In vitro CPC retention and VSC adsorption by IPM oil droplets: possible mechanisms of action of a two phase mouthwash.

PubMed

Sterer, N; Slutzky, H; Kohavi, D; Matalon, S

2013-09-01

Two phase oil-water mouthwash has been previously shown to efficiently bind oral microorganisms, relying on their cell surface hydrophobicity. The aim of the present in vitro study was to test the cetylpyridinium chloride (CPC) retention and volatile sulfide compounds (VSCs) adsorption abilities of the oil droplets created by mixing of a two phase oil-water solution. VSC adsorption was assayed using a salivary incubation assay and garlic powder solutions, and demonstrated using microscopic sulfide assay. CPC retention was assayed by kinetic and endpoint measurement of Streptococcus salivarius outgrowth using microplate (ELISA) reader. Results showed that the isopropyl myristate (IPM) oil droplets in the two phase solutions were able to adsorb 68-80% of VSCs. CPC at a concentration of 0.05% was most affectively retained by the oil droplets showing a significantly increase in residual antibacterial activity against Streptococcus salivarius. These results taken together, suggests that VSC adsorption and CPC retention by IPM oil droplets may be two additional mechanisms in the activity of the two phase mouthwash formulation.

Quantitation of IgE antibody specific for ragweed and grass allergens: binding of radiolabeled allergens by solid-phase bond IgE

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zeiss, C.R.; Levitz, D.; Suszko, I.M.

1978-08-01

IgE antibody specific for multiple allergens extracted from grass and ragweed pollens was measured by radioimmunoassay. The assay depends on the interaction between IgE antibody bound to a polystyrene solid phase, /sup 125/I-labeled grass allergens (GA), and ragweed allergens (RW). The binding of /sup 125/I RW by serum IgE antibody from 37 allergic patients ranged from 0.2 ng to 75 ng RW protein (P) bound per ml. This binding of /sup 125/I RW by patient's IgE was paralleled by their IgE binding of /sup 125/I antigen E (AgE), a purified allergen from ragweed pollen (r = 0.90, p less thanmore » 0.001). Inhibition of patient's IgE binding of /sup 125/I RW by highly purified AgE ranged from 25 to 85% indicated individual differences in patient's IgE response to inhaled ragweed pollen. The binding of /sup 125/I GA by serum IgE antibody from 7 grass-sensitive patients ranged from 0.6 ng GA P bound per ml to 15 ng. This assay should be useful in the study of IgE responses to environmental agents containing multiple allergens and has the advantage that other antibody classes cannot interfere with the interaction between IgE antibody and labeled allergens.« less

Due diligence in the characterization of matrix effects in a total IL-13 Singulex™ method.

PubMed

Fraser, Stephanie; Soderstrom, Catherine

2014-04-01

After obtaining her PhD in Cellular and Molecular biology from the University of Nevada, Reno, Stephanie has spent the last 15 years in the field of bioanalysis. She has held positions in academia, biotech, contract research and large pharma where she has managed ligand binding assay (discovery to Phase IIb clinical) and flow cytometry (preclinical) laboratories as well as taken the lead on implementing new/emergent technologies. Currently Stephanie leads Pfizer's Regulated Bioanalysis Ligand Binding Assay group, focusing on early clinical biomarker support. Interleukin (IL)-13, a Th2 cytokine, drives a range of physiological responses associated with the induction of allergic airway diseases and inflammatory bowel diseases. Analysis of IL-13 as a biomarker has provided insight into its role in disease mechanisms and progression. Serum IL-13 concentrations are often too low to be measured by standard enzyme-linked immunosorbent assay techniques, necessitating the implementation of a highly sensitive assay. Previously, the validation of a Singulex™ Erenna(®) assay for the quantitation of IL-13 was reported. Herein we describe refinement of this validation; defining the impact of matrix interference on the lower limit of quantification, adding spiked matrix QC samples, and extending endogenous IL-13 stability. A fit-for-purpose validation was conducted and the assay was used to support a Phase II clinical trial.

Relative Impact of Incorporating Pharmacokinetics on Predicting In Vivo Hazard and Mode of Action from High-Throughput In Vitro Toxicity Assays

EPA Science Inventory

The use of high-throughput in vitro assays has been proposed to play a significant role in the future of toxicity testing. In this study, rat hepatic metabolic clearance and plasma protein binding were measured for 59 ToxCast phase I chemicals. Computational in vitro-to-in vivo e...

First 25-hydroxyvitamin D assay for general chemistry analyzers.

PubMed

Saida, Fakhri B; Chen, Xiaoru; Tran, Kiet; Dou, Chao; Yuan, Chong

2015-03-01

25-Hydroxyvitamin D [25(OH)D], the predominant circulating form of vitamin D, is an accurate indicator of the general vitamin D status of an individual. Because vitamin D deficiencies have been linked to several pathologies (including osteoporosis and rickets), accurate monitoring of 25(OH)D levels is becoming increasingly important in clinical settings. Current 25(OH)D assays are either chromatographic or immunoassay-based assays. These assays include HPLC, liquid chromatography-tandem mass spectrometry (LC-MS/MS), enzyme-immunosorbent, immunochemiluminescence, immunofluorescence and radioimmunoassay. All these assays use heterogeneous formats that require phase separation and special instrumentations. In this article, we present an overview of these assays and introduce the first homogeneous assay of 25(OH)D for use on general chemistry analyzers. A special emphasis is put on the unique challenges posed by the 25(OH)D analyte. These challenges include a low detection limit, the dissociation of the analyte from its serum transporter and the inactivation of various binding proteins without phase separation steps.

Preparation of milk samples for immunoassay and liquid chromatographic screening using matrix solid-phase dispersion.

PubMed

Barker, S A; Long, A R

1994-01-01

The use of drugs to maintain the health and maximize the output of dairy cattle has made the monitoring of milk for such agents essential. Screening tests based on immunological, microbial inhibition, and bacterial receptor assays have been developed for the detection of violative levels of therapeutic substances. However, such assays are not infallible, and false positive or negative results can occur when contaminants bind receptors or compete for the binding of the target residues. Such effects may arise from dietary sources, diseases, or other variables. Thus, a violation by such a test is not definitive until further confirmation is obtained. Our laboratory has developed extraction procedures for several drugs used in dairy production. Our method uses matrix solid-phase dispersion (MSPD) to isolate drugs away from contaminants and to eliminate many possible interferences. MSPD can also be used to enhance the specificity of such assays by fractionating various classes of drugs that may cross-react. Similarly, such methods may be used for liquid chromatographic screening and confirmation of a suspect sample.

An enzyme immunoassay for rat growth hormone - Applications to the study of growth hormone variants

NASA Technical Reports Server (NTRS)

Farrington, Marianne A.; Hymer, W. C.

1987-01-01

A sensitive and specific competitive enzyme immunoassay for rat growth hormone (GH) is described and its use in the detection of GH variants is demonstrated. In the present assay, soluble GH and GH adsorbed to a solid-phase support compete for monkey anti-GH antibody binding sites. The immobilized antibody-GH complex is detected and quantified using goat antimonkey immunoglobin G covalently conjugated to horseradish peroxidase. It is noted that the assay can be performed in 27 hours and that sensitivities in the range of 0.19 to 25 ng can be obtained in the region of 10 to 90 percent binding.

A comparison of sperm agglutination and immobilization assays with a quantitative ELISA for anti-sperm antibody in serum.

PubMed

Lynch, D M; Leali, B A; Howe, S E

1986-08-01

An enzyme-linked immunosorbent assay (ELISA) that quantitates antisperm antibody in serum was compared with standard sperm agglutination and immobilization assays with the use of sera from 40 normal and 292 subfertile individuals. Quantitation of the assay was accomplished by standardizing assay parameters, including the incorporation of a standard reference curve, the number of whole target sperm, the optimal dilution of serum, the selection of microtiter plate, and the time and temperatures involved in the adsorption and incubation phases. With this method, the level of antisperm antibody binding to target sperm in 40 normal fertile individuals was found to be 2.3 (+/- 1.1 standard deviation [SD]) fg immunoglobulin (Ig)/sperm. An increased mean level of 7.4 +/- 3.7 fg Ig/sperm was determined in 84 infertile patients with positive agglutination and/or immobilization tests. In 208 individuals with negative agglutination and immobilization tests the mean concentration of antisperm antibody was 2.5 +/- 1.3 fg Ig/sperm. Postvasectomy patients assayed by this method had a mean Ig binding value of 7.1 +/- 2.4 fg Ig/sperm. The infertile group with positive agglutination and/or immobilization tests had a significantly higher mean antisperm antibody level than the normal fertile group, according to the Student's t-test for independent samples (P less than 0.001). This indirect serum-based assay reproducibly quantitates antisperm antibody binding to whole target sperm, suggests the normal and abnormal levels of antisperm antibody, and correlates with standard functional assays.

Phosphatidylserine recognition and induction of apoptotic cell clearance by Drosophila engulfment receptor Draper.

PubMed

Tung, Tran Thanh; Nagaosa, Kaz; Fujita, Yu; Kita, Asana; Mori, Hiroki; Okada, Ryo; Nonaka, Saori; Nakanishi, Yoshinobu

2013-05-01

The membrane phospholipid phosphatidylserine is exposed on the cell surface during apoptosis and acts as an eat-me signal in the phagocytosis of apoptotic cells in mammals and nematodes. However, whether this is also true in insects was unclear. When milk fat globule-epidermal growth factor 8, a phosphatidylserine-binding protein of mammals, was ectopically expressed in Drosophila, the level of phagocytosis was reduced, whereas this was not the case for the same protein lacking a domain responsible for the binding to phosphatidylserine. We found that the extracellular region of Draper, an engulfment receptor of Drosophila, binds to phosphatidylserine in an enzyme-linked immunosorbent assay-like solid-phase assay and in an assay for surface plasmon resonance. A portion of Draper containing domains EMI and NIM located close to the N-terminus was required for binding to phosphatidylserine, and a Draper protein lacking this region was not active in Drosophila. Finally, the level of tyrosine-phosphorylated Draper, indicative of the activation of Draper, in a hemocyte-derived cell line was increased after treatment with phosphatidylserine-containing liposome. These results indicated that phosphatidylserine serves as an eat-me signal in the phagocytic removal of apoptotic cells in Drosophila and that Draper is a phosphatidylserine-binding receptor for phagocytosis.

Mouse pharmacokinetics and metabolism of the curcumin analog, 4-piperidinone,3,5-bis[(2-fluorophenyl)methylene]-acetate(3E,5E) (EF-24; NSC 716993).

PubMed

Reid, Joel M; Buhrow, Sarah A; Gilbert, Judith A; Jia, Lee; Shoji, Mamoru; Snyder, James P; Ames, Matthew M

2014-06-01

Curcumin, a keto-enol constituent of turmeric, has in vitro and in vivo antitumor activity. However, in vivo potency is low due to poor oral absorption. The mono-carbonyl analog, 3,5-bis[(2-fluorophenyl)methylene]-4-piperidinone acetate (EF-24, NSC 716993), exhibited broad-spectrum activity in the NCI anticancer cell line screen and potent antiangiogenesis activity in a HUVEC cell migration assay. The purpose of this study was to characterize the preclinical pharmacology of EF-24 in mice. EF-24 plasma stability, protein binding, pharmacokinetics, and metabolism were characterized utilizing an LC/MS/MS assay. An LC/MS/MS assay incorporated protein precipitation with methanol, reverse-phase HPLC separation under gradient elution using an aqueous methanol mobile phase containing 0.1 % formic acid, and positive electrospray ionization detection of the m/z 312 > 149 transition for EF-24. The assay was linear over the range 7.8-1,000 nM. Plasma protein binding was >98 % with preferential binding to albumin. EF-24 plasma disposition in mice after i.v. administration of a 10 mg/kg dose was best fit to a 3-compartment open model. The terminal elimination half-life and plasma clearance values were 73.6 min and 0.482 L/min/kg, respectively. EF-24 bioavailability was 60 and 35 % after oral and i.p. administration, respectively. NADPH-dependent metabolism of EF-24 loss in liver microsomal preparations yielded several metabolites consistent with EF-24 hydroxylation and reduction.

Mouse pharmacokinetics and metabolism of the curcumin analog, 4-Piperidione,3,5-bis[(2-fluorophenyl)methylene]-acetate(3E,5E) (EF-24; NSC 716993)

PubMed Central

Reid, Joel M.; Buhrow, Sarah A.; Gilbert, Judith A.; Jia, Lee; Shoji, Mamoru; Snyder, James P.; Ames, Matthew M.

2015-01-01

Purpose Curcumin, a keto-enol constituent of turmeric, has in vitro and in vivo antitumor activity. However, in vivo potency is low due to poor oral absorption. The mono-carbonyl analog, 3,5-bis[(2-fluorophenyl)methylene]-4-piperidinone acetate (EF-24, NSC 716993), exhibited broad spectrum activity in the NCI anti-cancer cell line screen and potent anti-angiogenesis activity in a HUVEC cell migration assay. The purpose of this study was to characterize the preclinical pharmacology of EF-24 in mice. Methods EF-24 plasma stability, protein binding, pharmacokinetics and metabolism were characterized utilizing an LC/MS/MS assay. Results An LC/MS/MS assay that incorporated protein precipitation with methanol, reverse-phase HPLC separation under gradient elution using an aqueous methanol mobile phase containing 0.1% formic acid and positive electrospray ionization detection of the m/z 312 > 149 transition for EF-24. The assay was linear over the range 7.8-1000 nM. Plasma protein binding was > 98% with preferential binding to albumin. EF-24 plasma disposition in mice after i.v. administration of a 10 mg/kg dose was best fit to a 3-compartment open model. The terminal elimination half-life and plasma clearance values were 73.6 min and 0.482 L/min/kg, respectively. EF-24 bioavailability was 60% and 35% after oral and i.p. administration, respectively. NADPH-dependent metabolism of EF-24 loss in liver microsomal preparations yielded several metabolites consistent with EF-24 hydroxylation and reduction. PMID:24760417

Novel enzyme-linked immunosorbent assay for determination of fluvastatin in plasma at picogram level.

PubMed

Darwish, Ibrahim A; Al-Obaid, Abdul-Rahman M; Al-Malaq, Hamoud A

2009-11-15

For the first time, an enzyme-linked immunosorbent assay (ELISA) has been developed and validated for the determination of fluvastatin (FLV) in plasma samples at picogram level. The assay employed a polyclonal antibody that specifically recognizes FLV with high affinity, and FLV conjugate of bovine serum albumin (FLV-BSA) immobilized onto microplate wells as a solid-phase. The assay involved a competitive binding reaction between FLV, in plasma sample, and the immobilized FLV-BSA for the binding sites on a limited amount of the anti-FLV antibody. The bound anti-FLV antibody was quantified with horseradish peroxidase-labeled second anti-rabbit IgG antibody (HRP-IgG) and 3,3',5,5'-tetramethylbenzidine (TMB) as a substrate for the peroxidase enzyme. The concentration of FLV in the sample was quantified by its ability to inhibit the binding of the anti-FLV antibody to the immobilized FLV-BSA and subsequently the color intensity in the assay wells. The conditions for the proposed ELISA were investigated and the optimum conditions were employed in the determination of FLV in plasma samples. The assay limit of detection was 10 pg mL(-1) and the effective working range at relative standard deviations (RSD) of

Synthesis and binding studies of Alzheimer ligands on solid support.

PubMed

Rzepecki, Petra; Geib, Nina; Peifer, Manuel; Biesemeier, Frank; Schrader, Thomas

2007-05-11

Aminopyrazole derivatives constitute the first class of nonpeptidic rationally designed beta-sheet ligands. Here we describe a double solid-phase protocol for both synthesis and affinity testing. The presented solid-phase synthesis of four types of hybrid compounds relies on the Fmoc strategy and circumvents subsequent HPLC purification by precipitating the final product from organic solution in pure form. Hexa- and octapeptide pendants with internal di- and tetrapeptide bridges are now amenable in high yields to combinatorial synthesis of compound libraries for high-throughput screening purposes. Solid-phase peptide synthesis (SPPS) on an acid-resistant PAM allows us, after PMB deprotection, to subject the free aminopyrazole binding sites in an immobilized state to on-bead assays with fluorescence-labeled peptides. From the fluorescence emission intensity decrease, individual binding constants can be calculated via reference curves by simple application of the law of mass action. Gratifyingly, host/guest complexation can be monitored quantitatively even for those ligands, which are almost insoluble in water.

Basal cell adhesion molecule/lutheran protein. The receptor critical for sickle cell adhesion to laminin.

PubMed Central

Udani, M; Zen, Q; Cottman, M; Leonard, N; Jefferson, S; Daymont, C; Truskey, G; Telen, M J

1998-01-01

Sickle red cells bind significant amounts of soluble laminin, whereas normal red cells do not. Solid phase assays demonstrate that B-CAM/LU binds laminin on intact sickle red cells and that red cell B-CAM/LU binds immobilized laminin, whereas another putative laminin binding protein, CD44, does not. Ligand blots also identify B-CAM/LU as the only erythrocyte membrane protein(s) that binds laminin. Finally, transfection of murine erythroleukemia cells with human B-CAM cDNA induces binding of both soluble and immobilized laminin. Thus, B-CAM/LU appears to be the major laminin-binding protein of sickle red cells. Previously reported overexpression of B-CAM/LU by epithelial cancer cells suggests that this protein may also serve as a laminin receptor in malignant tumors. PMID:9616226

Different Results of IgE Binding- and Crosslinking-Based Allergy Tests Caused by Allergen Immobilization.

PubMed

Okamoto-Uchida, Yoshimi; Nakamura, Ryosuke; Matsuzawa, Yumiko; Soma, Megumi; Kawakami, Hiroshi; Ishii-Watabe, Akiko; Nishimaki-Mogami, Tomoko; Teshima, Reiko; Saito, Yoshiro

2016-01-01

The physicochemical nature of allergen molecules differ from the liquid phase to the solid phase. However, conventional allergy tests are based on the detection of immunoglobulin (Ig)E binding to immobilized allergens. We recently developed an in vitro allergy testing method using a luciferase-reporting humanized rat mast cell line to detect IgE crosslinking-induced luciferase expression (EXiLE test). The aim of the present study was to evaluate the effects of antigen immobilization on the results of different in vitro allergy tests using two anti-ovalbumin (OVA) antibodies (Abs), E-C1 and E-G5, with different properties in the OVA-induced allergic reaction. Both Abs showed clear binding to OVA with an enzyme-linked immunosorbent assay and by BIAcore analysis. However, only E-C1 potentiated EXiLE response for the liquid-phase OVA. On the other hand, OVA immobilized on solid-phase induced EXiLE responses in both E-C1 Ab- and E-G5 Ab-sensitized mast cells. Western blotting of OVA indicated that E-C1 Ab binds both to OVA monomers and dimers, unlike E-G5 Ab, which probably binds only to the OVA dimer. These results suggest that antigen immobilization enhanced IgE crosslinking ability through multimerization of allergen molecules in the solid phase, resulting in an increase in false positives in IgE binding-based conventional in vitro allergy tests. These findings shed light on the physicochemical nature of antigens as an important factor for the development and evaluation of in vitro allergy tests and suggest that mast cell activation-based allergy testing with liquid-phase allergens is a promising strategy to evaluate the physiological interactions of IgE and allergens.

Analysis of Ethylene Receptors: Ethylene-Binding Assays.

PubMed

Binder, Brad M; Schaller, G Eric

2017-01-01

Plant ethylene receptors bind ethylene with high affinity. Most of the characterization of ethylene binding to the receptors has been carried out using a radioligand-binding assay on functional receptors expressed in yeast. In this chapter, we describe methods for expressing ethylene receptors in yeast and conducting ethylene-binding assays on intact yeast and yeast membranes. The ethylene-binding assays can be modified to analyze ethylene binding to intact plants and other organisms as well as membranes isolated from any biological source.

CFS-1686 causes cell cycle arrest at intra-S phase by interference of interaction of topoisomerase 1 with DNA.

PubMed

Lin, Ru-Wei; Yang, Chia-Ning; Ku, ShengYu; Ho, Cheng-Jung; Huang, Shih-Bo; Yang, Min-Chi; Chang, Hsin-Wen; Lin, Chun-Mao; Hwang, Jaulang; Chen, Yeh-Long; Tzeng, Cherg-Chyi; Wang, Chihuei

2014-01-01

CFS-1686 (chemical name (E)-N-(2-(diethylamino)ethyl)-4-(2-(2-(5-nitrofuran-2-yl)vinyl)quinolin-4-ylamino)benzamide) inhibits cell proliferation and triggers late apoptosis in prostate cancer cell lines. Comparing the effect of CFS-1686 on cell cycle progression with the topoisomerase 1 inhibitor camptothecin revealed that CFS-1686 and camptothecin reduced DNA synthesis in S-phase, resulting in cell cycle arrest at the intra-S phase and G1-S boundary, respectively. The DNA damage in CFS-1686 and camptothecin treated cells was evaluated by the level of ATM phosphorylation, γH2AX, and γH2AX foci, showing that camptothecin was more effective than CFS-1686. However, despite its lower DNA damage capacity, CFS-1686 demonstrated 4-fold higher inhibition of topoisomerase 1 than camptothecin in a DNA relaxation assay. Unlike camptothecin, CFS-1686 demonstrated no activity on topoisomerase 1 in a DNA cleavage assay, but nevertheless it reduced the camptothecin-induced DNA cleavage of topoisomerase 1 in a dose-dependent manner. Our results indicate that CFS-1686 might bind to topoisomerase 1 to inhibit this enzyme from interacting with DNA relaxation activity, unlike campothecin's induction of a topoisomerase 1-DNA cleavage complex. Finally, we used a computer docking strategy to localize the potential binding site of CFS-1686 to topoisomerase 1, further indicating that CFS-1686 might inhibit the binding of Top1 to DNA.

Monoclonal antibodies to human vitamin D-binding protein.

PubMed Central

Pierce, E A; Dame, M C; Bouillon, R; Van Baelen, H; DeLuca, H F

1985-01-01

Monoclonal antibodies to vitamin D-binding protein isolated from human serum have been produced. The antibodies obtained have been shown to be specific for human vitamin D-binding protein by three independent assays. The antibodies recognize human vitamin D-binding protein specifically in an enzyme-linked immunosorbent assay. Human vitamin D-binding protein is detected specifically in both pure and crude samples by a radiometric immunosorbent assay (RISA) and by an immunoprecipitation assay. The anti-human vitamin D-binding protein antibodies cross-react with monkey and pig vitamin D-binding protein, but not with vitamin D-binding protein from rat, mouse, or chicken, as determined by the RISA and immunoprecipitation assays. Images PMID:3936035

On optimizing the blocking step of indirect enzyme-linked immunosorbent assay for Epstein-Barr virus serology.

PubMed

Lim, Chun Shen; Krishnan, Gopala; Sam, Choon Kook; Ng, Ching Ching

2013-01-16

Because blocking agent occupies most binding surface of a solid phase, its ability to prevent nonspecific binding determines the signal-to-noise ratio (SNR) and reliability of an enzyme-linked immunosorbent assay (ELISA). We demonstrate a stepwise approach to seek a compatible blocking buffer for indirect ELISA, via a case-control study (n=176) of Epstein-Barr virus (EBV)-associated nasopharyngeal carcinoma (NPC). Regardless of case-control status, we found that synthetic polymer blocking agents, mainly Ficoll and poly(vinyl alcohol) (PVA) were able to provide homogeneous backgrounds among samples, as opposed to commonly used blocking agents, notably nonfat dry milk (NFDM). The SNRs for NPC samples that correspond to blocking using PVA were approximately 3-fold, on average, higher than those blocking using NFDM. Both intra- and inter-assay precisions of PVA-based assays were <14%. A blocking agent of choice should have tolerable sample backgrounds from both cases and controls to ensure the reliability of an immunoassay. Copyright © 2012 Elsevier B.V. All rights reserved.

A Link between ORC-Origin Binding Mechanisms and Origin Activation Time Revealed in Budding Yeast

PubMed Central

Hoggard, Timothy; Shor, Erika; Müller, Carolin A.; Nieduszynski, Conrad A.; Fox, Catherine A.

2013-01-01

Eukaryotic DNA replication origins are selected in G1-phase when the origin recognition complex (ORC) binds chromosomal positions and triggers molecular events culminating in the initiation of DNA replication (a.k.a. origin firing) during S-phase. Each chromosome uses multiple origins for its duplication, and each origin fires at a characteristic time during S-phase, creating a cell-type specific genome replication pattern relevant to differentiation and genome stability. It is unclear whether ORC-origin interactions are relevant to origin activation time. We applied a novel genome-wide strategy to classify origins in the model eukaryote Saccharomyces cerevisiae based on the types of molecular interactions used for ORC-origin binding. Specifically, origins were classified as DNA-dependent when the strength of ORC-origin binding in vivo could be explained by the affinity of ORC for origin DNA in vitro, and, conversely, as ‘chromatin-dependent’ when the ORC-DNA interaction in vitro was insufficient to explain the strength of ORC-origin binding in vivo. These two origin classes differed in terms of nucleosome architecture and dependence on origin-flanking sequences in plasmid replication assays, consistent with local features of chromatin promoting ORC binding at ‘chromatin-dependent’ origins. Finally, the ‘chromatin-dependent’ class was enriched for origins that fire early in S-phase, while the DNA-dependent class was enriched for later firing origins. Conversely, the latest firing origins showed a positive association with the ORC-origin DNA paradigm for normal levels of ORC binding, whereas the earliest firing origins did not. These data reveal a novel association between ORC-origin binding mechanisms and the regulation of origin activation time. PMID:24068963

A novel DNA/histone H4 peptide complex detects autoantibodies in systemic lupus erythematosus sera.

PubMed

Panza, Filomena; Alcaro, Maria Claudia; Petrelli, Fiorella; Angelotti, Francesca; Pratesi, Federico; Rovero, Paolo; Migliorini, Paola

2016-10-04

The detection of anti-dsDNA antibodies is critical for the diagnosis and follow-up of systemic lupus erythematosus (SLE) patients. The presently available assays are characterized by a non-optimal specificity (solid phase assays) or sensitivity (Crithidia Luciliae immunofluorescence test (CLIFT)). To overcome the limits of CLIFT and solid phase chromatin assays, we explored the diagnostic potential of an assay based on plasmid DNA containing a highly bent fragment of 211 bp from Crithidia Luciliae minicircles, complexed with histone peptides. Electrically neutral complexes of PK201/CAT plasmid (PK) DNA and histone 4 (H4) peptides were evaluated by electromobility shift assay. Complexes of H4 peptides and PK were absorbed to the solid phase to detect specific immunoglobulin G (IgG) in sera. Sera from 109 SLE patients, 100 normal healthy subjects, and 169 disease controls were tested. H4(14-34) containing the consensus sequence for DNA binding interacts with PK, retarding its migration. H4(14-34)/PK complexes were used to test sera by ELISA. Anti-H4-PK antibodies were detected in 56 % of SLE sera (more frequently in patients with skin or joint involvement) versus 5.9 % in disease controls; inhibition assays show that sera react with epitopes present on DNA or on the complex, not on the peptide. Antibody titer is correlated with European Consensus Lupus Activity Measurement (ECLAM) score and anti-complement component 1q (C1q) antibodies, negatively with C3 levels. Anti-H4-PK antibodies compared with CLIFT and solid phase dsDNA assays display moderate concordance. The H4/PK assay is a simple and reliable test which is useful for the differential diagnosis and evaluation of disease activity in SLE patients.

Rosette Assay: Highly Customizable Dot-Blot for SH2 Domain Screening.

PubMed

Ng, Khong Y; Machida, Kazuya

2017-01-01

With a growing number of high-throughput studies, structural analyses, and availability of protein-protein interaction databases, it is now possible to apply web-based prediction tools to SH2 domain-interactions. However, in silico prediction is not always reliable and requires experimental validation. Rosette assay is a dot blot-based reverse-phase assay developed for the assessment of binding between SH2 domains and their ligands. It is conveniently customizable, allowing for low- to high-throughput analysis of interactions between various numbers of SH2 domains and their ligands, e.g., short peptides, purified proteins, and cell lysates. The binding assay is performed in a 96-well plate (MBA or MWA apparatus) in which a sample spotted membrane is incubated with up to 96 labeled SH2 domains. Bound domains are detected and quantified using a chemiluminescence or near-infrared fluorescence (IR) imaging system. In this chapter, we describe a practical protocol for rosette assay to assess interactions between synthesized tyrosine phosphorylated peptides and a library of GST-tagged SH2 domains. Since the methodology is not confined to assessment of SH2-pTyr interactions, rosette assay can be broadly utilized for ligand and drug screening using different protein interaction domains or antibodies.

Functional assignment of solute-binding proteins of ABC transporters using a fluorescence-based thermal shift assay.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Giulliani, S. E.; Frank, A. E.; Collart, F. R.

