDNF; therefore, it was possible to hypothesize that peripheral nerve injury affects sclerotic changes in the alveolar bone. This study aimed to evaluate the effect of BDNF on osteogenesis using in vitro osteoblast-lineage cell culture and an in vivo rat osteotomy model. MC3T3-E1 cells were cultured with BDNF and were examined for cell proliferative activity, chemotaxis and mRNA expression levels of osteoblast differentiation markers. For in vivo study, inferior alveolar nerve (IAN) injury experiments and mandibular cortical osteotomy were performed using a rat model. In the osteotomy model, exogenous BDNF was applied to bone surfaces after corticotomy of the mandible, and we morphologically analyzed the new bone formation. As a result, mRNA expression of osteoblast differentiation marker, osteocalcin, was significantly increased by BDNF, although cell proliferation and migration were not affected. In the in vivo study, osteopontin-positive new bone formation was significantly accelerated in the BDNF-grafted groups, and active bone remodeling, involving trkB-positive osteoblasts and osteocytes, continued after 28 days. In conclusion, BDNF stimulated the differentiation of MC3T3-E1 cells and it promoted new bone formation and maturation. These results suggested that local BDNF produced by peripheral nerve injury contributes to accelerating sclerotic changes in the alveolar bone. PMID:28072837

The impact of peripheral serotonin on leptin-brain serotonin axis, bone metabolism and strength in growing rats with experimental chronic kidney disease.

PubMed

Pawlak, Dariusz; Domaniewski, Tomasz; Znorko, Beata; Oksztulska-Kolanek, Ewa; Lipowicz, Paweł; Doroszko, Michał; Karbowska, Malgorzata; Pawlak, Krystyna

2017-12-01

Chronic kidney disease (CKD) results in decreased bone strength. Serotonin (5-HT) is one of the critical regulators of bone health, fulfilling distinct functions depending on its synthesis site: brain-derived serotonin (BDS) favors osteoblast proliferation, whereas gut-derived serotonin (GDS) inhibits it. We assessed the role of BDS and peripheral leptin in the regulation of bone metabolism and strength in young rats with 5/6 nephrectomy. BDS synthesis was accelerated during CKD progression. Decreased peripheral leptin in CKD rats was inversely related to BDS content in the hypothalamus, brainstem and frontal cortex. Serotonin in these brain regions affected bone strength and metabolism in the studied animals. The direct effect of circulating leptin on bone was not shown in uremia. At the molecular level, there was an inverse association between elevated GDS and the expression of cAMP responsive element-binding protein (Creb) gene in bone of CKD animals. In contrast, increased expression of activating transcription factor 4 (Atf4) was shown, which was associated with GDS-dependent transcription factor 1 (Foxo1), clock gene - Cry-1, cell cycle genes: c-Myc, cyclins, and osteoblast differentiation genes. These results identified a previously unknown molecular pathway, by which elevated GDS can shift in Foxo1 target genes from Creb to Atf4-dependent response, disrupting the leptin-BDS - dependent gene pathway in the bone of uremic rats. Thus, in the condition of CKD the effect of BDS and GDS on bone metabolism and strength can't be distinguished. Copyright © 2017 Elsevier Inc. All rights reserved.

Melorheostosis associated with peripheral form spondyloarthropathy: new image with 18-fluoride positron emission tomoscintigraphy coupled to computed tomography

PubMed Central

Hassani, Hakim; Slama, Jérôme; Hayem, Gilles; Ben Ali, Khadija; Sarda-Mantel, Laure; Burg, Samuel; Le Guludec, Dominique

2012-01-01

Melorheostosis is a rare benign bone pathology which can be responsible for incapacitating pain and bone deformations. Its imaging abnormalities are often typical. We describe here the case of a patient with melorheostosis involving the lower limbs, associated with a peripheral form of inflammatory spondyloarthropathy, who underwent 18FNa positron emission tomography coupled to a computed tomography scan. Our objective is to present this new image, to show the value of this new modality and emphasize its advantages compared to the 99mTechnetium bone scan. PMID:27790007

Estrogens are essential for male pubertal periosteal bone expansion.

PubMed

Bouillon, Roger; Bex, Marie; Vanderschueren, Dirk; Boonen, Steven

2004-12-01

The skeletal response to estrogen therapy was studied in a 17-yr-old boy with congenital aromatase deficiency. As expected, estrogen therapy (1 mg estradiol valeriate/d from age 17 until 20 yr) normalized total and free testosterone and reduced the rate of bone remodeling. Dual-energy x-ray absorptiometry-assessed areal bone mineral density (BMD) of the lumbar spine and femoral neck increased significantly (by 23% and 14%, respectively), but peripheral quantitative computed tomography at the ultradistal radius revealed no gain of either trabecular or cortical volumetric BMD. The increase in areal BMD was thus driven by an increase in bone size. Indeed, longitudinal bone growth (height, +8.5%) and especially cross-sectional area of the radius (+46%) and cortical thickness (+12%), as measured by peripheral quantitative computed tomography, increased markedly during estrogen treatment. These findings demonstrate that androgens alone are insufficient, whereas estrogens are essential for the process of pubertal periosteal bone expansion typically associated with the male bone phenotype.

Changes in bone structure of Corriedale sheep with inherited rickets: a peripheral quantitative computed tomography assessment.

PubMed

Dittmer, Keren E; Firth, Elwyn C; Thompson, Keith G; Marshall, Jonathan C; Blair, Hugh T

2011-03-01

An inherited skeletal disease with gross and microscopic features of rickets has been diagnosed in Corriedale sheep in New Zealand. The aim of this study was to quantify the changes present in tibia from sheep with inherited rickets using peripheral quantitative computed tomography. In affected sheep, scans in the proximal tibia, where metaphysis becomes diaphysis, showed significantly greater trabecular bone mineral content (BMC) and bone mineral density (BMD). The sheep with inherited rickets had significantly greater BMC and bone area in the mid-diaphysis of the proximal tibia compared to control sheep. However, BMD in the mid-diaphysis was significantly less in affected sheep than in controls, due to the greater cortical area and lower voxel density values in affected sheep. From this it was concluded that the increased strain on under-mineralised bone in sheep with inherited rickets led to increased bone mass in an attempt to improve bone strength. Copyright © 2010 Elsevier Ltd. All rights reserved.

Osteoporosis Care in the United States After Declines in Reimbursements for DXA

PubMed Central

Hayes, Burton L.; Curtis, Jeffrey R.; Laster, Andrew; Saag, Kenneth; Tanner, S. Bobo; Liu, Caiqin; Womack, Catherine; Johnson, Karen C.; Khaliq, Fazila; Carbone, Laura D.

2015-01-01

In January 2007, in the United States (US), Medicare initiated a series of cuts to reimbursement for dual-energy X-ray absorptiometry (DXA) services performed in the nonfacility setting that by January 2010 reduced payments for these services by more than 60% compared with 2006 levels. The objectives of this study were to determine if a temporal association exists between Medicare Physician Fee Schedule changes in office-based DXA reimbursement and attendance at educational conferences for osteoporosis, physicians’ perceptions of changes in their medical practices, or national trends in retail prescription medications for osteoporosis in those aged 65 and older. Compared with the 2 yr before the decline in Medicare reimbursement for DXA (2005–2006), attendance at educational meetings for osteoporosis in the US declined in the 2 yr after these cuts (2007–2008) by 6%; declines in attendance were only present in meetings selective for bone densitometry. Survey participants reported changes in DXA services with approximately one-third indicating that they had either decreased the number of DXAs they performed or declined service contracts or hardware/software updates compared with 2005–2006. The number of retail prescriptions for Food and Drug Administratione–approved osteoporosis drugs (excluding estrogen compounds and raloxifene) in the age 65 and older population increased by 5.5% in the time period 2007–2008 compared with 2005–2006. However, in the last year of the study (2008), total retail prescriptions for these drugs experienced for the first time over the interval of the study, a decline (1.4%) compared with the previous year. This occurred despite a 2.6% increase in the US population age 65 and older. In conclusion, there were temporal associations noted between Medicare cuts in DXA payments in attendance at educational conferences for bone densitometry, self-report of office-based provision of DXA services in the US, and retail prescriptions for osteoporosis therapies. PMID:21029972

Direct Comparison of the Precision of the New Hologic Horizon Model With the Old Discovery Model.

PubMed

Whittaker, LaTarsha G; McNamara, Elizabeth A; Vath, Savoun; Shaw, Emily; Malabanan, Alan O; Parker, Robert A; Rosen, Harold N

2017-11-22

Previous publications suggested that the precision of the new Hologic Horizon densitometer might be better than that of the previous Discovery model, but these observations were confounded by not using the same participants and technologists on both densitometers. We sought to study this issue methodically by measuring in vivo precision in both densitometers using the same patients and technologists. Precision studies for the Horizon and Discovery models were done by acquiring spine, hip, and forearm bone mineral density twice on 30 participants. The set of 4 scans on each participant (2 on the Discovery, 2 on the Horizon) was acquired by the same technologist using the same scanning mode. The pairs of data were used to calculate the least significant change according to the International Society for Clinical Densitometry guidelines. The significance of the difference between least significant changes was assessed using a Wilcoxon signed-rank test of the difference between the mean square error of the absolute value of the differences between paired measurements on the Discovery (Δ-Discovery) and the mean square error of the absolute value of the differences between paired measurements on the Horizon (Δ-Horizon). At virtually all anatomic sites, there was a nonsignificant trend for the precision to be better for the Horizon than for the Discovery. As more vertebrae were excluded from analysis, the precision deteriorated on both densitometers. The precision between densitometers was almost identical when reporting only 1 vertebral body. (1) There was a nonsignificant trend for greater precision on the new Hologic Horizon compared with the older Discovery model. (2) The difference in precision of the spine bone mineral density between the Horizon and the Discovery models decreases as fewer vertebrae are included. (3) These findings are substantially similar to previously published results which had not controlled as well for confounding from using different subjects and technologists. Copyright © 2017 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Noninvasive imaging of bone microarchitecture

PubMed Central

Patsch, Janina M.; Burghardt, Andrew J.; Kazakia, Galateia; Majumdar, Sharmila

2015-01-01

The noninvasive quantification of peripheral compartment-specific bone microarchitecture is feasible with high-resolution peripheral quantitative computed tomography (HR-pQCT) and high-resolution magnetic resonance imaging (HR-MRI). In addition to classic morphometric indices, both techniques provide a suitable basis for virtual biomechanical testing using finite element (FE) analyses. Methodical limitations, morphometric parameter definition, and motion artifacts have to be considered to achieve optimal data interpretation from imaging studies. With increasing availability of in vivo high-resolution bone imaging techniques, special emphasis should be put on quality control including multicenter, cross-site validations. Importantly, conclusions from interventional studies investigating the effects of antiosteoporotic drugs on bone microarchitecture should be drawn with care, ideally involving imaging scientists, translational researchers, and clinicians. PMID:22172043

Single x-ray transmission system for bone mineral density determination

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jimenez-Mendoza, Daniel; Vargas-Vazquez, Damian; Espinosa-Arbelaez, Diego G.

2011-12-15

Bones are the support of the body. They are composed of many inorganic compounds and other organic materials that all together can be used to determine the mineral density of the bones. The bone mineral density is a measure index that is widely used as an indicator of the health of the bone. A typical manner to evaluate the quality of the bone is a densitometry study; a dual x-ray absorptiometry system based study that has been widely used to assess the mineral density of some animals' bones. However, despite the success stories of utilizing these systems in many differentmore » applications, it is a very expensive method that requires frequent calibration processes to work properly. Moreover, its usage in small species applications (e.g., rodents) has not been quite demonstrated yet. Following this argument, it is suggested that there is a need for an instrument that would perform such a task in a more reliable and economical manner. Therefore, in this paper we explore the possibility to develop a new, affordable, and reliable single x-ray absorptiometry system. The method consists of utilizing a single x-ray source, an x-ray image sensor, and a computer platform that all together, as a whole, will allow us to calculate the mineral density of the bone. Utilizing an x-ray transmission theory modified through a version of the Lambert-Beer law equation, a law that expresses the relationship among the energy absorbed, the thickness, and the absorption coefficient of the sample at the x-rays wavelength to calculate the mineral density of the bone can be advantageous. Having determined the parameter equation that defines the ratio of the pixels in radiographies and the bone mineral density [measured in mass per unit of area (g/cm{sup 2})], we demonstrated the utility of our novel methodology by calculating the mineral density of Wistar rats' femur bones.« less

Single x-ray transmission system for bone mineral density determination

NASA Astrophysics Data System (ADS)

Jimenez-Mendoza, Daniel; Espinosa-Arbelaez, Diego G.; Giraldo-Betancur, Astrid L.; Hernandez-Urbiola, Margarita I.; Vargas-Vazquez, Damian; Rodriguez-Garcia, Mario E.

2011-12-01

Bones are the support of the body. They are composed of many inorganic compounds and other organic materials that all together can be used to determine the mineral density of the bones. The bone mineral density is a measure index that is widely used as an indicator of the health of the bone. A typical manner to evaluate the quality of the bone is a densitometry study; a dual x-ray absorptiometry system based study that has been widely used to assess the mineral density of some animals' bones. However, despite the success stories of utilizing these systems in many different applications, it is a very expensive method that requires frequent calibration processes to work properly. Moreover, its usage in small species applications (e.g., rodents) has not been quite demonstrated yet. Following this argument, it is suggested that there is a need for an instrument that would perform such a task in a more reliable and economical manner. Therefore, in this paper we explore the possibility to develop a new, affordable, and reliable single x-ray absorptiometry system. The method consists of utilizing a single x-ray source, an x-ray image sensor, and a computer platform that all together, as a whole, will allow us to calculate the mineral density of the bone. Utilizing an x-ray transmission theory modified through a version of the Lambert-Beer law equation, a law that expresses the relationship among the energy absorbed, the thickness, and the absorption coefficient of the sample at the x-rays wavelength to calculate the mineral density of the bone can be advantageous. Having determined the parameter equation that defines the ratio of the pixels in radiographies and the bone mineral density [measured in mass per unit of area (g/cm2)], we demonstrated the utility of our novel methodology by calculating the mineral density of Wistar rats' femur bones.

Area densitometry using rotating Scheimpflug photography for posterior capsule opacification and surface light scattering analyses.

PubMed

Minami, Keiichiro; Honbo, Masato; Mori, Yosai; Kataoka, Yasushi; Miyata, Kazunori

2015-11-01

To compare area densitometry analysis using rotating Scheimpflug photography in quantifications of posterior capsule opacification (PCO) and surface light scattering with previous anterior-segment analyzer measurement. Miyata Eye Hospital, Miyazaki, Japan. Prospective observational case series. Scheimpflug images of eyes with foldable intraocular lenses (IOLs) were obtained using rotating and fixed Scheimpflug photography. Area densitometry on the posterior and anterior surfaces was conducted for PCO and surface light scattering analyses, respectively, with an identical area size. Correlation between two measurements was analyzed using linear regression. The study included 105 eyes of 74 patients who received IOLs 1 to 18 years (mean, 4.9 ± 4.5 years) postoperatively. In the PCO analysis on the posterior IOL surface, there was a significant correlation between the two measurements (P < .001, R(2) = 0.60). In the surface light scattering analysis, a significant and higher correlation was obtained (P < .001, R(2) = 0.91) until the fixed Scheimpflug photography exhibited saturation due to intensive scatterings. Area densitometry combined with a rotating Scheimpflug photography was exchangeable to previously established densitometry measurement, and allowed successive evaluation in longer-term observations. Copyright © 2015 ASCRS and ESCRS. Published by Elsevier Inc. All rights reserved.

High degree of discordance between three-dimensional and two-dimensional lumbar spine bone mineral density in Turner's syndrome.

PubMed

Lage, Andrea Z; Brandão, Cynthia A; Mendes, Judite R T; Huayllas, Martha K; Liberman, Bernardo; Mendonça, Berenice B; Costa, Elaine M F; Verreschi, Ieda T; Lazaretti-Castro, Marise

2005-01-01

Low bone mineral density (BMD) measured by dual-energy X-ray absorptiometry (DXA) has been described in Turner's syndrome (TS). One of the error factors of DXA is short stature, a common finding in TS patients. Aimed to evaluate the influence of a low stature on BMD, we compared the two-dimensional (2D) or conventional BMD (cBMD) with three-dimensional (3D) or volumetric BMD (vBMD) in 62 females (10 to 48 yr old) with TS diagnosis in a case control study. They were compared to 102 normal females (7 to 45 yr old) grouped by age-ranges. All patients were subjected to a lumbar spine densitometry by DXA in the PA and lateral projections, obtained the cBMD and vBMD and calculated for the apparent BMD (appBMD). In TS, the mean of Z-score for cBMD was significantly lower than that for vBMD and for appBMD (-2.31 +/- 1.42; -0.64 +/- 1.55; and -1.72 +/- 1.5; respectively). Most of the patients (83.8%) had a Z-score <-1 for cBMD, whereas the majority (58.1%) had a Z-score <-1 for vBMD. Concluding, the cBMD underestimates the bone mass of the lumbar spine in patients with TS inducing to false diagnoses of bone fragility. Volumetric BMD approached the bone mass of control patients, while appBMD just partially do that.

Comparison of DXA Scans and Conventional X-rays for Spine Morphometry and Bone Age Determination in Children.

PubMed

Hoyer-Kuhn, Heike; Knoop, Kai; Semler, Oliver; Kuhr, Kathrin; Hellmich, Martin; Schoenau, Eckhard; Koerber, Friederike

2016-01-01

Conventional lateral spine and hand radiographs are the standard tools to evaluate vertebral morphometry and bone age in children. Beside bone mineral density analyses, dual-energy X-ray absorptiometry (DXA) measurements with lower radiation exposure provide high-resolution scans which are not approved for diagnostic purposes. Data about the comparability of conventional radiographs and DXA in children are missing yet. The purpose of the trial was to evaluate whether conventional hand and spine radiographs can be replaced by DXA scans to diminish radiation exposure. Thirty-eight children with osteogenesis imperfecta or secondary osteoporosis or short stature (male, n=20; age, 5.0-17.0 yr) were included and assessed once by additional DXA (GE iDXA) of the spine or the left hand. Intraclass correlation coefficients (ICCs) were used to express agreement between X-ray and iDXA assessment. Evaluation of the spine morphometry showed reasonable agreement between iDXA and radiography (ICC for fish-shape, 0.75; for wedge-shape, 0.65; and for compression fractures, 0.70). Bone age determination showed excellent agreement between iDXA and radiography (ICC, 0.97). IDXA-scans of the spine in a pediatric population should be used not only to assess bone mineral density but also to evaluate anatomic structures and vertebral morphometry. Therefore, iDXA can replace some radiographs in children with skeletal diseases. Copyright © 2016 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Interpregnancy interval as a risk factor for postmenopausal osteoporosis.

PubMed

Sahin Ersoy, Gulcin; Giray, Burak; Subas, Seda; Simsek, Ersin; Sakin, Onder; Turhan, Omer Talip; Bulut, Sadullah

2015-10-01

Bone mass loss associated with pregnancy and lactation is usually regained in the postpartum period. However, it is not known whether the bone loss is completely recovered in women with a shortened interpregnancy interval (IPI). The aim of this study was to analyze the effect of IPI and gynecological history on postmenopausal osteoporosis. The study was conducted among 537 postmenopausal women who were divided into two groups in accordance with the osteoporosis status. Prior to bone densitometry, the patients were questioned about reproductive history. Dual-energy X-ray absorptiometry was used to measure lumbar spinal, femur neck and total femoral bone mineral density. Association between IPI and postmenopausal osteoporosis was analyzed. The comparison of both groups according to the total duration of breastfeeding did not reveal a considerable variation (p=0.288). In the osteoporosis group the age and duration of menopause were found to be significantly higher (p<0.001) whereas the age of first pregnancy and IPI were notably lower in comparison to the controls group (p<0.001). Multivariate logistic regression analyses revealed that women who have 0-12 months interpregnancy interval have the highest risk for osteoporosis (OR: 4.306; 95% CI, 1.684-11.01). This analysis confirmed that the occurrence of first pregnancy under 27 years of age conveyed a higher risk for osteoporosis, as well. Shortened IPI may have a detrimental effect on bone mineral density in postmenopausal age. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Marrow Fat Quality Differences by Sex in Healthy Adults.

PubMed

Maciel, Jamilly G; de Araújo, Iana M; Carvalho, Adriana L; Simão, Marcelo N; Bastos, Clara M; Troncon, Luiz E A; Salmon, Carlos E G; de Paula, Francisco J A; Nogueira-Barbosa, Marcello H

Several studies have demonstrated the relationship between bone marrow adiposity (BMAT) and bone mass. 1 H magnetic resonance spectroscopy is a noninvasive technique able to assess both BMAT quantity and quality. The aim of our study was to perform quantitative and qualitative analyses of BMAT and to investigate its association with bone mineral density (BMD) in healthy nonobese volunteers. Fifty-one healthy volunteers, 21 men and 30 women, underwent 1.5 T 1 H magnetic resonance spectroscopy of the lumbar spine. BMD was determined by dual-energy X-ray absorptiometry of the lumbar spine. Correlation analysis was performed to evaluate association among lipids fractions, BMD, and age. The female and male volunteers had similar body mass index and BMD (p > 0.05). Our data demonstrated an inverse correlation of BMD and BMAT with age, with a stronger correlation of saturated lipids (r = 0.701; p < 0.0001) compared with unsaturated lipids (UL) (r = 0.278; p = 0.004). Importantly, female subjects had the highest amount of UL (confidence interval: 0.685%-1.722%; p < 0.001). Our study reports that men and women with similar BMD and body mass index have striking differences in bone marrow lipids composition, namely women have higher UL than men. In addition, we believe that our study brings new insights to the complex network involving BMAT and other factors that influence bone integrity. Copyright © 2016 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Peripheral cemento-ossifying fibroma: case series literature review.

PubMed

Verma, Esha; Chakki, Arunkumar Bhimashankar; Nagaral, Sharanbasappa Chandrashekar; Ganji, Kiran Kumar

2013-01-01

THE CONCEPT OF FIBROOSSEOUS LESIONS OF BONE HAS EVOLVED OVER THE LAST SEVERAL DECADES AND NOW INCLUDES TWO MAJOR ENTITIES: fibrous dysplasia and ossifying fibroma. Peripheral cemento-ossifying fibroma is a relatively rare tumour classified between fibroosseous lesions. It predominantly affects adolescents and young adults, with peak prevalence between 10 and 19 yrs. The cemento-ossifying fibroma is a central neoplasm of bone as well as periodontium which has caused considerable controversy because of confusion regarding terminology and the criteria for its diagnosis. The cemento-ossifying fibroma is odontogenic in origin, whereas ossifying fibroma is of bony origin. Lesions histologically similar to peripheral ossifying fibroma have been given various names in existing literature. Therefore, we present and discuss in this paper a series of cases of peripheral cemento-ossifying fibroma emphasizing the differential diagnosis.

An ultrasound wearable system for the monitoring and acceleration of fracture healing in long bones.

PubMed

Protopappas, Vasilios C; Baga, Dina A; Fotiadis, Dimitrios I; Likas, Aristidis C; Papachristos, Athanasios A; Malizos, Konstantinos N

2005-09-01

An ultrasound wearable system for remote monitoring and acceleration of the healing process in fractured long bones is presented. The so-called USBone system consists of a pair of ultrasound transducers, implanted into the fracture region, a wearable device and a centralized unit. The wearable device is responsible to carry out ultrasound measurements using the axial-transmission technique and initiate therapy sessions of low-intensity pulsed ultrasound. The acquired measurements and other data are wirelessly transferred from the patient-site to the centralized unit, which is located in a clinical setting. The evaluation of the system on an animal tibial osteotomy model is also presented. A dataset was constructed for monitoring purposes consisting of serial ultrasound measurements, follow-up radiographs, quantitative computed tomography-based densitometry and biomechanical data. The animal study demonstrated the ability of the system to collect ultrasound measurements in an effective and reliable fashion and participating orthopaedic surgeons accepted the system for future clinical application. Analysis of the acquired measurements showed that the pattern of evolution of the ultrasound velocity through healing bones over the postoperative period monitors a dynamic healing process. Furthermore, the ultrasound velocity of radiographically healed bones returns to 80% of the intact bone value, whereas the correlation coefficient of the velocity with the material and mechanical properties of the healing bone ranges from 0.699 to 0.814. The USBone system constitutes the first telemedicine system for the out-hospital management of patients sustained open fractures and treated with external fixation devices.

Comparison and validation of methods to quantify Cry1Ab toxin from Bacillus thuringiensis for standardization of insect bioassays.

PubMed

Crespo, André L B; Spencer, Terence A; Nekl, Emily; Pusztai-Carey, Marianne; Moar, William J; Siegfried, Blair D

2008-01-01

Standardization of toxin preparations derived from Bacillus thuringiensis (Berliner) used in laboratory bioassays is critical for accurately assessing possible changes in the susceptibility of field populations of target pests. Different methods were evaluated to quantify Cry1Ab, the toxin expressed by 80% of the commercially available transgenic maize that targets the European corn borer, Ostrinia nubilalis (Hübner). We compared three methods of quantification on three different toxin preparations from independent sources: enzyme-linked immunosorbent assay (ELISA), sodium dodecyl sulfate-polyacrylamide gel electrophoresis and densitometry (SDS-PAGE/densitometry), and the Bradford assay for total protein. The results were compared to those obtained by immunoblot analysis and with the results of toxin bioassays against susceptible laboratory colonies of O. nubilalis. The Bradford method resulted in statistically higher estimates than either ELISA or SDS-PAGE/densitometry but also provided the lowest coefficients of variation (CVs) for estimates of the Cry1Ab concentration (from 2.4 to 5.4%). The CV of estimates obtained by ELISA ranged from 12.8 to 26.5%, whereas the CV of estimates obtained by SDS-PAGE/densitometry ranged from 0.2 to 15.4%. We standardized toxin concentration by using SDS-PAGE/densitometry, which is the only method specific for the 65-kDa Cry1Ab protein and is not confounded by impurities detected by ELISA and Bradford assay for total protein. Bioassays with standardized Cry1Ab preparations based on SDS-PAGE/densitometry showed no significant differences in LC(50) values, although there were significant differences in growth inhibition for two of the three Cry1Ab preparations. However, the variation in larval weight caused by toxin source was only 4% of the total variation, and we conclude that standardization of Cry1Ab production and quantification by SDS-PAGE/densitometry may improve data consistency in monitoring efforts to identify changes in insect susceptibility to Cry1Ab.

[Imaging of diabetic osteopathy].

PubMed

Patsch, J; Pietschmann, P; Schueller-Weidekamm, C

2015-04-01

Diabetic bone diseases are more than just osteoporosis in patients with diabetes mellitus (DM): a relatively high bone mineral density is paired with a paradoxically high risk of fragility fractures. Diabetics exhibit low bone turnover, osteocyte dysfunction, relative hypoparathyroidism and an accumulation of advanced glycation end products in the bone matrix. Besides typical insufficiency fractures, diabetics show a high risk for peripheral fractures of the lower extremities (e.g. metatarsal fractures). The correct interdisciplinary assessment of fracture risks in patients with DM is therefore a clinical challenge. There are two state of the art imaging methods for the quantification of fracture risks: dual energy X-ray absorptiometry (DXA) and quantitative computed tomography (QCT). Radiography, multidetector computed tomography (MDCT) and magnetic resonance imaging (MRI) are suitable for the detection of insufficiency fractures. Novel research imaging techniques, such as high-resolution peripheral quantitative computed tomography (HR-pQCT) provide non-invasive insights into bone microarchitecture of the peripheral skeleton. Using MR spectroscopy, bone marrow composition can be studied. Both methods have been shown to be capable of discriminating between type 2 diabetic patients with and without prevalent fragility fractures and thus bear the potential of improving the current standard of care. Currently both methods remain limited to clinical research applications. DXA and HR-pQCT are valid tools for the quantification of bone mineral density and assessment of fracture risk in patients with DM, especially if interpreted in the context of clinical risk factors. Radiography, CT and MRI are suitable for the detection of insufficiency fractures.

Combination Chemotherapy in Treating Patients With Non-Metastatic Extracranial Ewing Sarcoma

ClinicalTrials.gov

2018-02-09

Adult Supratentorial Primitive Neuroectodermal Tumor (PNET); Childhood Supratentorial Primitive Neuroectodermal Tumor; Ewing Sarcoma of Bone; Extraosseous Ewing Sarcoma; Extraosseous Ewing Sarcoma/Peripheral Primitive Neuroectodermal Tumor; Localized Ewing Sarcoma/Peripheral Primitive Neuroectodermal Tumor; Peripheral Primitive Neuroectodermal Tumor of the Kidney; Untreated Childhood Supratentorial Primitive Neuroectodermal Tumor

Mushroom Extracts Decrease Bone Resorption and Improve Bone Formation.

PubMed

Erjavec, Igor; Brkljacic, Jelena; Vukicevic, Slobodan; Jakopovic, Boris; Jakopovich, Ivan

2016-01-01

Mushroom extracts have shown promising effects in the treatment of cancer and various chronic diseases. Osteoporosis is considered one of the most widespread chronic diseases, for which currently available therapies show mixed results. In this research we investigated the in vitro effects of water extracts of the culinary-medicinal mushrooms Trametes versicolor, Grifola frondosa, Lentinus edodes, and Pleurotus ostreatus on a MC3T3-E1 mouse osteoblast-like cell line, primary rat osteoblasts, and primary rat osteoclasts. In an animal osteoporosis model, rats were ovariectomized and then fed 2 mushroom blends of G. frondosa and L. edodes for 42 days. Bone loss was monitored using densitometry (dual-energy X-ray absorptiometry) and micro computed tomography. In the concentration test, mushroom extracts showed no toxic effect on MC3T3-E1 cells; a dose of 24 µg/mL showed the most proliferative effect. Mushroom extracts of T. versicolor, G. frondosa, and L. edodes inhibited osteoclast activity, whereas the extract of L. edodes increased osteoblast mineralization and the production of osteocalcin, a specific osteoblastic marker. In animals, mushroom extracts did not prevent trabecular bone loss in the long bones. However, we show for the first time that the treatment with a combination of extracts from L. edodes and G. frondosa significantly reduced trabecular bone loss at the lumbar spine. Inhibitory properties of extracts from L. edodes on osteoclasts and the promotion of osteoblasts in vitro, together with the potential to decrease lumbar spine bone loss in an animal osteoporosis model, indicate that medicinal mushroom extracts can be considered as a preventive treatment and/or a supplement to pharmacotherapy to enhance its effectiveness and ameliorate its harmful side effects.

Bone health in long-term gastric cancer survivors: A prospective study of high-dose vitamin D supplementation using an easy administration scheme.

PubMed

Climent, Marta; Pera, Manuel; Aymar, Isabel; Ramón, José M; Grande, Luis; Nogués, Xavier

2018-07-01

Bone disease in long-term survivors after gastric cancer resection has received little research attention. This study aimed to investigate bone health after curative resection of gastric cancer and the consequences of high-dose vitamin D supplementation in patients with low levels of 25-(OH)-vitamin D. Disease-free patients at least 24 months after gastric cancer resection represented the study cohort. Serum markers of bone metabolism were assessed at baseline and at 3 and 12 months. Bone mineral density and presence of fractures were assessed by X-ray at baseline. Patients with 25-(OH)-vitamin D ≤30 ng/mL at baseline received 16,000 IU of vitamin D3 every 10 days during the 1-year follow-up. Forty patients were included in the study. Mean time from surgery was 48.9 (24-109) months. Vitamin D insufficiency and secondary hyperparathyroidism were observed in 38 and 20 patients, respectively. Densitometry showed osteoporosis in 14 women and seven men and prevalent fractures in 12 women and six men at baseline. After 3 months of vitamin D supplementation, 35 patients reached values of 25-(OH)-vitamin D over 30 ng/mL. After 12 months, 38 patients were in the normal range of 25-(OH)-vitamin D. At the same time, iPTH levels and markers of bone turnover (C-terminal cross-linked telopeptide of type-I collagen, serum concentrations of bone-specific alkaline phosphatase and osteocalcin) significantly decreased after vitamin D intervention. Oral administration of high doses of vitamin D is easily implemented and restored 25-(OH)-vitamin D and iPTH values, which are frequently disturbed after gastric cancer resection.

Osteoporosis, bone mineral density and CKD-MBD complex (I): Diagnostic considerations.

PubMed

Bover, Jordi; Ureña-Torres, Pablo; Torregrosa, Josep-Vicent; Rodríguez-García, Minerva; Castro-Alonso, Cristina; Górriz, José Luis; Laiz Alonso, Ana María; Cigarrán, Secundino; Benito, Silvia; López-Báez, Víctor; Lloret Cora, María Jesús; daSilva, Iara; Cannata-Andía, Jorge

2018-04-24

Osteoporosis (OP) and chronic kidney disease (CKD) independently influence bone and cardiovascular health. A considerable number of patients with CKD, especially those with stages 3a to 5D, have a significantly reduced bone mineral density leading to a high risk of fracture and a significant increase in associated morbidity and mortality. Independently of classic OP related to age and/or gender, the mechanical properties of bone are also affected by inherent risk factors for CKD ("uraemic OP"). In the first part of this review, we will analyse the general concepts regarding bone mineral density, OP and fractures, which have been largely undervalued until now by nephrologists due to the lack of evidence and diagnostic difficulties in the context of CKD. It has now been proven that a reduced bone mineral density is highly predictive of fracture risk in CKD patients, although it does not allow a distinction to be made between the causes which generate it (hyperparathyroidism, adynamic bone disease and/or senile osteoporosis, etc.). Therefore, in the second part, we will analyse the therapeutic indications in different CKD stages. In any case, the individual assessment of factors which represent a higher or lower risk of fracture, the quantification of this risk (i.e. using tools such as FRAX ® ) and the potential indications for densitometry in patients with CKD could represent an important first step pending new clinical guidelines based on randomised studies which do not exclude CKD patients, all the while avoiding therapeutic nihilism in an area of growing importance. Copyright © 2018 Sociedad Española de Nefrología. Published by Elsevier España, S.L.U. All rights reserved.

Prevalence and Risk Factors of Osteoporosis in Women Referring to the Bone Densitometry Academic Center in Urmia, Iran

PubMed Central

Naz, Marzieh Saei Ghare; Ozgoli, Giti; Aghdashi, Mir Amir; Salmani, Fatemeh

2016-01-01

Background: Osteoporosis is one of the fastest growing health problems around the world. Several factors can affect this silent disease. The current study aimed to determine the prevalence and risk factors of osteoporosis in women in Urmia, a city in northwestern Iran. Methods: This cross-sectional study was performed on 360 non-pregnant women over the age of 15 who referred for bone density testing to the Urmia Imam Khomeini Academic Hospital. Data were collected by questionnaire, and bone mineral density of the femoral neck and lumbar spines L1- L4 was evaluated by dual X-ray absorptiometry. Results: The total prevalence of osteoporosis in this study was 42.2%; prevalence of osteoporosis among women 45 years old or less was 14.3% and over the age of 45 years was 50.7%. The factors such as level of education, history of bone fracture, disease history (rheumatoid arthritis, diabetes, high blood pressure), gravidity and parity values, duration of lactation (p<0.001), nutrition dimension of lifestyle (p=0.03), and green tea consumption (p=002) showed a statistically significant association with the bone mineral density. According to the regression model, age (OR=1.081), history of bone fracture (OR=2.75), and gravidity (OR=1.14) were identified as significant risk factors for osteoporosis, while the body mass index (OR=0.94) was identified as a protector against osteoporosis. Conclusion: The prevalence of osteoporosis in this study was high, and findings showed that the advancement of age, lifestyle, and reproductive factors (especially gravidity and duration of lactation) were determining factors for osteoporosis. Appropriate educational programs and interventions could help to increase the women’s peak bone mass therefore reducing their risk of developing osteoporosis. PMID:26925890

Detection of the KIT D816V mutation in peripheral blood of systemic mastocytosis: diagnostic implications.

PubMed

Jara-Acevedo, Maria; Teodosio, Cristina; Sanchez-Muñoz, Laura; Álvarez-Twose, Ivan; Mayado, Andrea; Caldas, Carolina; Matito, Almudena; Morgado, José M; Muñoz-González, Javier I; Escribano, Luis; Garcia-Montero, Andrés C; Orfao, Alberto

2015-08-01

Recent studies have found the KIT D816V mutation in peripheral blood of virtually all adult systemic mastocytosis patients once highly sensitive PCR techniques were used; thus, detection of the KIT D816V mutation in peripheral blood has been proposed to be included in the diagnostic work-up of systemic mastocytosis algorithms. However, the precise frequency of the mutation, the biological significance of peripheral blood-mutated cells and their potential association with involvement of bone marrow hematopoietic cells other than mast cells still remain to be investigated. Here, we determined the frequency of peripheral blood involvement by the KIT D816V mutation, as assessed by two highly sensitive PCR methods, and investigated its relationship with multilineage involvement of bone marrow hematopoiesis. Overall, our results confirmed the presence of the KIT D816V mutation in peripheral blood of most systemic mastocytosis cases (161/190; 85%)--with an increasing frequency from indolent systemic mastocytosis without skin lesions (29/44; 66%) to indolent systemic mastocytosis with skin involvement (124/135; 92%), and more aggressive disease subtypes (11/11; 100%)--as assessed by the allele-specific oligonucleotide-qPCR method, which was more sensitive (P<.0001) than the peptide nucleic acid-mediated PCR approach (84/190; 44%). Although the presence of the KIT mutation in peripheral blood, as assessed by the allele-specific oligonucleotide-qPCR technique, did not accurately predict for multilineage bone marrow involvement of hematopoiesis, the allele-specific oligonucleotide-qPCR allele burden and the peptide nucleic acid-mediated-PCR approach did. These results suggest that both methods provide clinically useful and complementary information through the identification and/or quantification of the KIT D816V mutation in peripheral blood of patients suspected of systemic mastocytosis.

The effect of nutritional rickets on bone mineral density.

PubMed

Thacher, Tom D; Fischer, Philip R; Pettifor, John M

2014-11-01

Nutritional rickets is caused by impaired mineralization of growing bone. The effect of nutritional rickets on areal bone mineral density (aBMD) has not been established. Our objective was to determine if aBMD is lower in children with active rickets than in healthy control children. We expected that the reduction in aBMD would vary between the radial and ulnar metaphyses near the growth plates and the proximal diaphyses. Case-control study. Primary care outpatient department of a teaching hospital in Jos, Nigeria. Nigerian children with radiographically-confirmed rickets were compared with a reference group of control children without rickets from the same community. Forearm bone density measurements were performed in all children with pDXA. Age, sex, and height-adjusted bone density parameters were compared between children with rickets and control subjects. A total of 264 children with active rickets (ages 13-120 months) and 660 control children (ages 11-123 months) were included. In multivariate analyses controlling for height, age, and gender, rickets was associated with a 4% greater bone area and 7% lower aBMD of the radial and ulnar metaphyses compared with controls (P < .001). The effects of rickets on the diaphyses of the radius and ulna were more pronounced with an 11% greater bone area, 21% lower aBMD, and 24% lower bone mineral apparent density than controls (P < .001). In children with rickets, aBMD values were unrelated to dairy product intake or serum calcium, phosphorus, alkaline phosphatase, or 25-hydroxyvitamin D. Metaphyseal aBMD was positively associated with radiographic severity score, attributed to bone edge detection artifact by densitometry in active rickets. Rickets results in increased bone area and reduced aBMD, which are more pronounced in the diaphyseal than in the metaphyseal regions of the radius and ulna, consistent with secondary hyperparathyroidism, generalized osteoid expansion and impaired mineralization.

Mechanical Contributions of the Cortical and Trabecular Compartments Contribute to Differences in Age-Related Changes in Vertebral Body Strength in Men and Women Assessed by QCT-Based Finite Element Analysis

PubMed Central

Christiansen, Blaine A; Kopperdahl, David L; Kiel, Douglas P; Keaveny, Tony M; Bouxsein, Mary L

2011-01-01

The biomechanical mechanisms underlying sex-specific differences in age-related vertebral fracture rates are ill defined. To gain insight into this issue, we used finite element analysis of clinical computed tomography (CT) scans of the vertebral bodies of L3 and T10 of young and old men and women to assess age- and sex-related differences in the strength of the whole vertebra, the trabecular compartment, and the peripheral compartment (the outer 2 mm of vertebral bone, including the thin cortical shell). We sought to determine whether structural and geometric changes with age differ in men and women, making women more susceptible to vertebral fractures. As expected, we found that vertebral strength decreased with age 2-fold more in women than in men. The strength of the trabecular compartment declined significantly with age for both sexes, whereas the strength of the peripheral compartment decreased with age in women but was largely maintained in men. The proportion of mechanical strength attributable to the peripheral compartment increased with age in both sexes and at both vertebral levels. Taken together, these results indicate that men and women lose vertebral bone differently with age, particularly in the peripheral (cortical) compartment. This differential bone loss explains, in part, a greater decline in bone strength in women and may contribute to the higher incidence of vertebral fractures among women than men. © 2011 American Society for Bone and Mineral Research. PMID:21542000

Peripheral Cemento-Ossifying Fibroma: Case Series Literature Review

PubMed Central

Ganji, Kiran Kumar; Chakki, ArunKumar Bhimashankar; Nagaral, Sharanbasappa Chandrashekar; Verma, Esha

2013-01-01

The concept of fibroosseous lesions of bone has evolved over the last several decades and now includes two major entities: fibrous dysplasia and ossifying fibroma. Peripheral cemento-ossifying fibroma is a relatively rare tumour classified between fibroosseous lesions. It predominantly affects adolescents and young adults, with peak prevalence between 10 and 19 yrs. The cemento-ossifying fibroma is a central neoplasm of bone as well as periodontium which has caused considerable controversy because of confusion regarding terminology and the criteria for its diagnosis. The cemento-ossifying fibroma is odontogenic in origin, whereas ossifying fibroma is of bony origin. Lesions histologically similar to peripheral ossifying fibroma have been given various names in existing literature. Therefore, we present and discuss in this paper a series of cases of peripheral cemento-ossifying fibroma emphasizing the differential diagnosis. PMID:23365762

Fate of bone marrow stromal cells in a syngenic model of bone formation.

PubMed

Boukhechba, Florian; Balaguer, Thierry; Bouvet-Gerbettaz, Sébastien; Michiels, Jean-François; Bouler, Jean-Michel; Carle, Georges F; Scimeca, Jean-Claude; Rochet, Nathalie

2011-09-01

Bone marrow stromal cells (BMSCs) have been demonstrated to induce bone formation when associated to osteoconductive biomaterials and implanted in vivo. Nevertheless, their role in bone reconstruction is not fully understood and rare studies have been conducted to follow their destiny after implantation in syngenic models. The aim of the present work was to use sensitive and quantitative methods to track donor and recipient cells after implantation of BMSCs in a syngenic model of ectopic bone formation. Using polymerase chain reaction (PCR) amplification of the Sex determining Region Y (Sry) gene and in situ hybridization of the Y chromosome in parallel to histological analysis, we have quantified within the implants the survival of the donor cells and the colonization by the recipient cells. The putative migration of the BMSCs in peripheral organs was also analyzed. We show here that grafted cells do not survive more than 3 weeks after implantation and might migrate in peripheral lymphoid organs. These cells are responsible for the attraction of host cells within the implants, leading to the centripetal colonization of the biomaterial by new bone.

[Effect of intravenous treatment with OK-432 on the bone marrow in patients with lung cancer].

PubMed

Fujii, M; Ishikawa, M; Toki, H

1984-03-01

We studied effects of OK-432 on the bone marrow and peripheral blood cells of lung cancer patients. The nuclear cell count of bone marrow increased in 5 to 7 patients upon intravenous treatment with OK-432 compared with 3 of 6 patients who were intramuscularly treated with OK-432. Serial neutrophil counts of bone marrow increased in all 7 patients treated intravenously compared with 3 of 6 patients treated intramuscularly. The mean nuclear cell count or the serial neutrophil count of bone marrow in intravenously treated patients was significantly higher than the pretreatment values (p less than 0.001). In the peripheral blood picture, the difference in white blood cells or neutrophils before and after intravenous treatment was also statistically significant (p less than 0.01). There was no change in the erythrocytic series count of bone marrow and the hemoglobin count. Our results support the superiority of intravenous OK-432 treatment over intramuscular treatment in the growth-accelerating effect on bone marrow cells, especially regarding the neutrophil series.

Bone Mass in Boys with Autism Spectrum Disorder

ERIC Educational Resources Information Center

Calarge, Chadi A.; Schlechte, Janet A.

2017-01-01

To examine bone mass in children and adolescents with autism spectrum disorders (ASD). Risperidone-treated 5 to 17 year-old males underwent anthropometric and bone measurements, using dual-energy X-ray absorptiometry and peripheral quantitative computed tomography. Multivariable linear regression analysis models examined whether skeletal outcomes…

Therapeutic Trial for Patients With Ewing Sarcoma Family of Tumor and Desmoplastic Small Round Cell Tumors

ClinicalTrials.gov

2017-09-18

Desmoplastic Small Round Cell Tumor; Ewing Sarcoma of Bone or Soft Tissue; Localized Ewing Sarcoma/Peripheral Primitive Neuroectodermal Tumor; Metastatic Ewing Sarcoma/Peripheral Primitive Neuroectodermal Tumor

Deficiency of retinaldehyde dehydrogenase 1 induces BMP2 and increases bone mass in vivo.

PubMed

Nallamshetty, Shriram; Wang, Hong; Rhee, Eun-Jung; Kiefer, Florian W; Brown, Jonathan D; Lotinun, Sutada; Le, Phuong; Baron, Roland; Rosen, Clifford J; Plutzky, Jorge

2013-01-01

The effects of retinoids, the structural derivatives of vitamin A (retinol), on post-natal peak bone density acquisition and skeletal remodeling are complex and compartment specific. Emerging data indicates that retinoids, such as all trans retinoic acid (ATRA) and its precursor all trans retinaldehyde (Rald), exhibit distinct and divergent transcriptional effects in metabolism. Despite these observations, the role of enzymes that control retinoid metabolism in bone remains undefined. In this study, we examined the skeletal phenotype of mice deficient in retinaldehyde dehydrogenase 1 (Aldh1a1), the enzyme responsible for converting Rald to ATRA in adult animals. Bone densitometry and micro-computed tomography (µCT) demonstrated that Aldh1a1-deficient (Aldh1a1(-/-) ) female mice had higher trabecular and cortical bone mass compared to age and sex-matched control C57Bl/6 wild type (WT) mice at multiple time points. Histomorphometry confirmed increased cortical bone thickness and demonstrated significantly higher bone marrow adiposity in Aldh1a1(-/-) mice. In serum assays, Aldh1a1(-/-) mice also had higher serum IGF-1 levels. In vitro, primary Aldh1a1(-/-) mesenchymal stem cells (MSCs) expressed significantly higher levels of bone morphogenetic protein 2 (BMP2) and demonstrated enhanced osteoblastogenesis and adipogenesis versus WT MSCs. BMP2 was also expressed at higher levels in the femurs and tibias of Aldh1a1(-/-) mice with accompanying induction of BMP2-regulated responses, including expression of Runx2 and alkaline phosphatase, and Smad phosphorylation. In vitro, Rald, which accumulates in Aldh1a1(-/-) mice, potently induced BMP2 in WT MSCs in a retinoic acid receptor (RAR)-dependent manner, suggesting that Rald is involved in the BMP2 increases seen in Aldh1a1 deficiency in vivo. Collectively, these data implicate Aldh1a1 as a novel determinant of cortical bone density and marrow adiposity in the skeleton in vivo through modulation of BMP signaling.

Assessment of Corneal Backward Light Scattering in Diabetic Patients.

PubMed

Özyol, Pelin; Özyol, Erhan

2016-10-03

To analyze corneal backward light scattering differences in patients with type 2 diabetes mellitus. We enrolled 43 eyes from 43 diabetic patients and 40 eyes from 40 healthy controls. Corneal backward light scattering was evaluated using densitometry measurements from different corneal layers and zones obtained using Scheimpflug tomography (PentacamHR). When densitometry values were divided by depth, anterior layer of diabetic corneas displayed significantly higher corneal backward light scattering values than controls (32.05, 95% confidence intervals [CI], 31.02-33.08 vs. 29.18, 95% CI, 27.60-30.76, P=0.024). Corneal densitometry measurements were also significantly higher in diabetic eyes compared with control eyes, when considered by concentric zones of total cornea in the 0 to 2 mm (21.65, 95% CI, 20.28-23.01 vs. 18.87 95% CI, 18.49-19.25, P=0.020), and anterior layer in the 0 to 2 mm (27.3, 95% CI, 25.04-29.56 vs. 22.31, 95% CI, 20.57-24.05, P<0.001), 2 to 6 mm (26.2, 95% CI, 24.99-27.41 vs. 22.4, 95% CI, 20.18-24.62, P<0.001) and 6 to 10 mm (32.19, 95% CI, 29.98-34.40 vs. 27.2, 95% CI, 25.39-29.01, P=0.022). There was excellent positive correlation between anterior total corneal densitometry measurements and duration of diabetes (r=0.802, P<0.001), although no significant correlation was observed with anterior total corneal densitometry measurements and hemoglobin A1c levels (r=0.080, P=0.621) in diabetic eyes. Backward light scattering values from the anterior layer of the cornea is greater in diabetic eyes than in controls. Anterior total corneal densitometry measurements show positive correlation with the duration of diabetes.

Low-dose radiation (LDR) induces hematopoietic hormesis: LDR-induced mobilization of hematopoietic progenitor cells into peripheral blood circulation.

PubMed

Li, Wei; Wang, Guanjun; Cui, Jiuwei; Xue, Lu; Cai, Lu

2004-11-01

The aim of this study was to investigate the stimulating effect of low-dose radiation (LDR) on bone marrow hematopoietic progenitor cell (HPC) proliferation and peripheral blood mobilization. Mice were exposed to 25- to 100-mGy x-rays. Bone marrow and peripheral blood HPCs (BFU-E, CFU-GM, and c-kit+ cells) were measured, and GM-CSF, G-CSF, and IL-3 protein and mRNA expression were detected using ELISA, slot blot hybridization, and Northern blot methods. To functionally evaluate LDR-stimulated and -mobilized HPCs, repopulation of peripheral blood cells in lethally irradiated recipients after transplantation of LDR-treated donor HPCs was examined by WBC counts, animal survival, and colony-forming units in the recipient spleens (CFUs-S). 75-mGy x-rays induced a maximal stimulation for bone marrow HPC proliferation (CFU-GM and BFU-E formation) 48 hours postirradiation, along with a significant increase in HPC mobilization into peripheral blood 48 to 72 hours postradiation, as shown by increases in CFU-GM formation and proportion of c-kit+ cells in the peripheral mononuclear cells. 75-mGy x-rays also maximally induced increases in G-CSF and GM-CSF mRNA expression in splenocytes and levels of serum GM-CSF. To define the critical role of these hematopoietic-stimulating factors in HPC peripheral mobilization, direct administration of G-CSF at a dose of 300 microg/kg/day or 150 microg/kg/day was applied and found to significantly stimulate GM-CFU formation and increase c-kit+ cells in the peripheral mononuclear cells. More importantly, 75-mGy x-rays plus 150 microg/kg/day G-CSF (LDR/150-G-CSF) produced a similar effect to that of 300 microg/kg/day G-CSF alone. Furthermore, the capability of LDR-mobilized donor HPCs to repopulate blood cells was confirmed in lethally irradiated recipient mice by counting peripheral WBC and CFUs-S. These results suggest that LDR induces hematopoietic hormesis, as demonstrated by HPC proliferation and peripheral mobilization, providing a potential approach to clinical application for HPC peripheral mobilization.

78 FR 76507 - Revised Medical Criteria for Evaluating Cancer (Malignant Neoplastic Diseases)

Federal Register 2010, 2011, 2012, 2013, 2014

2013-12-17

... blast (immature) cells in the peripheral blood or bone marrow is 10 percent or greater. We propose this... evaluate cancer treatment by bone marrow or stem cell transplantation, including transplantation using stem... evaluate cancers treated with bone marrow or stem cell transplantation, including transplantation using...

Impact of endocrine hyperfunction and phosphate wasting on bone in McCune-Albright syndrome.

PubMed

Lala, R; Matarazzo, P; Andreo, M; Defilippi, C; de Sanctis, C

2002-01-01

Skin dysplasia, as café-au-lait spots, bone fibrous dysplasia and peripheral endocrinopathies are the main clinical features of McCune-Albright syndrome (MAS). This illness is due to activating mutations of the Gsalpha protein and is spread with a mosaic pattern in affected tissues that consist of intermixed areas of normal and mutated cells. Peripheral endocrine secretion, free of hypothalamic pituitary control, is the hallmark of the endocrine syndromes: precocious puberty, Cushing's syndrome, hyperthyroidism and gigantism/acromegaly. In addition, phosphate wasting as hyperphosphaturia is often present. The impact of hormonal hypersecretion and phosphate loss on the bones of patients with MAS is poorly understood both in normal and fibrous bone tissue. As hypercortisolism and hyperthyroidism increase bone resorption, hyperestrogenism and growth hormone hypersecretion stimulate bone growth and mineralization, and phosphate wasting reduces bone mineral content. All these actions can be exerted at varying times and degrees in a single patient on lesional and non-lesional bones. Sonographic evidence of multiple diffused hyperechogenic spots in the testes of patients with MAS do not seem to be related to alterations in calcium-phosphate metabolism but rather to zonal dysplasia/hyperplasia of testicular tissue.

Integrin αMβ2 is differently expressed by subsets of human osteoclast precursors and mediates adhesion of classical monocytes to bone

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sprangers, Sara, E-mail: s.l.sprangers@acta.nl; Schoenmaker, Ton, E-mail: t.schoenmaker@acta.nl; Department of Periodontology, Academic Centre for Dentistry Amsterdam

Bone-degrading osteoclasts are formed through fusion of their monocytic precursors. In the population of human peripheral blood monocytes, three distinct subsets have been identified: classical, intermediate and non-classical monocytes. We have previously shown that when the monocyte subsets are cultured on bone, significantly more osteoclasts are formed from classical monocytes than from intermediate or non-classical monocytes. Considering that this difference does not exist when monocyte subsets are cultured on plastic, we hypothesized that classical monocytes adhere better to the bone surface compared to intermediate and non-classical monocytes. To investigate this, the different monocyte subsets were isolated from human peripheral bloodmore » and cultured on slices of human bone in the presence of the cytokine M-CSF. We found that classical monocytes adhere better to bone due to a higher expression of the integrin αMβ2 and that their ability to attach to bone is significantly decreased when the integrin is blocked. This suggests that integrin αMβ2 mediates attachment of osteoclast precursors to bone and thereby enables the formation of osteoclasts.« less

Effects of 2-oxoglutaric acid on bone morphometry, densitometry, mechanics, and immunohistochemistry in 9-month-old boars with prenatal dexamethasone-induced osteopenia.

PubMed

Tomaszewska, Ewa; Dobrowolski, Piotr; Bieńko, Marek; Prost, Łukasz; Szymańczyk, Sylwia; Zdybel, Adam

2015-11-01

The structural quality of the connective tissue is genetically determined and is influenced by hormonal and nutritional modification. An effect of a 2-Ox-rich diet on bone mineralization and structure and expression of non-collagenous protein in articular and growth cartilages of maternal dexamethasone-treated 9-month-old boars was considered in this study. Sows were treated i.m. with dexamethasone at the dose of 0.03 mg kg(-1) body weight every second day during the last 45 days of pregnancy. After the birth, the boars were divided into two groups: administered and not supplemented with 2-Ox for 9 months (0.4 g/kg body weight/day). Dexamethasone given during the prenatal time inhibited the growth and negatively influenced the mechanics, geometry and histomorphometrical parameters of long bones and cartilage irrespective of the diet. Moreover, maternal dexamethasone treatment resulted in expression of osteocalcin in the articular cartilage, and the diet rich in 2-Ox limited the OC expression. This study demonstrated that changes observed in adult boars initiated by dexamethasone treatment in the prenatal period were persistent and long-term use of alimentary 2-Ox supplementation can counteract only some of the destructive changes evoked by prenatal dexamethasone excess.

Spontaneous rib fractures.

PubMed

Katrancioglu, Ozgur; Akkas, Yucel; Arslan, Sulhattin; Sahin, Ekber

2015-07-01

Other than trauma, rib fracture can occur spontaneously due to a severe cough or sneeze. In this study, patients with spontaneous rib fractures were analyzed according to age, sex, underlying pathology, treatment, and complications. Twelve patients who presented between February 2009 and February 2011 with spontaneous rib fracture were reviewed retrospectively. The patients' data were evaluated according to anamnesis, physical examination, and chest radiographs. The ages of the patients ranged from 34 to 77 years (mean 55.91 ± 12.20 years), and 7 (58.4%) were male. All patients had severe cough and chest pain. The fractures were most frequently between 4th and 9th ribs; multiple rib fractures were detected in 5 (41.7%) patients. Eight (66.7%) patients had chronic obstructive pulmonary disease, 2 (16.7%) had bronchial asthma, and 2 (16.7%) had osteoporosis. Bone densitometry revealed a high risk of bone fracture in all patients. Patients with chronic obstructive pulmonary disease or bronchial asthma had been treated with high-dose steroids for over a year. Spontaneous rib fracture due to severe cough may occur in patients with osteoporosis, chronic obstructive pulmonary disease, or bronchial asthma, receiving long-term steroid therapy. If these patients have severe chest pain, chest radiography should be performed to check for bone lesions. © The Author(s) 2015.

Pediatric data for dual X-ray absorptiometric measures of normal lumbar bone mineral density in children under 5 years of age using the lunar prodigy densitometer.

PubMed

Manousaki, D; Rauch, F; Chabot, G; Dubois, J; Fiscaletti, M; Alos, N

2016-09-07

Knowledge of physiological variations of bone mineral density (BMD) in newborns and infants is necessary to evaluate pathological changes associated with fractures. Limited reference data for children under 5 years old are available. This study provides normative data of lumbar BMD for the Lunar Prodigy in young children under 5 years old. We assessed cross-sectionally 155 healthy children (77 boys, 80% Caucasian), ranging in age from newborn to the age of 5 years. Lumbar bone mineral content (BMC) and areal BMD were measured by dual-energy X-ray absorptiometry using a Lunar Prodigy absorptiometer. Volumetric BMD was calculated using the Kroeger and Carter methods. BMC and areal BMD increased from birth to 5 years (p<0.001). Volumetric BMD did not change with age. BMD and BMC correlated with age, weight and height (R(2)≥0.85 for all), with a maximum gain between the ages of 1 and 4 years, which did not follow the same pattern as height velocity. We did not find significant sex difference for any of the three measured parameters. This study provides normative data for lumbar spine densitometry of infants and young children using the Lunar Prodigy DXA system.

Osteoporosis and body composition.

PubMed

Crepaldi, G; Romanato, G; Tonin, P; Maggi, S

2007-01-01

The Epidemiologic Study on the Prevalence of Osteoporosis in Italy showed that the prevalence of osteoporosis among women and men aged 60 yr and over is 22.8% and 14.5%, respectively, giving rise to about 80,000 new fractures a yr. Sarcopenia is considered to be one of the main features of the aging process. It is characterized by a reduction in muscle mass and muscle strength, and affects women more than men. It is associated with a increased risk of fractures consequent upon a greater predisposition to falls, but also to the lack of bone remodeling due to reduced muscle mechanical strength. Muscle strength determines quality bone modifications such as density, strength, and microarchitecture. Variations in the ratios of cortical and muscle areas give rise to various types of osteoporosis, with different risks of fracture. Bone mineral density increases with body fat mass, and obesity has a protective effect against osteoporosis. This protective effect is explained by a combination of hormonal (peripheral aromatization of androgens to estrogens in adipose tissue) and mechanical factors (on weight-bearing bone sites), but the hormone leptin also probably mediates fat and bone mass. Serum leptin levels are closely related to body fat mass, and some findings suggest the peripheral effect of leptin, which exerts estrogenic effects, enhancing osteoblastic differentiation and inhibiting late adipocytic differentiation. The overall effect of leptin on bone results from a balance between negative central effects and positive direct peripheral effects, according to serum leptin levels.

Comparison of gamma densitometry and electrical capacitance measurements applied to hold-up prediction of oil–water flow patterns in horizontal and slightly inclined pipes

NASA Astrophysics Data System (ADS)

Perera, Kshanthi; Kumara, W. A. S.; Hansen, Fredrik; Mylvaganam, Saba; Time, Rune W.

2018-06-01

Measurement techniques are vital for the control and operation of multiphase oil–water flow in pipes. The development of such techniques depends on laboratory experiments involving flow visualization, liquid fraction (‘hold-up’), phase slip and pressure drop measurements. They provide valuable information by revealing the physics, spatial and temporal structures of complex multiphase flow phenomena. This paper presents the hold-up measurement of oil–water flow in pipelines using gamma densitometry and electrical capacitance tomography (ECT) sensors. The experiments were carried out with different pipe inclinations from  ‑5° to  +6° for selected mixture velocities (0.2–1.5 m s‑1), and at selected watercuts (0.05–0.95). Mineral oil (Exxsol D60) and water were used as test fluids. Nine flow patterns were identified including a new pattern called stratified wavy and mixed interface flow. As a third direct method, visual observations and high-speed videos were used for the flow regime and interface identification. ECT and gamma densitometry hold-up measurements show similar trends for changes in pipeline inclinations. Changing the pipe inclination affected the flow mostly at lower mixture velocities and caused a change of flow patterns, allowing the highest change of hold-up. ECT hold-up measurements overpredict the gamma densitometry measurements at higher input water cuts and underpredict at intermediate water cuts. Gamma hold-up results showed good agreement with the literature results, having a maximum deviation of 6%, while it was as high as 22% for ECT in comparison to gamma densitometry. Uncertainty analysis of the measurement techniques was carried out with single-phase oil flow. This shows that the measurement error associated with gamma densitometry is approximately 3.2%, which includes 1.3% statistical error and 2.9% error identified as electromagnetically induced noise in electronics. Thus, gamma densitometry can predict hold-up with a higher accuracy in comparison to ECT when applied to oil–water systems at minimized electromagnetic noise.

Automatic Estimation of Osteoporotic Fracture Cases by Using Ensemble Learning Approaches.

PubMed

Kilic, Niyazi; Hosgormez, Erkan

2016-03-01

Ensemble learning methods are one of the most powerful tools for the pattern classification problems. In this paper, the effects of ensemble learning methods and some physical bone densitometry parameters on osteoporotic fracture detection were investigated. Six feature set models were constructed including different physical parameters and they fed into the ensemble classifiers as input features. As ensemble learning techniques, bagging, gradient boosting and random subspace (RSM) were used. Instance based learning (IBk) and random forest (RF) classifiers applied to six feature set models. The patients were classified into three groups such as osteoporosis, osteopenia and control (healthy), using ensemble classifiers. Total classification accuracy and f-measure were also used to evaluate diagnostic performance of the proposed ensemble classification system. The classification accuracy has reached to 98.85 % by the combination of model 6 (five BMD + five T-score values) using RSM-RF classifier. The findings of this paper suggest that the patients will be able to be warned before a bone fracture occurred, by just examining some physical parameters that can easily be measured without invasive operations.

Evolutionary Origins of the Differences in Osteoporosis Risk in US Populations.

PubMed

Nelson, Dorothy A

2018-03-23

Over the past 50 years, it has been increasingly evident that there are population differences in bone mass and the risk of osteoporosis. In the United States, many studies have reported a lower prevalence of osteoporosis in African Americans compared with people of European descent. If we trace the trajectory of changes in lifeways from the earliest migrations of early Homo out of Africa over the past two million years or so, to include lower vitamin D levels in higher latitudes; more meat in the diet; increasing sedentism; and a longer lifespan/longer postmenopausal period, it is not surprising that osteoporosis occurs more frequently in populations of European descent. While many scholars have explored the apparent "paradox" of higher bone mass, lower vitamin D levels, and higher parathyroid hormone levels among African Americans, this brief review of evolutionary shifts that affected our species may change the approach to understanding the current population differences in the United States. Copyright © 2018 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Normocalcemic primary hyperparathyroidism in clinical practice: an indolent condition or a silent threat?

PubMed Central

Marques, Thyciara Fontenele; Vasconcelos, Renata; Diniz, Erik; Rêgo, Daniela; Griz, Luiz; Bandeira, Francisco

2015-01-01

Objective To describe the characteristics of normocalcemic primary hyperparathyroidism (NPHPT) in patients seen for osteoporosis evaluation. Patients and methods We examined the records of 156 women who came to the hospital to be screened for osteoporosis. Measurements of total calcium, PTH, 25-hydroxy vitamin D, and β-C-telopeptide were recorded. Bone mineral density and T-scores were evaluated by densitometry of the lumbar spine, femoral neck and distal one-third of the radius. The latter was only measured in patients with primary hyperparathyroidism. Nephrolithiasis and bone fractures were documented by a review of the medical records. Results We identified 14 patients with NPHPT, accounting for 8.9% of the population studied. In the medical records, the occurrence of kidney stones was reported in 28.6% of the patients with NPHPT, in contrast with only 0.7% of the noncarriers. Regarding the presence of general fractures, 21.4% of the patients with NPHPT were affected versus 16.2% of noncarriers. Conclusion Data from our study suggest that NPHPT has a diverse phenotypic presentation, implying that this may not be an “indolent” disease. PMID:21881813

[A man with persisting fever, night sweats and high sedimentation rate].

PubMed

Kildahl-Andersen, Odd; Murbræch, Klaus; Skudal, Hilde; Stalsberg, Helge

2011-11-29

Fever of unknown origin and high sedimentation rate are common clinical problems. A middle-aged man with fever of unknown origin, night sweats and high sedimentation rate was referred to our hospital for investigation. The patient was suspected to have mononucleosis or reactivation of infectious mononucleosis because of mild anaemia and thrombocytopenia, a weakly positive IgM antibody test for Epstein-Barr virus and monocytosis (in peripheral blood). Because monocytosis, elevated sedimentation rate and fever persisted, bone marrow smears were prepared and biopsies taken.The third biopsy showed that morphology was consistent with chronic myelomonocytic leukemia (CMML), which was confirmed by two later biopsies. However, a malignant cell population (consisting of blasts in peripheral blood) was only found in one of several flow cytometry assessments of peripheral blood and bone marrow aspirate and cytogenetic analyses of bone marrow cells were normal. The patient's clinical situation has been stable for some years and treatment has not been necessary.

Serum Sclerostin in Hepatitis C Virus Infected Patients

PubMed Central

López-Prieto, Javier; Pelazas-González, Ricardo; Alemán-Valls, M.Remedios; José de la Vega-Prieto, María; Jorge-Ripper, Carlos; Durán-Castellón, M. Carmen; Santolaria-Fernández, F

2014-01-01

Background Sclerostin inhibits osteoblast functions, differentiations, and survival rates. As an endogenous inhibitor of the Wnt/β-catenin pathway, the sclerostin should be related to decreased bone masses, although several studies indicate opposite results. In addition, it may be related to insulin resistances and carbohydrate metabolisms, a relation shared with other markers of bone metabolisms, such as osteocalcin. Hepatitis C virus (HCV) infected patients may present osteoporosis, and frequently show liver steatosis, which is a consequence of insulin resistance. The behaviour of sclerostin in these patients is yet unknown. The aim of this work is to analyse the relationships between serum sclerostin and osteocalcin levels and bone mineral density (BMD), liver functions, the intensity of liver steatosis and biochemical markers of bone homeostasis and insulin resistance in HCV-infected patients. Methods Forty HCV patients with 20 years of age and gender-matching controls were included in this study and underwent bone densitometry. Serum sclerostin, osteocalcin, collagen telopeptide, adiponectin, leptin, insulin, resistin, tumor necrosis factor (TNF)-α, and interleukin (IL)-6 were determined. Liver fat was histomorphometrically assessed. Results Sclerostin levels were slightly higher in patients than in controls, and were directly related to BMD at different parts of the skeleton, also to the serum telopeptide, and to the liver steatosis and TNF-α. On the contrary, osteocalcin showed a significant direct relationship with serum adiponectin, and an inverse one with IL-6. Conclusions Serum sclerostin levels were within the normal range in HCV patients, and correlated directly with BMD and serum telopeptide. In addition, the relationships of sclerostin and osteocalcin with variables associated with insulin resistance suggested the role of bones for intermediary metabolisms. PMID:24707469

Body mass index and bone loss among postmenopausal women: the 10-year follow-up of the OSTPRE cohort.

PubMed

Saarelainen, Jarmo; Kiviniemi, Vesa; Kröger, Heikki; Tuppurainen, Marjo; Niskanen, Leo; Jurvelin, Jukka; Honkanen, Risto

2012-03-01

Obesity protects against osteoporosis, but the magnitude of this association has been difficult to assess from cross-sectional or short term studies. We examined the time course of bone loss as a function of body mass index (BMI) in early and late postmenopausal women. Our study population (n = 300) was a random sample of the population-based Kuopio Osteoporosis Risk Factor and Prevention (OSTPRE) Study, Finland. We excluded women without complete BMD results, premenopausal women during the second bone densitometry and women who had used hormone replacement therapy, bisphosphonates or calcitonin. BMI along with femoral neck and spinal bone mineral density (BMD) were assessed three times by dual-energy X-ray absorptiometry during a mean follow-up of 10.5 years (SD 0.5). The mean baseline age was 53.6 years (SD 2.8), time since menopause 2.9 years (SD 4.3) and BMI 27.3 kg/m(2) (SD 4.4). The data was analyzed by linear mixed models. Thus, we were able to approximate the bone loss up to 20 postmenopausal years. To illustrate, a woman with a baseline BMI of 20 kg/m(2) became osteopenic 2 (spine) and 4 (femoral neck) years after menopause, while obesity (BMI of 30 kg/m(2)) delayed the incidence of osteopenia by 5 (spine) and 9 (femoral neck) years, respectively. The delay was due to high baseline BMD of the obese, while bone loss rate was similar for both lean and obese subjects. This lean versus obese difference may also be partly due to altered X-ray attenuation due to fat mass.

Alveolar bone healing process in spontaneously hypertensive rats (SHR). A radiographic densitometry study

PubMed Central

MANRIQUE, Natalia; PEREIRA, Cassiano Costa Silva; GARCIA, Lourdes Maria Gonzáles; MICARONI, Samuel; de CARVALHO, Antonio Augusto Ferreira; PERRI, Sílvia Helena Venturoli; OKAMOTO, Roberta; SUMIDA, Doris Hissako; ANTONIALI, Cristina

2012-01-01

Hypertension is one of the most important public health problems worldwide. If undiagnosed or untreated, this pathology represents a systemic risk factor and offers unfavorable conditions for dental treatments, especially those requiring bone healing. Objectives The purpose of this study was to demonstrate, by analysis of bone mineral density (BMD), that the alveolar bone healing process is altered in spontaneously hypertensive rats (SHRs). Material and Methods Wistar rats and SHRs were submitted to extraction of the upper right incisor and were euthanized 7, 14, 21, 28 and 42 days after surgery. Right maxillae were collected, radiographed and analyzed using Digora software. BMD was expressed as minimum (min), middle (med) and maximum (max) in the medium (MT) and apical (AT) thirds of the dental alveolus. Results The results were compared across days and groups. Wistar showed difference in med and max BMD in the MT between 7 and 28 and also between 14 and 28 days. The AT exhibited significant difference in med and min BMD between 7 and 28 days, as well as difference in min BMD between 28 and 42 days. SHRs showed lower med BMD in the MT at 28 days when compared to 21 and 42 days. Differences were observed across groups in med and min BMD at day 28 in the MT and AT; and in max BMD at 14, 21 and 42 days in the MT. Conclusions These results suggest that the alveolar bone healing process is delayed in SHRs comparing with Wistar rats. PMID:22666841

Protective effect of myo-inositol hexaphosphate (phytate) on bone mass loss in postmenopausal women.

PubMed

López-González, Angel A; Grases, Félix; Monroy, Nieves; Marí, Bartolome; Vicente-Herrero, Ma Teófila; Tur, Fernando; Perelló, Joan

2013-03-01

The objective of this paper was to evaluate the relationship between urinary concentrations of InsP6, bone mass loss and risk fracture in postmenopausal women. A total of 157 postmenopausal women were included in the study: 70 had low (≤0.76 μM), 42 intermediate (0.76-1.42 μM) and 45 high (≥1.42 μM) urinary phytate concentrations. Densitometry values for neck were measured at enrollment and after 12 months (lumbar spine and femoral neck), and 10-year risk fracture was calculated using the tool FRAX(®). Individuals with low InsP6 levels had significantly greater bone mass loss in the lumbar spine (3.08 ± 0.65 % vs. 0.43 ± 0.55 %) than did those with high phytate levels. Moreover, a significantly greater percentage of women with low than with high InsP6 levels showed more than 2 % of bone mass loss in the lumbar spine (55.6 vs. 20.7 %). The 10-year fracture probability was also significantly higher in the low-phytate group compared to the high-phytate group, both in hip (0.37 ± 0.06 % vs 0.18 ± 0.04 %) and major osteoporotic fracture (2.45 ± 0.24 % vs 1.83 ± 0.11 %). It can be concluded that high urinary phytate concentrations are correlated with reduced bone mass loss in lumbar spine over 12 months and with reduced 10-year probability of hip and major osteoporotic fracture, indicating that increased phytate consumption can prevent development of osteoporosis.

Falls, fractures and bone density in Parkinson's disease - a cross-sectional study.

PubMed

Tassorelli, Cristina; Berlangieri, Mariangela; Buscone, Simona; Bolla, Monica; De Icco, Roberto; Baricich, Alessio; Pacchetti, Claudio; Cisari, Carlo; Sandrini, Giorgio

2017-04-01

Evidence suggests that falls and associated bone fractures are more frequent in patients suffering from Parkinson's disease (PD) than in the general population. In this cross-sectional study we evaluated the clinical and biochemical characteristics that are associated to falls, fractures and bone health in a population of PD subjects. Forty-two consecutive subjects suffering from idiopathic PD (mild-to-moderate severity) with/without falls in the previous year were included. They were characterized as regards functional independence, balance, fear of falling, bone density (ultrasound densitometry) and plasma levels of vitamin D. Twenty-one age- and sex-matched healthy subjects were evaluated as controls. We detected a greater degree of osteoporosis in PD subjects as compared to controls, more pronounced in males than in females (Z-score: M -3.8 ± 1.6, F -2.28 ± 0.92, p = 0.0006). A positive correlation was found between independence levels and bone density or vitamin D levels. Twenty seven patients (64%) reported falls in the previous year. These were associated to post-traumatic fractures in 16 subjects (59% of fallers). Women fell more than men (fallers: 20 F/7 M; non fallers: 4 F/11 M, χ² test p = 0.02), although the occurrence of post-traumatic fractures among fallers did not differ between sexes (F 11/9, M 5/2, χ² test p > 0.05). Fallers with post-traumatic fractures showed higher degrees of motor impairment. These findings confirm that falls and osteoporosis represent major health issues in PD, already in the middle stages of disease.

Mathematical modeling of bone marrow--peripheral blood dynamics in the disease state based on current emerging paradigms, part I.

PubMed

Afenya, Evans K; Ouifki, Rachid; Camara, Baba I; Mundle, Suneel D

2016-04-01

Stemming from current emerging paradigms related to the cancer stem cell hypothesis, an existing mathematical model is expanded and used to study cell interaction dynamics in the bone marrow and peripheral blood. The proposed mathematical model is described by a system of nonlinear differential equations with delay, to quantify the dynamics in abnormal hematopoiesis. The steady states of the model are analytically and numerically obtained. Some conditions for the local asymptotic stability of such states are investigated. Model analyses suggest that malignancy may be irreversible once it evolves from a nonmalignant state into a malignant one and no intervention takes place. This leads to the proposition that a great deal of emphasis be placed on cancer prevention. Nevertheless, should malignancy arise, treatment programs for its containment or curtailment may have to include a maximum and extensive level of effort to protect normal cells from eventual destruction. Further model analyses and simulations predict that in the untreated disease state, there is an evolution towards a situation in which malignant cells dominate the entire bone marrow - peripheral blood system. Arguments are then advanced regarding requirements for quantitatively understanding cancer stem cell behavior. Among the suggested requirements are, mathematical frameworks for describing the dynamics of cancer initiation and progression, the response to treatment, the evolution of resistance, and malignancy prevention dynamics within the bone marrow - peripheral blood architecture. Copyright © 2016 Elsevier Inc. All rights reserved.

Qualitative identification of rigid gas permeable contact lens materials by densitometry.

PubMed

Arce, C G; Schuman, P D; Schuman, W P

1999-10-01

We describe a practical method to qualitatively identify polymethylmethacrylate (PMMA) and rigid gas permeable (RGP) contact lens materials. By progressive dilution of a saturated saline solution made with distilled or tap water and sodium chloride, we recorded comparative densitometry of rigid contact lens materials using a small hydrometer or by liquid displacement. The method was sensitive enough to separate the polymethylmethacrylate, all silicon-methacrylates, and all but two fluorine-containing silicon-methacrylates. The hydrometer had a precision of three decimals rounded to the nearest 0.005. There was only one RGP product that could have been confused with the PMMA material. Most silicon-methacrylates had lower densities than fluorine containing silicon-methacrylates. Only four of 25 products under 1.117 gm/cm3 contained fluorine. Densitometry with a hydrometer is an effective non-destructive method to identify RGP materials and to verify their quality. The method is easier when lens blanks are tested, but in spite of differences in shape, size, and weight, densitometry may also be used with new or used contact lenses. Its simplicity and low cost makes densitometry feasible for any contact lens laboratory or clinic to use on a routine basis. Only silicon-methacrylates had an inverse relationship between density and oxygen permeability. As the silicon content of the contact lens increases, the Dk increases and the density decreases.

Highly sensitive MYD88L265P mutation detection by droplet digital PCR in Waldenström Macroglobulinemia.

PubMed

Drandi, Daniela; Genuardi, Elisa; Dogliotti, Irene; Ferrante, Martina; Jiménez, Cristina; Guerrini, Francesca; Lo Schirico, Mariella; Mantoan, Barbara; Muccio, Vittorio; Lia, Giuseppe; Zaccaria, Gian Maria; Omedè, Paola; Passera, Roberto; Orsucci, Lorella; Benevolo, Giulia; Cavallo, Federica; Galimberti, Sara; García-Sanz, Ramón; Boccadoro, Mario; Ladetto, Marco; Ferrero, Simone

2018-03-22

We here describe a novel method for MYD88 L265P mutation detection and minimal residual disease monitoring in Waldenström Macroglobulinemia, by droplet digital PCR, in bone marrow and peripheral blood cells, as well as in circulating cell free DNA. Our method shows a sensitivity of 5.00E-05, by far superior to the widely used allele-specific polymerase chain reaction (1.00E-03). Overall, 291 unsorted samples from 148 patients (133 Waldenstrom 11 IgG-lymphoplasmacytic lymphoma and 4 IgM-monoclonal gammopathy of undetermined significance), 194 baseline and 97 follow-up, were analyzed. 122/128 (95.3%) bone marrow and 47/66 (71.2%) baseline peripheral blood samples scored positive for MYD88 L265P Moreover, to investigate whether MYD88 L265P by droplet digital PCR could be used for minimal residual disease monitoring, mutation levels were compared with IGH-based minimal residual disease analysis in 10 patients, showing to be as informative as to the classical, standardized but not yet validated in Waldenström Macroglobulinemia, IGH-based minimal residual disease assay (r 2 =0.64). Finally, MYD88 L265P detection performed by droplet digital PCR on plasmatic circulating tumor DNA from 60 patients showed a good correlation with bone marrow (bone marrow median mutational value 1.92E-02, plasmatic circulating tumor DNA value: 1.4E-02, peripheral blood value: 1.03E-03). This study indicates that droplet digital PCR MYD88 L265P assay is a feasible and sensitive tool for mutational screening and minimal residual disease monitoring in Waldenström Macroglobulinemia. Both unsorted bone marrow and peripheral blood samples can be reliably tested, as well as circulating tumor DNA, that represents an attractive, less invasive alternative to bone marrow for MYD88 L265P detection. Copyright © 2018, Ferrata Storti Foundation.

Protective effects of total saponins from stem and leaf of Panax ginseng against cyclophosphamide-induced genotoxicity and apoptosis in mouse bone marrow cells and peripheral lymphocyte cells.

PubMed

Zhang, Qiu Hua; Wu, Chun Fu; Duan, Lian; Yang, Jing Yu

2008-01-01

Cyclophosphamide (CP), commonly used anti-cancer, induces oxidative stress and is cytotoxic to normal cells. It is very important to choice the protective agent combined CP to reduce the side effects in cancer treatment. Ginsenosides are biological active constituents of Panax ginseng C.A. Meyer that acts as the tonic agent for the cancer patients to reduce the side effects in the clinic application. Because CP is a pro-oxidant agent and induces oxidative stress by the generation of free radicals to decrease the activities of anti-oxidant enzymes, the protective effects of the total saponins from stem and leaf of P. ginseng C.A. Meyer (TSPG) act as an anti-oxidant agent against the decreased anti-oxidant enzymes, the genotoxicity and apoptosis induced by CP was carried out. The alkaline single cell gel electrophoresis was employed to detect DNA damage; flow cytometry assay and AO/EB staining assay were employed to measure cell apoptosis; the enzymatic anti-oxidants (T-SOD, CAT and GPx) and non-enzymatic anti-oxidant (GSH) were measured by the various colorimetric methods. CP induced the significant DNA damage in mouse peripheral lymphocytes in time- and dose-dependent manners, inhibited the activities of T-SOD, GPx and CAT, and decreased the contents of GSH in mouse blood, triggered bone marrow cell apoptosis at 6 and 12h. TSPG significantly reduced CP-induced DNA damages in bone marrow cells and peripheral lymphocyte cells, antagonized CP-induced reduction of T-SOD, GPx, CAT activities and the GSH contents, decreased the bone marrow cell apoptosis induced by CP. TSPG, significantly reduced the genotoxicity of CP in bone marrow cells and peripheral lymphocyte cells, and decreased the apoptotic cell number induced by CP in bone marrow cells. The effects of TSPG on T-SOD, GPx, CAT activities and GSH contents might partially contribute to its protective effects on CP-induced cell toxicities.

High activity Rhenium-186 HEDP with autologous peripheral blood stem cell rescue: a phase I study in progressive hormone refractory prostate cancer metastatic to bone

PubMed Central

O'Sullivan, J M; McCready, V R; Flux, G; Norman, A R; Buffa, F M; Chittenden, S; Guy, M; Pomeroy, K; Cook, G; Gadd, J; Treleaven, J; Al-Deen, A; Horwich, A; Huddart, R A; Dearnaley, D P

2002-01-01

We tested the feasibility and toxicity of high activities Rhenium-186 hydroxyethylidene diphosphonate, with peripheral blood stem cell rescue in patients with progressive hormone refractory prostate cancer metastatic to bone. Twenty-five patients received between 2500 and 5000 MBq of Rhenium-186 hydroxyethylidene diphosphonate followed 14 days later by the return of peripheral blood peripheral blood stem cells. Activity limiting toxicity was defined as grade III haematological toxicity, lasting at least 7 days, or grade IV haematological toxicity of any duration or any serious unexpected toxicity. Activity limiting toxicity occurred in two of six who received activities of 5000 MBq and maximum tolerated activity was defined at this activity level. Prostate specific antigen reductions of 50% or more lasting at least 4 weeks were seen in five of the 25 patients (20%) all of whom received more than 3500 MBq of Rhenium-186 hydroxyethylidene diphosphonate. The actuarial survival at 1 year is 54%. Administered activities of 5000 MBq of Rhenium-186 hydroxyethylidene diphosphonate are feasible using autologous peripheral blood peripheral blood stem cell rescue in patients with progressive hormone refractory prostate cancer metastatic to bone. The main toxicity is thrombocytopaenia, which is short lasting. A statistically significant activity/prostate specific antigen response was seen. We have now commenced a Phase II trial to further evaluate response rates. British Journal of Cancer (2002) 86, 1715–1720. doi:10.1038/sj.bjc.6600348 www.bjcancer.com © 2002 Cancer Research UK PMID:12087455

Dairy food intake, peripheral bone structure, and muscle mass in elderly ambulatory women.

PubMed

Radavelli-Bagatini, Simone; Zhu, Kun; Lewis, Joshua R; Prince, Richard L

2014-07-01

Previous studies suggest that dairy intake may be associated with reduced bone and muscle loss with aging, but there are limited data in the very old. We evaluated the association between intake of dairy foods and peripheral bone structure and muscle mass in 564 elderly women aged 80 to 92 (mean 84.7) years, who were participants of the Calcium Intake Fracture Outcome Study/CAIFOS Aged Extension Study (CAIFOS/CARES) cohort and attended the 10-year follow-up. Assessments included dairy consumption (milk, yogurt, and cheese) by a validated food frequency questionnaire, 15% tibia bone mass, area and volumetric bone mineral density (vBMD) by peripheral quantitative computed tomography (pQCT), and appendicular bone and skeletal muscle mass by dual-energy X-ray absorptiometry (DXA). Women were categorized according to tertiles of dairy intake: first tertile (≤ 1.5 servings/d), second tertile (1.5 to 2.2 servings/d) and third tertile (≥ 2.2 servings/d). Controlling for confounding factors, pQCT assessment at the 15% tibia showed that compared with those in the first tertile of dairy intake, women in the third tertile had 5.7% greater total bone mass (p = 0.005), principally because of an increase in cortical and subcortical bone mass (5.9%, p = 0.050), resulting in a 6.2% increase in total vBMD (p = 0.013). Trabecular but not cortical and subcortical vBMD was also higher (7.8%, p = 0.044). DXA assessment showed that women in the third tertile of dairy intake had greater appendicular bone mass (7.1%, p = 0.007) and skeletal muscle mass (3.3%, p = 0.014) compared with tertile 1. The associations with bone measures were dependent on dairy protein and calcium intakes, whereas the association with appendicular muscle mass was not totally dependent on dairy protein intake. Our results suggest a positive association of dairy intake with appendicular bone mineralization and muscle mass in elderly women. Because many fractures in this age group are of the appendicular skeleton often associated with falls, dairy intake may be a modifiable lifestyle factor contributing to healthy aging. © 2014 American Society for Bone and Mineral Research.

Infant formula promotes bone growth in neonatal piglets by enhancing osteoblastogenesis through bone morphogenic protein signaling

USDA-ARS?s Scientific Manuscript database

Relatively few studies have examined the effects of formula feeding relative to breast-feeding on bone in the neonate. Using peripheral quantitative CT scan and histomorphometric analysis, we demonstrated that neonatal piglets fed with soy-based formula (SF) and cow milk-based formula (MF) for 21 or...

Assessment of bone in Ehlers Danlos syndrome by ultrasound and densitometry.

PubMed

Dolan, A L; Arden, N K; Grahame, R; Spector, T D

1998-10-01

Ehlers Danlos syndrome (EDS) is an inherited disorder of connective tissue characterised by hyperextensible skin, joint laxity, and easy bruising. There are phenotypic similarities with osteogenesis imperfecta, but in EDS a tendency to fracture or altered bone mass has not previously been considered to be a cardinal feature. This case-control design study investigates whether 23 patients with EDS had differences in fracture rates, bone mass, and calcaneal ultrasound parameters compared with age and sex matched controls. 23 cases of EDS (mean (SD) age 38.5 (15.5)) were compared with 23 controls (mean age 37.8 (14.5)). A significant reduction in bone density measured by dual energy x ray absorptiometry was found at the neck of femur by 0.9 SD, p = 0.05, and lumbar spine by 0.74 SD, p = 0.02. At the calcaneum, broad band ultrasound attenuation and speed of sound were significantly reduced compared with controls by 0.95 SD (p = 0.004) and 0.49 SD (p = 0.004) for broad band ultrasound attenuation and speed of sound respectively. Broad band ultrasound attenuation and speed of sound remained significantly reduced after adjusting for bone mineral density (BMD). After adjusting for functional status (HAQ), age and sex, hypermobility was inversely correlated with broad band ultrasound attenuation and SOS, but not BMD at hip or spine. Previous fracture was 10 times more common in EDS (p < 0.001), with 86.9% of patients reporting a total of 47 low impact fractures, compared with 8.7% of controls. This study has identified a tendency of EDS patients to fracture, have low bone mass and abnormal bone structure. The aetiology is likely to be multifactorial, with an inherited structural element, accentuated by immobility or reduced exercise. This is one of the first clinical studies to suggest ultrasound can detect structural differences in bone, independent of dual energy x ray absorptiometry.

Low-dose combined oral contraceptive use is associated with lower bone mineral content variation in adolescents over a 1-year period.

PubMed

Biason, Talita Poli; Goldberg, Tamara Beres Lederer; Kurokawa, Cilmery Suemi; Moretto, Maria Regina; Teixeira, Altamir Santos; Nunes, Hélio Rubens de Carvalho

2015-04-03

Low-dose combined oral contraceptives (COCs) can interfere with bone mass acquisition during adolescence. This study aimed to evaluate bone mineral density (BMD) and bone mineral content (BMC) in female adolescents taking a standard low-dose COC (ethinylestradiol 20 μg/desogestrel 150 μg) over a 1-year period and to compare their data with those of healthy adolescents from the same age group not taking COCs. This was a non-randomized parallel-control study with a 1-year follow-up. Sixty-seven adolescents aged from 12 to 19 years, divided into COC users (n = 41) taking 20 μg ethinylestradiol/150 μg desogestrel and COC non-user controls (n = 26), were evaluated by bone densitometry examinations at baseline and after 12 months. Comparisons between the groups at the study onset were performed using the Mann-Whitney test with the significance level fixed at 5% or p < 0.05. Comparisons between the groups at the study onset and after 12 months were based on variations in the median percentages for bone mass variables. The COC users presented with low bone mass acquisition in the lumbar spine, and had BMD and BMC median variations of 2.07% and +1.57%, respectively, between the measurements at baseline and 12 months. The control group had median variations of +12.16% and +16.84% for BMD and BMC, respectively, over the same period. The total body BMD and BMC showed similar evolutions during the study in both groups. Statistical significance (p < 0.05) was seen for the BMC percentage variation between COC users and non-users. Use of a low-dose COC (ethinylestradiol 20 μg/desogestrel 150 μg) was associated with lower bone mass acquisition in adolescents during the study period. Registry Number, RBR-5h9b3c.

The Effect of Changing Scan Mode on Trabecular Bone Score Using Lunar Prodigy.

PubMed

Chen, Weiwen; Slattery, Anthony; Center, Jacqueline; Pocock, Nicholas

2016-10-01

Trabecular bone score (TBS) is a measure of gray scale homogeneity that correlates with trabecular microarchitecture and is an independent predictor of fracture risk. TBS is being increasingly used in the assessment of patients at risk of osteoporosis and has recently been incorporated into FRAX ® . GE Lunar machines acquire spine scans using 1 of 3 acquisition modes depending on abdominal tissue thickness (thin, standard, and thick). From a database review, 30 patients (mean body mass index: 30.8, range 26.2-34.1) were identified who had undergone lumbar spine DXA scans (GE Lunar Prodigy, software 14.10; Lunar Radiation Corporation, Madison, WI) in both standard mode and thick mode, on the same day with no repositioning. Lumbar spine bone mineral density (L1-L4) and TBS were derived from the 30 paired spine scans. There was no significant difference in lumbar spine bone mineral density between the 2 scanning modes. There were, however, significant higher TBS values from the spine scans acquired in thick mode compared to the TBS values derived from spine acquisitions in standard mode (mean TBS difference: 0.24 [20%], standard deviation ±0.10). In conclusion, these preliminary data suggest that TBS values acquired in the GE Lunar Prodigy are dependent on the scanning mode used. Further evaluation is required to confirm the cause and develop appropriate protocols. Copyright © 2016 International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

[INVESTIGATION OF THE LEVEL OF MINERAL DENSITY OF SKELETAL OSSEOUS TISSUE IN PATIENTS WITH PERIODONTAL TISSUE DISEASES].

PubMed

Hodovana, O I

2015-01-01

Results of investigation of mineral density condition of skeletal osseous tissue in patients with inflammatory and dystrophic-inflammatory diseases of periodontal tissues with ultrasound densitometry method have been presented. Various changes of osseous tissue of skeletal bones have been detected: osteopenia, osteoporosis and osteosclerosis, which correlated with the severity of pathological process in periodontium. Analysis of the obtained results has been carried out depending on patients' sex as well as form and severity degree of the course of periodontal diseases. It has been established that the peak of detected impairments of mineral density in the skeleton is due to osteopenia, the degree of severity of which deteriorates with the severity of pathological process in periodontal tissues, especially in women.

Bone strength measured by peripheral quantitative computed tomography and the risk of nonvertebral fractures: the osteoporotic fractures in men (MrOS) study.

PubMed

Sheu, Yahtyng; Zmuda, Joseph M; Boudreau, Robert M; Petit, Moira A; Ensrud, Kristine E; Bauer, Douglas C; Gordon, Christopher L; Orwoll, Eric S; Cauley, Jane A

2011-01-01

Many fractures occur in individuals without osteoporosis defined by areal bone mineral density (aBMD). Inclusion of other aspects of skeletal strength may be useful in identifying at-risk subjects. We used surrogate measures of bone strength at the radius and tibia measured by peripheral quantitative computed tomography (pQCT) to evaluate their relationships with nonvertebral fracture risk. Femoral neck (FN) aBMD, measured by dual-energy X-ray absorptiometry (DXA), also was included. The study population consisted of 1143 white men aged 69+ years with pQCT measures at the radius and tibia from the Minneapolis and Pittsburgh centers of the Osteoporotic Fractures in Men (MrOS) study. Principal-components analysis and Cox proportional-hazards modeling were used to identify 21 of 58 pQCT variables with a major contribution to nonvertebral incident fractures. After a mean 2.9 years of follow-up, 39 fractures occurred. Men without incident fractures had significantly greater bone mineral content, cross-sectional area, and indices of bone strength than those with fractures by pQCT. Every SD decrease in the 18 of 21 pQCT parameters was significantly associated with increased fracture risk (hazard ration ranged from 1.4 to 2.2) independent of age, study site, body mass index (BMI), and FN aBMD. Using area under the receiver operation characteristics curve (AUC), the combination of FN aBMD and three radius strength parameters individually increased fracture prediction over FN aBMD alone (AUC increased from 0.73 to 0.80). Peripheral bone strength measures are associated with fracture risk and may improve our ability to identify older men at high risk of fracture. © 2011 American Society for Bone and Mineral Research.

[Morphofunctional properties of the peripheral blood and bone marrow cells of rats following a flight on board the Kosmos-936 biosatellite].

PubMed

Kozinets, G I; Korol'kov, V I; Britvan, I I; Bykova, I A; Spitsyna, N E

1983-01-01

Morphofunctional properties of peripheral blood cells of Cosmos-936 rats were examined, using morphological, interferometric and electron microscopic techniques. As follows from the morphological data, immediately after recovery the weightless rats showed symptoms of a stress reaction which disappeared by R+3. The centrifuged rats exhibited less expressed symptoms of this sort. The percentage of bone marrow cell distribution was shifted towards enhanced myelopoiesis and diminished erythropoiesis. By the end of the readaptation period the ratio of bone marrow cell composition returned to normal. Interferometric and electron microscopic examinations did not reveal any irreversible changes in the structure and function of cells that may be caused by zero-g.

Bone Mineral Changes in Epilepsy Patients During Initial Years of Antiepileptic Drug Therapy.

PubMed

Shiek Ahmad, Baemisla; O'Brien, Terence John; Gorelik, Alexandra; Hill, Keith David; Wark, John Dennis

2016-10-01

Antiepileptic drug (AED) therapy is associated with decreased bone mineral density; however, the time course for this development is unclear. The aim of this study was to evaluate bone mineral changes during the initial years of AED therapy in AED-naive, newly diagnosed epilepsy patients compared with non-AED users. In 49 epilepsy patients newly started on AEDs and in 53 non-AED users of both genders, bone mineral density (BMD) and bone mineral content were measured using dual-energy X-ray absorptiometry at baseline (within the first year of therapy) and at least 1 yr later. Bone changes between the 2 assessments, adjusted for age, height, and weight, were calculated as the annual rate of change. The median duration of AED therapy was 3.5 mo at baseline and 27.6 mo at follow-up. No overall difference was found in mean BMD and bone mineral content measures between user and nonuser cohorts in both cross-sectional baseline and the annual rate of change (p > 0.05). However, users on carbamazepine monotherapy (n = 11) had an increased annual rate of total hip (-2.1% vs -0.8%, p = 0.020) and femoral neck BMD loss (-2.1% vs -0.6%, p = 0.032) compared to nonusers. They also had a marginally higher rate of femoral neck BMD loss (-2.1%, p = 0.049) compared with valproate (-0.1%, n = 13) and levetiracetam users (+0.6%, n = 13). During the initial years of AED treatment for epilepsy, no difference was found in bone measures between AED users as a group and nonuser cohorts. However, the data suggested that carbamazepine monotherapy was associated with increased bone loss at the hip regions, compared to users of levetiracetam or valproate and nonusers. Larger studies of longer duration are warranted to better delineate the bone effects of specific AEDs, with further consideration of the role of early dual-energy X-ray absorptiometry scanning and careful AED selection in potentially minimizing the impact on bone health in these patients. Copyright © 2016 International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Childhood Forearm Breaks Resulting from Mild Trauma May Indicate Bone Deficits

MedlinePlus

... a powerful new technology called high-resolution peripheral quantitative computed tomography (HRpQCT), which, unlike DXA, can assess ... persist throughout life. The investigators concluded that additional research is needed to determine if childhood bone weakness ...

Event-free survival of infants and toddlers enrolled in the HR-NBL-1/SIOPEN trial is associated with the level of neuroblastoma mRNAs at diagnosis.

PubMed

Corrias, Maria V; Parodi, Stefano; Tchirkov, Andrei; Lammens, Tim; Vicha, Ales; Pasqualini, Claudia; Träger, Catarina; Yáñez, Yania; Dallorso, Sandro; Varesio, Luigi; Luksch, Roberto; Laureys, Genevieve; Valteau-Couanet, Dominique; Canete, Adela; Pöetschger, Ulrike; Ladenstein, Ruth; Burchill, Susan A

2018-07-01

The purpose of this study was to evaluate whether levels of neuroblastoma mRNAs in bone marrow and peripheral blood from stage M infants (≤12 months of age at diagnosis, MYCN amplified) and toddlers (between 12 and 18 months, any MYCN status) predict event-free survival (EFS). Bone marrow aspirates and peripheral blood samples from 97 infants/toddlers enrolled in the European High-Risk Neuroblastoma trial were collected at diagnosis in PAXgene ™ blood RNA tubes. Samples were analyzed by reverse transcription quantitative polymerase chain reaction according to standardized procedures. Bone marrow tyrosine hydroxylase (TH) or paired-like homeobox 2b (PHOX2B) levels in the highest tertile were associated with worse EFS; hazard ratios, adjusted for age and MYCN status, were 1.5 and 1.8 respectively. Expression of both TH and PHOX2B in the highest tertile predicted worse outcome (p = 0.015), and identified 20 (23%) infants/toddlers with 5-year EFS of 20% (95%CI: 4%-44%). Prognostic significance was maintained after adjusting for over-fitting bias (p = 0.038), age and MYCN status. In peripheral blood, PHOX2B levels in the highest tertile predicted a two-fold increased risk of an event (p = 0.032), and identified 23 (34%) infants/toddlers with 5-year EFS of 29% (95%CI: 12%-48%). Time-dependent receiver operating characteristic analysis confirmed the prognostic value of combined TH and PHOX2B in bone marrow and of PHOX2B in peripheral blood during the first year of follow-up. High levels of bone marrow TH and PHOX2B and of peripheral blood PHOX2B at diagnosis allow early identification of a group of high-risk infant and toddlers with neuroblastoma who may be candidates for alternative treatments. Integration with additional biomarkers, as well as validation in additional international trials is warranted. © 2018 Wiley Periodicals, Inc.

Association Between Insulin Resistance and Bone Structure in Nondiabetic Postmenopausal Women.

PubMed

Shanbhogue, Vikram V; Finkelstein, Joel S; Bouxsein, Mary L; Yu, Elaine W

2016-08-01

The clinical consequences of insulin resistance and hyperinsulinemia on bone remain largely unknown. The objective of the study was to evaluate the effect of insulin resistance on peripheral bone geometry, volumetric bone mineral density (vBMD), bone microarchitecture, and estimated bone strength. This cross-sectional study included 146 postmenopausal, nondiabetic Caucasian women (mean age 60.3 ± 2.7 y) who were participating in the Study of Women's Health Across the Nation. There were no interventions. High-resolution peripheral quantitative computed tomography was used to assess bone density and microstructure at the distal radius and tibia. Fasting insulin and glucose were measured and insulin resistance was estimated using homeostasis model assessment of insulin resistance (HOMA-IR), with higher values indicating greater insulin resistance. There was a negative association between HOMA-IR and bone size and a positive association between HOMA-IR and total vBMD, trabecular vBMD, trabecular thickness, and cortical thickness at the radius and tibia. These relationships remained, even after adjusting for body weight and other potential covariates (eg, time since menopause, cigarette smoking, physical activity, prior use of osteoporosis medications or glucocorticoids). In nondiabetic, postmenopausal women, insulin resistance was associated with smaller bone size, greater volumetric bone mineral density, and generally favorable bone microarchitecture at weight-bearing and nonweight-bearing skeletal sites. These associations were independent of body weight and other potential covariates, suggesting that hyperinsulinemia directly affects bone structure independent of obesity and may explain, in part, the higher trabecular bone density and favorable trabecular microarchitecture seen in individuals with type 2 diabetes mellitus.

Effect of rhythmic gymnastics on volumetric bone mineral density and bone geometry in premenarcheal female athletes and controls.

PubMed

Tournis, S; Michopoulou, E; Fatouros, I G; Paspati, I; Michalopoulou, M; Raptou, P; Leontsini, D; Avloniti, A; Krekoukia, M; Zouvelou, V; Galanos, A; Aggelousis, N; Kambas, A; Douroudos, I; Lyritis, G P; Taxildaris, K; Pappaioannou, N

2010-06-01

Weight-bearing exercise during growth exerts positive effects on the skeleton. Our objective was to test the hypothesis that long-term elite rhythmic gymnastics exerts positive effects on volumetric bone mineral density and geometry and to determine whether exercise-induced bone adaptation is associated with increased periosteal bone formation or medullary contraction using tibial peripheral quantitative computed tomography and bone turnover markers. We conducted a cross-sectional study at a tertiary center. We studied 26 elite premenarcheal female rhythmic gymnasts (RG) and 23 female controls, aged 9-13 yr. We measured bone age, volumetric bone mineral density, bone mineral content (BMC), cortical thickness, cortical and trabecular area, and polar stress strength index (SSIp) by peripheral quantitative computed tomography of the left tibia proximal to the distal metaphysis (trabecular) at 14, 38 (cortical), and 66% (muscle mass) from the distal end and bone turnover markers. The two groups were comparable according to height and chronological and bone age. After weight adjustment, cortical BMC, area, and thickness at 38% were significantly higher in RG (P < 0.005-0.001). Periosteal circumference, SSIp, and muscle area were higher in RG (P < 0.01-0.001). Muscle area was significantly associated with cortical BMC, area, and SSIp, whereas years of training showed positive association with cortical BMC, area, and thickness independent of chronological age. RG in premenarcheal girls may induce positive adaptations on the skeleton, especially in cortical bone. Increased duration of exercise is associated with a positive response of bone geometry.

[The effects of increased dietary calcium intake on bone mineral density in long-term lactating women, and recovery of bone loss caused by long-term lactation with low calcium diet].

PubMed

Yoneyama, Kyoko; Ikeda, Junko

2004-12-01

The purpose of this study was to examine the efficacy of an increased calcium (Ca) diet for preventing bone mineral loss in long-term lactating women, considering bone metabolism, and recovery of bone loss caused by long-term lactation with low dietary Ca intake. Two groups of long-term (> 12 mon.) lactating women ... one with an enhanced Ca intake (Group M, n = 22) and the other with diet feeding no cow's milk and no milk products (Group N, n = 16) ... and a control group of 21 non-lactating postpartum women (Group C) were studied. Bone mineral density (BMD) was measured by ultrasonic bone densitometry. Stiffness calculated from the combined value of speed of sound and broadband ultrasound attenuation was used as an index of BMD. BMD and bone metabolic markers in urine and serum (only M and C groups) were assessed from 1 approximately 12 weeks postpartum (initial) at six-month intervals for a maximum of two years and changes were compared among the groups. 1. The mean (+/- SD) dietary Ca intake was 1032 (209) mg/day in the M group. 2. After lactating for one year, the N group demonstrated significant decrease in BMD, with both 1 and 2 babies, whereas the M group had no significant change. 3. The BMD in the N group returned to initial levels at 0.5 approximately 1 year post-weaning, 4. In the N group, compared with the M group, the urinary Hydroxyproline/creatinine ratio was significantly higher at the initial measurement and half a year thereafter, while urinary Ca/ creatinine ratio was significantly lower after a year. However, there were no significant differences between the M and C groups. 5. Serum bone alkaline phosphatase was significantly higher in the M group compared with the C group. Bone loss during long-term lactation can be prevented with adequate dietary Ca intake. Once lost, recovery to initial levels occurs 0.5 approximately 1 year post-weaning.

Characterisation of mineralisation of bone and cartilage: X-ray diffraction and Ca and Sr K α X-ray fluorescence microscopy

NASA Astrophysics Data System (ADS)

Bradley, D. A.; Muthuvelu, P.; Ellis, R. E.; Green, E. M.; Attenburrow, D.; Barrett, R.; Arkill, K.; Colridge, D. B.; Winlove, C. P.

2007-10-01

Bone is a dynamic structure, constantly remodelling in response to changing mechanical and environmental factors. This is particularly evident in the mineral component encrusting the collagenous framework. The mineral is principally in the form of calcium apatite, but calcium can exchange with strontium, both during the cellular processes of mineralisation and resorption and by passive exchange with the deposited crystals. Mineralisation is generally characterized by densitometry, but because of the differences in absorption cross sections of calcium and strontium it can be misleading in studies of composition. In this work we have used X-ray diffraction to identify calcium and strontium apatite and X-ray fluorescence to quantify strontium and calcium distribution. With the beam characteristics available from synchrotron radiation, this has enabled us to obtain microscopic resolution on thin sections of bone and cartilage from the equine metacarpophalangeal joint. Two issues have been investigated; the first is the distribution of mineral in the bone-cartilage interface and within individual trabeculae. In trabecular bone the ratio of strontium to calcium concentration was typically 0.0035 ± 0.0020, and higher by a factor of ∼3 at the periphery than in the centre of a trabeculum (possibly reflecting the more rapid turnover of mineral in the surface layer). In the dense subchondral bone the ratio was similar, approximately doubling in the calcified cartilage. The second objective was to explore the changes in mineralisation associated with development of osteoarthrosis. We analysed lesions showing cartilage thinning and changes in the trabecular organization and density of the underlying bone. At the centre of the lesion the ratio of strontium to calcium was much lower than that in normal tissue, although the calcified cartilage still showed a higher ratio than the underlying bone. In the superficially normal tissue around the lesion the calcified cartilage returned to a normal ratio much more rapidly than the underlying bone. These data demonstrate the complex relationship between changes in cartilage and the underlying bone.

[New methods for the evaluation of bone quality. Assessment of bone structural property using imaging.

PubMed

Ito, Masako

Structural property of bone includes micro- or nano-structural property of the trabecular and cortical bone, and macroscopic geometry. Radiological technique is useful to analyze the bone structural property;multi-detector row CT(MDCT)or high-resolution peripheral QCT(HR-pQCT)is available to analyze human bone in vivo . For the analysis of hip geometry, CT-based hip structure analysis(HSA)is available as well as DXA-based HSA. These structural parameters are related to biomechanical property, and these assessment tools provide information of pathological changes or the effects of anti-osteoporotic agents on bone.

Splenic marginal zone lymphoma.

PubMed

Piris, Miguel A; Onaindía, Arantza; Mollejo, Manuela

Splenic marginal zone lymphoma (SMZL) is an indolent small B-cell lymphoma involving the spleen and bone marrow characterized by a micronodular tumoral infiltration that replaces the preexisting lymphoid follicles and shows marginal zone differentiation as a distinctive finding. SMZL cases are characterized by prominent splenomegaly and bone marrow and peripheral blood infiltration. Cells in peripheral blood show a villous cytology. Bone marrow and peripheral blood characteristic features usually allow a diagnosis of SMZL to be performed. Mutational spectrum of SMZL identifies specific findings, such as 7q loss and NOTCH2 and KLF2 mutations, both genes related with marginal zone differentiation. There is a striking clinical variability in SMZL cases, dependent of the tumoral load and performance status. Specific molecular markers such as 7q loss, p53 loss/mutation, NOTCH2 and KLF2 mutations have been found to be associated with the clinical variability. Distinction from Monoclonal B-cell lymphocytosis with marginal zone phenotype is still an open issue that requires identification of precise and specific thresholds with clinical meaning. Copyright © 2016 Elsevier Ltd. All rights reserved.

CD31+ Cells From Peripheral Blood Facilitate Bone Regeneration in Biologically Impaired Conditions Through Combined Effects on Immunomodulation and Angiogenesis.

PubMed

Sass, F Andrea; Schmidt-Bleek, Katharina; Ellinghaus, Agnes; Filter, Sebastian; Rose, Alexander; Preininger, Bernd; Reinke, Simon; Geissler, Sven; Volk, Hans-Dieter; Duda, Georg N; Dienelt, Anke

2017-05-01

Controlled revascularization and inflammation are key elements regulating endogenous regeneration after (bone) tissue trauma. Peripheral blood-derived cell subsets, such as regulatory T-helper cells and circulating (endothelial) progenitor cells, respectively, can support endogenous tissue healing, whereas effector T cells that are associated with an aged immune system can hinder bone regeneration. CD31 is expressed by diverse leukocytes and is well recognized as a marker of circulating endothelial (precursor) cells; however, CD31 is absent from the surface of differentiated effector T cells. Thus, we hypothesized that by separating the inhibitory fractions from the supportive fractions of circulating cells within the peripheral blood (PB) using the CD31 marker, bone regeneration in biologically compromised conditions, such as those observed in aged patients, could be improved. In support of our hypothesis, we detected an inverse correlation between CD31+ cells and effector T cells in the hematomas of human fracture patients, dependent on the age of the patient. Furthermore, we demonstrated the regenerative capacity of human PB-CD31+ cells in vitro. These findings were translated to a clinically relevant rat model of impaired bone healing. The transplantation of rat PB-CD31+ cells advanced bone tissue restoration in vivo and was associated with an early anti-inflammatory response, the stimulation of (re)vascularization, and reduced fibrosis. Interestingly, the depletion or enrichment of the highly abundant CD31+/14+ monocytes from the mixed CD31+ cell population diminished tissue regeneration at different levels, suggesting combined effects within the PB-CD31+ subsets. In summary, an intraoperative enrichment of PB-CD31+ cells might be a novel option to facilitate endogenous regeneration under biologically impaired situations by supporting immunomodulation and vascularization. © 2016 American Society for Bone and Mineral Research. © 2016 American Society for Bone and Mineral Research.

Combat sports practice favors bone mineral density among adolescent male athletes.

PubMed

Nasri, Raouf; Hassen Zrour, Saoussen; Rebai, Haithem; Neffeti, Fadoua; Najjar, Mohamed Fadhel; Bergaoui, Naceur; Mejdoub, Hafedh; Tabka, Zouhair

2015-01-01

The aim of this study was to determine the impact of combat sports practice on bone mineral density (BMD) and to analyze the relationship between bone parameters and anthropometric measurements, bone markers, and activity index (AI). In other words, to detect the most important determinant of BMD in the adolescent period among combat sports athletes. Fifty athletes engaged in combat sports, mean age 17.1±0.2 yr, were compared with 30 sedentary subjects who were matched for age, height, and pubertal stage. For all subjects, the whole-body BMD, lumbar spine BMD (L2-L4), and BMD in the pelvis, arms, and legs was measured by dual-energy X-ray absorptiometry, and anthropometric measurements were evaluated. Daily calcium intake, bone resorption, and formation markers were measured. BMD measurements were greater in the combat sports athletes than in the sedentary group (p<0.01). Weight, body mass index, and lean body mass were significantly correlated with BMD in different sites. Daily calcium consumption lower than daily calcium intake recommended in both athletes and sedentary group. AI was strongly correlated with all BMD measurements particularly with the whole body, legs, and arms. Negative correlations were observed between bone markers and BMD in different sites. The common major predictor of BMD measurements was AI (p<0.0001). AI associated to lean body mass determined whole-body BMD until 74%. AI explained both BMD in arms and L2-L4 at 25%. AI associated to height can account for 63% of the variance in BMD legs. These observations suggested that the best model predicting BMD in different sites among adolescent combat sports athletes was the AI. Children and adolescents should be encouraged to participate in combat sports to maximize their bone accrual. Copyright © 2015 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Interpretation and use of FRAX in clinical practice - position paper of the International Osteoporosis Foundation and the International Society for Clinical Densitometry

USDA-ARS?s Scientific Manuscript database

The International Osteoporosis Foundation (IOF) and the International Society for Clinical Densitometry (ISCD) appointed a joint Task Force to develop resource documents in order to make recommendations on how to improve FRAX and better inform clinicians who use FRAX. The Task Force met in November...

Role of ghrelin and insulin-like growth factor binding protein-3 in the development of osteoporosis in inflammatory bowel disease.

PubMed

Koutroubakis, Ioannis E; Zavos, Christos; Damilakis, John; Papadakis, Georgios; Neratzoulakis, John; Karkavitsas, Nikolaos; Kouroumalis, Elias A

2011-07-01

A high prevalence of bone loss is observed in patients with inflammatory bowel disease (IBD). Leptin, ghrelin, insulin-like growth factor (IGF)-1, and IGF binding protein (IGFBP)-3 have been suggested to interfere in the bone metabolism. The aim of this study was to investigate the role of these peptides in the development of osteoporosis in IBD. One hundred and eighteen consecutive IBD patients were included. All patients underwent bone densitometry by dual energy x-ray absorptiometry at the femoral neck and lumbar spine levels. Serum samples were collected from all patients and analyzed for concentrations of the aforementioned peptides by radioimmunoassay. Forty (33.9%) patients were normal, 55 (46.6%) were osteopenic, and 23 (19.5%) were osteoporotic. Positive statistically significant correlations were found between body mass index (BMI), leptin, IGFBP-3 levels, and the bone mineral density (BMD) of the femoral neck and lumbar spine. Moreover, an inverse statistically significant correlation was found between BMD of the femoral neck and the lumbar spine, and age, duration of the disease, and ghrelin levels. Multivariate analysis revealed that the most significant factors associated with the BMD were age and BMI. A weak but statistically significant correlation was found between IGFBP-3 and femoral neck BMD (P=0.045) and between ghrelin and spine BMD (P=0.039). No correlation was observed between leptin and BMD. Low BMI is the most important independent risk factor for osteoporosis in IBD patients. There is no independent influence of leptin but ghrelin and IGFBP-3 may play a role in the bone metabolism in the IBD.

Use of cone beam computed tomography in identifying postmenopausal women with osteoporosis.