2008-12-08

We have used a fluorescence-based thermal shift (FTS) assay to identify amino acids that bind to solute-binding proteins in the bacterial ABC transporter family. The assay was validated with a set of six proteins with known binding specificity and was consistently able to map proteins with their known binding ligands. The assay also identified additional candidate binding ligands for several of the amino acid-binding proteins in the validation set. We extended this approach to additional targets and demonstrated the ability of the FTS assay to unambiguously identify preferential binding for several homologues of amino acid-binding proteins with known specificity andmore » to functionally annotate proteins of unknown binding specificity. The assay is implemented in a microwell plate format and provides a rapid approach to validate an anticipated function or to screen proteins of unknown function. The ABC-type transporter family is ubiquitous and transports a variety of biological compounds, but the current annotation of the ligand-binding proteins is limited to mostly generic descriptions of function. The results illustrate the feasibility of the FTS assay to improve the functional annotation of binding proteins associated with ABC-type transporters and suggest this approach that can also be extended to other protein families.« less

Simultaneous Multiple MS Binding Assays Addressing D1 and D2 Dopamine Receptors.

PubMed

Schuller, Marion; Höfner, Georg; Wanner, Klaus T

2017-10-09

MS Binding Assays are a label-free alternative to radioligand binding assays. They provide basically the same capabilities as the latter, but use a non-labeled reporter ligand instead of a radioligand. In contrast to radioligand binding assays, MS Binding Assays offer-owing to the selectivity of mass spectrometric detection-the opportunity to monitor the binding of different reporter ligands at different targets simultaneously. The present study shows a proof of concept for this strategy as exemplified for MS Binding Assays selectively addressing D 1 and D 2 dopamine receptors in a single binding experiment. A highly sensitive, rapid and robust LC-ESI-MS/MS quantification method capable of quantifying both SCH23390 and raclopride, selectively addressing D 1 and D 2 receptors, respectively, was established and validated for this purpose. Based thereon, simultaneous saturation and competition experiments with SCH23390 and raclopride in the presence of both D 1 and D 2 receptors were performed and analyzed by LC-MS/MS within a single chromatographic cycle. The present study thus demonstrates the feasibility of this strategy and the high versatility of MS Binding Assays that appears to surpass that common for conventional radioligand binding assays. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Clostridial toxins active locally in the gastrointestinal tract.

PubMed

Wilkins, T; Krivan, H; Stiles, B; Carman, R; Lyerly, D

1985-01-01

Clostridium difficile and Clostridium spiroforme have only in recent years been recognized as intestinal pathogens. They both produce toxins that are also produced by other clostridia. C. difficile toxins A and B are produced by C. sordellii and a few strains of C. perfringens whereas C. spiroforme produces the same toxins as C. perfringens Type E (iota toxin). Iota toxin activity may be the product of two proteins. Toxigenic strains of C. spiroforme and Type E produce two antigens which possess much more biological activity when administered together than when given alone. C. difficile was thought for some time to produce only a single toxin, but then the enterotoxic activity was shown to be due to a separate toxin (toxin A). This toxin increases the oral toxicity of toxin B (the main cytotoxin) and may increase the permeability of the colon. Toxin A binds to a specific receptor in hamster brush border membranes and in the membranes of rabbit erythrocytes. This receptor appears to be a glycoprotein. The receptor can be extracted from the membrane with Triton and binds to immobilized toxin A. The receptor can be extracted and used to coat plastic plates as a first phase in an ELISA assay. Another assay has been developed in which the toxin A binds to the red cells and then the erythrocytes are agglutinated with antitoxin. An even more sensitive assay consists of using rabbit erythrocyte ghosts to bind the toxin and then precipitating the ghosts with antibody to toxin A attached to latex beads. Monoclonal antibodies to toxin A also have been developed and are used in these and other assays.

Structure–activity relationships for the binding of polymyxins with human α-1-acid glycoprotein

PubMed Central

Azad, Mohammad A.K.; Huang, Johnny X.; Cooper, Matthew A.; Roberts, Kade D.; Thompson, Philip E.; Nation, Roger L.; Li, Jian; Velkov, Tony

2012-01-01

Here, for the first time, we have characterized binding properties of the polymyxin class of antibiotics for human α-1-acid glycoprotein (AGP) using a combination of biophysical techniques. The binding affinity of colistin, polymyxin B, polymyxin B3, colistin methansulfonate, and colistin nona-peptide was determined by isothermal titration calorimetry (ITC), surface plasma resonance (SPR) and fluorometric assay methods. All assay techniques indicated colistin, polymyxin B and polymyxin B3 display a moderate binding affinity for AGP. ITC and SPR showed there was no detectable binding affinity for colistin methansulfonate and colistin nona-peptide, suggesting both the positive charges of the diaminobutyric acid (Dab) side chains and the N-terminal fatty acyl chain of the polymyxin molecule are required to drive binding to AGP. In addition, the ITC and fluorometric data suggested that endogenous lipidic substances bound to AGP provide part of the polymyxin binding surface. A molecular model of the polymyxin B3–AGP F1*S complex was presented that illustrates the pivotal role of the N-terminal fatty acyl chain and the D-Phe6-L-Leu7 hydrophobic motif of polymyxin B3 for binding to the cleft-like ligand binding cavity of AGP F1*S variant. The model conforms with the entropy driven binding interaction characterized by ITC which suggests hydrophobic interactions coupled to desolvation events and conformational changes are the primary driving force for polymyxins binding to AGP. Collectively, the data are consistent with a role of this acute-phase reactant protein in the transport of polymyxins in plasma. PMID:22587817

A Chrysin Derivative Suppresses Skin Cancer Growth by Inhibiting Cyclin-dependent Kinases*

PubMed Central

Liu, Haidan; Liu, Kangdong; Huang, Zunnan; Park, Chan-Mi; Thimmegowda, N. R.; Jang, Jae-Hyuk; Ryoo, In-Ja; He, Long; Kim, Sun-Ok; Oi, Naomi; Lee, Ki Won; Soung, Nak-Kyun; Bode, Ann M.; Yang, Yifeng; Zhou, Xinmin; Erikson, Raymond L.; Ahn, Jong-Seog; Hwang, Joonsung; Kim, Kyoon Eon; Dong, Zigang; Kim, Bo-Yeon

2013-01-01

Chrysin (5,7-dihydroxyflavone), a natural flavonoid widely distributed in plants, reportedly has chemopreventive properties against various cancers. However, the anticancer activity of chrysin observed in in vivo studies has been disappointing. Here, we report that a chrysin derivative, referred to as compound 69407, more strongly inhibited EGF-induced neoplastic transformation of JB6 P+ cells compared with chrysin. It attenuated cell cycle progression of EGF-stimulated cells at the G1 phase and inhibited the G1/S transition. It caused loss of retinoblastoma phosphorylation at both Ser-795 and Ser-807/811, the preferred sites phosphorylated by Cdk4/6 and Cdk2, respectively. It also suppressed anchorage-dependent and -independent growth of A431 human epidermoid carcinoma cells. Compound 69407 reduced tumor growth in the A431 mouse xenograft model and retinoblastoma phosphorylation at Ser-795 and Ser-807/811. Immunoprecipitation kinase assay results showed that compound 69407 attenuated endogenous Cdk4 and Cdk2 kinase activities in EGF-stimulated JB6 P+ cells. Pulldown and in vitro kinase assay results indicated that compound 69407 directly binds with Cdk2 and Cdk4 in an ATP-independent manner and inhibited their kinase activities. A binding model between compound 69407 and a crystal structure of Cdk2 predicted that compound 69407 was located inside the Cdk2 allosteric binding site. The binding was further verified by a point mutation binding assay. Overall results indicated that compound 69407 is an ATP-noncompetitive cyclin-dependent kinase inhibitor with anti-tumor effects, which acts by binding inside the Cdk2 allosteric pocket. This study provides new insights for creating a general pharmacophore model to design and develop novel ATP-noncompetitive agents with chemopreventive or chemotherapeutic potency. PMID:23888052

Development of LSPR and SPR sensor for the detection of an anti-cancer drug for chemotherapy

NASA Astrophysics Data System (ADS)

Zhao, Sandy Shuo; Bolduc, Olivier R.; Colin, Damien Y.; Pelletier, Joelle N.; Masson, Jean-François

2012-03-01

The anti-cancer drug, methotrexate (MTX) as a strong inhibitor of human dihydrofolate reductase (hDHFR) has been studied in localized surface plasmon resonance (LSPR) and surface plasmon resonance (SPR) competitive binding assays with folic acid stabilized gold nanoparticles (FA AuNP). The latter with a diameter of 15 nm were prepared in a simple step with sequential characterization using UV-Vis, FTIR, and Raman. A LSPR competitive binding assay between different concentrations of MTX and FA AuNP for hDHFR in solution was designed to quantify MTX by using UV-Vis spectroscopy. Sensitivity of the assay was optimized with respect to both concentrations of the enzyme and FA. The detection and quantification of spiked MTX was demonstrated in phosphate buffer saline and in fetal bovine serum accompanied by solid-phase extraction treatment of the serum. In addition, this assay could also provide as a screening tool for potential inhibitors of hDHFR. In another perspective, MTX was measured in a competitive binding assay with FA AuNP for histidine-tagged hDHFR immobilized on a SPR sensitive surface. In this case, FA AuNP offer a secondary amplification of the analytical response which is indirectly proportional to the concentration of MTX. This alternative approach could contribute to the realization of direct detection of MTX in complex biological fluids. A comparison of characteristics and analytical parameters such as sensitivity, dynamic range and limit of detection between the LSPR and SPR sensing platforms will also be presented. Both assays offer potential in tackling real biological samples for the purpose of monitoring and validating anti-cancer drug levels in human serum during chemotherapy.

In Situ Protein Binding Assay Using Fc-Fusion Proteins.

PubMed

Padmanabhan, Nirmala; Siddiqui, Tabrez J

2017-01-01

This protocol describes an in situ protein-protein interaction assay between tagged recombinant proteins and cell-surface expressed synaptic proteins. The assay is arguably more sensitive than other traditional protein binding assays such as co-immunoprecipitation and pull-downs and provides a visual readout for binding. This assay has been widely used to determine the dissociation constant of binding of trans-synaptic adhesion proteins. The step-wise description in the protocol should facilitate the adoption of this method in other laboratories.

Characterization of protein--DNA interactions using surface plasmon resonance spectroscopy with various assay schemes.

PubMed

Teh, Huey Fang; Peh, Wendy Y X; Su, Xiaodi; Thomsen, Jane S

2007-02-27

Specific protein-DNA interactions play a central role in transcription and other biological processes. A comprehensive characterization of protein-DNA interactions should include information about binding affinity, kinetics, sequence specificity, and binding stoichiometry. In this study, we have used surface plasmon resonance spectroscopy (SPR) to study the interactions between human estrogen receptors (ER, alpha and beta subtypes) and estrogen response elements (ERE), with four assay schemes. First, we determined the sequence-dependent receptors' binding capacity by monitoring the binding of ER to various ERE sequences immobilized on a sensor surface (assay format denoted as the direct assay). Second, we screened the relative affinity of ER for various ERE sequences using a competition assay, in which the receptors bind to an ERE-immobilized surface in the presence of competitor ERE sequences. Third, we monitored the assembly of ER-ERE complexes on a SPR surface and thereafter the removal and/or dissociation of the ER (assay scheme denoted as the dissociation assay) to determine the binding stoichiometry. Last, a sandwich assay (ER binding to ERE followed by anti-ER recognition of a specific ER subtype) was performed in an effort to understand how ERalpha and ERbeta may associate and compete when binding to the DNA. With these assay schemes, we reaffirmed that (1) ERalpha is more sensitive than ERbeta to base pair change(s) in the consensus ERE, (2) ERalpha and ERbeta form a heterodimer when they bind to the consensus ERE, and (3) the binding stoichiometry of both ERalpha- and ERbeta-ERE complexes is dependent on salt concentration. With this study, we demonstrate the versatility of the SPR analysis. With the involvement of various assay arrangements, the SPR analysis can be further extended to more than kinetics and affinity study.

Direct replacement of antibodies with molecularly imprinted polymer nanoparticles in ELISA--development of a novel assay for vancomycin.

PubMed

Chianella, Iva; Guerreiro, Antonio; Moczko, Ewa; Caygill, J Sarah; Piletska, Elena V; De Vargas Sansalvador, Isabel M Perez; Whitcombe, Michael J; Piletsky, Sergey A

2013-09-03

A simple and straightforward technique for coating microplate wells with molecularly imprinted polymer nanoparticles (nanoMIPs) to develop assays similar to the enzyme-linked immunosorbent assay (ELISA) is presented here for the first time. NanoMIPs were synthesized by a solid-phase approach with an immobilized vancomycin (template) and characterized using Biacore 3000, dynamic light scattering, and electron microscopy. Immobilization, blocking, and washing conditions were optimized in microplate format. The detection of vancomycin was achieved in competitive binding experiments with a horseradish peroxidase-vancomycin conjugate. The assay was capable of measuring vancomycin in buffer and in blood plasma within the range of 0.001-70 nM with a detection limit of 0.0025 nM (2.5 pM). The sensitivity of the assay was 3 orders of magnitude better than a previously described ELISA based on antibodies. In these experiments, nanoMIPs have shown high affinity and minimal interference from blood plasma components. Immobilized nanoMIPs were stored for 1 month at room temperature without any detrimental effects to their binding properties. The high affinity of nanoMIPs and the lack of a requirement for cold chain logistics make them an attractive alternative to traditional antibodies used in ELISA.

3,3',5-Triiodo-L-thyronine-like activity in effluents from domestic sewage treatment plants detected by in vitro and in vivo bioassays

DOE Office of Scientific and Technical Information (OSTI.GOV)

Murata, Tomonori; Yamauchi, Kiyoshi

2008-02-01

Thyroid system-disrupting activity in effluents from municipal domestic sewage treatment plants was detected using three in vitro assays and one in vivo assay. Contaminants in the effluents were extracted by solid-phase extraction (SPE) and eluted stepwise with different organic solvents. The majority of the thyroid system-disrupting activity was detected in the dichloromethane/methanol (1/1) fraction after SPE in all three in vitro assays: competitive assays of 3,3',5-[{sup 125}I]triiodo-L-thyronine ([{sup 125}I]T{sub 3}) binding to the plasma protein transthyretin (TTR assay) and thyroid hormone receptor (TR assay) and T{sub 3}-dependent luciferase assay (Luc assay). Subsequent reverse-phase high-performance liquid chromatography (RP-HPLC) of the dichloromethane/methanolmore » (1/1) fraction separated contaminants potent in the TR and Luc assays from those potent in the TTR assay. The contaminants potent in the TR and Luc assays were also potent in an in vivo short-term gene expression assay in Xenopus laevis (Tadpole assay). The present study demonstrated that the effluents from domestic sewage treatment plants contain contaminants with T{sub 3}-like activity of {approx} 10{sup -10} M T{sub 3}-equivalent concentration (T{sub 3}EQ) and that the TR and Luc assays are powerful in vitro bioassays for detecting thyroid system-disrupting activity in effluents. The availability and applicability of these bioassays for screening contaminants with thyroid system-disrupting activity in the water environment are discussed.« less

International Validation of Two Human Recombinant Estrogen ...

EPA Pesticide Factsheets

An international validation study has been successfully completed for 2 competitive binding assays using human recombinant ERa. Assays evaluated included the Freyberger-Wilson (FW) assay using a full length human ER, and the Chemical Evaluation and Research Institute (CERI) assay using a ligand-binding domain of the human ER. Twenty three compounds were tested in 6 laboratories for the FW assay and 5 for the CERJ assay, which included three controls (used with every run), 9 uncoded, and 14 coded chemicals across 3 subtasks. The overall goal of this validation study was to demonstrate the ability of each of the two assays to reliably classify the test chemicals as binders or non-binders. Laboratories had little trouble with the ER binders that produced a full binding curve when using either the CERI or FW assays. As is typical with all ER competitive binding assays, the weak binders proved to be more challenging. However, overall results from both the FW and CERI assays were consistent and in agreement with expected classifications regardless of the form of the hrER (i.e., full length ER versus an ER ligand binding domain) or the subtle differences in the protocols for conducting each assay. The reproducibility and accuracy for classification of chemicals as potential ER binders and non- binders using the FW and CERI hrER binding assays were comparable to that of the U.S.EPA’s existing ER binding test guideline OPPTS 890.1250, while providing an improved, highe

Endogenous fatty acids in olfactory hairs influence pheromone binding protein structure and function in Lymantria dispar.

PubMed

Nardella, Jason; Terrado, Mailyn; Honson, Nicolette S; Plettner, Erika

2015-08-01

The gypsy moth utilizes a pheromone, (7R,8S)-2-methyl-7,8-epoxyoctadecane, for mate location. The pheromone is detected by sensory hairs (sensilla) on the antennae of adult males. Sensilla contain the dendrites of olfactory neurons bathed in lymph, which contains pheromone binding proteins (PBPs). We have extracted and identified free fatty acids from lymph of sensory hairs, and we demonstrate that these function as endogenous ligands for gypsy moth PBP1 and PBP2. Homology modeling of both PBPs, and docking of fatty acids reveal multiple binding sites: one internal, the others external. Pheromone binding assays suggest that these fatty acids increase PBP-pheromone binding affinity. We show that fatty acid binding causes an increase in α-helix content in the N-terminal domain, but not in the C-terminal peptide of both proteins. The C-terminal peptide was shown to form a α-helix in a hydrophobic, homogeneous environment, but not in the presence of fatty acid micelles. Through partition assays we show that the fatty acids prevent adsorption of the pheromone on hydrophobic surfaces and facilitate pheromone partition into an aqueous phase. We propose that lymph is an emulsion of fatty acids and PBP that influence each other and thereby control the partition equilibria of hydrophobic odorants. Copyright © 2015 Elsevier Inc. All rights reserved.

High specific activity enantiomerically enriched juvenile hormones: synthesis and binding assay.

PubMed Central

Prestwich, G D; Wawrzeńczyk, C

1985-01-01

A stereoselective total synthesis of chiral juvenile hormone I is described that allows stoichiometric introduction of two tritium atoms in the final step. Both optical antipodes of the pivotal epoxy alcohol intermediate were prepared in 95% enantiomeric excess by the Sharpless epoxidation of a (Z)-allylic alcohol. Elaboration of the hydroxy-methyl group to a vinyl group followed by selective homogeneous tritiation affords optically active juvenile hormone I analogs at 58 Ci/mmol. Competitive binding of the labeled 10R, 11S and 10S,11R enantiomers with unlabeled enantiomers to the hemolymph binding protein of Manduca sexta larvae was determined by using a dextran-coated charcoal assay. The natural 10R,11S enantiomer has twice the relative binding affinity of the 10S,11R enantiomer. The availability of such high specific activity optically pure hormones will contribute substantially to the search for high-affinity receptors for juvenile hormones in the nuclei of cells. Moreover, the chiral 12-hydroxy-(10R,11S)-epoxy intermediate allows modification of juvenile hormone for solid-phase biochemical and radioimmunochemical work without altering either the biologically important carbomethoxy or epoxy recognition sites. PMID:3860862

Dual inhibition of HY023016 based on binding properties of platelet membrane receptor subunit glycoprotein Ibα and thrombin exosites.

PubMed

Chen, Qiu-Fang; Cui, Shuang; Shen, Hui-Liang; Chen, Xiang; Li, Yun-Zhan; Wu, Qian; Xu, Yun-Gen; Gong, Guo-Qing

2018-03-05

Thrombin has long been suggested as a desirable antithrombotic target, but anti-thrombin therapy without anti-platelet thereby has never achieved the ideal effect. HY023016 is a novel compound, in our previous study, it exerted better anti-thrombotic than dabigatran etexilate. The present study aims to illustrate the excess anti-thrombotic molecular mechanisms of HY023016 through thrombin anion exosites and the platelet membrane receptor subunit glycoprotein Ibα (GPIbα). HY023016 strongly inhibited the conversion of fibrinogen to fibrous may via blocking thrombin exosite I. We also discovered that HY023016 remarkably inhibited exosite II by a loss of affinity for the γ'-peptide of fibrinogen and for heparin. Furthermore, a solid phase binding assay revealed that HY023016 inhibited ristocetin-induced washed platelets bind to von Willebrand factor (vWF). In GST pull-down assay, HY023016 decreased the binding of recombinant vWF-A1 to GPIbα N-terminal. Thus, HY023016 provides an innovative idea for designing multi-targeted anti-thrombotic drugs and laying a scientific foundation for reducing "total thrombosis risk" in a clinical drug treatment. Copyright © 2018 Elsevier B.V. All rights reserved.

Direct replacement of antibodies with molecularly imprinted polymer (MIP) nanoparticles in ELISA – development of a novel assay for vancomycin

PubMed Central

Chianella, Iva; Guerreiro, Antonio; Moczko, Ewa; Caygill, J. Sarah; Piletska, Elena V.; Perez De Vargas Sansalvador, Isabel M.; Whitcombe, Michael J.; Piletsky, Sergey A.

2016-01-01

A simple and straightforward technique for coating microplate wells with molecularly imprinted polymer nanoparticles (nanoMIPs) to develop ELISA type assays is presented here for the first time. NanoMIPs were synthesized by a solid phase approach with immobilized vancomycin (template) and characterized using Biacore 3000, dynamic light scattering and electron microscopy. Immobilization, blocking and washing conditions were optimized in microplate format. The detection of vancomycin was achieved in competitive binding experiments with a HRP-vancomycin conjugate. The assay was capable of measuring vancomycin in buffer and in blood plasma within the range 0.001-70 nM with a detection limit of 0.0025 nM (2.5 pM). The sensitivity of the assay was three orders of magnitude better than a previously described ELISA based on antibodies. In these experiments nanoMIPs have shown high affinity and minimal interference from blood plasma components. Immobilized nanoMIPs were stored for 1 month at room temperature without any detrimental effects to their binding properties. The high affinity of nanoMIPs and the lack of a requirement for cold chain logistics make them an attractive alternative to traditional antibodies used in ELISA. PMID:23947402

Characterization of binding affinity of CJ-023,423 for human prostanoid EP4 receptor.

PubMed

Murase, Akio; Nakao, Kazunari; Takada, Junji

2008-01-01

In order to characterize the receptor binding pharmacology of CJ-023,423, a potent and selective EP4 antagonist, we performed a radioligand receptor binding assay under various assay conditions. An acidic (pH 6) and hypotonic buffer is a conventional, well-known buffer for prostaglandin E2 receptor binding assays. CJ-023,423 showed moderate binding affinity for human EP4 receptor under conventional buffer conditions. However, its binding affinity was greatly increased under neutral (pH 7.4) and isotonic buffer conditions. In this report, the binding mechanism between CJ-023,423 and human EP4 receptor is discussed based on the binding affinities determined under various assay conditions. Copyright 2008 S. Karger AG, Basel.

Parallel Force Assay for Protein-Protein Interactions

PubMed Central

Aschenbrenner, Daniela; Pippig, Diana A.; Klamecka, Kamila; Limmer, Katja; Leonhardt, Heinrich; Gaub, Hermann E.

2014-01-01

Quantitative proteome research is greatly promoted by high-resolution parallel format assays. A characterization of protein complexes based on binding forces offers an unparalleled dynamic range and allows for the effective discrimination of non-specific interactions. Here we present a DNA-based Molecular Force Assay to quantify protein-protein interactions, namely the bond between different variants of GFP and GFP-binding nanobodies. We present different strategies to adjust the maximum sensitivity window of the assay by influencing the binding strength of the DNA reference duplexes. The binding of the nanobody Enhancer to the different GFP constructs is compared at high sensitivity of the assay. Whereas the binding strength to wild type and enhanced GFP are equal within experimental error, stronger binding to superfolder GFP is observed. This difference in binding strength is attributed to alterations in the amino acids that form contacts according to the crystal structure of the initial wild type GFP-Enhancer complex. Moreover, we outline the potential for large-scale parallelization of the assay. PMID:25546146

Parallel force assay for protein-protein interactions.

PubMed

Aschenbrenner, Daniela; Pippig, Diana A; Klamecka, Kamila; Limmer, Katja; Leonhardt, Heinrich; Gaub, Hermann E

2014-01-01

Quantitative proteome research is greatly promoted by high-resolution parallel format assays. A characterization of protein complexes based on binding forces offers an unparalleled dynamic range and allows for the effective discrimination of non-specific interactions. Here we present a DNA-based Molecular Force Assay to quantify protein-protein interactions, namely the bond between different variants of GFP and GFP-binding nanobodies. We present different strategies to adjust the maximum sensitivity window of the assay by influencing the binding strength of the DNA reference duplexes. The binding of the nanobody Enhancer to the different GFP constructs is compared at high sensitivity of the assay. Whereas the binding strength to wild type and enhanced GFP are equal within experimental error, stronger binding to superfolder GFP is observed. This difference in binding strength is attributed to alterations in the amino acids that form contacts according to the crystal structure of the initial wild type GFP-Enhancer complex. Moreover, we outline the potential for large-scale parallelization of the assay.

Bone sialoprotein-collagen interaction promotes hydroxyapatite nucleation.

PubMed

Baht, Gurpreet S; Hunter, Graeme K; Goldberg, Harvey A

2008-09-01

In bone, hydroxyapatite (HA) crystals are deposited onto the type I collagen scaffold by a mechanism that has yet to be elucidated. Bone sialoprotein (BSP) is an acidic phosphoprotein that is expressed at high levels in mineralized tissues, capable of binding type I collagen, and nucleating HA. Both bone-extracted and recombinant BSP (rBSP) bind with equal affinity to collagen. The nature of the BSP-collagen interaction and its role in HA nucleation are not known. We have used a solid-phase binding assay and affinity chromatography to characterize the BSP-collagen interaction. rBSP-binding affinities of triple-helical and fibrillar type I collagen were similar (K(D) approximately 13 nM), while that of heat-denatured type I collagen was lower (K(D) approximately 44 nM), indicating the importance of triple-helical structure in binding BSP. Pepsin treatment of collagen had no effect on rBSP binding, demonstrating that the telopeptides of collagen are not involved. The majority of collagen-bound rBSP was eluted by acetonitrile, indicating that hydrophobic interactions are principally responsible for binding. Using an HA-nucleation assay, it was shown that rBSP is ten-fold more potent in reconstituted fibrillar collagen gels than in agarose gels. Nucleating potency of a non-collagen-binding, HA-nucleating peptide [rBSP(134-206)] showed no difference in the two gel systems. The work here shows that optimal binding of rBSP requires collagen to be in a native, triple-helical structure, does not require the telopeptides, and is stabilized by hydrophobic interactions. Upon binding to collagen, rBSP displays an increase in nucleation potency, implying a co-operative effect of BSP and collagen in mineral formation.

Recombinant human antibody fragment against tetanus toxoid produced by phage display.

PubMed

Neelakantam, B; Sridevi, N V; Shukra, A M; Sugumar, P; Samuel, S; Rajendra, L

2014-03-01

Phage display technology is a powerful in vitro method for the identification of specific monoclonal antibodies (antibody fragments) to an antigenic target and allows the rapid generation and selection of high affinity, fully human antibodies directed toward any disease target appropriate for antibody therapy. In the present study, we exploited the phage display technology for the selection of an antigen binding fragment (Fabs) toward tetanus toxoid using human naïve phage antibody library constructed from peripheral blood lymphocytes of naïve human donors. The phages displaying Fab were subjected to three rounds of bio-panning with tetanus toxoid as antigen on a solid phase. The high affinity antibody fragments were expressed in HB2151 strain of Escherichia coli and purified by immobilized metal affinity chromatography. The binding activity and specificity of the antibody fragment was established by its reactivity toward tetanus toxoid and non-reactivity toward other related toxins as determined by enzyme-linked immunosorbent assay and immunoblot analysis. The selected Fab fragment forming the antigen-binding complexes with the toxoid in flocculation assay indicates that the Fab may have a potential neutralizing ability toward antigen.

Regulation of the yeast RAD2 gene: DNA damage-dependent induction correlates with protein binding to regulatory sequences and their deletion influences survival.

PubMed

Siede, W; Friedberg, E C

1992-03-01

In the yeast Saccharomyces cerevisiae the RAD2 gene is absolutely required for damage-specific incision of DNA during nucleotide excision repair and is inducible by DNA-damaging agents. In the present study we correlated sensitivity to killing by DNA-damaging agents with the deletion of previously defined specific promoter elements. Deletion of the element DRE2 increased the UV sensitivity of cells in both the G1/early S and S/G2 phases of the cell cycle as well as in stationary phase. On the other hand, increased UV sensitivity associated with deletion of the sequence-related element DRE1 was restricted to cells irradiated in G1/S. Specific binding of protein(s) to the promoter elements DRE1 and DRE2 was observed under non-inducing conditions using gel retardation assays. Exposure of cells to DNA-damaging agents resulted in increased protein binding that was dependent on de novo protein synthesis.