PubMed

Brasileiro, C B; Chalub, L L F H; Abreu, M H N G; Barreiros, I D; Amaral, T M P; Kakehasi, A M; Mesquita, R A

2017-12-01

The aim of this study is to correlate radiometric indices from cone beam computed tomography (CBCT) images and bone mineral density (BMD) in postmenopausal women. Quantitative CBCT indices can be used to screen for women with low BMD. Osteoporosis is a disease characterized by the deterioration of bone tissue and the consequent decrease in BMD and increase in bone fragility. Several studies have been performed to assess radiometric indices in panoramic images as low-BMD predictors. The aim of this study is to correlate radiometric indices from CBCT images and BMD in postmenopausal women. Sixty postmenopausal women with indications for dental implants and CBCT evaluation were selected. Dual-energy X-ray absorptiometry (DXA) was performed, and the patients were divided into normal, osteopenia, and osteoporosis groups, according to the World Health Organization (WHO) criteria. Cross-sectional images were used to evaluate the computed tomography mandibular index (CTMI), the computed tomography index (inferior) (CTI (I)) and computed tomography index (superior) (CTI (S)). Student's t test was used to compare the differences between the indices of the groups' intraclass correlation coefficient (ICC). Statistical analysis showed a high degree of interobserver and intraobserver agreement for all measurements (ICC > 0.80). The mean values of CTMI, CTI (S), and CTI (I) were lower in the osteoporosis group than in osteopenia and normal patients (p < 0.05). In comparing normal patients and women with osteopenia, there was no statistically significant difference in the mean value of CTI (I) (p = 0.075). Quantitative CBCT indices may help dentists to screen for women with low spinal and femoral bone mineral density so that they can refer postmenopausal women for bone densitometry.

Texture analysis of clinical radiographs using radon transform on a local scale for differentiation between post-menopausal women with and without hip fracture

NASA Astrophysics Data System (ADS)

Boehm, Holger F.; Körner, Markus; Baumert, Bernhard; Linsenmaier, Ulrich; Reiser, Maximilian

2011-03-01

Osteoporosis is a chronic condition characterized by demineralization and destruction of bone tissue. Fractures associated with the disease are becoming an increasingly relevant issue for public health institutions. Prediction of fracture risk is a major focus research and, over the years, has been approched by various methods. Still, bone mineral density (BMD) obtained by dual-energy X-ray absorptiometry (DXA) remains the clinical gold-standard for diagnosis and follow-up of osteoporosis. However, DXA is restricted to specialized diagnostic centers and there exists considerable overlap in BMD results between populations of individuals with and without fractures. Clinically far more available than DXA is conventional x-ray imaging depicting trabecular bone structure in great detail. In this paper, we demonstrate that bone structure depicted by clinical radiographs can be analysed quantitatively by parameters obtained from the Radon Transform (RT). RT is a global analysis-tool for detection of predefined, parameterized patterns, e.g. straight lines or struts, representing suitable approximations of trabecular bone texture. The proposed algorithm differentiates between patients with and without fractures of the hip by application of various texture-metrics based on the Radon-Transform to standard x-ray images of the proximal femur. We consider three different regions-of-interest in the proximal femur (femoral head, neck, and inter-trochanteric area), and conduct an analysis with respect to correct classification of the fracture status. Performance of the novel approach is compared to DXA. We draw the conclusion that performance of RT is comparable to DXA and may become a useful supplement to densitometry for the prediction of fracture risk.

Impact of an osteoporosis specialized unit on bone health in breast cancer survivals treated with aromatase inhibitors.

PubMed

Martínez, Purificación; Galve, Elena; Arrazubi, Virginia; Sala, M Ángeles; Fernández, Seila; Pérez, Clara E; Arango, Juan F; Torre, Iñaki

2017-10-11

Considering the increased fracture risk in early breast cancer patients treated with aromatase inhibitors (AI), we assessed the impact of a preventive intervention conducted by a specialized osteoporosis unit on bone health at AI treatment start. Retrospective cohort of postmenopausal women who started treatment with AI after breast cancer surgical/chemotherapy treatment and were referred to the osteoporosis unit for a comprehensive assessment of bone health. Bone densitometry and fracture screening by plain X-ray were performed at the baseline visit and once a year for 5 years. The final record included 130 patients. At AI treatment start, 49% had at least one high-risk factor for fractures, 55% had osteopenia, and 39% osteoporosis. Based on the baseline assessment, 79% of patients initiated treatment with bisphosphonates, 88% with calcium, and 79% with vitamin D. After a median of 65 (50-77) months, 4% developed osteopenia or osteoporosis, and 14% improved their densitometric diagnosis. Fifteen fractures were recorded in 11 (8.5%) patients, all of them receiving preventive treatment (10 with bisphosphonates). During the follow-up period, patients with one or more high-risk factors for fracture showed a greater frequency of fractures (15% vs. 3%) and experienced the first fracture earlier than those without high-risk factors (mean of 99 and 102 months, respectively; P=0.023). The preventive intervention of a specialized unit at the start of AI treatment in breast cancer survivors allows the identification of patients with high fracture risk and may contribute to preventing bone events in these patients. Copyright © 2017 Elsevier España, S.L.U. and Sociedad Española de Reumatología y Colegio Mexicano de Reumatología. All rights reserved.

An interesting case of peripheral vascular disease, vascular reperfusion, and subsequent development of pain due to Paget's disease of bone.

PubMed

Kwun, Sunna; Tucci, Joseph R

2013-01-01

To present a case of Paget's disease of bone that was unmasked after vascular reperfusion. In this case study, we review the presentation, evaluation, diagnosis, and management of a patient with Paget's disease and peripheral vascular disease. A 79-year-old-woman with a history of coronary artery heart disease and recent finding of a T5 compression fracture was hospitalized for evaluation of right lower extremity claudication. Angiography demonstrated a focal complete occlusion of the distal right femoral and popliteal arteries. A self-expanding stent was placed in the distal femoral and popliteal arteries. Approximately 48 hours after the procedure, the patient developed severe, right lower leg pain. On endocrine evaluation, the patient was found to have clinical signs suggesting Paget's disease of bone, which was subsequently confirmed by imaging. This patient's development of severe pain following reperfusion of distal femoral and popliteal arteries is in keeping with the known and aforementioned hypervascularity of pagetic bone. The finding of increased warmth over an area of skeletal deformation should always raise the possibility of Paget's disease of bone.

The effect of Amifostine prophylaxis on bone densitometry, biomechanical strength and union in mandibular pathologic fracture repair.

PubMed

Tchanque-Fossuo, Catherine N; Donneys, Alexis; Sarhaddi, Deniz; Poushanchi, Behdod; Deshpande, Sagar S; Weiss, Daniela M; Buchman, Steven R

2013-11-01

Pathologic fractures (Fx) of the mandibles are severely debilitating consequences of radiation (XRT) in the treatment of craniofacial malignancy. We have previously demonstrated Amifostine's effect (AMF) in the remediation of radiation-induced cellular damage. We posit that AMF prophylaxis will preserve bone strength and drastically reverse radiotherapy-induced non-union in a murine mandibular model of pathologic fracture repair. Twenty-nine rats were randomized into 3 groups: Fx, XRT/Fx, and AMF/XRT/Fx. A fractionated human equivalent dose of radiation was delivered to the left hemimandibles of XRT/Fx and AMF/XRT/Fx. AMF/XRT/Fx was pre-treated with AMF. All groups underwent left mandibular osteotomy with external fixation and setting of a 2.1mm fracture gap post-operatively. Utilizing micro-computed tomography and biomechanical testing, the healed fracture was evaluated for strength. All radiomorphometrics and biomechanical properties were significantly diminished in XRT/Fx compared to both Fx and AMF/XRT/Fx. No difference was demonstrated between Fx and AMF/XRT/Fx in both outcomes. Our investigation establishes the significant and substantial capability of AMF prophylaxis to preserve and enhance bone union, quality and strength in the setting of human equivalent radiotherapy. Such novel discoveries establish the true potential to utilize pharmacotherapy to prevent and improve the treatment outcomes of radiation-induced late pathologic fractures. © 2013.

Amifostine Prophylaxis on Bone Densitometry, Biomechanical Strength and Union in Mandibular Pathologic Fracture Repair

PubMed Central

Tchanque-Fossuo, Catherine N.; Donneys, Alexis; Sarhaddi, Deniz; Poushanchi, Behdod; Deshpande, Sagar S.; Weiss, Daniela M.

2013-01-01

Background Pathologic fractures (Fx) of the mandibles are severely debilitating consequences of radiation (XRT) in the treatment of craniofacial malignancy. We have previously demonstrated Amifostine’s effect (AMF) in the remediation of radiation-induced cellular damage. We posit that AMF prophylaxis will preserve bone strength and drastically reverse radiotherapy-induced non-union in a murine mandibular model of pathologic fracture repair. Materials and Methods Twenty-nine rats were randomized into 3 groups: Fx, XRT/Fx, and AMF/XRT/Fx. A fractionated human equivalent dose of radiation was delivered to the left hemimandibles of XRT/Fx and AMF/XRT/Fx. AMF/XRT/Fx was pre-treated with AMF. All groups underwent left mandibular osteotomy with external fixation and setting of a 2.1mm fracture gap post-operatively. Utilizing micro-computed tomography and biomechanical testing, the healed fracture was evaluated for strength. Results All radiomorphometrics and biomechanical properties were significantly diminished in XRT/Fx compared to both Fx and AMF/XRT/Fx. No difference was demonstrated between Fx and AMF/XRT/Fx in both outcomes. Conclusion Our investigation establishes the significant and substantial capability of AMF prophylaxis to preserve and enhance bone union, quality and strength in the setting of human equivalent radiotherapy. Such novel discoveries establish the true potential to utilize pharmacotherapy to prevent and improve the treatment outcomes of radiation-induced late pathologic fractures. PMID:23860272

Testosterone is an independent determinant of bone mineral density in men with type 2 diabetes mellitus.

PubMed

Vasilkova, Olga; Mokhort, Tatiana; Sanec, Igor; Sharshakova, Tamara; Hayashida, Naomi; Takamura, Noboru

2011-01-01

Although many reports have elucidated pathophysiological characteristics of abnormal bone metabolism in patients with type 2 diabetes mellitus (DT2), determinants of bone mineral density (BMD) in patients with DT2 are still controversial. We examined 168 Belarussian men 45-60 years of age. Plasma total cholesterol (TC), high-density lipoprotein cholesterol, low-density lipoprotein cholesterol, very low-density lipoprotein cholesterol, triglycerides, hemoglobin A(1c) (HbA(1c)), immunoreactive insulin, and C-reactive protein concentrations were assessed. BMD was measured using dual energy X-ray densitometry of the lumbar spine (L(1)-L(4)). Total testosterone (TT) and sex hormone-binding globulin were measured, and free testosterone (FT) was calculated. Using univariate linear regression analysis, BMD of the lumbar spine was significantly correlated with FT (r=0.32, p<0.01) and TT (r=0.36, p<0.01). Using multiple linear regression analysis adjusted for confounding factors, BMD was significantly correlated with TT (β=0.23, p<0.001) and TC (β=-0.029, p=0.005). Age (β=0.005, p=0.071), body mass index (β=0.005, p=0.053), HbA(1c) (β=-0.002, p=0.72) and duration of diabetes (β=0.001, p=0.62) were not significantly correlated with BMD. Our data indicate that androgens are independent determinants of BMD in male patients with DT2.

Survival Fraction at 2 Gy and γH2AX Expression Kinetics in Peripheral Blood Lymphocytes From Cancer Patients: Relationship With Acute Radiation-Induced Toxicities

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pouliliou, Stamatia E.; Lialiaris, Theodoros S.; Dimitriou, Thespis

Purpose: Predictive assays for acute radiation toxicities would be clinically relevant in radiation oncology. We prospectively examined the predictive role of the survival fraction at 2 Gy (SF2) and of γH2AX (double-strand break [DSB] DNA marker) expression kinetics in peripheral blood mononuclear cells (PBMCs) from cancer patients before radiation therapy. Methods and Materials: SF2 was measured with Trypan Blue assay in the PBMCs from 89 cancer patients undergoing radiation therapy at 4 hours (SF2{sub [4h]}) and 24 hours (SF2{sub [24h]}) after ex vivo irradiation. Using Western blot analysis and band densitometry, we further assessed the expression of γH2AX in PBMC DNA at 0 hours, 30 minutes,more » and 4 hours (33 patients) and 0 hour, 4 hours, and 24 hours (56 patients), following ex vivo irradiation with 2 Gy. Appropriate ratios were used to characterize each patient, and these were retrospectively correlated with early radiation therapy toxicity grade. Results: The SF2{sub (4h)} was inversely correlated with the toxicity grade (P=.006). The γH2AX-ratio{sub (30min)} (band density of irradiated/non-irradiated cells at 30 minutes) revealed, similarly, a significant inverse association (P=.0001). The DSB DNA repair rate from 30 minutes to 4 hours, calculated as the relative RγH2AX-ratio (γH2AX-ratio{sub (4h)}/γH2AX-ratio{sub (30min)}) showed a significant direct association with high toxicity grade (P=.01). Conclusions: Our results suggest that SF2 is a significant radiation sensitivity index for patients undergoing radiation therapy. γH2AX Western blot densitometry analysis provided 2 important markers of normal tissue radiation sensitivity. Low γH2AX expression at 30 minutes was linked with high toxicity grade, suggesting that poor γH2AX repair activity within a time frame of 30 minutes after irradiation predicts for poor radiation tolerance. On the other hand, rapid γH2AX content restoration at 4 hours after irradiation, compatible with efficient DSB repair ability, predicts for increased radiation tolerance.« less

Leptin stimulates bone formation in ob/ob mice at doses having minimal impact on energy metabolism.

PubMed

Philbrick, Kenneth A; Wong, Carmen P; Branscum, Adam J; Turner, Russell T; Iwaniec, Urszula T

2017-03-01

Leptin, the protein product of the ob gene, is essential for normal bone growth, maturation and turnover. Peripheral actions of leptin occur at lower serum levels of the hormone than central actions because entry of leptin into the central nervous system (CNS) is limited due to its saturable transport across the blood-brain barrier (BBB). We performed a study in mice to model the impact of leptin production associated with different levels of adiposity on bone formation and compared the response with well-established centrally mediated actions of the hormone on energy metabolism. Leptin was infused (0, 4, 12, 40, 140 or 400 ng/h) for 12 days into 6-week-old female ob/ob mice (n = 8/group) using sc-implanted osmotic pumps. Treatment resulted in a dose-associated increase in serum leptin. Bone formation parameters were increased at EC 50 infusion rates of 7-17 ng/h, whereas higher levels (EC 50 , 40-80 ng/h) were required to similarly influence indices of energy metabolism. We then analyzed gene expression in tibia and hypothalamus at dose rates of 0, 12 and 140 ng/h; the latter dose resulted in serum leptin levels similar to WT mice. Infusion with 12 ng/h leptin increased the expression of genes associated with Jak/Stat signaling and bone formation in tibia with minimal effect on Jak/Stat signaling and neurotransmitters in hypothalamus. The results suggest that leptin acts peripherally to couple bone acquisition to energy availability and that limited transport across the BBB insures that the growth-promoting actions of peripheral leptin are not curtailed by the hormone's CNS-mediated anorexigenic actions. © 2017 Society for Endocrinology.

Parathyroid Hormone-Related Peptide Elicits Peripheral TRPV1-dependent Mechanical Hypersensitivity

PubMed Central

Shepherd, Andrew J.; Mickle, Aaron D.; Kadunganattil, Suraj; Hu, Hongzhen; Mohapatra, Durga P.

2018-01-01

Bone metastasis in breast, prostate and lung cancers often leads to chronic pain, which is poorly managed by existing analgesics. The neurobiological mechanisms that underlie chronic pain associated with bone-metastasized cancers are not well understood, but sensitization of peripheral nociceptors by tumor microenvironment factors has been demonstrated to be important. Parathyroid hormone-related peptide (PTHrP) is highly expressed in bone-metastasized breast and prostate cancers, and is critical to growth and proliferation of these tumors in the bone tumor microenvironment. Previous studies have suggested that PTHrP could sensitize nociceptive sensory neurons, resulting in peripheral pain hypersensitivity. In this study, we found that PTHrP induces both heat and mechanical hypersensitivity, that are dependent on the pain-transducing transient receptor potential channel family vanilloid, member-1 (TRPV1), but not the mechano-transducing TRPV4 and TRPA1 ion channels. Functional ratiometric Ca2+ imaging and voltage-clamp electrophysiological analysis of cultured mouse DRG neurons show significant potentiation of TRPV1, but not TRPA1 or TRPV4 channel activation by PTHrP. Interestingly, PTHrP exposure led to the slow and sustained activation of TRPV1, in the absence of any exogenous channel agonist, and is dependent on the expression of the type-1 parathyroid hormone receptor (PTH1), as well as on downstream phosphorylation of the channel by protein kinase C (PKC). Accordingly, local administration of specific small-molecule antagonists of TRPV1 to mouse hindpaws after the development of PTHrP-induced mechanical hypersensitivity led to its significant attenuation. Collectively, our findings suggest that PTHrP/PTH1-mediated flow activation of TRPV1 channel contributes at least in part to the development and maintenance of peripheral mechanical pain hypersensitivity, and could therefore constitute a mechanism for nociceptor sensitization in the context of metastatic bone cancer pain. PMID:29497363

Vismodegib and Gamma-Secretase/Notch Signalling Pathway Inhibitor RO4929097 in Treating Patients With Advanced or Metastatic Sarcoma

ClinicalTrials.gov

2016-06-09

Adult Alveolar Soft Part Sarcoma; Adult Angiosarcoma; Adult Desmoplastic Small Round Cell Tumor; Adult Epithelioid Hemangioendothelioma; Adult Epithelioid Sarcoma; Adult Extraskeletal Myxoid Chondrosarcoma; Adult Extraskeletal Osteosarcoma; Adult Fibrosarcoma; Adult Leiomyosarcoma; Adult Liposarcoma; Adult Malignant Mesenchymoma; Adult Malignant Peripheral Nerve Sheath Tumor; Adult Rhabdomyosarcoma; Adult Synovial Sarcoma; Adult Unclassified Pleomorphic Sarcoma; Chondrosarcoma; Clear Cell Sarcoma of the Kidney; Conjunctival Kaposi Sarcoma; Dermatofibrosarcoma Protuberans; Gastrointestinal Stromal Tumor; Metastatic Ewing Sarcoma/Peripheral Primitive Neuroectodermal Tumor; Metastatic Osteosarcoma; Ovarian Sarcoma; Recurrent Adult Soft Tissue Sarcoma; Recurrent Adult Unclassified Pleomorphic Sarcoma of Bone; Recurrent Ewing Sarcoma/Peripheral Primitive Neuroectodermal Tumor; Recurrent Kaposi Sarcoma; Recurrent Osteosarcoma; Recurrent Uterine Corpus Sarcoma; Small Intestine Leiomyosarcoma; Stage III Adult Soft Tissue Sarcoma; Stage III Uterine Sarcoma; Stage IV Adult Soft Tissue Sarcoma; Stage IV Uterine Sarcoma; Unclassified Pleomorphic Sarcoma of Bone

Deficiency of Retinaldehyde Dehydrogenase 1 Induces BMP2 and Increases Bone Mass In Vivo

PubMed Central

Nallamshetty, Shriram; Wang, Hong; Rhee, Eun-Jung; Kiefer, Florian W.; Brown, Jonathan D.; Lotinun, Sutada; Le, Phuong; Baron, Roland; Rosen, Clifford J.; Plutzky, Jorge

2013-01-01

The effects of retinoids, the structural derivatives of vitamin A (retinol), on post-natal peak bone density acquisition and skeletal remodeling are complex and compartment specific. Emerging data indicates that retinoids, such as all trans retinoic acid (ATRA) and its precursor all trans retinaldehyde (Rald), exhibit distinct and divergent transcriptional effects in metabolism. Despite these observations, the role of enzymes that control retinoid metabolism in bone remains undefined. In this study, we examined the skeletal phenotype of mice deficient in retinaldehyde dehydrogenase 1 (Aldh1a1), the enzyme responsible for converting Rald to ATRA in adult animals. Bone densitometry and micro-computed tomography (µCT) demonstrated that Aldh1a1-deficient (Aldh1a1−/−) female mice had higher trabecular and cortical bone mass compared to age and sex-matched control C57Bl/6 wild type (WT) mice at multiple time points. Histomorphometry confirmed increased cortical bone thickness and demonstrated significantly higher bone marrow adiposity in Aldh1a1−/− mice. In serum assays, Aldh1a1−/− mice also had higher serum IGF-1 levels. In vitro, primary Aldh1a1−/− mesenchymal stem cells (MSCs) expressed significantly higher levels of bone morphogenetic protein 2 (BMP2) and demonstrated enhanced osteoblastogenesis and adipogenesis versus WT MSCs. BMP2 was also expressed at higher levels in the femurs and tibias of Aldh1a1−/− mice with accompanying induction of BMP2-regulated responses, including expression of Runx2 and alkaline phosphatase, and Smad phosphorylation. In vitro, Rald, which accumulates in Aldh1a1−/− mice, potently induced BMP2 in WT MSCs in a retinoic acid receptor (RAR)-dependent manner, suggesting that Rald is involved in the BMP2 increases seen in Aldh1a1 deficiency in vivo. Collectively, these data implicate Aldh1a1 as a novel determinant of cortical bone density and marrow adiposity in the skeleton in vivo through modulation of BMP signaling. PMID:23951127

A novel NF1 mutation in a Chinese patient with giant café-au-lait macule in neurofibromatosis type 1 associated with a malignant peripheral nerve sheath tumor and bone abnormality.

PubMed

Tong, H-X; Li, M; Zhang, Y; Zhu, J; Lu, W-Q

2012-08-29

Neurofibromatosis type 1 (NF1; OMIM#162200) is a common neurocutaneous disorder that is characterized by multiple café-au-lait, skinfold freckling, Lisch nodules, and neurofibromas. Mutations in the NF1 gene, which encodes the neurofibromin protein, have been identified as the pathogenic gene of NF1. In this study, we present a clinical and molecular study of a Chinese patient with giant café-au-lait in NF1. The patient showed >6 café-au-lait spots on the body, axillary freckling, and multiple subcutaneous neurofibromas. He also had a malignant peripheral nerve sheath tumor and bone abnormalities. The germline mutational analysis of the NF1 gene revealed a novel missense mutation in exon 13. It is a novel heterozygous nucleotide G>A transition at position 2241 of the NF1 gene. We found no mutation in malignant peripheral nerve sheath tumor DNA from this patient. This expands the database for NF1 gene mutations in NF1. Its absence in the normal chromosomes suggests that it is responsible for the NF1 phenotype. To our knowledge, this is the first case of giant café-au-lait macule in NF1 associated with a malignant peripheral nerve sheath tumor and bone abnormality.

Body composition of adult cystic fibrosis patients and control subjects as determined by densitometry, bioelectrical impedance, total-body electrical conductivity, skinfold measurements, and deuterium oxide dilution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Newby, M.J.; Keim, N.L.; Brown, D.L.

1990-08-01

This study contrasts body compositions (by six methods) of eight cystic fibrosis (CF) subjects with those of eight control subjects matched for age, height, and sex. CF subjects weighed 84% as much as control subjects. Densitometry and two bioelectrical impedance-analysis methods suggested that reduced CF weights were due to less lean tissue (10.7, 9.5, and 10.4 kg). Total-body electrical conductivity (TOBEC) and skinfold-thickness measurements indicated that CF subjects were leaner than control subjects and had less fat (5.4 and 3.6 kg) and less lean (5.2 and 7 kg) tissue. D2O dilution showed a pattern similar to TOBEC (8.3 kg lessmore » lean, 2.7 kg less fat tissue). Densitometry estimates of fat (mass and percent) were not correlated (r less than 0.74, p greater than 0.05) with any other method for CF subjects but were correlated with all other methods for control subjects. CF subjects contained less fat and lean tissue than did control subjects. Densitometry by underwater weighing is unsuitable for assessing body composition of CF patients.« less

Association Between Insulin Resistance and Bone Structure in Nondiabetic Postmenopausal Women

PubMed Central

Finkelstein, Joel S.; Bouxsein, Mary L.; Yu, Elaine W.

2016-01-01

Context: The clinical consequences of insulin resistance and hyperinsulinemia on bone remain largely unknown. Objective: The objective of the study was to evaluate the effect of insulin resistance on peripheral bone geometry, volumetric bone mineral density (vBMD), bone microarchitecture, and estimated bone strength. Design, Setting, and Participants: This cross-sectional study included 146 postmenopausal, nondiabetic Caucasian women (mean age 60.3 ± 2.7 y) who were participating in the Study of Women's Health Across the Nation. Interventions: There were no interventions. Main Outcome Measures: High-resolution peripheral quantitative computed tomography was used to assess bone density and microstructure at the distal radius and tibia. Fasting insulin and glucose were measured and insulin resistance was estimated using homeostasis model assessment of insulin resistance (HOMA-IR), with higher values indicating greater insulin resistance. Results: There was a negative association between HOMA-IR and bone size and a positive association between HOMA-IR and total vBMD, trabecular vBMD, trabecular thickness, and cortical thickness at the radius and tibia. These relationships remained, even after adjusting for body weight and other potential covariates (eg, time since menopause, cigarette smoking, physical activity, prior use of osteoporosis medications or glucocorticoids). Conclusions: In nondiabetic, postmenopausal women, insulin resistance was associated with smaller bone size, greater volumetric bone mineral density, and generally favorable bone microarchitecture at weight-bearing and nonweight-bearing skeletal sites. These associations were independent of body weight and other potential covariates, suggesting that hyperinsulinemia directly affects bone structure independent of obesity and may explain, in part, the higher trabecular bone density and favorable trabecular microarchitecture seen in individuals with type 2 diabetes mellitus. PMID:27243136

Absence of mutagenicity effects of Psidium cattleyanum Sabine (Myrtaceae) extract on peripheral blood and bone marrow cells of mice.

PubMed

Costa, T D A; Vieira, S; Andrade, S F; Maistro, E L

2008-07-29

Cattley guava (Psidium cattleyanum Sabine) is a native fruit of Brazil that is popular both as a sweet food and for its reputed therapeutic properties. We examined whether it could damage DNA using the alkaline single-cell gel electrophoresis (comet assay) and the micronucleus test in leukocytes and in bone marrow cells of mice. P. cattleyanum leaf extract was tested at concentrations of 1000, 1500 and 2000 mg/kg. N-nitroso-N-ethylurea was used as a positive control. Peripheral blood leukocytes were collected 4 and 24 h after the treatments for the comet assay, and bone marrow cells were collected after 24 and 48 h for the micronucleus test. Unlike N-nitroso-N-ethylurea, P. cattleyanum extract failed to induce a significant increase in cell DNA damage, in micronucleated cell frequency, and in bone marrow toxicity. The lack of mutagenicity and cytotoxicity with high doses of this plant extract means that it can be safely used in traditional medicine.

MEGACARYOCYTES IN THE PERIPHERAL CIRCULATION

PubMed Central

Minot, George R.

1922-01-01

A megacaryocyte is seen commonly as an occasional cell in the peripheral blood of patients with myelogenous leucemia. Less commonly they appear in relatively large numbers. These giant cells also may occur in the blood under other conditions. Their presence is indicative of a bone marrow under intense strain. PMID:19868650

Low bone mineral density in Greek patients with inflammatory bowel disease: prevalence and risk factors.

PubMed

Koutroubakis, Ioannis E; Zavos, Christos; Damilakis, John; Papadakis, Georgios Z; Neratzoulakis, John; Karkavitsas, Nikolaos; Kouroumalis, Elias A

2011-01-01

A high prevalence of osteopenia and osteoporosis is observed in patients with inflammatory bowel disease (IBD). Various risk factors of bone loss have been suggested in IBD. The aim of the present study was to investigate the prevalence of low bone mineral density (BMD) and to identify related risk factors in Greek patients with IBD. One hundred and eighteen consecutive IBD patients were included. All patients underwent bone densitometry by dual energy X-ray absorptiometry at the femoral neck and lumbar spine levels. Serum levels of 25 hydroxyvitamin D (25 OH D), 1.25 dihydroxyvitamin D (1.25 OH 2D), osteocalcin, calcitonin and homocysteine were measured in all participants. Forty (33.9%) patients were normal, 55 (46.6%) were osteopenic, and 23 (19.5%) were osteoporotic. No significant differences between IBD patients with osteopenia or osteoporosis and those with normal BMD concerning the use of steroids and the examined biochemical markers were found. Statistically significant differences among the three groups were found for body mass index (BMI), age and disease duration (P=0.002, P<0.0001 and P=0.03 respectively). Multivariate analysis revealed that the most significant factors associated with BMD were age and BMI (P<0.0001). A weak but statistically significant correlation was also found for disease duration (P=0.04). There is a high prevalence of osteopenia and osteoporosis in Greek patients with IBD. Low BMI, age and disease duration are the most important independent risk factors for osteoporosis in Greek IBD patients.

DXA in the assessment of subchondral bone mineral density in knee osteoarthritis--A semi-standardized protocol after systematic review.

PubMed

Sepriano, Alexandre; Roman-Blas, Jorge A; Little, Robert D; Pimentel-Santos, Fernando; Arribas, Jose María; Largo, Raquel; Branco, Jaime C; Herrero-Beaumont, Gabriel

2015-12-01

Subchondral bone mineral density (sBMD) contributes to the initiation and progression of knee osteoarthritis (OA). Reliable methods to assess sBMD status may predict the response of specific OA phenotypes to targeted therapies. While dual-energy X-ray absorptiometry (DXA) of the knee can determine sBMD, no consensus exists regarding its methodology. Construct a semi-standardized protocol for knee DXA to measure sBMD in patients with OA of the knee by evaluating the varying methodologies present in existing literature. We performed a systematic review of original papers published in PubMed and Web of Science from their inception to July 2014 using the following search terms: subchondral bone, osteoarthritis, and bone mineral density. DXA of the knee can be performed with similar reproducibility values to those proposed by the International Society for Clinical Densitometry for the hip and spine. We identified acquisition view, hip rotation, knee positioning and stabilization, ROI location and definition, and the type of analysis software as important sources of variation. A proposed knee DXA protocol was constructed taking into consideration the results of the review. DXA of the knee can be reliably performed in patients with knee OA. Nevertheless, we found substantial methodological variation across previous studies. Methodological standardization may provide a foundation from which to establish DXA of the knee as a valid tool for identification of SB changes and as an outcome measure in clinical trials of disease modifying osteoarthritic drugs. Copyright © 2015 Elsevier Inc. All rights reserved.

Radiographic morphometry and densitometry predict strength of cadaveric proximal humeri more reliably than age and DXA scan density.

PubMed

Skedros, John G; Knight, Alex N; Pitts, Todd C; O'Rourke, Peter J; Burkhead, Wayne Z

2016-02-01

Methods are needed for identifying poorer quality cadaver proximal humeri to ensure that they are not disproportionately segregated into experimental groups for fracture studies. We hypothesized that measurements made from radiographs of cadaveric proximal humeri are stronger predictors of fracture strength than chronological age or bone density values derived from dual-energy x-ray absorptiometry (DXA) scans. Thirty-three proximal humeri (range: 39-78 years) were analyzed for: (1) bone mineral density (BMD, g/cm(2)) using DXA, (2) bulk density (g/cm(3)) using DXA and volume displacement, (3) regional bone density in millimeters of aluminum (mmAl) using radiographs, and (4) regional mean (medial+lateral) cortical thickness and cortical index (CI) using radiographs. The bones were then fractured simulating a fall. Strongest correlations with ultimate fracture load (UFL) were: mean cortical thickness at two diaphyseal locations (r = 0.71; p < 0.001), and mean mmAl in the humeral head (r = 0.70; p < 0.001). Weaker correlations were found between UFL and DXA-BMD (r = 0.60), bulk density (r = 0.43), CI (r = 0.61), and age (r = -0.65) (p values <0.01). Analyses between UFL and the product of any two characteristics showed six combinations with r-values >0.80, but none included DXA-derived density, CI, or age. Radiographic morphometric and densitometric measurements from radiographs are therefore stronger predictors of UFL than age, CI, or DXA-derived density measurements. © 2015 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

Assessment of vitamin K2 levels in osteoporotic patients: a case control study.

PubMed

Noori, Akram; Lashkari, Mahin; Oveisi, Sonia; Khair Khah, Mohamad Reza; Zargar, Ali

2014-07-14

The aim of this study was to measure the level of Vitamin K2 (Vit K2) in osteoporotic patients and individuals with normal bone density as controls. This case-control study was done in Outpatient Department of Rheumatology at Qazvin Boo-ali Sina Hospital in 2013. Participants were 50 patients with osteoporotic densitometry measured by DEXA (T score? -2.5) who were matched with 48 persons in control group with normal bone density (T score> -1). The level of Vit K2 in samples was measured using enzyme linked immunosorbent assay (ELISA). Data were analyzed by Mann-Whitney U test and Chi-square test. The level of Vit K2 in patients with osteoporosis was not significantly different from the control group (Median: 75.95 vs. 71.35 nmol/L, respectively; P-value: 0.709). The authors determined cut-offs 75 percentile of vitamin K2 in all participants that was 85 nmol/L and percentages of persons in two groups were similar. Although Vit K2 level in patients with osteoporosis was not significantly different from the control group, further studies are necessary to confirm the association of osteoporosis and Vit K2.

Association between duration of playing video games and bone mineral density in Chinese adolescents.

PubMed

Shao, Haiyu; Xu, Shaonan; Zhang, Jun; Zheng, Jiayin; Chen, Jinping; Huang, Yazeng; Ru, Bin; Jin, Yongming; Zhang, Qi; Ying, Qifeng

2015-01-01

The aim of the study was to investigate the association between duration of playing video games and bone mineral density (BMD) in Chinese adolescents. Three hundred eighty-four Chinese adolescents aged 14-18 yr (148 males and 236 females) were analyzed. Anthropometric measurements were obtained using standard procedures. Total body and regional BMD were measured using dual-energy X-ray absorptiometry. Duration of playing video games, defined as hours per day, was measured by a self-report questionnaire. We examined the association between duration of playing video games and BMD using multiple linear regression analysis. After adjustment for age, sex, pubertal stage, parental education, body mass index, adolescents with longer video game duration were more likely to have lower legs, trunk, pelvic, spine, and total BMD (p < 0.05). We concluded that duration of video game was negatively associated with BMD in Chinese adolescents. These findings provide support for reducing duration of playing video games as a possible means to increase BMD in adolescents. Future research is needed to elucidate the underlined mechanisms linking playing video games and osteoporosis. Copyright © 2015 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Primary hyperparathyroidism: recent advances.

PubMed

Walker, Marcella D; Bilezikian, John P

2018-07-01

The purpose of this review is to describe recent advances and changes in the evaluation and management of primary hyperparathyroidism (PHPT). Although it has long been recognized that asymptomatic PHPT is associated with bone loss, particularly at cortical skeletal sites when evaluated with dual-energy X-ray absorptiometry, new imaging techniques suggest that trabecular skeletal deterioration as well as clinically silent vertebral fractures and nephrolithiasis are common. Nonclassical targets of asymptomatic PHPT as well as the effect of vitamin D deficiency and treatment upon PHPT presentation have been the subject of recent intense investigation. Randomized clinical trials are now available regarding the effect of parathyroidectomy (PTX) upon both classical and nonclassical target organs. They have confirmed results from observational studies with regard to the skeletal benefits of PTX but have not consistently shown improvements in nonclassical symptoms. These findings have led to recommendations for more extensive renal and skeletal evaluation and broader criteria for PTX in PHPT. In addition to dual-energy X-ray absorptiometry, vertebral and renal imaging is recommended. When available, trabecular imaging techniques may be helpful. PTX criteria now include subclinical kidney stones, vertebral fractures and hypercalciuria, in addition to those based on age, serum calcium, bone densitometry and renal function.

[Relationship among anthropometric and gluco-metabolic parameters, bone mineral density and endometriosis].

PubMed

Nava-González, Edna J; de la Garza-Casas, Yolanda E; Salazar-Montalvo, Raúl G; Gallegos-Cabriales, Esther C

2013-01-01

women with endometriosis may have a decreased bone mineral density (BMD). Several studies have shown that accumulation of adipose tissue profoundly affects BMD. It has also been documented that excess body fat is associated with risk of developing endometriosis. The aim was to analyze the relationship between BMD, fat mass, and the insulin-glucose axis in women with endometriosis. thirty women with a diagnosis of endometriosis established by surgery were enrolled to participate in an observational prospective study. Anthropometry was performed to determine body mass index, and a dual X-ray densitometry to collect data on body composition and BMD. Glucose and insulin determinations were performed. Women were divided in two groups: with normal weight (n = 18) or overweight (n = 12). For the analysis of the results, we used descriptive statistics and Pearson's test. normal weight/overweight: mean age 32.5/35.2 years; body mass index 21.5/30.2; adiposity index: 27.7 %/36.1 %; fat mass index: 35.4/45.8 %; overweight women showed a significant value with p < 0.05. overweight, high values of adiposity index and fat mass index were related to endometriosis. This could support the hypothesis about a common pathogenesis among endometriosis, osteoporosis, diabetes and obesity.

Functional Effects of Prebiotic Fructans in Colon Cancer and Calcium Metabolism in Animal Models.

PubMed

Rivera-Huerta, Marisol; Lizárraga-Grimes, Vania Lorena; Castro-Torres, Ibrahim Guillermo; Tinoco-Méndez, Mabel; Macías-Rosales, Lucía; Sánchez-Bartéz, Francisco; Tapia-Pérez, Graciela Guadalupe; Romero-Romero, Laura; Gracia-Mora, María Isabel

2017-01-01

Inulin-type fructans are polymers of fructose molecules and are known for their capacity to enhance absorption of calcium and magnesium, to modulate gut microbiota and energy metabolism, and to improve glycemia. We evaluated and compared the effects of Chicory inulin "Synergy 1®" and inulin from Mexican agave "Metlin®" in two experimental models of colon cancer and bone calcium metabolism in mice and rats. Inulins inhibited the development of dextran sulfate sodium-induced colitis and colon cancer in mice; these fructans reduced the concentration of tumor necrosis factor alpha and prevented the formation of intestinal polyps, villous atrophy, and lymphoid hyperplasia. On the other hand, inulin treatments significantly increased bone densitometry (femur and vertebra) in ovariectomized rats without altering the concentration of many serum biochemical parameters and urinary parameters. Histopathology results were compared between different experimental groups. There were no apparent histological changes in rats treated with inulins and a mixture of inulins-isoflavones. Our results showed that inulin-type fructans have health-promoting properties related to enhanced calcium absorption, potential anticancer properties, and anti-inflammatory effects. The use of inulin as a prebiotic can improve health and prevent development of chronic diseases such as cancer and osteoporosis.

The Role of Peripheral Nerve Function in Age-Related Bone Loss and Changes in Bone Adaptation

DTIC Science & Technology

2013-10-01

mechanical loading (months 6-18): 2a. Strain gage analysis of bone strain during tibial compression (months 6-7) 2b. Capsaicin or vehicle treatment...of neonatal mice (months 6-8) 2c. Tibial compression of capsaicin- and vehicle-injected mice (months 8-10) 2d. Micro-computed tomography of mouse...the endosteal and periosteal surfaces. Capsaicin treatment altered bone formation rate parameters in the tibias of treated mice (Table 2). There

Official Positions for FRAX(®) clinical regarding glucocorticoids: the impact of the use of glucocorticoids on the estimate by FRAX(®) of the 10 year risk of fracture from Joint Official Positions Development Conference of the International Society for Clinical Densitometry and International Osteoporosis Foundation on FRAX(®).

PubMed

Leib, Edward S; Saag, Kenneth G; Adachi, Jonathan D; Geusens, Piet P; Binkley, Neil; McCloskey, Eugene V; Hans, Didier B

2011-01-01

Given the significant impact the use of glucocorticoids can have on fracture risk independent of bone density, their use has been incorporated as one of the clinical risk factors for calculating the 10-year fracture risk in the World Health Organization's Fracture Risk Assessment Tool (FRAX(®)). Like the other clinical risk factors, the use of glucocorticoids is included as a dichotomous variable with use of steroids defined as past or present exposure of 3 months or more of use of a daily dose of 5 mg or more of prednisolone or equivalent. The purpose of this report is to give clinicians guidance on adjustments which should be made to the 10-year risk based on the dose, duration of use and mode of delivery of glucocorticoids preparations. A subcommittee of the International Society for Clinical Densitometry and International Osteoporosis Foundation joint Position Development Conference presented its findings to an expert panel and the following recommendations were selected. 1) There is a dose relationship between glucocorticoid use of greater than 3 months and fracture risk. The average dose exposure captured within FRAX(®) is likely to be a prednisone dose of 2.5-7.5 mg/day or its equivalent. Fracture probability is under-estimated when prednisone dose is greater than 7.5 mg/day and is over-estimated when the prednisone dose is less than 2.5 mg/day. 2) Frequent intermittent use of higher doses of glucocorticoids increases fracture risk. Because of the variability in dose and dosing schedule, quantification of this risk is not possible. 3) High dose inhaled glucocorticoids may be a risk factor for fracture. FRAX(®) may underestimate fracture probability in users of high dose inhaled glucocorticoids. 4) Appropriate glucocorticoid replacement in individuals with adrenal insufficiency has not been found to increase fracture risk. In such patients, use of glucocorticoids should not be included in FRAX(®) calculations. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Enhanced Precision of the New Hologic Horizon Model Compared With the Old Discovery Model Is Less Evident When Fewer Vertebrae Are Included in the Analysis.

PubMed

McNamara, Elizabeth A; Kilim, Holly P; Malabanan, Alan O; Whittaker, LaTarsha G; Rosen, Harold N

The International Society for Clinical Densitometry guidelines recommend using locally derived precision data for spine bone mineral densities (BMDs), but do not specify whether data derived from L1-L4 spines correctly reflect the precision for spines reporting fewer than 4 vertebrae. Our experience suggested that the decrease in precision with successively fewer vertebrae is progressive as more vertebrae are excluded and that the precision for the newer Horizon Hologic model might be better than that for the previous model, and we sought to quantify. Precision studies were performed on Hologic densitometers by acquiring spine BMD in fast array mode twice on 30 patients, according to International Society for Clinical Densitometry guidelines. This was done 10 different times on various Discovery densitometers, and once on a Horizon densitometer. When 1 vertebral body was excluded from analysis, there was no significant deterioration in precision. When 2 vertebrae were excluded, there was a nonsignificant trend to poorer precision, and when 3 vertebrae were excluded, there was significantly worse precision. When 3 or 4 vertebrae were reported, the precision of the spine BMD measurement was significantly better on the Hologic Horizon than on the Discovery, but the difference in precision between densitometers narrowed and was no longer significant when 1 or 2 vertebrae were reported. The results suggest that (1) the measurement of in vivo spine BMD on the new Hologic Horizon densitometer is significantly more precise than on the older Discovery model; (2) the difference in precision between the Horizon and Discovery models decreases as fewer vertebrae are included; (3) the measurement of spine BMD is less precise as more vertebrae are excluded, but still quite reasonable even when only 1 vertebral body is included; and (4) when 3 vertebrae are reported, L1-L4 precision data can reasonably be used to report significance of changes in BMD. When 1 or 2 vertebrae are reported, precision data for 1 or 2 vertebrae, respectively, should be used, because the exclusion of 2-3 vertebrae significantly worsens precision. Copyright © 2016 International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Alterations in bone marrow and blood mononuclear cell polyamine and methylglyoxal bis(guanylhydrazone) levels: phase I evaluation of alpha-difluoromethylornithine and methylglyoxal bis(guanylhydrazone) treatment of human hematological malignancies.

PubMed

Maddox, A M; Freireich, E J; Keating, M J; Haddox, M K

1988-03-01

Nine patients with hematological malignancies were treated with difluoromethylornithine and methylglyoxal bis(guanylhydrazone). The number of circulating blast cells decreased in all of the patients treated with DFMO and MGBG for longer than 1 wk. Morphological evidence of myeloid maturation was evident in four patients with leukemia and the circulating M Protein decreased in one patient with multiple myeloma. The polyamine content of the mononuclear cells in both the peripheral blood and bone marrow was transiently increased after the initial MGBG dose. During administration of DFMO decreases were achieved in the peripheral blood mononuclear cell putrescine levels in 7 patients, spermidine levels in 5 patients, and spermine levels in 4 patients. Alterations in bone marrow mononuclear cell polyamine levels were similar to those which occurred in the peripheral cells. An average of 9 days of DFMO treatment was required to lower mononuclear cell polyamine levels. Three of the 4 evaluable patients receiving multiple MGBG doses had an increased mononuclear cell content of MGBG after DFMO pretreatment. Enhancement of cellular MGBG levels was not directly correlated to the degree of cellular polyamine depletion.

[Petrous plasmacytoma revealed by a painful peripheral facial palsy].

PubMed

Lagarde, J; Cret, C; Karlin, L; Ameri, A

2011-01-01

The classical hypothesis of Bell's palsy, tempting in cases of peripheral facial palsy of rapid onset, must nevertheless be evoked with caution particularly if an intense pain is present, which should lead to search for a tumor of the skull base, especially the petrous bone. A 43-year-old man presented a peripheral facial palsy of rapidly progressive onset. A petrous bone tumor was diagnosed on the CT scan, which revealed an aspect of a glomic tumor or a metastatic lesion. The final histological diagnosis was plasmacytoma. This type of tumor has been rarely reported in this location. The radiological features are not specific at all, underlying the importance of searching for some associated signs such as a monoclonal protein and performing a histological examination when the firm diagnosis of a systemic disease like multiple myeloma has not been possible. Copyright © 2010 Elsevier Masson SAS. All rights reserved.

Musculoskeletal Complications and Bone Metastases in Breast Cancer Patients Undergoing Estrogen Deprivation Therapy

DTIC Science & Technology

2016-10-01

are that any treatment or environmental factor that leads to bone loss (e.g., glucocorticoids, GnRH inhibitors, radiation, fracture , osteoporosis...recurrence and mortality. Previous cell culture and clinical studies have demonstrated that peripheral adipose ( fat ) tissue promotes cancer growth, yet the...contribution of increased MAT on metastatic tumor growth in bone is currently unknown. MAT, which is a historically understudied fat depot, accounts

Volleyball and Basketball Enhanced Bone Mass in Prepubescent Boys.

PubMed

Zouch, Mohamed; Chaari, Hamada; Zribi, Anis; Bouajina, Elyès; Vico, Laurence; Alexandre, Christian; Zaouali, Monia; Ben Nasr, Hela; Masmoudi, Liwa; Tabka, Zouhair

2016-01-01

The aim of this study was to examine the effect of volleyball and basketball practice on bone acquisition and to determine which of these 2 high-impact sports is more osteogenic in prepubertal period. We investigated 170 boys (aged 10-12 yr, Tanner stage I): 50 volleyball players (VB), 50 basketball players (BB), and 70 controls. Bone mineral content (BMC, g) and bone area (BA, cm(2)) were measured by dual-energy X-ray absorptiometry at different sites. We found that, both VB and BB have a higher BMC at whole body and most weight-bearing and nonweight-bearing sites than controls, except the BMC in head which was lower in VB and BB than controls. Moreover, only VB exhibited greater BMC in right and left ultra-distal radius than controls. No significant differences were observed between the 3 groups in lumbar spine, femoral neck, and left third D radius BMC. Athletes also exhibited a higher BA in whole body, limbs, lumbar spine, and femoral region than controls. In addition, they have a similar BA in head and left third D radius with controls. The VB exhibited a greater BA in most radius region than controls and a greater femoral neck BA than BB. A significant positive correlation was reported between total lean mass and both BMC and BA in whole body, lumbar spine, total hip, and right whole radius among VB and BB. In summary, we suggest that volleyball and basketball have an osteogenic effect BMC and BA in loaded sites in prepubescent boys. The increased bone mass induced by both volleyball and basketball training in the stressed sites was associated to a decreased skull BMC. Moreover, volleyball practice produces a more sensitive mechanical stress in loaded bones than basketball. This effect seems translated by femoral neck expansion. Copyright © 2016 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

[Interaction between fluorine and zinc after long-term oral administration into the digestive system of rats].

PubMed

Mazurek-Mochol, Małgorzata

2002-01-01

Drug interactions are the side effect of administration of two or more drugs or a drug-food combination. Although some drug interactions are intentional and beneficial to the patient, the majority are unintentional and associated with a potentially harmful effect. The aim of this study was to search for interactions in rats between fluoride and zinc administered orally for 12 weeks and to elucidate any potential toxicological and therapeutic consequences. 60 male Wistar rats were divided into six groups of ten rats each and exposed to: 1. controls (distilled water); 2. sodium fluoride (NaF); 3. low-dose zinc (Zn); 4. high-dose zinc; 5. NaF + low-dose Zn; 6. NaF + high-dose Zn. At the end of the experiment the content of F- and Zn+ in serum, urine, incisors, femur and mandible was measured and densitometry of femoral bones was performed. Serum alkaline phosphatase, alanine and aspartate aminotransferase activities, as well as bilirubin and creatinine concentrations were determined to confirm non-toxicity of fluoride dose. Animals receiving NaF only demonstrated higher content of fluorine in serum, urine bones and teeth. Zinc concentrations in serum, urine, bones and teeth were elevated in rats receiving zinc with or without NaF. Fluorine accumulation in bones and teeth was reduced by Zn, but in general the effect lacked statistical significance. Zinc slightly reduced the concentrations of fluorine in serum and urine. Sodium fluoride slightly reduced the concentration of zinc in serum and urine. Bone mineral content (BMC) was significantly increased by NaF and was not further increased by co-administration of zinc. No changes in serum alkaline phosphatase, alanine and aspartate aminotransferase activities, bilirubin and creatinine concentrations were detected. In conclusion, simultaneous administration of fluorine and zinc may be beneficial for prevention and treatment of pathologic conditions in bones and teeth and is not accompanied by an increase in fluorine levels which could be responsible for toxicological symptoms.

Effects of high-impact exercise on the physical properties of bones of ovariectomized rats fed to a high-protein diet.

PubMed

Shimano, R C; Yanagihara, G R; Macedo, A P; Yamanaka, J S; Shimano, A C; Tavares, J M R S; Issa, J P M

2018-05-01

The aim of this study was to evaluate the effects of high-impact physical exercise as a prophylactic and therapeutic means in osteopenic bones of rats submitted to ovariectomy and protein diet intake. A total of 64 Wistar rats were divided into eight groups (n = 8 each), being: OVX, ovx, standard diet and sedentary; OVXE, ovx, standard diet and jump; OVXP, ovx, high-protein diet and sedentary; and OVXEP, ovx, high-protein diet and jump; SH, sham, standard diet and sedentary; SHE, sham, standard diet and jump; SHP, sham, high-protein diet and sedentary; and SHEP, sham, high-protein diet and jump. OVX surgery consists of ovariectomy, and sham was the control surgery. The jumping protocol consisted of 20 jumps/day, 5 days/week. The bone structure was evaluated by densitometry, mechanical tests, histomorphometric, and immunohistochemical analyses. A high-protein diet resulted in increased bone mineral density (P = .049), but decreased maximal load (P = .026) and bone volume fraction (P = .023). The benefits of physical exercise were demonstrated by higher values of the maximal load in the trained groups compared to the sedentary groups (P < .001). The sham groups had decreased immunostaining of osteocalcin (P = .004) and osteopontin (P = .010) compared to ovx groups. However, the high-protein diet (P = .005) and jump exercise (P = .017) resulted in lower immunostaining of osteopontin compared to the standard diet and sedentary groups, respectively. In this experimental model, it was concluded that ovariectomy and a high-fat diet can negatively affect bone tissue and the high-impact exercise was not enough to suppress the deleterious effects caused by the protein diet and ovariectomy. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

18F-FLT Positron Emission Tomography and Diffusion-Weighted Magnetic Resonance Imaging in Planning Surgery and Radiation Therapy and Measuring Response in Patients With Newly Diagnosed Ewing Sarcoma

ClinicalTrials.gov

2017-11-16

Adult Supratentorial Primitive Neuroectodermal Tumor (PNET); Ewing Sarcoma of Bone; Extraosseous Ewing Sarcoma; Localized Ewing Sarcoma/Peripheral Primitive Neuroectodermal Tumor; Metastatic Ewing Sarcoma/Peripheral Primitive Neuroectodermal Tumor; Untreated Childhood Supratentorial Primitive Neuroectodermal Tumor

Whole-Body Radiation Therapy, Systemic Chemotherapy, and High-Dose Chemotherapy Followed By Stem Cell Rescue in Treating Patients With Poor-Risk Ewing Sarcoma

ClinicalTrials.gov

2015-01-07

Adult Supratentorial Primitive Neuroectodermal Tumor (PNET); Ewing Sarcoma of Bone; Extraosseous Ewing Sarcoma; Metastatic Ewing Sarcoma/Peripheral Primitive Neuroectodermal Tumor; Recurrent Childhood Supratentorial Primitive Neuroectodermal Tumor; Recurrent Ewing Sarcoma/Peripheral Primitive Neuroectodermal Tumor; Untreated Childhood Supratentorial Primitive Neuroectodermal Tumor

Reversal of Multidrug Resistance in Breast Cancer

DTIC Science & Technology

1994-08-23

peripherally derived stem cells (72). Antman and others showed increased numbers of CFU-GM and BFU-E in peripheral blood in the majority of patients treated...original regimen as reported by Antman (45). Peripheral stem cells are not washed before reinfusion and the osmolality of the cell suspension requires the...dosE combination alkylating agents with autologous bone marrow support. A phase I trial. J Clin Oncol 4:646-654, 1986. 63. Eder JP, Antman K, Peters W

Monte Carlo simulation of age-dependent radiation dose from alpha- and beta-emitting radionuclides to critical trabecular bone and bone marrow targets

NASA Astrophysics Data System (ADS)

Dant, James T.; Richardson, Richard B.; Nie, Linda H.

2013-05-01

Alpha (α) particles and low-energy beta (β) particles present minimal risk for external exposure. While these particles can induce leukemia and bone cancer due to internal exposure, they can also be beneficial for targeted radiation therapies. In this paper, a trabecular bone model is presented to investigate the radiation dose from bone- and marrow-seeking α and β emitters to different critical compartments (targets) of trabecular bone for different age groups. Two main issues are addressed with Monte Carlo simulations. The first is the absorption fractions (AFs) from bone and marrow to critical targets within the bone for different age groups. The other issue is the application of 223Ra for the radiotherapy treatment of bone metastases. Both a static model and a simulated bone remodeling process are established for trabecular bone. The results show significantly lower AFs from radionuclide sources in the bone volume to the peripheral marrow and the haematopoietic marrow for adults than for newborns and children. The AFs from sources on the bone surface and in the bone marrow to peripheral marrow and haematopoietic marrow also varies for adults and children depending on the energy of the particles. Regarding the use of 223Ra as a radionuclide for the radiotherapy of bone metastases, the simulations show a significantly higher dose from 223Ra and its progeny in forming bone to the target compartment of bone metastases than that from two other more commonly used β-emitting radiopharmaceuticals, 153Sm and 89Sr. There is also a slightly lower dose from 223Ra in forming bone to haematopoietic marrow than that from 153Sm and 89Sr. These results indicate a higher therapy efficiency and lower marrow toxicity from 223Ra and its progeny. In conclusion, age-related changes in bone dimension and cellularity seem to significantly affect the internal dose from α and β emitters in the bone and marrow to critical targets, and 223Ra may be a more efficient radiopharmaceutical for the treatment of bone metastases than 153Sm and 89Sr, if the diffusion of 219Rn to the bone marrow is insignificant.

Bone architecture and strength in the growing skeleton: the role of sedentary time.

PubMed

Gabel, Leigh; McKay, Heather A; Nettlefold, Lindsay; Race, Douglas; Macdonald, Heather M

2015-02-01

Today's youths spend close to 60% of their waking hours in sedentary activities; however, we know little about the potentially deleterious effects of sedentary time on bone health during this key period of growth and development. Thus, our objective was to determine whether sedentary time is associated with bone architecture, mineral density, and strength in children, adolescents, and young adults. We used high-resolution peripheral quantitative computed tomography (Scanco Medical) to measure bone architecture (trabecular and cortical microstructure and bone macrostructure) and cortical and total bone mineral density (BMD) at the distal tibia (8% site) in 154 males and 174 females (9-20 yr) who were participants in the University of British Columbia Healthy Bones III study. We applied finite element analysis to high-resolution peripheral quantitative computed tomography scans to estimate bone strength. We assessed self-reported screen time in all participants using a questionnaire and sedentary time (volume and patterns) in a subsample of participants with valid accelerometry data (89 males and 117 females; ActiGraph GT1M). We fit sex-specific univariate multivariable regression models, controlling for muscle cross-sectional area, limb length, maturity, ethnicity, dietary calcium, and physical activity. We did not observe independent effect of screen time on bone architecture, BMD, or strength in either sex (P > 0.05). Likewise, when adjusted for muscle cross-sectional area, limb length, maturity, ethnicity, dietary calcium, and physical activity, accelerometry-derived volume of sedentary time and breaks in bouts of sedentary time were not a determinant of bone architecture, BMD, or strength in either sex (P > 0.05). Further study is warranted to determine whether the lack of association between sedentary time and bone architecture, BMD, and strength at the distal tibia is also present at other skeletal sites.

Comparisons of bone mineral density and bone quality in adult rock climbers, resistance-trained men, and untrained men.

PubMed

Sherk, Vanessa D; Bemben, Michael G; Bemben, Debra A

2010-09-01

The nature of muscular contractions and episodes of impact loading during technical rock climbing are often varied and complex, and the resulting effects on bone health are unclear. The purpose of this study was to compare total body, lumbar spine, proximal femur, and forearm areal bone mineral density (aBMD) and tibia and forearm bone quality in male rock climbers (RC) (n = 15), resistance trained men (RT) (n = 16), and untrained male controls (CTR) (n = 16). Total body, anteroposterior (AP) lumbar spine, proximal femur, and forearm aBMD and body composition were measured using dual-energy X-ray absorptiometry (DXA) (Lunar Prodigy, v. 10.50.086; GE Healthcare, Waukesha, Wisconsin, U.S.A.). Volumetric BMD (vBMD), bone content, bone area, and muscle cross-sectional area (MCSA) of the tibia and forearm were measured using pQCT (peripheral quantitative computed tomography; Stratec XCT 3000, Pforzheim, Germany). No significant group differences were seen in bone-free lean body mass. CTR had significantly (p < 0.05) greater body fat % than RC and RT and significantly (p < 0.05) greater fat mass than RC. Lumbar spine and femoral neck aBMD were significantly (p < 0.05) greater in RT compared to both RC and CTR. RC had significantly (p < 0.05) lower aBMD at the 33% radius site than CTR. Forearm MCSA was significantly (p < 0.05) lower in CTR than in the other groups. No significant differences were seen between groups for vBMD or bone area of the tibia and forearm. In conclusion, resistance-trained men had higher bone density at the central skeletal sites than rock climbers; however, bone quality variables of the peripheral limbs were similar in rock climber and resistance-trained groups.

High Resolution Peripheral Quantitative Computed Tomography for Assessment of Bone Quality

NASA Astrophysics Data System (ADS)

Kazakia, Galateia

2014-03-01

The study of bone quality is motivated by the high morbidity, mortality, and societal cost of skeletal fractures. Over 10 million people are diagnosed with osteoporosis in the US alone, suffering 1.5 million osteoporotic fractures and costing the health care system over 17 billion annually. Accurate assessment of fracture risk is necessary to ensure that pharmacological and other interventions are appropriately administered. Currently, areal bone mineral density (aBMD) based on 2D dual-energy X-ray absorptiometry (DXA) is used to determine osteoporotic status and predict fracture risk. Though aBMD is a significant predictor of fracture risk, it does not completely explain bone strength or fracture incidence. The major limitation of aBMD is the lack of 3D information, which is necessary to distinguish between cortical and trabecular bone and to quantify bone geometry and microarchitecture. High resolution peripheral quantitative computed tomography (HR-pQCT) enables in vivo assessment of volumetric BMD within specific bone compartments as well as quantification of geometric and microarchitectural measures of bone quality. HR-pQCT studies have documented that trabecular bone microstructure alterations are associated with fracture risk independent of aBMD.... Cortical bone microstructure - specifically porosity - is a major determinant of strength, stiffness, and fracture toughness of cortical tissue and may further explain the aBMD-independent effect of age on bone fragility and fracture risk. The application of finite element analysis (FEA) to HR-pQCT data permits estimation of patient-specific bone strength, shown to be associated with fracture incidence independent of aBMD. This talk will describe the HR-pQCT scanner, established metrics of bone quality derived from HR-pQCT data, and novel analyses of bone quality currently in development. Cross-sectional and longitudinal HR-pQCT studies investigating the impact of aging, disease, injury, gender, race, and therapeutics on bone quality will be discussed.

Influence of meniscus on cartilage and subchondral bone features of knees from older individuals: A cadaver study

PubMed Central

Touraine, Sébastien; Bouhadoun, Hamid; Engelke, Klaus; Laredo, Jean Denis; Chappard, Christine

2017-01-01

Objective Cartilage and subchondral bone form a functional unit. Here, we aimed to examine the effect of meniscus coverage on the characteristics of this unit in knees of older individuals. Methods We assessed the hyaline cartilage, subchondral cortical plate (SCP), and subchondral trabecular bone in areas covered or uncovered by the meniscus from normal cadaver knees (without degeneration). Bone cores harvested from the medial tibial plateau at locations uncovered (central), partially covered (posterior), and completely covered (peripheral) by the meniscus were imaged by micro-CT. The following were measured on images: cartilage volume (Cart.Vol, mm3) and thickness (Cart.Th, mm); SCP thickness (SCP.Th, μm) and porosity (SCP.Por, %); bone volume to total volume fraction (BV/TV, %); trabecular thickness (Tb.Th, μm), spacing (Tb.Sp, μm), and number (Tb.N, 1/mm); structure model index (SMI); trabecular pattern factor (Tb.Pf); and degree of anisotropy (DA). Results Among the 28 specimens studied (18 females) from individuals with mean age 82.8±10.2 years, cartilage and SCP were thicker at the central site uncovered by the meniscus than the posterior and peripheral sites, and Cart.Vol was greater. SCP.Por was highest in posterior samples. In the upper 1–5 mm of subchondral bone, central samples were characterized by higher values for BV/TV, Tb.N, Tb.Th, and connectivity (Tb.Pf), a more plate-like trabecular structure and lower anisotropy than with other samples. Deeper down, at 6–10 mm, the differences were slightly higher for Tb.Th centrally, DA peripherally and SMI posteriorly. Conclusions The coverage or not by meniscus in the knee of older individuals is significantly associated with Cart.Th, SCP.Th, SCP.Por and trabecular microarchitectural parameters in the most superficial 5 mm and to a lesser extent the deepest area of subchondral trabecular bone. These results suggest an effect of differences in local loading conditions. In subchondral bone uncovered by the meniscus, the trabecular architecture resembles that of highly loaded areas. PMID:28797093

Peripheral cannabinoid receptor, CB2, regulates bone mass

PubMed Central

Ofek, Orr; Karsak, Meliha; Leclerc, Nathalie; Fogel, Meirav; Frenkel, Baruch; Wright, Karen; Tam, Joseph; Attar-Namdar, Malka; Kram, Vardit; Shohami, Esther; Mechoulam, Raphael; Zimmer, Andreas; Bab, Itai

2006-01-01

The endogenous cannabinoids bind to and activate two G protein-coupled receptors, the predominantly central cannabinoid receptor type 1 (CB1) and peripheral cannabinoid receptor type 2 (CB2). Whereas CB1 mediates the cannabinoid psychotropic, analgesic, and orectic effects, CB2 has been implicated recently in the regulation of liver fibrosis and atherosclerosis. Here we show that CB2-deficient mice have a markedly accelerated age-related trabecular bone loss and cortical expansion, although cortical thickness remains unaltered. These changes are reminiscent of human osteoporosis and may result from differential regulation of trabecular and cortical bone remodeling. The CB2–/– phenotype is also characterized by increased activity of trabecular osteoblasts (bone-forming cells), increased osteoclast (the bone-resorbing cell) number, and a markedly decreased number of diaphyseal osteoblast precursors. CB2 is expressed in osteoblasts, osteocytes, and osteoclasts. A CB2-specific agonist that does not have any psychotropic effects enhances endocortical osteoblast number and activity and restrains trabecular osteoclastogenesis, apparently by inhibiting proliferation of osteoclast precursors and receptor activator of NF-κB ligand expression in bone marrow-derived osteoblasts/stromal cells. The same agonist attenuates ovariectomy-induced bone loss and markedly stimulates cortical thickness through the respective suppression of osteoclast number and stimulation of endocortical bone formation. These results demonstrate that the endocannabinoid system is essential for the maintenance of normal bone mass by osteoblastic and osteoclastic CB2 signaling. Hence, CB2 offers a molecular target for the diagnosis and treatment of osteoporosis, the most prevalent degenerative disease in developed countries. PMID:16407142

Significant bone microarchitecture impairment in premenopausal women with active celiac disease.

PubMed

Zanchetta, María Belén; Costa, Florencia; Longobardi, Vanesa; Longarini, Gabriela; Mazure, Roberto Martín; Moreno, María Laura; Vázquez, Horacio; Silveira, Fernando; Niveloni, Sonia; Smecuol, Edgardo; Temprano, María de la Paz; Hwang, Hui Jer; González, Andrea; Mauriño, Eduardo César; Bogado, Cesar; Zanchetta, Jose R; Bai, Julio César

2015-07-01

Patients with active celiac disease (CD) are more likely to have osteoporosis and increased risk of fractures. High-resolution peripheral quantitative computed tomography (HR-pQCT) permits three-dimensional exploration of bone microarchitectural characteristics measuring separately cortical and trabecular compartments, and giving a more profound insight into bone disease pathophysiology and fracture. We aimed to determine the volumetric and microarchitectural characteristics of peripheral bones-distal radius and tibia-in an adult premenopausal cohort with active CD assessed at diagnosis. We prospectively enrolled 31 consecutive premenopausal women with newly diagnosed CD (median age 29 years, range: 18-49) and 22 healthy women of similar age (median age 30 years, range 21-41) and body mass index. Compared with controls, peripheral bones of CD patients were significantly lower in terms of total volumetric density mg/cm(3) (mean ± SD: 274.7 ± 51.7 vs. 324.7 ± 45.8, p 0.0006 at the radius; 264.4 ± 48.7 vs. 307 ± 40.7, p 0.002 at the tibia), trabecular density mg/cm(3) (118.6 ± 31.5 vs. 161.9 ± 33.6, p<0.0001 at the radius; 127.9 ± 28.7 vs. 157.6 ± 15.6, p < 0.0001 at the tibia); bone volume/trabecular volume ratio % (9.9 ± 2.6 vs. 13.5 ± 2.8, p<0.0001 at the radius; 10.6 ± 2.4 vs. 13.1 ± 1.3, p < 0.0001 at the tibia); number of trabeculae 1/mm (1.69 ± 0.27 vs. 1.89 ± 0.26, p 0.009 at the radius; 1.53 ± 0.32 vs. 1.80 ± 0.26, p 0.002 at the tibia); and trabecular thickness mm (0.058 ± 0.010 vs. 0.071 ± 0.008, p < 0.0001 at the radius with no significant difference at the tibia). Cortical density was significantly lower in both regions (D comp mg/cm(3) 860 ± 57.2 vs. 893.9 ± 43, p 0.02; 902.7 ± 48.7 vs. 932.6 ± 32.6, p 0.01 in radius and tibia respectively). Although cortical thickness was lower in CD patients, it failed to show any significant inter-group difference (a-8% decay with p 0.11 in both bones). Patients with symptomatic CD (n = 22) had a greater bone microarchitectural deficit than those with subclinical CD. HR-pQCT was used to successfully identify significant deterioration in the microarchitecture of trabecular and cortical compartments of peripheral bones. Impairment was characterized by lower trabecular number and thickness-which increased trabecular network heterogeneity-and lower cortical density and thickness. In the prospective follow-up of this group of patients we expect to be able to assess whether bone microarchitecture recovers and to what extend after gluten-free diet. Copyright © 2015 Elsevier Inc. All rights reserved.

[DEFINITION OF INTERRELATION BETWEEN AMINOACID COMPOSITION OF URINE AND BONE TISSUE DENSITY AT CHILDREN WITH ACUTE LEUKAEMIA FOR ONCOHEMATOLOGICAL PATHOLOGY RISK GROUP FORMATION].

PubMed

Bebeshko, V G; Bruslova, E M; Volodina, T T; Tsvietkova, N M; Lyashenko, L A; Pushkareva, T I; Voloshko, V I; Veselskaya, L P; Chernysh, T A; Trikhleb, I V

2014-12-01

Age and sexual indexies of densitometry at patients with acute leukemia (AL) and healthy children are presented. 31% of children with AL during the initial period of disease had manifestations of the osteopenic syndrome. At patients with AL more often than at healthy children anomalies of development of front part of skull are defined. The partial contribution of free and peptides-connencted oxyproline in urine at AL patients differs in comparison with control group that is caused by modification or deficiency of the corresponding enzymes. 30% of patients with AL had raised concentration of free oxyproline in urine, and lowered glycine concentration that testifies to the increased disintegration of collagen and deficiency of tile plastic material necessary for collagene-forming processes. The obtained data should be considered for forming of risk group on oncohematological pathology at children.

[Influence of occupational factors on the bone and joint functional state in the upper extremities and cervical spine in female workers of clothing manufacture].

PubMed

Druzhinin, V N; Shardakova, É F; Cherniĭ, A N

2014-01-01

The studies using multiple X-ray methods covered influence of complex containing working process and occupational environment factors on locomotory apparatus of upper limbs and cervical spine in female seamers engaged into various productions. Comparative analysis involved results of regular (standard X-ray) and special X-ray methods (stereoroentgenography, high definition roentgenography, roentgen densitometry, roentgenogrammetry) in 370 examinees with early and moderate clinical symptoms of occupationally mediated diseases of the stated areas. X-ray studies of locomotory apparatus of upper limbs and cervical spine in clothing manufacture workers, with special diagnostic methods, enabled to determine incidence and severity of functional and structural changes more reliably than via standard examination. The changes revealed were assigned mostly in "early" and "moderate" categories and matched with occupational peculiarities of the workers examined.

Reproducibility of the World Health Organization 2008 criteria for myelodysplastic syndromes

PubMed Central

Senent, Leonor; Arenillas, Leonor; Luño, Elisa; Ruiz, Juan C.; Sanz, Guillermo; Florensa, Lourdes

2013-01-01

The reproducibility of the World Health Organization 2008 classification for myelodysplastic syndromes is uncertain and its assessment was the major aim of this study. The different peripheral blood and bone marrow variables required for an adequate morphological classification were blindly evaluated by four cytomorphologists in samples from 50 patients with myelodysplastic syndromes. The degree of agreement among observers was calculated using intraclass correlation coefficient and the generalized kappa statistic for multiple raters. The degree of agreement for the percentages of blasts in bone marrow and peripheral blood, ring sideroblasts in bone marrow, and erythroid, granulocytic and megakaryocytic dysplastic cells was strong (P<0.001 in all instances). After stratifying the percentages according to the categories required for the assignment of World Health Organization subtypes, the degree of agreement was not statistically significant for cases with 5-9% blasts in bone marrow (P=0.07), 0.1-1% blasts in peripheral blood (P=0.47), or percentage of erythroid dysplastic cells (P=0.49). Finally, the interobserver concordance for World Health Organization-defined subtypes showed a moderate overall agreement (P<0.001), the reproducibility being lower for cases with refractory anemia with excess of blasts type 1 (P=0.05) and refractory anemia with ring sideroblasts (P=0.09). In conclusion, the reproducibility of the World Health Organization 2008 classification for myelodysplastic syndromes is acceptable but the defining criteria for blast cells and features of erythroid dysplasia need to be refined. PMID:23065505

Reproducibility of the World Health Organization 2008 criteria for myelodysplastic syndromes.

PubMed

Senent, Leonor; Arenillas, Leonor; Luño, Elisa; Ruiz, Juan C; Sanz, Guillermo; Florensa, Lourdes

2013-04-01

The reproducibility of the World Health Organization 2008 classification for myelodysplastic syndromes is uncertain and its assessment was the major aim of this study. The different peripheral blood and bone marrow variables required for an adequate morphological classification were blindly evaluated by four cytomorphologists in samples from 50 patients with myelodysplastic syndromes. The degree of agreement among observers was calculated using intraclass correlation coefficient and the generalized kappa statistic for multiple raters. The degree of agreement for the percentages of blasts in bone marrow and peripheral blood, ring sideroblasts in bone marrow, and erythroid, granulocytic and megakaryocytic dysplastic cells was strong (P<0.001 in all instances). After stratifying the percentages according to the categories required for the assignment of World Health Organization subtypes, the degree of agreement was not statistically significant for cases with 5-9% blasts in bone marrow (P=0.07), 0.1-1% blasts in peripheral blood (P=0.47), or percentage of erythroid dysplastic cells (P=0.49). Finally, the interobserver concordance for World Health Organization-defined subtypes showed a moderate overall agreement (P<0.001), the reproducibility being lower for cases with refractory anemia with excess of blasts type 1 (P=0.05) and refractory anemia with ring sideroblasts (P=0.09). In conclusion, the reproducibility of the World Health Organization 2008 classification for myelodysplastic syndromes is acceptable but the defining criteria for blast cells and features of erythroid dysplasia need to be refined.

Dissociation between peripheral blood chimerism and tolerance to hindlimb composite tissue transplants: preferential localization of chimerism in donor bone.

PubMed

Rahhal, Dina N; Xu, Hong; Huang, Wei-Chao; Wu, Shengli; Wen, Yujie; Huang, Yiming; Ildstad, Suzanne T

2009-09-27

Mixed chimerism induces donor-specific tolerance to composite tissue allotransplants (CTAs). In the present studies, we used a nonmyeloablative conditioning approach to establish chimerism and promote CTA acceptance. Wistar Furth (RT1A(u)) rats were conditioned with 600 to 300 cGy total body irradiation (TBI, day-1), and 100 x 10(6) T-cell-depleted ACI (RT1A(abl)) bone marrow cells were transplanted on day 0, followed by a 11-day course of tacrolimus and one dose of antilymphocyte serum (day 10). Heterotopic osteomyocutaneous flap transplantation was performed 4 to 6 weeks after bone marrow transplantation. Mixed chimerism was initially achieved in almost all recipients, but long-term acceptance of CTA was only achieved in rats treated with 600 cGy TBI. When anti-alphabeta-T-cell receptor (TCR) monoclonal antibody (mAb) (day-3) was added into the regimens, donor chimerism was similar to recipients preconditioned without anti-alphabeta-TCR mAb. However, the long-term CTA survival was significantly improved in chimeras receiving more than or equal to 300 cGy TBI plus anti-alphabeta-TCR mAb. Higher levels of donor chimerism were associated with CTA acceptance. The majority of flap acceptors lost peripheral blood chimerism within 6 months. However, donor chimerism persisted in the transplanted bone at significantly higher levels compared with other hematopoietic compartments. The compartment donor chimerism may be responsible for the maintenance of tolerance to CTA. Long-term acceptors were tolerant to a donor skin graft challenge even in the absence of peripheral blood chimerism. Mixed chimerism established by nonmyeloablative conditioning induces long-term acceptance of CTA, which is associated with persistent chimerism preferentially in the transplanted donor bone.

High-sensitivity virus and mycoplasma screening test reveals high prevalence of parvovirus B19 infection in human synovial tissues and bone marrow.

PubMed

Watanabe, Ken; Otabe, Koji; Shimizu, Norio; Komori, Keiichirou; Mizuno, Mitsuru; Katano, Hisako; Koga, Hideyuki; Sekiya, Ichiro

2018-03-27

Latent microorganism infection is a safety concern for the clinical application of mesenchymal stem cells (MSCs). The aim of this study is to investigate the frequencies and sensitivities of the latent virus and mycoplasma infections in synovium, bone marrow, peripheral blood cells, and blood plasma and cultured synovial MSCs. Total DNA and RNA of the synovium (n = 124), bone marrow (n = 123), peripheral blood cells (n = 121), plasma (n = 121), and 14-day cultured synovial MSCs (n = 63) were collected from patients who underwent total knee arthroplasty or anterior ligament reconstruction after written informed consents were obtained. The multiplex polymerase chain reaction (PCR) primers were designed to quantitatively measure the representative genomes of 13 DNA viruses, 6 RNA viruses, and 9 mycoplasmas. Multi-spliced mRNA detection and virus spike test were also performed to demonstrate the sensitivity of synovial MSCs to the candidate pathogens. In synovium and bone marrow, the positive rates of parvovirus B19 genome were significantly higher than in peripheral blood cells (18.7% and 22% vs. 0.8%, respectively). Multi-alignment analysis of amplified and sequenced viral target genes showed the proximity of the parvovirus B19 gene from different tissue in the same patients. Synovial MSCs cultured for 14 days were positive for virus infection only in two patients (2/62 = 3%). Parvovirus B19 multi-spliced mRNAs were not detected in these two samples. Virus spike test demonstrated the sensitivity of synovial MSCs to herpes simplex virus (HSV)1 and cytomegalovirus (CMV), but not to parvovirus B19. This study revealed a relatively high incidence of latent parvovirus B19 in synovium and bone marrow tissue.

Protease-activated receptor 2 in dorsal root ganglion contributes to peripheral sensitization of bone cancer pain.

PubMed

Liu, S; Liu, Y-P; Yue, D-M; Liu, G-J

2014-03-01

Treating bone cancer pain continues to be a major clinical challenge, and the underlying mechanisms of bone cancer pain remain elusive. Protease-activated receptor 2 (PAR2) has been reported to be involved in neurogenic inflammation, nociceptive pain and hyperalgesia. Here, we investigated the role of PAR2 in bone cancer pain development. Expression of PAR2, mechanical allodynia, thermal hyperalgesia and neurochemical alterations induced by bone cancer pain were analysed in male, adult C3H/HeJ mice with tumour cell implantation (TCI). To investigate the contribution of PAR2 to bone cancer pain, PAR2 antagonist peptide and PAR2 knockout mice were used. TCI produced bone cancer-related pain behaviours. Production and persistence of these pain behaviours were well correlated with TCI-induced up-regulation of PAR2 in sciatic nerve and dorsal root ganglia (DRG). PAR2 knockout and spinal administration of PAR2 antagonist peptide prevented and/or reversed bone cancer-related pain behaviours and associated neurochemical changes in DRG and dorsal horn (DH). TCI also induced proteases release in tumour-bearing tibia, sciatic nerve and DRG. Plantar injection of supernatant from sarcoma cells induced PAR2 up-regulation and intracellular calcium [Ca(2+) ]i increase in DRG, and calcitonin gene-related peptide accumulation in DH, as well as significant thermal and mechanical hyperalgesia, which were all in PAR2-dependent manners. These findings suggest that PAR2 may be a key mediator for peripheral sensitization of bone cancer pain. Inhibiting PAR2 activation, especially during the early phase, may be a new therapy for preventing/suppressing development of bone cancer pain. © 2013 European Pain Federation - EFIC®

Association of unipedal standing time and bone mineral density in community-dwelling Japanese women.

PubMed

Sakai, A; Toba, N; Takeda, M; Suzuki, M; Abe, Y; Aoyagi, K; Nakamura, T

2009-05-01

Bone mineral density (BMD) and physical performance of the lower extremities decrease with age. In community-dwelling Japanese women, unipedal standing time, timed up and go test, and age are associated with BMD while in women aged 70 years and over, unipedal standing time is associated with BMD. The aim of this study was to clarify whether unipedal standing time is significantly associated with BMD in community-dwelling women. The subjects were 90 community-dwelling Japanese women aged 54.7 years. BMD of the second metacarpal bone was measured by computed X-ray densitometry. We measured unipedal standing time as well as timed up and go test to assess physical performance of the lower extremities. Unipedal standing time decreased with increased age. Timed up and go test significantly correlated with age. Low BMD was significantly associated with old age, short unipedal standing time, and long timed up and go test. Stepwise regression analysis revealed that age, unipedal standing time, and timed up and go test were significant factors associated with BMD. In 21 participants aged 70 years and over, body weight and unipedal standing time, but not age, were significantly associated with BMD. BMD and physical performance of the lower extremities decrease with older age. Unipedal standing time, timed up and go test, and age are associated with BMD in community-dwelling Japanese women. In women aged 70 years and over, unipedal standing time is significantly associated with BMD.

Construction and validation of a population-based bone densitometry database.

PubMed

Leslie, William D; Caetano, Patricia A; Macwilliam, Leonard R; Finlayson, Gregory S

2005-01-01

Utilization of dual-energy X-ray absorptiometry (DXA) for the initial diagnostic assessment of osteoporosis and in monitoring treatment has risen dramatically in recent years. Population-based studies of the impact of DXA and osteoporosis remain challenging because of incomplete and fragmented test data that exist in most regions. Our aim was to create and assess completeness of a database of all clinical DXA services and test results for the province of Manitoba, Canada and to present descriptive data resulting from testing. A regionally based bone density program for the province of Manitoba, Canada was established in 1997. Subsequent DXA services were prospectively captured in a program database. This database was retrospectively populated with earlier DXA results dating back to 1990 (the year that the first DXA scanner was installed) by integrating multiple data sources. A random chart audit was performed to assess completeness and accuracy of this dataset. For comparison, testing rates determined from the DXA database were compared with physician administrative claims data. There was a high level of completeness of this database (>99%) and accurate personal identifier information sufficient for linkage with other health care administrative data (>99%). This contrasted with physician billing data that were found to be markedly incomplete. Descriptive data provide a profile of individuals receiving DXA and their test results. In conclusion, the Manitoba bone density database has great potential as a resource for clinical and health policy research because it is population based with a high level of completeness and accuracy.

Premature greying of the hair is not associated with low bone mineral density.

PubMed

Beardsworth, S A; Kearney, C E; Steel, S A; Newman, J; Purdie, D W

1999-01-01

In two recent case-control studies premature greying of the hair was associated with a lowering of bone mineral density (BMD) and osteopenia, suggesting that this might be a clinically useful risk marker for osteoporosis. We report a further re-examination of this proposal in 52 prematurely grey-haired women from East Yorkshire who responded to an advertisement inviting them for bone densitometry. Thirty-five had no clinical or drug history that could influence bone density. All were Caucasian with a mean age of 52.8 years. In the group as a whole the mean BMD values at the lumbar spine and femoral neck were no different from those of a young adult, but there was a trend toward a greater than average BMD than that of the local age-matched population (p = 0.097 and 0.218, respectively). Twenty women were premenopausal, with an average age of 45.3 years. Mean BMD values at the lumbar spine and femoral neck in this group were no different from those of young adults. There was, however, a trend toward a BMD greater than that of the local age-matched population at the femoral neck (p = 0.117). Fifteen women were postmenopausal with an average age of 62.9 years and an average age at menopause of 51.1 years. Mean BMD values at both the lumbar spine and femoral neck in this group were lower than those of young adults, but no different from those of the local age-matched population. In conclusion, our group of prematurely grey-haired women had average BMD for their age, and we are therefore unable to support the proposed clinical usefulness of premature greying as a risk marker for osteoporosis.

Cost-minimization study comparing annual infusion of zoledronic acid or weekly oral alendronate in women with low bone mineral density.

PubMed

Chávez-Valencia, Venice; Arce-Salinas, César Alejandro; Espinosa-Ortega, Fabricio

2014-01-01

Cost-minimization study to assess the annual direct costs of 2 antiresorptive strategies in postmenopausal women with low bone mineral densities (BMDs). Patients were randomly assigned to receive 70 mg of oral weekly alendronate or a 1-time 5mg of intravenous zoledronic acid. All medical and nonmedical direct costs were recorded for 1 yr. Student's t-test or the Chi-squared test was used. A total of 101 postmenopausal women were enrolled with a mean age of 58.3 ± 7.6 yr and a postmenopausal period of 13.5 ± 8.3 yr. A total of 50 patients completed 1 yr of alendronate and 51 patients received zoledronic acid. At baseline, no differences were seen between the 2 groups in anthropometric measures, comorbidities, and bone mineral density. The costs for medical attention for low bone mass were $81,532 (US Dollars) for the alendronate group and $69,251 for the zoledronic acid group; the cost per patient was $1631 in the alendronate group vs $1358 in the zoledronic acid group (p<0.0001). Therefore, zoledronic acid treatment provided an annual savings of 15% of the direct costs compared with oral alendronate treatment. Moreover, there was a significant increase in lumbar spine T-scores in the zoledronic acid group when compared with the alendronate group. Annual zoledronic acid infusion as an antiresorptive treatment in women with low BMD provides significant monetary savings when compared with weekly alendronate therapy for 1 yr. Zoledronic acid infusion is also linked to higher increase in BMD and compliance. Copyright © 2014 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

[Number of teeth and hormonal profile of postmenopausal women with osteoporosis, osteopenia and normal bone mineral density--a preliminary study].

PubMed

Stagraczyński, Maciej; Kulczyk, Tomasz; Leszczyński, Piotr; Męczekalski, Błażej

2015-10-01

Profound hypoestrogenism causes increased risk of osteoporosis and bone fracture in menopause. This period of women life is also characterized by decrease number of teeth and deterioration of oral cavity health. The aim of the study was to assess the number of teeth, hormonal profile (Follicle-stimualting hormone (FSH), estradiol (E2), testosterone (T) and dehydroepiandrosterone sulphate (DHEA-S) and the bone mineral density (BMD) of the lumbar part of the spine in postmenopausal women with osteoporosis, osteopenia and normal BMD. The next step of the study was to determine whether there was a correlation between vertebral mineral bone density, the hormonal profile and the number of teeth. A total number of 47 women was involved in the study. Based on the results of densitometry tests (DEXA) of vertebral column the subjects were divided into 3 groups: 10 with osteoporosis, 20 with osteopenia and 17 with normal BMD. All the subjects had undergone a hormonal assessment which included blood serum estimation for FSH, E2, DHEA-S and T levels. Also the total number of teeth present was recorded. Serum estradiol and testosterone levels in postmenopausal women were found to be positively correlated with the number of teeth present. A negative correlation was found between age and the number of maxillary teeth in postmenopausal women with osteopenia. There was no influence of serum FSH, estradiol, testosterone and DHEA-S levels on vertebral BMD loss in postmenopausal women. There was no correlation between teeth number and BMD of vertebral column. Serum levels of estradiol and testosterone in postmenopausal women positively correlate with teeth numbers. Age is the main risk factor for teeth loss in postmenopausal women. © 2015 MEDPRESS.

High prevalence of morphometric vertebral deformities in patients with inflammatory bowel disease.

PubMed

Heijckmann, Anna Caroline; Huijberts, Maya S P; Schoon, Erik J; Geusens, Piet; de Vries, Jolanda; Menheere, Paul P C A; van der Veer, Eveline; Wolffenbuttel, Bruce H R; Stockbrugger, Reinhold W; Dumitrescu, Bianca; Nieuwenhuijzen Kruseman, Arie C

2008-08-01

Earlier studies have documented that the prevalence of decreased bone mineral density (BMD) is elevated in patients with inflammatory bowel disease. The objective of this study was to investigate the prevalence of vertebral deformities in inflammatory bowel disease patients and their relation with BMD and bone turnover. One hundred and nine patients with Crohn's disease (CD) and 72 with ulcerative colitis (UC) (age 44.5+/-14.2 years) were studied. BMD of the hip (by dual X-ray absorptiometry) was measured and a lateral single energy densitometry of the spine for assessment of vertebral deformities was performed. Serum markers of bone resorption (carboxy-terminal cross-linked telopeptide of type I collagen) and formation (procollagen type I amino-terminal propeptide) were measured, and determinants of prevalent vertebral deformities were assessed using logistic regression analysis. Vertebral deformities were found in 25% of both CD and UC patients. Comparing patients with and without vertebral deformities, no significant difference was found between Z-scores and T-scores of BMD, or levels of serum carboxy-terminal cross-linked telopeptide of type I collagen and serum procollagen type I amino-terminal propeptide. Using logistic regression analysis the only determinant of any morphometric vertebral deformity was sex. The presence of multiple vertebral deformities was associated with older age and glucocorticoid use. The prevalence of morphometric vertebral deformities is high in CD and UC. Male sex, but neither disease activity, bone turnover markers, clinical risk factors, nor BMD predicted their presence. The determinants for having more than one vertebral deformity were age and glucocorticoid use. This implies that in addition to screening for low BMD, morphometric assessment of vertebral deformities is warranted in CD and UC.

Risk factors for stress fracture among young female cross-country runners.

PubMed

Kelsey, Jennifer L; Bachrach, Laura K; Procter-Gray, Elizabeth; Nieves, Jeri; Greendale, Gail A; Sowers, Maryfran; Brown, Byron W; Matheson, Kim A; Crawford, Sybil L; Cobb, Kristin L

2007-09-01

To identify risk factors for stress fracture among young female distance runners. Participants were 127 competitive female distance runners, aged 18-26, who provided at least some follow-up data in a randomized trial among 150 runners of the effects of oral contraceptives on bone health. After completing a baseline questionnaire and undergoing bone densitometry, they were followed an average of 1.85 yr. Eighteen participants had at least one stress fracture during follow-up. Baseline characteristics associated (P<0.10) in multivariate analysis with stress fracture occurrence were one or more previous stress fractures (rate ratio [RR] [95% confidence interval]=6.42 (1.80-22.87), lower whole-body bone mineral content (RR=2.70 [1.26-5.88] per 1-SD [293.2 g] decrease), younger chronologic age (RR=1.42 [1.05-1.92] per 1-yr decrease), lower dietary calcium intake (RR=1.11 [0.98-1.25] per 100-mg decrease), and younger age at menarche (RR=1.92 [1.15-3.23] per 1-yr decrease). Although not statistically significant, a history of irregular menstrual periods was also associated with increased risk (RR=3.41 [0.69-16.91]). Training-related factors did not affect risk. The results of this and other studies indicate that risk factors for stress fracture among young female runners include previous stress fractures, lower bone mass, and, although not statistically significant in this study, menstrual irregularity. More study is needed of the associations between stress fracture and age, calcium intake, and age at menarche. Given the importance of stress fractures to runners, identifying preventive measures is of high priority.

Bone health status of postmenopausal Chinese women.

PubMed

Lo, Sue S T

2015-12-01

To evaluate the prevalence of osteoporosis in treatment-naïve postmenopausal women, their treatment adherence, and the risk factors for osteoporosis. Cross-sectional study of bone density reports, a self-administered health checklist, and computerised consultation records. Primary care sexual and reproductive health service in Hong Kong. Postmenopausal Chinese women who had never received osteoporosis treatment or hormone replacement therapy. Each woman completed a checklist of risk factors for osteoporosis, menopause age, history of hormone replacement therapy, and osteoporosis treatment prior to undergoing bone mineral density measurement at the postero-anterior lumbar spine and left femur. The consultation records of those with osteoporosis were reviewed to determine their treatment adherence. T-score at the spine and hip, presence or absence of risk factors for osteoporosis, and treatment adherence. Between January 2008 and December 2011, 1507 densitometries were performed for eligible women; 51.6% of whom were diagnosed with osteopenia and 25.7% with osteoporosis. The mean age of women with normal bone mineral density, osteopenia, and osteoporosis was 57.0, 58.0, and 59.7 years, respectively. Approximately half of them had an inadequate dietary calcium intake, performed insufficient weight-bearing exercise, or had too little sun exposure. Logistic regression analysis revealed that age, body mass index of <18.5 kg/m(2), parental history of osteoporosis or hip fracture, and duration of menopause were significant risk factors for osteoporosis. Among those with osteoporosis, 42.9% refused treatment, 30.7% complied with treatment, and 26.3% discontinued treatment or defaulted from follow-up. Those who refused treatment were significantly older. Osteoporosis is prevalent in postmenopausal women. Only 50% adopted primary prevention strategies. Almost 70% refused treatment or stopped prematurely.

Comparative effects of denosumab or bisphosphonate treatment on bone mineral density and calcium metabolism in postmenopausal women.

PubMed

Augoulea, A; Tsakonas, E; Triantafyllopoulos, I; Rizos, D; Armeni, E; Tsoltos, N; Tournis, S; Deligeoroglou, E; Antoniou, A; Lambrinoudaki, I

2017-03-01

To clarify potential differences between denosumab (DNS) and bisphosphonates (BIS) in terms of bone density and bone metabolism, in a sample of postmenopausal women. A total of 113 postmenopausal women aged 53-66 years were treated with either DNS or BIS for 12 months. Bone densitometry and laboratory tests were compared between baseline and follow-up. Femoral neck BMD increased in both treatment-arms (FN-BMD, DNS: 0.69±0.07 g/cm 2 to 0.75±0.09 g/cm 2 ; BIS: 0.69±0.06 g/cm 2 to 0.71±0.07 g/cm 2 ; p≤0.001 in both cases). Lumbar spine BMD (LS-BMD) increased significantly only in the DNS-group (0.83±0.14 g/cm 2 to 0.89±0.14 g/cm 2 , p=0.0001). Only women under treatment with DNS had a significant increase in serum parathyroid hormone (PTH: 44.87±17.54 pg/mL to 53.27±15.77 pg/mL, p=0.04), independently of baseline vitamin D levels. DNS-administration resulted in higher increase from baseline in FN-BMD compared to BIS (DNS vs BIS: 8.7%±8.5 vs 3.8%±7.3, p=0.004). Finally, baseline 25OH vitamin D levels did not determine the extent of PTH-increase following administration of DNS- or BIS-treatment. Both treatments increased BMD, however, the effect of DNS on FN-BMD was superior compared to that of BIS. DNS-treatment increased serum PTH. Baseline 25OH vitamin D levels did not predict the extent of PTH increase at follow-up.

Comparison of bone density in amenorrheic women due to athletics, weight loss, and premature menopause.

PubMed

Jones, K P; Ravnikar, V A; Tulchinsky, D; Schiff, I

1985-07-01

Studied was the peripheral bone density of 39 women (ages 18 to 43) with the diagnosis of secondary amenorrhea in an effort to define the population of amenorrheic women at risk for osteoporosis. Eight women had exercise-induced amenorrhea (athletes), 20 women had amenorrhea associated with weight loss, and 11 women had premature menopause. These diagnoses were made on the basis of history, physical examination, and luteinizing hormone (LH), follicle-stimulating hormone (FSH), and prolactin levels, and failure to have withdrawal bleeding after the administration of progestin. Twenty-five nonathletic, normally menstruating women served as control subjects. The peripheral bone density of the amenorrheic athletes (0.738 g/cm2 +/- 0.047) was not significantly different from that of the controls (0.726 g/cm2 +/- 0.044). The average bone density of the group with weight loss-associated amenorrhea (0.672 g/cm2 +/- 0.066) was significantly less than controls (P less than .005) as was that of the women with premature menopause (0.616 g/cm2 +/- 0.048, P less than .001). There was a significant correlation between months of amenorrhea and decrease in bone density (r = 0.506, P less than .001). From this study it was concluded that women with exercise-associated amenorrhea are not at significant risk for cortical bone loss as measured by direct photon absorptiometry. Women with weight loss-associated amenorrhea and women with premature menopause are at significant risk for bone loss when compared with normal controls.

ω-3 Fatty Acids Reduce Chemotherapy-Induced Hematological Toxicity by Bone Marrow Stimulation in Mice.

PubMed

Murakami, Kohei; Miyata, Hiroshi; Miyazaki, Yasuhiro; Makino, Tomoki; Takahashi, Tsuyoshi; Kurokawa, Yukinori; Yamasaki, Makoto; Nakajima, Kiyokazu; Takiguchi, Shuji; Mori, Masaki; Doki, Yuichiro

2017-07-01

ω-3 Fatty acids exert several benefits during chemotherapy, such as preventing intestinal mucosal damage and improving response to chemotherapy. However, little is known about the effect of ω-3 fatty acids on chemotherapy-induced hematological toxicities. Mice that had consumed either an ω-3-rich or an ω-3-poor diet for 2 weeks were intraperitoneally administered cisplatin. The resultant changes in blood cell count, bone marrow cell count, and cytokine levels in bone marrow supernatant were analyzed. The effect of ω-3 fatty acids on human peripheral blood mononuclear cells (PBMCs) exposed to cisplatin was also examined. Although peripheral blood cell counts decreased after cisplatin treatment in both groups of mice, the decrease in white blood cell count was significantly lower in mice that consumed the ω-3-rich diet. The decrease in bone marrow cells after cisplatin treatment was also reduced in mice that consumed the ω-3-rich diet. Levels of stem cell factor (SCF) and fibroblast growth factor 1 (FGF-1) were significantly higher in bone marrow supernatants from mice that consumed the ω-3-rich diet. The rate of apoptosis in PBMCs (after exposure to cisplatin) cultured in medium containing ω-3 fatty acids was significantly lower than in PBMCs cultured in control medium. ω-3-Rich diets reduced chemotherapy-induced leukopenia in mice. This may be the result of increased numbers of bone marrow cells due to higher levels of SCF and FGF-1 in the bone marrow.

The Role of Peripheral Nerve Function in Age-Related Bone Loss and Changes in Bone Adaptation

DTIC Science & Technology

2015-12-01

scratch response in development of spontaneous dermatitis in NC/Nga mice. Br J Dermatol 2004;151:335-45. 32. Nakano T, Andoh T, Sasaki A, Nojima H, Kuraishi... contact a stripe of brain derived neurotrophic factor becomes the axon [16]. During neuron growth, mitochondria, membrane vesicles, proteins involved in...epiphyseal bone marrow [27]. The CGRP containing neurons in rat femurs near the growth plate come in contact with osteoclasts [21]. Neuropeptide

Skeletal adaptations associated with pre-pubertal gymnastics participation as determined by DXA and pQCT: a systematic review and meta-analysis.

PubMed

Burt, Lauren A; Greene, David A; Ducher, Gaele; Naughton, Geraldine A

2013-05-01

Participation in gymnastics prior to puberty offers an intriguing and unique model, particularly in girls. The individuality comes from both upper and lower limbs being exposed to high mechanical loading through year long intensive training programs, initiated at a young age. Studying this unique model and the associated changes in musculoskeletal health during growth is an area of specific interest. Previous reviews on gymnastics participation and bone health have been broad; and not limited to a particular maturation period, such as pre-puberty. To determine the difference in skeletal health between pre-pubertal girls participating in gymnastics compared with non-gymnasts. Meta-analysis. Following a systematic search, 17 studies were included in this meta-analysis. All studies used dual-energy X-ray absorptiometry to assess bone mineral density and bone mineral content. In addition, two studies included peripheral quantitative computed tomography. Following the implementation of a random effects model, gymnasts were found to have greater bone properties than non-gymnasts. The largest difference in bone health between gymnasts and non-gymnasts was observed in peripheral quantitative computed tomography-derived volumetric bone mineral density at the distal radius (d=1.06). Participation in gymnastics during pre-pubertal growth was associated with skeletal health benefits, particularly to the upper body. Copyright © 2012 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.

Telomerase gene therapy rescues telomere length, bone marrow aplasia, and survival in mice with aplastic anemia.

PubMed

Bär, Christian; Povedano, Juan Manuel; Serrano, Rosa; Benitez-Buelga, Carlos; Popkes, Miriam; Formentini, Ivan; Bobadilla, Maria; Bosch, Fatima; Blasco, Maria A

2016-04-07

Aplastic anemia is a fatal bone marrow disorder characterized by peripheral pancytopenia and marrow hypoplasia. The disease can be hereditary or acquired and develops at any stage of life. A subgroup of the inherited form is caused by replicative impairment of hematopoietic stem and progenitor cells due to very short telomeres as a result of mutations in telomerase and other telomere components. Abnormal telomere shortening is also described in cases of acquired aplastic anemia, most likely secondary to increased turnover of bone marrow stem and progenitor cells. Here, we test the therapeutic efficacy of telomerase activation by using adeno-associated virus (AAV)9 gene therapy vectors carrying the telomerase Tert gene in 2 independent mouse models of aplastic anemia due to short telomeres (Trf1- and Tert-deficient mice). We find that a high dose of AAV9-Tert targets the bone marrow compartment, including hematopoietic stem cells. AAV9-Tert treatment after telomere attrition in bone marrow cells rescues aplastic anemia and mouse survival compared with mice treated with the empty vector. Improved survival is associated with a significant increase in telomere length in peripheral blood and bone marrow cells, as well as improved blood counts. These findings indicate that telomerase gene therapy represents a novel therapeutic strategy to treat aplastic anemia provoked or associated with short telomeres. © 2016 by The American Society of Hematology.

Central and peripheral fat body mass have a protective effect on osteopenia or osteoporosis in adults and elderly?

PubMed

Freitas, P M S S; Garcia Rosa, M L; Gomes, A M; Wahrlich, V; Di Luca, D G; da Cruz Filho, R A; da Silva Correia, D M; Faria, C A; Yokoo, E M

2016-04-01

This cross-sectional study involves randomly selected men aged 50 to 99 years and postmenopausal women. Either central fat mass or peripheral fat mass were associated to osteoporosis or osteopenia independently from fat-free body mass and other confounding factors. Obesity and osteoporosis are public health problems that probably share common pathophysiological mechanisms. The question if body fat mass, central or peripheral, is protective or harmful for osteoporosis or osteopenia is not completely resolved. This study aims to investigate the association between osteoporosis or osteopenia, and fat body mass (central and peripheral) independently from fat-free body mass, in men aged 50 to 99 years old and postmenopausal women randomly selected in the community. This is a cross-sectional investigation with a random sample of registered population in Niterói Family Doctor Program (FDP), State of Rio de Janeiro, Brazil. Bone mineral density (BMD) and fat-free mass were assessed by dual X-ray absorptiometry (DXA). There was statistically significant bivariate association between bone loss with gender, age, skin color, alcohol consumption at risk dose, use of thiazide, fat-free body mass, and fat body mass (central and peripheral). In the multiple analysis of fat-free body mass, central and peripheral fat body mass showed an independent and protective effect on the presence of osteoporosis or osteopenia (p value <0.001). Since both obesity and osteoporosis are public health problems worldwide, strategies aimed at preventing both conditions should be encouraged during aging.

The Factors Affecting Bone Density in Cirrhosis

PubMed Central

Hajiabbasi, Asghar; Shafaghi, Afshin; Fayazi, Haniyeh Sadat; Shenavar Masooleh, Irandokht; Hedayati Emami, Mohammad Hassan; Ghavidel Parsa, Pooneh; Amir Maafi, Alireza

2015-01-01

Background: Bone loss is common in cirrhosis. However, the prevalence of osteopenia and osteoporosis has been heterogeneous in different reports. Reduction in bone formation with or without increase in bone resorption appears to be responsible for bone loss in these patients. Objectives: We aimed to investigate bone loss in patients with cirrhosis at different anatomical sites and key factors that might affect it. Patients and Methods: In this cross-sectional study, 97 patients with cirrhosis who were referred to Razi Hospital, Rasht, Iran, from 2008 to 2010, were studied. Cirrhosis was diagnosed using biopsy and/or clinical and paraclinical findings. Bone mineral densitometry was done in L2 through L4 lumbar spine (LS) and femoral neck (FN), using dual-energy X-ray absorptiometry (DEXA) (QDR 1000, Hologic DEXA Inc, Waltham, Massachusetts, the United States). Statistical analysis was performed using SPSS 18. A P value < 0.05 was considered statistically significant. Results: A total of 97 patients with cirrhosis (55.7% male) and the mean age of 51 ± 13 years and median body mass index (BMI) of 22.7 kg/m2 were recruited over a two-year period. Etiologies of cirrhosis were hepatitis C (40.2%), hepatitis B (26.8%), cryptogenic (21.6%), and other causes (11.4%). Child A, B, and C, were seen in 16.5%, 47.4%, and 36.1% of patients, respectively. The DEXA results were abnormal in 78.4% of our participants (osteopenia, 45.4%; osteoporosis, 33%). BMI and calculated glomerular filtration rate (GFRc) had moderate positive and Child score had moderate negative significant correlation with T score in both anatomical sites. There was no significant association between abnormal DEXA and the causes of cirrhosis. The univariate analysis showed that the risk of abnormal results in DEXA was significantly higher in those with low BMI, current smoking, higher Child score, and low GFRc; however, in multivariate analysis, the abnormal results were more frequent in those with lower vitamin D, higher Child score, and less GFRc. Conclusions: Abnormal DEXA was highly prevalent among patients with cirrhosis. The risk of this finding was increased by lower vitamin D levels, advanced disease, and impaired renal function. PMID:25977695

Calcium supplementation does not augment bone gain in young women consuming diets moderately low in calcium.

PubMed

Barger-Lux, M Janet; Davies, K Michael; Heaney, Robert P

2005-10-01

In earlier observational work, the dietary calcium:protein ratio was directly related to bone accrual in healthy postadolescent women. In this study, we sought to test the hypothesis that augmented calcium intake would increase postadolescent skeletal consolidation, using a double-blind, randomized, placebo-controlled design. We recruited 152 healthy young women (age 23.1 +/- 2.7 y, BMI 22.5 +/- 3.0 kg/m2); their usual diets, as assessed by 7-d food diaries, were low in calcium (605 +/- 181 mg/d; 15.1 +/- 4.5 mmol/d) and in the calcium:protein ratio (10.1 +/- 2.0 mg/g). The subjects were randomly assigned to supplemental calcium [500 mg calcium (12.5 mmol) as the carbonate, 3 times/d, with meals] or placebo capsules identical in appearance; all participants also took a daily multivitamin, and they were followed for up to 36 mo with bone densitometry (dual energy X-ray absorptiometry; DXA) at 6-mo intervals. A total of 121 subjects remained in the study for at least 12 mo (median time in the study, 35 mo), with a mean compliance level (observed/expected tablet consumption) of 87.7%. DXA data for these 121 subjects indicated modest but significant mean rates of increase (i.e., 0.24 to 1.10%/y) in bone mineral content (BMC; total body, total hip, and lumbar spine) and in lumbar spine bone mineral density (BMD) but no change in total hip BMD. None of these rates of change differed by group, i.e., calcium supplementation did not have any measurable effect on bone mass accrual. By midstudy, the calcium content of the subjects' usual diets for both groups had risen by approximately 15%. The combined effect of improved intakes of dietary calcium and the small amount of calcium added by the multivitamin tablets resulted in a mean calcium intake for the control group > 800 mg (20 mmol)/d, possibly at or near the threshold beyond which additional calcium has no further effect on bone accrual.

A DXA Whole Body Composition Cross-Calibration Experience: Evaluation With Humans, Spine, and Whole Body Phantoms.

PubMed

Krueger, Diane; Libber, Jessie; Sanfilippo, Jennifer; Yu, Hui Jing; Horvath, Blaine; Miller, Colin G; Binkley, Neil

2016-01-01

New densitometer installation requires cross-calibration for accurate longitudinal assessment. When replacing a unit with the same model, the International Society for Clinical Densitometry recommends cross-calibrating by scanning phantoms 10 times on each instrument and states that spine bone mineral density (BMD) should be within 1%, whereas total body lean, fat, and %fat mass should be within 2% of the prior instrument. However, there is limited validation that these recommendations provide adequate total body cross-calibration. Here, we report a total body cross-calibration experience with phantoms and humans. Cross-calibration between an existing and new Lunar iDXA was performed using 3 encapsulated spine phantoms (GE [GE Lunar, Madison, WI], BioClinica [BioClinica Inc, Princeton, NJ], and Hologic [Hologic Inc, Bedford, MA]), 1 total body composition phantom (BioClinica), and 30 human volunteers. Thirty scans of each phantom and a total body scan of human volunteers were obtained on each instrument. All spine phantom BMD means were similar (within 1%; <-0.010 g/cm2 bias) between the existing and new dual-energy X-ray absorptiometry unit. The BioClinica body composition phantom (BBCP) BMD and bone mineral content (BMC) values were within 2% with biases of 0.005 g/cm2 and -3.4 g. However, lean and fat mass and %fat differed by 4.6%-7.7% with biases of +463 g, -496 g, and -2.8%, respectively. In vivo comparison supported BBCP data; BMD and BMC were within ∼2%, but lean and fat mass and %fat differed from 1.6% to 4.9% with biases of +833 g, -860 g, and -1.1%. As all body composition comparisons exceeded the recommended 2%, the new densitometer was recalibrated. After recalibration, in vivo bias was lower (<0.05%) for lean and fat; -23 and -5 g, respectively. Similarly, BBCP lean and fat agreement improved. In conclusion, the BBCP behaves similarly, but not identical, to human in vivo measurements for densitometer cross-calibration. Spine phantoms, despite good BMD and BMC agreement, did not detect substantial lean and fat differences observed using BBCP and in vivo assessments. Consequently, spine phantoms are inadequate for dual-energy X-ray absorptiometry whole body composition cross-calibration. Copyright © 2016 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Bisphosphonates for prevention of postmenopausal osteoporosis.

PubMed

Ravn, Pernille

2002-02-01

Our studies showed that 5 mg alendronate per day was the lowest, most effective dose that persistently prevented bone loss in recently postmenopausal women with normal bone mass. The effect on bone mass and biochemical markers was found comparable to that of commonly recommended regimens of postmenopausal HRT, and 5 mg alendronate per day is suggested as a new option for prevention of postmenopausal osteoporosis. HRT must, however, still be considered the first choice for this indication because of additional beneficial effects on other organ systems. The effect of alendronate was unaffected by bone or fat mass status, but increased with increasing postmenopausal age. The implications were that alendronate stabilized bone mass to a comparable extent in women at particular risk of osteoporosis because of thin body habitus or low bone mass and in healthy postmenopausal women with normal bone mass. Calcium supplementation was insufficient to prevent bone loss and did not add an effect on bone metabolism when combined with alendronate treatment in recently postmenopausal women. The gastrointestinal risk and adverse event profile of 5 mg alendronate per day was comparable to that of placebo, and this dose of alendronate appeared safe for long-term use. Bone loss resumed at a normal postmenopausal rate promptly after withdrawal of alendronate in early postmenopausal women consistent with a substantial underlying natural bone loss during early menopause. Oral ibandronate increased bone mass at all skeletal regions in elderly postmenopausal women with low bone mass, and 2.5 mg ibandronate per day was the lowest dose with this effect. The results are indicative of ibandronate as an option for secondary prevention of postmenopausal osteoporosis, but longer-term phase III trials should be performed before ibandronate can be recommended for this indication. The study showed that 2.5 mg ibandronate per day was efficient for prevention of bone loss and increment in bone mass in a population of women at particular risk of osteoporosis because of low bone mass. There were no differences between 2.5 mg ibandronate per day and placebo in terms of side effects, including complaints from the gastrointestinal tract, and ibandronate appeared safe for longer-term use in this dosing. Bone loss resumed at a normal postmenopausal rate when treatment was withdrawn. The response in bone mass and biochemical markers indicated that 2.5 mg ibandronate per day is equivalent to 10 mg alendronate per day in postmenopausal women. Our studies of two recently developed biochemical markers, urine CTX and serum total OC, showed that bone turnover was lowest in the premenopausal period, where these biochemical markers furthermore revealed a negative association with bone mass. It indicated that increased bone turnover contributes to a small premenopausal bone loss and resulting lowered bone mass. In consistence, a small premenopausal bone loss was observed in some regions of the hip. The biochemical markers increased at the time of menopause, consistent with initiation of the postmenopausal bone loss, and became gradually more negatively associated with bone mass as time past the menopause increased. The biochemical markers were furthermore higher in postmenopausal women with low bone mass, consistent with the characterization of postmenopausal osteoporosis as a condition with increased bone turnover. Our results consistently indicated a central role of increased bone turnover for development of low bone mass and osteoporosis. It is, however, also important to stress that the associations between biochemical markers and bone mass were too weak to allow for a valid individual estimation of bone mass based on biochemical markers. In contrast, the biochemical markers were shown as valid tools for monitoring and prediction of treatment effect of bisphosphonates. CTX, NTX, and total OC revealed the best performance characteristics in this respect. Six months after start of treatment, the level of suppression of these biochemical markers of bone resorption and formation accurately reflected the size of the 1-2 year response in bone mass in groups of women treated with bisphosphonate. This was a clear advance over bone densitometry, which has a precision error in the area of the anticipated yearly bone mass response during bisphosphonate therapy. The relationship was consistent during treatment with alendronate or ibandronate and in younger or elderly postmenopausal women. In individual patients, cut-off values of an about 40% decrease in urine CTX or NTX and an about 20% decrease in total OC validly predicted long-term prevention of bone loss. The sensitivity of prediction was high, but the specificity low. This implicated that the biochemical markers could be used as an exact method to detect "responders" to therapy, whereas "non-responders" to bisphosphonate treatment should be detected with bone densitometry in patients who do not reveal a decrease below the cut-off value in the biochemical marker during treatment. However, before such approach can be generally recommended the cut-off values of the biochemical markers should be validated in future clinical trials of bisphosphonate. Postmenopausal osteoporosis develops slowly over many years and mainly becomes a significant individual and socio-economic health problem 1-3 decades after the menopause. Prevention of postmenopausal osteoporosis by bisphosphonates is therefore likely to imply a treatment regimen of at least a decade, as presently recommended for HRT (Consensus Development Statement 1997). However, future cost-effectiveness studies should reveal when bisphosphonate treatment should ideally be initiated. Our studies showed that the bisphosphonates were effective over the range from general recommendation (recently postmenopausal women with normal bone mass) to a reservation for women at particular risk of osteoporosis (elderly women, thin women, or women with osteopenia). Presently available biochemical markers could be used for groupwise and individual monitoring and prediction of treatment response. Most presently available biochemical markers, however, have the drawback of a low specificity. Recent studies of CTX measured in serum are promising, and indicate that this new biochemical marker might have overcome these drawbacks due to a pronounced response to treatment and a low long-term biological variation (Christgau et al. 1998b, Rosen et al. 1998, and 2000).

Quantitative in vivo assessment of bone microarchitecture in the human knee using HR-pQCT.

PubMed

Kroker, Andres; Zhu, Ying; Manske, Sarah L; Barber, Rhamona; Mohtadi, Nicholas; Boyd, Steven K

2017-04-01

High-resolution peripheral quantitative computed tomography (HR-pQCT) is a novel imaging modality capable of visualizing bone microarchitecture in vivo at human peripheral sites such as the distal radius and distal tibia. This research has extended the technology to provide a non-invasive assessment of bone microarchitecture at the human knee by establishing new hardware, imaging protocols and data analysis. A custom leg holder was developed to stabilize a human knee centrally within a second generation HR-pQCT field of view. Five participants with anterior cruciate ligament reconstructions had their knee joint imaged in a continuous scan of 6cm axially. The nominal isotropic voxel size was 60.7μm. Bone mineral density and microarchitecture were assessed within the weight-bearing regions of medial and lateral compartments of the knee at three depths from the weight-bearing articular bone surface, including both the cortical and trabecular bone regions. Scan duration was approximately 18min per knee and produced 5GB of projection data and 10GB of reconstructed image data (2304×2304 image matrix, 1008 slices). Motion during the scan was minimized by the leg holder and was similar in magnitude as a scan of the distal tibia. Bone mineral density and microarchitectural parameters were assessed for 16 volumes of interest in the tibiofemoral joint. This is a new non-invasive in vivo assessment tool for bone microarchitecture in the human knee that provides an opportunity to gain insight into normal, injured and surgically reconstructed human knee bone architecture in cross-sectional or longitudinal studies. Crown Copyright © 2017. Published by Elsevier Inc. All rights reserved.

Pattern of Bone Generation after Irradiation in Vascularized Tissue Engineered Constructs.

PubMed

Eweida, Ahmad; Fathi, Ibrahim; Eltawila, Ahmed M; Elsherif, Ahmad M; Elkerm, Yasser; Harhaus, Leila; Kneser, Ulrich; Sakr, Mahmoud F

2018-02-01

 Regenerative medicine modalities provide promising alternatives to conventional reconstruction techniques but are still deficient after malignant tumor excision or irradiation due to defective vascularization.  We investigated the pattern of bone formation in axially vascularized tissue engineering constructs (AVTECs) after irradiation in a study that mimics the clinical scenario after head and neck cancer. Heterotopic bone generation was induced in a subcutaneously implanted AVTEC in the thigh of six male New Zealand rabbits. The tissue construct was made up of Nanobone (Artoss GmbH; Rostock, Germany) granules mixed with autogenous bone marrow and 80 μL of bone morphogenic protein-2 at a concentration of 1.5 μg/μL. An arteriovenous loop was created microsurgically between the saphenous vessels and implanted in the core of the construct to induce axial vascularization. The constructs were subjected to external beam irradiation on postoperative day 20 with a single dose of 15 Gy. The constructs were removed 20 days after irradiation and subjected to histological and immunohistochemical analysis for vascularization, bone formation, apoptosis, and cellular proliferation.  The vascularized constructs showed homogenous vascularization and bone formation both in their central and peripheral regions. Although vascularity, proliferation, and apoptosis were similar between central and peripheral regions of the constructs, significantly more bone was formed in the central regions of the constructs.  The study shows for the first time the pattern of bone formation in AVTECs after irradiation using doses comparable to those applied after head and neck cancer. Axial vascularization probably enhances the osteoinductive properties in the central regions of AVTECs after irradiation. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.