Assignment of C1q-binding HLA antibodies as unacceptable HLA antigens avoids positive CDC-crossmatches prior to transplantation of deceased donor organs.

PubMed

Juhl, David; Marget, Matthias; Hallensleben, Michael; Görg, Siegfried; Ziemann, Malte

2017-03-01

Soon, a virtual crossmatch shall replace the complement-dependent cytotoxicity (CDC) allocation crossmatch in the Eurotransplant region. To prevent positive CDC-crossmatches in the recipient centre, careful definition of unacceptable antigens is necessary. For highly sensitized patients, this is difficult by CDC alone. Assignment of all antibodies detected by sensitive assays, however, could prevent organ allocation. To assess the usefulness of the Luminex C1q-assay to prevent positive CDC-crossmatches, all CDC-crossmatches performed prior to deceased kidney transplantation in a 16-month-period were reviewed. Sera causing positive crossmatches were investigated by the C1q-assay. 31 out of 1432 crossmatches (2.2%) were positive. Sera involved in 26 positive crossmatches were available. C1q-binding donor-specific antibodies were detected in 19 sera (73.1%). The other sera were from recipients without any HLA antibodies detectable by CDC or common solid phase assays. Three patients had known Non-HLA antibodies causing positive CDC-results. Four crossmatches were only weak positive. Therefore, avoidance of donors with HLA antigens against whom C1q-binding antibodies were detected would have prevented all positive crossmatches due to HLA antibodies. Provided that all HLA specificities against which antibodies are detected by the Luminex C1q-assay are considered as unacceptable antigens, CDC-crossmatches prior to transplantation might safely be omitted in many patients. They should be maintained in highly immunized patients, however, for whom assignment of all C1q-positive antibodies as unacceptable antigens could lead to a significant delay or even prevention of transplantation. Copyright © 2017 Elsevier B.V. All rights reserved.

International Validation of Two Human Recombinant Estrogen Receptor (ERa) Binding Assays

EPA Science Inventory

An international validation study has been successfully completed for 2 competitive binding assays using human recombinant ERa. Assays evaluated included the Freyberger-Wilson (FW) assay using a full length human ER, and the Chemical Evaluation and Research Institute (CERI) assay...

Adaptive Focused Acoustics (AFA) Improves the Performance of Microtiter Plate ELISAs.

PubMed

Green, David J; Rudd, Edwin A; Laugharn, James A

2014-08-01

We investigated the use of Adaptive Focused Acoustics (AFA) technology to improve the performance of microtiter plate enzyme-linked immunosorbent assays (ELISAs). Experiments were performed with commercially available AFA instrumentation and off-the-shelf 96-well microtiter plate sandwich ELISAs. AFA was applied over a range of acoustic energies, temperatures, and durations to the antigen/antibody binding step of an ELISA for measuring HIV-1 p24 in tissue culture samples. AFA-mediated antigen/antibody binding was enhanced up to 2-fold over passive binding at comparable temperatures and was superior or comparable at low temperature (8-10 °C) to passive binding at 37 °C. Lower nonspecific binding (NSB), lower inter- and intra-assay coefficients of variation (CVs), higher Z' factors, and lower limits of detection (LODs) were measured in AFA-mediated assays compared with conventional passive binding. In a more limited study, AFA enhancement of antigen/antibody binding and lower NSB was measured in an ELISA for measuring IGFBP-3 in human plasma. We conclude from this study that application of AFA to antigen/antibody binding steps in microtiter plate ELISAs can enhance key assay performance parameters, particularly Z' factors and LODs. These features render AFA-mediated binding assays potentially more useful in applications such as high-throughput screening and in vitro diagnostics than assays processed with conventional passive antigen/antibody binding steps. © 2014 Society for Laboratory Automation and Screening.

Integrated Summary Report: Validation of Two Binding Assays ...

EPA Pesticide Factsheets

This Integrated Summary Report (ISR) summarizes, in a single document, the results from an international multi-laboratory validation study conducted for two in vitro estrogen receptor (ER) binding assays. These assays both use human recombinant estrogen receptor, alpha subtype (hrERα), to identify chemicals that may impact estrogen signaling through binding to the ER. The purpose of the ISR is to support the peer review of the findings obtained during the validation process.The two assays evaluated during this validation process are: The Freyberger-Wilson Assay (FW) using a full length human ER, and The Chemical Evaluation and Research Institute (CERI) Assay using a ligand-binding domain of the human ER.The two assays are mechanistically and functionally similar in that each measures the ability of a test chemical to competitively inhibit binding of [3H]17β-estradiol to the human recombinant ER. The essential elements of the FW and the CERI assays were developed at the laboratories of Bayer Pharma AG, Wuppertal, Germany (Freyberger et al., 2010) and CERI, Tokyo, Japan (Akahori et al., 2008), respectively.The ER competitive binding assay has long been in use, and is a well characterized approach, but historically uses rodent or other animal tissues as a source of the ER. Validation of the FW and CERI assays using human recombinant estrogen receptors ( subtype) will provide an updated alternative for the Agency’s current test guideline (OPPTS 89

Detergent enhances binding of a secreted HLA-A2 molecule to solid phase peptides.

PubMed

Tussey, L G; Frelinger, J A

1991-11-01

We have constructed a secreted analogue (sA2) of the human class I molecule HLA-A2. sA2 was affinity purified both in the presence and absence of detergent and the effects of detergent on the magnitude and specificity of A2 binding to solid phase peptides tested. sA2 purified in the presence of detergent and detergent-solubilized A2 are shown to function comparably in the binding of the synthetic peptide M.Y + 57-68, a known T-cell epitope derived from the influenza A matrix protein. The molecules binding to M.Y + 57-68 typically represent 8% to 10% of the added protein. In contrast, less than 1% of sA2 protein purified in the absence of detergent binds M.Y + 57-68. This reduced binding is not due to a change in the affinity of sA2 for M.Y + 57-68. Addition of detergent at various stages of the purification and iodination procedures indicates that the longer the sA2 molecules are exposed to detergent the better they bind. However, the concentration of detergent during the actual binding assay does not appear to be critical. We also find that while the sA2-detergent and the sA2-no detergent molecules differ in the extent to which they bind various peptides, they do not differ in their patterns of binding. We conclude that detergent probably does not influence the specificity of class I/peptide binding but does increase the number of sA2 molecules that can participate in the binding of peptide either by generating and stabilizing "empty" sA2 molecules or by stabilizing a structure that is more amenable to binding peptide.

Bio-nanocapsule-based scaffold improves the sensitivity and ligand-binding capacity of mammalian receptors on the sensor chip.

PubMed

Iijima, Masumi; Yoshimoto, Nobuo; Niimi, Tomoaki; Maturana, Andrés D; Kuroda, Shun'ichi

2016-06-01

Mammalian receptors are recognized as target molecules for drug discovery, and chemical libraries have been screened for both potential antagonists and agonists mainly by ligand-binding assays using immobilized receptors. A bio-nanocapsule (BNC) of approximately 30 nm that displays a tandem form of the protein A-derived immunoglobulin G (IgG) Fc-binding Z domains (denoted as ZZ-BNC) has been developed for both clustering and oriented immobilization of IgGs on the solid phase of immunosensors. In this study, human IgG1 Fc-fused vascular endothelial growth factor (VEGF) receptor was immobilized through ZZ-BNC on the sensor chip of quartz crystal microbalance (ZZ-BNC-coating). When compared with direct adsorption and protein A-coating, the sensor chip showed higher sensitivity (∽46- and ∽165-fold, respectively) and larger ligand-binding capacity (∽4- and ∽18-fold, respectively). Furthermore, the number of VEGF molecules bound to its receptor increased from 0.20 (direct adsorption) to 2.06 by ZZ-BNC-coating, strongly suggesting that ZZ-BNC reduced the steric hindrance near ligand recognition sites through oriented immobilization. Similarly, the sensitivity and ligand-binding capacity of leptin and prolactin receptors were both enhanced at a level comparable to that observed for the VEGF receptor. Thus, the combination of ZZ-BNC and Fc-fused receptors could significantly improve the function of ligand-binding assays. Copyright © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Detection of biotin in individual sea urchin oocytes using a bioluminescence binding assay.

PubMed

Feltus, A; Grosvenor, A L; Conover, R C; Anderson, K W; Daunert, S

2001-04-01

The ability to detect biomolecules in single cells is important in order to fully understand the processes by which many biochemical events occur. To that end, we have developed a bioluminescence binding assay capable of measuring the intracellular biotin content of individual cells. The assay depends on competition between an aequorin-biotin conjugate (AEQ-biotin) and free biotin within the oocytes for binding sites on the protein avidin. The assay is performed by microinjecting each component into the oocytes and following the resulting bioluminescence within the oocyte upon triggering of aequorin. Results obtained using sea urchin oocytes show that the assay performed within the cells behaves in a manner consistent with assay theory. Using the assay, the individual biotin content of the oocytes is an average of approximately 20 amol. To our knowledge, this is the first reported multicomponent binding assay to be performed inside an intact single cell.

Cytotoxic effect of achatinin(H) (lectin) from Achatina fulica against a human mammary carcinoma cell line (MCF7).

PubMed

Dharmu, Indra; Ramamurty, N; Kannan, Ramalingam; Babu, Mary

2007-01-01

The hemolymph-derived achatinin(H) (lectin) from Achatina fulica showed a marked cytotoxic effect on MCF7, a human mammary carcinoma cell line. IC(50) values as measured by the 3-(4,5-dimethylthiazol-2yl)-2,5-diphenyltetrazolium bromide assay for achatinin(H) ranged from 6 to 10 microg/ml in the MCF7 cells. MCF7 cells showed significant morphological changes leading to cell death. The above cell death was observed after 48 h of treatment with 8 microg/ml when compared to untreated cells. Alterations in the tumor marker enzymes, as well as in antioxidant enzymes, were observed after achatinin(H) treatment. The specificity and purity of the achatinin(H) was confirmed by the Western blot assay. Achatinin(H) binding to MCF7 cells was detected by anti-achatinin(H), and visualization of the achatinin(H) binding sites on confluent MCF7 cells was confirmed by flourescein isothiocyanate conjugated secondary antibody. MCF7-treated cells fluoresced, indicating the presence of achatinin(H) binding sites. Fluorescence-activated cell sorting analysis of the cell cycle showed a significant increase in S-phase in MCF7 cells after 48 h of achatinin(H) treatment. The cells were arrested in G(2)/M phase of the cell cycle after 48 h with significant changes in cell viability. Cellular damage was confirmed by agarose gel electrophoresis with the characteristic appearance of a DNA streak in treated MCF7 cells indicating the ongoing apoptosis.

Recombinant phage probes for Listeria monocytogenes

NASA Astrophysics Data System (ADS)

Carnazza, S.; Gioffrè, G.; Felici, F.; Guglielmino, S.

2007-10-01

Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 104 cells ml-1. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.

Development of binding assays in microfabricated picoliter vials: an assay for biotin.

PubMed

Grosvenor, A L; Feltus, A; Conover, R C; Daunert, S; Anderson, K W

2000-06-01

A homogeneous binding assay for the detection of biotin in picoliter vials was developed using the photoprotein aequorin as the label. The binding assay was based on the competition of free biotin with biotinylated aequorin (AEQ-biotin) for avidin. A sequential protocol was used, and modification of the assay to reduce the number of steps was examined. Results showed that detection limits on the order of 10(-14) mol of biotin were possible. Reducing the number of steps provided similar detection limits but only if the amount of avidin used was decreased. These binding assays based on picoliter volumes have potential applications in a variety of fields, including microanalysis and single-cell analysis, where the amount of sample is limited. In addition, these assays are suitable for the high-throughput screening of biopharmaceuticals.

Impact of SPR biosensor assay configuration on antibody: Neonatal Fc receptor binding data

PubMed Central

Wang, Xiangdan; McKay, Patrick; Dutina, George; Hass, Philip E.; Nijem, Ihsan; Allison, David; Cowan, Kyra J.; Lin, Kevin; Quarmby, Valerie; Yang, Jihong

2017-01-01

ABSTRACT Binding interactions with the neonatal Fc receptor (FcRn) are one determinant of pharmacokinetic properties of recombinant human monoclonal antibody (rhumAb) therapeutics, and a conserved binding motif in the crystallizable fragment (Fc) region of IgG molecules interacts with FcRn. Surface plasmon resonance (SPR) biosensor assays are often used to characterize interactions between FcRn and rhumAb therapeutics. In such assays, generally either the rhumAb (format 1) or the FcRn protein (format 2) is immobilized on a biosensor chip. However, because evidence suggests that, in some cases, the variable domains of a rhumAb may also affect FcRn binding, we evaluated the effect of SPR assay configuration on binding data. We sought to assess FcRn binding properties of 2 rhumAbs (rhumAb1 and rhumAb2) to FcRn proteins using these 2 biosensor assay formats. The two rhumAbs have greater than 99% sequence identity in the Fc domain but differ in their Fab regions. rhumAb2 contains a positively charged patch in the variable domain that is absent in rhumAb1. Our results showed that binding of rhumAb1 to FcRn was independent of biosensor assay configuration, while binding of rhumAb2 to FcRn was highly SPR assay configuration dependent. Further investigations revealed that the format dependency of rhumAb2-FcRn binding is linked to the basic residues that form a positively charged patch in the variable domain of rhumAb2. Our work highlights the importance of analyzing rhumAb-FcRn binding interactions using 2 alternate SPR biosensor assay configurations. This approach may also provide a simple way to identify the potential for non-Fc-driven FcRn binding interactions in otherwise typical IgGs. PMID:28001487

Discovery and Optimization of Novel 5-Indolyl-7-arylimidazo[1,2-a]pyridine-8-carbonitrile Derivatives as Potent Antitubulin Agents Targeting Colchicine-binding Site

NASA Astrophysics Data System (ADS)

Zhai, Xin; Wang, Xiaoqiang; Wang, Jiao; Liu, Jin; Zuo, Daiying; Jiang, Nan; Zeng, Tianfang; Yang, Xiuxiu; Jing, Tongfei; Gong, Ping

2017-02-01

Aiming at development of potent antitubulin agents targeting colchicine-binding site, a series of novel 5-indolyl-7-arylimidazo[1,2-a]pyridine-8-carbonitrilederivatives (5a-5v and 7a-7h) were designed based on bioisosterism and hybridization strategies. All these compounds were concisely synthesized via a three-step process and examined against five human cancer cell lines (HT-29, A549, MKN-45, MDA-MB-231 and SMMC-7721) along with a normal human cell (L02) in vitro. A structure-activity relationships (SARs) study was carried out and optimization towards this series of compounds in cellular assay resulted in the discovery of 5k, which displayed similar or better antitumor potency against the tested cancer cells with IC50 value ranging from 0.02 to 1.22 μM superior to CA-4 and Crolibulin. Significantly, a cell cycle study disclosed the ability of 5k to arrest cell cycle at the G2/M phase, and immunofluorescence assay as well as a colchicine competition assay revealed that tubulin polymerization was disturbed by 5k by binding to the colchicine site. Moreover, the molecular modeling mode showed the posture of 5k and Crolibulin was similar in the colchcine-binding pocket of tubulin as identified with the SARs and pharmacological results. Together, all these results rationalized 5k might serve as a promising lead for a novel class of antitubulin agents for cancer treatments.

A novel assay reveals preferential binding between Rabs, kinesins, and specific endosomal subpopulations

PubMed Central

Bentley, Marvin; Decker, Helena; Luisi, Julie

2015-01-01

Identifying the proteins that regulate vesicle trafficking is a fundamental problem in cell biology. In this paper, we introduce a new assay that involves the expression of an FKBP12-rapamycin–binding domain–tagged candidate vesicle-binding protein, which can be inducibly linked to dynein or kinesin. Vesicles can be labeled by any convenient method. If the candidate protein binds the labeled vesicles, addition of the linker drug results in a predictable, highly distinctive change in vesicle localization. This assay generates robust and easily interpretable results that provide direct experimental evidence of binding between a candidate protein and the vesicle population of interest. We used this approach to compare the binding of Kinesin-3 family members with different endosomal populations. We found that KIF13A and KIF13B bind preferentially to early endosomes and that KIF1A and KIF1Bβ bind preferentially to late endosomes and lysosomes. This assay may have broad utility for identifying the trafficking proteins that bind to different vesicle populations. PMID:25624392

Label-Free, LC-MS-Based Assays to Quantitate Small-Molecule Antagonist Binding to the Mammalian BLT1 Receptor.

PubMed

Chen, Xun; Stout, Steven; Mueller, Uwe; Boykow, George; Visconti, Richard; Siliphaivanh, Phieng; Spencer, Kerrie; Presland, Jeremy; Kavana, Michael; Basso, Andrea D; McLaren, David G; Myers, Robert W

2017-08-01

We have developed and validated label-free, liquid chromatography-mass spectrometry (LC-MS)-based equilibrium direct and competition binding assays to quantitate small-molecule antagonist binding to recombinant human and mouse BLT1 receptors expressed in HEK 293 cell membranes. Procedurally, these binding assays involve (1) equilibration of the BLT1 receptor and probe ligand, with or without a competitor; (2) vacuum filtration through cationic glass fiber filters to separate receptor-bound from free probe ligand; and (3) LC-MS analysis in selected reaction monitoring mode for bound probe ligand quantitation. Two novel, optimized probe ligands, compounds 1 and 2, were identified by screening 20 unlabeled BLT1 antagonists for direct binding. Saturation direct binding studies confirmed the high affinity, and dissociation studies established the rapid binding kinetics of probe ligands 1 and 2. Competition binding assays were established using both probe ligands, and the affinities of structurally diverse BLT1 antagonists were measured. Both binding assay formats can be executed with high specificity and sensitivity and moderate throughput (96-well plate format) using these approaches. This highly versatile, label-free method for studying ligand binding to membrane-associated receptors should find broad application as an alternative to traditional methods using labeled ligands.

Predicting changes in cardiac myocyte contractility during early drug discovery with in vitro assays

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morton, M.J., E-mail: michael.morton@astrazeneca.com; Armstrong, D.; Abi Gerges, N.

2014-09-01

Cardiovascular-related adverse drug effects are a major concern for the pharmaceutical industry. Activity of an investigational drug at the L-type calcium channel could manifest in a number of ways, including changes in cardiac contractility. The aim of this study was to define which of the two assay technologies – radioligand-binding or automated electrophysiology – was most predictive of contractility effects in an in vitro myocyte contractility assay. The activity of reference and proprietary compounds at the L-type calcium channel was measured by radioligand-binding assays, conventional patch-clamp, automated electrophysiology, and by measurement of contractility in canine isolated cardiac myocytes. Activity inmore » the radioligand-binding assay at the L-type Ca channel phenylalkylamine binding site was most predictive of an inotropic effect in the canine cardiac myocyte assay. The sensitivity was 73%, specificity 83% and predictivity 78%. The radioligand-binding assay may be run at a single test concentration and potency estimated. The least predictive assay was automated electrophysiology which showed a significant bias when compared with other assay formats. Given the importance of the L-type calcium channel, not just in cardiac function, but also in other organ systems, a screening strategy emerges whereby single concentration ligand-binding can be performed early in the discovery process with sufficient predictivity, throughput and turnaround time to influence chemical design and address a significant safety-related liability, at relatively low cost. - Highlights: • The L-type calcium channel is a significant safety liability during drug discovery. • Radioligand-binding to the L-type calcium channel can be measured in vitro. • The assay can be run at a single test concentration as part of a screening cascade. • This measurement is highly predictive of changes in cardiac myocyte contractility.« less

Validation of an enzyme-linked immunosorbent assay for the quantification of human IgG directed against the repeat region of the circumsporozoite protein of the parasite Plasmodium falciparum

PubMed Central

2012-01-01

Background Several pre-erythrocytic malaria vaccines based on the circumsporozoite protein (CSP) antigen of Plasmodium falciparum are in clinical development. Vaccine immunogenicity is commonly evaluated by the determination of anti-CSP antibody levels using IgG-based assays, but no standard assay is available to allow comparison of the different vaccines. Methods The validation of an anti-CSP repeat region enzyme-linked immunosorbent assay (ELISA) is described. This assay is based on the binding of serum antibodies to R32LR, a recombinant protein composed of the repeat region of P. falciparum CSP. In addition to the original recombinant R32LR, an easy to purify recombinant His-tagged R32LR protein has been constructed to be used as solid phase antigen in the assay. Also, hybridoma cell lines have been generated producing human anti-R32LR monoclonal antibodies to be used as a potential inexhaustible source of anti-CSP repeats standard, instead of a reference serum. Results The anti-CSP repeats ELISA was shown to be robust, specific and linear within the analytical range, and adequately fulfilled all validation criteria as defined in the ICH guidelines. Furthermore, the coefficient of variation for repeatability and intermediate precision did not exceed 23%. Non-interference was demonstrated for R32LR-binding sera, and the assay was shown to be stable over time. Conclusions This ELISA, specific for antibodies directed against the CSP repeat region, can be used as a standard assay for the determination of humoral immunogenicity in the development of any CSP-based P. falciparum malaria vaccine. PMID:23173602

Competition-based cellular peptide binding assays for 13 prevalent HLA class I alleles using fluorescein-labeled synthetic peptides.

PubMed

Kessler, Jan H; Mommaas, Bregje; Mutis, Tuna; Huijbers, Ivo; Vissers, Debby; Benckhuijsen, Willemien E; Schreuder, Geziena M Th; Offringa, Rienk; Goulmy, Els; Melief, Cornelis J M; van der Burg, Sjoerd H; Drijfhout, Jan W

2003-02-01

We report the development, validation, and application of competition-based peptide binding assays for 13 prevalent human leukocyte antigen (HLA) class I alleles. The assays are based on peptide binding to HLA molecules on living cells carrying the particular allele. Competition for binding between the test peptide of interest and a fluorescein-labeled HLA class I binding peptide is used as read out. The use of cell membrane-bound HLA class I molecules circumvents the need for laborious biochemical purification of these molecules in soluble form. Previously, we have applied this principle for HLA-A2 and HLA-A3. We now describe the assays for HLA-A1, HLA-A11, HLA-A24, HLA-A68, HLA-B7, HLA-B8, HLA-B14, HLA-B35, HLA-B60, HLA-B61, and HLA-B62. Together with HLA-A2 and HLA-A3, these alleles cover more than 95% of the Caucasian population. Several allele-specific parameters were determined for each assay. Using these assays, we identified novel HLA class I high-affinity binding peptides from HIVpol, p53, PRAME, and minor histocompatibility antigen HA-1. Thus these convenient and accurate peptide-binding assays will be useful for the identification of putative cytotoxic T lymphocyte epitopes presented on a diverse array of HLA class I molecules.

Quantitatively and Kinetically Identifying Binding Motifs of Amelogenin Proteins to Mineral Crystals Through Biochemical and Spectroscopic Assays

PubMed Central

Zhu, Li; Hwang, Peter; Witkowska, H. Ewa; Liu, Haichuan; Li, Wu

2014-01-01

Tooth enamel is the hardest tissue in vertebrate animals. Consisting of millions of carbonated hydroxyapatite crystals, this highly mineralized tissue develops from a protein matrix in which amelogenin is the predominant component. The enamel matrix proteins are eventually and completely degraded and removed by proteinases to form mineral-enriched tooth enamel. Identification of the apatite-binding motifs in amelogenin is critical for understanding the amelogenin–crystal interactions and amelogenin–proteinases interactions during tooth enamel biomineralization. A stepwise strategy is introduced to kinetically and quantitatively identify the crystal-binding motifs in amelogenin, including a peptide screening assay, a competitive adsorption assay, and a kinetic-binding assay using amelogenin and gene-engineered amelogenin mutants. A modified enzyme-linked immunosorbent assay on crystal surfaces is also applied to compare binding amounts of amelogenin and its mutants on different planes of apatite crystals. We describe the detailed protocols for these assays and provide the considerations for these experiments in this chapter. PMID:24188774

Relative Impact of Incorporating Pharmacokinetics on ...

EPA Pesticide Factsheets

The use of high-throughput in vitro assays has been proposed to play a significant role in the future of toxicity testing. In this study, rat hepatic metabolic clearance and plasma protein binding were measured for 59 ToxCast phase I chemicals. Computational in vitro-to-in vivo extrapolation was used to estimate the daily dose in a rat, called the oral equivalent dose, which would result in steady-state in vivo blood concentrations equivalent to the AC50 or lowest effective concentration (LEC) across more than 600 ToxCast phase I in vitro assays. Statistical classification analysis was performed using either oral equivalent doses or unadjusted AC50/LEC values for the in vitro assays to predict the in vivo effects of the 59 chemicals. Adjusting the in vitro assays for pharmacokinetics did not improve the ability to predict in vivo effects as either a discrete (yes or no) response or a low effect level (LEL) on a continuous dose scale. Interestingly, a comparison of the in vitro assay with the lowest oral equivalent dose with the in vivo endpoint with the lowest LEL suggested that the lowest oral equivalent dose may provide a conservative estimate of the point of departure for a chemical in a dose-response assessment. Furthermore, comparing the oral equivalent doses for the in vitro assays with the in vivo dose range that resulted in adverse effects identified more coincident in vitro assays across chemicals than expected by chance, suggesting that the approach ma

Electroactivity of Aptamer at Soft Microinterface Arrays.

PubMed

Felisilda, Bren Mark B; Arrigan, Damien W M

2018-06-26

The electrochemical behavior of a synthetic oligonucleotide, thrombin-binding aptamer (TBA, 15-mer), was explored at a liquid-organogel microinterface array. TBA did not display any response when only background electrolytes were present in both phases. On the basis of literature reports that surfactants can influence nucleic acid detection, the response in the presence of cetyltrimethylammonium (CTA + ) was examined. With both TBA and CTA + in the aqueous phase, the transfer current for CTA + was diminished, signifying the interaction of CTA + with TBA. Experiments with CTA + spiked into the organic phase revealed a sharp current peak, consistent with the interfacial formation of a CTA + -TBA complex. However, use of CTA + as the organic phase electrolyte cation, as the salt with tetrakis(4-chlorophenyl)borate, greatly improved the response to TBA. In this case, a distinctive peak response (at ca. -0.25 V) was attributed to the transfer of CTA + across the soft interface to complex with aqueous phase TBA. Employing this process as a detection step enabled a detection limit of 0.11 μM TBA (by cyclic voltammetry). Furthermore, the presence of magnesium cations at physiological concentration resulted in the disappearance of the TBA response because of Mg 2+ -induced folding of TBA. Also, the current response of TBA was decreased by the addition of thrombin, indicating TBA interacted with this binding partner. Finally, the interfacial surfactant-aptamer interaction was explored in a synthetic urine matrix that afforded a detection limit of 0.29 μM TBA. These results suggest that aptamer-binding interactions can be monitored by electrochemistry at aqueous-organic interfaces and open up a new possibility for detection in aptamer-binding assays.

Development of a Fluorescence Assay for the Characterization of Brevenal Binding to Rat Brain Synaptosomes

PubMed Central

2015-01-01

The marine dinoflagellate Karenia brevis produces a family of neurotoxins known as brevetoxins. Brevetoxins elicit their effects by binding to and activating voltage-sensitive sodium channels (VSSCs) in cell membranes. K. brevis also produces brevenal, a brevetoxin antagonist, which is able to inhibit and/or negate many of the detrimental effects of brevetoxins. Brevenal binding to VSSCs has yet to be fully characterized, in part due to the difficulty and expense of current techniques. In this study, we have developed a novel fluorescence binding assay for the brevenal binding site. Several fluorescent compounds were conjugated to brevenal to assess their effects on brevenal binding. The assay was validated against the radioligand assay for the brevenal binding site and yielded comparable equilibrium inhibition constants. The fluorescence-based assay was shown to be quicker and far less expensive and did not generate radioactive waste or need facilities for handling radioactive materials. In-depth studies using the brevenal conjugates showed that, while brevenal conjugates do bind to a binding site in the VSSC protein complex, they are not displaced by known VSSC site specific ligands. As such, brevenal elicits its action through a novel mechanism and/or currently unknown receptor site on VSSCs. PMID:25226846

Avoiding false positives and optimizing identification of true ...

EPA Pesticide Factsheets

The potential for chemicals to affect endocrine signaling is commonly evaluated via in vitro receptor binding and gene activation, but these assays, especially antagonism assays, have potential artifacts that must be addressed for accurate interpretation. Results are presented from screening 94 chemicals from 54 chemical groups for estrogen receptor (ER) activation in a competitive rainbow trout ER (rtER) binding assay and a trout liver slice vitellogenin mRNA expression assay. Results from true competitive agonists and antagonists, and inactive chemicals with little or no indication of ER binding or gene activation were easily interpreted. However, results for numerous industrial chemicals were more challenging to interpret, including chemicals with: (1) apparent competitive binding curves but no gene activation, (2) apparent binding and gene inhibition with evidence of either cytotoxicity or changes in assay media pH, (3) apparent binding but non-competitive gene inhibition of unknown cause, or (4) no rtER binding and gene inhibition not due to competitive ER interaction but due to toxicity, pH change, or some unknown cause. The use of endpoints such as toxicity, pH, precipitate formation, and determination of inhibitor dissociation constants (Ki) for interpreting the results of antagonism and binding assays for diverse chemicals is presented. Of the 94 chemicals tested for antagonism only two, tamoxifen and ICI-182,780, were found to be true competitive

A novel BRET-based binding assay for interaction studies of relaxin family peptide receptor 3 with its ligands.