The 18 kDa Translocator Protein (Peripheral Benzodiazepine Receptor) Expression in the Bone of Normal, Osteoprotegerin or Low Calcium Diet Treated Mice

PubMed Central

Kam, Winnie Wai-Ying; Meikle, Steven R.; Dunstan, Colin R.; Banati, Richard B.

2012-01-01

The presence of the translocator protein (TSPO), previously named as the mitochondrial or peripheral benzodiazepine receptor, in bone cells was studied in vitro and in situ using RT-qPCR, and receptor autoradiography using the selective TSPO ligand PK11195. In vitro, the TSPO is highly expressed in osteoblastic and osteoclastic cells. In situ, constitutive expression of TSPO is found in bone marrow and trabecular bone, e.g., spongiosa. Mice with a reduction of bone turnover induced by a 4-day treatment of osteoprotegerin reduces [3H]PK11195 binding in the spongiosa (320±128 Bq.mg−1, 499±106 Bq.mg−1 in saline-treated controls). In contrast, mice with an increase in bone turnover caused by a 4-day low calcium diet increases [3H]PK11195 binding in the spongiosa (615±90 Bq.mg−1). Further, our study includes technical feasibility data on [18F]fluoride microPET imaging of rodent bone with altered turnover. Despite [18F]fluoride having high uptake, the in vivo signal differences were small. Using a phantom model, we describe the spillover effect and partial volume loss that affect the quantitative microPET imaging of the small bone structures in experimental mouse models. In summary, we demonstrate the expression of TSPO in small rodent bone tissues, including osteoblasts and osteoclasts. A trend increase in TSPO expression was observed in the spongiosa from low to high bone turnover conditions. However, despite the potential utility of TSPO expression as an in vivo biomarker of bone turnover in experimental rodent models, our small animal PET imaging data using [18F]fluoride show that even under the condition of a good biological signal-to-noise ratio and high tracer uptake, the currently achievable instrument sensitivity and spatial resolution is unlikely to be sufficient to detect subtle differences in small structures, such as mouse bone. PMID:22295097

Pomalidomide After Combination Chemotherapy in Treating Patients With Newly Diagnosed Acute Myeloid Leukemia or High-Risk Myelodysplastic Syndrome

ClinicalTrials.gov

2018-05-15

Acute Myeloid Leukemia; Blasts 10-19 Percent of Bone Marrow Nucleated Cells; Blasts 20 Percent or More of Bone Marrow Nucleated Cells; Blasts 5-19 Percent of Peripheral Blood White Cells; Chronic Myelomonocytic Leukemia-2; Myelodysplastic Syndrome; Myeloproliferative Neoplasm; Previously Treated Myelodysplastic Syndrome; Untreated Adult Acute Myeloid Leukemia

The method of selection of leukocytes in images of preparations of peripheral blood and bone marrow

NASA Astrophysics Data System (ADS)

Zakharenko, Y. V.; Nikitaev, V. G.; Polyakov, E. V.; Seldyukov, S. O.

2017-01-01

Study of the segmentation method on the basis of histogram analysis for the selection of leukocytes in the images of blood and bone marrow in the diagnosis of acute leukemia was conducted in this paper. Method of filtering was offered to eliminate the artifacts, resulting from the selection of leukocytes.

Aplastic anemia as a feature of systemic lupus erythematosus: a case report and literature review.

PubMed

Chalayer, Émilie; Ffrench, Martine; Cathébras, Pascal

2015-06-01

Peripheral cytopenias are common in systemic lupus erythematosus, but bone marrow involvement is rarely reported. Aplastic anemia is the result of immune-mediated destruction of hematopoietic stem cells causing pancytopenia and characterized by an empty bone marrow. This rare but serious disease has been described as an unusual manifestation of systemic lupus erythematosus. We reviewed the 25 cases published in the English language literature and discuss the clinical presentation, outcome, treatment, and pathophysiology of aplastic anemia as a complication of systemic lupus erythematosus. We report here the first case of aplastic anemia associated with systemic lupus erythematosus treated with an allogeneic hematopoietic stem cell transplant. Over one half of patients received concomitantly the diagnoses of systemic lupus erythematosus and aplastic anemia. No clinical or histological features can distinguish primary aplastic anemia from aplastic anemia occurring in systemic lupus erythematosus patients. The overall mortality is about 15% and corticosteroid-based therapy alone or in combination with other immunomodulatory drugs can restore bone marrow function. Systemic lupus erythematosus may be complicated by bone marrow involvement. The diagnosis of peripheral cytopenias should be confirmed by bone marrow aspiration. All these patients should receive cortisone as a first treatment. Plasma exchanges seem to have some efficacy. Other different immunomodulatory therapies were used with variable results.

[Undifferentiated blastic cell crisis of chronic myelogenous leukemia with myeloblastic tumor in the skin].

PubMed

Kawakami, K; Kiyosaki, M; Amaya, H; Nakamaki, T; Hino, K; Tomoyasu, S

2000-04-01

A 54-year-old female, who had been treated for 4 years in the chronic phase of chronic myelogenous leukemia (CML) was admitted for management of a CML blastic crisis. Blast cells showed strong positive expression of CD7 and HLA-DR, and weakly expressed CD2, CD5 and CD10, as well. The cells were peroxidase negative in peripheral blood and bone marrow. An undifferentiated blastic crisis was diagnosed and she was treated with Interferon-alpha and VP(vincristine 2 mg/week; prednisolone 30 mg/day). A 5-7 mm in diameter tumor in the skin of the anterior right chest appeared one week after VP therapy. The tumor consisted of blasts which were CD13, CD33 and peroxidase positive, unlike the peripheral undifferentiated blasts. This is a rare case of mixed blast crisis with an increase in undifferentiated blasts in peripheral blood and bone marrow, and myeloblastic tumor formation in the skin.

[The geometry of the keel determines the behaviour of the tibial tray against torsional forces in total knee replacement].

PubMed

García David, S; Cortijo Martínez, J A; Navarro Bermúdez, I; Maculé, F; Hinarejos, P; Puig-Verdié, L; Monllau, J C; Hernández Hermoso, J A

2014-01-01

The keel design of the tibial tray is essential for the transmission of the majority of the forces to the peripheral bone structures, which have better mechanical proprieties, thus reducing the risk of loosening. The aim of the present study was to compare the behaviour of different tibial tray designs submitted to torsional forces. Four different tibial components were modelled. The 3-D reconstruction was made using the Mimics software. The solid elements were generated by SolidWorks. The finite elements study was done by Unigraphics. A torsional force of 6 Nm. applied to the lateral aspects of each tibial tray was simulated. The GENUTECH® tibial tray, with peripheral trabecular bone support, showed a lower displacement and less transmitted tensions under torsional forces. The results suggest that a tibial tray with more peripheral support behaves mechanically better than the other studied designs. Copyright © 2013 SECOT. Published by Elsevier Espana. All rights reserved.

Feasibility of simultaneous computed tomographic colonography and fully automated bone mineral densitometry in a single examination.

PubMed

Summers, Ronald M; Baecher, Nicolai; Yao, Jianhua; Liu, Jiamin; Pickhardt, Perry J; Choi, J Richard; Hill, Suvimol

2011-01-01

To show the feasibility of calculating the bone mineral density (BMD) from computed tomographic colonography (CTC) scans using fully automated software. Automated BMD measurement software was developed that measures the BMD of the first and second lumbar vertebrae on computed tomography and calculates the mean of the 2 values to provide a per patient BMD estimate. The software was validated in a reference population of 17 consecutive women who underwent quantitative computed tomography and in a population of 475 women from a consecutive series of asymptomatic patients enrolled in a CTC screening trial conducted at 3 medical centers. The mean (SD) BMD was 133.6 (34.6) mg/mL (95% confidence interval, 130.5-136.7; n = 475). In women aged 42 to 60 years (n = 316) and 61 to 79 years (n = 159), the mean (SD) BMDs were 143.1 (33.5) and 114.7 (28.3) mg/mL, respectively (P < 0.0001). Fully automated BMD measurements were reproducible for a given patient with 95% limits of agreement of -9.79 to 8.46 mg/mL for the mean difference between paired assessments on supine and prone CTC. Osteoporosis screening can be performed simultaneously with screening for colorectal polyps.

Effect of Clothing on Measurement of Bone Mineral Density.

PubMed

McNamara, Elizabeth A; Feldman, Anna Z; Malabanan, Alan O; Abate, Ejigayehu G; Whittaker, LaTarsha G; Yano-Litwin, Amanda; Dorazio, Jolene; Rosen, Harold N

2016-01-01

It is unknown whether allowing patients to have BMD (bone mineral density) studies acquired while wearing radiolucent clothing adlib contributes appreciably to the measurement error seen. To examine this question, a spine phantom was scanned 30 times without any clothing, while draped with a gown, and while draped with heavy winter clothing. The effect on mean BMD and on SD (standard deviation) was assessed. The effect of clothing on mean or SD of the area was not significant. The effect of clothing on mean and SD for BMD was small but significant and was around 1.6% for the mean. However, the effect on BMD precision was much more clinically important. Without clothing the spine phantom had an least significant change of 0.0077 gm/cm(2), while when introducing variability of clothing the least significant change rose as high as 0.0305 gm/cm(2). We conclude that, adding clothing to the spine phantom had a small but statistically significant effect on the mean BMD and on variance of the measurement. It is unlikely that the effect on mean BMD has any clinical significance, but the effect on the reproducibility (precision) of the result is likely clinically significant. Copyright © 2016 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Cartilage Degeneration, Subchondral Mineral and Meniscal Mineral Densities in Hartley and Strain 13 Guinea Pigs

PubMed Central

Sun, Yubo; Scannell, Brian P; Honeycutt, Patrick R; Mauerhan, David R; H, James Norton; Hanley Jr, Edward N

2015-01-01

Osteoarthritis is a joint disease involved in articular cartilage, subchondral bone, meniscus and synovial membrane. This study sought to examine cartilage degeneration, subchondral bone mineral density (BMD) and meniscal mineral density (MD) in male Hartley, female Hartley and female strain 13 guinea pigs to determine the association of cartilage degeneration with subchondral BMD and meniscal MD. Cartilage degeneration, subchondral BMD and meniscal MD in 12 months old guinea pigs were examined with histochemistry, X-ray densitometry and calcium analysis. We found that male Hartley guinea pigs had more severe cartilage degeneration, subchondral BMD and meniscal MD than female Hartley guinea pigs, but not female strain 13 guinea pigs. Female strain 13 guinea pigs had more severe cartilage degeneration and higher subchondral BMD, but not meniscal MD, than female Hartley guinea pigs. These findings indicate that higher subchondral BMD, not meniscal MD, is associated with more severe cartilage degeneration in the guinea pigs and suggest that abnormal subchondral BMD may be a therapeutic target for OA treatment. These findings also indicate that the pathogenesis of OA in the male guinea pigs and female guinea pigs are different. Female strain 13 guinea pig may be used to study female gender-specific pathogenesis of OA. PMID:26401159

Basketball Affects Bone Mineral Density Accrual in Boys More Than Swimming and Other Impact Sports: 9-mo Follow-Up.

PubMed

Agostinete, Ricardo R; Lynch, Kyle R; Gobbo, Luís A; Lima, Manoel Carlos Spiguel; Ito, Igor H; Luiz-de-Marco, Rafael; Rodrigues-Junior, Mario A; Fernandes, Romulo A

2016-01-01

The objective of this study was to analyze the effect of different sports on bone mineral density (BMD) accrual among male adolescents during a 9-mo follow-up. The sample was composed of 82 boys (control [n = 13], basketball [n = 14], karate [n = 9], soccer [n = 18], judo [n = 12], and swimming [n = 16]) who were followed up for 9 mo (from October 2013 to August 2014). BMD (gram per square centimeter) was assessed at baseline and follow-up using a dual-energy X-ray absorptiometry scanner, whereas somatic maturation was estimated through the use of the peak height velocity. Vitamin D consumption was assessed by questionnaire. After 9 mo of follow-up, all groups (including the control group) presented significant BMD accrual (overall sample: 4.5% in the whole body). On the other hand, the basketball group presented higher BMD accrual in the upper limbs (17.6%) than the control group (7.2%). A similar difference was observed in whole-body BMD (control group: 4.1% vs basketball group: 7.1%). The basketball group had significantly higher BMD gains than the control group and other sports groups. Copyright © 2016 International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Unilateral vs bilateral hip bone mineral density measurement for the diagnosis of osteoporosis.

PubMed

Ikegami, Shota; Kamimura, Mikio; Uchiyama, Shigeharu; Mukaiyama, Keijiro; Kato, Hiroyuki

2014-01-01

It has not been established whether unilateral or bilateral hip dual-energy X-ray absorptiometry (DXA) is preferable for the diagnosis of osteoporosis. We investigated the discordance in DXA measurements in bilateral hips to determine whether unilateral DXA is valid for osteoporosis diagnosis. The subjects were 2964 Japanese patients without a previous diagnosis of primary osteoporosis. We measured bilateral femoral bone mineral density (BMD) and calculated indices, related to the unilateral results, for predicting contralateral hip osteoporosis. A likelihood ratio (LR) of a negative test (LR [-]) of less than 0.2 was considered to exclude the diagnosis. In the normal spinal BMD group, the sensitivity of unilateral DXA for women was 27-73% and LR (-) was 0.28-0.73; the sensitivity for men was 0-50% and LR (-) was 0.51-1.00; the diagnosis of contralateral osteoporosis was not excluded. Sensitivity increased and LR (-) increased with worsening spinal BMD status; however, LR (-) did not meet the cutoff for exclusion. We could exclude unilateral hip osteoporosis, in women only, by performing contralateral femoral DXA; this necessitated lowering the T-score cutoff from -2.5 to -2.0. Unilateral femoral DXA is not useful for excluding the diagnosis of contralateral hip osteoporosis. Copyright © 2014 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Scanning laser densitometry and color perimetry demonstrate reduced photopigment density and sensitivity in two patients with retinal degeneration.

PubMed

Tornow, R P; Stilling, R; Zrenner, E

1999-10-01

To test the feasibility of scanning laser densitometry with a modified Rodenstock scanning laser ophthalmoscope (SLO) to measure the rod and cone photopigment distribution in patients with retinal diseases. Scanning laser densitometry was performed using a modified Rodenstock scanning laser ophthalmoscope. The distribution of the photopigments was calculated from dark adapted and bleached images taken with the 514 nm laser of the SLO. This wavelength is absorbed by rod and cone photopigments. Discrimination is possible due to their different spatial distribution. Additionally, to measure retinal sensitivity profiles, dark adapted two color static perimetry with a Tübinger manual perimeter was performed along the horizontal meridian with 1 degree spacing. A patient with retinitis pigmentosa had slightly reduced photopigment density within the central +/- 5 degrees but no detectable photopigment for eccentricities beyond 5 degrees. A patient with cone dystrophy had nearly normal pigment density beyond +/- 5 degrees, but considerably reduced photopigment density within the central +/- 5 degrees. Within the central +/- 5 degrees, the patient with retinitis pigmentosa had normal sensitivity for the red stimulus and reduced sensitivity for the green stimulus. There was no measurable function beyond 7 degrees. The patient with cone dystrophy had normal sensitivity for the green stimulus outside the foveal center and reduced sensitivity for the red stimulus at the foveal center. The results of color perimetry for this patient with a central scotoma were probably influenced by eccentric fixation. Scanning laser densitometry with a modified Rodenstock SLO is a useful method to assess the human photopigment distribution. Densitometry results were confirmed by dark adapted two color static perimetry. Photopigment distribution and retinal sensitivity profiles can be measured with high spatial resolution. This may help to measure exactly the temporal development of retinal diseases and to test the success of different therapeutic treatments. Both methods have limitations at the present state of development. However, some of these limitations can be overcome by further improving the instruments.

Lung densitometry: why, how and when

PubMed Central

Camiciottoli, Gianna; Diciotti, Stefano

2017-01-01

Lung densitometry assesses with computed tomography (CT) the X-ray attenuation of the pulmonary tissue which reflects both the degree of inflation and the structural lung abnormalities implying decreased attenuation, as in emphysema and cystic diseases, or increased attenuation, as in fibrosis. Five reasons justify replacement with lung densitometry of semi-quantitative visual scales used to measure extent and severity of diffuse lung diseases: (I) improved reproducibility; (II) complete vs. discrete assessment of the lung tissue; (III) shorter computation times; (IV) better correlation with pathology quantification of pulmonary emphysema; (V) better or equal correlation with pulmonary function tests (PFT). Commercially and open platform software are available for lung densitometry. It requires attention to technical and methodological issues including CT scanner calibration, radiation dose, and selection of thickness and filter to be applied to sections reconstructed from whole-lung CT acquisition. Critical is also the lung volume reached by the subject at scanning that can be measured in post-processing and represent valuable information per se. The measurements of lung density include mean and standard deviation, relative area (RA) at −970, −960 or −950 Hounsfield units (HU) and 1st and 15th percentile for emphysema in inspiratory scans, and RA at −856 HU for air trapping in expiratory scans. Kurtosis and skewness are used for evaluating pulmonary fibrosis in inspiratory scans. The main indication for lung densitometry is assessment of emphysema component in the single patient with chronic obstructive pulmonary diseases (COPD). Additional emerging applications include the evaluation of air trapping in COPD patients and in subjects at risk of emphysema and the staging in patients with lymphangioleiomyomatosis (LAM) and with pulmonary fibrosis. It has also been applied to assess prevalence of smoking-related emphysema and to monitor progression of smoking-related emphysema, alpha1 antitrypsin deficiency emphysema, and pulmonary fibrosis. Finally, it is recommended as end-point in pharmacological trials of emphysema and lung fibrosis. PMID:29221318

Osteoporosis/osteopenia as an independent factor associated with periodontitis in postmenopausal women: a case-control study.

PubMed

Passos, J S; Vianna, M I P; Gomes-Filho, I S; Cruz, S S; Barreto, M L; Adan, L; Rösing, C K; Cerqueira, E M M; Trindade, S C; Coelho, J M F

2013-04-01

This study investigated whether osteoporosis/osteopenia has an influence on the progression of periodontitis in postmenopausal women. The findings highlight that postmenopausal women with osteoporosis/osteopenia had a greater chance of presenting periodontitis than those with normal bone mineral density, particularly among nonusers of osteoporosis medications and women with a greater number of remaining teeth, showing that osteoporosis/osteopenia has had an influence on the progression of periodontitis. This study investigated whether osteoporosis/osteopenia has an influence on the progression of periodontitis in postmenopausal women and explored the effects of use of osteoporosis medication and tooth loss on this association. This case-control study involved 521 postmenopausal women, with minimum age of 50 years, in Feira de Santana, Bahia, Brazil. Sociodemographic characteristics, health conditions/medications, and lifestyle habits were recorded. A complete periodontal examination was performed and periodontitis was diagnosed. Bone mineral density was evaluated through lumbar spine and femoral bone densitometry, obtained using dual-energy X-ray absorptiometry. Logistic regression was used to calculate the strength of association between the occurrences of osteoporosis/osteopenia and periodontitis. Women with osteoporosis/osteopenia were twice as likely to present periodontitis, as were those with normal bone mineral density, even after adjusting for smoking, age, family income, and last visit to dentist (odds ratios (OR)adjusted=2.24, 95% CI [1.24-4.06], p=0.008). Among nonusers of osteoporosis medication (ORadjusted=2.51, 95% CI [1.33-4.73], p=0.004) and women with at least 10 remaining teeth (ORadjusted=2.50 95% CI [1.18-5.27], p=0.02), the odds ratio was higher and statistically significant. These findings highlight that postmenopausal women with osteoporosis/osteopenia had a greater chance of presenting periodontitis than those with normal bone mineral density, particularly among nonusers of osteoporosis medications and women with a greater number of remaining teeth.

Leptin regulates bone formation via the sympathetic nervous system

NASA Technical Reports Server (NTRS)

Takeda, Shu; Elefteriou, Florent; Levasseur, Regis; Liu, Xiuyun; Zhao, Liping; Parker, Keith L.; Armstrong, Dawna; Ducy, Patricia; Karsenty, Gerard

2002-01-01

We previously showed that leptin inhibits bone formation by an undefined mechanism. Here, we show that hypothalamic leptin-dependent antiosteogenic and anorexigenic networks differ, and that the peripheral mediators of leptin antiosteogenic function appear to be neuronal. Neuropeptides mediating leptin anorexigenic function do not affect bone formation. Leptin deficiency results in low sympathetic tone, and genetic or pharmacological ablation of adrenergic signaling leads to a leptin-resistant high bone mass. beta-adrenergic receptors on osteoblasts regulate their proliferation, and a beta-adrenergic agonist decreases bone mass in leptin-deficient and wild-type mice while a beta-adrenergic antagonist increases bone mass in wild-type and ovariectomized mice. None of these manipulations affects body weight. This study demonstrates a leptin-dependent neuronal regulation of bone formation with potential therapeutic implications for osteoporosis.

Expanding the Description of Spaceflight Effects beyond Bone Mineral Density [BMD]: Trabecular Bone Score [TBS] in ISS Astronauts

NASA Technical Reports Server (NTRS)

Sibonga, J. D.; Spector, E. R.; King, L. J.; Evans, H. J.; Smith, S. A.

2014-01-01

Dual-energy x-ray absorptiometry [DXA] is the widely-applied bone densitometry method used to diagnose osteoporosis in a terrestrial population known to be at risk for age-related bone loss. This medical test, which measures areal bone mineral density [aBMD] of clinically-relevant skeletal sites (e.g., hip and spine), helps the clinician to identify which persons, among postmenopausal women and men older than 50 years, are at high risk for low trauma or fragility fractures and might require an intervention. The most recognized osteoporotic fragility fracture is the vertebral compression fracture which can lead to kyphosis or hunched backs typically seen in the elderly. DXA measurement of BMD however is recognized to be insufficient as a sole index for assessing fracture risk. DXA's limitation may be related to its inability to monitor changes in structural parameters, such as trabecular vs. cortical bone volumes, bone geometry or trabecular microarchitecture. Hence, in order to understand risks to human health and performance due to space exposure, NASA needs to expand its measurements of bone to include other contributors to skeletal integrity. To this aim, the Bone and Mineral Lab conducted a pilot study for a novel measurement of bone microarchitecture that can be obtained by retrospective analysis of DXA scans. Trabecular Bone Score (TBS) assesses changes to trabecular microarchitecture by measuring the grey color "texture" information extracted from DXA images of the lumbar spine. An analysis of TBS in 51 ISS astronauts was conducted to assess if TBS could detect 1) an effect of spaceflight and 2) a response to countermeasures independent of DXA BMD. In addition, changes in trunk body lean tissue mass and in trunk body fat tissue mass were also evaluated to explore an association between body composition, as impacted by ARED exercise, and bone microarchitecture. The pilot analysis of 51 astronaut scans of the lumbar spine suggests that, following an ISS mission, DXA BMD and TBS are detecting different effects of ARED exercise and of ARED + Bisphosphonate on the lumbar spine of astronauts. There is emerging evidence associating reduced TBS with terrestrial metabolic bone disorders where a TBS <1.200 is associated with "degraded" while > 1.350 is associated with "normal." However, it is not possible to conclude how the spaceflight-induced changes in TBS increase risk for vertebral fractures in the astronaut or if changes in body composition of the trunk region could be an indirect method of assessing exercise effect on bone microarchitecture. More importantly, this pilot analysis demonstrates a new, minimal risk approach for monitoring changes to vertebral bone microarchitecture. This method could help assess the combined skeletal effects of spaceflight with the effects of aging in the astronaut after return to Earth.

Trial of Dasatinib in Advanced Sarcomas

ClinicalTrials.gov

2017-03-20

Rhabdomyosarcoma; Malignant Peripheral Nerve Sheath Tumors; Chondrosarcoma; Sarcoma, Ewing's; Sarcoma, Alveolar Soft Part; Chordoma; Epithelioid Sarcoma; Giant Cell Tumor of Bone; Hemangiopericytoma; Gastrointestinal Stromal Tumor (GIST)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Galvin, M.J.; MacNichols, G.L.; McRee, D.I.

In this study, the influence of 2450 MHz CW microwave radiation on hematopoiesis in pregnant mice was examined. Dams (mice CD-1 strain) were irradiated during Days 1-6 or 6-15 of pregnancy. The animals were irradiated for a total of 8 hr per day at an average power density of 30 mW/cm/sup 2/. Peripheral blood and bone marrow samples were obtained on Day 18 of pregnancy. The total leukocyte and differential leukocyte counts of peripheral blood samples were not affected by either exposure regimen. In addition, no effects were noted in either the erythroid or myeloid mitotic indices of bone marrowmore » samples. Exposure of pregnant mice to microwave radiation under the conditions of these experiments had no effects on the investigated aspects of hematopoiesis.« less

Effects of multi-deficiencies-diet on bone parameters of peripheral bone in ovariectomized mature rat.

PubMed

El Khassawna, Thaqif; Böcker, Wolfgang; Govindarajan, Parameswari; Schliefke, Nathalie; Hürter, Britta; Kampschulte, Marian; Schlewitz, Gudrun; Alt, Volker; Lips, Katrin Susanne; Faulenbach, Miriam; Möllmann, Henriette; Zahner, Daniel; Dürselen, Lutz; Ignatius, Anita; Bauer, Natali; Wenisch, Sabine; Langheinrich, Alexander Claus; Schnettler, Reinhard; Heiss, Christian

2013-01-01

Many postmenopausal women have vitamin D and calcium deficiency. Therefore, vitamin D and calcium supplementation is recommended for all patients with osteopenia and osteoporosis. We used an experimental rat model to test the hypothesis that induction of osteoporosis is more efficiently achieved in peripheral bone through combining ovariectomy with a unique multi-deficiencies diet (vitamin D depletion and deficient calcium, vitamin K and phosphorus). 14-week-old Sprague-Dawley rats served as controls to examine the initial bone status. 11 rats were bilaterally ovariectomized (OVX) and fed with multi-deficiencies diet. Three months later the treated group and the Sham group (n = 8) were euthanized. Bone biomechanical competence of the diaphyseal bone was examined on both, tibia and femur. Image analysis was performed on tibia via µCT, and on femur via histological analysis. Lower torsional stiffness indicated inferior mechanical competence of the tibia in 3 month OVX+Diet. Proximal metaphyseal region of the tibia showed a diminished bone tissue portion to total tissue in the µCT despite the increased total area as evaluated in both µCT and histology. Cortical bone showed higher porosity and smaller cross sectional thickness of the tibial diaphysis in the OVX+Diet rats. A lower ALP positive area and elevated serum level of RANKL exhibited the unbalanced cellular interaction in bone remodeling in the OVX+Diet rat after 3 month of treatment. Interestingly, more adipose tissue area in bone marrow indicated an effect of bone loss similar to that observed in osteoporotic patients. Nonetheless, the presence of osteoid and elevated serum level of PTH, BGP and Opn suggest the development of osteomalacia rather than an osteoporosis. As the treatment and fracture management of both osteoporotic and osteomalacia patients are clinically overlapping, this study provides a preclinical animal model to be utilized in local supplementation of minerals, drugs and growth factors in future fracture healing studies.

Effects of Multi-Deficiencies-Diet on Bone Parameters of Peripheral Bone in Ovariectomized Mature Rat

PubMed Central

El Khassawna, Thaqif; Böcker, Wolfgang; Govindarajan, Parameswari; Schliefke, Nathalie; Hürter, Britta; Kampschulte, Marian; Schlewitz, Gudrun; Alt, Volker; Lips, Katrin Susanne; Faulenbach, Miriam; Möllmann, Henriette; Zahner, Daniel; Dürselen, Lutz; Ignatius, Anita; Bauer, Natali; Wenisch, Sabine; Langheinrich, Alexander Claus; Schnettler, Reinhard; Heiss, Christian

2013-01-01

Many postmenopausal women have vitamin D and calcium deficiency. Therefore, vitamin D and calcium supplementation is recommended for all patients with osteopenia and osteoporosis. We used an experimental rat model to test the hypothesis that induction of osteoporosis is more efficiently achieved in peripheral bone through combining ovariectomy with a unique multi-deficiencies diet (vitamin D depletion and deficient calcium, vitamin K and phosphorus). 14-week-old Sprague-Dawley rats served as controls to examine the initial bone status. 11 rats were bilaterally ovariectomized (OVX) and fed with multi-deficiencies diet. Three months later the treated group and the Sham group (n = 8) were euthanized. Bone biomechanical competence of the diaphyseal bone was examined on both, tibia and femur. Image analysis was performed on tibia via µCT, and on femur via histological analysis. Lower torsional stiffness indicated inferior mechanical competence of the tibia in 3 month OVX+Diet. Proximal metaphyseal region of the tibia showed a diminished bone tissue portion to total tissue in the µCT despite the increased total area as evaluated in both µCT and histology. Cortical bone showed higher porosity and smaller cross sectional thickness of the tibial diaphysis in the OVX+Diet rats. A lower ALP positive area and elevated serum level of RANKL exhibited the unbalanced cellular interaction in bone remodeling in the OVX+Diet rat after 3 month of treatment. Interestingly, more adipose tissue area in bone marrow indicated an effect of bone loss similar to that observed in osteoporotic patients. Nonetheless, the presence of osteoid and elevated serum level of PTH, BGP and Opn suggest the development of osteomalacia rather than an osteoporosis. As the treatment and fracture management of both osteoporotic and osteomalacia patients are clinically overlapping, this study provides a preclinical animal model to be utilized in local supplementation of minerals, drugs and growth factors in future fracture healing studies. PMID:23977109

Alterations of bone microstructure and strength in end-stage renal failure.

PubMed

Trombetti, A; Stoermann, C; Chevalley, T; Van Rietbergen, B; Herrmann, F R; Martin, P-Y; Rizzoli, R

2013-05-01

End-stage renal disease (ESRD) patients have a high risk of fractures. We evaluated bone microstructure and finite-element analysis-estimated strength and stiffness in patients with ESRD by high-resolution peripheral computed tomography. We observed an alteration of cortical and trabecular bone microstructure and of bone strength and stiffness in ESRD patients. Fragility fractures are common in ESRD patients on dialysis. Alterations of bone microstructure contribute to skeletal fragility, independently of areal bone mineral density. We compared microstructure and finite-element analysis estimates of strength and stiffness by high-resolution peripheral quantitative computed tomography (HR-pQCT) in 33 ESRD patients on dialysis (17 females and 16 males; mean age, 47.0 ± 12.6 years) and 33 age-matched healthy controls. Dialyzed women had lower radius and tibia cortical density with higher radius cortical porosity and lower tibia cortical thickness, compared to controls. Radius trabecular number was lower with higher heterogeneity of the trabecular network. Male patients displayed only a lower radius cortical density. Radius and tibia cortical thickness correlated negatively with bone-specific alkaline phosphatase (BALP). Microstructure did not correlate with parathyroid hormone (PTH) levels. Cortical porosity correlated positively with "Kidney Disease: Improving Global Outcomes" working group PTH level categories (r = 0.36, p < 0.04). BMI correlated positively with trabecular number (r = 0.4, p < 0.02) and negatively with trabecular spacing (r = -0.37, p < 0.03) and trabecular network heterogeneity (r = -0.4, p < 0.02). Biomechanics positively correlated with BMI and negatively with BALP. Cortical and trabecular bone microstructure and calculated bone strength are altered in ESRD patients, predominantly in women. Bone microstructure and biomechanical assessment by HR-pQCT may be of major clinical relevance in the evaluation of bone fragility in ESRD patients.

Extraction of impacted mandibular third molars - the effect of osteotomy at two speeds on peripheral bone: a histopathological analysis.

PubMed

Siroraj, A Pearlcid; Giri G V V; Ramkumar, Subramaniam; Narasimhan, Malathi

2016-05-01

The aim of this study was to find out the ideal speed for making a precise osteotomy with minimal damage to the surrounding bone. Thirty-six patients were divided into two groups (n=18 in each) depending on the speed of the handpiece used for osteotomy (slow=20000rpm and fast=40000rpm). Samples were taken from the peripheral bone and examined histologically to measure the margins of the osteotomy, the amount of debris produced, and the degree of thermal osteonecrosis. The osteotomy made with the high speed handpiece was better than that made with the low speed one on all counts. The margins in the high speed group were more or less precisely as required, with less debris and no thermal necrosis, which illustrated the efficacy of a high speed osteotomy. These findings can apply to other procedures that involve osteotomies in maxillofacial surgery. Copyright © 2016 The British Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved.

Repeated hematopoietic stem and progenitor cell mobilization without depletion of the bone marrow stem and progenitor cell pool in mice after repeated administration of recombinant murine G-CSF.

PubMed

de Kruijf, Evert-Jan F M; van Pel, Melissa; Hagoort, Henny; Kruysdijk, Donnée; Molineux, Graham; Willemze, Roel; Fibbe, Willem E

2007-05-01

Administration of recombinant-human G-CSF (rhG-CSF) is highly efficient in mobilizing hematopoietic stem and progenitor cells (HSC/HPC) from the bone marrow (BM) toward the peripheral blood. This study was designed to investigate whether repeated G-CSF-induced HSC/HPC mobilization in mice could lead to a depletion of the bone marrow HSC/HPC pool with subsequent loss of mobilizing capacity. To test this hypothesis Balb/c mice were treated with a maximum of 12 repeated 5-day cycles of either 10 microg rhG-CSF/day or 0.25 microg rmG-CSF/day. Repeated administration of rhG-CSF lead to strong inhibition of HSC/HPC mobilization toward the peripheral blood and spleen after >4 cycles because of the induction of anti-rhG-CSF antibodies. In contrast, after repeated administration of rmG-CSF, HSC/HPC mobilizing capacity remained intact for up to 12 cycles. The number of CFU-GM per femur did not significantly change for up to 12 cycles. We conclude that repeated administration of G-CSF does not lead to depletion of the bone marrow HSC/HPC pool.

Muscle and Myotendinous Tissue Properties at the Distal Tibia as Assessed by High-Resolution Peripheral Quantitative Computed Tomography.

PubMed

Erlandson, M C; Wong, A K O; Szabo, E; Vilayphiou, N; Zulliger, M A; Adachi, J D; Cheung, A M

High-resolution peripheral quantitative computed tomography (HR-pQCT) quantifies bone microstructure and density at the distal tibia where there is also a sizable amount of myotendinous (muscle and tendon) tissue (M T ); however, there is no method for the quantification of M T . This study aimed (1) to assess the feasibility of using HR-pQCT distal tibia scans to estimate M T properties using a custom algorithm, and (2) to determine the relationship between M T properties at the distal tibia and mid-leg muscle density (MD) obtained from pQCT. Postmenopausal women from the Hamilton cohort of the Canadian Multicenter Osteoporosis Study had a single-slice (2.3 ± 0.5 mm) 66% site pQCT scan measuring muscle cross-sectional area (MCSA) and MD. A standard HR-pQCT scan was acquired at the distal tibia. HR-pQCT-derived M T cross-sectional area (M T CSA) and M T density (M T D) were calculated using a custom algorithm in which thresholds (34.22-194.32 mg HA/cm 3 ) identified muscle seed volumes and were iteratively expanded. Pearson and Bland-Altman plots were used to assess correlations and systematic differences between pQCT- and HR-pQCT-derived muscle properties. Among 45 women (mean age: 74.6 ± 8.5 years, body mass index: 25.9 ± 4.3 kg/m 2 ), M T D was moderately correlated with mid-leg MD across the 2 modalities (r = 0.69-0.70, p < 0.01). Bland-Altman analyses revealed no evidence of directional bias for M T D-MD. HR-pQCT and pQCT measures of M T CSA and MCSA were moderately correlated (r = 0.44, p < 0.01). Bland-Altman plots for M T CSA revealed that larger MCSAs related to larger discrepancy between the distal and the mid-leg locations. This is the first study to assess the ability of HR-pQCT to measure M T size, density, and morphometry. HR-pQCT-derived M T D was moderately correlated with mid-leg MD from pQCT. This relationship suggests that distal M T may share common properties with muscle throughout the length of the leg. Future studies will assess the value of HR-pQCT-derived M T properties in the context of falls, mobility, and balance. Copyright © 2016 International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

In vivo assessment of bone healing following Piezotome® ultrasonic instrumentation.

PubMed

Reside, Jonathan; Everett, Eric; Padilla, Ricardo; Arce, Roger; Miguez, Patricia; Brodala, Nadine; De Kok, Ingeborg; Nares, Salvador

2015-04-01

This pilot study evaluated the molecular, histologic, and radiographic healing of bone to instrumentation with piezoelectric or high speed rotary (R) devices over a 3-week healing period. Fourteen Sprague-Dawley rats (Charles River Laboratories International, Inc., Wilmington, MA, USA) underwent bilateral tibial osteotomies prepared in a randomized split-leg design using Piezotome® (P1) (Satelec Acteon, Merignac, France), Piezotome 2® (P2) (Satelec Acteon), High-speed R instrumentation, or sham surgery (S). At 1 week, an osteogenesis array was used to evaluate differences in gene expression while quantitative analysis assessed percentage bone fill (PBF) and bone mineral density (BMD) in the defect, peripheral, and distant regions at 3 weeks. Qualitative histologic evaluation of healing osteotomies was also performed at 3 weeks. At 1 week, expression of 11 and 18 genes involved in bone healing was significantly (p < .05) lower following P1 and P2 instrumentation, respectively, relative to S whereas 16 and 4 genes were lower relative to R. No differences in PBF or BMD were detected between groups within the osteotomy defect. However, significant differences in PBF (p = .020) and BMD (p = .008) were noted along the peripheral region between P2 and R groups, being R the group with the lowest values. Histologically, smooth osteotomy margins were present following instrumentation using P1 or P2 relative to R. Piezoelectric instrumentation favors preservation of bone adjacent to osteotomies while variations in gene expression suggest differences in healing rates due to surgical modality. Bone instrumented by piezoelectric surgery appears less detrimental to bone healing than high-speed R device. © 2013 Wiley Periodicals, Inc.

Mild cognitive impairment is associated with poor physical function but not bone structure or density in late adulthood: findings from the Hertfordshire cohort study.

PubMed

Patel, A; Jameson, K A; Edwards, M H; Ward, K; Gale, C R; Cooper, C; Dennison, Elaine M

2018-04-24

This study investigated the association between mild cognitive impairment (MCI) and physical function and bone health in older adults. MCI was associated with poor physical performance but not bone mineral density or bone microarchitecture. Cross-sectional study to investigate the association between mild cognitive impairment (MCI) and physical performance, and bone health, in a community-dwelling cohort of older adults. Cognitive function of 222 men and 221 women (mean age 75.5 and 75.8 years in men and women, respectively) was assessed by the Strawbridge questionnaire and Mini Mental State Exam (MMSE). Participants underwent dual-energy X-ray absorptiometry (DXA), peripheral-quantitative computed tomography (pQCT) and high-resolution peripheral-quantitative computed tomography (HR-pQCT) scans to assess their bone density, strength and microarchitecture. Their physical function was assessed and a physical performance (PP) score was recorded. In the study, 11.8% of women and 8.1% of men were cognitively impaired on the MMSE (score < 24). On the Strawbridge questionnaire, 24% of women were deemed cognitively impaired compared to 22.3% of men. Cognitive impairment on the Strawbridge questionnaire was associated with poorer physical performance score in men but not in women in the unadjusted analysis. MMSE < 24 was strongly associated with the risk of low physical performance in men (OR 12.9, 95% CI 1.67, 99.8, p = 0.01). Higher MMSE score was associated with better physical performance in both sexes. Poorer cognitive function, whether assessed by the Strawbridge questionnaire, or by MMSE score, was not associated with bone density, shape or microarchitecture, in either sex. MCI in older adults was associated with poor physical performance, but not bone density, shape or microarchitecture.

Anti-thymocyte globulin as graft-versus-host disease prevention in the setting of allogeneic peripheral blood stem cell transplantation: a review from the Acute Leukemia Working Party of the European Society for Blood and Marrow Transplantation

PubMed Central

Baron, Frédéric; Mohty, Mohamad; Blaise, Didier; Socié, Gérard; Labopin, Myriam; Esteve, Jordi; Ciceri, Fabio; Giebel, Sebastian; Gorin, Norbert Claude; Savani, Bipin N; Schmid, Christoph; Nagler, Arnon

2017-01-01

Allogeneic hematopoietic stem cell transplantation is increasingly used as treatment for patients with life-threatening blood diseases. Its curative potential is largely based on immune-mediated graft-versus-leukemia effects caused by donor T cells contained in the graft. Unfortunately, donor T cells are also the cause of graft-versus-host disease. The vast majority of human leukocyte antigen-matched allogeneic hematopoietic stem cell transplants are nowadays carried out with peripheral blood stem cells as the stem cell source. In comparison with bone marrows, peripheral blood stem cells contain more hematopoietic stem/progenitor cells but also one log more T cells. Consequently, the use of peripheral blood stem cells instead of bone marrow has been associated with faster hematologic recovery and a lower risk of relapse in patients with advanced disease, but also with a higher incidence of chronic graft-versus-host disease. These observations have been the basis for several studies aimed at assessing the impact of immunoregulation with anti-thymocyte globulin on transplantation outcomes in patients given human leukocyte antigen-matched peripheral blood stem cells from related or unrelated donors. After a brief introduction on anti-thymocyte globulin, this article reviews recent studies assessing the impact of anti-thymocyte globulin on transplantation outcomes in patients given peripheral blood stem cells from human leukocyte antigen-matched related or unrelated donors as well as in recipients of grafts from human leukocyte antigen haploidentical donors. PMID:27927772

Central adiponectin administration reveals new regulatory mechanisms of bone metabolism in mice

PubMed Central

Wu, Yuwei; Tu, Qisheng; Valverde, Paloma; Zhang, Jin; Murray, Dana; Dong, Lily Q.; Cheng, Jessica; Jiang, Hua; Rios, Maribel; Morgan, Elise; Tang, Zhihui

2014-01-01

Adiponectin (APN), the most abundant adipocyte-secreted adipokine, regulates energy homeostasis and exerts well-characterized insulin-sensitizing properties. The peripheral or central effects of APN regulating bone metabolism are beginning to be explored but are still not clearly understood. In the present study, we found that APN-knockout (APN-KO) mice fed a normal diet exhibited decreased trabecular structure and mineralization and increased bone marrow adiposity compared with wild-type (WT) mice. APN intracerebroventricular infusions decreased uncoupling protein 1 (UCP1) expression in brown adipose tissue, epinephrine and norepinephrine serum levels, and osteoclast numbers, whereas osteoblast osteogenic marker expression and trabecular bone mass increased in APN-KO and WT mice. In addition, centrally administered APN increased hypothalamic tryptophan hydroxylase 2 (TPH2), cocaine- and amphetamine-regulated transcript (CART), and 5-hydroxytryptamine (serotonin) receptor 2C (Htr2C) expressions but decreased hypothalamic cannabinoid receptor-1 expression. Treatment of immortalized mouse neurons with APN demonstrated that APN-mediated effects on TPH2, CART, and Htr2C expression levels were abolished by downregulating adaptor protein containing pleckstrin homology domain, phosphotyrosine domain, and leucine zipper motif (APPL)-1 expression. Pharmacological increase in sympathetic activity stimulated adipogenic differentiation of bone marrow stromal cells (BMSC) and reversed APN-induced expression of the lysine-specific demethylases involved in regulating their commitment to the osteoblastic lineage. In conclusion, we found that APN regulates bone metabolism via central and peripheral mechanisms to decrease sympathetic tone, inhibit osteoclastic differentiation, and promote osteoblastic commitment of BMSC. PMID:24780611

Osteoporosis in men.

PubMed

Binkley, Neil

2006-08-01

Osteoporosis is defined as "a systemic skeletal disease characterized by low bone mass and microarchitectural deterioration of bone tissue with a consequent increase in bone fragility and susceptibility to fracture". Approximately 40-50% of women sustain osteoporotic fractures in their lifetime; as such, it is appropriate that studies initially focused upon females. Despite an increased recognition of osteoporotic fractures in men, there continues to be neglect of this disease in males. This ongoing neglect is inappropriate as 25-33% of men in some populations will sustain osteoporotic fractures in their lifetime. Testosterone plays an important role in male skeletal health. However, recent data suggest that estrogen may in fact be the dominant hormone regulating skeletal status in both men and women. BMD measurement may be utilized for osteoporosis diagnosis and to assist with fracture risk prediction in men prior to their sustaining a fracture. Recognizing this need, the International Society for Clinical Densitometry (ISCD) recommended and recently reaffirmed use of a BMD T-score of -2.5 or below be utilized to diagnose osteoporosis in men. Androgen therapy of hypogonadal men may be considered with the caveat that data do not exist to document that this treatment reduces fracture risk. At this time, the data is inadequate to support use of androgen treatment in eugonadal men with osteoporosis. Parathyroid hormone treatment does increase BMD; existing studies have not been of adequate size or duration to document fracture reduction efficacy. Bisphosphonate therapy increases BMD, reduces vertebral fracture risk and is considered the standard of care for osteoporotic men at this point in time.

Approach to the Child with Fractures

PubMed Central

Boyce, Alison M.

2011-01-01

Evaluation of the child with fractures is challenging, as no clear guidelines exist to distinguish traumatic from pathological fractures. Although most fractures in childhood are benign, recurrent fractures may be associated with a wide variety of primary skeletal diseases as well as secondary causes, necessitating a careful history and physical exam to guide the evaluation. There is no “gold standard” for the evaluation and treatment of children with fractures and low bone mineral density (BMD); therefore, the diagnosis of osteoporosis in a pediatric patient should be made using a combination of clinical and radiographic features. Interpretation of bone densitometry in growing patients presents a unique set of challenges because areal BMD measured by dual-energy x-ray absorptiometry depends on multiple dynamic variables. Interpretation of pediatric dual-energy x-ray absorptiometry should be based on Z-scores (sd scores compared to age, sex, and ethnicity-matched controls), using normative databases specific to the brand of densitometer and the patient population. Given the skeleton's ability to recover from low BMD through modeling and remodeling, optimizing management of underlying conditions leading to bone fragility is the initial step. Conservative measures including calcium and vitamin D supplementation and weight-bearing physical activity are important interventions that should not be overlooked. The use of bisphosphonates in children and adolescents is controversial due to lack of long-term efficacy and safety data and should be limited to clinical trials and compassionate therapy in children with significantly compromised quality of life. Close monitoring is required, and further study is necessary to assess their long-term safety and efficacy in children. PMID:21734001

Osteoporosis: the emperor has no clothes

PubMed Central

Järvinen, T L N; Michaëlsson, K; Aspenberg, P; Sievänen, H

2015-01-01

Current prevention strategies for low-trauma fractures amongst older persons depend on the notions that fractures are mainly caused by osteoporosis (pathophysiology), that patients at high risk can be identified (screening) and that the risk is amenable to bone-targeted pharmacotherapy (treatment). However, all these three notions can be disputed. Pathophysiology Most fracture patients have fallen, but actually do not have osteoporosis. A high likelihood of falling, in turn, is attributable to an ageing-related decline in physical functioning and general frailty. Screening Currently available fracture risk prediction strategies including bone densitometry and multifactorial prediction tools are unable to identify a large proportion of patients who will sustain a fracture, whereas many of those with a high fracture risk score will not sustain a fracture. Treatment The evidence for the viability of bone-targeted pharmacotherapy in preventing hip fracture and other clinical fragility fractures is mainly limited to women aged 65–80 years with osteoporosis, whereas the proof of hip fracture-preventing efficacy in women over 80 years of age and in men at all ages is meagre or absent. Further, the antihip fracture efficacy shown in clinical trials is absent in real-life studies. Many drugs for the treatment of osteoporosis have also been associated with increased risks of serious adverse events. There are also considerable uncertainties related to the efficacy of drug therapy in preventing clinical vertebral fractures, whereas the efficacy for preventing other fractures (relative risk reductions of 20–25%) remains moderate, particularly in terms of the low absolute risk reduction in fractures with this treatment. PMID:25809279

Erythrocyte dysplasia in peripheral blood smears from 5 thrombocytopenic dogs treated with vincristine sulfate.

PubMed

Collicutt, Nancy B; Garner, Bridget

2013-12-01

Secondary dyserythropoiesis has been associated with vincristine administration in dogs. Evaluation of bone marrow aspirates for the presence of morphologic abnormalities in the erythroid lineage aids in the diagnosis. However, morphologic features of circulating erythroid precursors in these cases have not been described previously. The purpose of this report was to describe the cytologic features of dyserythropoiesis in peripheral blood and also bone marrow smears in a case series of dogs with immune-mediated thrombocytopenia (IMT) treated with vincristine sulfate. Nineteen dogs receiving vincristine for treatment of IMT were identified by retrospectively searching a computerized medical record system. There were 5 dogs that had dysplastic erythroid precursors in peripheral blood smears within 7 days of vincristine treatment. Two of those 5 dogs also had evidence for erythrodysplasia in modified Wright's-stained bone marrow smears obtained postvincristine administration. Morphologic changes included bizarre or inappropriate mitotic figures, abnormal nuclear configurations (fragmentation, elongation, indentation, and binucleation), atypical nuclear remnants (Howell-Jolly bodies), or nuclear and cytoplasmic asynchrony within the erythroid precursors. A brief review of the literature with discussion of the etiologies for dyserythropoiesis is provided. The dyserythropoiesis was clinically insignificant in all 5 cases and resolved. However, pathologists and clinicians should be aware of these potential findings to prevent misdiagnosis of other conditions. © 2013 American Society for Veterinary Clinical Pathology and European Society for Veterinary Clinical Pathology.

Whole body proton irradiation causes acute damage to bone marrow hematopoietic progenitor and stem cells in mice.

PubMed

Chang, Jianhui; Wang, Yingying; Pathak, Rupak; Sridharan, Vijayalakshmi; Jones, Tamako; Mao, Xiao Wen; Nelson, Gregory; Boerma, Marjan; Hauer-Jensen, Martin; Zhou, Daohong; Shao, Lijian

2017-12-01

Exposure to proton irradiation during missions in deep space can lead to bone marrow injury. The acute effects of proton irradiation on hematopoietic stem and progenitor cells remain undefined and thus were investigated. We exposed male C57BL/6 mice to 0.5 and 1.0 Gy proton total body irradiation (proton-TBI, 150 MeV) and examined changes in peripheral blood cells and bone marrow (BM) progenitors and LSK cells 2 weeks after exposure. 1.0 Gy proton-TBI significantly reduced the numbers of peripheral blood cells compared to 0.5 Gy proton-TBI and unirradiated animals, while the numbers of peripheral blood cell counts were comparable between 0.5 Gy proton-TBI and unirradiated mice. The frequencies and numbers of LSK cells and CMPs in BM of 0.5 and 1.0 Gy irradiated mice were decreased in comparison to those of normal controls. LSK cells and CMPs and their progeny exhibited a radiation-induced impairment in clonogenic function. Exposure to 1.0 Gy increased cellular apoptosis but not the production of reactive oxygen species (ROS) in CMPs two weeks after irradiation. LSK cells from irradiated mice exhibited an increase in ROS production and apoptosis. Exposure to proton-TBI can induce acute damage to BM progenitors and LSK cells.

Peripheral Nerve Fibers and Their Neurotransmitters in Osteoarthritis Pathology

PubMed Central

Grässel, Susanne; Muschter, Dominique

2017-01-01

The importance of the nociceptive nervous system for maintaining tissue homeostasis has been known for some time, and it has also been suggested that organogenesis and tissue repair are under neuronal control. Changes in peripheral joint innervation are supposed to be partly responsible for degenerative alterations in joint tissues which contribute to development of osteoarthritis. Various resident cell types of the musculoskeletal system express receptors for sensory and sympathetic neurotransmitters, allowing response to peripheral neuronal stimuli. Among them are mesenchymal stem cells, synovial fibroblasts, bone cells and chondrocytes of different origin, which express distinct subtypes of adrenoceptors (AR), receptors for vasoactive intestinal peptide (VIP), substance P (SP) and calcitonin gene-related peptide (CGRP). Some of these cell types synthesize and secrete neuropeptides such as SP, and they are positive for tyrosine-hydroxylase (TH), the rate limiting enzyme for biosynthesis of catecholamines. Sensory and sympathetic neurotransmitters are involved in the pathology of inflammatory diseases such as rheumatoid arthritis (RA) which manifests mainly in the joints. In addition, they seem to play a role in pathogenesis of priori degenerative joint disorders such as osteoarthritis (OA). Altogether it is evident that sensory and sympathetic neurotransmitters have crucial trophic effects which are critical for joint tissue and bone homeostasis. They modulate articular cartilage, subchondral bone and synovial tissue properties in physiological and pathophysiological conditions, in addition to their classical neurological features. PMID:28452955

Long-term sequelae of autologous bone marrow or peripheral stem cell transplantation for lymphoid malignancies.

PubMed

Vose, J M; Kennedy, B C; Bierman, P J; Kessinger, A; Armitage, J O

1992-02-01

The study was made to evaluate the long-term physical and psychosocial changes after high-dose therapy and autologous bone marrow or peripheral stem transplantation for recurrent lymphoid malignancies. Patients who had undergone high dose therapy and autologous bone marrow or peripheral stem cell transplantation for recurrent lymphoid malignancies at least 1 year previously were contacted by phone interview regarding their status after the transplant. The patients' comments were confirmed by checking medical records when possible. Fifty patients who had undergone transplantation at the University of Nebraska Medical Center at least 1 year before the interview were available for interview and willing to answer questions. After transplant, many patients noticed temporary changes in their appearance, which usually returned to normal within 1 year. Few patients reported remarkable cardiovascular, gastrointestinal, or pulmonary changes after transplantation. However, up to one-third of the patients reported changes in sexual function or desire. The most common infectious problem after transplant was Herpes zoster, which occurred in 25% of the patients. Overall, the patients had a positive outlook after high-dose therapy and transplantation, with most being able to return to work and enjoy a normal life style. Ninety-six percent of the patients stated that they would be willing to undergo high-dose therapy and transplantation again under the same circumstances.

The effects of hemostatic agents on peripheral nerve function: an experimental study.

PubMed

Alkan, Alper; Inal, Samet; Yildirim, Mehmet; Baş, Burcu; Ağar, Erdal

2007-04-01

In the practice of oral and maxillofacial surgery, hemostatic agents are sometimes placed in close proximity to peripheral nerves. In the present study, we evaluated immediate and delayed effects of 4 hemostatic agents (oxidized regenerated cellulose, 5% colloid silver-added gelatine sponge, bovine collagen, bone wax) on peripheral nerve function. A total of 25 rat sciatic nerves were prepared, and the amplitudes were recorded with a physiological data acquisition system. Animals were randomly assigned to 5 groups: control, oxidized regenerated cellulose, gelatine sponge, bone wax, and bovine collagen. The first hour records are defined as immediate effects of these hemostatic agents on nerve function. The animals were then allowed to recover for 4 weeks. At the end of this period, the same surgical and recording procedures were performed. These final records are defined as delayed effects of hemostatic agents on nerve function. According to nerve conduction velocity (NCV) and compound action potential (CAP) values of the experimental groups, early and delayed effects of each hemostatic agent were statistically compared with Bonferroni corrected test (P < .05). Statistically, NCV was significantly reduced, and the CAP was significantly increased 1 hour after surgery (P < .05) in the group of oxidized regenerated cellulose. However, there were no significant differences after 4 weeks compared with the first records. In the gelatine sponge group, CAP was significantly increased 4 weeks after the application. In the bovine collagen and bone wax groups, NCV and CAP values (1 hour and 4 weeks after the application) were not statistically significant compared with initial control records. The present study shows that bovine collagen is the most suitable hemostatic agent applicable for peripheral nerves.

A Case of Complete and Durable Molecular Remission of Chronic Lymphocytic Leukemia Following Treatment with Epigallocatechin-3-gallate, an Extract of Green Tea

PubMed Central

Block, Keith I; Kressel, Bruce R; Sukhatme, Vikas P; White, Jeffrey D

2015-01-01

We report the case of a 48-year-old man who achieved a complete molecular remission 20 years after a diagnosis of chronic lymphocytic leukemia while using epigallicatechin-3-gallate, an extract of green tea. The patient presented at age 28 with lymphocytosis, mild anemia, mild thrombocytopenia, and massive splenomegaly, for which a splenectomy was performed. He was then followed expectantly. Over the next two decades, he suffered two symptomatic chronic lymphocytic leukemia-related events. The first occurred twelve years after diagnosis (at age 40) when the patient developed fevers, night sweats, and moderate anemia. He was diagnosed with autoimmune hemolytic anemia secondary to chronic lymphocytic leukemia. The patient declined conventional therapy in favor of a diet, exercise, and supplement regimen, and recovered from the autoimmune hemolytic anemia though the underlying chronic lymphocytic leukemia remained evident. This is the first published case report of "spontaneous" recovery from secondary autoimmune hemolytic anemia in an adult.  Over the second decade following chronic lymphocytic leukemia diagnosis, serial bone marrow biopsies demonstrated increasing lymphocytosis, with minimal peripheral lymphocytosis. However, twenty years after diagnosis, peripheral lymphocytosis accelerated, with white blood cell counts rising to 55,000/µL. Because the patient continued to refuse conventional therapy, he was treated instead with a supplement regimen that included high doses of epigallocatechin-3-gallate, a green tea extract. Peripheral lymphocytosis resolved. More remarkably, a bone marrow examination, including flow cytometry, showed no evidence of a malignant clone. Two years later (at age 51), the peripheral blood and bone marrow were without molecular evidence of chronic lymphocytic leukemia or any malignancy. The patient remains well at age 52.  PMID:26858922

Bone mineral measurement: Skylab experiment M-078.

PubMed

Vogel, J M

1975-01-01

The observation that bone mineral is lost in patients who are either immobilized or remain in bed for extended periods of time formed the basis for the concern that large amounts of bone mineral may be lost during long periods of weightlessness. This concern was magnified when early X-ray densitometry studies suggested that rather large amounts of mineral could be lost during rather short periods of weightlessness (4-14 days). Even though these Gemini results have recently been modified, they still reflect substantial losses in the upper extremity. This led to a series of prolonged bed-rest studies (30-36 weeks) which, in addition to careful calcium balance, also employed a newer, more precise method of estimating bone mineral in the radius, ulna, and os calcis. It employed an essentially monoenergetic photon source (125I) and a scintillation detector operating in a rectilinear scanning mode to measure bone mineral by the absorptiometric technique. Bed-rest studies revealed variable mineral losses but suggested that little if any is lost during 4-6 weeks, with variable amounts being lost in 8 weeks. Losses up to 40% were noted in the os calcis after 9 months, with essentially none in the radius and ulna. When this technique was employed during the Apollo 14, 15, and 16 missions, only one crewman (CMP Apollo 15) showed significant losses in the os calcis and none in the radius or ulna. These results were, therefore, in concert with the bed-rest data but at variance with the earlier Gemini data. The variability observed during bed rest was reconciled when it was observed that the rate of loss could be correlated with the initial 24-hour urinary hydroxyproline excretion and the initial os calcis mineral content. Prediction terms were established. Measurements of the SL-II crew after 28 days of weightlessness revealed no significant bone mineral losses. The Skylab data lie within the predicted limits obtained from the bed-rest data. The relevance of the prediction terms to the Skylab and longer missions discussed.

Secondary osteoporosis.

PubMed

Boyle, I T

1993-10-01

Osteoporosis with attendant increased fracture risk is a common complication of many other diseases. Indeed, almost all chronic diseases make some impact on life-style, usually by restricting physical activity and hence reducing the anabolic effect of exercise and gravitational strains on the skeleton. Restricted appetite and modified gastrointestinal tract function is another commonplace finding that has an impact on bone nutrition and synthesis, as on other systems. Sex hormone status is of particular importance for the maintenance of the normal skeleton, and the postmenopausal woman is at particular risk for most causes of secondary osteoporosis. In dealing with secondary osteoporosis in the hypo-oestrogenic woman, the question of giving hormone replacement therapy in addition to other disease-specific therapy should always be considered, as, for example, in a young amenorrhoeic woman with Crohn's disease. Similarly, in hypogonadal men the administration of testosterone is useful for bone conservation. The wider availability of bone densitometry ought to make us more aware of the presence of osteoporosis in the many disease states discussed above. This is particularly important as the life span of such patients is now increased by improved management of the underlying disease process in many instances. Even in steroid-induced osteoporosis--one of the commonest and most severe forms of osteoporosis--we now have some effective therapy in the form of the bisphosphonates and other anti-bone-resorbing drug classes. The possibility of prophylaxis against secondary osteoporosis has therefore become a possibility, although the very long-term effects of such drug regimens are still unknown. In some situations, such as thyrotoxicosis, Cushing's syndrome and immobilization, spontaneous resolution of at least part of the osteoporosis is possible after cure of the underlying problem. The shorter the existence of the basic problem, the more successful the restoration of the skeleton appears to be. A useful credo for clinicians with respect to secondary osteoporosis is: to think of it; to use specific therapy for the underlying disease; to reduce or remove completely any relevant drug or toxic material; to optimize physical activity and general nutrition; to treat hypogonadism if present and feasible; and to consider the use of specific anti-bone-resorbing or other bone active drugs.

Trabecular bone class mapping across resolutions: translating methods from HR-pQCT to clinical CT

NASA Astrophysics Data System (ADS)

Valentinitsch, Alexander; Fischer, Lukas; Patsch, Janina M.; Bauer, Jan; Kainberger, Franz; Langs, Georg; DiFranco, Matthew

2015-03-01

Quantitative assessment of 3D bone microarchitecture in high-resolution peripheral quantitative computed tomography (HR-pQCT) has shown promise in fracture risk assessment and biomechanics, but is limited to the distal radius and tibia. Trabecular microarchitecture classes (TMACs), based on voxel-wise clustering texture and structure tensor features in HRpQCT, is extended in this paper to quantify trabecular bone classes in clinical multi-detector CT (MDCT) images. Our comparison of TMACs in 12 cadaver radii imaged using both HRpQCT and MDCT yields a mean Dice score of up to 0.717+/-0.40 and visually concordant bone quality maps. Further work to develop clinically viable bone quantitative imaging using HR-pQCT validation could have a significant impact on overall bone health assessment.

Recombinant VSV G proteins reveal a novel raft-dependent endocytic pathway in resorbing osteoclasts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mulari, Mika T.K.; Centre for Military Medicine, Research Department, Lahti; Nars, Martin

2008-05-01

Transcytotic membrane flow delivers degraded bone fragments from the ruffled border to the functional secretory domain, FSD, in bone resorbing osteoclasts. Here we show that there is also a FSD-to-ruffled border trafficking pathway that compensates for the membrane loss during the matrix uptake process and that rafts are essential for this ruffled border-targeted endosomal pathway. Replacing the cytoplasmic tail of the vesicular stomatitis virus G protein with that of CD4 resulted in partial insolubility in Triton X-100 and retargeting from the peripheral non-bone facing plasma membrane to the FSD. Recombinant G proteins were subsequently endosytosed and delivered from the FSDmore » to the peripheral fusion zone of the ruffled border, which were both rich in lipid rafts as suggested by viral protein transport analysis and visualizing the rafts with fluorescent recombinant cholera toxin. Cholesterol depletion by methyl-{beta}-cyclodextrin impaired the ruffled border-targeted vesicle trafficking pathway and inhibited bone resorption dose-dependently as quantified by measuring the CTX and TRACP 5b secreted to the culture medium and by measuring the resorbed area visualized with a bi-phasic labeling method using sulpho-NHS-biotin and WGA-lectin. Thus, rafts are vital for membrane recycling from the FSD to the late endosomal/lysosomal ruffled border and bone resorption.« less

Analysis of the immune system of multiple myeloma patients achieving long-term disease control by multidimensional flow cytometry

PubMed Central

Pessoa de Magalhães, Roberto J.; Vidriales, María-Belén; Paiva, Bruno; Fernandez-Gimenez, Carlos; García-Sanz, Ramón; Mateos, Maria-Victoria; Gutierrez, Norma C.; Lecrevisse, Quentin; Blanco, Juan F; Hernández, Jose; de las Heras, Natalia; Martinez-Lopez, Joaquin; Roig, Monica; Costa, Elaine Sobral; Ocio, Enrique M.; Perez-Andres, Martin; Maiolino, Angelo; Nucci, Marcio; De La Rubia, Javier; Lahuerta, Juan-Jose; San-Miguel, Jesús F.; Orfao, Alberto

2013-01-01

Multiple myeloma remains largely incurable. However, a few patients experience more than 10 years of relapse-free survival and can be considered as operationally cured. Interestingly, long-term disease control in multiple myeloma is not restricted to patients with a complete response, since some patients revert to having a profile of monoclonal gammopathy of undetermined significance. We compared the distribution of multiple compartments of lymphocytes and dendritic cells in the bone marrow and peripheral blood of multiple myeloma patients with long-term disease control (n=28), patients with newly diagnosed monoclonal gammopathy of undetermined significance (n=23), patients with symptomatic multiple myeloma (n=23), and age-matched healthy adults (n=10). Similarly to the patients with monoclonal gammopathy of undetermined significance and symptomatic multiple myeloma, patients with long-term disease control showed an expansion of cytotoxic CD8+ T cells and natural killer cells. However, the numbers of bone marrow T-regulatory cells were lower in patients with long-term disease control than in those with symptomatic multiple myeloma. It is noteworthy that B cells were depleted in patients with monoclonal gammopathy of undetermined significance and in those with symptomatic multiple myeloma, but recovered in both the bone marrow and peripheral blood of patients with long-term disease control, due to an increase in normal bone marrow B-cell precursors and plasma cells, as well as pre-germinal center peripheral blood B cells. The number of bone marrow dendritic cells and tissue macrophages differed significantly between patients with long-term disease control and those with symptomatic multiple myeloma, with a trend to cell count recovering in the former group of patients towards levels similar to those found in healthy adults. In summary, our results indicate that multiple myeloma patients with long-term disease control have a constellation of unique immune changes favoring both immune cytotoxicity and recovery of B-cell production and homing, suggesting improved immune surveillance. PMID:22773604

Functional Role of MicroRNAs in Hematopoietic Stem Cells in the Myelodysplastic Syndromes

DTIC Science & Technology

2012-05-01

bone  marrow  was  not  regularly  accompanied  by  absolute   neutropenia  in  the  peripheral  blood.  Notably,  the... neutropenia  observed  in  the  peripheral  blood  of   15-­‐20%  of  MDS  patients.  The  other  cytopenias  in  MDS

Non-conventional features of peripheral serotonin signalling - the gut and beyond.

PubMed

Spohn, Stephanie N; Mawe, Gary M

2017-07-01

Serotonin was first discovered in the gut, and its conventional actions as an intercellular signalling molecule in the intrinsic and extrinsic enteric reflexes are well recognized, as are a number of serotonin signalling pharmacotherapeutic targets for treatment of nausea, diarrhoea or constipation. The latest discoveries have greatly broadened our understanding of non-conventional actions of peripheral serotonin within the gastrointestinal tract and in a number of other tissues. For example, it is now clear that bacteria within the lumen of the bowel influence serotonin synthesis and release by enterochromaffin cells. Also, serotonin can act both as a pro-inflammatory and anti-inflammatory signalling molecule in the intestinal mucosa via activation of serotonin receptors (5-HT 7 or 5-HT 4 receptors, respectively). For decades, serotonin receptors have been known to exist in a variety of tissues other than the gut, but studies have now provided strong evidence for physiological roles of serotonin in several important processes, including haematopoiesis, metabolic homeostasis and bone metabolism. Furthermore, evidence for serotonin synthesis in peripheral tissues outside of the gut is emerging. In this Review, we expand the discussion beyond gastrointestinal functions to highlight the roles of peripheral serotonin in colitis, haematopoiesis, energy and bone metabolism, and how serotonin is influenced by the gut microbiota.

Molecular Detection of Breast Cancer

DTIC Science & Technology

1998-02-01

treatment-resistant cancer cells. Clearly new approaches are needed to treat these diseases. This project is designed to develop novel approaches to...detect breast cancer cells that contaminate peripheral blood and bone marrow, and to remove such contaminating cells. An RT-PCR assay has been developed ...to detect breast cancer cells, and a novel gene therapy vector has been developed to kill contaminating cancer cells. Blood and bone marrow samples

Common endocrine control of body weight, reproduction, and bone mass

NASA Technical Reports Server (NTRS)

Takeda, Shu; Elefteriou, Florent; Karsenty, Gerard

2003-01-01

Bone mass is maintained constant between puberty and menopause by the balance between osteoblast and osteoclast activity. The existence of a hormonal control of osteoblast activity has been speculated for years by analogy to osteoclast biology. Through the search for such humoral signal(s) regulating bone formation, leptin has been identified as a strong inhibitor of bone formation. Furthermore, intracerebroventricular infusion of leptin has shown that the effect of this adipocyte-derived hormone on bone is mediated via a brain relay. Subsequent studies have led to the identification of hypothalamic groups of neurons involved in leptin's antiosteogenic function. In addition, those neurons or neuronal pathways are distinct from neurons responsible for the regulation of energy metabolism. Finally, the peripheral mediator of leptin's antiosteogenic function has been identified as the sympathetic nervous system. Sympathomimetics administered to mice decreased bone formation and bone mass. Conversely, beta-blockers increased bone formation and bone mass and blunted the bone loss induced by ovariectomy.

Interest of a prescreening questionnaire to reduce the cost of bone densitometry.

PubMed

Ben Sedrine, W; Broers, P; Devogelaer, J P; Depresseux, G; Kaufman, J M; Goemaere, S; Reginster, J Y

2002-05-01

Bone mineral density (BMD) measurement is widely recognized as the best single tool to identify patients with a high lifetime risk of developing an osteoporosis-related fracture. However, the cost/benefit value of screening the whole population has been repeatedly challenged and demonstrated to be rather poor. In many countries, BMD scan is not or no longer reimbursed because of lack of validated criteria to identify patients who should benefit from this procedure. Based on the proposals of a nationwide expert panel, a simple questionnaire identifying historical, clinical and behavioral risk factors for osteoporosis was developed. The aim of this study was to assess the diagnostic accuracy of the proposed criteria; to determine the extent to which this questionnaire could be useful for optimizing the use of densitometry tests; and, more specifically, to estimate the diagnostic costs per osteoporotic or osteopenic patient detected. For this purpose, we applied the questionnaire to 3998 consecutive individuals at least 20 years old, of both genders, either consulting spontaneously or referred for a BMD measurement to an outpatient osteoporosis center. BMD was measured by dual-energy X-ray absorptiometry (DXA) at the lumbar spine and at the hip (both total hip and femoral neck). Diagnostic accuracies were evaluated through measures of sensitivity, specificity, and positive and negative predictive values. After determining a benchmark value for age, different strategies were compared in order to identify the most cost-effective one in terms of cost per patient detected. According to the WHO operational definition of osteoporosis (T-score <-2.5), 31% of the subjects were classified as osteoporotic at one or more of the measured sites. If only patients with at least one of the proposed risk factors had been referred for scans, 33.3% of the BMD measurements would have been avoided. Among those, less than 5% were missclassified as they did have osteoporosis at the total hip and up to 23% at one or more of the considered sites. On the other hand, of the subjects who would be recommended for a densitometry test, only a small fraction were identified correctly (the positive predictive values varied from 11.3% at the total hip to 34.8% at any site). In this first setting, the suggested criteria seem useful chiefly for excluding subjects who do not need a DXA scan rather than selecting osteoporotic patients. When applied only to patients aged 61 years or more, the positive predictive values rose to 15.1% (total hip) and 42.9% (any site), whereas the corresponding negative predictive values were set at 93% and 68.6%. In comparison, with a mass screening scenario the estimated diagnostic costs (costs associated with the DXA procedure) per osteoporotic patient detected at any of the considered sites would be reduced by more than 9% (59.4 instead of 65.3 Euros) if the suggested indications are taken into account for prescreening patients. And when the questionnaire is applied only to women over the age of 60 years these costs would be further reduced to 50.6 Euros, representing a 23% decrease. Then, a prescreening strategy based on these indications concomitantly with an age-selective criterion could represent a promising way toward a more rational use of BMD measurement.

Combined effect of IL-17 and blockade of nitric oxide biosynthesis on haematopoiesis in mice.

PubMed

Krstić, A; Santibanez, J F; Okić, I; Mojsilović, S; Kocić, J; Jovcić, G; Milenković, P; Bugarski, D

2010-05-01

The study was undertaken to extend our investigation concerning both the in vivo activity of interleukin (IL)-17 and the specific role of nitric oxide (NO) in IL-17-induced effects in the process of haematopoiesis. CBA mice were simultaneously treated with IL-17 and/or nitric oxide synthase (NOS) inhibitor, l-NAME, for 5 days and changes within various haematopoietic cell lineages in bone marrow, spleen and peripheral blood were analysed. Findings showed that administration of both IL-17 and l-NAME stimulated increase in net haematopoiesis in normal mice. IL-17-enhanced myelopoiesis was characterized by stimulation of both femoral and splenic haematopoietic progenitor cells and morphologically recognizable granulocytes. Additionally, IL-17 induced alterations in the frequency of erythroid progenitor cells in both bone marrow and spleen, accompanied with their mobilization to the peripheral blood. As a consequence of these changes in the erythroid cell compartments, significant reticulocytosis was observed, which evidenced that in IL-17-treated mice effective erythropoiesis occurred. Exposure of mice to NOS inhibitor also increased the number of both granulocyte-macrophage and erythroid progenitors in bone marrow and spleens, and these alterations were followed by the mobilization of erythroid progenitors and elevated content of reticulocytes in peripheral blood. The specific role of NO in IL-17-induced haematopoiesis was demonstrated only in the IL-17-reducing effect on bone marrow late stage erythroid progenitors, CFU-E. The results demonstrated the involvement of both IL-17 and NO in the regulation of haematopoietic cell activity in various haematopoietic compartments. They further suggest that IL-17 effects are differentially mediated depending on the haematopoietic microenvironments.

The Physiology of Bone Pain. How Much Do We Really Know?

PubMed Central

Nencini, Sara; Ivanusic, Jason J.

2016-01-01

Pain is associated with most bony pathologies. Clinical and experimental observations suggest that bone pain can be derived from noxious stimulation of the periosteum or bone marrow. Sensory neurons are known to innervate the periosteum and marrow cavity, and most of these have a morphology and molecular phenotype consistent with a role in nociception. However, little is known about the physiology of these neurons, and therefore information about mechanisms that generate and maintain bone pain is lacking. The periosteum has received greater attention relative to the bone marrow, reflecting the easier access of the periosteum for experimental assessment. With the electrophysiological preparations used, investigators have been able to record from single periosteal units in isolation, and there is a lot of information available about how they respond to different stimuli, including those that are noxious. In contrast, preparations used to study sensory neurons that innervate the bone marrow have been limited to recording multi-unit activity in whole nerves, and whilst they clearly report responses to noxious stimulation, it is not possible to define responses for single sensory neurons that innervate the bone marrow. There is only limited evidence that peripheral sensory neurons that innervate bone can be sensitized or that they can be activated by multiple stimulus types, and at present this only exists in part for periosteal units. In the central nervous system, it is clear that spinal dorsal horn neurons can be activated by noxious stimuli applied to bone. Some can be sensitized under pathological conditions and may contribute in part to secondary or referred pain associated with bony pathology. Activity related to stimulation of sensory nerves that innervate bone has also been reported in neurons of the spinoparabrachial pathway and the somatosensory cortices, both known for roles in coding information about pain. Whilst these provide some clues as to the way information about bone pain is centrally coded, they need to be expanded to further our understanding of other central territories involved. There is a lot more to learn about the physiology of peripheral sensory neurons that innervate bone and their central projections. PMID:27199772

Hematologic evaluation of employees with leukopenia. Naval Weapons Center, China Lake, California.

PubMed

Luiken, G A; Marsh, W L; Heath, V C; Long, H L; Weatherly, T L; Seal, G M

1988-12-01

Evaluation of 86 employees with a history of leukopenia at the Naval Weapons Center (NWC), China Lake, California, was done by exposure questionnaires, medical histories, physical examinations, peripheral blood smear, and bone marrow evaluations, including morphologic examination, stem cell culture, and cytogenetics. Forty-eight subjects were found to be leukopenic at the time of the study, and two subjects were found to have hairy cell leukemia. All subjects had positive exposure histories and were healthy at the time of the study. Review of peripheral smears identified the patients with marrow abnormalities. Bone marrow cultures revealed several patients with possible marrow suppression. Chromosome studies were not diagnostic. Five-year follow-up health questionnaires revealed no significant health problems; the two workers with hairy cell leukemia are alive and fully functional. Leukopenia in itself does not appear to be a risk factor for poor health, and it is unknown whether or not it may be a useful screening tool to identify workers at risk in toxic environments. Careful evaluation of blood cell counts and peripheral smears should be sufficient to identify people with potential marrow abnormalities.

Safety profile and long-term engraftment of human CD31+ blood progenitors in bone tissue engineering.

PubMed

Zigdon-Giladi, Hadar; Elimelech, Rina; Michaeli-Geller, Gal; Rudich, Utai; Machtei, Eli E

2017-07-01

Endothelial progenitor cells (EPCs) participate in angiogenesis and induce favorable micro-environments for tissue regeneration. The efficacy of EPCs in regenerative medicine is extensively studied; however, their safety profile remains unknown. Therefore, our aims were to evaluate the safety profile of human peripheral blood-derived EPCs (hEPCs) and to assess the long-term efficacy of hEPCs in bone tissue engineering. hEPCs were isolated from peripheral blood, cultured and characterized. β tricalcium phosphate scaffold (βTCP, control) or 10 6 hEPCs loaded onto βTCP were transplanted in a nude rat calvaria model. New bone formation and blood vessel density were analyzed using histomorphometry and micro-computed tomography (CT). Safety of hEPCs using karyotype analysis, tumorigenecity and biodistribution to target organs was evaluated. On the cellular level, hEPCs retained their karyotype during cell expansion (seven passages). Five months following local hEPC transplantation, on the tissue and organ level, no inflammatory reaction or dysplastic change was evident at the transplanted site or in distant organs. Direct engraftment was evident as CD31 human antigens were detected lining vessel walls in the transplanted site. In distant organs human antigens were absent, negating biodistribution. Bone area fraction and bone height were doubled by hEPC transplantation without affecting mineral density and bone architecture. Additionally, local transplantation of hEPCs increased blood vessel density by nine-fold. Local transplantation of hEPCs showed a positive safety profile. Furthermore, enhanced angiogenesis and osteogenesis without mineral density change was found. These results bring us one step closer to first-in-human trials using hEPCs for bone regeneration. Copyright © 2017 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.

Effect of dexamethasone on mandibular bone biomechanics in rats during the growth phase as assessed by bending test and peripheral quantitative computerized tomography.

PubMed

Bozzini, Clarisa; Champin, Graciela; Alippi, Rosa M; Bozzini, Carlos E

2015-04-01

Long-term glucocorticoid administration to growing rats induces osteopenia and alterations in the biomechanical behavior of the bone. This study was performed to estimate the effects of dexamethasone (DTX), a synthetic steroid with predominant glucocorticoid activity, on the biomechanical properties of the mandible of rats during the growth phase, as assessed by bending test and peripheral quantitative computed tomographic (pQCT) analysis. The data obtained by the two methods will provide more precise information when analyzed together than separately. Female rats aged 23 d (n=7) received 500μg.kg-1 per day of DXT for 4 weeks. At the end of the treatment period, their body weight and body length were 51.3% and 20.6% lower, respectively, than controls. Hemimandible weight and area (an index of mandibular size) were 27.3% and 9.7% lower, respectively. The right hemimandible of each animal was subjected to a mechanical 3-point bending test. Significant weakening of the bone, as shown by a correlative impairment of strength and stiffness, was observed in experimental rats. Bone density and cross-sectional area were measured by pQCT. Cross-sectional, cortical and trabecular areas were reduced by 20% to 30% in the DTX group, as were other cortical parameters, including the bone density, mineral content and cross-sectional moment of inertia. The "bone strength index" (BSI, the product of the pQCT-assessed xCSMI and vCtBMD) was 56% lower in treated rats, which compares well with the 54% and 52% reduction observed in mandibular strength and stiffness determined through the bending test. Data suggest that the corticosteroid exerts a combined, negative action on bone geometry (mass and architecture) and volumetric bone mineral density of cortical bone, which would express independent effects on both cellular (material quality) and tissue (cross-sectional design) levels of biological organization of the skeleton in the species.

Maintenance of Host Leukocytes in Peripheral Immune Compartments Following Lethal Irradiation and Bone Marrow Reconstitution: Implications for Graft Versus Host Disease

PubMed Central

Staley, Elizabeth M.; Tanner, Scott M.; Daft, Joseph G.; Stanus, Andrea L.; Martin, Steven M.; Lorenz, Robin G.

2013-01-01

Bone marrow reconstitution is utilized as a tool for disease treatment and as a research technique to elucidate the function of bone marrow derived cells. Clinically successful engraftment is indicated by the development of a functioning immune repertoire. In research, reconstitution is considered successful if >85% of splenic leukocytes are of donor origins. Previous work suggests that splenic reconstitution may not be indicative of reconstitution in the mucosa. We sought to evaluate mucosal reconstitution in animals following a standard bone marrow eradication and reconstitution technique. Bone marrow was harvested from adult B6.SJL donor mice (CD45.1) and injected via either the retro-orbital or intraperitoneal route into lethally irradiated B6 (CD45.2) adult or neonatal recipients respectively. Expression of CD45 by flow cytometry was used to calculate reconstitution with respect to immune compartment and cell type. In reconstituted adult animals 93.2±1.5% of splenic leukocytes expressed the donor CD45.1 antigen thus meeting the standard definition of reconstitution, however only 58.6±13.6% of intestinal lamina propria lymphocytes and 52.4±16.0% of intestinal intraepithelial lymphocytes were of donor origin, confirming splenic reconstitution fails to represent peripheral immune reconstitution. T-cells in the gastrointestinal tract are the most poorly reconstituted, while B-cells appear to be almost universally replaced by donor cells. The inadequate mucosal reconstitution was not corrected by evaluating later timepoints or by performing the bone marrow transfer during the neonatal period. This demonstration that substantial host T-cells remain in the intestinal mucosa after a “successful” bone marrow transplantation should cause a re-evaluation of data from research bone marrow chimera experiments, as well as the mechanisms for complications after clinical bone marrow transplantation. PMID:23334064

Maintenance of host leukocytes in peripheral immune compartments following lethal irradiation and bone marrow reconstitution: implications for graft versus host disease.

PubMed

Staley, Elizabeth M; Tanner, Scott M; Daft, Joseph G; Stanus, Andrea L; Martin, Steven M; Lorenz, Robin G

2013-03-01

Bone marrow reconstitution is utilized as a tool for disease treatment and as a research technique to elucidate the function of bone marrow derived cells. Clinically successful engraftment is indicated by the development of a functioning immune repertoire. In research, reconstitution is considered successful if >85% of splenic leukocytes are of donor origins. Previous work suggests that splenic reconstitution may not be indicative of reconstitution in the mucosa. We sought to evaluate mucosal reconstitution in animals following a standard bone marrow eradication and reconstitution technique. Bone marrow was harvested from adult B6.SJL donor mice (CD45.1) and injected via either the retro-orbital or intraperitoneal route into lethally irradiated B6 (CD45.2) adult or neonatal recipients respectively. The expression of CD45 by flow cytometry was used to calculate reconstitution with respect to immune compartment and cell type. In reconstituted adult animals 93.2±1.5% of splenic leukocytes expressed the donor CD45.1 antigen thus meeting the standard definition of reconstitution, however only 58.6±13.6% of intestinal lamina propria lymphocytes and 52.4±16.0% of intestinal intraepithelial lymphocytes were of donor origin, confirming splenic reconstitution fails to represent peripheral immune reconstitution. T-cells in the gastrointestinal tract are the most poorly reconstituted, while B-cells appear to be almost universally replaced by donor cells. The inadequate mucosal reconstitution was not corrected by evaluating later time points or by performing the bone marrow transfer during the neonatal period. This demonstration that substantial host T-cells remain in the intestinal mucosa after a "successful" bone marrow transplantation should cause a re-evaluation of data from research bone marrow chimera experiments, as well as the mechanisms for complications after clinical bone marrow transplantation. Copyright © 2013 Elsevier B.V. All rights reserved.

High-Fat Diet-Induced Obesity Promotes Expansion of Bone Marrow Adipose Tissue and Impairs Skeletal Stem Cell Functions in Mice.

PubMed

Tencerova, Michaela; Figeac, Florence; Ditzel, Nicholas; Taipaleenmäki, Hanna; Nielsen, Tina Kamilla; Kassem, Moustapha

2018-06-01

Obesity represents a risk factor for development of insulin resistance and type 2 diabetes. In addition, it has been associated with increased adipocyte formation in the bone marrow (BM) along with increased risk for bone fragility fractures. However, little is known on the cellular mechanisms that link obesity, BM adiposity, and bone fragility. Thus, in an obesity intervention study in C57BL/6J mice fed with a high-fat diet (HFD) for 12 weeks, we investigated the molecular and cellular phenotype of bone marrow adipose tissue (BMAT), BM progenitor cells, and BM microenvironment in comparison to peripheral adipose tissue (AT). HFD decreased trabecular bone mass by 29%, cortical thickness by 5%, and increased BM adiposity by 184%. In contrast to peripheral AT, BMAT did not exhibit pro-inflammatory phenotype. BM progenitor cells isolated from HFD mice exhibited decreased mRNA levels of inflammatory genes (Tnfα, IL1β, Lcn2) and did not manifest an insulin resistant phenotype evidenced by normal levels of pAKT after insulin stimulation as well as normal levels of insulin signaling genes. In addition, BM progenitor cells manifested enhanced adipocyte differentiation in HFD condition. Thus, our data demonstrate that BMAT expansion in response to HFD exerts a deleterious effect on the skeleton. Continuous recruitment of progenitor cells to adipogenesis leads to progenitor cell exhaustion, decreased recruitment to osteoblastic cells, and decreased bone formation. In addition, the absence of insulin resistance and inflammation in the BM suggest that BMAT buffers extra energy in the form of triglycerides and thus plays a role in whole-body energy homeostasis. © 2018 The Authors. Journal of Bone and Mineral Research Published by Wiley Periodicals, Inc. © 2018 The Authors. Journal of Bone and Mineral Research Published by Wiley Periodicals, Inc.

Bioindicators in the MIDUS National Study: Protocol, Measures, Sample, and Comparative Context

PubMed Central

Love, Gayle Dienberg; Seeman, Teresa E.; Weinstein, Maxine; Ryff, Carol D.

2010-01-01

Objectives MIDUS is a national study of health and aging among individuals aged 25 to 74 at baseline(1995/96). Longitudinal survey assessments (2004/05), were followed by biological assessments on a subsample aged 35–85. To facilitate public use, we describe the protocol, measures, and sample. Methods Respondents traveled to clinics for a two-day data collection protocol that included fasting blood specimens, 12-hour urine specimen, medical history, physical exam, bone densitometry, a laboratory challenge (heart rate variability, blood pressure, respiration, salivary cortisol). Results Response rates for the biological protocol (N = 1,255) were 39.3%, or 43.1% (adjusting for those who could not be located or contacted). Reasons for non-participation were travel, family obligations, and being too busy. Respondents were comparable to the recruitment pool on most demographic characteristics and health assessments. Discussion Strengths of the protocol vis-à-vis other similar studies include opportunities to link biological factors with diverse content from other MIDUS projects. PMID:20876364

Gene Therapy of Breast Cancer: Studies of Selection Promoter/Enhancer-Modified Vectors to Deliver Suicide Genes.

DTIC Science & Technology

1996-09-01

bone marrow (BM) or peripheral blood (PB) as sources of hematopoietic stem cells is being used as a treatment option for patients with breast cancer 1...peripheral blood (PB) may affect the outcome of patients receiving high dose chemotherapy with autologous transplantation of hematopoietic stem cell ...cancer cell contamination to relapse remains unclear, tumor-free hematopoietic stem cell products for autologous transplantation are nonetheless desirable

Expression of nociceptive ligands in canine osteosarcoma.

PubMed

Shor, S; Fadl-Alla, B A; Pondenis, H C; Zhang, X; Wycislo, K L; Lezmi, S; Fan, T M

2015-01-01

Canine osteosarcoma (OS) is associated with localized pain as a result of tissue injury from tumor infiltration and peritumoral inflammation. Malignant bone pain is caused by stimulation of peripheral pain receptors, termed nociceptors, which reside in the localized tumor microenvironment, including the periosteal and intramedullary bone cavities. Several nociceptive ligands have been determined to participate directly or indirectly in generating bone pain associated with diverse skeletal abnormalities. Canine OS cells actively produce nociceptive ligands with the capacity to directly or indirectly activate peripheral pain receptors residing in the bone tumor microenvironment. Ten dogs with appendicular OS. Expression of nerve growth factor, endothelin-1, and microsomal prostaglandin E synthase-1 was characterized in OS cell lines and naturally occurring OS samples. In 10 dogs with OS, circulating concentrations of nociceptive ligands were quantified and correlated with subjective pain scores and tumor volume in patients treated with standardized palliative therapies. Canine OS cells express and secrete nerve growth factor, endothelin-1, and prostaglandin E2. Naturally occurring OS samples uniformly express nociceptive ligands. In a subset of OS-bearing dogs, circulating nociceptive ligand concentrations were detectable but failed to correlate with pain status. Localized foci of nerve terminal proliferation were identified in a minority of primary bone tumor samples. Canine OS cells express nociceptive ligands, potentially permitting active participation of OS cells in the generation of malignant bone pain. Specific inhibitors of nociceptive ligand signaling pathways might improve pain control in dogs with OS. Copyright © 2015 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of American College of Veterinary Internal Medicine.

Central adiponectin administration reveals new regulatory mechanisms of bone metabolism in mice.

PubMed

Wu, Yuwei; Tu, Qisheng; Valverde, Paloma; Zhang, Jin; Murray, Dana; Dong, Lily Q; Cheng, Jessica; Jiang, Hua; Rios, Maribel; Morgan, Elise; Tang, Zhihui; Chen, Jake

2014-06-15

Adiponectin (APN), the most abundant adipocyte-secreted adipokine, regulates energy homeostasis and exerts well-characterized insulin-sensitizing properties. The peripheral or central effects of APN regulating bone metabolism are beginning to be explored but are still not clearly understood. In the present study, we found that APN-knockout (APN-KO) mice fed a normal diet exhibited decreased trabecular structure and mineralization and increased bone marrow adiposity compared with wild-type (WT) mice. APN intracerebroventricular infusions decreased uncoupling protein 1 (UCP1) expression in brown adipose tissue, epinephrine and norepinephrine serum levels, and osteoclast numbers, whereas osteoblast osteogenic marker expression and trabecular bone mass increased in APN-KO and WT mice. In addition, centrally administered APN increased hypothalamic tryptophan hydroxylase 2 (TPH2), cocaine- and amphetamine-regulated transcript (CART), and 5-hydroxytryptamine (serotonin) receptor 2C (Htr2C) expressions but decreased hypothalamic cannabinoid receptor-1 expression. Treatment of immortalized mouse neurons with APN demonstrated that APN-mediated effects on TPH2, CART, and Htr2C expression levels were abolished by downregulating adaptor protein containing pleckstrin homology domain, phosphotyrosine domain, and leucine zipper motif (APPL)-1 expression. Pharmacological increase in sympathetic activity stimulated adipogenic differentiation of bone marrow stromal cells (BMSC) and reversed APN-induced expression of the lysine-specific demethylases involved in regulating their commitment to the osteoblastic lineage. In conclusion, we found that APN regulates bone metabolism via central and peripheral mechanisms to decrease sympathetic tone, inhibit osteoclastic differentiation, and promote osteoblastic commitment of BMSC. Copyright © 2014 the American Physiological Society.

[Bone marrow stromal damage mediated by immune response activity].

PubMed

Vojinović, J; Kamenov, B; Najman, S; Branković, Lj; Dimitrijević, H

1994-01-01

The aim of this work was to estimate influence of activated immune response on hematopoiesis in vitro, using the experimental model of BCG immunized BALB/c mice and in patients with chronic immunoactivation: long-lasting infections, autoimmunity or malignancy. We correlated changes in long term bone marrow cultures (Dexter) and NBT reduction with appearance of anemia in patients and experimental model of immunization by BCG. Increased spontaneous NBT reduction pointed out role of macrophage activation in bone marrow stroma damage. Long-term bone marrow cultures showed reduced number of hematopoietic cells, with predomination of fibroblasts and loss of fat cells. This results correlated with anemia and leucocytosis with stimulated myelopoiesis in peripheral blood. Activation of immune response, or acting of any agent that directly changes extracellular matrix and cellularity of bone marrow, may result in microenviroment bone marrow damage that modify hematopoiesis.

Computerized tomographic determination of spinal bone mineral content

NASA Technical Reports Server (NTRS)

Cann, C. E.; Genant, H. K.

1980-01-01

The aims of the study were three-fold: to determine the magnitude of vertebral cancellous mineral loss in normal subjects during bedrest, to compare this loss with calcium balance and mineral loss in peripheral bones, and to use the vertebral measurements as an evaluative criterion for the C12MDP treatment and compare it with other methods. The methods used are described and the results from 14 subjects are presented.

Craniofacial melorheostosis.

PubMed

McDermott, Meredith; Branstetter, Barton F; Seethala, Raja R

2008-01-01

Melorheostosis is a rare benign disease of cortical bone most frequently presenting as peripheral hyperostosis with a characteristic "melting wax" appearance on conventional radiographs. The disease most frequently affects the appendicular skeleton and is seen only rarely in the craniofacial bones. We discuss a case of melorheostosis in the nasal cavity and skull base with an atypical radiographic appearance and suggest findings that may differentiate craniofacial melorheostosis from more common entities in this region.

Effects of spaceflight on rat peripheral blood leukocytes and bone marrow progenitor cells

NASA Technical Reports Server (NTRS)

Ichiki, A. T.; Gibson, L. A.; Jago, T. L.; Strickland, K. M.; Johnson, D. L.; Lange, R. D.; Allebban, Z.

1996-01-01

The white blood cell (WBC) elements and the bone marrow myeloid progenitor cell populations were analyzed to ascertain adaptation to micro-gravity and subsequent readaptation to 1 G in rats flown on the 14-day Spacelab Life Sciences-2 (SLS-2) mission. Bone marrow cells were harvested from one group of rats killed inflight (FD13) and blood was drawn from three other groups at various times. The WBC level was normal on FD14 with the exception of neutrophilia. On FD13, numbers of colony-forming units-granulocyte (CFU-G), CFU-GM, and CFU-M from flight animals were decreased compared with ground controls when incubated with recombinant rat interleukin-3 (rrIL-3) alone or in combination with recombinant human erythropoietin (rhEpo). On recovery (R + 0), flight rats had decreased numbers of total leukocytes and absolute numbers of lymphocytes and monocytes with elevated neutrophils compared with control rats. They had lower numbers of CD4, CD8, CD2, CD3, and B cells in the peripheral blood but no differences in spleen lymphocytes.

Bone and fall-related fracture risks in women and men with a recent clinical fracture.

PubMed

van Helden, Svenhjalmar; van Geel, Antonia C M; Geusens, Piet P; Kessels, Alfons; Nieuwenhuijzen Kruseman, Arie C; Brink, Peter R G

2008-02-01

Worldwide fracture rates are increasing as a result of the aging population, and prevention, both primary and secondary, is an important public health goal. Therefore, we systematically analyzed risk factors in subjects with a recent clinical fracture. All men and women over fifty years of age who had been treated in the emergency department of, or hospitalized at, our institution because of a recent fracture during a one-year period were offered the opportunity to undergo an evidence-based bone and fall-related risk-factor assessment and bone densitometry. The women included in this study were also compared with a group of postmenopausal women without a fracture history who had been included in another cohort study. Of the 940 consecutive patients, 797 (85%) were eligible for this study and 568 (60%) agreed to participate. The prevalence of fall-related risk factors (75% [95% confidence interval = 71% to 78%]; n = 425) and the prevalence of bone-related risk factors (53% [95% confidence interval = 49% to 57%]; n = 299) at the time of fracture were higher than the prevalence of osteoporosis (35% [95% confidence interval = 31% to 39%]; n = 201) as defined by a dual x-ray absorptiometry T score of

Simultaneous Feulgen densitometry and autoradiographic grain counting with the Quantimet 720D image-analysis system. III. Improvements in Feulgen densitometry.

PubMed

Sklarew, R J

1983-10-01

A method has been developed for densitometric estimation of the Feulgen-stained DNA content of 3H-labeled nuclei in autoradiographs in conjunction with automated grain counting using a Quantimet Imaging System. Refinements in the methodology are reported which include 1) the incorporation of an Image-Editor Module into the Quantimet module configuration; 2) the optimization of incident illumination based upon evaluation of various light sources; 3) changes in the optical configuration which reduce glare and minimize the level of monitor shading correction; 4) the optimization of scanner sensitivity; and 5) the evaluation of cell-flattening and staining with respect to densitometry resolution and sensitivity. These refinements resulted in a CV of less than 6.4% in the G-1 and G-2 DNA peaks of rat kidney cells in autoradiographs compared to the previous CV of 10.5%, and a G-2 to G-1 ratio of 2.025. For a fixed field position the CV was 5.1% and the replication error less than 1.0%.

[Analysis of microdeletions in 22q11 in Colombian patients with congenital heart disease].

PubMed

Salazar, Marleny; Villalba, Guiovanny; Mateus, Heidi; Villegas, Victoria; Fonseca, Dora; Núñez, Federico; Caicedo, Víctor; Pachón, Sonia; Bernal, Jaime E

2011-12-01

Cardiac defects are the most frequent congenital malformations, with an incidence estimated between 4 and 12 per 1000 newborns. Their etiology is multifactorial and might be attributed to genetic predispositions and environmental factors. Since 1990 these types of pathologies have been associated with 22q11 microdeletion. In this study, the frequency of microdeletion 22q11 was determined in 61 patients with non-syndromic congenital heart disease. DNA was extracted from peripheral blood and TUPLE1 and STR D10S2198 genes were amplified by multiplex PCR and visualized in agarose gels. Gene content was quantified by densitometry. Three patients were found with microdeletion 22q11, representing a 4.9% frequency. This microdeletion was associated with two cases of Tetralogy of Fallot and a third case with atrial septal defect (ASD). In conclusion, the frequency for microdeletion 22q11 in the population analyzed was 4.9%. The cases that presented Teratology of Fallot had a frequency for this microdeletion of 7.4% and for ASD of 11.1%.

Effect of Denosumab on Peripheral Compartmental Bone Density, Microarchitecture and Estimated Bone Strength in De Novo Kidney Transplant Recipients.

PubMed

Bonani, Marco; Meyer, Ursina; Frey, Diana; Graf, Nicole; Bischoff-Ferrari, Heike A; Wüthrich, Rudolf P

2016-01-01

In a randomized controlled clinical trial in kidney transplant recipients (NCT01377467) we have recently shown that RANKL inhibition with denosumab significantly improved areal bone mineral density (aBMD) when given during the first year after transplantation. The effect of denosumab on skeletal microstructure and bone strength in kidney transplant recipients is not known. The purpose of the present bone microarchitecture ancillary study was to investigate high-resolution peripheral quantitative computed tomography (HRpQCT) data from the distal tibia and distal radius in 24 study patients that had been randomized to receive either two injections of denosumab 60 mg at baseline and after 6 months (n=10) or no treatment (n=14). Consistent with the full trial findings, denosumab reduced biomarkers of bone turnover, and significantly increased aBMD at the lumbar spine (median difference of 4.7%; 95% confidence interval [CI] 2.6 - 7.8; p<0.001). Bone quality as assessed by total and cortical volumetric bone mineral density (Tot. vBMD, Ct.vBMD) and cortical thickness (Ct.Th) increased significantly at the tibia, while changes at the radius were less pronounced. The trabecular volumetric BMD (Tb.vBMD), thickness (Tb. Th), separation (Tb.Sp) and number (Tb.N) and the cortical porosity (Ct.Po) at the tibia and the radius did not significantly change in both treatment groups. Micro-finite element analysis (µFEA) showed that bone stiffness increased significantly at the tibia (median difference 5.6%; 95% CI 1.8% - 9.2%; p=0.002) but not at the radius (median difference 2.9%, 95% CI -3.7% - 9.1%; p=0.369). Likewise, failure load increased significantly at the tibia (median difference 5.1%; 95% CI 2.1% - 8.1%; p=0.002) but not at the radius (median difference 2.4%, 95% CI -3.2% - 8.5%; p=0.336). These findings demonstrate that denosumab improves bone density and bone quality in first-year kidney transplant recipients at risk to develop osteoporosis. © 2016 The Author(s) Published by S. Karger AG, Basel.

Bone geometry in young male and female football players: a peripheral quantitative computed tomography (pQCT) study.

PubMed

Lozano-Berges, Gabriel; Matute-Llorente, Ángel; Gómez-Bruton, Alejandro; González-Agüero, Alex; Vicente-Rodríguez, Germán; Casajús, José A

2018-05-08

The present study shows that football practice during growth may improve bone geometry in male and female football players. However, only females had better bone strength in comparison with controls. The aim of this study was to compare bone geometry in adolescent football players and controls. A total of 107 football players (71 males/36 females; mean age 12.7 ± 0.6/12.7 ± 0.6 years) and 42 controls (20 males/22 females; mean age 13.1 ± 1.4/12.7 ± 1.3 years) participated in this study. Total and trabecular volumetric bone mineral content (Tt.BMC/Tb.BMC), cross-sectional area (Tt.Ar/Tb.Ar), and bone strength index (BSI) were measured at 4% site of the non-dominant tibia by peripheral quantitative computed tomography (pQCT). Moreover, Tt.BMC, cortical BMC (Ct.BMC), Tt.Ar, cortical Ar (Ct.Ar), cortical thickness (Ct.Th), periosteal circumference (PC), endosteal circumference (EC), fracture load in X-axis, and polar strength strain index (SSIp) were measured at 38% site of the tibia. Multivariate analyses of covariance were used to compare bone pQCT variables between football players and controls using the tibia length and maturity offset as covariates. Female football players demonstrated 13.8-16.4% higher BSI, Ct.Th, fracture load in X-axis, and SSIp than controls (p < .0036). Males showed no significant differences in bone strength when compared to controls (p > .0036). In relation to bone mineral content and area, male football players showed 8.8% higher Tt.Ar and Tb.Ar at the 4% site of the tibia when compared to controls; whereas 13.8-15.8% higher Tt.BMC, Ct.BMC, and Ct.Ar at the 38% site of the tibia were found in female football players than controls (p < .0036). In this study, female adolescent football players presented better bone geometry and strength values than controls. In contrast, only bone geometry was higher in male football players than controls.

Age-related differences in volumetric bone mineral density, microarchitecture, and bone strength of distal radius and tibia in Chinese women: a high-resolution pQCT reference database study.

PubMed

Hung, V W Y; Zhu, T Y; Cheung, W-H; Fong, T-N; Yu, F W P; Hung, L-K; Leung, K-S; Cheng, J C Y; Lam, T-P; Qin, L

2015-06-01

In a cohort of 393 Chinese women, by using high-resolution peripheral quantitative computed tomography (HR-pQCT), we found that significant cortical bone loss occurred after midlife. Prominent increase in cortical porosity began at the fifth decade but reached a plateau before the sixth decade. Trabecular bone loss was already evident in young adulthood and continued throughout life. This study aimed to investigate age-related differences in volumetric bone mineral density (vBMD), microarchitecture, and estimated bone strength at peripheral skeleton in Chinese female population. In a cross-sectional cohort of 393 Chinese women aged 20-90 years, we obtained vBMD, microarchtecture, and micro-finite element-derived bone strength at distal radius and tibia using HR-pQCT. The largest predictive age-related difference was found for cortical porosity (Ct.Po) which showed over four-fold and two-fold differences at distal radius and tibia, respectively, over the adulthood. At both sites, cortical bone area, vBMD, and thickness showed significant quadratic association with age with significant decrease beginning after midlife. Change of Ct.Po became more prominent between age of 50 and 57 (0.26 %/year at distal radius, 0.54 %/year at distal tibia, both p ≤ 0.001) but thereafter, reached a plateau (0.015 and 0.028 %/year, both p > 0.05). In contrast, trabecular vBMD and microarchitecture showed linear association with age with significant deterioration observed throughout adulthood. Estimated age of peak was around age of 20 for trabecular vBMD and microarchitecture and Ct.Po and age of 40 for cortical vBMD and microarchitecture. Estimated stiffness and failure load peaked at mid-30s at the distal radius and at age 20 at distal tibia. Age-related differences in vBMD and microarchitecture in Chinese women differed by bone compartments. Significant cortical bone loss occurred after midlife. Prominent increase in Ct.Po began at the fifth decade but appeared to be arrested before the sixth decade. Loss of trabecular bone was already evident in young adulthood and continued throughout life.

Hypergravity suppresses bone resorption in ovariectomized rats

NASA Astrophysics Data System (ADS)

Ikawa, Tesshu; Kawaguchi, Amu; Okabe, Takahiro; Ninomiya, Tadashi; Nakamichi, Yuko; Nakamura, Midori; Uehara, Shunsuke; Nakamura, Hiroaki; Udagawa, Nobuyuki; Takahashi, Naoyuki; Nakamura, Hiroaki; Wakitani, Shigeyuki

2011-04-01

The effects of gravity on bone metabolism are unclear, and little has been reported about the effects of hypergravity on the mature skeleton. Since low gravity has been shown to decrease bone volume, we hypothesized that hypergravity increases bone volume. To clarify this hypothesis, adult female rats were ovariectomized and exposed to hypergravity (2.9G) using a centrifugation system. The rats were killed 28 days after the start of loading, and the distal femoral metaphysis of the rats was studied. Bone architecture was assessed by micro-computed tomography (micro-CT) and bone mineral density was measured using peripheral quantitative CT (pQCT). Hypergravity increased the trabecular bone volume of ovariectomized rats. Histomorphometric analyses revealed that hypergravity suppressed both bone formation and resorption and increased bone volume in ovariectomized rats. Further, the cell morphology, activity, proliferation, and differentiation of osteoclasts and osteoblasts exposed to hypergravity were evaluated in vitro. Hypergravity inhibited actin ring formation in mature osteoclasts, which suggested that the osteoclast activity was suppressed. However, hypergravity had no effect on osteoblasts. These results suggest that hypergravity can stimulate an increase in bone volume by suppressing bone resorption in ovariectomized rats.

Prevalence of vitamin D insufficiency among adolescents and its correlation with bone parameters using high-resolution peripheral quantitative computed tomography.

PubMed

Cheung, T F; Cheuk, K Y; Yu, F W P; Hung, V W Y; Ho, C S; Zhu, T Y; Ng, B K W; Lee, K M; Qin, L; Ho, S S Y; Wong, G W K; Cheng, J C Y; Lam, T P

2016-08-01

Vitamin D deficiency and insufficiency are highly prevalent among adolescents in Hong Kong, which is a sub-tropical city with ample sunshine. Vitamin D level is significantly correlated with key bone density and bone quality parameters. Further interventional studies are warranted to define the role of vitamin D supplementation for improvement of bone health among adolescents. The relationship between bone quality parameters and vitamin D (Vit-D) status remains undefined among adolescents. The aims of this study were to evaluate Vit-D status and its association with both bone density and bone quality parameters among adolescents. Three hundred thirty-three girls and 230 boys (12-16 years old) with normal health were recruited in summer and winter separately from local schools. Serum 25(OH) Vit-D level, bone density and quality parameters by Dual Energy X-ray Absorptiometry (DXA) and High-Resolution peripheral Quantitative Computed Tomography (HR-pQCT), dietary calcium intake, and physical activity level were assessed. Sixty-four point seven percent and 11.4 % of subjects were insufficient [25 ≤ 25(OH)Vit-D ≤ 50 nmol/L] and deficient [25(OH)Vit-D < 25 nmol/L] in Vit-D, respectively. The mean level of serum 25(OH)Vit-D in summer was significantly higher than that in winter (44.7 ± 13.6 and 35.9 ± 12.6 nmol/L, respectively) without obvious gender difference. In girls, areal bone mineral density (aBMD) and bone mineral content (BMC) of bilateral femoral necks, cortical area, cortical thickness, total volumetric bone mineral density (vBMD), and trabecular thickness were significantly correlated with 25(OH)Vit-D levels. In boys, aBMD of bilateral femoral necks, BMC of the dominant femoral neck, cortical area, cortical thickness, total vBMD, trabecular vBMD, BV/TV, and trabecular separation were significantly correlated with 25(OH)Vit-D levels. Vit-D insufficiency was highly prevalent among adolescents in Hong Kong with significant correlation between Vit-D levels and key bone density and bone quality parameters being detected in this study. Given that this is a cross-sectional study and causality relationship cannot be inferred, further interventional studies investigating the role of Vit-D supplementation on improving bone health among adolescents are warranted.

First impressions of cardiovascular calcification treatment in hemodialysis patients with a new dialysis fluid containing sodium thiosulphate (STS).

PubMed

Yonova, Diana H; Vazelov, Evgueniy S; Trendafilov, Ivan I; Stoinova, Veselka V; Nedevska, Mariya T; Antonov, Simeon A

2014-04-01

Cardiovascular calcification (CVC) in hemodialysis patients (HDP) causes cardiovascular pathology. Up until now very few drugs and therapeutic interventions have been able to reduce cardiovascular calcium deposits in hemodialysis patients and the process requires more than a year. Our idea in this study was to test 2 calcium binders--sodium thiosulfate (STS) and dinatrium ethylene diamine tetraacetic acid (DNEDTA)--for prevention and treatment of cardiovascular calcification of hemodialysis patients, using both substances not as an intravenous infusion but by adding them to the liquid bicarbonate part of the dialysis fluid. 6 HDPs were treated with sodium thiosulphate (STS), 6 with dinatrium ethylene diamine tetraacetic acid (DNEDTA), and 6 patients served as controls. Electrolytes, liver function, markers of inflammation, oxidative stress, bone metabolism, spiral computed tomography (SCT) of coronary CVC and bone densitometry were performed twice (start and end of the study). Starting blood parameters were similar to the end (STS group). No toxic or side effects from STS were observed. Initially in the DNEDTA group all the patients had vomiting so we excluded DNEDTA from the study. SCT found a significant reduction of calcification in 4 patients (STS group) and retardation in 2 patients comparatively to controls. The first results are hopeful, but the number of the patients was small, so we are enlarging the enrollment in the expectation of corroborating our results soon.

Peripheral blood biomarkers of solid tumor angiogenesis in dogs: A polychromatic flow cytometry pilot study

PubMed Central

Bentley, R. Timothy; Mund, Julie A.; Pollok, Karen E.; Childress, Michael O.; Case, Jamie

2012-01-01

A subset of peripheral blood hematopoietic stem and progenitor cells of bone marrow origin is elevated in humans with solid cancers before treatment and declines with therapy. This biomarker of angiogenesis is not specific to tumor type and has great potential in the objective assessment of treatment response in clinical trials. This pilot study was designed to develop a biomarker of neoangiogenesis in dogs for the diagnosis of cancer, the measurement of treatment response, and the provision of objective data in clinical trials. Polychromatic flow cytometry was used to quantify two subsets of circulating hematopoietic stem and progenitor cells in dogs with spontaneous solid tumors before (n = 8) and after (n = 3) treatment, and normal controls (n = 6). Pro-angiogenic peripheral blood cells of bone marrow origin were detected in all eight cases and the six normal controls; however, there was no statistically significant difference between the two groups. Interestingly, an apparent decline in pro-angiogenic cells was observed after treatment. Bone marrow derived hematopoietic cells appear to contribute to tumor angiogenesis in dogs, as has been previously reported in humans. While the methodology for pro-angiogenic cell quantification in a small number of dogs in the current study did not result in a significant difference from normal controls, an optimized canine polychromatic flow cytometry protocol holds great promise in the development of a canine cancer model and for the objective measurements of treatment response in clinical trials. PMID:23063489

Generation of dendritic cells from human bone marrow mononuclear cells: advantages for clinical application in comparison to peripheral blood monocyte derived cells.

PubMed

Bai, L; Feuerer, M; Beckhove, P; Umansky, V; Schirrmacher, V

2002-02-01

Dendritic cells (DCs) currently used for vaccination in clinical studies to induce immunity against malignant cells are normally generated from peripheral blood-derived monocytes. Here we studied conditions for the generation of DCs from unseparated human bone marrow (BM) mononuclear cells and compared them functionally with DCs from blood. The two types of DCs, from bone marrow (BM-DC) and peripheral blood (BL-DC), were generated in parallel from the same normal healthy donors by culturing in serum-free X-VIVO 20 medium containing GM-CSF and IL-4, and then the phenotypes and functions were compared. BM-DC generation occurred in 14 days and involved proliferative expansion from CD34 stem cells and differentiation while BL-DC generation occurred in 7 days from CD14 monocytes and involved only differentiation. A 7- to 25-fold higher number of DCs could be obtained from BM than from blood. BM-DC had similar phenotypes as BL-DC. The capacity to stimulate MLR reactivity in allogeneic T lymphocytes was higher with BM-DC than that with BL-DC. Also, the capacity to stimulate autologous memory T cell responses to tetanus toxoid (TT) or tuberculin (PPD) was higher with BM-DC than with BL-DC. These results suggest that BM-DC as produced here may be a very economic and useful source of professional antigen-presenting cells for anti-tumor immunotherapeutic protocols.

Altered ovarian function affects skeletal homeostasis independent of the action of follicle-stimulating hormone.

PubMed

Gao, Jianjun; Tiwari-Pandey, Rashmi; Samadfam, Rana; Yang, Yinzhi; Miao, Dengshun; Karaplis, Andrew C; Sairam, M Ram; Goltzman, David

2007-06-01

Osteoporosis is a leading public health problem. Although a major cause in women is thought to be a decline in estrogen, it has recently been proposed that FSH or follitropin is required for osteoporotic bone loss. We examined the FSH receptor null mouse (FORKO mouse) to determine whether altered ovarian function could induce bone loss independent of FSH action. By 3 months of age, FORKO mice developed age-dependent declines in bone mineral density and trabecular bone volume of the lumbar spine and femur, which could be partly reversed by ovarian transplantation. Bilateral ovariectomy reduced elevated circulating testosterone levels in FORKO mice and decreased bone mass to levels indistinguishable from those in ovariectomized wild-type controls. Androgen receptor blockade and especially aromatase inhibition each produced bone volume reductions in the FORKO mouse. The results indicate that ovarian secretory products, notably estrogen, and peripheral conversion of ovarian androgen to estrogen can alter bone homeostasis independent of any bone resorptive action of FSH.

Bone metabolism in oxalosis: a single-center study using new imaging techniques and biomarkers.

PubMed

Bacchetta, Justine; Fargue, Sonia; Boutroy, Stéphanie; Basmaison, Odile; Vilayphiou, Nicolas; Plotton, Ingrid; Guebre-Egziabher, Fitsum; Dohin, Bruno; Kohler, Rémi; Cochat, Pierre

2010-06-01

The deposition of calcium oxalate crystals in the kidney and bone is a hallmark of primary hyperoxaluria type 1 (PH1). We report here an evaluation of the bone status of 12 PH1 children based on bone biomarkers [parathyroid hormone, vitamin D, fibroblast growth factor 23 (FGF23)] and radiological assessments (skeletal age, three-dimensional high-resolution peripheral quantitative computed tomography, HR-pQCT) carried out within the framework of a cross-sectional single-center study. The controls consisted of healthy and children with chronic kidney disease already enrolled in local bone and mineral metabolism studies. The mean age (+ or - standard deviation) age of the patients was 99 (+ or - 63) months. Six children suffered from fracture. Bone maturation was accelerated in five patients, four of whom were <5 years. The combination of new imaging techniques and biomarkers highlighted new and unexplained features of PH1: advanced skeletal age in young PH1 patients, increased FGF23 levels and decreased total volumetric bone mineral density with bone microarchitecture alteration.