PubMed

Wang, Jia-Hui; Shao, Xiao-Xia; Hu, Meng-Jun; Wei, Dian; Liu, Ya-Li; Xu, Zeng-Guang; Guo, Zhan-Yun

2017-05-01

Relaxin family peptide receptor 3 (RXFP3) is an A-class G protein-coupled receptor that is implicated in the regulation of food intake and stress response upon activation by its cognate agonist relaxin-3. To study its interaction with various ligands, we developed a novel bioluminescence resonance energy transfer (BRET)-based binding assay using the brightest NanoLuc as an energy donor and a newly developed cyan-excitable orange fluorescent protein (CyOFP) as an energy acceptor. An engineered CyOFP without intrinsic cysteine residues but with an introduced cysteine at the C-terminus was overexpressed in Escherichia coli and chemically conjugated to the A-chain N-terminus of an easily labeled chimeric R3/I5 peptide via an intermolecular disulfide linkage. After the CyOFP-conjugated R3/I5 bound to a shortened human RXFP3 (removal of 33 N-terminal residues) fused with the NanoLuc reporter at the N-terminus, high BRET signals were detected. Saturation binding and real-time binding assays demonstrated that this BRET pair retained high binding affinity with fast association/dissociation. Using this BRET pair, binding potencies of various ligands with RXFP3 were conveniently measured through competition binding assays. Thus, the novel BRET-based binding assay facilitates interaction studies of RXFP3 with various ligands. The engineered CyOFP without intrinsic cysteine residues may also be applied to other BRET-based binding assays in future studies.

Point mutations abolishing the mannose-binding capability of boar spermadhesin AQN-1.

PubMed

Ekhlasi-Hundrieser, Mahnaz; Calvete, Juan J; Von Rad, Bettina; Hettel, Christiane; Nimtz, Manfred; Töpfer-Petersen, Edda

2008-05-01

The mannose-binding capability of recombinant wild-type boar spermadhesin AQN-1 and of its site-directed mutants in the highly-conserved region around of the single glycosylation site (asparagine 50) of some spermadhesins, where the carbohydrate binding site has been proposed to be located, was checked using a solid-phase assay and a biotinylated mannose ligand. Substitution of glycine 54 by amino acids bearing an unipolar side chain did not cause significant decrease in the mannose-binding activity. However, amino acids with uncharged polar side chains or having a charged polar side chain abolished the binding of biotinylated mannose to the corresponding AQN-1 mutants. The results suggest that the higher surface accessibility of amino acids possessing polar side chains compared to those bearing nonpolar groups may sterically interfere with monosaccharide binding. The location of the mannose-binding site in AQN-1 appears to be topologically conserved in other heparin-binding boar spermadhesins, i.e., AQN-3 and AWN, but departs from the location of the mannose-6-phosphate-recognition site of PSP-II. This indicates that different spermadhesin molecules have evolved non-equivalent carbohydrate-binding capabilities, which may underlie their distinct patterns of biological activities.

Development of a Surface Plasmon Resonance Assay for the Characterization of Small-Molecule Binding Kinetics and Mechanism of Binding to Kynurenine 3-Monooxygenase.

PubMed

Poda, Suresh B; Kobayashi, Masakazu; Nachane, Ruta; Menon, Veena; Gandhi, Adarsh S; Budac, David P; Li, Guiying; Campbell, Brian M; Tagmose, Lena

2015-10-01

Kynurenine 3-monooxygenase (KMO), a pivotal enzyme in the kynurenine pathway, was identified as a potential therapeutic target for treating neurodegenerative and psychiatric disorders. In this article, we describe a surface plasmon resonance (SPR) assay that delivers both kinetics and the mechanism of binding (MoB) data, enabling a detailed characterization of KMO inhibitors for the enzyme in real time. SPR assay development included optimization of the protein construct and the buffer conditions. The stability and inhibitor binding activity of the immobilized KMO were significantly improved when the experiments were performed at 10°C using a buffer containing 0.05% n-dodecyl-β-d-maltoside (DDM) as the detergent. The KD values of the known KMO inhibitors (UPF648 and RO61-8048) from the SPR assay were in good accordance with the biochemical LC/MS/MS assay. Also, the SPR assay was able to differentiate the binding kinetics (k(a) and k(d)) of the selected unknown KMO inhibitors. For example, the inhibitors that showed comparable IC50 values in the LC/MS/MS assay displayed differences in their residence time (τ = 1/k(d)) in the SPR assay. To better define the MoB of the inhibitors to KMO, an SPR-based competition assay was developed, which demonstrated that both UPF648 and RO61-8048 bound to the substrate-binding site. These results demonstrate the potential of the SPR assay for characterizing the affinity, the kinetics, and the MoB profiles of the KMO inhibitors.

Recombinant human antibody fragment against tetanus toxoid produced by phage display

PubMed Central

Neelakantam, B.; Sridevi, N. V.; Shukra, A. M.; Sugumar, P.; Samuel, S.

2014-01-01

Phage display technology is a powerful in vitro method for the identification of specific monoclonal antibodies (antibody fragments) to an antigenic target and allows the rapid generation and selection of high affinity, fully human antibodies directed toward any disease target appropriate for antibody therapy. In the present study, we exploited the phage display technology for the selection of an antigen binding fragment (Fabs) toward tetanus toxoid using human naïve phage antibody library constructed from peripheral blood lymphocytes of naïve human donors. The phages displaying Fab were subjected to three rounds of bio-panning with tetanus toxoid as antigen on a solid phase. The high affinity antibody fragments were expressed in HB2151 strain of Escherichia coli and purified by immobilized metal affinity chromatography. The binding activity and specificity of the antibody fragment was established by its reactivity toward tetanus toxoid and non-reactivity toward other related toxins as determined by enzyme-linked immunosorbent assay and immunoblot analysis. The selected Fab fragment forming the antigen-binding complexes with the toxoid in flocculation assay indicates that the Fab may have a potential neutralizing ability toward antigen. PMID:24678405

Fatty Acid-binding Proteins Interact with Comparative Gene Identification-58 Linking Lipolysis with Lipid Ligand Shuttling*

PubMed Central

Hofer, Peter; Boeszoermenyi, Andras; Jaeger, Doris; Feiler, Ursula; Arthanari, Haribabu; Mayer, Nicole; Zehender, Fabian; Rechberger, Gerald; Oberer, Monika; Zimmermann, Robert; Lass, Achim; Haemmerle, Guenter; Breinbauer, Rolf; Zechner, Rudolf; Preiss-Landl, Karina

2015-01-01

The coordinated breakdown of intracellular triglyceride (TG) stores requires the exquisitely regulated interaction of lipolytic enzymes with regulatory, accessory, and scaffolding proteins. Together they form a dynamic multiprotein network designated as the “lipolysome.” Adipose triglyceride lipase (Atgl) catalyzes the initiating step of TG hydrolysis and requires comparative gene identification-58 (Cgi-58) as a potent activator of enzyme activity. Here, we identify adipocyte-type fatty acid-binding protein (A-Fabp) and other members of the fatty acid-binding protein (Fabp) family as interaction partners of Cgi-58. Co-immunoprecipitation, microscale thermophoresis, and solid phase assays proved direct protein/protein interaction between A-Fabp and Cgi-58. Using nuclear magnetic resonance titration experiments and site-directed mutagenesis, we located a potential contact region on A-Fabp. In functional terms, A-Fabp stimulates Atgl-catalyzed TG hydrolysis in a Cgi-58-dependent manner. Additionally, transcriptional transactivation assays with a luciferase reporter system revealed that Fabps enhance the ability of Atgl/Cgi-58-mediated lipolysis to induce the activity of peroxisome proliferator-activated receptors. Our studies identify Fabps as crucial structural and functional components of the lipolysome. PMID:25953897

Surface changes and polymyxin interactions with a resistant strain of Klebsiella pneumoniae.

PubMed

Velkov, Tony; Deris, Zakuan Z; Huang, Johnny X; Azad, Mohammad A K; Butler, Mark; Sivanesan, Sivashangarie; Kaminskas, Lisa M; Dong, Yao-Da; Boyd, Ben; Baker, Mark A; Cooper, Matthew A; Nation, Roger L; Li, Jian

2014-05-01

This study examines the interaction of polymyxin B and colistin with the surface and outer membrane components of a susceptible and resistant strain of Klebsiella pneumoniae. The interaction between polymyxins and bacterial membrane and isolated LPS from paired wild type and polymyxin-resistant strains of K. pneumoniae were examined with N-phenyl-1-naphthylamine (NPN) uptake, fluorometric binding and thermal shift assays, lysozyme and deoxycholate sensitivity assays, and by (1)H NMR. LPS from the polymyxin-resistant strain displayed a reduced binding affinity for polymyxins B and colistin in comparison with the wild type LPS. The outer membrane NPN permeability of the resistant strain was greater compared with the susceptible strain. Polymyxin exposure enhanced the permeability of the outer membrane of the wild type strain to lysozyme and deoxycholate, whereas polymyxin concentrations up to 32 mg/ml failed to permeabilize the outer membrane of the resistant strain. Zeta potential measurements revealed that mid-logarithmic phase wild type cells exhibited a greater negative charge than the mid-logarithmic phase-resistant cells. Taken together, our findings suggest that the resistant derivative of K. pneumoniae can block the electrostatically driven first stage of polymyxin action, which thereby renders the hydrophobically driven second tier of polymyxin action on the outer membrane inconsequential.

Principles of quantitation of viral loads using nucleic acid sequence-based amplification in combination with homogeneous detection using molecular beacons.

PubMed

Weusten, Jos J A M; Carpay, Wim M; Oosterlaken, Tom A M; van Zuijlen, Martien C A; van de Wiel, Paul A

2002-03-15

For quantitative NASBA-based viral load assays using homogeneous detection with molecular beacons, such as the NucliSens EasyQ HIV-1 assay, a quantitation algorithm is required. During the amplification process there is a constant growth in the concentration of amplicons to which the beacon can bind while generating a fluorescence signal. The overall fluorescence curve contains kinetic information on both amplicon formation and beacon binding, but only the former is relevant for quantitation. In the current paper, mathematical modeling of the relevant processes is used to develop an equation describing the fluorescence curve as a function of the amplification time and the relevant kinetic parameters. This equation allows reconstruction of RNA formation, which is characterized by an exponential increase in concentrations as long as the primer concentrations are not rate limiting and by linear growth over time after the primer pool is depleted. During the linear growth phase, the actual quantitation is based on assessing the amplicon formation rate from the viral RNA relative to that from a fixed amount of calibrator RNA. The quantitation procedure has been successfully applied in the NucliSens EasyQ HIV-1 assay.

Aptamer Internalization via Endocytosis Inducing S-Phase Arrest and Priming Maver-1 Lymphoma Cells for Cytarabine Chemotherapy.

PubMed

Li, Huan; Yang, Shuanghui; Yu, Ge; Shen, Liangfang; Fan, Jia; Xu, Ling; Zhang, Hedong; Zhao, Nianxi; Zeng, Zihua; Hu, Tony; Wen, Jianguo; Zu, Youli

2017-01-01

The goal of precision therapy is to efficiently treat cancer without side effects. Aptamers are a class of small ligands composed of single-stranded oligonucleotides that bind to their targets with high affinity and specificity. In this study, we identified an ssDNA aptamer specifically targeting Maver-1 lymphoma cells with high binding affinity (K d = 70±8 pmol/L). Interestingly, cellular cycle studies revealed that exposure of Maver-1 cells to synthetic aptamers triggered S-phase arrest of 40% of the cells (vs. 18% baseline). Confocal microscopy confirmed specific cell binding of aptamers and the resultant endocytosis into Maver-1 cells. Subsequent functional assays validated the fact that aptamer internalization into targeted cells is a prerequisite for Maver-1 cell growth inhibition. Importantly, aptamer-induced S-phase arrest induced enhanced chemotherapeutic results involving cytarabine, which primarily kills lymphoma cells at S-phase. Combination treatments revealed that aptamer re-exposure considerably primed Maver-1 cells for cytarabine chemotherapy, thus achieving a synergistic killing effect by reaching cell death rates as high as 61% (vs. 13% or 14% induced by aptamer or cytarabine treatment alone). These findings demonstrated that aptamers do not only act as molecular ligands but can also function as biotherapeutic agents by inducing S-phase arrest of lymphoma cells. In addition, logical combination of aptamer and cytarabine treatments ushers the way to a unique approach in precision lymphoma chemotherapy.

Aptamer Internalization via Endocytosis Inducing S-Phase Arrest and Priming Maver-1 Lymphoma Cells for Cytarabine Chemotherapy

PubMed Central

Li, Huan; Yang, Shuanghui; Yu, Ge; Shen, Liangfang; Fan, Jia; Xu, Ling; Zhang, Hedong; Zhao, Nianxi; Zeng, Zihua; Hu, Tony; Wen, Jianguo; Zu, Youli

2017-01-01

The goal of precision therapy is to efficiently treat cancer without side effects. Aptamers are a class of small ligands composed of single-stranded oligonucleotides that bind to their targets with high affinity and specificity. In this study, we identified an ssDNA aptamer specifically targeting Maver-1 lymphoma cells with high binding affinity (Kd = 70±8 pmol/L). Interestingly, cellular cycle studies revealed that exposure of Maver-1 cells to synthetic aptamers triggered S-phase arrest of 40% of the cells (vs. 18% baseline). Confocal microscopy confirmed specific cell binding of aptamers and the resultant endocytosis into Maver-1 cells. Subsequent functional assays validated the fact that aptamer internalization into targeted cells is a prerequisite for Maver-1 cell growth inhibition. Importantly, aptamer-induced S-phase arrest induced enhanced chemotherapeutic results involving cytarabine, which primarily kills lymphoma cells at S-phase. Combination treatments revealed that aptamer re-exposure considerably primed Maver-1 cells for cytarabine chemotherapy, thus achieving a synergistic killing effect by reaching cell death rates as high as 61% (vs. 13% or 14% induced by aptamer or cytarabine treatment alone). These findings demonstrated that aptamers do not only act as molecular ligands but can also function as biotherapeutic agents by inducing S-phase arrest of lymphoma cells. In addition, logical combination of aptamer and cytarabine treatments ushers the way to a unique approach in precision lymphoma chemotherapy. PMID:28435459

Opposite beta2-glycoprotein I requirement for the binding of infectious and autoimmune antiphospholipid antibodies to cardiolipin liposomes is associated with antibody avidity.

PubMed

Celli, C M; Gharavi, A E; Chaimovich, H

1999-01-12

The aim of this study was to investigate the interaction of antiphospholipid antibodies (aPL) from two different populations (patients with autoimmune or infectious disorders) with cardiolipin (CL) arranged in a defined bilayer. beta2-Glycoprotein I (beta2GPI), an apolipoprotein that plays a critical role in the aPL binding to phospholipids, was quantified by dot blot in purified IgG-aPL samples, further classified according to apparent avidity to CL. In solid-phase assays, beta2GPI increased, preferentially, the binding of low-avidity autoimmune aPL to CL but inhibited the binding of low-avidity syphilitic aPL. In the absence of beta2GPI, both autoimmune and infectious aPL induced the leakage of the entrapped fluorescent probe, carboxyfluorescein (CF), from small unilamellar vesicles containing CL. aPL-induced probe leakage was protein concentration-dependent and characterized by a lag-phase onset of 100-120 min. beta2GPI increased the leakage rate induced by low-avidity autoimmune aPL only and inhibited the leakage induced by all syphilitic aPL. The following conclusions were provided: (1) in the absence of beta2GPI, autoimmune and infectious aPL bind to CL in a bilayer, inducing liposome leakage; (2) the leakage mechanism induced by aPL is suggested to be intravesicular; (3) beta2GPI requirement for phospholipid binding in both solid and fluid phase is associated to aPL avidity; (4) CL alone or the CL-beta2GPI complex are the most likely epitopes for autoimmune aPL; (5) aPL from syphilis patients can only form the CL-aPL complex, supporting that beta2GPI is not (part of) the target epitope.

Alkyne-substituted diminazene as G-quadruplex binders with anticancer activities.

PubMed

Wang, Changhao; Carter-Cooper, Brandon; Du, Yixuan; Zhou, Jie; Saeed, Musabbir A; Liu, Jinbing; Guo, Min; Roembke, Benjamin; Mikek, Clinton; Lewis, Edwin A; Lapidus, Rena G; Sintim, Herman O

2016-08-08

G-quadruplex ligands have been touted as potential anticancer agents, however, none of the reported G-quadruplex-interactive small molecules have gone past phase II clinical trials. Recently it was revealed that diminazene (berenil, DMZ) actually binds to G-quadruplexes 1000 times better than DNA duplexes, with dissociation constants approaching 1 nM. DMZ however does not have strong anticancer activities. In this paper, using a panel of biophysical tools, including NMR, FRET melting assay and FRET competition assay, we discovered that monoamidine analogues of DMZ bearing alkyne substitutes selectively bind to G-quadruplexes. The lead DMZ analogues were shown to be able to target c-MYC G-quadruplex both in vitro and in vivo. Alkyne DMZ analogues display respectable anticancer activities (single digit micromolar GI50) against ovarian (OVCAR-3), prostate (PC-3) and triple negative breast (MDA-MB-231) cancer cell lines and represent interesting new leads to develop anticancer agents. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Evaluation of potential endocrine activity of 2,4-dichlorophenoxyacetic acid using in vitro assays.

PubMed

Coady, Katherine K; Kan, H Lynn; Schisler, Melissa R; Gollapudi, B Bhaskar; Neal, Barbara; Williams, Amy; LeBaron, Matthew J

2014-08-01

The herbicide 2,4-dichlorophenoxyacetic acid (2,4-D) was evaluated in five in vitro screening assays to assess the potential for interaction with the androgen, estrogen and steroidogenesis pathways in the endocrine system. The assays were conducted to meet the requirements of the in vitro component of Tier 1 of the United States Environmental Protection Agency's Endocrine Disruptor Screening Program (EDSP), and included assays for estrogen receptor (ER) binding (rat uterine cytosol ER binding assay), ER-mediated transcriptional activation (HeLa-9903-ERα transactivation assay), androgen receptor (AR) binding (rat prostate cytosol AR binding assay), aromatase enzymatic activity inhibition (recombinant human CYP19 aromatase inhibition assay), and interference with steroidogenesis (H295R steroidogenesis assay). Results from these five assays demonstrated that 2,4-D does not have the potential to interact in vitro with the estrogen, androgen, or steroidogenesis pathways. These in vitro data are consistent with a corresponding lack of endocrine effects observed in apical in vivo animal studies, and thus provide important supporting data valuable in a comprehensive weight of evidence evaluation indicating a low potential of 2,4-D to interact with the endocrine system. Copyright © 2014 Elsevier Ltd. All rights reserved.

Dicationic Surfactants with Glycine Counter Ions for Oligonucleotide Transportation.

PubMed

Pietralik, Zuzanna; Skrzypczak, Andrzej; Kozak, Maciej

2016-08-04

Gemini surfactants are good candidates to bind, protect, and deliver nucleic acids. Herein, the concept of amino acids (namely glycine) as counter ions of gemini surfactants for gene therapy application was explored. This study was conducted on DNA and RNA oligomers and two quaternary bis-imidazolium salts, having 2,5-dioxahexane and 2,8-dioxanonane spacer groups. The toxicity level of surfactants was assessed by an MTT assay, and their ability to bind nucleic acids was tested through electrophoresis. The nucleic acid conformation was established based on circular dichroism and infrared spectroscopic analyses. The structures of the formed complexes were characterized by small-angle scattering of synchrotron radiation. Both studied surfactants appear to be suitable for gene therapy; however, although they vary by only three methylene groups in the spacer, they differ in binding ability and toxicity. The tested oligonucleotides maintained their native conformations upon surfactant addition and the studied lipoplexes formed a variety of structures. In systems based on a 2,5-dioxahexane spacer, a hexagonal phase was observed for DNA-surfactant complexes and a micellar phase was dominant with RNA. For the surfactant with a 2,8-dioxanonane spacer group, the primitive cubic phase prevailed. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Azadioxatriangulenium: a long fluorescence lifetime fluorophore for large biomolecule binding assay

NASA Astrophysics Data System (ADS)

Just Sørensen, Thomas; Thyrhaug, Erling; Szabelski, Mariusz; Luchowski, Rafal; Gryczynski, Ignacy; Gryczynski, Zygmunt; Laursen, Bo W.

2013-06-01

Of the many optical bioassays available, sensing by fluorescence anisotropy has great advantages as it provides a sensitive, instrumentally simple, ratiometric method of detection. However, it is hampered by a severe limitation, as the emission lifetime of the label needs to be comparable to the correlation lifetime (tumbling time) of the biomolecule which is labelled. For proteins of moderate size this is on the order of 20-200 ns, which due to practical issues currently limits the choice of labels to the dansyl-type dyes and certain aromatic dyes. These have the significant drawback of UV/blue absorption and emission as well as an often significant solvent sensitivity. Here, we report the synthesis and characterization of a new fluorescent label for high molecular weight biomolecule assay based on the azadioxatriangulenium motif. The NHS ester of the long fluorescence lifetime, red-emitting fluorophore: azadioxatriangulenium (ADOTA-NHS) was conjugated to anti-rabbit Immunoglobulin G (antiIgG). The long fluorescence lifetime was exploited to determine the correlation time of the high molecular weight antibody and its complex with rabbit Immunoglobulin G (IgG) with steady-state fluorescence anisotropy and time-resolved methods: solution phase immuno-assay was performed following either steady-state or time-resolved fluorescence anisotropy. By performing a variable temperature experiment it was determined that the binding of the ligand resulted in an increase in correlation time of more than 75%, and an increase in the steady-state anisotropy of 18%. The results show that the triangulenium class of dyes can be used in anisotropy assay to detect binding events involving biomolecules of far larger size than what is possible with most other red-emitting organic dyes.

Interaction between bioactive compound 11a-N-tosyl-5-deoxi-pterocarpan (LQB-223) and Calf thymus DNA: Spectroscopic approach, electrophoresis and theoretical studies.

PubMed

Silva, Marina M; Nascimento, Eduarda O O; Silva, Edeíldo F; Araújo, João Xavier de; Santana, Camilla C; Grillo, Luciano Aparecido M; de Oliveira, Rafaela S; R R Costa, Paulo; Buarque, Camilla D; Santos, Josué Carinhanha C; Figueiredo, Isis M

2017-03-01

The interaction of small molecules with DNA has been quite important, since this biomolecule is currently the major target for a wide range of drugs in clinical use or advanced clinical research phase. Thus, the present work aimed to assess the interaction process between the bioactive compound 11a-N-tosyl-5-carba-pterocarpan, (LQB-223), that presents antitumor activity, with DNA, employing spectroscopic techniques, electrophoresis, viscosity and theoretical studies. Through UV-vis and molecular fluorescence spectroscopy, it was possible to infer that the preferential quenching mechanism was static, characterized by non-fluorescent supramolecular complex formation between the LQB-223 and DNA. The binding constant was 1.94∙10 3 Lmol -1 (30°C) and, according to the thermodynamic parameters, the main forces involved in the interaction process are hydrophobic. Potassium iodide assay, competition with ethidium bromide, fluorescence contact energy transfer and melting temperature profile of DNA were employed to evaluate the binding mode. Except for KI assay, all results obtained indicated minor groove as the preferential binding mode of LQB-223 to DNA. These observations were supported by ionic strength assay, viscosity and molecular dynamics and docking studies. Finally, electrophoresis analysis demonstrated that the interaction does not promote DNA fragmentation, but it leads to variation in the migration profile after increasing the ligand concentration. Copyright © 2016 Elsevier B.V. All rights reserved.

Application of the novel bioluminescent ligand-receptor binding assay to relaxin-RXFP1 system for interaction studies.

PubMed

Wu, Qing-Ping; Zhang, Lei; Shao, Xiao-Xia; Wang, Jia-Hui; Gao, Yu; Xu, Zeng-Guang; Liu, Ya-Li; Guo, Zhan-Yun

2016-04-01

Relaxin is a prototype of the relaxin family peptide hormones and plays important biological functions by binding and activating the G protein-coupled receptor RXFP1. To study their interactions, in the present work, we applied the newly developed bioluminescent ligand-receptor binding assay to the relaxin-RXFP1 system. First, a fully active easily labeled relaxin, in which three Lys residues of human relaxin-2 were replaced by Arg, was prepared through overexpression of a single-chain precursor in Pichia pastoris and in vitro enzymatic maturation. Thereafter, the B-chain N-terminus of the easily labeled relaxin was chemically cross-linked with a C-terminal cysteine residue of an engineered NanoLuc through a disulfide linkage. Receptor-binding assays demonstrated that the NanoLuc-conjugated relaxin retained high binding affinity with the receptor RXFP1 (K d = 1.11 ± 0.08 nM, n = 3) and was able to sensitively monitor binding of a variety of ligands with RXFP1. Using the novel bioluminescent binding assay, we demonstrated that three highly conserved B-chain Arg residues of relaxin-3 had distinct contributions to binding of the receptor RXFP1. In summary, our present work provides a novel bioluminescent ligand-receptor binding assay for the relaxin-RXFP1 system to facilitate their interaction studies, such as characterization of relaxin analogues or screening novel agonists or antagonists of RXFP1.

HPV binding assay to Laminin-332/integrin α6β4 on human keratinocytes.

PubMed

Brendle, Sarah A; Christensen, Neil D

2015-01-01

Human papillomaviruses (HPVs) have been shown to bind to Laminin-332 (Ln-332) on the extracellular matrix (ECM) secreted by human keratinocytes. The assay described here is an important tool to study HPV receptor binding to the ECM. The assay can also be modified to study the receptors required for HPV infection and for binding to tissues. We previously showed that Ln-332 is essential for the binding of HPV11 to human keratinocytes and that infectious entry of HPV11 requires α6β4 integrin for the transfer of HPV11 from ECM to host cells (Culp et al., J Virol 80:8940-8950, 2006). We also demonstrated that several of the high-risk HPV types (16, 18, 31 and 45) bind to Ln-332 and/or other components of the ECM in vitro (Broutian et al., J Gen Virol 91:531-540, 2010). The exact binding and internalization mechanism(s) for HPV are still under investigation. A better understanding of these mechanisms will aid in the design of therapeutics against HPVs and ultimately help prevent many cancers. In this chapter, we describe the HPV binding assay to Ln-332/integrin α6β4 on human keratinocytes (ECM). We also present data and suggestions for modifying the assay for testing the specificity of HPV for receptors (by blocking receptors) and binding to human tissues (basement membrane, BM) in order to study binding mechanisms.

Development of on-chip fully automated immunoassay system "μTASWako i30" to measure the changes in glycosylation profiles of alpha-fetoprotein in patients with hepatocellular carcinoma.

PubMed

Kurosawa, Tatsuo; Watanabe, Mitsuo

2016-12-01

Glycosylation profiles significantly change during oncogenesis. Aberrant glycosylation can be used as a cancer biomarker in clinical settings. Different glycoforms can be separately detected using lectin affinity electrophoresis and lectin array-based methods. However, most methodologies and procedures need experienced technique to perform the assays and expertise to interpret the results. To apply glycomarkers for clinical practice, a robust assay system with an easy-to-use workflow is required. Wako's μTASWako i30, a fully automated immunoanalyzer, was developed for in vitro diagnostics based on microfluidic technology. It utilizes the principles of liquid-phase binding assay, where immunoreactions are performed in a liquid phase, and electrokinetic analyte transport assay. Capillary electrophoresis on microfluidic chip has enabled the detection of different glycoform types of alpha-fetoprotein (AFP), a serum biomarker for hepatocellular carcinoma. AFP with altered glycosylation can be separated based on the reactivity to Lens culinaris agglutinin on electrophoresis. The glycoform AFP-L3 was reportedly more specific in hepatocellular carcinoma. This assay system can provide a high sensitivity and rapid results in 9 min. The test results for ratio of AFP-L3 to total AFP using μTASWako i30 are correlated with those of conventional methodology. The μTASWako assay system and the technology can be utilized for glycosylation analysis in the postgenomic era. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Construction Strategy for an Internal Amplification Control for Real-Time Diagnostic Assays Using Nucleic Acid Sequence-Based Amplification: Development and Clinical Application

PubMed Central

Rodríguez-Lázaro, David; D'Agostino, Martin; Pla, Maria; Cook, Nigel

2004-01-01

An important analytical control in molecular amplification-based methods is an internal amplification control (IAC), which should be included in each reaction mixture. An IAC is a nontarget nucleic acid sequence which is coamplified simultaneously with the target sequence. With negative results for the target nucleic acid, the absence of an IAC signal indicates that amplification has failed. A general strategy for the construction of an IAC for inclusion in molecular beacon-based real-time nucleic acid sequence-based amplification (NASBA) assays is presented. Construction proceeds in two phases. In the first phase, a double-stranded DNA molecule that contains nontarget sequences flanked by target sequences complementary to the NASBA primers is produced. At the 5′ end of this DNA molecule is a T7 RNA polymerase binding sequence. In the second phase of construction, RNA transcripts are produced from the DNA by T7 RNA polymerase. This RNA is the IAC; it is amplified by the target NASBA primers and is detected by a molecular beacon probe complementary to the internal nontarget sequences. As a practical example, an IAC for use in an assay for the detection of Mycobacterium avium subsp. paratuberculosis is described, its incorporation and optimization within the assay are detailed, and its application to spiked and natural clinical samples is shown to illustrate the correct interpretation of the diagnostic results. PMID:15583319

Development Of Antibody-Based Fiber-Optic Sensors

NASA Astrophysics Data System (ADS)

Tromberg, Bruce J.; Sepaniak, Michael J.; Vo-Dinh, Tuan

1988-06-01

The speed and specificity characteristic of immunochemical complex formation has encouraged the development of numerous antibody-based analytical techniques. The scope and versatility of these established methods can be enhanced by combining the principles of conventional immunoassay with laser-based fiber-optic fluorimetry. This merger of spectroscopy and immunochemistry provides the framework for the construction of highly sensitive and selective fiber-optic devices (fluoroimmuno-sensors) capable of in-situ detection of drugs, toxins, and naturally occurring biochemicals. Fluoroimmuno-sensors (FIS) employ an immobilized reagent phase at the sampling terminus of a single quartz optical fiber. Laser excitation of antibody-bound analyte produces a fluorescence signal which is either directly proportional (as in the case of natural fluorophor and "antibody sandwich" assays) or inversely proportional (as in the case of competitive-binding assays) to analyte concentration. Factors which influence analysis time, precision, linearity, and detection limits include the nature (solid or liquid) and amount of the reagent phase, the method of analyte delivery (passive diffusion, convection, etc.), and whether equilibrium or non-equilibrium assays are performed. Data will be presented for optical fibers whose sensing termini utilize: (1) covalently-bound solid antibody reagent phases, and (2) membrane-entrapped liquid antibody reagents. Assays for large-molecular weight proteins (antigens) and small-molecular weight, carcinogenic, polynuclear aromatics (haptens) will be considered. In this manner, the influence of a system's chemical characteristics and measurement requirements on sensor design, and the consequence of various sensor designs on analytical performance will be illustrated.

Interfacial bioconjugation on emulsion droplet for biosensors.

PubMed

Zhang, Qifan; Scigliano, Anita; Biver, Tarita; Pucci, Andrea; Swager, Timothy M

2018-04-13

Interfacial bioconjugation methods are developed for intact liquid emulsion droplets. Complex emulsion droplets having internal hydrocarbon and fluorocarbon immiscible structured phases maintain a dynamic interface for controlled interfacial reactivity. The internal morphological change after binding to biomolecules is readily visualized and detected by light transmission, which provides a platform for the formation of inexpensive and portable bio-sensing assays for enzymes, antibodies, nucleic acids and carbohydrates. Copyright © 2018. Published by Elsevier Ltd.

DNA Replication Arrest and DNA Damage Responses Induced by Alkylating Minor Groove Binders

DTIC Science & Technology

2001-05-01

We are interested in the molecular mechanisms involved in DNA replication arrest by the S phase DNA damage checkpoints. Using in vitro simian virus...40 DNA replication assays, we have found three factors that directly contribute to DNA damage-induced DNA replication arrest: Replication Protein A...trans-acting inhibitors. RPA is the major eukaryotic single-stranded DNA binding protein required for DNA replication , repair and recombination. Upon DNA

A novel assay to identify the trafficking proteins that bind to specific vesicle populations

PubMed Central

Bentley, Marvin; Banker, Gary

2016-01-01

Here we describe a method capable of identifying interactions between candidate trafficking proteins and a defined vesicle population in intact cells. The assay involves the expression of an FKBP12-rapamycin–binding domain (FRB)–tagged candidate vesicle-binding protein that can be inducibly linked to an FKBP-tagged molecular motor. If the FRB-tagged candidate protein binds the labeled vesicles, then linking the FRB and FKBP domains recruits motors to the vesicles and causes a predictable, highly distinctive change in vesicle trafficking. We describe two versions of the assay: a general protocol for use in cells with a typical microtubule-organizing center and a specialized protocol designed to detect protein-vesicle interactions in cultured neurons. We have successfully used this assay to identify kinesins and Rabs that bind to a variety of different vesicle populations. In principle, this assay could be used to investigate interactions between any category of vesicle trafficking proteins and any vesicle population that can be specifically labeled. PMID:26621371

Membrane proteins bind lipids selectively to modulate their structure and function.

PubMed

Laganowsky, Arthur; Reading, Eamonn; Allison, Timothy M; Ulmschneider, Martin B; Degiacomi, Matteo T; Baldwin, Andrew J; Robinson, Carol V

2014-06-05

Previous studies have established that the folding, structure and function of membrane proteins are influenced by their lipid environments and that lipids can bind to specific sites, for example, in potassium channels. Fundamental questions remain however regarding the extent of membrane protein selectivity towards lipids. Here we report a mass spectrometry approach designed to determine the selectivity of lipid binding to membrane protein complexes. We investigate the mechanosensitive channel of large conductance (MscL) from Mycobacterium tuberculosis and aquaporin Z (AqpZ) and the ammonia channel (AmtB) from Escherichia coli, using ion mobility mass spectrometry (IM-MS), which reports gas-phase collision cross-sections. We demonstrate that folded conformations of membrane protein complexes can exist in the gas phase. By resolving lipid-bound states, we then rank bound lipids on the basis of their ability to resist gas phase unfolding and thereby stabilize membrane protein structure. Lipids bind non-selectively and with high avidity to MscL, all imparting comparable stability; however, the highest-ranking lipid is phosphatidylinositol phosphate, in line with its proposed functional role in mechanosensation. AqpZ is also stabilized by many lipids, with cardiolipin imparting the most significant resistance to unfolding. Subsequently, through functional assays we show that cardiolipin modulates AqpZ function. Similar experiments identify AmtB as being highly selective for phosphatidylglycerol, prompting us to obtain an X-ray structure in this lipid membrane-like environment. The 2.3 Å resolution structure, when compared with others obtained without lipid bound, reveals distinct conformational changes that re-position AmtB residues to interact with the lipid bilayer. Our results demonstrate that resistance to unfolding correlates with specific lipid-binding events, enabling a distinction to be made between lipids that merely bind from those that modulate membrane protein structure and/or function. We anticipate that these findings will be important not only for defining the selectivity of membrane proteins towards lipids, but also for understanding the role of lipids in modulating protein function or drug binding.

Lectin binding assays for in-process monitoring of sialylation in protein production.

PubMed

Xu, Weiduan; Chen, Jianmin; Yamasaki, Glenn; Murphy, John E; Mei, Baisong

2010-07-01

Many therapeutic proteins require appropriate glycosylation for their biological activities and plasma half life. Coagulation factor VIII (FVIII) is a glycoprotein which has extensive post-translational modification by N-linked glycosylation. The terminal sialic acid in the N-linked glycans of FVIII is required for maximal circulatory half life. The extent of FVIII sialylation can be determined by high pH anion-exchange chromatography coupled with a pulse electrochemical detector (HPAEC-PED), but this requires a large amount of purified protein. Using FVIII as a model, the objective of the present study was to develop assays that enable detection and prediction of sialylation deficiency at an early stage in the process and thus prevent downstream product quality excursions. Lectin ECA (Erythrina Cristagalli) binds to unsialylated Galbeta1-4 GlcNAc and the ECA-binding level (i.e., terminal Gal(beta1-4) exposure) is inversely proportional to the level of sialylation. By using ECA, a cell-based assay was developed to measure the global sialylation profile in FVIII producing cells. To examine the Galbeta1-4 exposure on the FVIII molecule in bioreactor tissue culture fluid (TCF), an ELISA-based ECA-FVIII binding assay was developed. The ECA-binding specificity in both assays was assessed by ECA-specific sugar inhibitors and neuraminidase digestion. The ECA-binding specificity was also independently confirmed by a ST3GAL4 siRNA knockdown experiment. To establish the correlation between Galbeta1-4 exposure and the HPAEC-PED determined FVIII sialylation value, the FVIII containing bioreactor TCF and the purified FVIII samples were tested with ECA ELISA binding assay. The results indicated an inverse correlation between ECA binding and the corresponding HPAEC-PED sialylation value. The ECA-binding assays are cost effective and can be rapidly performed, thereby making them effective for in-process monitoring of protein sialylation.

Identification of candidate diagnostic serum biomarkers for Kawasaki disease using proteomic analysis

PubMed Central

Kimura, Yayoi; Yanagimachi, Masakatsu; Ino, Yoko; Aketagawa, Mao; Matsuo, Michie; Okayama, Akiko; Shimizu, Hiroyuki; Oba, Kunihiro; Morioka, Ichiro; Imagawa, Tomoyuki; Kaneko, Tetsuji; Yokota, Shumpei; Hirano, Hisashi; Mori, Masaaki

2017-01-01

Kawasaki disease (KD) is a systemic vasculitis and childhood febrile disease that can lead to cardiovascular complications. The diagnosis of KD depends on its clinical features, and thus it is sometimes difficult to make a definitive diagnosis. In order to identify diagnostic serum biomarkers for KD, we explored serum KD-related proteins, which differentially expressed during the acute and recovery phases of two patients by mass spectrometry (MS). We identified a total of 1,879 proteins by MS-based proteomic analysis. The levels of three of these proteins, namely lipopolysaccharide-binding protein (LBP), leucine-rich alpha-2-glycoprotein (LRG1), and angiotensinogen (AGT), were higher in acute phase patients. In contrast, the level of retinol-binding protein 4 (RBP4) was decreased. To confirm the usefulness of these proteins as biomarkers, we analyzed a total of 270 samples, including those collected from 55 patients with acute phase KD, by using western blot analysis and microarray enzyme-linked immunosorbent assays (ELISAs). Over the course of this experiment, we determined that the expression level of these proteins changes specifically in the acute phase of KD, rather than the recovery phase of KD or other febrile illness. Thus, LRG1 could be used as biomarkers to facilitate KD diagnosis based on clinical features. PMID:28262744

Dye-binding assays for evaluation of the effects of small molecule inhibitors on amyloid (aβ) self-assembly.

PubMed

Jameson, Laramie P; Smith, Nicholas W; Dzyuba, Sergei V

2012-11-21

Dye-binding assays, such as those utilizing Congo red and thioflavin T, are among the most widely used tools to probe the aggregation of amyloidogenic biomolecules and for the evaluation of small molecule inhibitors of amyloid aggregation and fibrillization. A number of recent reports have indicated that these dye-binding assays could be prone to false positive effects when assessing inhibitors' potential toward Aβ peptides, species involved in Alzheimer's disease. Specifically, this review focuses on the application of thioflavin T for determining the efficiency of small molecule inhibitors of Aβ aggregation and addresses potential reasons that might be associated with the false positive effects in an effort to increase reliability of dye-binding assays.

Dye-Binding Assays for Evaluation of the Effects of Small Molecule Inhibitors on Amyloid (Aβ) Self-Assembly

PubMed Central

2012-01-01

Dye-binding assays, such as those utilizing Congo red and thioflavin T, are among the most widely used tools to probe the aggregation of amyloidogenic biomolecules and for the evaluation of small molecule inhibitors of amyloid aggregation and fibrillization. A number of recent reports have indicated that these dye-binding assays could be prone to false positive effects when assessing inhibitors’ potential toward Aβ peptides, species involved in Alzheimer’s disease. Specifically, this review focuses on the application of thioflavin T for determining the efficiency of small molecule inhibitors of Aβ aggregation and addresses potential reasons that might be associated with the false positive effects in an effort to increase reliability of dye-binding assays. PMID:23173064

Flow cytometer measurement of binding assays

DOEpatents

Saunders, George C.

1987-01-01

A method of measuring the result of a binding assay that does not require separation of fluorescent smaller particles is disclosed. In a competitive binding assay the smaller fluorescent particles coated with antigen compete with antigen in the sample being analyzed for available binding sites on larger particles. In a sandwich assay, the smaller, fluorescent spheres coated with antibody attach themselves to molecules containing antigen that are attached to larger spheres coated with the same antibody. The separation of unattached, fluorescent smaller particles is made unnecessary by only counting the fluorescent events triggered by the laser of a flow cytometer when the event is caused by a particle with a light scatter measurement within a certain range corresponding to the presence of larger particles.

A High-Throughput TNP-ATP Displacement Assay for Screening Inhibitors of ATP-Binding in Bacterial Histidine Kinases

PubMed Central

Guarnieri, Michael T.; Blagg, Brian S. J.

2011-01-01

Abstract Bacterial histidine kinases (HK) are members of the GHKL superfamily, which share a unique adenosine triphosphate (ATP)-binding Bergerat fold. Our previous studies have shown that Gyrase, Hsp90, MutL (GHL) inhibitors bind to the ATP-binding pocket of HK and may provide lead compounds for the design of novel antibiotics targeting these kinases. In this article, we developed a competition assay using the fluorescent ATP analog, 2′,3′-O-(2,4,6-trinitrophenyl) adenosine 5′-triphosphate. The method can be used for high-throughput screening of compound libraries targeting HKs or other ATP-binding proteins. We utilized the assay to screen a library of GHL inhibitors targeting the bacterial HK PhoQ, and discuss the applications of the 2′,3′-O-(2,4,6-trinitrophenyl) adenosine 5′-triphosphate competition assay beyond GHKL inhibitor screening. PMID:21050069

Concerted application of LC-MS and ligand binding assays to better understand exposure of a large molecule drug.

PubMed

Xu, Weifeng; Jiang, Hao; Titsch, Craig; Gadkari, Snaehal; Batog, Alicja; Wang, Bonnie; Hippeli, Lauren; Yamamoto, Brent; Chadwick, Kristina; Wheeler, Jennifer; Thompson, Chris; Stahl, James; Willett, Scott; DeSilva, Binodh S; Myler, Heather; Dodge, Robert W; Pillutla, Renuka C

2018-06-20

A ligand-binding assay (LBA) was used to measure exposure of PRM-151, the recombinant form of human pentraxin-2 (PTX-2), a complex pentamer with multiple binding partners. However, the assay showed a lack of dose-dependent exposure in select preclinical species and it could not differentiate the infused PRM-151 from the endogenous PTX-2 in nonhuman primates. Instead of assessing interference from its multiple binding partners, which could be time consuming and laborious, a LC-MS assay avoid of these interference was implemented to measure 'total' drug without the use of immunoaffinity capture reagents. The resultant LC-MS data confirmed the original data and the lack of dose-dependent exposure is now understood to be due to the multiple and diverse targets and functions and resultant complex biodistribution rather than an assay artifact.

Magnetic nanobeads present during enzymatic amplification and labeling for a simplified DNA detection protocol based on AC susceptometry

NASA Astrophysics Data System (ADS)

Bejhed, Rebecca S.; Strømme, Maria; Svedlindh, Peter; Ahlford, Annika; Strömberg, Mattias

2015-12-01

Magnetic biosensors are promising candidates for low-cost point-of-care biodiagnostic devices. For optimal efficiency it is crucial to minimize the time and complexity of the assay protocol including target recognition, amplification, labeling and read-out. In this work, possibilities for protocol simplifications for a DNA biodetection principle relying on hybridization of magnetic nanobeads to rolling circle amplification (RCA) products are investigated. The target DNA is recognized through a padlock ligation assay resulting in DNA circles serving as templates for the RCA process. It is found that beads can be present during amplification without noticeably interfering with the enzyme used for RCA (phi29 polymerase). As a result, the bead-coil hybridization can be performed immediately after amplification in a one-step manner at elevated temperature within a few minutes prior to read-out in an AC susceptometer setup, i.e. a combined protocol approach. Moreover, by recording the phase angle ξ = arctan(χ″/χ'), where χ and χ″ are the in-phase and out-of-phase components of the AC susceptibility, respectively, at one single frequency the total assay time for the optimized combined protocol would be no more than 1.5 hours, often a relevant time frame for diagnosis of cancer and infectious disease. Also, applying the phase angle method normalization of AC susceptibility data is not needed. These findings are useful for the development of point-of-care biodiagnostic devices relying on bead-coil binding and magnetic AC susceptometry.

Detection of IgA-class circulating immune complexes (CIC) in sera from patients with IgA nephropathy using a solid-phase anti-C3 Facb enzyme immunoassay (EIA).

PubMed Central

Yagame, M; Tomino, Y; Miura, M; Tanigaki, T; Suga, T; Nomoto, Y; Sakai, H

1987-01-01

The detection of circulating immune complexes (CIC) in sera from patients with IgA nephropathy is described. A solid-phase anti-C3 Facb enzyme immunoassay (EIA) was employed for detection of IgA-, IgG- and IgM-CIC in sera. The C1q-binding enzyme assay was also used for the detection of CIC in sera from these patients and healthy adults. Twenty-two patients with IgA nephropathy, 14 patients with other glomerular diseases and 19 healthy adults were examined by anti-C3 Facb EIA. The levels of IgA-CIC in sera from patients with IgA nephropathy were significantly higher than those in sera from patients with other glomerular diseases and healthy adults. CIC measured by the C1q-binding enzyme assay was detected in some patients with IgA nephropathy. The levels of serum IgA in patients with IgA nephropathy were significantly higher than those in patients with other glomerular diseases and healthy adults. However, there was no significant correlation between the levels of IgA-CIC in sera and those of serum IgA in patients with IgA nephropathy. There was also no significant correlation between the levels of IgA-CIC in sera and the degree of histopathological injuries in the patients. It is concluded that the solid-phase anti-C3 Facb EIA is useful for the detection of IgA-CIC in sera from patients with IgA nephropathy. PMID:3301093

Evaluation of OASIS QSAR Models Using ToxCast™ in Vitro Estrogen and Androgen Receptor Binding Data and Application in an Integrated Endocrine Screening Approach

PubMed Central

Bhhatarai, Barun; Wilson, Daniel M.; Price, Paul S.; Marty, Sue; Parks, Amanda K.; Carney, Edward

2016-01-01

Background: Integrative testing strategies (ITSs) for potential endocrine activity can use tiered in silico and in vitro models. Each component of an ITS should be thoroughly assessed. Objectives: We used the data from three in vitro ToxCast™ binding assays to assess OASIS, a quantitative structure-activity relationship (QSAR) platform covering both estrogen receptor (ER) and androgen receptor (AR) binding. For stronger binders (described here as AC50 < 1 μM), we also examined the relationship of QSAR predictions of ER or AR binding to the results from 18 ER and 10 AR transactivation assays, 72 ER-binding reference compounds, and the in vivo uterotrophic assay. Methods: NovaScreen binding assay data for ER (human, bovine, and mouse) and AR (human, chimpanzee, and rat) were used to assess the sensitivity, specificity, concordance, and applicability domain of two OASIS QSAR models. The binding strength relative to the QSAR-predicted binding strength was examined for the ER data. The relationship of QSAR predictions of binding to transactivation- and pathway-based assays, as well as to in vivo uterotrophic responses, was examined. Results: The QSAR models had both high sensitivity (> 75%) and specificity (> 86%) for ER as well as both high sensitivity (92–100%) and specificity (70–81%) for AR. For compounds within the domains of the ER and AR QSAR models that bound with AC50 < 1 μM, the QSAR models accurately predicted the binding for the parent compounds. The parent compounds were active in all transactivation assays where metabolism was incorporated and, except for those compounds known to require metabolism to manifest activity, all assay platforms where metabolism was not incorporated. Compounds in-domain and predicted to bind by the ER QSAR model that were positive in ToxCast™ ER binding at AC50 < 1 μM were active in the uterotrophic assay. Conclusions: We used the extensive ToxCast™ HTS binding data set to show that OASIS ER and AR QSAR models had high sensitivity and specificity when compounds were in-domain of the models. Based on this research, we recommend a tiered screening approach wherein a) QSAR is used to identify compounds in-domain of the ER or AR binding models and predicted to bind; b) those compounds are screened in vitro to assess binding potency; and c) the stronger binders (AC50 < 1 μM) are screened in vivo. This scheme prioritizes compounds for integrative testing and risk assessment. Importantly, compounds that are not in-domain, that are predicted either not to bind or to bind weakly, that are not active in in vitro, that require metabolism to manifest activity, or for which in vivo AR testing is in order, need to be assessed differently. Citation: Bhhatarai B, Wilson DM, Price PS, Marty S, Parks AK, Carney E. 2016. Evaluation of OASIS QSAR models using ToxCast™ in vitro estrogen and androgen receptor binding data and application in an integrated endocrine screening approach. Environ Health Perspect 124:1453–1461; http://dx.doi.org/10.1289/EHP184 PMID:27152837

A newly identified protein of Leptospira interrogans mediates binding to laminin.

PubMed

Longhi, Mariana T; Oliveira, Tatiane R; Romero, Eliete C; Gonçales, Amane P; de Morais, Zenaide M; Vasconcellos, Silvio A; Nascimento, Ana L T O

2009-10-01

Pathogenic Leptospira is the aetiological agent of leptospirosis, a life-threatening disease that affects populations worldwide. The search for novel antigens that could be relevant in host-pathogen interactions is being pursued. These antigens have the potential to elicit several activities, including adhesion. This study focused on a hypothetical predicted lipoprotein of Leptospira, encoded by the gene LIC12895, thought to mediate attachment to extracellular matrix (ECM) components. The gene was cloned and expressed in Escherichia coli BL21 Star (DE3)pLys by using the expression vector pAE. The recombinant protein tagged with N-terminal hexahistidine was purified by metal-charged chromatography and characterized by circular dichroism spectroscopy. The capacity of the protein to mediate attachment to ECM components was evaluated by binding assays. The leptospiral protein encoded by LIC12895, named Lsa27 (leptospiral surface adhesin, 27 kDa), bound strongly to laminin in a dose-dependent and saturable fashion. Moreover, Lsa27 was recognized by antibodies from serum samples of confirmed leptospirosis specimens in both the initial and the convalescent phases of the disease. Lsa27 is most likely a surface protein of Leptospira as revealed in liquid-phase immunofluorescence assays with living organisms. Taken together, these data indicate that this newly identified membrane protein is expressed during natural infection and may play a role in mediating adhesion of L. interrogans to its host.

Monoclonal antibody proteomics: use of antibody mimotope displaying phages and the relevant synthetic peptides for mAb scouting.

PubMed

Hajdú, István; Flachner, Beáta; Bognár, Melinda; Végh, Barbara M; Dobi, Krisztina; Lőrincz, Zsolt; Lázár, József; Cseh, Sándor; Takács, László; Kurucz, István

2014-08-01

Monoclonal antibody proteomics uses nascent libraries or cloned (Plasmascan™, QuantiPlasma™) libraries of mAbs that react with individual epitopes of proteins in the human plasma. At the initial phase of library creation, cognate protein antigen and the epitope interacting with the antibodies are not known. Scouting for monoclonal antibodies (mAbs) with the best binding characteristics is of high importance for mAb based biomarker assay development. However, in the absence of the identity of the cognate antigen the task represents a challenge. We combined phage display, and surface plasmon resonance (Biacore) experiments to test whether specific phages and the respective mimotope peptides obtained from large scale studies are applicable to determine key features of antibodies for scouting. We show here that mAb captured phage-mimotope heterogeneity that is the diversity of the selected peptide sequences, is inversely correlated with an important binding descriptor; the off-rate of the antibodies and that represents clues for driving the selection of useful mAbs for biomarker assay development. Carefully chosen synthetic mimotope peptides are suitable for specificity testing in competitive assays using the target proteome, in our case the human plasma. Copyright © 2014 Elsevier B.V. All rights reserved.

Glucocorticoid receptor ligand binding in monocytic cells using a microplate assay.

PubMed

Jansen, J; Uitdehaag, B; Koper, J W; van Den Berg, T K

1999-01-01

Glucocorticoids have profound effects on macrophage function and are widely used as anti-inflammatory drugs. Glucocorticoids receptor (GR) ligand binding capacity is a major determinant of cellular glucocorticoid sensitivity. The number and affinity of GR can be measured in a whole cell binding assay using (3)H-dexamethasone. Here, we describe a rapid and simple microplate assay for GR measurement using the human promonocytic cell line THP-1. Copyright 2000 S. Karger AG, Basel.

Homogeneous bioluminescence competitive binding assay for folate based on a coupled glucose-6-phosphate dehydrogenase--bacterial luciferase enzyme system.

PubMed

Huang, W; Feltus, A; Witkowski, A; Daunert, S

1996-05-01

A homogeneous bioluminescence competitive binding assay for folate was developed by using a coupled enzyme system of glucose-6-phosphate dehydrogenase (G6PDH) and bacterial luciferase. A highly substituted G6PDH-folate conjugate was prepared by employing an N-hydroxysuccinimide/carbodiimide method. Folate binding protein inhibits the activity of the conjugate. In the presence of folate, there is a competition between folate and the G6PDH-folate conjugate for the binding site of the folate binding protein, and the activity of the conjugate is recovered. Thus, the concentration of folate can be related to the activity of the G6PDH-folate conjugate, which is directly related to the bioluminescence produced by the coupled enzyme reaction. Using this assay, dose-response curves with a detection limit of 2.5 x 10(-8) M folate were obtained, which is an improvement of an order of magnitude with respect to an assay that monitors G6PDH activity spectrophotometrically. The assay was validated using vitamin tablets and a cell culture medium.

Avoiding false positives and optimizing identification of true negatives in estrogen receptor binding and agonist/antagonist assays

EPA Science Inventory

The potential for chemicals to affect endocrine signaling is commonly evaluated via in vitro receptor binding and gene activation, but these assays, especially antagonism assays, have potential artifacts that must be addressed for accurate interpretation. Results are presented fr...

Integrated Summary Report: Validation of Two Binding Assays Using Human Recombinant Estrogen Receptor Alpha (hrERa)

EPA Science Inventory

This Integrated Summary Report (ISR) summarizes, in a single document, the results from an international multi-laboratory validation study conducted for two in vitro estrogen receptor (ER) binding assays. These assays both use human recombinant estrogen receptor, alpha subtype (h...

Pheromone induction of agglutination in Saccharomyces cerevisiae a cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Terrance, K.; Lipke, P.N.

1987-10-01

a-Agglutinin, the cell surface sexual agglutinin of yeast a cells, was assayed by its ability to bind its complementary agglutinin, ..cap alpha..-agglutinin. The specific binding of /sup 125/I-..cap alpha..-agglutinin to a cells treated with the sex pheromone ..cap alpha..-factor was 2 to 2.5 times that of binding to a cells not treated with ..cap alpha..-factor. Competition with unlabeled ..cap alpha..-agglutinin revealed that the increased binding was due to increased cell surface expression of a-agglutinin, with no apparent change in the binding constant. The increase in site number was similar to the increase in cellular agglutinability. Increased expression of a-agglutinin followedmore » the same kinetics as the increase in cellular agglutinability, with a 10-min lag followed by a 15- to 20-min response time. Induction kinetics were similar in cells in phases G1 and G2 of the cell cycle. Maximal expression levels were similar in cells treated with excess pheromone and in cells exposed to pheromone after destruction of constitutively expressed a-agglutinin.« less

Lsa63, a newly identified surface protein of Leptospira interrogans binds laminin and collagen IV.

PubMed

Vieira, Monica L; de Morais, Zenaide M; Gonçales, Amane P; Romero, Eliete C; Vasconcellos, Silvio A; Nascimento, Ana L T O

2010-01-01

Leptospira interrogans is the etiological agent of leptospirosis, a zoonotic disease that affects populations worldwide. We have identified in proteomic studies a protein that is encoded by the gene LIC10314 and expressed in virulent strain of L. interrogans serovar Pomona. This protein was predicted to be surface exposed by PSORT program and contains a p83/100 domain identified by BLAST analysis that is conserved in protein antigens of several strains of Borrelia and Treponema spp. The proteins containing this domain have been claimed antigen candidates for serodiagnosis of Lyme borreliosis. Thus, we have cloned the LIC10314 and expressed the protein in Escherichia coli BL21-SI strain by using the expression vector pAE. The recombinant protein tagged with N-terminal hexahistidine was purified by metal-charged chromatography and characterized by circular dichroism spectroscopy. This protein is conserved among several species of pathogenic Leptospira and absent in the saprophytic strain L. biflexa. We confirm by liquid-phase immunofluorescence assays with living organisms that this protein is most likely a new surface leptospiral protein. The ability of the protein to mediate attachment to ECM components was evaluated by binding assays. The leptospiral protein encoded by LIC10314, named Lsa63 (Leptospiral surface adhesin of 63kDa), binds strongly to laminin and collagen IV in a dose-dependent and saturable fashion. In addition, Lsa63 is probably expressed during infection since it was recognized by antibodies of serum samples of confirmed-leptospirosis patients in convalescent phase of the disease. Altogether, the data suggests that this novel identified surface protein may be involved in leptospiral pathogenesis. 2009 The British Infection Society. Published by Elsevier Ltd. All rights reserved.