Bone Blood Flow During Simulated Microgravity: Physiological and Molecular Mechanisms

NASA Technical Reports Server (NTRS)

Bloomfield, Susan A.

1999-01-01

Blood flow to bone has been shown to affect bone mass and presumably bone strength. Preliminary data indicate that blood flow to the rat femur decreases after 14 days of simulated microgravity, using hindlimb suspension (HLS). If adult rats subjected to HLS are given dobutamine, a synthetic catecholamine which can cause peripheral vasodilation and increased blood flow, the loss of cortical bone area usually observed is prevented. Further, mechanisms exist at the molecular level to link changes in bone blood flow to changes in bone cell activity, particularly for vasoactive agents like nitric oxide (NO). The decreases in fluid shear stress created by fluid flow associated with the shifts of plasma volume during microgravity may result in alterations in expression of vasoactive agents such as NO, producing important functional effects on bone cells. The primary aim of this project is to characterize changes in 1) bone blood flow, 2) indices of bone mass, geometry, and strength, and 3) changes in gene expression for modulators of nitric oxide activity (e.g., nitric oxide synthase) and other candidate genes involved in signal transduction of mechanical loading after 3, 7, 14, 21, and 28 days of HLS in the adult rat. Using a rat of at least 5 months of age avoids inadvertently studying effects of simulated microgravity on growing, rather than adult, bone. Utilizing the results of these studies, we will then define how altered blood flow contributes to changes in bone with simulated microgravity by administering a vasodilatory agent (which increases blood flow to tissues) during hindlimb suspension. In all studies, responses in the unloaded hindlimb bones (tibial shaft, femoral neck) will be compared with those in the weightbearing humeral shaft and the non-weightbearing calvarium (skull) from the same animal. Bone volumetric mineral density and geometry will be quantified by peripheral quantitative CT; structural and material properties of the long bones will be determined by 3-point bending (tibia, humerus) or compression (femoral neck) testing to failure. A unique aspect of these studies will be defining the time course of changes in gene expression in bone cell populations with unloading, accomplished with Northern blots, in situ hybridization, and immunohistochemistry. These studies have high relevance for concurrent protocols being proposed by investigators on NSBRI Cardiovascular and Muscle teams, with blood flow data available on a number of tissues other than bone. Further, dobutamine and other Beta-agonists have been tested as countermeasures for altered muscle and cardiovascular function. Results of the intervention tested in our studies have potential relevance for a number of systemic changes seen with prolonged spaceflight.

Circulating promyelocytes and low levels of CD16 expression on polymorphonuclear leukocytes accompany early-onset periodontitis.

PubMed Central

Nemoto, E; Nakamura, M; Shoji, S; Horiuchi, H

1997-01-01

Early-onset periodontitis (EOP) is characterized by rapidly progressive alveolar bone loss, chemotactic defects of neutrophils, and significant familial aggregation. We found immature myeloid lineage cells, defined as promyelocytes, in the peripheral blood in patients with EOP. A hematological examination of peripheral blood cells showed normal reference values regarding cell proportions. Flow cytometry revealed significantly lower expression of CD16, a glycosylphosphatidylinositol (GPI)-anchored protein, on peripheral neutrophils in patients compared with those in age- and sex-matched healthy controls, whereas the levels of CD11a and CD11b expression were similar. The chemotactic response of neutrophils was lower toward not only formyl-methionyl-leucyl-phenylalanine but also complement fragment C5a than that of healthy controls. The expression of another GPI-anchored protein, CD14, was equally expressed by controls and patients. Therefore, the low level of CD16 expression was not due to the incomplete synthesis of the GPI anchor. GPI anchors of CD16 on neutrophils from controls and patients were both partially resistant to phosphatidylinositol-specific phospholipase C. The presence of promyelocytes in peripheral blood, low expression of CD16, and low chemotactic response of neutrophils suggest that patients with EOP have an abnormal maturation system in myeloid lineage cells in the bone marrow, which may be associated with the onset and course of EOP. PMID:9284170

Validation of cytogenetic risk groups according to International Prognostic Scoring Systems by peripheral blood CD34+FISH: results from a German diagnostic study in comparison with an international control group

PubMed Central

Braulke, Friederike; Platzbecker, Uwe; Müller-Thomas, Catharina; Götze, Katharina; Germing, Ulrich; Brümmendorf, Tim H.; Nolte, Florian; Hofmann, Wolf-Karsten; Giagounidis, Aristoteles A. N.; Lübbert, Michael; Greenberg, Peter L.; Bennett, John M.; Solé, Francesc; Mallo, Mar; Slovak, Marilyn L.; Ohyashiki, Kazuma; Le Beau, Michelle M.; Tüchler, Heinz; Pfeilstöcker, Michael; Nösslinger, Thomas; Hildebrandt, Barbara; Shirneshan, Katayoon; Aul, Carlo; Stauder, Reinhard; Sperr, Wolfgang R.; Valent, Peter; Fonatsch, Christa; Trümper, Lorenz; Haase, Detlef; Schanz, Julie

2015-01-01

International Prognostic Scoring Systems are used to determine the individual risk profile of myelodysplastic syndrome patients. For the assessment of International Prognostic Scoring Systems, an adequate chromosome banding analysis of the bone marrow is essential. Cytogenetic information is not available for a substantial number of patients (5%–20%) with dry marrow or an insufficient number of metaphase cells. For these patients, a valid risk classification is impossible. In the study presented here, the International Prognostic Scoring Systems were validated based on fluorescence in situ hybridization analyses using extended probe panels applied to cluster of differentiation 34 positive (CD34+) peripheral blood cells of 328 MDS patients of our prospective multicenter German diagnostic study and compared to chromosome banding results of 2902 previously published patients with myelodysplastic syndromes. For cytogenetic risk classification by fluorescence in situ hybridization analyses of CD34+ peripheral blood cells, the groups differed significantly for overall and leukemia-free survival by uni- and multivariate analyses without discrepancies between treated and untreated patients. Including cytogenetic data of fluorescence in situ hybridization analyses of peripheral CD34+ blood cells (instead of bone marrow banding analysis) into the complete International Prognostic Scoring System assessment, the prognostic risk groups separated significantly for overall and leukemia-free survival. Our data show that a reliable stratification to the risk groups of the International Prognostic Scoring Systems is possible from peripheral blood in patients with missing chromosome banding analysis by using a comprehensive probe panel (clinicaltrials.gov identifier:01355913). PMID:25344522

Nuclear medicine techniques in the assessment of alkaptonuria.

PubMed

Vinjamuri, Sobhan; Ramesh, Chandakacharla N; Jarvis, Jonathan; Gallagher, Jim A; Ranganath, Lakshminarayana L

2011-10-01

Alkaptonuria is a rare autosomal recessive disorder due to a lack of the enzyme homogentisate dioxygenase, leading to ochronosis, a process of accumulation of a melanin-like polymer of homogentisic acid in cartilage and other collagenous structures. Patients develop severe osteoarthropathy that resembles osteoarthritis. Although the diagnosis of alkaptonuria is not particularly challenging in view of the blue-black discolouration of visible connective tissue and the presence of homogentisic acid in urine, the natural history of alkaptonuria remains poorly understood. Patients would benefit immensely from an objective assessment of their disease status and from a clearer understanding of the pathophysiology and associated physical changes. Isotope bone scans, which are commonly used to identify the extent of involvement of bones in cancerous processes, have also been increasingly used for characterizing the extent of arthropathy in conditions such as osteoarthritis and rheumatoid arthritis. Semiquantitative scores based on the extent of involvement of joints have been used to describe the involvement of large joints in the context of symptomatic treatment for osteoarthritis. A similar semiquantitative isotope bone scan score depending on the involvement of the number of large joints in patients with alkaptonuria can be formulated and validated in a suitable cohort of patients. Bone densitometry measurement using dual-energy X-ray absorptiometry scanning is an internationally accepted tool to assess the risk and extent of osteoporosis, and is increasingly used to assess the additional fracture risk in patients with arthropathy. We believe that, currently, nuclear medicine techniques can provide useful information, which can be incorporated into disease severity scores for alkaptonuria. Once the biological basis for alkaptonuria is better understood, it is feasible that nuclear medicine techniques of even greater sensitivity and specificity can be developed, thereby taking advantage of the vast advances in the fields of radiochemistry, radiopharmacy, positron emission tomography-computed tomography and positron emission tomography-magnetic resonance imaging scanning.

Muscular Maximal Strength Indices and Bone Variables in a Group of Elderly Women.

PubMed

Nasr, Riad; Al Rassy, Nathalie; Watelain, Eric; Matta, Joseph; Frenn, Fabienne; Rizkallah, Maroun; Maalouf, Ghassan; El Khoury, César; Berro, Abdel-Jalil; El Hage, Rawad

2018-03-22

The aim of the present study was to explore the relations between muscular maximal strength indices and bone parameters (bone mineral density [BMD], hip geometry indices, and trabecular bone score [TBS]) in a group of elderly women. This study included 35 healthy elderly women whose ages range between 65 and 75 yr (68.1 ± 3.1 yr). BMD (in gram per square centimeter) was determined for each individual by dual-energy X-ray absorptiometry at the whole body, lumbar spine (L1-L4), total hip (TH), and femoral neck (FN). L1-L4 TBS and hip geometry indices were also evaluated by dual-energy X-ray absorptiometry. Maximal muscle strength of bench press (1-repetition maximum [RM] bench press), maximal muscle strength of leg press (1-RM leg press), and handgrip were measured using validated methods. 1-RM bench press was positively correlated to TH BMD (r = 0.40; p < 0.05), FN BMD (r = 0.41; p < 0.05), FN section modulus (r = 0.33; p < 0.05), and FN cross-sectional moment of inertia (r = 0.35; p < 0.05). 1-RM leg press was positively correlated to TH BMD (r = 0.50; p < 0.01), FN BMD (r = 0.35; p < 0.05), FN cross-sectional area (r = 0.38; p < 0.05), and TBS (r = 0.37; p < 0.05). Handgrip was correlated only to FN cross-sectional moment of inertia (r = 0.43; p < 0.01). This study suggests that 1-RM bench press and 1-RM leg press are positive determinants of BMD in elderly women. Copyright © 2018 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

[Biphasic ceramic wedge and plate fixation with locked adjustable screws for open wedge tibial osteotomy].

PubMed

Lavallé, F; Pascal-Mousselard, H; Rouvillain, J L; Ribeyre, D; Delattre, O; Catonné, Y

2004-10-01

The aim of this radiological study was to evaluate the use of a biphasic ceramic wedge combined with plate fixation with locked adjustable screws for open wedge tibial osteotomy. Twenty-six consecutive patients (27 knees) underwent surgery between December 1999 and March 2002 to establish a normal lower-limb axis. The series included 6 women and 20 men, mean age 50 years (16 right knees and 11 left knees). Partial weight-bearing with crutches was allowed on day 1. A standard radiological assessment was performed on day 1, 90, and 360 (plain AP and lateral stance films of the knee). A pangonogram was performed before surgery and at day 360. Presence of a lateral metaphyseal space, development of peripheral cortical bridges, and osteointegration of the bone substitute-bone interface were evaluated used to assess bone healing. The medial tibial angle between the line tangent to the tibial plateau and the anatomic axis of the tibia (beta) was evaluated to assess preservation of postoperative correction. The HKA angle was determined. Three patients were lost to follow-up and 23 patients (24 knees) were retained for analysis. At last follow-up, presence of peripheral cortical bridges and complete filling of the lateral metaphyseal space demonstrated bone healing in all patients. Good quality osteointegration was achieved since 21 knees did not present an interface between the bone substitute and native bone (homogeneous transition zone). The beta angle was unchanged for 23 knees. A normal axis was observed in patients (16 knees) postoperatively. Use of a biphasic ceramic wedge in combination with plate fixation with locked adjustable screws is a reliable option for open wedge tibial osteotomy. The bone substitute fills the gap well. Tolerance and integration are optimal. Bone healing is achieved. Plate fixation with protected weight bearing appears to be a solid assembly, maintaining these corrections.

The utility of changes in serum levels of C-terminal telopeptide of type I collagen in predicting patient response to oral monthly ibandronate therapy.

PubMed

Hochberg, Marc C; Silverman, Stuart L; Barr, Charles E; Miller, Paul D

2010-01-01

Bone turnover markers may provide a more rapid indication of patient response to osteoporosis treatment than bone mineral density (BMD) measurements. This post hoc analysis of data from the MOBILE (Monthly Oral iBandronate In LadiEs) study assessed the relationship between increases in BMD at 12 mo from baseline after starting ibandronate treatment and changes in bone resorption marker serum C-terminal telopeptide of type I collagen (sCTX) from baseline at 3 and 6 mo. MOBILE enrolled postmenopausal women aged 55-80 yr with mean lumbar spine (LS) BMD T-score of -2.5 to -5.0. This analysis included women who received 150-mg monthly oral ibandronate (n=323). A high proportion of women were classified as BMD responders after 1 yr (BMD increase was >/=0%, i.e., 74-91% depending on skeletal site; BMD increase was >/=3%, i.e., 34-67%). Women with larger decreases in sCTX were more likely to be BMD responders. The percent increase in LS BMD at 12 mo was significantly associated with the percent decrease in sCTX at 3 mo from baseline (Pearson correlation coefficient: -0.19, p=0.0016). In linear regression models, percent decrease in sCTX at 3 mo from baseline was a significant predictor of 1-yr LS BMD response (R(2)=0.61, p=0.0007). These data suggest that 3-mo changes in sCTX levels are associated with 1-yr LS BMD increases in postmenopausal women treated with once-monthly oral ibandronate. The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

A screening model for low bone mass in elderly Japanese men using quantitative ultrasound measurements: Fujiwara-Kyo Study.

PubMed

Minematsu, Akira; Hazaki, Kan; Harano, Akihiro; Iki, Masayuki; Fujita, Yuki; Okamoto, Nozomi; Kurumatani, Norio

2012-01-01

Screening for low bone mass is important to prevent fragility fractures in men as well as women, although men show a much lower prevalence of osteoporosis than women. The purpose of this study was to establish a screening model for low bone mineral density (BMD) using a quantitative ultrasound parameter and easily obtained objective indices for elderly Japanese men. We examined 1633 men (65-84 yr old) who were subjects of the Fujiwara-Kyo Study. Speed of sound (SOS) at the calcaneus was determined, and BMD was measured by dual-energy X-ray absorptiometry at the lumbar spine (LS), total hip (TH), and femoral neck (FN). Low BMD was defined as >1 standard deviation below the young adult mean, in accordance with World Health Organization criteria. We performed receiver operating characteristic (ROC) analysis to identify a better screening model incorporating SOS and determined the optimal cutoff value using Youden index. Prevalences of low BMD at the 3 skeletal sites were 27.8% (LS), 33.5% (TH), 48.6% (FN), and 43.3% at either LS or TH. The greatest area under the ROC curve (0.806, 95% confidence interval: 0.785-0.828) and smallest Akaike's information criterion were obtained in the multivariate model incorporating SOS, age, height, and weight for predicting low BMD at all skeletal sites. This model predicted low BMD at TH with the sensitivity of 0.726 and specificity of 0.739, whereas a similar model predicted low BMD at LS with much lower validity. We conclude that the multivariate model for TH could be used to screen for low BMD in elderly Japanese men. Copyright © 2012 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

In vivo precision of the GE Lunar iDXA densitometer for the measurement of total-body, lumbar spine, and femoral bone mineral density in adults.

PubMed

Hind, Karen; Oldroyd, Brian; Truscott, John G

2010-01-01

Knowledge of precision is integral to the monitoring of bone mineral density (BMD) changes using dual-energy X-ray absorptiometry (DXA). We evaluated the precision for bone measurements acquired using a GE Lunar iDXA (GE Healthcare, Waukesha, WI) in self-selected men and women, with mean age of 34.8 yr (standard deviation [SD]: 8.4; range: 20.1-50.5), heterogeneous in terms of body mass index (mean: 25.8 kg/m(2); SD: 5.1; range: 16.7-42.7 kg/m(2)). Two consecutive iDXA scans (with repositioning) of the total body, lumbar spine, and femur were conducted within 1h, for each subject. The coefficient of variation (CV), the root-mean-square (RMS) averages of SDs of repeated measurements, and the corresponding 95% least significant change were calculated. Linear regression analyses were also undertaken. We found a high level of precision for BMD measurements, particularly for scans of the total body, lumbar spine, and total hip (RMS: 0.007, 0.004, and 0.007 g/cm(2); CV: 0.63%, 0.41%, and 0.53%, respectively). Precision error for the femoral neck was higher but still represented good reproducibility (RMS: 0.014 g/cm(2); CV: 1.36%). There were associations between body size and total-body BMD and total-hip BMD SD precisions (r=0.534-0.806, p<0.05) in male subjects. Regression parameters showed good association between consecutive measurements for all body sites (r(2)=0.98-0.99). The Lunar iDXA provided excellent precision for BMD measurements of the total body, lumbar spine, femoral neck, and total hip. Copyright © 2010 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Relationship between A163G osteoprotegerin gene polymorphism and other osteoporosis parameters in Roma and non-Roma postmenopausal women in eastern Slovakia.

PubMed

Mydlárová Blaščáková, Marta; Blaščáková, Ľudmila; Poráčová, Janka; Mydlár, Jozef; Vašková, Janka; Bernasovská, Jarmila; Boroňová, Iveta; Petrejčíková, Eva; Bernasovský, Ivan

2017-09-01

The study was focused on evaluating the possible correlation between biochemical, anthropometric, and genetic indicators of osteoporosis in postmenopausal women. The frequency of genotypes and differences in measured parameters were evaluated within two ethnically different groups of women in Slovakia. The study included 310 postmenopausal women divided into non-Roma and Roma groups. Based on results of densitometry, they were divided into control groups and women with osteoporosis and osteopenia. In all women, a genetic analysis of polymorphism of osteoprotegerin gene promotor region (A163G) was provided along with measurement of indicators of bone tissue metabolism. There is a particularly low incidence of osteoporosis in Roma women. We found a correlation between bone mineral density (BMD), body mass index, and waist and hip circumference in women with osteoporosis and in Roma women with osteopenia. The frequency of the AG genotype was higher in non-Roma women with osteoporosis, but reached only 10.7% in Roma women with osteopenia. While the presence of the G allele in the non-Roma population was accompanied by higher BMD and markers of osteoformation, it was accompanied by significantly higher concentrations of parathyroid hormone in the Roma population. The presence of the AG genotype has a different effect on bone metabolism in two ethnically diverse populations of women in Slovakia. In the general population, the presence of the G allele exhibited protective effects consistent with other studies, but in Roma population this appears to be the allele A. However, this requires a further study for confirmation and more detailed characterization of the differences between populations that have this work indicated. © 2016 Wiley Periodicals, Inc.

Grip strength is a predictor of bone mineral density among adolescent combat sport athletes.

PubMed

Nasri, Raouf; Hassen Zrour, Saoussen; Rebai, Haithem; Fadhel Najjar, Mohamed; Neffeti, Fadoua; Bergaoui, Naceur; Mejdoub, Hafedh; Tabka, Zouhair

2013-01-01

The aim of this study was firstly to investigate the correlation between bone parameters and grip strength (GS) in hands, explosive legs power (ELP), and hormonal parameters; second, to identify the most determinant variables of bone mineral density (BMD) among adolescent combat sport athletes. Fifty combat sport athletes aged 17.1 ± 0.2 year were compared with 30 sedentary subjects matched for age, height, and pubertal stage. For all subjects, the BMD in deferent sites associated with anthropometric parameters were measured by dual-energy X-ray absorptiometry. The growth hormone (GH) and testosterone (TESTO) concentrations were tested. The GS in dominant (GSDA) and nondominant arms (GSNDA) and ELP were evaluated. All BMD measured were greater in athletes than in sedentary group (p<0.01). The GS and ELP showed higher values in athletes than in sedentary group (p<0.01). The BMD in all sites were correlated with weight, but without correlation with height. The GSNDA and ELP were significantly correlated with BMD of both spine and legs. The GH was correlated with the BMD of whole body and spine (p<0.05). The TESTO was only correlated with BMD of the arms (p<0.01). The best predictor of BMD measurements is GSNDA. This study has proved the osteogenic effect of combat sports practice, especially judo and karate kyokushinkai. Therefore, children and adolescent should be encouraged to participate in combat sport. Moreover, it suggested that the best model predicting BMD in different sites among adolescent combat sports athletes was the GSNDA. Copyright © 2013 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Precision of dual-energy X-ray absorptiometry of the knee and heel: methodology and implications for research to reduce bone mineral loss after spinal cord injury.

PubMed

Peppler, W T; Kim, W J; Ethans, K; Cowley, K C

2017-05-01

Methodological validation of dual-energy x-ray absorptiometry (DXA)-based measures of leg bone mineral density (BMD) based on the guidelines of the International Society for Clinical Densitometry. The primary objective of this study was to determine the precision of BMD estimates at the knee and heel using the manufacturer provided DXA acquisition algorithm. The secondary objective was to determine the smallest change in DXA-based measurement of BMD that should be surpassed (least significant change (LSC)) before suggesting that a biological change has occurred in the distal femur, proximal tibia and calcaneus. Academic Research Centre, Canada. Ten people with motor-complete SCI of at least 2 years duration and 10 people from the general population volunteered to have four DXA-based measurements taken of their femur, tibia and calcaneus. BMDs for seven regions of interest (RIs) were calculated, as were short-term precision (root-mean-square (RMS) standard deviation (g cm -2 ), RMS-coefficient of variation (RMS-CV, %)) and LSC. Overall, RMS-CV values were similar between SCI (3.63-10.20%, mean=5.3%) and able-bodied (1.85-5.73%, mean=4%) cohorts, despite lower absolute BMD values at each RIs in those with SCI (35%, heel to 54%, knee; P<0.0001). Precision was highest at the calcaneus and lowest at the femur. Except at the femur, RMS-CV values were under 6%. For DXA-based estimates of BMD at the distal femur, proximal tibia and calcaneus, these precision values suggest that LSC values >10% are needed to detect differences between treated and untreated groups in studies aimed at reducing bone mineral loss after SCI.

Imbalanced expression of RANKL and osteoprotegerin mRNA in pannus tissue of rheumatoid arthritis.

PubMed

Ainola, M; Mandelin, J; Liljeström, M; Konttinen, Y T; Salo, J

2008-01-01

To test if the pannus tissue is characterized by a high receptor activator of nuclear factor kappaB ligand to osteoprotegerin (RANKL:OPG) ratio, which could explain local osteoclastogenesis and formation of bony erosions. Messenger RNA and protein expressions of RANKL and OPG in rheumatoid and osteoarthritic tissue samples were measured using quantitative real-time RT-PCR and Western blot/densitometry. Pannus and synovitis fibroblasts explanted from tissue samples were cultured in vitro without and with TNF-alpha, IL-1Beta or IL-17 and analyzed quantitatively for RANKL expression. The ability of pannus fibroblasts to induce formation of multinuclear osteoclast-like cells from human monocytes, with macrophage-colony stimulating factor (M-CSF) but without RANKL added, was tested. Histochemical staining was used to assess the eventual presence of RANKL and tartrate resistant acid phosphatase positive osteoclast-like cells at the pannus-bone interface. RANKL:OPG ratios of messenger RNA (p<0.05) and protein level were high in pannus (2.06+/-0.73 and 2.2+/-0.65) compared to rheumatoid (0.62+/-0.13 and 1.31+/-0.69) and osteoarthritis (0.62+/-0.32 and 0.52+/-0.16) synovial membranes. Resting and stimulated (p dependent on the cytokine used) pannus fibroblasts produced RANKL in excess (p=0.0005) and unstimulated pannus fibroblasts also effectively induced osteoclast-like cell formation from monocytes in vitro without any exogenous RANKL added. Compatible with these findings, multinuclear osteoclasts-like cells were frequent in the fibroblast- and macrophage-rich pannus tissue at the soft tissue-to-bone interface. The high RANKL:OPG ratio, together with close fibroblast-to-monocyte contacts in pannus tissue, probably favor local generation of bone resorbing osteoclasts at the site of erosion in rheumatoid arthritis.

Bone health nutraceuticals alter microarray mRNA gene expression: A randomized, parallel, open-label clinical study.

PubMed

Lin, Yumei; Kazlova, Valentina; Ramakrishnan, Shyam; Murray, Mary A; Fast, David; Chandra, Amitabh; Gellenbeck, Kevin W

2016-01-15

Dietary intake of fruits and vegetables has been suggested to have a role in promoting bone health. More specifically, the polyphenols they contain have been linked to physiological effects related to bone mineral density and bone metabolism. In this research, we use standard microarray analyses of peripheral whole blood from post-menopausal women treated with two fixed combinations of plant extracts standardized to polyphenol content to identify differentially expressed genes relevant to bone health. In this 28-day open-label study, healthy post-menopausal women were randomized into three groups, each receiving one of three investigational fixed combinations of plant extracts: an anti-resorptive (AR) combination of pomegranate fruit (Punica granatum L.) and grape seed (Vitis vinifera L.) extracts; a bone formation (BF) combination of quercetin (Dimorphandra mollis Benth) and licorice (Glycyrrhiza glabra L.) extracts; and a fixed combination of all four plant extracts (AR plus BF). Standard microarray analysis was performed on peripheral whole blood samples taken before and after each treatment. Annotated genes were analyzed for their association to bone health by comparison to a gene library. The AR combination down-regulated a number of genes involved in reduction of bone resorption including cathepsin G (CTSG) and tachykinin receptor 1 (TACR1). The AR combination also up-regulated genes associated with formation of extracellular matrix including heparan sulfate proteoglycan 2 (HSPG2) and hyaluronoglucosaminidase 1 (HYAL1). In contrast, treatment with the BF combination resulted in up-regulation of bone morphogenetic protein 2 (BMP-2) and COL1A1 (collagen type I α1) genes which are linked to bone and collagen formation while down-regulating genes linked to osteoclastogenesis. Treatment with a combination of all four plant extracts had a distinctly different effect on gene expression than the results of the AR and BF combinations individually. These results could be due to multiple feedback systems balancing activities of osteoblasts and osteoclasts. In summary, this ex-vivo microarray study indicated that the pomegranate, grape seed, quercetin and licorice combinations of plant extracts modulated gene expression for both osteoclastic and osteogenic processes. Copyright © 2015 The Authors. Published by Elsevier GmbH.. All rights reserved.

Changes in Astigmatism, Densitometry, and Aberrations After SMILE for Low to High Myopic Astigmatism: A 12-Month Prospective Study.

PubMed

Pedersen, Iben Bach; Ivarsen, Anders; Hjortdal, Jesper

2017-01-01

To evaluate 12-month changes in refraction, visual outcome, corneal densitometry, and postoperative aberrations after small incision lenticule extraction (SMILE) for myopic astigmatism. This 12-month prospective clinical trial comprised 101 eyes (101 patients) treated with SMILE for myopic astigmatism with cylinder of 0.75 to 4.00 diopters (D). The preoperative, 1-week, and 1-, 3-, 6-, 9-, and 12-month examinations included measurement of manifest refraction, uncorrected distance visual acuity (UDVA), and corrected (CDVA) distance visual acuity. Astigmatic error vector analysis was performed using Al-pin's method. Densitometry and aberrations were evaluated with Pentacam HR (Oculus Optikgeräte, Wetzlar, Germany). Preoperative spherical equivalent averaged -6.78 ± 1.90 D with 1.81 ± 1.00 D in cylinder correction. After 12 months, 74% and 93% of the eyes were within ±0.50 and ±1.00 D of the attempted refraction, respectively. The logMAR UDVA and CDVA averaged 0.03 ± 0.16 and -0.08 ± 0.09, respectively. Vector analysis showed a with-the-rule undercorrection at 12 months with a mean difference vector of 0.31 D @ 91°. There was a minor counterclockwise rotation of the axis, with an arithmetic angle of error of 0.34° ± 14°. An undercorrection of approximately 11% per diopter of attempted correction was seen at 12 months. Spherical aberrations, coma, and higher order aberrations remained stable during the postoperative period (P < .09). After 12 months, no increase in densitometry could be identified. Treatment of astigmatism with SMILE seems to be predictable and effective, but with an astigmatic undercorrection of approximately 11% and a small counterclockwise rotation of the axis. [J Refract Surg. 2017;33(1):11-17.]. Copyright 2017, SLACK Incorporated.

The usefulness of densitometry in predicting the composition and fragility of urolithiasis.

PubMed

Argüelles-Salido, Enrique; Lozano-Blasco, Jose Maria; Subira-Rios, Jorge; Bernardo-Villar, Pastora; Podio-Lora, Virtudes; Campoy-Martínez, Pedro; Vazquez-Albertino, Ricardo; Medina-Lopez, Rafael

2014-04-01

The choice of ideal treatment for a given lithiasis is a crucial factor for its success, minimizing the number of interventions and complications. Previous determination of stone composition and its fragility is desirable, to predict its behavior during extracorporeal shock wave lithotripsy and for evaluation of its appropriateness, or to set the indication for other techniques. To determine the role of densitometry in the prediction of composition and fragility of urinary lithiasis undergoing SWL. Experimental prospective, blinded, in vitro study using 193 urinary calculi of known composition : monohydrated calcium oxalate, mixed calcium oxalate, uric acid, and calcium carbonate, obtained from spontaneous passage or surgery. Densitometry and SWL were performed on them. We compare the mineral composition of the stone and mineral density of each composition group to check if they are characteristic of each type and correlate these parameters with the energy dose required to fragment them down to a given fragment size. Only 53 out of 193 stones showed valuable data. Calcium carbonate was the composition showing grater mineral content and density (1,24 gr and 0,47 gr/cm2), followed by mixed oxalate (0,51/0,26) and uric acid (0,52/ 0,15), finishing with the monohydrate calcium oxalate group (0,32/0,05).Only the comparison between calcium carbonate and monohydrated calcium oxalate showed statistically significant results (p<0,05). Correlation coefficients between mineral content (0,347) and density (0,424) and the energy used for stone fragmentation to a given fragment size were statistically significant (p<0,05) CONCLUSIONS: In our study, the use of densitometry to determine stone composition and lithiasic fragility did not show conclusive results due to the limited number of calculi tested. Nevertheless, there are signs that, with a different study design , more practically useful results could be achieved.

Clinical practice guidelines for the diagnosis and management of osteoporosis. Scientific Advisory Board, Osteoporosis Society of Canada.

PubMed Central

1996-01-01

OBJECTIVE: To recommend clinical practice guidelines for the assessment of people at risk for osteoporosis, and for effective diagnosis and management of the condition. OPTIONS: Screening and diagnostic methods: risk-factor assessment, clinical evaluation, measurement of bone mineral density, laboratory investigations. Prophylactic and corrective therapies: calcium and vitamin D nutritional supplementation, physical activity and fall-avoidance techniques, ovarian hormone therapy, bisphosphonate drugs, other drug therapies. Pain-management medications and techniques. OUTCOMES: Prevention of loss of bone mineral density and fracture; increased bone mass; and improved quality of life. EVIDENCE: Epidemiologic and clinical studies and reports were examined, with emphasis on recent randomized controlled trials. Clinical practice in Canada and elsewhere was surveyed. Availability of treatment products and diagnostic equipment in Canada was considered. VALUES: Cost-effective methods and products that can be adopted across Canada were considered. A high value was given to accurate assessment of fracture risk and osteoporosis, and to increasing bone mineral density, reducing fractures and fracture risk and minimizing side effects of diagnosis and treatment. BENEFITS, HARMS AND COSTS: Proper diagnosis and management of osteoporosis minimize injury and disability, improve quality of life for patients and reduce costs to society. Rationally targeted methods of screening and diagnosis are safe and cost effective. Harmful side effects and costs of recommended therapies are minimal compared with the harms and costs of untreated osteoporosis. Alternative therapies provide a range of choices for physicians and patients. RECOMMENDATIONS: Population sets at high risk should be identified and then the diagnosis confirmed through bone densitometry. Dual-energy x-ray absorptiometry is the preferred measurement technique. Radiography can be adjunct when indicated. Calcium and vitamin D nutritional supplementation should be at currently recommended levels. Patients should be counselled in fall-avoidance techniques and exercises. Immobilization should be avoided. Guidelines for management of acute pain are listed. Ovarian hormone therapy is the therapy of choice for osteoporosis prevention and treatment in postmenopausal women. Bisphosphonates are an alternative therapy for women with established osteoporosis who cannot or prefer not to take ovarian hormone therapy. PMID:8873639

Effects of physical exercise on bone mass, balance skill and aerobic capacity in women and men with low bone mineral density, after one year of training--a prospective study.

PubMed

Kronhed, A C; Möller, M

1998-10-01

Vadstena is a small community in the county of Ostergötland, Sweden, where a project began in 1989 to prevent osteoporosis and to lower the expected incidence of osteoporotic fractures. Persons aged 40-70 years who had a low bone mineral density (BMD) value at screening of the distal radius by single-photon absorptiometry (SPA) were invited to participate in a training study during one year. The definition of low BMD was a densitometry value below -1 SD (standard deviation) from a sex- and age-specific reference value (z-score). Fifteen persons wanted to exercise in a group and 15 persons wanted to become a control group. All participants answered a questionnaire about lifestyle, occupation, diseases, medication and heredity. Clinical tests were made regarding mobility of the joints and muscles, balance and physical fitness. BMD for the hip and the lumbar spine were assessed by dual-energy X-ray absorptiometry (DXA) before and after the investigation period. The training programme was carried out for 60 min twice a week during one year and had the intention to improve bone mass, muscle strength and flexibility, balance skill and aerobic capacity. After the training period there was a significant increase in BMD at the greater trochanter (P < 0.01), in balance skill (standing on one leg with closed eyes and "ski step"-test) (P < 0.05) and in oxygen uptake capacity (P < 0.05) in the exercise group. In the control group, there was a significant increase in BMD at the lumbar spine (P < 0.05). However, these results should be judged with caution because several participants were over the age of 60, and at that age degenerative changes in the lumbar spine may increase to a greater or lesser extent. Regular weight-bearing exercises during one year seem to influence BMD at the greater trochanter in a training group comprising both women and men. However, our study was small in number and further training studies are needed to assess the effect of weight-bearing training on bone mass in different sex- and age-specific groups.

Electrical peripheral nerve stimulation relieves bone cancer pain by inducing Arc protein expression in the spinal cord dorsal horn

PubMed Central

Sun, Ke-fu; Feng, Wan-wen; Liu, Yue-peng; Dong, Yan-bin; Gao, Li; Yang, Hui-lin

2018-01-01

Objective The analgesic effect on chronic pain of peripheral nerve stimulation (PNS) has been proven, but its underlying mechanism remains unknown. Therefore, this study aimed to assess the analgesic effect of PNS on bone cancer pain in a rat model and to explore the underlying mechanism. Materials and methods PNS on sciatic nerves with bipolar electrode was performed in both naïve and bone cancer pain model rats. Then, the protein levels of activity-regulated cytoskeleton-associated protein (Arc), α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid–type glutamate receptor 1 (GluA1), and phosphate N-methyl-d-aspartic acid-type glutamate receptor subunit 2B (pGluNR2B) in spinal cord were evaluated by immunohistochemistry and Western blotting. Thermal paw withdraw latency and mechanical paw withdraw threshold were used to estimate the analgesic effect of PNS on bone cancer pain. Intrathecal administration of Arc shRNA was used to inhibit Arc expression in the spinal cord. Results PNS at 60 and 120 Hz for 20 min overtly induced Arc expression in the spinal cord, increased thermal pain thresholds in naïve rats, and relieved bone cancer pain; meanwhile, 10 Hz PNS did not achieve those results. In addition, PNS at 60 and 120 Hz also reduced the expression of GluA1, but not pGluNR2B, in the spinal cord. Finally, the anti-nociceptive effect and GluA1 downregulation induced by PNS were inhibited by intrathecal administration of Arc shRNA. Conclusion PNS (60 Hz, 0.3 mA) can relieve bone-cancer-induced allodynia and hyperalgesia by upregulating Arc protein expression and then by decreasing GluA1 transcription in the spinal cord dorsal horn. PMID:29606887

Effects of Prosthetic Material and Framework Design on Stress Distribution in Dental Implants and Peripheral Bone: A Three-Dimensional Finite Element Analysis.

PubMed

Arinc, Hakan

2018-06-22

BACKGROUND The purpose of this study was to evaluate the effects of prosthetic material and framework design on the stress within dental implants and peripheral bone using finite element analysis (FEA). MATERIAL AND METHODS A mandibular implant-supported fixed dental prosthesis with different prosthetic materials [cobalt-chromium-supported ceramic (C), zirconia-supported ceramic (Z), and zirconia-reinforced polymethyl methacrylate (ZRPMMA)-supported resin (ZP)] and different connector widths (2, 3, and 4 mm) within the framework were used to evaluate stress via FEA under oblique loading conditions. Maximum principal (smax), minimum principal (smin), and von Mises (svM) stress values were obtained. RESULTS Minimum stress values were observed in the model with a 2-mm connector width for C and ZP. The models with 3-mm and 4-mm connector widths showed higher stress values than the model with a 2-mm connector width for C (48-50%) and ZP (50-52%). Similar stress values were observed in the 3- and 4-mm models. There was no significant difference in the amount of stress with Z regardless of connector width. The Z and ZP models showed similar stress values in the 3- and 4-mm models and higher stress values than in the C model. Z, ZP, and C showed the highest stress values for the model with a 2-mm connector width. CONCLUSIONS Changes in the material and width of connectors may influence stress on cortical bone, cancellous bone, and implants. C was associated with the lowest stress values. Higher maximum and minimum principal stress values were seen in cortical bone compared to cancellous bone.

Consensus criteria for sensitive detection of minimal neuroblastoma cells in bone marrow, blood and stem cell preparations by immunocytology and QRT-PCR: recommendations by the International Neuroblastoma Risk Group Task Force

PubMed Central

Beiske, K; Burchill, S A; Cheung, I Y; Hiyama, E; Seeger, R C; Cohn, S L; Pearson, A D J; Matthay, K K

2009-01-01

Disseminating disease is a predictive and prognostic indicator of poor outcome in children with neuroblastoma. Its accurate and sensitive assessment can facilitate optimal treatment decisions. The International Neuroblastoma Risk Group (INRG) Task Force has defined standardised methods for the determination of minimal disease (MD) by immunocytology (IC) and quantitative reverse transcriptase-polymerase chain reaction (QRT-PCR) using disialoganglioside GD2 and tyrosine hydroxylase mRNA respectively. The INRG standard operating procedures (SOPs) define methods for collecting, processing and evaluating bone marrow (BM), peripheral blood (PB) and peripheral blood stem cell harvest by IC and QRT-PCR. Sampling PB and BM is recommended at diagnosis, before and after myeloablative therapy and at the end of treatment. Peripheral blood stem cell products should be analysed at the time of harvest. Performing MD detection according to INRG SOPs will enable laboratories throughout the world to compare their results and thus facilitate quality-controlled multi-centre prospective trials to assess the clinical significance of MD and minimal residual disease in heterogeneous patient groups. PMID:19401690

MPL expression on AML blasts predicts peripheral blood neutropenia and thrombocytopenia.

PubMed

Rauch, Philipp J; Ellegast, Jana M; Widmer, Corinne C; Fritsch, Kristin; Goede, Jeroen S; Valk, Peter J M; Löwenberg, Bob; Takizawa, Hitoshi; Manz, Markus G

2016-11-03

Although the molecular pathways that cause acute myeloid leukemia (AML) are increasingly well understood, the pathogenesis of peripheral blood cytopenia, a major cause of AML mortality, remains obscure. A prevailing assumption states that AML spatially displaces nonleukemic hematopoiesis from the bone marrow. However, examining an initial cohort of 223 AML patients, we found no correlation between bone marrow blast content and cytopenia, questioning the displacement theory. Measuring serum concentration of thrombopoietin (TPO), a key regulator of hematopoietic stem cells and megakaryocytes, revealed loss of physiologic negative correlation with platelet count in AML cases with blasts expressing MPL, the thrombopoietin (scavenging) receptor. Mechanistic studies demonstrated that MPL hi blasts could indeed clear TPO, likely therefore leading to insufficient cytokine levels for nonleukemic hematopoiesis. Microarray analysis in an independent multicenter study cohort of 437 AML cases validated MPL expression as a central predictor of thrombocytopenia and neutropenia in AML. Moreover, t(8;21) AML cases demonstrated the highest average MPL expression and lowest average platelet and absolute neutrophil counts among subgroups. Our work thus explains the pathophysiology of peripheral blood cytopenia in a relevant number of AML cases. © 2016 by The American Society of Hematology.

Mobilization of Hematopoietic Stem and Progenitor Cells Using Inhibitors of CXCR4 and VLA-4

PubMed Central

Rettig, Michael P.; Ansstas, George; DiPersio, John F.

2012-01-01

Successful hematopoietic stem cell transplant (HSCT) requires the infusion of a sufficient number of hematopoietic stem/progenitor cells (HSPCs) that are capable of homing to the bone marrow cavity and regenerating durable trilineage hematopoiesis in a timely fashion. Stem cells harvested from peripheral blood are the most commonly used graft source in HSCT. While granulocyte colony-stimulating factor (G-CSF) is the most frequently used agent for stem cell mobilization, the use of G-CSF alone results in suboptimal stem cell yields in a significant proportion of patients. Both the chemokine receptor CXCR4 and the integrin α4β1 (VLA-4) play important roles in the homing and retention of HSPCs within the bone marrow microenvironment. Preclinical and/or clinical studies have shown that targeted disruption of the interaction of CXCR4 or VLA-4 with their ligands results in the rapid and reversible mobilization of hematopoietic stem cells into the peripheral circulation and is synergistic when combined with G-CSF. In this review we discuss the development of small molecule CXCR4 and VLA-4 inhibitors and how they may improve the utility and convenience of peripheral blood stem cell transplantation. PMID:21886173

Hindlimb unloading has a greater effect on cortical compared with cancellous bone in mature female rats

NASA Technical Reports Server (NTRS)

Allen, Matthew R.; Bloomfield, Susan A.

2003-01-01

This study was designed to determine the effects of 28 days of hindlimb unloading (HU) on the mature female rat skeleton. In vivo proximal tibia bone mineral density and geometry of HU and cage control (CC) rats were measured with peripheral quantitative computed tomography (pQCT) on days 0 and 28. Postmortem pQCT, histomorphometry, and mechanical testing were performed on tibiae and femora. After 28 days, HU animals had significantly higher daily food consumption (+39%) and lower serum estradiol levels (-49%, P = 0.079) compared with CC. Proximal tibia bone mineral content and cortical bone area significantly declined over 28 days in HU animals (-4.0 and 4.8%, respectively), whereas total and cancellous bone mineral densities were unchanged. HU animals had lower cortical bone formation rates and mineralizing surface at tibial midshaft, whereas differences in similar properties were not detected in cancellous bone of the distal femur. These results suggest that cortical bone, rather than cancellous bone, is more prominently affected by unloading in skeletally mature retired breeder female rats.

Isolated juvenile xanthogranuloma in the bone marrow: report of a case and review of the literature.

PubMed

Kesserwan, Chimen; Boué, Daniel R; Kahwash, Samir B

2007-01-01

We report a case of juvenile xanthogranuloma limited to involvement of the bone marrow in a 6-week-old male infant. Evaluation of the bone marrow was a part of the workup for peripheral blood cytopenia. Examination showed hypercellular marrow with paratrabecular clusters of lipidized histiocytes positive for CD68, CD4, and factor XIII(a) and negative for S100 and CD1a. Clinical and radiological workup showed no associated skin lesions or osseous or visceral involvement. The patient was started on chemotherapy with clinical improvement and gradual decreased bone marrow involvement. The child is alive and well at 16 months of age. This case represents, to the best of our knowledge, the 1st documented case of juvenile xanthogranuloma with isolated bone marrow involvement sparing skin and viscera.

Lupus pernio: a clinico-radiological study of thirty-five cases.

PubMed

Spiteri, M A; Matthey, F; Gordon, T; Carstairs, L S; James, D G

1985-03-01

Thirty-five patients with lupus pernio were observed in a series of 818 patients with clinical and histological evidence of sarcoidosis. This analysis provides the natural history of lupus pernio and its associated clinico-radiographic features. There was intrathoracic involvement in 74% of patients, upper respiratory tract disease in 54%, reticulo-endothelial involvement in 54%, bone cysts in 43% and ocular lesions in 37%. It predominated in West Indies-born women. Histological confirmation was easily obtained by nasal mucosal biopsy and this could be repeated serially to evaluate the response to various treatments. Nasal bone radiographs showed destruction of the nasal bones, porosis and alteration in bone texture. Peripheral bone cysts were evident in 50% of patients who were radiographed, and in about 50% of these patients, the cysts were found in both hands and feet.

Lymphocyte Infusion in Treating Patients With Relapsed Cancer After Bone Marrow or Peripheral Stem Cell Transplantation

ClinicalTrials.gov

2011-11-28

Breast Cancer; Chronic Myeloproliferative Disorders; Gestational Trophoblastic Tumor; Kidney Cancer; Leukemia; Lymphoma; Multiple Myeloma and Plasma Cell Neoplasm; Myelodysplastic Syndromes; Neuroblastoma; Ovarian Cancer; Sarcoma; Testicular Germ Cell Tumor

Evaluating Dactinomycin and Vincristine in Young Patients With Cancer

ClinicalTrials.gov

2017-05-15

Childhood Acute Lymphoblastic Leukemia; Childhood Rhabdomyosarcoma; Childhood Soft Tissue Sarcoma; Ewing Sarcoma; Ewing Sarcoma of Bone; Ewing Sarcoma/Peripheral Primitive Neuroectodermal Tumor (PNET); Unspecified Childhood Solid Tumor, Protocol Specific; Wilms Tumor and Other Childhood Kidney Tumors

Anti-leukaemic activity of a novel haploidentical-transplantation approach employing unmanipulated bone marrow followed by CD6-depleted peripheral blood stem cells in children with refractory/relapsed acute leukaemia.

PubMed

Schuster, Friedhelm R; Meisel, Roland; Führer, Monika; Reuther, Susanne; Hauer, Julia; Tischer, Johanna; Feuchtinger, Tobias; Laws, Hans-Jürgen; Kolb, Hans-Jochem; Borkhardt, Arndt

2013-09-01

The treatment outcome of children with refractory acute leukaemia or relapse post-stem cell transplantation is dismal. We report 10 children (non-remission n = 7) who underwent a new haploidentical transplant approach utilizing unmanipulated bone marrow followed by CD6-depleted peripheral blood stem cells. Nine patients had successful engraftment and no evidence of leukaemia. Acute and chronic graft-versus-host-disease was observed in five and three patients, respectively; two patients died of treatment-related toxicity. Seven patients relapsed after 7 (range 3-34) months, however two patients are alive at 6·5 and 7·0 years. This approach provides anti-leukaemic activity even in heavily pre-treated children but long-term disease control requires further intervention. © 2013 John Wiley & Sons Ltd.

Endotoxin-associated protein: a potent stimulus for human granulocytopoietic activity which may be accessory cell independent.

PubMed Central

Bjornson, B H; Agura, E; Harvey, J M; Johns, M; Andrews, R G; McCabe, W R

1988-01-01

Proteins coextracted with endotoxin, termed endotoxin-associated protein (EAP), have been shown to exert interleukin 1-like activities. The present studies demonstrate that EAP also exerts potent granulopoietic colony-stimulating activity (CSA) on human peripheral blood and bone marrow progenitor cells, comparable to that seen with various types of conditioned media. The CSA observed with EAP appeared to be heat (100 degrees C, 30 min) and trypsin resistant and partially pronase resistant. Similar resistance was observed with the porin proteins of the outer membrane of gram-negative bacteria, and similar CSA activity was observed with a purified porin preparation of Neisseria gonorrhoeae. The CSA of EAP could be demonstrated in human peripheral blood and bone marrow leukocytes rigorously depleted of monocytes, T lymphocytes, and B lymphocytes by treatment with specific monoclonal antibodies and complement. PMID:2836311

Clinical Imaging of Bone Microarchitecture with HR-pQCT

PubMed Central

Nishiyama, Kyle K.; Shane, Elizabeth

2014-01-01

Osteoporosis, a disease characterized by loss of bone mass and structural deterioration, is currently diagnosed by dual-energy x-ray absorptiometry (DXA). However, DXA does not provide information about bone microstructure, which is a key determinant of bone strength. Recent advances in imaging permit the assessment of bone microstructure in vivo using high-resolution peripheral quantitative computed tomography (HR-pQCT). From these data, novel image processing techniques can be applied to characterize bone quality and strength. To date, most HR-pQCT studies are cross-sectional comparing subjects with and without fracture. These studies have shown that HR-pQCT is capable of discriminating fracture status independent of DXA. Recent longitudinal studies present new challenges in terms of analyzing the same region of interest and multisite calibrations. Careful application of analysis techniques and educated clinical interpretation of HR-pQCT results have improved our understanding of various bone-related diseases and will no doubt continue to do so in the future. PMID:23504496

[Fetal bone and joint disorders].

PubMed

Jakobovits, Akos

2008-12-21

The article discusses the physiology and pathology of fetal bone and joint development and functions. The bones provide static support for the body. The skull and the bones of spinal column encase the central and part of the peripheral nervous system. The ribs and the sternum shield the heart and the lungs, while the bones of the pelvis protect the intraabdominal organs. Pathological changes of these bony structures may impair the functions of the respective systems or internal organs. Movements of the bones are brought about by muscles. The deriving motions are facilitated by joints. Bony anomalies of the extremities limit their effective functions. Apart from skeletal and joint abnormalities, akinesia may also be caused by neurological, muscular and skin diseases that secondarily affect the functions of bones and joints. Such pathological changes may lead to various degrees of physical disability and even to death. Some of the mentioned anomalies are recognizable in utero by ultrasound. The diagnosis may serve as medical indication for abortion in those instances when the identified abnormality is incompatible with independent life.

Clinical cone beam computed tomography compared to high-resolution peripheral computed tomography in the assessment of distal radius bone.

PubMed

de Charry, C; Boutroy, S; Ellouz, R; Duboeuf, F; Chapurlat, R; Follet, H; Pialat, J B

2016-10-01

Clinical cone beam computed tomography (CBCT) was compared to high-resolution peripheral quantitative computed tomography (HR-pQCT) for the assessment of ex vivo radii. Strong correlations were found for geometry, volumetric density, and trabecular structure. Using CBCT, bone architecture assessment was feasible but compared to HR-pQCT, trabecular parameters were overestimated whereas cortical ones were underestimated. HR-pQCT is the most widely used technique to assess bone microarchitecture in vivo. Yet, this technology has been only applicable at peripheral sites, in only few research centers. Clinical CBCT is more widely available but quantitative assessment of the bone structure is usually not performed. We aimed to compare the assessment of bone structure with CBCT (NewTom 5G, QR, Verona, Italy) and HR-pQCT (XtremeCT, Scanco Medical AG, Brüttisellen, Switzerland). Twenty-four distal radius specimens were scanned with these two devices with a reconstructed voxel size of 75 μm for Newtom 5G and 82 μm for XtremeCT, respectively. A rescaling-registration scheme was used to define the common volume of interest. Cortical and trabecular compartments were separated using a semiautomated double contouring method. Density and microstructure were assessed with the HR-pQCT software on both modality images. Strong correlations were found for geometry parameters (r = 0.98-0.99), volumetric density (r = 0.91-0.99), and trabecular structure (r = 0.94-0.99), all p < 0.001. Correlations were lower for cortical microstructure (r = 0.80-0.89), p < 0.001. However, absolute differences were observed between modalities for all parameters, with an overestimation of the trabecular structure (trabecular number, 1.62 ± 0.37 vs. 1.47 ± 0.36 mm(-1)) and an underestimation of the cortical microstructure (cortical porosity, 3.3 ± 1.3 vs. 4.4 ± 1.4 %) assessed on CBCT images compared to HR-pQCT images. Clinical CBCT devices are able to analyze large portions of distal bones with good spatial resolution and limited irradiation. However, compared to dedicated HR-pQCT, the assessment of microarchitecture by NewTom 5G dental CBCT showed some discrepancies, for density measurements mainly. Further technical developments are required to reach optimal assessment of bone characteristics.

Evaluation of a multi-endpoint assay in rats, combining the bone-marrow micronucleus test, the Comet assay and the flow-cytometric peripheral blood micronucleus test.

PubMed

Bowen, Damian E; Whitwell, James H; Lillford, Lucinda; Henderson, Debbie; Kidd, Darren; Mc Garry, Sarah; Pearce, Gareth; Beevers, Carol; Kirkland, David J

2011-05-18

With the publication of revised draft ICH guidelines (Draft ICH S2), there is scope and potential to establish a combined multi-end point in vivo assay to alleviate the need for multiple in vivo assays, thereby reducing time, cost and use of animals. Presented here are the results of an evaluation trial in which the bone-marrow and peripheral blood (via MicroFlow(®) flow cytometry) micronucleus tests (looking at potential chromosome breakage and whole chromosome loss) in developing erythrocytes or young reticulocytes were combined with the Comet assay (measuring DNA strand-breakage), in stomach, liver and blood lymphocytes. This allowed a variety of potential target tissues (site of contact, site of metabolism and peripheral distribution) to be assessed for DNA damage. This combination approach was performed with minimal changes to the standard and regulatory recommended sampling times for the stand-alone assays. A series of eight in vivo genotoxins (2-acetylaminofluorene, benzo[a]pyrene, carbendazim, cyclophosphamide, dimethylnitrosamine, ethyl methanesulfonate, ethyl nitrosourea and mitomycin C), which are known to act via different modes of action (direct- and indirect-acting clastogens, alkylating agents, gene mutagens, cross-linking and aneugenic compounds) were tested. Male rats were dosed at 0, 24 and 45 h, and bone marrow and peripheral blood (micronucleus endpoint), liver, whole blood and stomach (Comet endpoint) were sampled at three hours after the last dose. Comet and micronucleus responses were as expected based on available data for conventional (acute) stand-alone assays. All compounds were detected as genotoxic in at least one of the endpoints. The importance of evaluating both endpoints was highlighted by the uniquely positive responses for certain chemicals (benzo[a]pyrene and 2-acetylaminofluorene) with the Comet endpoint and certain other chemicals (carbendazim and mitomycin C) with the micronucleus endpoint. The data generated from these investigations demonstrate the suitability of the multi-endpoint design. 2011 Elsevier B.V. All rights reserved.

Analysis of the surface expression of c-kit and occurrence of the c-kit Asp816Val activating mutation in T cells, B cells, and myelomonocytic cells in patients with mastocytosis.

PubMed

Akin, C; Kirshenbaum, A S; Semere, T; Worobec, A S; Scott, L M; Metcalfe, D D

2000-02-01

The Asp816Val c-kit activating mutation is detectable in the peripheral blood cells of some patients with mastocytosis and in lesional skin biopsies obtained from adult patients with urticaria pigmentosa. These observations led to the conclusion that this mutation is present in mast cells and mast cell precursors that express c-kit. However, the distribution of the Asp816Val mutation among hematopoietic lineages is unknown. To determine the distribution of the Asp816Val mutation among hematopoietic lineages and to explore its relationship to clinical disease, we examined cells bearing differentiation markers for myelomonocytic cells as well as T and B lymphocytes, in both peripheral blood and bone marrow obtained from patients with mastocytosis. The presence of Asp816Val c-kit mutation in cells magnetically sorted from peripheral blood or bone marrow according to surface differentiation markers was studied by reverse transcriptase polymerase chain reaction (RT-PCR) restriction fragment length polymorphism (RFLP) analysis. The surface expression of c-kit was determined by flow cytometry. The mutation was detectable by RT-PCR in at least one cell lineage in the bone marrow in 7 of 7 patients examined and in the peripheral blood of 11 of 11 adult patients with urticaria pigmentosa and indolent disease. The mutation was identified most frequently in B cells and myeloid cells. Flow cytometric analysis demonstrated that the differentiated cells expressing mutated c-kit were negative for surface KIT. These results are consistent with the conclusion that the c-kit Asp816Val mutation occurs in an early progenitor cell and is carried by myelomonocytic cells, T cells, and B cells in addition to mast cells. However, unlike mast cells, these myelomonocytic cells, T cells, and B cells do not concomitantly express surface c-kit and thus may be less susceptible to the effects of this mutation.

Bone disease in primary hyperparathyroidism

PubMed Central

Bandeira, Francisco; Cusano, Natalie E.; Silva, Barbara C.; Cassibba, Sara; Almeida, Clarissa Beatriz; Machado, Vanessa Caroline Costa; Bilezikian, John P.