Bivalent O-glycoside mimetics with S/disulfide/Se substitutions and aromatic core: Synthesis, molecular modeling and inhibitory activity on biomedically relevant lectins in assays of increasing physiological relevance.

PubMed

Kaltner, Herbert; Szabó, Tamás; Fehér, Krisztina; André, Sabine; Balla, Sára; Manning, Joachim C; Szilágyi, László; Gabius, Hans-Joachim

2017-06-15

The emerging significance of recognition of cellular glycans by lectins for diverse aspects of pathophysiology is a strong incentive for considering development of bioactive and non-hydrolyzable glycoside derivatives, for example by introducing S/Se atoms and the disulfide group instead of oxygen into the glycosidic linkage. We report the synthesis of 12 bivalent thio-, disulfido- and selenoglycosides attached to benzene/naphthalene cores. They present galactose, for blocking a plant toxin, or lactose, the canonical ligand of adhesion/growth-regulatory galectins. Modeling reveals unrestrained flexibility and inter-headgroup distances too small to bridge two sites in the same lectin. Inhibitory activity was first detected by solid-phase assays using a surface-presented glycoprotein, with relative activity enhancements per sugar unit relative to free cognate sugar up to nearly 10fold. Inhibitory activity was also seen on lectin binding to surfaces of human carcinoma cells. In order to proceed to characterize this capacity in the tissue context monitoring of lectin binding in the presence of inhibitors was extended to sections of three types of murine organs as models. This procedure proved to be well-suited to determine relative activity levels of the glycocompounds to block binding of the toxin and different human galectins to natural glycoconjugates at different sites in sections. The results on most effective inhibition by two naphthalene-based disulfides and a selenide raise the perspective for broad applicability of the histochemical assay in testing glycoclusters that target biomedically relevant lectins. Copyright © 2017 Elsevier Ltd. All rights reserved.

Discovery of a Series of Acridinones as Mechanism-Based Tubulin Assembly Inhibitors with Anticancer Activity

PubMed Central

Magalhaes, Luma G.; Marques, Fernando B.; da Fonseca, Marina B.; Rogério, Kamilla R.; Graebin, Cedric S.; Andricopulo, Adriano D.

2016-01-01

Microtubules play critical roles in vital cell processes, including cell growth, division, and migration. Microtubule-targeting small molecules are chemotherapeutic agents that are widely used in the treatment of cancer. Many of these compounds are structurally complex natural products (e.g., paclitaxel, vinblastine, and vincristine) with multiple stereogenic centers. Because of the scarcity of their natural sources and the difficulty of their partial or total synthesis, as well as problems related to their bioavailability, toxicity, and resistance, there is an urgent need for novel microtubule binding agents that are effective for treating cancer but do not have these disadvantages. In the present work, our lead discovery effort toward less structurally complex synthetic compounds led to the discovery of a series of acridinones inspired by the structure of podophyllotoxin, a natural product with important microtubule assembly inhibitory activity, as novel mechanism-based tubulin assembly inhibitors with potent anticancer properties and low toxicity. The compounds were evaluated in vitro by wound healing assays employing the metastatic and triple negative breast cancer cell line MDA-MB-231. Four compounds with IC50 values between 0.294 and 1.7 μM were identified. These compounds showed selective cytotoxicity against MDA-MB-231 and DU-145 cancer cell lines and promoted cell cycle arrest in G2/M phase and apoptosis. Consistent with molecular modeling results, the acridinones inhibited tubulin assembly in in vitro polymerization assays with IC50 values between 0.9 and 13 μM. Their binding to the colchicine-binding site of tubulin was confirmed through competitive assays. PMID:27508497

Detection of DNA damage in individual cells by flow cytometric analysis using anti-DNA monoclonal antibody

DOE Office of Scientific and Technical Information (OSTI.GOV)

Frankfurt, O.S.

A new method for the measurement of DNA damage in individual cells treated with alkylating agents is described. The method is based on the binding of anti-DNA monoclonal antibody to DNA in situ. Binding of antibody was evaluated by flow cytometry with indirect immunofluorescence. No binding of antibody to DNA in non-treated HeLa S3 cells was detected. Treatment of cells with HN2 or L-phenylalanine mustard induced binding of antibody to DNA in situ. Binding of antibody was observed after treating cells with doses of drugs which reduced the surviving fraction below 20%. Intensity of binding increased in proportion to themore » drug dose. In HN2-treated cells a cell subset with the lowest antibody binding was observed among cells in G1 phase. Binding of antibody to DNA in HN2-treated cells was eliminated by single-strand (ss) specific S1 nuclease. In competition assay, antibody was inhibited by thermally denatured DNA, but not by native double-stranded (ds) DNA, RNA, nucleosides and deoxyribohomopolymers. Immunoreactivity of cells with the monoclonal antibody F7-26 may be a useful probe for the assessment of cell damage induced by alkylating agents, especially in heterogeneous cell populations.« less

The validation of pharmacogenetics for the identification of Fabry patients to be treated with migalastat.

PubMed

Benjamin, Elfrida R; Della Valle, Maria Cecilia; Wu, Xiaoyang; Katz, Evan; Pruthi, Farhana; Bond, Sarah; Bronfin, Benjamin; Williams, Hadis; Yu, Julie; Bichet, Daniel G; Germain, Dominique P; Giugliani, Roberto; Hughes, Derralynn; Schiffmann, Raphael; Wilcox, William R; Desnick, Robert J; Kirk, John; Barth, Jay; Barlow, Carrolee; Valenzano, Kenneth J; Castelli, Jeff; Lockhart, David J

2017-04-01

Fabry disease is an X-linked lysosomal storage disorder caused by mutations in the α-galactosidase A gene. Migalastat, a pharmacological chaperone, binds to specific mutant forms of α-galactosidase A to restore lysosomal activity. A pharmacogenetic assay was used to identify the α-galactosidase A mutant forms amenable to migalastat. Six hundred Fabry disease-causing mutations were expressed in HEK-293 (HEK) cells; increases in α-galactosidase A activity were measured by a good laboratory practice (GLP)-validated assay (GLP HEK/Migalastat Amenability Assay). The predictive value of the assay was assessed based on pharmacodynamic responses to migalastat in phase II and III clinical studies. Comparison of the GLP HEK assay results in in vivo white blood cell α-galactosidase A responses to migalastat in male patients showed high sensitivity, specificity, and positive and negative predictive values (≥0.875). GLP HEK assay results were also predictive of decreases in kidney globotriaosylceramide in males and plasma globotriaosylsphingosine in males and females. The clinical study subset of amenable mutations (n = 51) was representative of all 268 amenable mutations identified by the GLP HEK assay. The GLP HEK assay is a clinically validated method of identifying male and female Fabry patients for treatment with migalastat.Genet Med 19 4, 430-438.

Regulation of the aceI multidrug efflux pump gene in Acinetobacter baumannii.

PubMed

Liu, Qi; Hassan, Karl A; Ashwood, Heather E; Gamage, Hasinika K A H; Li, Liping; Mabbutt, Bridget C; Paulsen, Ian T

2018-06-01

To investigate the function of AceR, a putative transcriptional regulator of the chlorhexidine efflux pump gene aceI in Acinetobacter baumannii. Chlorhexidine susceptibility and chlorhexidine induction of aceI gene expression were determined by MIC and quantitative real-time PCR, respectively, in A. baumannii WT and ΔaceR mutant strains. Recombinant AceR was prepared as both a full-length protein and as a truncated protein, AceR (86-299), i.e. AceRt, which has the DNA-binding domain deleted. The binding interaction of the purified AceR protein and its putative operator region was investigated by electrophoretic mobility shift assays and DNase I footprinting assays. The binding of AceRt with its putative ligand chlorhexidine was examined using surface plasmon resonance and tryptophan fluorescence quenching assays. MIC determination assays indicated that the ΔaceI and ΔaceR mutant strains both showed lower resistance to chlorhexidine than the parental strain. Chlorhexidine-induced expression of aceI was abolished in a ΔaceR background. Electrophoretic mobility shift assays and DNase I footprinting assays demonstrated chlorhexidine-stimulated binding of AceR with two sites upstream of the putative aceI promoter. Surface plasmon resonance and tryptophan fluorescence quenching assays suggested that the purified ligand-binding domain of the AceR protein was able to bind with chlorhexidine with high affinity. This study provides strong evidence that AceR is an activator of aceI gene expression when challenged with chlorhexidine. This study is the first characterization, to our knowledge, of a regulator controlling expression of a PACE family multidrug efflux pump.

Application of solid-phase microextraction in the investigation of protein binding of pharmaceuticals.

PubMed

Theodoridis, Georgios

2006-01-18

Protein-drug interactions of seven common pharmaceuticals were studied using solid-phase microextraction (SPME). SPME can be used in such investigations on the condition that no analyte depletion occurs. In multi-compartment systems (e.g. a proteinaceous matrix) only the free portion of the analyte is able to partition into the SPME fiber. In addition if no sample depletion occurs, the bound drug-free drug equilibria are not disturbed. In the present study seven pharmaceuticals (quinine, quinidine, naproxen, ciprofloxacin, haloperidol, paclitaxel and nortriptyline) were assayed by SPME. For quantitative purposes SPME was validated first in the absence of proteins. Calibration curves were constructed for each drug by HPLC-fluorescence and HPLC-UV analysis. SPME was combined to HPLC off-line, desorption occurring in HPLC inserts filled with 200 microL methanol. Binding of each drug to human serum albumin was studied independently. Experimental results were in agreement with literature data and ultrafiltration experiments, indicating the feasibility of the method for such bioanalytical purposes.

Screening for epitope specificity directly on culture supernatants in the early phase of monoclonal antibody production by an ELISA with biotin-labeled antigen.

PubMed

Andersen, Ditte C; Jensen, Charlotte H; Gregersen, Annemette; Brandt, Jette; Kliem, Anette; Skjødt, Karsten; Koch, Claus; Teisner, Børge

2004-01-01

This report describes an assay for comparison of epitope specificity in groups of monoclonal antibodies against a given antigen. The only prerequisite is the biotin-labeled antigen. One of the monoclonal antibodies is captured onto a plastic surface via a rabbit anti-mouse Ig, and the other preincubated with biotinylated antigen. When the two antibodies react with the same epitope subsequent binding of the biotin-labeled antigen is abolished (inhibition). In the cases where no inhibition was observed, the two antibodies were considered to react with distinct, independent epitopes. The obvious advantages using this assay, are that it can be performed directly on culture supernatants in the early phase of monoclonal antibody production, and also works for antigens with repetitive epitopes. Moreover, the bonus effect, i.e., a signal in excess of the reference signal when sets of monoclonal antibodies with different epitope specificity are compared, gives a relative measure of affinity.

High Throughput, Label-free Screening Small Molecule Compound Libraries for Protein-Ligands using Combination of Small Molecule Microarrays and a Special Ellipsometry-based Optical Scanner.

PubMed

Landry, James P; Fei, Yiyan; Zhu, X D

2011-12-01

Small-molecule compounds remain the major source of therapeutic and preventative drugs. Developing new drugs against a protein target often requires screening large collections of compounds with diverse structures for ligands or ligand fragments that exhibit sufficiently affinity and desirable inhibition effect on the target before further optimization and development. Since the number of small molecule compounds is large, high-throughput screening (HTS) methods are needed. Small-molecule microarrays (SMM) on a solid support in combination with a suitable binding assay form a viable HTS platform. We demonstrate that by combining an oblique-incidence reflectivity difference optical scanner with SMM we can screen 10,000 small-molecule compounds on a single glass slide for protein ligands without fluorescence labeling. Furthermore using such a label-free assay platform we can simultaneously acquire binding curves of a solution-phase protein to over 10,000 immobilized compounds, thus enabling full characterization of protein-ligand interactions over a wide range of affinity constants.

Effects of vitamin D-binding protein-derived macrophage-activating factor on human breast cancer cells.

PubMed

Pacini, Stefania; Punzi, Tiziana; Morucci, Gabriele; Gulisano, Massimo; Ruggiero, Marco

2012-01-01

Searching for additional therapeutic tools to fight breast cancer, we investigated the effects of vitamin D-binding protein-derived macrophage activating factor (DBP-MAF, also known as GcMAF) on a human breast cancer cell line (MCF-7). The effects of DBP-MAF on proliferation, morphology, vimentin expression and angiogenesis were studied by cell proliferation assay, phase-contrast microscopy, immunohistochemistry and western blotting, and chorioallantoic membrane (CAM) assay. DBP-MAF inhibited human breast cancer cell proliferation and cancer cell-stimulated angiogenesis. MCF-7 cells treated with DBP-MAF predominantly grew in monolayer and appeared to be well adherent to each other and to the well surface. Exposure to DBP-MAF significantly reduced vimentin expression, indicating a reversal of the epithelial/mesenchymal transition, a hallmark of human breast cancer progression. These results are consistent with the hypothesis that the known anticancer efficacy of DBP-MAF can be ascribed to different biological properties of the molecule that include inhibition of tumour-induced angiogenesis and direct inhibition of cancer cell proliferation, migration and metastatic potential.

[NF-kappaB-induced gp96 up-regulation promotes hepatocyte growth, cell cycle progression and transition].

PubMed

Feng, Cong; Wu, Bo; Fan, Hongxia; Li, Changfei; Meng, Songdong

2014-10-04

To investigate the mechanism of gp96 raised during hepatitis B virus (HBV) infection and the pathological mechanism. The mechanism of NF-KB activating gp96 expression was determined by bioinformatics analysis, luciferase reporter assay, real-time PCR and Western blot. The effect of over-expression and knockdown gp96 expression by transfection or RNA interference on hepatocyte proliferation, apoptosis and cell cycle was examined by CCK-8 and flow cytometry. The role of gp96 for HCC development was determined by epithelial-mesenchymal transition (EMT) and colony formation assay. NF-kB significantly increased the gp96 expression by binding to the NF-kappaB binding site. Over-expression and knockdown studies both show that gp96 promoted hepatocyte proliferation, inhibited apoptosis, and induced G0/G1 to S phase cell cycle progression. Moreover, gp96 induced epithelial-mesenchymal transition and increased colony formation ability of hepatocytes. Our results therefore provide insights in chronic HBV infection-induced gp96 expression, and indicate that elevated gp96 may contribute to HCC development during chronic inflammation.

Beyond conventional dose-response curves: Sensorgram comparison in SPR allows single concentration activity and similarity assessment.

PubMed

Gassner, C; Karlsson, R; Lipsmeier, F; Moelleken, J

2018-05-30

Previously we have introduced two SPR-based assay principles (dual-binding assay and bridging assay), which allow the determination of two out of three possible interaction parameters for bispecific molecules within one assay setup: two individual interactions to both targets, and/or one simultaneous/overall interaction, which potentially reflects the inter-dependency of both individual binding events. However, activity and similarity are determined by comparing report points over a concentration range, which also mirrors the way data is generated by conventional ELISA-based methods So far, binding kinetics have not been specifically considered in generic approaches for activity assessment. Here, we introduce an improved slope-ratio model which, together with a sensorgram comparison based similarity assessment, allows the development of a detailed, USP-conformal ligand binding assay using only a single sample concentration. We compare this novel analysis method to the usual concentration-range approach for both SPR-based assay principles and discuss its impact on data quality and increased sample throughput. Copyright © 2018 Elsevier B.V. All rights reserved.

A Colorimetric Microplate Assay for DNA-Binding Activity of His-Tagged MutS Protein.

PubMed

Banasik, Michał; Sachadyn, Paweł

2016-09-01

A simple microplate method was designed for rapid testing DNA-binding activity of proteins. The principle of the assay involves binding of tested DNA by his-tagged protein immobilized on a nickel-coated ELISA plate, following colorimetric detection of biotinylated DNA with avidin conjugated to horseradish peroxidase. The method was used to compare DNA mismatch binding activities of MutS proteins from three bacterial species. The assay required relatively low amounts of tested protein (approximately 0.5-10 pmol) and DNA (0.1-10 pmol) and a relatively short time of analysis (up to 60 min). The method is very simple to apply and convenient to test different buffer conditions of DNA-protein binding. Sensitive colorimetric detection enables naked eye observations and quantitation with an ELISA reader. The performance of the assay, which we believe is a distinguishing trait of the method, is based on two strong and specific molecular interactions: binding of a his-tagged protein to a nickel-coated microplate and binding of biotinylated DNA to avidin. In the reported experiments, the solution was used to optimize the conditions for DNA mismatch binding by MutS protein; however, the approach could be implemented to test nucleic acids interactions with any protein of interest.

A robust methodology to subclassify pseudokinases based on their nucleotide-binding properties

PubMed Central

Murphy, James M.; Zhang, Qingwei; Young, Samuel N.; Reese, Michael L.; Bailey, Fiona P.; Eyers, Patrick A.; Ungureanu, Daniela; Hammaren, Henrik; Silvennoinen, Olli; Varghese, Leila N.; Chen, Kelan; Tripaydonis, Anne; Jura, Natalia; Fukuda, Koichi; Qin, Jun; Nimchuk, Zachary; Mudgett, Mary Beth; Elowe, Sabine; Gee, Christine L.; Liu, Ling; Daly, Roger J.; Manning, Gerard; Babon, Jeffrey J.; Lucet, Isabelle S.

2017-01-01

Protein kinase-like domains that lack conserved residues known to catalyse phosphoryl transfer, termed pseudokinases, have emerged as important signalling domains across all kingdoms of life. Although predicted to function principally as catalysis-independent protein-interaction modules, several pseudokinase domains have been attributed unexpected catalytic functions, often amid controversy. We established a thermal-shift assay as a benchmark technique to define the nucleotide-binding properties of kinase-like domains. Unlike in vitro kinase assays, this assay is insensitive to the presence of minor quantities of contaminating kinases that may otherwise lead to incorrect attribution of catalytic functions to pseudokinases. We demonstrated the utility of this method by classifying 31 diverse pseudokinase domains into four groups: devoid of detectable nucleotide or cation binding; cation-independent nucleotide binding; cation binding; and nucleotide binding enhanced by cations. Whereas nine pseudokinases bound ATP in a divalent cation-dependent manner, over half of those examined did not detectably bind nucleotides, illustrating that pseudokinase domains predominantly function as non-catalytic protein-interaction modules within signalling networks and that only a small subset is potentially catalytically active. We propose that henceforth the thermal-shift assay be adopted as the standard technique for establishing the nucleotide-binding and catalytic potential of kinase-like domains. PMID:24107129

A cooperative-binding split aptamer assay for rapid, specific and ultra-sensitive fluorescence detection of cocaine in saliva† †Electronic supplementary information (ESI) available: Optimization of Mg2+ and ATMND concentrations for our CBSA-based ATMND-binding assay; ATMND-reported calibration curve for CBSA-5325 at various cocaine concentrations; ATMND binding affinity for the cocaine-assembled CBSA-5325; K D of 38-GC and different 38-GC mutants for cocaine as characterized by ITC; stem length effects on cocaine-induced CBSA assembly; spectra of CBSA-5335-based fluorescence detection of cocaine in 1× binding buffer; characterization of cocaine binding affinity of CBSA-5335 and PSA using ITC; fluorescence detection of cocaine in saliva with our fluorophore/quencher modified CBSA-5335; calibration curve of our CBSA-5335-based fluorophore/quencher assay in 1× binding buffer and 10% saliva at cocaine concentrations ranging from 0 to 10 μM; bias and precision of the CBSA-5335-based fluorophore/quencher assay; comparison of amplification-free split-aptamer assays for cocaine detection; sequence ID and DNA sequences used in this work. See DOI: 10.1039/c6sc01833e Click here for additional data file.

PubMed Central

Yu, Haixiang; Canoura, Juan; Guntupalli, Bhargav; Lou, Xinhui

2017-01-01

Sensors employing split aptamers that reassemble in the presence of a target can achieve excellent specificity, but the accompanying reduction of target affinity mitigates any overall gains in sensitivity. We for the first time have developed a split aptamer that achieves enhanced target-binding affinity through cooperative binding. We have generated a split cocaine-binding aptamer that incorporates two binding domains, such that target binding at one domain greatly increases the affinity of the second domain. We experimentally demonstrate that the resulting cooperative-binding split aptamer (CBSA) exhibits higher target binding affinity and is far more responsive in terms of target-induced aptamer assembly compared to the single-domain parent split aptamer (PSA) from which it was derived. We further confirm that the target-binding affinity of our CBSA can be affected by the cooperativity of its binding domains and the intrinsic affinity of its PSA. To the best of our knowledge, CBSA-5335 has the highest cocaine affinity of any split aptamer described to date. The CBSA-based assay also demonstrates excellent performance in target detection in complex samples. Using this CBSA, we achieved specific, ultra-sensitive, one-step fluorescence detection of cocaine within fifteen minutes at concentrations as low as 50 nM in 10% saliva without signal amplification. This limit of detection meets the standards recommended by the European Union's Driving under the Influence of Drugs, Alcohol and Medicines program. Our assay also demonstrates excellent reproducibility of results, confirming that this CBSA-platform represents a robust and sensitive means for cocaine detection in actual clinical samples. PMID:28451157

Exo-Dye-based assay for rapid, inexpensive, and sensitive detection of DNA-binding proteins.

PubMed

Chen, Zaozao; Ji, Meiju; Hou, Peng; Lu, Zuhong

2006-07-07

We reported herein a rapid, inexpensive, and sensitive technique for detecting sequence-specific DNA-binding proteins. In this technique, the common exonuclease III (ExoIII) footprinting assay is coupled with simple SYBR Green I staining for monitoring the activities of DNA-binding proteins. We named this technique as ExoIII-Dye-based assay. In this assay, a duplex probe was designed to detect DNA-binding protein. One side of the probe contains one protein-binding site, and another side of it contains five protruding bases at 3' end for protection from ExoIII digestion. If a target protein is present, it will bind to binding sites of probe and produce a physical hindrance to ExoIII, which protects the duplex probe from digestion of ExoIII. SYBR Green I will bind to probe, which results in high fluorescence intensity. On the contrary, in the absence of the target protein, the naked duplex probe will be degraded by ExoIII. SYBR Green I will be released, which results in a low fluorescence intensity. In this study, we employed this technique to successfully detect transcription factor NF-kappaB in crude cell extracts. Moreover, it could also be used to evaluate the binding affinity of NF-kappaB. This technique has therefore wide potential application in research, medical diagnosis, and drug discovery.

Highly variable sensitivity of five binding and two bio-assays for TSH-receptor antibodies.

PubMed

Diana, T; Wüster, C; Kanitz, M; Kahaly, G J

2016-10-01

TSH-receptor (TSHR) antibodies (Ab) can be measured with binding or bio-assays. Sensitivity and specificity of five binding and two bio-assays were compared. TSHR-blocking (TBAb) and TSHR-stimulating (TSAb) Ab were measured with reporter bio-assays. Blocking activity was defined as percent inhibition of luciferase expression relative to induction with bTSH alone. TSAb was reported as percentage of specimen-to-reference ratio (SRR%). TSHR-binding inhibitory immunoglobulins (TBII) were measured with Kronus, Dynex, Kryptor, Cobas, and Immulite. Sixty patients with Graves' disease (GD), 20 with Hashimoto's thyroiditis (HT), and 20 healthy controls (C) were included. C tested negative in all assays (specificity 100 %) while all 60 hyperthyroid GD patients tested positive in the TSAb bio-assay (sensitivity 100 %). Among these 60 GD patients, 20 had low TSAb positivity (SRR% 140-279), but were TBII positive in only 20 (100 %), 7 (35 %), 9 (45 %), 11 (55 %), and 18 (90 %) using the Kronus, Dynex, Kryptor, Cobas, and Immulite, respectively. In 20 moderate TSAb-positive (SRR% 280-420) patients, TBII tested positive in 20 (100 %), 14 (70 %), 13 (65 %), 16 (80 %), and 19 (95 %), respectively. The high (SRR% > 420) TSAb-positive patients were all TBII positive. All 20 hypothyroid HT patients tested TBAb positive (sensitivity 100 %) in the bio-assay while they tested TBII positive in 20 (100 %), 18 (90 %), 20, 20, and 18, respectively. Results obtained with two luminometers correlated for TSAb positive (r = 0.99, p < 0.001), TBAb positive (r = 0.88, p < 0.001), and C (r = 0.86, p < 0.001). None of the binding assays differentiated between TSAb and TBAb. Sensitivity is highly variable between binding and bio-assays for TSHR-Abs.

Noncompetitive blocking of human GLUT1 hexose transporter by methylxanthines reveals an exofacial regulatory binding site.

PubMed

Ojeda, Paola; Pérez, Alejandra; Ojeda, Lorena; Vargas-Uribe, Mauricio; Rivas, Coralia I; Salas, Monica; Vera, Juan Carlos; Reyes, Alejandro M

2012-09-01

Glucose transporter (GLUT)1 has become an attractive target to block glucose uptake in malignant cells since most cancer cells overexpress GLUT1 and are sensitive to glucose deprivation. Methylxanthines are natural compounds that inhibit glucose uptake; however, the mechanism of inhibition remains unknown. Here, we used a combination of binding and glucose transport kinetic assays to analyze in detail the effects of caffeine, pentoxifylline, and theophylline on hexose transport in human erythrocytes. The displacement of previously bound cytochalasin B revealed a direct interaction between the methylxanthines and GLUT1. Methylxanthines behave as noncompetitive blockers (inhibition constant values of 2-3 mM) in exchange and zero-trans efflux assays, whereas mixed inhibition with a notable uncompetitive component is observed in zero-trans influx assays (inhibition constant values of 5-12 mM). These results indicate that methylxanthines do not bind to either exofacial or endofacial d-glucose-binding sites but instead interact at a different site accessible by the external face of the transporter. Additionally, infinite-cis exit assays (Sen-Widdas assays) showed that only pentoxifylline disturbed d-glucose for binding to the exofacial substrate site. Interestingly, coinhibition assays showed that methylxanthines bind to a common site on the transporter. We concluded that there is a methylxanthine regulatory site on the external surface of the transporter, which is close but distinguishable from the d-glucose external site. Therefore, the methylxanthine moiety may become an attractive framework for the design of novel specific noncompetitive facilitative GLUT inhibitors.

Homogeneous time-resolved G protein-coupled receptor-ligand binding assay based on fluorescence cross-correlation spectroscopy.

PubMed

Antoine, Thomas; Ott, David; Ebell, Katharina; Hansen, Kerrin; Henry, Luc; Becker, Frank; Hannus, Stefan

2016-06-01

G protein-coupled receptors (GPCRs) mediate many important physiological functions and are considered as one of the most successful therapeutic target classes for a wide spectrum of diseases. Drug discovery projects generally benefit from a broad range of experimental approaches for screening compound libraries and for the characterization of binding modes of drug candidates. Owing to the difficulties in solubilizing and purifying GPCRs, assay formats have been so far mainly limited to cell-based functional assays and radioligand binding assays. In this study, we used fluorescence cross-correlation spectroscopy (FCCS) to analyze the interaction of detergent-solubilized receptors to various types of GPCR ligands: endogenous peptides, small molecules, and a large surrogate antagonist represented by a blocking monoclonal antibody. Our work demonstrates the suitability of the homogeneous and time-resolved FCCS assay format for a robust, high-throughput determination of receptor-ligand binding affinities and kinetic rate constants for various therapeutically relevant GPCRs. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Specificity of the weak binding between the phage SPO1 transcription-inhibitory protein, TF1, and SPO1 DNA.

PubMed

Johnson, G G; Geiduschek, E P

1977-04-05

The interaction of the phage SPO1 protein transcription factor 1 (TF1), with DNA has been analyzed by membrane filter binding and by sedimentation methods. Substantially specific binding of TF1 to helical SPO1 DNA can be demonstrated by nitrocellulose filter-binding assays at relatively low ionic strength (0.08). However, TF1-DNA complexes dissociate and reequilibrate relatively rapidly and this makes filter-binding assays unsuitable for quantitative measurements of binding equilibra. Accordingly, the sedimentation properties of TF1-DNA complexes have been explored and a short-column centrifugation assay has been elaborated for quantitative measurements. Preferential binding of TF1 to the hydroxymethyluracil-containing SPO1 DNA has also been demonstrated by short-column centrifugation. TF1 binds relatively weakly and somewhat cooperatively to SPO1 DNA at many sites; TF1-DNA complexes dissociate and reequilibrate rapidly. At 20 degrees C in 0.01 M phosphate, pH 7.5, 0.15 KC1, one molecule of TF1 can bind to approximately every 60 nucleotide pairs of SPO1 DNA.

Persistent Graves' hyperthyroidism despite rapid negative conversion of thyroid-stimulating hormone-binding inhibitory immunoglobulin assay results: a case report.

PubMed

Ohara, Nobumasa; Kaneko, Masanori; Kitazawa, Masaru; Uemura, Yasuyuki; Minagawa, Shinichi; Miyakoshi, Masashi; Kaneko, Kenzo; Kamoi, Kyuzi

2017-02-06

Graves' disease is an autoimmune thyroid disorder characterized by hyperthyroidism, and patients exhibit thyroid-stimulating hormone receptor antibody. The major methods of measuring circulating thyroid-stimulating hormone receptor antibody include the thyroid-stimulating hormone-binding inhibitory immunoglobulin assays. Although the diagnostic accuracy of these assays has been improved, a minority of patients with Graves' disease test negative even on second-generation and third-generation thyroid-stimulating hormone-binding inhibitory immunoglobulins. We report a rare case of a thyroid-stimulating hormone-binding inhibitory immunoglobulin-positive patient with Graves' disease who showed rapid lowering of thyroid-stimulating hormone-binding inhibitory immunoglobulin levels following administration of the anti-thyroid drug thiamazole, but still experienced Graves' hyperthyroidism. A 45-year-old Japanese man presented with severe hyperthyroidism (serum free triiodothyronine >25.0 pg/mL; reference range 1.7 to 3.7 pg/mL) and tested weakly positive for thyroid-stimulating hormone-binding inhibitory immunoglobulins on second-generation tests (2.1 IU/L; reference range <1.0 IU/L). Within 9 months of treatment with oral thiamazole (30 mg/day), his thyroid-stimulating hormone-binding inhibitory immunoglobulin titers had normalized, but he experienced sustained hyperthyroidism for more than 8 years, requiring 15 mg/day of thiamazole to correct. During that period, he tested negative on all first-generation, second-generation, and third-generation thyroid-stimulating hormone-binding inhibitory immunoglobulin assays, but thyroid scintigraphy revealed diffuse and increased uptake, and thyroid ultrasound and color flow Doppler imaging showed typical findings of Graves' hyperthyroidism. The possible explanations for serial changes in the thyroid-stimulating hormone-binding inhibitory immunoglobulin results in our patient include the presence of thyroid-stimulating hormone receptor antibody, which is bioactive but less reactive on thyroid-stimulating hormone-binding inhibitory immunoglobulin assays, or the effect of reduced levels of circulating thyroid-stimulating hormone receptor antibody upon improvement of thyroid autoimmunity with thiamazole treatment. Physicians should keep in mind that patients with Graves' disease may show thyroid-stimulating hormone-binding inhibitory immunoglobulin assay results that do not reflect the severity of Graves' disease or indicate the outcome of the disease, and that active Graves' disease may persist even after negative results on thyroid-stimulating hormone-binding inhibitory immunoglobulin assays. Timely performance of thyroid function tests in combination with sensitive imaging tests, including thyroid ultrasound and scintigraphy, are necessary to evaluate the severity of Graves' disease and treatment efficacy.

A magnetic bead-based ligand binding assay to facilitate human kynurenine 3-monooxygenase drug discovery.

PubMed

Wilson, Kris; Mole, Damian J; Homer, Natalie Z M; Iredale, John P; Auer, Manfred; Webster, Scott P

2015-02-01

Human kynurenine 3-monooxygenase (KMO) is emerging as an important drug target enzyme in a number of inflammatory and neurodegenerative disease states. Recombinant protein production of KMO, and therefore discovery of KMO ligands, is challenging due to a large membrane targeting domain at the C-terminus of the enzyme that causes stability, solubility, and purification difficulties. The purpose of our investigation was to develop a suitable screening method for targeting human KMO and other similarly challenging drug targets. Here, we report the development of a magnetic bead-based binding assay using mass spectrometry detection for human KMO protein. The assay incorporates isolation of FLAG-tagged KMO enzyme on protein A magnetic beads. The protein-bound beads are incubated with potential binding compounds before specific cleavage of the protein-compound complexes from the beads. Mass spectrometry analysis is used to identify the compounds that demonstrate specific binding affinity for the target protein. The technique was validated using known inhibitors of KMO. This assay is a robust alternative to traditional ligand-binding assays for challenging protein targets, and it overcomes specific difficulties associated with isolating human KMO. © 2014 Society for Laboratory Automation and Screening.

Measuring Norfloxacin Binding to Trypsin Using a Fluorescence Quenching Assay in an Upper-Division, Integrated Laboratory Course

ERIC Educational Resources Information Center

Hicks, Katherine A.

2016-01-01

Fluorescence quenching assays are often used to measure dissociation constants that quantify the binding affinity between small molecules and proteins. In an upper-division undergraduate laboratory course, where students work on projects using a guided inquiry-based approach, a binding titration experiment at physiological pH is performed to…

Complementary Spectroscopic Assays for Investigating Protein-Ligand Binding Activity: A Project for the Advanced Chemistry Laboratory

ERIC Educational Resources Information Center

Mascotti, David P.; Waner, Mark J.

2010-01-01

A protein-ligand binding, guided-inquiry laboratory project with potential application across the advanced undergraduate curriculum is described. At the heart of the project are fluorescence and spectrophotometric assays utilizing biotin-4-fluorescein and streptavidin. The use of the same stock solutions for an assay that may be examined by two…

DEVELOPMENT AND CHARACTERIZATION OF A CELL LINE THAT STABLY EXPRESSES AN ESTROGEN-RESPONSIVE LUCIFERASE REPORTER FOR THE DETECTION OF ESTROGEN RECEPTOR AGONIST AND ANTAGONISTS

EPA Science Inventory

Screening for endocrine disrupting chemicals (EDCs) that act as estrogens or antiestrogens relies on the use of in vitro binding and gene expression assays coupled with short-term diagnostic in vivo assays. Although binding assays are useful to identify chemicals that are competi...

Structural basis for collagen recognition by the immune receptor OSCAR.

PubMed

Zhou, Long; Hinerman, Jennifer M; Blaszczyk, Michal; Miller, Jeanette L C; Conrady, Deborah G; Barrow, Alexander D; Chirgadze, Dimitri Y; Bihan, Dominique; Farndale, Richard W; Herr, Andrew B

2016-02-04

The osteoclast-associated receptor (OSCAR) is a collagen-binding immune receptor with important roles in dendritic cell maturation and activation of inflammatory monocytes as well as in osteoclastogenesis. The crystal structure of the OSCAR ectodomain is presented, both free and in complex with a consensus triple-helical peptide (THP). The structures revealed a collagen-binding site in each immunoglobulin-like domain (D1 and D2). The THP binds near a predicted collagen-binding groove in D1, but a more extensive interaction with D2 is facilitated by the unusually wide D1-D2 interdomain angle in OSCAR. Direct binding assays, combined with site-directed mutagenesis, confirm that the primary collagen-binding site in OSCAR resides in D2, in marked contrast to the related collagen receptors, glycoprotein VI (GPVI) and leukocyte-associated immunoglobulin-like receptor-1 (LAIR-1). Monomeric OSCAR D1D2 binds to the consensus THP with a KD of 28 µM measured in solution, but shows a higher affinity (KD 1.5 μM) when binding to a solid-phase THP, most likely due to an avidity effect. These data suggest a 2-stage model for the interaction of OSCAR with a collagen fibril, with transient, low-affinity interactions initiated by the membrane-distal D1, followed by firm adhesion to the primary binding site in D2. © 2016 by The American Society of Hematology.

Lipid A binding sites in membranes of macrophage tumor cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hampton, R.Y.; Golenbock, D.T.; Raetz, C.R.

1988-10-15

Lipopolysaccharide affects a variety of eukaryotic cells and mammalian organisms. These actions are involved in the pathogenesis of Gram-negative septicemia. Many of the actions of lipopolysaccharide are believed to be caused by its active moiety, lipid A. Our laboratory has previously identified a bioactive lipid A precursor, termed lipid IVA, which can be labeled with 32P of high specific activity and purified. In this work we have used the labeled probe, 4'-32P-lipid IVA, to develop a novel assay for the specific binding of lipid IVA to whole cells. We have also demonstrated its use in a ligand blotting assay ofmore » immobilized cellular proteins. Using the whole cell assay, we show that 4'-32P-lipid IVA specifically binds to RAW 264.7 macrophage-like cultured cells. The binding is saturable, is inhibited with excess unlabeled lipid IVA, and is proteinase K-sensitive. It displays cellular and pharmacological specificity. Using the ligand blotting assay, we show that several RAW 264.7 cell proteins can bind 4'-32P-lipid IVA. The two principal binding proteins have Mr values of 31 and 95 kDa, as judged by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Fractionation studies indicate that the 31-kDa protein is enriched in the nuclear fraction and may be a histone, whereas the 95-kDa protein is enriched in the membrane fraction. The binding assays that we have developed should lead to a clearer understanding of lipid A/animal cell interactions.« less

Novel Multiplexed Assay for Identifying SH2 Domain Antagonists of STAT Family Proteins

PubMed Central

Takakuma, Kazuyuki; Ogo, Naohisa; Uehara, Yutaka; Takahashi, Susumu; Miyoshi, Nao; Asai, Akira

2013-01-01

Some of the signal transducer and activator of transcription (STAT) family members are constitutively activated in a wide variety of human tumors. The activity of STAT depends on their Src homology 2 (SH2) domain-mediated binding to sequences containing phosphorylated tyrosine. Thus, antagonizing this binding is a feasible approach to inhibiting STAT activation. We have developed a novel multiplexed assay for STAT3- and STAT5b-SH2 binding, based on amplified luminescent proximity homogeneous assay (Alpha) technology. AlphaLISA and AlphaScreen beads were combined in a single-well assay, which allowed the binding of STAT3- and STAT5b-SH2 to phosphotyrosine peptides to be simultaneously monitored. Biotin-labeled recombinant human STAT proteins were obtained as N- and C-terminal deletion mutants. The spacer length of the DIG-labeled peptide, the reaction time, and the concentration of sodium chloride were optimized to establish a HTS system with Z’ values of greater than 0.6 for both STAT3- and STAT5b-SH2 binding. We performed a HTS campaign for chemical libraries using this multiplexed assay and identified hit compounds. A 2-chloro-1,4-naphthalenedione derivative, Compound 1, preferentially inhibited STAT3-SH2 binding in vitro, and the nuclear translocation of STAT3 in HeLa cells. Initial structure activity relationship (SAR) studies using the multiplexed assay showed the 3-substituent effect on both the activity and selectivity of STAT3 and STAT5b inhibition. Therefore, this multiplexed assay is useful for not only searching for potential lead compounds but also obtaining SAR data for developing new STAT3/STAT5b inhibitors. PMID:23977103

Novel multiplexed assay for identifying SH2 domain antagonists of STAT family proteins.

PubMed

Takakuma, Kazuyuki; Ogo, Naohisa; Uehara, Yutaka; Takahashi, Susumu; Miyoshi, Nao; Asai, Akira

2013-01-01

Some of the signal transducer and activator of transcription (STAT) family members are constitutively activated in a wide variety of human tumors. The activity of STAT depends on their Src homology 2 (SH2) domain-mediated binding to sequences containing phosphorylated tyrosine. Thus, antagonizing this binding is a feasible approach to inhibiting STAT activation. We have developed a novel multiplexed assay for STAT3- and STAT5b-SH2 binding, based on amplified luminescent proximity homogeneous assay (Alpha) technology. AlphaLISA and AlphaScreen beads were combined in a single-well assay, which allowed the binding of STAT3- and STAT5b-SH2 to phosphotyrosine peptides to be simultaneously monitored. Biotin-labeled recombinant human STAT proteins were obtained as N- and C-terminal deletion mutants. The spacer length of the DIG-labeled peptide, the reaction time, and the concentration of sodium chloride were optimized to establish a HTS system with Z' values of greater than 0.6 for both STAT3- and STAT5b-SH2 binding. We performed a HTS campaign for chemical libraries using this multiplexed assay and identified hit compounds. A 2-chloro-1,4-naphthalenedione derivative, Compound 1, preferentially inhibited STAT3-SH2 binding in vitro, and the nuclear translocation of STAT3 in HeLa cells. Initial structure activity relationship (SAR) studies using the multiplexed assay showed the 3-substituent effect on both the activity and selectivity of STAT3 and STAT5b inhibition. Therefore, this multiplexed assay is useful for not only searching for potential lead compounds but also obtaining SAR data for developing new STAT3/STAT5b inhibitors.

Assessment of a recombinant androgen receptor binding assay: initial steps towards validation.

PubMed

Freyberger, Alexius; Weimer, Marc; Tran, Hoai-Son; Ahr, Hans-Jürgen

2010-08-01

Despite more than a decade of research in the field of endocrine active compounds with affinity for the androgen receptor (AR), still no validated recombinant AR binding assay is available, although recombinant AR can be obtained from several sources. With funding from the European Union (EU)-sponsored 6th framework project, ReProTect, we developed a model protocol for such an assay based on a simple AR binding assay recently developed at our institution. Important features of the protocol were the use of a rat recombinant fusion protein to thioredoxin containing both the hinge region and ligand binding domain (LBD) of the rat AR (which is identical to the human AR-LBD) and performance in a 96-well plate format. Besides two reference compounds [dihydrotestosterone (DHT), androstenedione] ten test compounds with different affinities for the AR [levonorgestrel, progesterone, prochloraz, 17alpha-methyltestosterone, flutamide, norethynodrel, o,p'-DDT, dibutylphthalate, vinclozolin, linuron] were used to explore the performance of the assay. At least three independent experiments per compound were performed. The AR binding properties of reference and test compounds were well detected, in terms of the relative ranking of binding affinities, there was good agreement with published data obtained from experiments using recombinant AR preparations. Irrespective of the chemical nature of the compound, individual IC(50)-values for a given compound varied by not more than a factor of 2.6. Our data demonstrate that the assay reliably ranked compounds with strong, weak, and no/marginal affinity for the AR with high accuracy. It avoids the manipulation and use of animals, as a recombinant protein is used and thus contributes to the 3R concept. On the whole, this assay is a promising candidate for further validation. Copyright 2009 Elsevier Inc. All rights reserved.

ABFs, a family of ABA-responsive element binding factors.

PubMed

Choi, H; Hong, J; Ha, J; Kang, J; Kim, S Y

2000-01-21

Abscisic acid (ABA) plays an important role in environmental stress responses of higher plants during vegetative growth. One of the ABA-mediated responses is the induced expression of a large number of genes, which is mediated by cis-regulatory elements known as abscisic acid-responsive elements (ABREs). Although a number of ABRE binding transcription factors have been known, they are not specifically from vegetative tissues under induced conditions. Considering the tissue specificity of ABA signaling pathways, factors mediating ABA-dependent stress responses during vegetative growth phase may thus have been unidentified so far. Here, we report a family of ABRE binding factors isolated from young Arabidopsis plants under stress conditions. The factors, isolated by a yeast one-hybrid system using a prototypical ABRE and named as ABFs (ABRE binding factors) belong to a distinct subfamily of bZIP proteins. Binding site selection assay performed with one ABF showed that its preferred binding site is the strong ABRE, CACGTGGC. ABFs can transactivate an ABRE-containing reporter gene in yeast. Expression of ABFs is induced by ABA and various stress treatments, whereas their induction patterns are different from one another. Thus, a new family of ABRE binding factors indeed exists that have the potential to activate a large number of ABA/stress-responsive genes in Arabidopsis.

Dux4 induces cell cycle arrest at G1 phase through upregulation of p21 expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu, Hongliang; Wang, Zhaoxia; Jin, Suqin

2014-03-28

Highlights: • Dux4 induced TE671 cell proliferation defect and G1 phase arrest. • Dux4 upregulated p21 expression without activating p53. • Silencing p21 rescued Dux4 mediated proliferation defect and cell cycle arrest. • Sp1 binding site was required for Dux4-induced p21 promoter activation. - Abstract: It has been implicated that Dux4 plays crucial roles in development of facioscapulohumeral dystrophy. But the underlying myopathic mechanisms and related down-stream events of this retrogene were far from clear. Here, we reported that overexpression of Dux4 in a cell model TE671 reduced cell proliferation rate, and increased G1 phase accumulation. We also determined themore » impact of Dux4 on p53/p21 signal pathway, which controls the checkpoint in cell cycle progression. Overexpression of Dux4 increased p21 mRNA and protein level, while expression of p53, phospho-p53 remained unchanged. Silencing p21 rescued Dux4 mediated proliferation defect and cell cycle arrest. Furthermore, we demonstrated that enhanced Dux4 expression increased p21 promoter activity and elevated expression of Sp1 transcription factor. Mutation of Sp1 binding site decreased dux4 induced p21 promoter activation. Chromatin immunoprecipitation (ChIP) assays confirmed the Dux4-induced binding of Sp1 to p21 promoter in vivo. These results suggest that Dux4 might induce proliferation inhibition and G1 phase arrest through upregulation of p21.« less

The transcription factor CCAAT-binding factor CBF/NF-Y regulates the proximal promoter activity in the human alpha 1(XI) collagen gene (COL11A1).

PubMed

Matsuo, Noritaka; Yu-Hua, Wang; Sumiyoshi, Hideaki; Sakata-Takatani, Keiko; Nagato, Hitoshi; Sakai, Kumiko; Sakurai, Mami; Yoshioka, Hidekatsu

2003-08-29

We have characterized the proximal promoter region of the human COL11A1 gene. Transient transfection assays indicate that the segment from -199 to +1 is necessary for the activation of basal transcription. Electrophoretic mobility shift assays (EMSAs) demonstrated that the ATTGG sequence, within the -147 to -121 fragment, is critical to bind nuclear proteins in the proximal COL11A1 promoter. We demonstrated that the CCAAT binding factor (CBF/NF-Y) bound to this region using an interference assay with consensus oligonucleotides and a supershift assay with specific antibodies in an EMSA. In a chromatin immunoprecipitation assay and EMSA using DNA-affinity-purified proteins, CBF/NF-Y proteins directly bound this region in vitro and in vivo. We also showed that four tandem copies of the CBF/NF-Y-binding fragment produced higher transcriptional activity than one or two copies, whereas the absence of a CBF/NF-Y-binding fragment suppressed the COL11A1 promoter activity. Furthermore, overexpression of a dominant-negative CBF-B/NF-YA subunit significantly inhibited promoter activity in both transient and stable cells. These results indicate that the CBF/NF-Y proteins regulate the transcription of COL11A1 by directly binding to the ATTGG sequence in the proximal promoter region.

Development of rapid and sensitive high throughput pharmacologic assays for marine phycotoxins.

PubMed

Van Dolah, F M; Finley, E L; Haynes, B L; Doucette, G J; Moeller, P D; Ramsdell, J S

1994-01-01

The lack of rapid, high throughput assays is a major obstacle to many aspects of research on marine phycotoxins. Here we describe the application of microplate scintillation technology to develop high throughput assays for several classes of marine phycotoxin based on their differential pharmacologic actions. High throughput "drug discovery" format microplate receptor binding assays developed for brevetoxins/ciguatoxins and for domoic acid are described. Analysis for brevetoxins/ciguatoxins is carried out by binding competition with [3H] PbTx-3 for site 5 on the voltage dependent sodium channel in rat brain synaptosomes. Analysis of domoic acid is based on binding competition with [3H] kainic acid for the kainate/quisqualate glutamate receptor using frog brain synaptosomes. In addition, a high throughput microplate 45Ca flux assay for determination of maitotoxins is described. These microplate assays can be completed within 3 hours, have sensitivities of less than 1 ng, and can analyze dozens of samples simultaneously. The assays have been demonstrated to be useful for assessing algal toxicity and for assay-guided purification of toxins, and are applicable to the detection of biotoxins in seafood.

FcUni-RLuc: an engineered Renilla luciferase with Fc binding ability and light emission activity.

PubMed

Farzannia, A; Roghanian, R; Zarkesh-Esfahani, S H; Nazari, M; Emamzadeh, R

2015-03-07

A novel and advanced Fc-binding probe – FcUni-RLuc namely – has been produced and functionally assayed for labelling IgGs. The Fc antibody binding sequence – HWRGWV – was fused to Renilla luciferase, and the purified probe was employed for bioluminescence enzyme-linked immunoabsorbance assay of Her2 positive cells.

Protein and lipid binding parameters in rainbow trout (Oncorhynchus mykiss) blood and liver fractions to extrapolate from an in vitro metabolic degradation assay to in vivo bioaccumulation potential of hydrophobic organic chemicals.

PubMed

Escher, Beate I; Cowan-Ellsberry, Christina E; Dyer, Scott; Embry, Michelle R; Erhardt, Susan; Halder, Marlies; Kwon, Jung-Hwan; Johanning, Karla; Oosterwijk, Mattheus T T; Rutishauser, Sibylle; Segner, Helmut; Nichols, John

2011-07-18

Binding of hydrophobic chemicals to colloids such as proteins or lipids is difficult to measure using classical microdialysis methods due to low aqueous concentrations, adsorption to dialysis membranes and test vessels, and slow kinetics of equilibration. Here, we employed a three-phase partitioning system where silicone (polydimethylsiloxane, PDMS) serves as a third phase to determine partitioning between water and colloids and acts at the same time as a dosing device for hydrophobic chemicals. The applicability of this method was demonstrated with bovine serum albumin (BSA). Measured binding constants (K(BSAw)) for chlorpyrifos, methoxychlor, nonylphenol, and pyrene were in good agreement with an established quantitative structure-activity relationship (QSAR). A fifth compound, fluoxypyr-methyl-heptyl ester, was excluded from the analysis because of apparent abiotic degradation. The PDMS depletion method was then used to determine partition coefficients for test chemicals in rainbow trout (Oncorhynchus mykiss) liver S9 fractions (K(S9w)) and blood plasma (K(bloodw)). Measured K(S9w) and K(bloodw) values were consistent with predictions obtained using a mass-balance model that employs the octanol-water partition coefficient (K(ow)) as a surrogate for lipid partitioning and K(BSAw) to represent protein binding. For each compound, K(bloodw) was substantially greater than K(S9w), primarily because blood contains more lipid than liver S9 fractions (1.84% of wet weight vs 0.051%). Measured liver S9 and blood plasma binding parameters were subsequently implemented in an in vitro to in vivo extrapolation model to link the in vitro liver S9 metabolic degradation assay to in vivo metabolism in fish. Apparent volumes of distribution (V(d)) calculated from the experimental data were similar to literature estimates. However, the calculated binding ratios (f(u)) used to relate in vitro metabolic clearance to clearance by the intact liver were 10 to 100 times lower than values used in previous modeling efforts. Bioconcentration factors (BCF) predicted using the experimental binding data were substantially higher than the predicted values obtained in earlier studies and correlated poorly with measured BCF values in fish. One possible explanation for this finding is that chemicals bound to proteins can desorb rapidly and thus contribute to metabolic turnover of the chemicals. This hypothesis remains to be investigated in future studies, ideally with chemicals of higher hydrophobicity. © 2011 American Chemical Society

Studying the Salt Dependence of the Binding of σ70 and σ32 to Core RNA Polymerase Using Luminescence Resonance Energy Transfer

PubMed Central

Glaser, Bryan T.; Bergendahl, Veit; Anthony, Larry C.; Olson, Brian; Burgess, Richard R.

2009-01-01

The study of protein-protein interactions is becoming increasingly important for understanding the regulation of many cellular processes. The ability to quantify the strength with which two binding partners interact is desirable but the accurate determination of equilibrium binding constants is a difficult process. The use of Luminescence Resonance Energy Transfer (LRET) provides a homogeneous binding assay that can be used for the detection of protein-protein interactions. Previously, we developed an LRET assay to screen for small molecule inhibitors of the interaction of σ70 with theβ' coiled-coil fragment (amino acids 100–309). Here we describe an LRET binding assay used to monitor the interaction of E. coli σ70 and σ32 with core RNA polymerase along with the controls to verify the system. This approach generates fluorescently labeled proteins through the random labeling of lysine residues which enables the use of the LRET assay for proteins for which the creation of single cysteine mutants is not feasible. With the LRET binding assay, we are able to show that the interaction of σ70 with core RNAP is much more sensitive to NaCl than to potassium glutamate (KGlu), whereas the σ32 interaction with core RNAP is insensitive to both salts even at concentrations >500 mM. We also find that the interaction of σ32 with core RNAP is stronger than σ70 with core RNAP, under all conditions tested. This work establishes a consistent set of conditions for the comparison of the binding affinities of the E.coli sigma factors with core RNA polymerase. The examination of the importance of salt conditions in the binding of these proteins could have implications in both in vitro assay conditions and in vivo function. PMID:19649256

Development of an enzyme-linked immunosorbent assay and a beta-1 adrenergic receptor-based assay for monitoring the drug atenolol.

PubMed

Sapir, A; Shalev, A Hariton; Skalka, N; Bronshtein, A; Altstein, M

2013-03-01

Two approaches for monitoring atenolol (ATL) were applied: an immunochemical assay and a competitive-binding assay, based on the interaction between ATL and its target receptor, β1 adrenergic receptor (β1AR). Polyclonal antibodies (Abs) for ATL were generated, and a highly specific microplate immunochemical assay, that is, an enzyme-linked immunosorbent assay (ELISA), for its detection was developed. The ATL ELISA exhibited I50 and limit of detection (I20) values of 0.15 ± 0.048 and 0.032 ± 0.016 ng/ml, respectively, and the Abs did not cross-react with any of the tested beta-blocker drugs. Furthermore, a human β1AR (h-β1AR) was stably expressed in Spodoptera frugiperda cells (Sf9). The receptor was employed to develop a competitive-binding assay that monitored binding of ATL in the presence of isoproteranol by quantification of secondary messenger, cyclic adenosine monophosphate (cAMP), levels in the transfected cells. The assay showed that the recombinant h-β1AR was functional, could bind the agonistic ligand isoproterenol as well as the antagonist ATL, as indicated by a dose-dependent elevation of cAMP in the presence of isoproteranol, and decrease after ATL addition. The highly efficient and sensitive ELISA and the receptor assay represent two methods suitable for efficient and cost-effective large-scale, high-throughput monitoring of ATL in environmental, agricultural, and biological samples. Copyright © 2012 SETAC.

ApoHRP-based assay to measure intracellular regulatory heme.

PubMed

Atamna, Hani; Brahmbhatt, Marmik; Atamna, Wafa; Shanower, Gregory A; Dhahbi, Joseph M

2015-02-01

The majority of the heme-binding proteins possess a "heme-pocket" that stably binds to heme. Usually known as housekeeping heme-proteins, they participate in a variety of metabolic reactions (e.g., catalase). Heme also binds with lower affinity to the "Heme-Regulatory Motifs" (HRM) in specific regulatory proteins. This type of heme binding is known as exchangeable or regulatory heme (RH). Heme binding to HRM proteins regulates their function (e.g., Bach1). Although there are well-established methods for assaying total cellular heme (e.g., heme-proteins plus RH), currently there is no method available for measuring RH independent of the total heme (TH). The current study describes and validates a new method to measure intracellular RH. This method is based on the reconstitution of apo-horseradish peroxidase (apoHRP) with heme to form holoHRP. The resulting holoHRP activity is then measured with a colorimetric substrate. The results show that apoHRP specifically binds RH but not with heme from housekeeping heme-proteins. The RH assay detects intracellular RH. Furthermore, using conditions that create positive (hemin) or negative (N-methyl protoporphyrin IX) controls for heme in normal human fibroblasts (IMR90), the RH assay shows that RH is dynamic and independent of TH. We also demonstrated that short-term exposure to subcytotoxic concentrations of lead (Pb), mercury (Hg), or amyloid-β (Aβ) significantly alters intracellular RH with little effect on TH. In conclusion the RH assay is an effective assay to investigate intracellular RH concentration and demonstrates that RH represents ∼6% of total heme in IMR90 cells.