2015-01-01

Bone disease in severe primary hyperparathyroidism (PHPT) is described classically as osteitis fibrosa cystica (OFC). Bone pain, skeletal deformities and pathological fractures are features of OFC. Bone mineral density is usually extremely low in OFC, but it is reversible after surgical cure. The signs and symptoms of severe bone disease include bone pain, pathologic fractures, proximal muscle weakness with hyperreflexia. Bone involvement is typically characterized as salt-and-pepper appearance in the skull, bone erosions and bone resorption of the phalanges, brown tumors and cysts. In the radiography, diffuse demineralization is observed, along with pathological fractures, particularly in the long bones of the extremities. In severe, symptomatic PHPT, marked elevation of the serum calcium and PTH concentrations are seen and renal involvement is manifested by nephrolithiasis and nephrocalcinosis. A new technology, recently approved for clinical use in the United States and Europe, is likely to become more widely available because it is an adaptation of the lumbar spine DXA image. Trabecular bone score (TBS) is a gray-level textural analysis that provides an indirect index of trabecular microarchitecture. Newer technologies, such as high-resolution peripheral quantitative computed tomography (HR-pQCT), have provided further understanding of the microstructural skeletal features in PHPT. PMID:25166047

PDGFBB promotes PDGFR{alpha}-positive cell migration into artificial bone in vivo

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yoshida, Shigeyuki; Center for Human Metabolomic Systems Biology, Keio University School of Medicine, 35 Shinano-machi, Shinjuku-ku, Tokyo 160-8582; Iwasaki, Ryotaro

2012-05-18

Highlights: Black-Right-Pointing-Pointer We examined effects of PDGFBB in PDGFR{alpha} positive cell migration in artificial bones. Black-Right-Pointing-Pointer PDGFBB was not expressed in osteoblastic cells but was expressed in peripheral blood cells. Black-Right-Pointing-Pointer PDGFBB promoted PDGFR{alpha} positive cell migration into artificial bones but not osteoblast proliferation. Black-Right-Pointing-Pointer PDGFBB did not inhibit osteoblastogenesis. -- Abstract: Bone defects caused by traumatic bone loss or tumor dissection are now treated with auto- or allo-bone graft, and also occasionally by artificial bone transplantation, particularly in the case of large bone defects. However, artificial bones often exhibit poor affinity to host bones followed by bony union failure.more » Thus therapies combining artificial bones with growth factors have been sought. Here we report that platelet derived growth factor bb (PDGFBB) promotes a significant increase in migration of PDGF receptor {alpha} (PDGFR{alpha})-positive mesenchymal stem cells/pre-osteoblastic cells into artificial bone in vivo. Growth factors such as transforming growth factor beta (TGF{beta}) and hepatocyte growth factor (HGF) reportedly inhibit osteoblast differentiation; however, PDGFBB did not exhibit such inhibitory effects and in fact stimulated osteoblast differentiation in vitro, suggesting that combining artificial bones with PDGFBB treatment could promote host cell migration into artificial bones without inhibiting osteoblastogenesis.« less

Neutron Resonance Densitometry for Particle-like Debris of Melted Fuel

NASA Astrophysics Data System (ADS)

Harada, H.; Kitatani, F.; Koizumi, M.; Takamine, J.; Kureta, M.; Tsutiya, H.; Iimura, H.; Seya, M.; Becker, B.; Kopecky, S.; Schillebeeckx, P.

2014-04-01

Neutron Resonance Densitometry (NRD) is proposed for the quantification of nuclear materials in particle-like debris of melted fuel from the reactors of the Fukushima Daiichi nuclear power plant. The method is based on a combination of neutron resonance transmission analysis (NRTA) and neutron resonance capture analysis (NRCA). It uses the neutron time-of-flight (TOF) technique with a pulsed white neutron source and a neutron flight path as short as 5 m. The spectrometer for NRCA is made of LaBr3(Ce) detectors. The achievable uncertainty due to only counting statistics is less than 1 % to determine Pu and U isotopes.

Seasonal vegetation differences from ERTS imagery

NASA Technical Reports Server (NTRS)

Ashley, M. D.; Rea, J.

1975-01-01

Knowledge of the times when crop and forest vegetation experience seasonally related changes in development is important in understanding growth and yield relationships. This article describes how densitometry of earth resources technology satellite (ERTS-1) multispectral scanner (MSS) imagery can be used to identify such phenological events. Adjustments for instrument calibration, aperture size, gray-scale differences between overpasses, and normalization of changing solar elevation are considered in detail. Seasonal vegetation differences can be identified by densitometry of band 5 (0.6-0.7 microns) and band 7 (0.8-1.1 microns) MSS imagery. Band-to-band ratios of the densities depicted the changes more graphically than the individual band readings.

Chlorogenic acid content, essential oil compositions, and in vitro antioxidant activities of Chromolaena odorata leaves

PubMed Central

Pitakpawasutthi, Yamon; Thitikornpong, Worathat; Palanuvej, Chanida; Ruangrungsi, Nijsiri

2016-01-01

Chromolaena odorata (L.) R. M. King and H. Rob. is a Thai medicinal plant used for the treatment of wounds, rashes, diabetes, and insect repellent. The leaves of C. odorata were collected from 10 different sources throughout Thailand. The chemical constituents of essential oils were hydro-distilled from the leaves and were analyzed by gas chromatography-mass spectrometry. Chlorogenic acid contents were determined by thin-layer chromatography (TLC) - densitometry with winCATS software and TLC image analysis with ImageJ software. The TLC plate was developed in the mobile phase that consisted of ethyl acetate:water:formic acid (17:3:2). Antioxidant activities were examined by 1,1-diphenyl-2-picryl hydrazyl (DPPH) radical scavenging and β-carotene bleaching assays. C. odorata essential oil has shown the major components of pregeijerene, dauca-5, 8-diene, (E)-caryophyllene, β-pinene, and α-pinene. The chlorogenic acid content of C. odorata leaves was determined by TLC-densitometry and TLC image analysis. Results have shown that TLC-densitometry and TLC image analysis method were not statistically significantly different. DPPH radical scavenging and β-carotene bleaching assays of ethanolic extract of C. odorata leaves showed its antioxidant potential. PMID:27144150

Comparisons of the skeletal locations of putative plutonium-induced osteosarcomas in humans with those in beagle dogs and with naturally occurring tumors in both species.

PubMed

Miller, Scott C; Lloyd, Ray D; Bruenger, Fred W; Krahenbuhl, Melinda P; Polig, Erich; Romanov, Sergey A

2003-11-01

Osteosarcomas occur from exposures to bone-seeking, alpha-particle-emitting isotopes, particularly plutonium. The skeletal distribution of putative 239Pu-induced osteosarcomas reported in Mayak Metallurgical and Radiochemical Plutonium Plant workers is compared with those observed in canine studies, and these are compared with distributions of naturally occurring osteosarcomas in both species. In the Mayak workers, 29% and 71% of the osteosarcomas were in the peripheral and central skeleton, respectively, with the spine having the most tumors (36%). An almost identical distribution of plutonium-induced osteosarcomas was reported for dogs injected with 239Pu as young adults. This distribution of osteosarcomas is quite different from the distributions of naturally occurring osteosarcomas for both species. In the Cooperative Osteosarcoma Study Group in humans (1,736 osteosarcomas from all ages), over 91% of the tumors occurred in the peripheral skeleton. In the Mayo Clinic group of older individuals (>40 years old), over 60% of the osteosarcomas appeared in the peripheral skeleton. The distribution of naturally occurring osteosarcomas in the canine is similar to that in the adult human. The similarities of the distributions of plutonium-associated osteosarcomas in the Mayak workers with those found in experimental studies suggest that many of the reported osteosarcomas may have been associated with plutonium exposures. These results also support the experimental paradigm that plutonium osteosarcomas have a preference for well vascularized cancellous bone sites. These sites have a greater initial deposition of plutonium, but also greater turnover due to elevated bone remodeling rates.

Stem cell collection in unmanipulated HLA-haploidentical/mismatched related transplantation with combined granulocyte-colony stimulating factor-mobilised blood and bone marrow for patients with haematologic malignancies: the impact of donor characteristics and procedural settings.

PubMed

Zhang, C; Chen, X-H; Zhang, X; Gao, L; Gao, L; Kong, P-Y; Peng, X-G; Sun, A-H; Gong, Y; Zeng, D-F; Wang, Q-Y

2010-06-01

Unmanipulated haploidentical/mismatched related transplantation with combined granulocyte-colony stimulating factor-mobilised peripheral blood stem cells (G-PBSCs) and granulocyte-colony stimulating factor-mobilised bone marrow (G-BM) has been developed as an alternative transplantation strategy for patients with haematologic malignancies. However, little information is available about the factors predicting the outcome of peripheral blood stem cell (PBSC) collection and bone marrow (BM) harvest in this transplantation. The effects of donor characteristics and procedure factors on CD34(+) cell yield were investigated. A total of 104 related healthy donors received granulocyte-colony stimulating factor (G-CSF) followed by PBSC collection and BM harvest. Male donors had significantly higher yields compared with female donors. In multiple regression analysis for peripheral blood collection, age and flow rate were negatively correlated with cell yield, whereas body mass index, pre-aphaeresis white blood cell (WBC) and circulating immature cell (CIC) counts were positively correlated with cell yields. For BM harvest, age was negatively correlated with cell yields, whereas pre-BM collection CIC counts were positively correlated with cell yield. All donors achieved the final product of >or=6 x10(6) kg(-1) recipient body weight. This transplantation strategy has been shown to be a feasible approach with acceptable outcomes in stem cell collection for patients who received HLA-haploidentical/mismatched transplantation with combined G-PBSCs and G-BM. In donors with multiple high-risk characteristics for poor aphaeresis CD34(+) cell yield, BM was an alternative source.

Pseudofracture: an acute peripheral tissue trauma model.

PubMed

Darwiche, Sophie S; Kobbe, Philipp; Pfeifer, Roman; Kohut, Lauryn; Pape, Hans-Christoph; Billiar, Timothy

2011-04-18

Following trauma there is an early hyper-reactive inflammatory response that can lead to multiple organ dysfunction and high mortality in trauma patients; this response is often accompanied by a delayed immunosuppression that adds the clinical complications of infection and can also increase mortality. Many studies have begun to assess these changes in the reactivity of the immune system following trauma. Immunologic studies are greatly supported through the wide variety of transgenic and knockout mice available for in vivo modeling; these strains aid in detailed investigations to assess the molecular pathways involved in the immunologic responses. The challenge in experimental murine trauma modeling is long term investigation, as fracture fixation techniques in mice, can be complex and not easily reproducible. This pseudofracture model, an easily reproduced trauma model, overcomes these difficulties by immunologically mimicking an extremity fracture environment, while allowing freedom of movement in the animals and long term survival without the continual, prolonged use of anaesthesia. The intent is to recreate the features of long bone fracture; injured muscle and soft tissue are exposed to damaged bone and bone marrow without breaking the native bone. The pseudofracture model consists of two parts: a bilateral muscle crush injury to the hindlimbs, followed by injection of a bone solution into these injured muscles. The bone solution is prepared by harvesting the long bones from both hindlimbs of an age- and weight-matched syngeneic donor. These bones are then crushed and resuspended in phosphate buffered saline to create the bone solution. Bilateral femur fracture is a commonly used and well-established model of extremity trauma, and was the comparative model during the development of the pseudofracture model. Among the variety of available fracture models, we chose to use a closed method of fracture with soft tissue injury as our comparison to the pseudofracture, as we wanted a sterile yet proportionally severe peripheral tissue trauma model. Hemorrhagic shock is a common finding in the setting of severe trauma, and the global hypoperfusion adds a very relevant element to a trauma model. The pseudofracture model can be easily combined with a hemorrhagic shock model for a multiple trauma model of high severity.

Volumetric bone mineral density (vBMD), bone structure, and structural geometry among rural South Indian, US Caucasian, and Afro-Caribbean older men.

PubMed

Jammy, Guru Rajesh; Boudreau, Robert M; Singh, Tushar; Sharma, Pawan Kumar; Ensrud, Kristine; Zmuda, Joseph M; Reddy, P S; Newman, Anne B; Cauley, Jane A

2018-05-22

Peripheral quantitative computed tomography (pQCT) provides biomechanical estimates of bone strength. Rural South Indian men have reduced biomechanical indices of bone strength compared to US Caucasian and Afro-Caribbean men. This suggests an underlying higher risk of osteoporotic fractures and greater future fracture burden among the rural South Indian men. Geographical and racial comparisons of bone mineral density (BMD) have largely focused on DXA measures of areal BMD. In contrast, peripheral quantitative computed tomography (pQCT) measures volumetric BMD (vBMD), bone structural geometry and provides estimates of biomechanical strength. To further understand potential geographical and racial differences in skeletal health, we compared pQCT measures among US Caucasian, Afro-Caribbean, and rural South Indian men. We studied men aged ≥ 60 years enrolled in the Mobility and Independent Living among Elders Study (MILES) in rural south India (N = 245), Osteoporotic Fractures in Men Study (MrOS) in the US (N = 1148), and the Tobago Bone Health Study (N = 828). The BMI (kg/m 2 ) of rural South Indian men (21.6) was significantly lower compared to the US Caucasians (28) and Afro-Caribbean men (26.9). Adjusting for age, height, body weight, and grip strength; rural South Indian men compared to US Caucasians had significantly lower trabecular vBMD [- 1.3 to - 1.5 standard deviation (SD)], cortical thickness [- 0.8 to - 1.2 SD]; significantly higher endosteal circumference [0.5 to 0.8 SD]; but similar cortical vBMD. Afro-Caribbean men compared to US Caucasians had similar trabecular vBMD but significantly higher cortical vBMD [0.9 to 1.2 SD], SSIp [0.2 to 1.4 SD], and tibial endosteal circumference [1 SD], CONCLUSIONS: In comparison to US Caucasians, rural South Indian men have reduced bone strength (lower trabecular vBMD) and Afro-Caribbean men have greater bone strength (higher cortical vBMD). These results suggest an underlying higher risk of osteoporotic fractures and greater future fracture burden among rural South Indian men.

Deficiency of bone marrow beta3-integrin enhances non-functional neovascularization.

PubMed

Watson, Alan R; Pitchford, Simon C; Reynolds, Louise E; Direkze, Natalie; Brittan, Mairi; Alison, Malcolm R; Rankin, Sara; Wright, Nicholas A; Hodivala-Dilke, Kairbaan M

2010-03-01

beta3-Integrin is a cell surface adhesion and signalling molecule important in the regulation of tumour angiogenesis. Mice with a global deficiency in beta3-integrin show increased pathological angiogenesis, most likely due to increased vascular endothelial growth factor receptor 2 expression on beta3-null endothelial cells. Here we transplanted beta3-null bone marrow (BM) into wild-type (WT) mice to dissect the role of BM beta3-integrin deficiency in pathological angiogenesis. Mice transplanted with beta3-null bone marrow show significantly enhanced angiogenesis in subcutaneous B16F0 melanoma and Lewis lung carcinoma (LLC) cell models and in B16F0 melanoma lung metastasis when compared with tumours grown in mice transplanted with WT bone marrow. The effect of bone marrow beta3-integrin deficiency was also assessed in the RIPTAg mouse model of pancreatic tumour growth. Again, angiogenesis in mice lacking BM beta3-integrin was enhanced. However, tumour weight between the groups was not significantly altered, suggesting that the enhanced blood vessel density in the mice transplanted with beta3-null bone marrow was not functional. Indeed, we demonstrate that in mice transplanted with beta3-null bone marrow a significant proportion of tumour blood vessels are non-functional when compared with tumour blood vessels in WT-transplanted controls. Furthermore, beta3-null-transplanted mice showed an increased angiogenic response to VEGF in vivo when compared with WT-transplanted animals. BM beta3-integrin deficiency affects the mobilization of progenitor cells to the peripheral circulation. We show that VEGF-induced mobilization of endothelial progenitor cells is enhanced in mice transplanted with beta3-null bone marrow when compared with WT-transplanted controls, suggesting a possible mechanism underlying the increased blood vessel density seen in beta3-null-transplanted mice. In conclusion, although BM beta3-integrin is not required for pathological angiogenesis, our studies demonstrate a role for BM beta3-integrin in VEGF-induced mobilization of bone marrow-derived cells to the peripheral circulation and for the functionality of those vessels in which BM-derived cells become incorporated.

Effect of tocopherol-monoglucoside (TMG), a water-soluble glycosylated derivate of vitamin E, on hematopoietic recovery in irradiated mice.

PubMed

Cherdyntseva, Nadezda; Shishkina, Anna; Butorin, Ivan; Murase, Hironobu; Gervas, Polina; Kagiya, Tsutomu V

2005-03-01

A preparation of alpha-tocopherol monoglucoside (TMG) administered i.p. at a dose of 600 mg/kg immediately after whole body gamma irradiation was examined for its radioprotective efficacy towards bone marrow and peripheral blood nucleated cells. When mice received X-rays at a dose of 5,6 Gy, a marked decrease in bone marrow karyocytes and a reduction of peripheral leukocytes within the early post-irradiated period were observed. However these changes were attenuated in TMG-treated mice. Significant protection of blood lymphocytes was found for the TMG group of mice. The return to normal value of the reduced blood leukocyte count starting from the 8th day was more rapid in TMG-treated mice than in untreated irradiated mice. TMG administration was found to enhance hematopoietic recovery, as measured by the exceeded nucleated bone marrow cell count due to elevated amount of both lymphoid and granulocytic elements in the TMG-group, in comparison with that of both control irradiated and non-irradiated animals. These findings indicate that the radioprotective effect of TMG is apparently realized through its influence on hematopoietic system.

Brain Metastasis in Bone and Soft Tissue Cancers: A Review of Incidence, Interventions, and Outcomes

PubMed Central

Shweikeh, Faris; Bukavina, Laura; Saeed, Kashif; Sarkis, Reem; Suneja, Aarushi; Sweiss, Fadi; Drazin, Doniel

2014-01-01

Bone and soft tissue malignancies account for a small portion of brain metastases. In this review, we characterize their incidence, treatments, and prognosis. Most of the data in the literature is based on case reports and small case series. Less than 5% of brain metastases are from bone and soft tissue sarcomas, occurring most commonly in Ewing's sarcoma, malignant fibrous tumors, and osteosarcoma. Mean interval from initial cancer diagnosis to brain metastasis is in the range of 20–30 months, with most being detected before 24 months (osteosarcoma, Ewing sarcoma, chordoma, angiosarcoma, and rhabdomyosarcoma), some at 24–36 months (malignant fibrous tumors, malignant peripheral nerve sheath tumors, and alveolar soft part sarcoma), and a few after 36 months (chondrosarcoma and liposarcoma). Overall mean survival ranges between 7 and 16 months, with the majority surviving < 12 months (Ewing's sarcoma, liposarcoma, malignant fibrous tumors, malignant peripheral nerve sheath tumors, angiosarcoma and chordomas). Management is heterogeneous involving surgery, radiosurgery, radiotherapy, and chemotherapy. While a survival advantage may exist for those given aggressive treatment involving surgical resection, such patients tended to have a favorable preoperative performance status and minimal systemic disease. PMID:24757391

T cell numbers relate to bone involvement in Gaucher disease.

PubMed

Lacerda, L; Arosa, F A; Lacerda, R; Cabeda, J; Porto, G; Amaral, O; Fortuna, A; Pinto, R; Oliveira, P; McLaren, C E; Sá Miranda, C; de Sousa, M

1999-04-01

The major elements of bone pathology in Gaucher disease are a failure of osteoclast and osteoblast function, resulting in osteopenia and also osteonecrosis. T lymphocytes have recently been found to be involved in the regulation of osteoblast/osteoclast activity in vitro. In the present report the peripheral blood T major lymphocyte subsets were investigated in a group of genotyped type 1 Gaucher disease patients. A total of 31 patients were studied: 21 non-splenectomized (5 N370S homozygotes) and 10 splenectomized (of whom 1 was a N370S homozygote). The results show that non-splenectomized patients present a decrease in absolute numbers of peripheral blood T lymphocytes, specially the CD4+ T subset. However, when patients were analyzed with respect to the presence of bone disease, the number of CD8+ T lymphocytes was found to be statistically significantly lower in patients presenting bone involvement. Furthermore, lower numbers of CD8+ T lymphocytes were significantly correlated with higher levels of plasma tartrate resistant acid phosphatase (TRAP) activity, a putative marker of osteoclast cell activity. These in vivo findings are in agreement with the results reached in vitro by others. They provide an additional marker of disease severity in Gaucher disease. In the group of genotyped Gaucher disease patients, the majority of the N370S homozygous patients presented a clinically milder phenotype, including the absence of bone involvement, confirming earlier reports predicting that a number of these patients may remain undiagnosed. Collectively the homozygosity for the N370S mutation and normal T cell numbers may provide additional markers for the clinical heterogeneity of Gaucher disease.

Osteoporosis and skeletal fractures in chronic liver disease.

PubMed Central

Diamond, T; Stiel, D; Lunzer, M; Wilkinson, M; Roche, J; Posen, S

1990-01-01

In order to determine the prevalence and severity of hepatic osteodystrophy by non-invasive means we compared 115 consecutive ambulant patients with histologically proven chronic liver disease to 113 age and sex matched control subjects. Methods used included the assessment of fracture prevalence rates, spinal radiography, and measurements of bone mineral density in the spine and the forearm. Spinal and peripheral fractures were more prevalent in the patients than in the control subjects (p less than 0.03 and p less than 0.01 respectively). The type of the underlying liver disease did not significantly affect the fracture prevalence rates, but alcoholic patients sustained more peripheral fractures than patients with other hepatic disorders (p less than 0.05). The bone mineral densities of the spines and the forearms were significantly reduced in male patients of all age groups and in female patients aged 60 years or more (p less than 0.001 for men and p less than 0.01 for women for both measurements). The prevalence rates of spinal and forearm osteoporosis were twice as high among patients with liver disease than in control subjects regardless of the definitions used. The presence of cirrhosis and hypogonadism were major risk factors for development of both spinal (Beta coef = 0.190 and 0.176; SE = 0.079 and 0.086 respectively) and forearm osteoporosis (Beta coef = 0.20 and 0.29; SE = 0.073 and 0.80 respectively). Spinal bone density was the predominant determinant of spinal fractures (Beta coef = -0.007; SE = 0.001), while hypogonadism (Beta coef = 0.363; SE = 0.075) and cirrhosis (Beta coef = 0.185; SE = 0.068) were the major predictors of peripheral fractures. The concentrations of serum calcium and serum vitamin D metabolites and the use of corticosteroids were apparently without effect on the prevalence of skeletal fractures or bone density. PMID:2318434

Related Hematopoietic Stem Cell Transplantation (HSCT) for Genetic Diseases of Blood Cells

ClinicalTrials.gov

2017-01-12

Stem Cell Transplantation; Bone Marrow Transplantation; Peripheral Blood Stem Cell Transplantation; Allogeneic Transplantation; Genetic Diseases; Thalassemia; Pediatrics; Diamond-Blackfan Anemia; Combined Immune Deficiency; Wiskott-Aldrich Syndrome; Chronic Granulomatous Disease; X-linked Lymphoproliferative Disease; Metabolic Diseases

Limited Associations between Keel Bone Damage and Bone Properties Measured with Computer Tomography, Three-Point Bending Test, and Analysis of Minerals in Swiss Laying Hens

PubMed Central

Gebhardt-Henrich, Sabine G.; Pfulg, Andreas; Fröhlich, Ernst K. F.; Käppeli, Susanna; Guggisberg, Dominik; Liesegang, Annette; Stoffel, Michael H.

2017-01-01

Keel bone damage is a wide-spread welfare problem in laying hens. It is unclear so far whether bone quality relates to keel bone damage. The goal of the present study was to detect possible associations between keel bone damage and bone properties of intact and damaged keel bones and of tibias in end-of-lay hens raised in loose housing systems. Bones were palpated and examined by peripheral quantitative computer tomography (PQCT), a three-point bending test, and analyses of bone ash. Contrary to our expectations, PQCT revealed higher cortical and trabecular contents in fractured than in intact keel bones. This might be due to structural bone repair after fractures. Density measurements of cortical and trabecular tissues of keel bones did not differ between individuals with and without fractures. In the three-point bending test of the tibias, ultimate shear strength was significantly higher in birds with intact vs. fractured keel bones. Likewise, birds with intact or slightly deviated keel bones had higher mineral and calcium contents of the keel bone than birds with fractured keel bones. Calcium content in keel bones was correlated with calcium content in tibias. Although there were some associations between bone traits related to bone strength and keel bone damage, other factors such as stochastic events related to housing such as falls and collisions seem to be at least as important for the prevalence of keel bone damage. PMID:28848740

The subchondral bone plate.

PubMed

Müller-Gerbl, M

1998-01-01

Pauwels (1965) and subsequent workers in the same field have shown that the distribution of the subchondral density within a joint surface can serve as a parametric measurement which reflects the main stress acting on a joint. Our own investigations on anatomical specimens have demonstrated that this subchondral mineralization does indeed show regular distribution patterns from which conclusions about the mechanical situation within an individual joint may be drawn. Since radiographical densitometry and histological methods are only available for determining the adaptive reaction of the bone to the particular mechanical situation in a joint after death, the information obtained applies only to an end situation and tells us nothing about the development of the changes with time. Furthermore, investigations carried out on human specimens by radiographical densitometry mostly apply to samples of a particular age, since such specimens can be acquired only from departments of pathology, forensic medicine or anatomy. The functional reactions of the bone tissue to repeated long-term changes in the loading--lengthy immobilization and subsequent remobilization, for instance, or heavy loading over a considerable period of time--cannot be followed by any ordinary method in experimental animals, since the death of the animal is a prerequisite for the precise quantitative examination of the bone tissue. This applies also to attempts to follow the process by means of animal experiments. CT OAM has been developed as a method which, based on CT, can provide a surface representation of the 3-D density distribution in the joints of living subjects. Comparative studies were carried out to establish and confirm the validity of the procedure. These have shown (1) that the results obtained from anatomical specimens are identical with those obtained in the living; (2) that secondary CT sections are suitable for evaluation and that the spectrum of joint surfaces examined can be extended to include the whole joint (if this were not so, effects caused by the apparatus--particularly the partial-volume effect--would render the procedure impossible); and finally (3) that the distribution of the Hounsfield density within the subchondral bone represents the distribution of the mineralization. The mineralization patterns found by us in different joints of normal subjects have shown that these patterns can be brought into line with current models of joint mechanics. The radiocarpal joint, for instance, has revealed the various types of loading occurring within physiological limits. Information has also been obtained about the age-related changes taking place in the hip, wrist and ankle joints. The increase of the total mineralization in gymnasts can be related to the qualitative and quantitative adaptation to an increased peak loading, and reduced mineralization to a lengthy reduction in use during, for instance, postoperative immobilization. In groups of patients with various diseases of mechanical origin (shoulder instability, malalignment of the main axis, defective repositioning of healed fractures, rupture of the rotator cuff, meniscectomy or rupture of the anterior cruciate ligament), a pattern of mineralization is found which is different from the normal picture. These findings reflect the abnormal mechanical situation. The mineralization pattern of the femoropatellar joint has revealed the differing etiologies of medial and lateral cartilage damage and the examination of patients with lunatomalacia has made it possible to recognize a genetic disposition. The postoperative comparison of the mineralization patterns of patients with genu varum who have undergone a correction osteotomy and the results of animal experiments on various procedures for reconstructing the anterior cruciate ligament or a primary replacement of the meniscus, have produced results which make it possible to judge the success or failure of the operation. (ABSTRACT TRUNCATED)

Bone structure in two adult subjects with impaired minor spliceosome function resulting from RNU4ATAC mutations causing microcephalic osteodysplastic primordial dwarfism type 1 (MOPD1).

PubMed

Krøigård, Anne Bruun; Frost, Morten; Larsen, Martin Jakob; Ousager, Lilian Bomme; Frederiksen, Anja Lisbeth

2016-11-01

Microcephalic osteodysplastic primordial dwarfism type 1 (MOPD1), or Taybi-Linder syndrome is characterized by distinctive skeletal dysplasia, severe intrauterine and postnatal growth retardation, microcephaly, dysmorphic features, and neurological malformations. It is an autosomal recessive disorder caused by homozygous or compound heterozygous mutations in the RNU4ATAC gene resulting in impaired function of the minor spliceosome. Here, we present the first report on bone morphology, bone density and bone microstructure in two adult MOPD1 patients and applied radiographs, dual energy X-ray absorptiometry, high-resolution peripheral quantitative computed tomography and biochemical evaluation. The MOPD1 patients presented with short stature, low BMI but normal macroscopic bone configuration. Bone mineral density was low. Compared to Danish reference data, total bone area, cortical bone area, cortical thickness, total bone density, cortical bone density, trabecular bone density and trabecular bone volume per tissue volume (BV/TV) were all low. These findings may correlate to the short stature and low body weight of the MOPD1 patients. Our findings suggest that minor spliceosome malfunction may be associated with altered bone modelling. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Validation of cytogenetic risk groups according to International Prognostic Scoring Systems by peripheral blood CD34+FISH: results from a German diagnostic study in comparison with an international control group.

PubMed

Braulke, Friederike; Platzbecker, Uwe; Müller-Thomas, Catharina; Götze, Katharina; Germing, Ulrich; Brümmendorf, Tim H; Nolte, Florian; Hofmann, Wolf-Karsten; Giagounidis, Aristoteles A N; Lübbert, Michael; Greenberg, Peter L; Bennett, John M; Solé, Francesc; Mallo, Mar; Slovak, Marilyn L; Ohyashiki, Kazuma; Le Beau, Michelle M; Tüchler, Heinz; Pfeilstöcker, Michael; Nösslinger, Thomas; Hildebrandt, Barbara; Shirneshan, Katayoon; Aul, Carlo; Stauder, Reinhard; Sperr, Wolfgang R; Valent, Peter; Fonatsch, Christa; Trümper, Lorenz; Haase, Detlef; Schanz, Julie

2015-02-01

International Prognostic Scoring Systems are used to determine the individual risk profile of myelodysplastic syndrome patients. For the assessment of International Prognostic Scoring Systems, an adequate chromosome banding analysis of the bone marrow is essential. Cytogenetic information is not available for a substantial number of patients (5%-20%) with dry marrow or an insufficient number of metaphase cells. For these patients, a valid risk classification is impossible. In the study presented here, the International Prognostic Scoring Systems were validated based on fluorescence in situ hybridization analyses using extended probe panels applied to cluster of differentiation 34 positive (CD34(+)) peripheral blood cells of 328 MDS patients of our prospective multicenter German diagnostic study and compared to chromosome banding results of 2902 previously published patients with myelodysplastic syndromes. For cytogenetic risk classification by fluorescence in situ hybridization analyses of CD34(+) peripheral blood cells, the groups differed significantly for overall and leukemia-free survival by uni- and multivariate analyses without discrepancies between treated and untreated patients. Including cytogenetic data of fluorescence in situ hybridization analyses of peripheral CD34(+) blood cells (instead of bone marrow banding analysis) into the complete International Prognostic Scoring System assessment, the prognostic risk groups separated significantly for overall and leukemia-free survival. Our data show that a reliable stratification to the risk groups of the International Prognostic Scoring Systems is possible from peripheral blood in patients with missing chromosome banding analysis by using a comprehensive probe panel (clinicaltrials.gov identifier:01355913). Copyright© Ferrata Storti Foundation.

Influence of parity on bone mineral density and peripheral fracture risk in Moroccan postmenopausal women.

PubMed

Allali, Fadoua; Maaroufi, Houda; Aichaoui, Siham El; Khazani, Hamza; Saoud, Bouchra; Benyahya, Boubker; Abouqal, Redouane; Hajjaj-Hassouni, Najia

2007-08-20

The aims of the study were to determine: (1) the relationship between parity and bone mineral density (BMD); (2) the relationship between parity and osteoporotic peripheral fractures. The group studied included 730 postmenopausal women. Patients were separated into four groups according to the number of fullterm pregnancies, group 1: nulliparae, group 2: one to three pregnancies, group 3: four to five pregnancies, and group 4: six and more pregnancies. Additionally, patients were separated into three groups according to their ages, as <50 years, 50-59 years and >or=60 years. The median parity was 4 [0-20]. All the patients with parity greater than six had spine and hip BMD values significantly lower than values in the other groups (p<0.001). After adjustment for age and body mass index (BMI), decreased lumbar and total hip BMD were still associated to increased parity (analysis of covariance (ANCOVA), p=0.04 and 0.023, respectively). The relation between parity and lumbar BMD was highly significant among women aged <50 years (age-adjusted p=0.022), while there was no parity-spine BMD association in the other age groups. The relation between parity and hip BMD was seen only in the group 50-59 years (age-adjusted p=0.042). A positive history for peripheral fractures was present in 170 (23%) patients. There was relationship between parity and peripheral fractures neither in the whole population nor in the sub-groups according to age. The present study suggests that the BMD of the spine and hip decreases with an increasing number of pregnancies, and this situation shows variations in different age groups. However, there was no correlation between parity level and peripheral fractures.

In vivo biocompatibility of new nano-calcium-deficient hydroxyapatite/poly-amino acid complex biomaterials.

PubMed

Dai, Zhenyu; Li, Yue; Lu, Weizhong; Jiang, Dianming; Li, Hong; Yan, Yonggang; Lv, Guoyu; Yang, Aiping

2015-01-01

To evaluate the compatibility of novel nano-calcium-deficient hydroxyapatite/poly-amino acid (n-CDHA/PAA) complex biomaterials with muscle and bone tissue in an in vivo model. Thirty-two New Zealand white rabbits were used in this study. Biomaterials were surgically implanted into each rabbit in the back erector spinae and in tibia with induced defect. Polyethylene was implanted into rabbits in the control group and n-CDHA/PAA into those of the experimental group. Animals were examined at four different points in time: 2 weeks, 4 weeks, 12 weeks, and 24 weeks after surgery. They were euthanized after embolization. Back erector spinae muscles with the surgical implants were examined after hematoxylin and eosin (HE) staining at these points in time. Tibia bones with the surgical implants were examined by X-ray and scanning electron microscopy (SEM) at these points in time to evaluate the interface of the bone with the implanted biomaterials. Bone tissues were sectioned and subjected to HE, Masson, and toluidine blue staining. HE staining of back erector spinae muscles at 4 weeks, 12 weeks, and 24 weeks after implantation of either n-CDHA/PAA or polyethylene showed disappearance of inflammation and normal arrangement in the peripheral tissue of implant biomaterials; no abnormal staining was observed. At 2 weeks after implantation, X-ray imaging of bone tissue samples in both experimental and control groups showed that the peripheral tissues of the implanted biomaterials were continuous and lacked bone osteolysis, absorption, necrosis, or osteomyelitis. The connection between implanted biomaterials and bone tissue was tight. The results of HE, Masson, toluidine blue staining and SEM confirmed that the implanted biomaterials were closely connected to the bone defect and that no rejection had taken place. The n-CDHA/PAA biomaterials induced differentiation of a large number of chondrocytes. New bone trabecula began to form at 4 weeks after implanting n-CDHA/PAA biomaterials, and lamellar bone gradually formed at 12 weeks and 24 weeks after implantation. Routine blood and kidney function tests showed no significant changes at 2 weeks and 24 weeks after implantation of both biomaterials. n-CDHA/PAA composites showed good compatibility in in vivo model. In this study, n-CDHA/PAA were found to be safe, nontoxic, and biologically active in bone repair.

In vivo biocompatibility of new nano-calcium-deficient hydroxyapatite/poly-amino acid complex biomaterials

PubMed Central

Dai, Zhenyu; Li, Yue; Lu, Weizhong; Jiang, Dianming; Li, Hong; Yan, Yonggang; Lv, Guoyu; Yang, Aiping

2015-01-01

Objective To evaluate the compatibility of novel nano-calcium-deficient hydroxyapatite/poly-amino acid (n-CDHA/PAA) complex biomaterials with muscle and bone tissue in an in vivo model. Methods Thirty-two New Zealand white rabbits were used in this study. Biomaterials were surgically implanted into each rabbit in the back erector spinae and in tibia with induced defect. Polyethylene was implanted into rabbits in the control group and n-CDHA/PAA into those of the experimental group. Animals were examined at four different points in time: 2 weeks, 4 weeks, 12 weeks, and 24 weeks after surgery. They were euthanized after embolization. Back erector spinae muscles with the surgical implants were examined after hematoxylin and eosin (HE) staining at these points in time. Tibia bones with the surgical implants were examined by X-ray and scanning electron microscopy (SEM) at these points in time to evaluate the interface of the bone with the implanted biomaterials. Bone tissues were sectioned and subjected to HE, Masson, and toluidine blue staining. Results HE staining of back erector spinae muscles at 4 weeks, 12 weeks, and 24 weeks after implantation of either n-CDHA/PAA or polyethylene showed disappearance of inflammation and normal arrangement in the peripheral tissue of implant biomaterials; no abnormal staining was observed. At 2 weeks after implantation, X-ray imaging of bone tissue samples in both experimental and control groups showed that the peripheral tissues of the implanted biomaterials were continuous and lacked bone osteolysis, absorption, necrosis, or osteomyelitis. The connection between implanted biomaterials and bone tissue was tight. The results of HE, Masson, toluidine blue staining and SEM confirmed that the implanted biomaterials were closely connected to the bone defect and that no rejection had taken place. The n-CDHA/PAA biomaterials induced differentiation of a large number of chondrocytes. New bone trabecula began to form at 4 weeks after implanting n-CDHA/PAA biomaterials, and lamellar bone gradually formed at 12 weeks and 24 weeks after implantation. Routine blood and kidney function tests showed no significant changes at 2 weeks and 24 weeks after implantation of both biomaterials. Conclusion n-CDHA/PAA composites showed good compatibility in in vivo model. In this study, n-CDHA/PAA were found to be safe, nontoxic, and biologically active in bone repair. PMID:26504382

Effect of oral monthly ibandronate on bone microarchitecture in women with osteopenia-a randomized placebo-controlled trial.

PubMed

Chapurlat, R D; Laroche, M; Thomas, T; Rouanet, S; Delmas, P D; de Vernejoul, M-C

2013-01-01

We have examined the effect of oral monthly ibandronate on distal radius and tibia microarchitecture with high-resolution peripheral quantitative tomography compared with placebo, in women with osteopenia, and found that ibandronate did not significantly affect trabecular bone but improved cortical density and thickness at the tibia. We have examined the effect of ibandronate on bone microarchitecture with peripheral high-resolution quantitative computed tomography (HR-pQCT) in a randomized placebo-controlled trial among 148 women with osteopenia. Patients received either oral 150 mg monthly ibandronate or placebo over 24 months. Bone microarchitecture was assessed at baseline, 6, 12, and 24 months, using HR-pQCT at the distal radius and tibia; areal bone mineral density (aBMD) was measured with DXA at the spine, hip, and radius. At 12 months, there was no significant difference in trabecular bone volume at the radius (the primary end point) between women on ibandronate (10.8 ± 2.5%) and placebo (10.5 ± 2.9%), p = 0.25. There was no significant difference in other radius trabecular and cortical microarchitecture parameters at 12 and 24 months. In contrast, at the tibia, cortical vBMD in the ibandronate group was significantly greater than in the placebo group at 6, 12, and 24 months, with better cortical thickness at 6, 12, and 24 months. With ibandronate, aBMD was significantly increased at the hip and spine at 12 and 24 months but at the radius was significantly superior to placebo only at 24 months. Most of the adverse events related to ibandronate were expected with bisphosphonate use, and none of them were serious. We conclude that 12 months of treatment with ibandronate in women with osteopenia did not affect trabecular bone microarchitecture, but improved cortical vBMD at the tibia at 12 and 24 months, and preserved cortical thickness at the tibia.

Optimizing the method for generation of integration-free induced pluripotent stem cells from human peripheral blood.

PubMed

Gu, Haihui; Huang, Xia; Xu, Jing; Song, Lili; Liu, Shuping; Zhang, Xiao-Bing; Yuan, Weiping; Li, Yanxin

2018-06-15

Generation of induced pluripotent stem cells (iPSCs) from human peripheral blood provides a convenient and low-invasive way to obtain patient-specific iPSCs. The episomal vector is one of the best approaches for reprogramming somatic cells to pluripotent status because of its simplicity and affordability. However, the efficiency of episomal vector reprogramming of adult peripheral blood cells is relatively low compared with cord blood and bone marrow cells. In the present study, integration-free human iPSCs derived from peripheral blood were established via episomal technology. We optimized mononuclear cell isolation and cultivation, episomal vector promoters, and a combination of transcriptional factors to improve reprogramming efficiency. Here, we improved the generation efficiency of integration-free iPSCs from human peripheral blood mononuclear cells by optimizing the method of isolating mononuclear cells from peripheral blood, by modifying the integration of culture medium, and by adjusting the duration of culture time and the combination of different episomal vectors. With this optimized protocol, a valuable asset for banking patient-specific iPSCs has been established.

Bone mass regulation of leptin and postmenopausal osteoporosis with obesity.

PubMed

Legiran, Siswo; Brandi, Maria Luisa

2012-09-01

Leptin has been known to play a role in weight regulation through food intake and energy expenditure. Leptin also has an important role in bone metabolism. The role of leptin is determined by leptin receptors, either central or peripheral to the bones. We discuss the role of leptin on bone and molecular genetics of osteoporosis in postmenopausal obese women. The role of leptin in bone preserves bone mineral density (BMD) through increased OPG levels leading to bind RANKL, resulting in reducing osteoclast activity. The estrogen role on bone is also mediated by RANKL and OPG. In postmenopausal women who have estrogen deficiency, it increases the rate of RANKL, which increases osteoclastogenesis. Obese individuals who have a high level of leptin will be effected by bone protection. There are similarities in the mechanism between estrogen and leptin in influencing the process of bone remodeling. It may be considered that the role of estrogen can be replaced by leptin. Molecular genetic aspects that play a role in bone remodeling, such as leptin, leptin receptors, cytokines (e.g. RANK, RANKL, and OPG), require further study to be useful, especially regarding osteoporosis therapy based on genetic analysis.

Isolated extra-medullary relapse of acute leukemia following allogeneic bone marrow transplantation.

PubMed

Firas, Al Sabty; Demeckova, E; Bojtarova, E; Czako, B; Hrubisko, M; Mistrik, M

2008-01-01

Isolated extramedullary relapse (IEMR) of acute leukemia (AL) after allogeneic bone marrow transplantation (BMT) is a rare occurrence. It is seen more commonly after BMT than after conventional chemotherapy (CHT) alone. We describe the natural history and response to treatment in four patients with IEMR following allogeneic BMT. The results indicate a stronger graft-versus-leukemia (GVL) effect in the marrow than in the peripheral tissues (Fig. 4, Ref. 13). Full Text (Free, PDF) www.bmj.sk.

[The effect of lithium carbonate on the leukocyte count following ionizing radiation. 4. The effect of lithium carbonate on the activation of granulocytes].

PubMed

Wolf, G; Müller, G M; Kehrberg, G

1989-01-01

From numerous investigations it is known that lithium carbonate promotes granulocytopoiesis by stimulation of CSF (colony stimulating factor) in bone marrow. To prove if no immature, in their functions restricted cells are delivered from bone marrow, the activity of granulocytes was tested in vitro in patients with lithium therapy. It could be seen that granulocytes of peripheral blood show an increased in-vitro-activation after lithium influence in vivo.

Hypocalcemia development in patients operated for primary hyperparathyroidism: Can it be predicted preoperatively?

PubMed

Kaya, Cafer; Tam, Abbas Ali; Dirikoç, Ahmet; Kılıçyazgan, Aylin; Kılıç, Mehmet; Türkölmez, Şeyda; Ersoy, Reyhan; Çakır, Bekir

2016-10-01

Primary hyperparathyroidism (PHP) is a common endocrine disease, and its most effective treatment is surgery. Postoperative hypocalcemia is a morbidity of parathyroid surgeries, and it may extend hospitalization durations. The purpose of this study is to determine the predictive factors related to the development of hypocalcemia and hungry bone syndrome (HBS) in patients who underwent parathyroidectomy for PHP. Laboratory data comprising parathyroid hormone (PTH), calcium, phosphate, 25-OHD, albumin, magnesium, alkaline phosphatase (ALP), blood urea nitrogen (BUN), and thyroid stimulating hormone (TSH) of the patients were recorded preoperatively, on the 1st and 4th days postoperatively, and in the 6th postoperative month, and their neck ultrasound (US) and bone densitometry data were also recorded. Hypocalcemia was seen in 63 patients (38.4%) on the 1st day after parathyroidectomy. Ten patients (6.1%) had permanent hypocalcemia in the 6th month after surgery. Out of the patients who underwent parathyroidectomy for PHP, 22 (13.4%) had HBS. The incidence of postoperative hypocalcemia was higher in patients who underwent parathyroidectomy for PHP, who had parathyroid hyperplasia, and who had osteoporosis. Preoperative PTH, ALP, and BUN values were higher in those patients who developed HBS. Furthermore, HBS was more common in patients who had osteoporosis, who had parathyroid hyperplasia, and who underwent thyroidectomy simultaneously with parathyroidectomy. As a result, patients who have the risk factors for development of hypocalcemia and HBS should be monitored more attentively during the perioperative period.

Is It Possible to Increase the Clinical Effectiveness of the Fracture Risk Assessment Tool in Osteopenia Patients by Taking Into Account Bone Mineral Density Values?

PubMed

Park, Jin-Sung; Lee, Jaewon; Park, Ye-Soo

2016-01-01

The study aimed to investigate the effectiveness of the clinical use of the Fracture Risk Assessment Tool (FRAX(®)) developed by the World Health Organization identifying patients at risk of osteoporotic fracture and to evaluate changes in osteoporotic fracture risk prediction according to bone mineral density (BMD) values. We identified the occurrence of osteoporotic fracture among patients whose BMD was measured in our hospital between April 2003 and March 2013. We then analyzed FRAX(®) scores obtained with or without BMD on the day before the occurrence of an osteoporotic fracture in actual osteoporotic fracture patients. According to the National Osteoporosis Foundation high-risk criteria, we identified the percentage of high-risk patients before the actual fracture. Among 445 osteoporotic fracture patients, when FRAX(®)-BMD was used, 281 patients (63%) were identified as high-risk before an actual osteoporotic fracture, and when FRAX(®) without BMD was used, 258 patients (58%) were identified (p = 0.115). In the 84 osteopenia patients, 39 patients (46.4%) were identified as high-risk when FRAX(®) without BMD was used, and 19 patients (22.6%) were identified when FRAX(®)-BMD was used (p = 0.001). The use of BMD in FRAX(®) does not seem to increase the clinical effectiveness of predicting osteoporotic fracture in osteopenia patients. Copyright © 2016 International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Factors in daily physical activity related to calcaneal mineral density in men.

PubMed

Hutchinson, T M; Whalen, R T; Cleek, T M; Vogel, J M; Arnaud, S B

1995-05-01

To determine the factors in daily physical activity that influence the mineral density of the calcaneus, we recorded walking steps and the type and duration of exercise in 43 healthy 26-to 51-yr-old men. Areal (g.cm-2) calcaneal bone mineral density (CBMD) was measured by single energy x-ray densitometry (SXA, Osteon, Inc., Wahiawa, HI). Subjects walked a mean (+/- SD) of 7902 (+/- 2534) steps per day or approximately 3.9 (+/- 1.2) miles daily. Eight subjects reported no exercise activities. The remaining 35 subjects spent 143 (2-772) (median and range) min.wk-1 exercising. Twenty-eight men engaged in exercise activities that generate single leg peak vertical ground reaction forces (GRFz) of 2 or more body weights (high loaders, HL), and 15 reported exercise or daily activities that typically generate GRFz less than 1.5 body weights (low loaders, LL). CBMD was 12% higher in HL than LL (0.668 +/- 0.074 g.cm-2 vs 0.597 +/- 0.062 g.cm-2, P < 0.004). In the HL group, CBMD correlated to reported minutes of high load exercise (r = 0.41, P < 0.03). CBMD was not related to the number of daily walking steps (N = 43, r = 0.03, NS). The results of this study support the concept that the dominant factor in daily physical activity relating to bone mineral density is the participation in site specific high loading activities, i.e., for the calcaneus, high calcaneal loads.

Factors in Daily Physical Activity Related to Calcaneal Mineral Density in Men

NASA Technical Reports Server (NTRS)

Hutchinson, Teresa M.; Whalen, Robert T.; Cleek, Tammy M.; Vogel, John M.; Arnaud, Sara B.

1995-01-01

To determine the factors in daily physical activity that influence the mineral density of the calcaneus, we recorded walking steps and the type and duration of exercise in 43 healthy 26-to 51-yr-old men. Areal (g/sq cm) calcaneal bone mineral density (CBMD) was measured by single energy x-ray densitometry. Subjects walked a mean (+/- SD) of 7902(+/-2534) steps per day or approximately 3.9(+/-1.2) miles daily. Eight subjects reported no exercise activities. The remaining 35 subjects spent 143(2-772) (median and range) min/wk exercising. Twenty-eight men engaged in exercise activities that generate single leg peak vertical ground reaction forces (GRF(sub z)) of 2 or more body weights (high loaders, HL), and 15 reported exercise or daily activities that typically generate GRF(sub z) less than 1.5 body weights (low loaders, LL). CBMD was 12% higher in HL than LL (0.668 +/- 0.074 g/sq cm vs 0.597 +/- 0.062 g/sq cm, P less than 0.004). In the HL group, CBMD correlated to reported minutes of high load exercise (r = 0.41, P less than 0.03). CBMD was not related to the number of daily walking steps (N = 43, r = 0.03, NS). The results of this study support the concept that the dominant factor in daily physical activity relating to bone mineral density is the participation in site specific high loading activities, i.e., for the calcaneus, high calcaneal loads.

Phenotype of sarcopenic obesity in older individuals with a history of falling.

PubMed

Huo, Ya Ruth; Suriyaarachchi, Pushpa; Gomez, Fernando; Curcio, Carmen L; Boersma, Derek; Gunawardene, Piumali; Demontiero, Oddom; Duque, Gustavo

2016-01-01

Although sarcopenic obesity is associated with disability in middle-aged community-dwelling individuals, the phenotype of sarcopenic obesity in people 65 and older, especially those with a history of falls, remain unknown. To fill this knowledge gap, the goal of this study was to obtain a comprehensive phenotype of sarcopenic obesity in this high-risk population. Cross-sectional study of 680 subjects (mean age=79±9, 65% female) assessed between 2009 and 2013 at the Falls and Fractures Clinic, Nepean Hospital (Penrith, Australia). The assessment included a comprehensive examination, posturography, gait velocity, grip strength, bone densitometry and body composition by DXA, and blood tests for biochemical status. Patients were divided into four groups based on DXA and clinical criteria: 1) sarcopenic obese; 2) non-sarcopenic obese; 3) sarcopenic and; 4) non-sarcopenic/non-obese. The difference between groups was assessed by one-way ANOVA, chi-square analysis, and multivariable linear regression. Sarcopenic obese subjects were older (81.1±7.3), mostly female and more likely to have lower bone mineral density, lower grip strength, slower gait velocity, and poor balance. Sarcopenic obese individuals also showed significantly higher parathyroid hormone and lower vitamin D. We identified a particular set of clinical and biochemical characteristics in our subgroup of sarcopenic obese older fallers. Identification of these particular characteristics in the clinical setting is essential in order to prevent poor outcomes in this high-risk population. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Shell bone histology of the long-necked chelid Yaminuechelys (Testudines: Pleurodira) from the late Cretaceous—early Palaeocene of Patagonia with comments on the histogenesis of bone ornamentation

NASA Astrophysics Data System (ADS)

Jannello, Juan Marcos; Cerda, Ignacio A.; de la Fuente, Marcelo S.

2016-04-01

Yaminuechelys is a long-necked chelid turtle whose remains have been recovered from outcrops of the Santonian-Maastrichtian and Danian of South America. With the purpose of providing data about shell sculpturing origin and palaeoecology, the bone histology of several shell elements (including neural, costal, peripheral and plastral plates) of Yaminuechelys is described herein. Histological analysis reveals that Yaminuechelys shares with Chelidae the presence of interwoven structural fibre bundles in the external cortex, and parallel-fibred bone of the internal cortex. The presence of resorption lines in several samples indicates that the particular ornamentation of the external surfaces originated, at least in part, by focalized resorption and new bone deposition. This mechanism for ornamentation origin and maintenance is here described for the first time in a turtle. Compactness of the shell bones is consistent with an aquatic habitat, which supports previous hypothesis based on palaeoenvironmental and morphological data.

Bone Histology of a Kannemeyeriid Dicynodont Wadiasaurus: Palaeobiological Implications

NASA Astrophysics Data System (ADS)

Ray, Sanghamitra; Bandyopadhyay, Saswati; Appana, Ravi

Examination of the bone microstructure of several skeletal elements shows that the cortex comprises fibrolamellar bone tissue suggesting rapid osteogenesis and overall fast growth for Wadiasaurus, a kannemeyeriid dicynodont from India. Three distinct stages have been identified in the ontogeny of Wadiasaurus. In the juvenile stage, when up to 30% of adult size is attained, growth was fast and sustained, whereas in the sub-adult stage when up to 60% of adult size is attained, growth was fast but periodically interrupted as evident from the presence of growth marks. During the adult stage the bone microstructure is characterized by the presence of peripheral parallel-fibred bone that suggested considerable slowing down of growth, possibly with the onset of sexual maturity. A flexible and indeterminate growth strategy is proposed for Wadiasaurus. The cortical thickness (RBT) and the correspondingly low optimal k values of the various limb bones of Wadiasaurus were comparable with that of the land vertebrates such as Ceratotherium, suggesting that the limbs were selected for impact loading.

Control of bone and fat mass by oxytocin.

PubMed

Amri, Ez-Zoubir; Pisani, Didier F

2016-11-01

Osteoporosis and overweight/obesity constitute major worldwide public health burdens. Aging is associated with a decrease in hormonal secretion, lean mass and bone mass, and an increase in fat accumulation. It is established that both obesity and osteoporosis are affected by genetic and environmental factors, bone remodeling and adiposity are both regulated through the hypothalamus and sympathetic nervous system. Oxytocin (OT), belongs to the pituitary hormone family and regulates the function of peripheral target organs, its circulating levels decreased with age. Nowadays, it is well established that OT plays an important role in the control of bone and fat mass and their metabolism. Of note, OT and oxytocin receptor knock out mice develop bone defects and late-onset obesity. Thus OT emerges as a promising molecule in the treatment of osteoporosis and obesity as well as associated metabolic disorders such as type 2 diabetes and cardiovascular diseases. In this review, we will discuss findings regarding the OT effects on bone and fat mass.

Development and validation of a tool for identifying women with low bone mineral density and low-impact fractures: the São Paulo Osteoporosis Risk Index (SAPORI).

PubMed

Pinheiro, M M; Reis Neto, E T; Machado, F S; Omura, F; Szejnfeld, J; Szejnfeld, V L

2012-04-01

The performance of the São Paulo Osteoporosis Risk Index (SAPORI) was tested in 1,915 women from the original cohort, São Paulo Osteoporosis Study (SAPOS) (N = 4332). This new tool was able to identify women with low bone density (spine and hip) and low-impact fracture, with an area under the receiving operator curve (ROC) of 0.831, 0.724, and 0.689, respectively. A number of studies have demonstrated the clinical relevance of risk factors for identifying individuals at risk of fracture (Fx) and osteoporosis (OP). The SAPOS is an epidemiological study for the assessment of risk factors for Fx and low bone density in women from the community of the metropolitan area of São Paulo, Brazil. The aim of the present study was to develop and validate a tool for identifying women at higher risk for OP and low-impact Fx. A total of 4,332 pre-, peri-, and postmenopausal women were analyzed through a questionnaire addressing risk factors for OP and Fx. All of them performed bone densitometry at the lumbar spine and proximal femur (DPX NT, GE-Lunar). Following the identification of the main risk factors for OP and Fx through multivariate and logistic regression, respectively, the SAPORI was designed and subsequently validated on a second cohort of 1,915 women from the metropolitan community of São Paulo. The performance of this tool was assessed through ROC analysis. The main and significant risk factors associated with low bone density and low-impact Fx were low body weight, advanced age, Caucasian ethnicity, family history of hip Fx, current smoking, and chronic use of glucocorticosteroids. Hormonal replacement therapy and regular physical activity in the previous year played a protective role (p < 0.05). After the statistical adjustments, the SAPORI was able to identify women with low bone density (T-score ≤ -2 standard deviations) in the femur, with 91.4% sensitivity, 52% specificity, and an area under the ROC of 0.831 (p < 0.001). At the lumbar spine, the performance was similar (81.5% sensitivity, 50% specificity, and area under ROC of 0.724; p < 0.001). Regarding the identification of low-impact Fx, the sensitivity was 71%, the specificity was 52%, and the area under the ROC was 0.689 (p < 0.001). The SAPORI is a simple, useful, fast, practice, and valid tool for identifying women at higher risk for low bone density and osteoporotic fractures.

[Sufficiency with water-soluble vitamins and state of bone in pregnant women].

PubMed

Vrzhesinskaya, O A; Pereverzeva, O G; Gmoshinskaya, M V; Kodentsova, V M; Safronova, A I; Korosteleva, M M; Aleshina, I V; Fandeeva, T A

2015-01-01

Vitamin status and bone strength have been estimated in 91 pregnant women (29.3 ± 4.6 years old) from Moscow by non-invasive methods. Sufficiency with vitamins C, B2, B6 has been evaluated by morning urinary excretion of ascorbic acid, riboflavin and 4-piridoxic acid determined by visual titration and fluorimetric methods. The rate of bone resorption has been measured by the ratio of urinary calcium and creatinine, determined by complexometric titration and spectrophotometrically. The study of the bone strength has been conducted using an ultrasonic densitometer (the speed of the ultrasonic waves along the cortical layer). The lack of vitamin C was found in 20.4% .of the women surveyed, vitamin B2--in 27.4%. Vitamin B6 deficiency was detected most frequently (90%). Excretion of vitamins B2 and B6 in women in the third trimester of pregnancy was lower as compared with the women in the first and second trimester. In 53.3% of the women surveyed an increase in urinary excretion of calcium per creatinine has been observed. Excretion of group B vitamins (especially vitamin B6, 1.75 fold, p < 0.05) in women taking vitamin supplements was higher compared to non-taking vitamins that indicates the better sufficiency of the organism with these vitamins. Among women who took vitamin complexes, inadequate supply with water-soluble vitamins C, B2 and B6 was detected less frequently (the difference was significant for vitamin B2) than among women who did not intake vitamin complexes (in 11.9, 27.7 and 42.4% vs 16.1, 54.8 and 48.8 %). The rate of bone resorption (Ca/creatinine) in women taking vitamins was smaller (0.19 ± 0.09 vs 0.24 ± 0.14, p > 0.05). Ca/creatinine ratio was within normal range in 40% of women who intake vitamins, while in women not taking vitamins--only in 22.2%; this value exceeded the upper limit of norm in the rest. The strength of bone was broken in women in the second and third trimester of pregnancy, having worse supply of vitamins. The percentage of agreement of the results of osteopenia diagnosis assessment (ultrasound densitometry and urinary Ca/creatinine) was 42.2%. Thus, the conclusion has been confirmed that the evaluation of the status of bone is possible only basing on the results of determination of several parameters.