The subunits of the S-phase checkpoint complex Mrc1/Tof1/Csm3: dynamics and interdependence

PubMed Central

2014-01-01

Background The S-phase checkpoint aims to prevent cells from generation of extensive single-stranded DNA that predisposes to genome instability. The S. cerevisiae complex Tof1/Csm3/Mrc1 acts to restrain the replicative MCM helicase when DNA synthesis is prohibited. Keeping the replication machinery intact allows restart of the replication fork when the block is relieved. Although the subunits of the Tof1/Csm3/Mrc1 complex are well studied, the impact of every single subunit on the triple complex formation and function needs to be established. Findings This work studies the cellular localization and the chromatin binding of GFP-tagged subunits when the complex is intact and when a subunit is missing. We demonstrate that the complex is formed in cell nucleus, not the cytoplasm, as Tof1, Csm3 and Mrc1 enter the nucleus independently from one another. Via in situ chromatin binding assay we show that a Tof1-Csm3 dimer formation and chromatin binding is required to ensure the attachment of Mrc1 to chromatin. Our study indicates that the translocation into the nucleus is not the process to regulate the timing of chromatin association of Mrc1. We also studied the nuclear behavior of Mrc1 subunit in the process of adaptation to the presence hydroxyurea. Our results indicate that after prolonged HU incubation, cells bypass the S-phase checkpoint and proceed throughout the cell cycle. This process is accompanied by Mrc1 chromatin detachment and Rad53 dephosphorylation. Conclusions In S. cerevisiae the subunits of the S-phase checkpoint complex Mrc1/Tof1/Csm3 independently enter the cell nucleus, where a Tof1-Csm3 dimer is formed to ensure the chromatin binding of Mrc1 and favor DNA replication and S-phase checkpoint fork arrest. In the process of adaptation to the presence of hydroxyurea Mrc1 is detached from chromatin and Rad53 checkpoint activity is diminished in order to allow S-phase checkpoint escape and completion of the cell cycle. PMID:25379053

The subunits of the S-phase checkpoint complex Mrc1/Tof1/Csm3: dynamics and interdependence.

PubMed

Uzunova, Sonya Dimitrova; Zarkov, Alexander Stefanov; Ivanova, Anna Marianova; Stoynov, Stoyno Stefanov; Nedelcheva-Veleva, Marina Nedelcheva

2014-01-01

The S-phase checkpoint aims to prevent cells from generation of extensive single-stranded DNA that predisposes to genome instability. The S. cerevisiae complex Tof1/Csm3/Mrc1 acts to restrain the replicative MCM helicase when DNA synthesis is prohibited. Keeping the replication machinery intact allows restart of the replication fork when the block is relieved. Although the subunits of the Tof1/Csm3/Mrc1 complex are well studied, the impact of every single subunit on the triple complex formation and function needs to be established. This work studies the cellular localization and the chromatin binding of GFP-tagged subunits when the complex is intact and when a subunit is missing. We demonstrate that the complex is formed in cell nucleus, not the cytoplasm, as Tof1, Csm3 and Mrc1 enter the nucleus independently from one another. Via in situ chromatin binding assay we show that a Tof1-Csm3 dimer formation and chromatin binding is required to ensure the attachment of Mrc1 to chromatin. Our study indicates that the translocation into the nucleus is not the process to regulate the timing of chromatin association of Mrc1. We also studied the nuclear behavior of Mrc1 subunit in the process of adaptation to the presence hydroxyurea. Our results indicate that after prolonged HU incubation, cells bypass the S-phase checkpoint and proceed throughout the cell cycle. This process is accompanied by Mrc1 chromatin detachment and Rad53 dephosphorylation. In S. cerevisiae the subunits of the S-phase checkpoint complex Mrc1/Tof1/Csm3 independently enter the cell nucleus, where a Tof1-Csm3 dimer is formed to ensure the chromatin binding of Mrc1 and favor DNA replication and S-phase checkpoint fork arrest. In the process of adaptation to the presence of hydroxyurea Mrc1 is detached from chromatin and Rad53 checkpoint activity is diminished in order to allow S-phase checkpoint escape and completion of the cell cycle.

Mathematical simulations for bioanalytical assay development: the (un-)necessity and (im-)possibility of free drug quantification.

PubMed

Staack, Roland F; Jordan, Gregor; Heinrich, Julia

2012-02-01

For every drug development program it needs to be discussed whether discrimination between free and total drug concentrations is required to accurately describe its pharmacokinetic behavior. This perspective describes the application of mathematical simulation approaches to guide this initial decision based on available knowledge about target biology, binding kinetics and expected drug concentrations. We provide generic calculations that can be used to estimate the necessity of free drug quantification for different drug molecules. In addition, mathematical approaches are used to simulate various assay conditions in bioanalytical ligand-binding assays: it is demonstrated that due to the noncovalent interaction between the binding partners and typical assay-related interferences in the equilibrium, a correct quantification of the free drug concentration is highly challenging and requires careful design of different assay procedure steps.

Large-scale investigation of Leishmania interaction networks with host extracellular matrix by surface plasmon resonance imaging.

PubMed

Fatoux-Ardore, Marie; Peysselon, Franck; Weiss, Anthony; Bastien, Patrick; Pratlong, Francine; Ricard-Blum, Sylvie

2014-02-01

We have set up an assay to study the interactions of live pathogens with their hosts by using protein and glycosaminoglycan arrays probed by surface plasmon resonance imaging. We have used this assay to characterize the interactions of Leishmania promastigotes with ~70 mammalian host biomolecules (extracellular proteins, glycosaminoglycans, growth factors, cell surface receptors). We have identified, in total, 27 new partners (23 proteins, 4 glycosaminoglycans) of procyclic promastigotes of six Leishmania species and 18 partners (15 proteins, 3 glycosaminoglycans) of three species of stationary-phase promastigotes for all the strains tested. The diversity of the interaction repertoires of Leishmania parasites reflects their dynamic and complex interplay with their mammalian hosts, which depends mostly on the species and strains of Leishmania. Stationary-phase Leishmania parasites target extracellular matrix proteins and glycosaminoglycans, which are highly connected in the extracellular interaction network. Heparin and heparan sulfate bind to most Leishmania strains tested, and 6-O-sulfate groups play a crucial role in these interactions. Numerous Leishmania strains bind to tropoelastin, and some strains are even able to degrade it. Several strains interact with collagen VI, which is expressed by macrophages. Most Leishmania promastigotes interact with several regulators of angiogenesis, including antiangiogenic factors (endostatin, anastellin) and proangiogenic factors (ECM-1, VEGF, and TEM8 [also known as anthrax toxin receptor 1]), which are regulated by hypoxia. Since hypoxia modulates the infection of macrophages by the parasites, these interactions might influence the infection of host cells by Leishmania.

Large-Scale Investigation of Leishmania Interaction Networks with Host Extracellular Matrix by Surface Plasmon Resonance Imaging

PubMed Central

Fatoux-Ardore, Marie; Peysselon, Franck; Weiss, Anthony; Bastien, Patrick; Pratlong, Francine

2014-01-01

We have set up an assay to study the interactions of live pathogens with their hosts by using protein and glycosaminoglycan arrays probed by surface plasmon resonance imaging. We have used this assay to characterize the interactions of Leishmania promastigotes with ∼70 mammalian host biomolecules (extracellular proteins, glycosaminoglycans, growth factors, cell surface receptors). We have identified, in total, 27 new partners (23 proteins, 4 glycosaminoglycans) of procyclic promastigotes of six Leishmania species and 18 partners (15 proteins, 3 glycosaminoglycans) of three species of stationary-phase promastigotes for all the strains tested. The diversity of the interaction repertoires of Leishmania parasites reflects their dynamic and complex interplay with their mammalian hosts, which depends mostly on the species and strains of Leishmania. Stationary-phase Leishmania parasites target extracellular matrix proteins and glycosaminoglycans, which are highly connected in the extracellular interaction network. Heparin and heparan sulfate bind to most Leishmania strains tested, and 6-O-sulfate groups play a crucial role in these interactions. Numerous Leishmania strains bind to tropoelastin, and some strains are even able to degrade it. Several strains interact with collagen VI, which is expressed by macrophages. Most Leishmania promastigotes interact with several regulators of angiogenesis, including antiangiogenic factors (endostatin, anastellin) and proangiogenic factors (ECM-1, VEGF, and TEM8 [also known as anthrax toxin receptor 1]), which are regulated by hypoxia. Since hypoxia modulates the infection of macrophages by the parasites, these interactions might influence the infection of host cells by Leishmania. PMID:24478075

Cross-linking of surface Ig receptors on murine B lymphocytes stimulates the expression of nuclear tetradecanoyl phorbol acetate-response element-binding proteins

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chiles, T.C.; Liu, J.L.; Rothstein, T.L.

1991-03-15

Cross-linking of sIg on primary B lymphocytes leads to increased nuclear DNA-binding activity specific for the tetradecanoyl phorbol acetate-response element (TRE), as judged by gel mobility shift assays. Stimulation of B cells to enter S phase of the cell cycle by treatment with the combination of phorbol ester plus calcium ionophore also stimulated nuclear TRE-binding activity within 2 h, with maximal expression at 4 h; however, phorbol ester and calcium ionophore were not as effective in stimulating binding activity when examined separately. Stimulated nuclear expression of TRE-binding activity appears to require protein synthesis. Fos- and Jun/AP-1-related proteins participate directly inmore » the identified nucleoprotein complex, as shown by the ability of c-fos- and c-jun-specific antisera to either alter or completely abolish electrophoretic migration of the complex in native gels. Further, UV photo-cross-linking studies identified two major TRE-binding protein species, whose sizes correspond to TRE-binding proteins derived from HeLa cell nuclear extracts. The results suggest that in primary B cells nuclear TRE-binding activity represents a downstream signaling event that occurs subsequent to changes in protein kinase C activity and intracellular Ca2+ but that can be triggered physiologically through sIg.« less

Multi-Laboratory Study of Five Methods for the Determination of Brevetoxins in Shellfish Tissue Extracts.

PubMed

Dickey, Robert W; Plakas, Steven M; Jester, Edward L E; El Said, Kathleen R; Johannessen, Jan N; Flewelling, Leanne J; Scott, Paula; Hammond, Dan G; Van Dolah, Frances M; Leighfield, Tod A; Bottein Dachraoui, Marie-Yasmine; Ramsdell, John S; Pierce, Richard H; Henry, Mike S; Poli, Mark A; Walker, Calvin; Kurtz, Jan; Naar, Jerome; Baden, Daniel G; Musser, Steve M; White, Kevin D; Truman, Penelope; Miller, Aaron; Hawryluk, Timothy P; Wekell, Marleen M; Stirling, David; Quilliam, Michael A; Lee, Jung K

A thirteen-laboratory comparative study tested the performance of four methods as alternatives to mouse bioassay for the determination of brevetoxins in shellfish. The methods were N2a neuroblastoma cell assay, two variations of the sodium channel receptor binding assay, competitive ELISA, and LC/MS. Three to five laboratories independently performed each method using centrally prepared spiked and naturally incurred test samples. Competitive ELISA and receptor binding (96-well format) compared most favorably with mouse bioassay. Between-laboratory relative standard deviations (RSDR) ranged from 10 to 20% for ELISA and 14 to 31% for receptor binding. Within-laboratory (RSDr) ranged from 6 to 15% for ELISA, and 5 to 31% for receptor binding. Cell assay was extremely sensitive but data variation rendered it unsuitable for statistical treatment. LC/MS performed as well as ELISA on spiked test samples but was inordinately affected by lack of toxin-metabolite standards, uniform instrumental parameters, or both, on incurred test samples. The ELISA and receptor binding assay are good alternatives to mouse bioassay for the determination of brevetoxins in shellfish.

Microbubble Enzyme-Linked Immunosorbent Assay for the Detection of Targeted Microbubbles in in Vitro Static Binding Assays.

PubMed

Wischhusen, Jennifer; Padilla, Frederic

2017-07-01

Targeted microbubbles (MBs) are ultrasound contrast agents that are functionalized with a ligand for ultrasound molecular imaging of endothelial markers. Novel targeted MBs are characterized in vitro by incubation in protein-coated wells, followed by binding quantification by microscopy or ultrasound imaging. Both methods provide operator-dependent results: Between 3 and 20 fields of view from a heterogeneous sample are typically selected for analysis by microscopy, and in ultrasound imaging, different acoustic settings affect signal intensities. This study proposes a new method to reproducibly quantify MB binding based on enzyme-linked immunosorbent assay (ELISA), in which bound MBs are revealed with an enzyme-linked antibody. MB-ELISA was adapted to in vitro static binding assays, incubating the MBs in inverted position or by agitation, and compared with microscopy. The specificity and sensitivity of MB-ELISA enable the reliable quantification of MB binding in a rapid, high-throughput and whole-well analysis, facilitating the characterization of new targeted contrast agents. Copyright © 2017 World Federation for Ultrasound in Medicine & Biology. Published by Elsevier Inc. All rights reserved.

Assessment of a robust model protocol with accelerated throughput for a human recombinant full length estrogen receptor-alpha binding assay: protocol optimization and intralaboratory assay performance as initial steps towards validation.

PubMed

Freyberger, Alexius; Wilson, Vickie; Weimer, Marc; Tan, Shirlee; Tran, Hoai-Son; Ahr, Hans-Jürgen

2010-08-01

Despite about two decades of research in the field of endocrine active compounds, still no validated human recombinant (hr) estrogen receptor-alpha (ERalpha) binding assay is available, although hr-ERalpha is available from several sources. In a joint effort, US EPA and Bayer Schering Pharma with funding from the EU-sponsored 6th framework project, ReProTect, developed a model protocol for such a binding assay. Important features of this assay are the use of a full length hr-ERalpha and performance in a 96-well plate format. A full length hr-ERalpha was chosen, as it was considered to provide the most accurate and human-relevant results, whereas truncated receptors could perform differently. Besides three reference compounds [17beta-estradiol, norethynodrel, dibutylphthalate] nine test compounds with different affinities for the ERalpha [diethylstilbestrol (DES), ethynylestradiol, meso-hexestrol, equol, genistein, o,p'-DDT, nonylphenol, n-butylparaben, and corticosterone] were used to explore the performance of the assay. Three independent experiments per compound were performed on different days, and dilutions of test compounds from deep-frozen stocks, solutions of radiolabeled ligand and receptor preparation were freshly prepared for each experiment. The ERalpha binding properties of reference and test compounds were well detected. As expected dibutylphthalate and corticosterone were non-binders in this assay. In terms of the relative ranking of binding affinities, there was good agreement with published data obtained from experiments using a human recombinant ERalpha ligand binding domain. Irrespective of the chemical nature of the compound, individual IC(50)-values for a given compound varied by not more than a factor of 2.5. Our data demonstrate that the assay was robust and reliably ranked compounds with strong, weak, and no affinity for the ERalpha with high accuracy. It avoids the manipulation and use of animals, i.e., the preparation of uterine cytosol as receptor source from ovariectomized rats, as a recombinant protein is used and thus contributes to the 3R concept (reduce, replace, and refine). Furthermore, in contrast to other assays, this assay could be adjusted to an intermediate/high throughput format. On the whole, this assay is a promising candidate for further validation. Copyright 2010 Elsevier Inc. All rights reserved.

Detection of microbial invasion of the amniotic cavity by analysis of cervicovaginal proteins in women with preterm labor and intact membranes.

PubMed

Combs, C Andrew; Garite, Thomas J; Lapidus, Jodi A; Lapointe, Jerome P; Gravett, Michael; Rael, Julie; Amon, Erol; Baxter, Jason K; Brady, Kim; Clewell, William; Eddleman, Keith A; Fortunato, Stephen; Franco, Albert; Haas, David M; Heyborne, Kent; Hickok, Durlin E; How, Helen Y; Luthy, David; Miller, Hugh; Nageotte, Michael; Pereira, Leonardo; Porreco, Richard; Robilio, Peter A; Simhan, Hyagriv; Sullivan, Scott A; Trofatter, Kenneth; Westover, Thomas

2015-04-01

Microbial invasion of the amniotic cavity (MIAC) is common in early preterm labor and is associated with maternal and neonatal infectious morbidity. MIAC is usually occult and is reliably detected only with amniocentesis. We sought to develop a noninvasive test to predict MIAC based on protein biomarkers in cervicovaginal fluid (CVF) in a cohort of women with preterm labor (phase 1) and to validate the test in an independent cohort (phase 2). This was a prospective study of women with preterm labor who had amniocentesis to screen for MIAC. MIAC was defined by positive culture and/or 16S ribosomal DNA results. Nine candidate CVF proteins were analyzed by enzyme-linked immunosorbent assay. Logistic regression was used to identify combinations of up to 3 proteins that could accurately classify the phase 1 cohort (N = 108) into those with or without MIAC. The best models, selected by area under the curve (AUC) of the receiver operating characteristic curve in phase 1, included various combinations of interleukin (IL)-6, chemokine (C-X-C motif) ligand 1 (CXCL1), alpha fetoprotein, and insulin-like growth factor binding protein-1. Model performance was then tested in the phase 2 cohort (N = 306). MIAC was present in 15% of cases in phase 1 and 9% in phase 2. A 3-marker CVF model using IL-6 plus CXCL1 plus insulin-like growth factor binding protein-1 had AUC 0.87 in phase 1 and 0.78 in phase 2. Two-marker models using IL-6 plus CXCL1 or alpha fetoprotein plus CXCL1 performed similarly in phase 2 (AUC 0.78 and 0.75, respectively), but were not superior to CVF IL-6 alone (AUC 0.80). A cutoff value of CVF IL-6 ≥463 pg/mL (which had 81% sensitivity in phase 1) predicted MIAC in phase 2 with sensitivity 79%, specificity 78%, positive predictive value 38%, and negative predictive value 97%. High levels of IL-6 in CVF are strongly associated with MIAC. If developed into a bedside test or rapid laboratory assay, cervicovaginal IL-6 might be useful in selecting patients in whom the probability of MIAC is high enough to warrant amniocentesis or transfer to a higher level of care. Such a test might also guide selection of potential subjects for treatment trials. Copyright © 2015 Elsevier Inc. All rights reserved.

Carbonic anhydrase II binds to and increases the activity of the epithelial sodium-proton exchanger, NHE3

PubMed Central

Krishnan, Devishree; Liu, Lei; Wiebe, Shane A.; Casey, Joseph R.; Cordat, Emmanuelle; Alexander, R. Todd

2016-01-01

Two-thirds of sodium filtered by the renal glomerulus is reabsorbed from the proximal tubule via a sodium/proton exchanger isoform 3 (NHE3)-dependent mechanism. Since sodium and bicarbonate reabsorption are coupled, we postulated that the molecules involved in their reabsorption [NHE3 and carbonic anhydrase II (CAII)] might physically and functionally interact. Consistent with this, CAII and NHE3 were closely associated in a renal proximal tubular cell culture model as revealed by a proximity ligation assay. Direct physical interaction was confirmed in solid-phase binding assays with immobilized CAII and C-terminal NHE3 glutathione-S-transferase fusion constructs. To assess the effect of CAII on NHE3 function, we expressed NHE3 in a proximal tubule cell line and measured NHE3 activity as the rate of intracellular pH recovery, following an acid load. NHE3-expressing cells had a significantly greater rate of intracellular pH recovery than controls. Inhibition of endogenous CAII activity with acetazolamide significantly decreased NHE3 activity, indicating that CAII activates NHE3. To ascertain whether CAII binding per se activates NHE3, we expressed NHE3 with wild-type CAII, a catalytically inactive CAII mutant (CAII-V143Y), or a mutant unable to bind other transporters (CAII-HEX). NHE3 activity increased upon wild-type CAII coexpression, but not in the presence of the CAII V143Y or HEX mutant. Together these studies support an association between CAII and NHE3 that alters the transporter’s activity. PMID:26041446

Development of a Novel Green Fluorescent Protein-Based Binding Assay to Study the Association of Plakins with Intermediate Filament Proteins.

PubMed

Favre, Bertrand; Begré, Nadja; Bouameur, Jamal-Eddine; Borradori, Luca

2016-01-01

Protein-protein interactions are fundamental for most biological processes, such as the formation of cellular structures and enzymatic complexes or in signaling pathways. The identification and characterization of protein-protein interactions are therefore essential for understanding the mechanisms and regulation of biological systems. The organization and dynamics of the cytoskeleton, as well as its anchorage to specific sites in the plasma membrane and organelles, are regulated by the plakins. These structurally related proteins anchor different cytoskeletal networks to each other and/or to other cellular structures. The association of several plakins with intermediate filaments (IFs) is critical for maintenance of the cytoarchitecture. Pathogenic mutations in the genes encoding different plakins can lead to dramatic manifestations, occurring principally in the skin, striated muscle, and/or nervous system, due to cytoskeletal disorganization resulting in abnormal cell fragility. Nevertheless, it is still unclear how plakins bind to IFs, although some general rules are slowly emerging. We here describe in detail a recently developed protein-protein fluorescence binding assay, based on the production of recombinant proteins tagged with green fluorescent protein (GFP) and their use as fluid-phase fluorescent ligands on immobilized IF proteins. Using this method, we have been able to assess the ability of C-terminal regions of GFP-tagged plakin proteins to bind to distinct IF proteins and IF domains. This simple and sensitive technique, which is expected to facilitate further studies in this area, can also be potentially employed for any kind of protein-protein interaction studies. © 2016 Elsevier Inc. All rights reserved.

Colorimetric detection with aptamer-gold nanoparticle conjugates coupled to an android-based color analysis application for use in the field.

PubMed

Smith, Joshua E; Griffin, Daniel K; Leny, Juliann K; Hagen, Joshua A; Chávez, Jorge L; Kelley-Loughnane, Nancy

2014-04-01

The feasibility of using aptamer-gold nanoparticle conjugates (Apt-AuNPs) to design colorimetric assays for in the field detection of small molecules was investigated. An assay to detect cocaine was designed using two clones of a known cocaine-binding aptamer. The assay was based on the AuNPs difference in affinity for single-stranded DNA (non-binding) and double stranded DNA (target bound). In the first assay, a commonly used design was followed, in which the aptamer and target were incubated to allow binding followed by exposure to the AuNPs. Interactions between the non-bound analytes and the AuNPs surface resulted in a number of false positives. The assay was redesigned by incubating the AuNPs and the aptamer prior to target addition to passivate the AuNPs surface. The adsorbed aptamer was able to bind the target while preventing non-specific interactions. The assay was validated with a number of masking and cutting agents and other controlled substances showing minimal false positives. Studies to improve the assay performance in the field were performed, showing that assay activity could be preserved for up to 2 months. To facilitate the assay analysis, an android application for automatic colorimetric characterization was developed. The application was validated by challenging the assay with cocaine standards of different concentrations, and comparing the results to a conventional plate reader, showing outstanding agreement. Finally, the rapid identification of cocaine in mixtures mimicking street samples was demonstrated. This work established that Apt-AuNPs can be used to design robust assays to be used in the field. Copyright © 2013 Elsevier B.V. All rights reserved.

Solid-phase receptor-based assay for the detection of cyclic imines by chemiluminescence, fluorescence, or colorimetry.

PubMed

Rodríguez, Laura P; Vilariño, Natalia; Molgó, Jordi; Aráoz, Rómulo; Antelo, Alvaro; Vieytes, Mercedes R; Botana, Luis M

2011-08-01

The spirolides and gymnodimines are marine phycotoxins included in the group of cyclic imines. The toxicity of these compounds to humans is still unknown, although their toxicity by intraperitoneal injection in rodents is very high. A receptor-based method was developed using the competition of the 13-desmethyl spirolide C with biotin-labeled α-bungarotoxin for binding to nicotinic acetylcholine receptors and the immobilization of the α-bungarotoxin-receptor complex on streptavidin-coated surfaces. The quantification of the immobilized receptor can be achieved using a specific antibody. Finally, after the addition of a secondary antibody labeled with horseradish peroxidase, three alternative substrates of this enzyme generate a chemiluminescent, fluorescent, or colorimetric signal. The assay performs well in shellfish extracts and the detection range is 5-150 nM of 13-desmethyl spirolide C in shellfish extracts, which is at least 5 times more sensitive than the existing fluorescence polarization assay. This assay can also detect gymnodimine, although with 10 times lower sensitivity than the spirolide. The detection of cyclic imines with microplate assays would be useful for screening purposes in order to reduce the number of samples to be processed by bioassays or analytical methods.

Molecularly imprinted polymer nanoparticle-based assay (MINA): application for fumonisin B1 determination.

PubMed

Munawar, Hasim; Smolinska-Kempisty, Katarzyna; Cruz, Alvaro Garcia; Canfarotta, Francesco; Piletska, Elena; Karim, Khalku; Piletsky, Sergey A

2018-06-20

The enzyme-linked immunosorbent assay (ELISA) has been used as a standard tool for monitoring food and animal feed contamination from the carcinogenic fumonisin B1 (FB1). Unfortunately, ELISA is not always efficient due to the instability of the antibody and enzyme components in the immunoassay, the presence of natural enzyme inhibitors in the samples and the high levels of non-specific protein binding. Additionally, the production of antibodies for ELISA can be time-consuming and costly, due to the involvement of animals in the manufacturing process. To overcome these limiting factors, a molecularly imprinted nanoparticle based assay (MINA) has been developed, where the molecularly imprinted nanoparticles (nanoMIPs) replace the primary antibody used in a competitive ELISA. Herein, computational modelling was used to design the nanoMIPs by selecting monomers that specifically interact with FB1. The affinity of the monomers to FB1 was verified by measuring their binding in affinity chromatography experiments. The nanoMIPs were produced by solid phase synthesis and the results showed that nanoMIPs had a hydrodynamic diameter of around 249 ± 29 nm. The assay tested in model samples is highly selective and does not show cross-reactivity with other mycotoxins such as fumonisin B2 (FB2), aflatoxin B1 (AFB1), citrinin (CTT), zearalenone (ZEA), and deoxynivalenol (DON). The MINA allows the detection of FB1 in the concentration range of 10 pM-10 nM with a detection limit of 1.9 pM and a recovery of 108.13-113.76%.

Formation of target-specific binding sites in enzymes: solid-phase molecular imprinting of HRP.

PubMed

Czulak, J; Guerreiro, A; Metran, K; Canfarotta, F; Goddard, A; Cowan, R H; Trochimczuk, A W; Piletsky, S

2016-06-07

Here we introduce a new concept for synthesising molecularly imprinted nanoparticles by using proteins as macro-functional monomers. For a proof-of-concept, a model enzyme (HRP) was cross-linked using glutaraldehyde in the presence of glass beads (solid-phase) bearing immobilized templates such as vancomycin and ampicillin. The cross-linking process links together proteins and protein chains, which in the presence of templates leads to the formation of permanent target-specific recognition sites without adverse effects on the enzymatic activity. Unlike complex protein engineering approaches commonly employed to generate affinity proteins, the method proposed can be used to produce protein-based ligands in a short time period using native protein molecules. These affinity materials are potentially useful tools especially for assays since they combine the catalytic properties of enzymes (for signaling) and molecular recognition properties of antibodies. We demonstrate this concept in an ELISA-format assay where HRP imprinted with vancomycin and ampicillin replaced traditional enzyme-antibody conjugates for selective detection of templates at micromolar concentrations. This approach can potentially provide a fast alternative to raising antibodies for targets that do not require high assay sensitivities; it can also find uses as a biochemical research tool, as a possible replacement for immunoperoxidase-conjugates.

Criteria for the selection of a solid phase to be used in immunoassays.

PubMed

Delagneau, J F; Masseyeff, R

1990-01-01

Heterogeneous immunoassays are very sensitive and only limited in terms of performance by non specific binding. They require separation of free from bound fractions and concomitant use of a solid phase coated with an immunoreactive component (i.e. immunosorbent). The improvement of these key immunosorbents is crucial and involves a great deal of expertise and capabilities. Specifications differ according to procedure (e.g. capture or competitive assay). Each routinely used solid phase, such as polystyrene wells, porous membrane or dispersible microbeads, presents specific performance characteristics, advantages, and drawbacks. Among the tasks to be implemented are optimization of the spatial orientation of immunological reagents, selection of the surface neutral hydrophilic support, acceleration of reactions by increasing the reactive surface area of the supports, streamlining and simplification of procedural steps. These various aspects are abundantly described and emphasized here.

A novel and sensitive radioreceptor assay for serum melatonin levels

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tenn, C.; Niles, L.

A simple and sensitive radioreceptor assay (RRA) has been developed to measure melatonin levels in serum. The assay is based on competition between 2-({sup 125}I)iodomelatonin (({sup 125}I)MEL) and melatonin for binding to high-affinity binding sites in chick forebrain. To measure the amount of melatonin present in a serum sample, it was extracted with dichloromethane and added to the assay medium. The percentage inhibition of radioligand binding in the presence of the extracted serum was determined and compared to the percent displacement by known amounts of melatonin in a standard curve. There was little or no cross-reactivity with other structurally relatedmore » compounds. The sensitivity of the assay is {approximately}1.5pg/0.15 mL and the intra- and inter-assay variations are approximately 8%. Since the RRA results are comparable to that of an established radioimmunoassay (RIA), it provides a sensitive and rapid alternative to the more time consuming RIA.« less

Expression of human peroxisome proliferator-activated receptors ligand binding domain-maltose binding protein fusion protein in Escherichia coli: a convenient and reliable method for preparing receptor for screening ligands.

PubMed

Li, Changqing; Tian, Mi; Yuan, Ye; Zhou, Qinxin

2008-12-01

Human peroxisome proliferator-activated receptors (hPPARs) are ligand-activated transcription factors and are the target for the treatment of many diseases. Screening of their ligands is mainly based on assays of ligand binding to the ligand binding domain (LBD) of hPPARs.However, such assays are difficult because of the preparation of hPPARs LBD. In order to yield functional hPPARs LBD for screening ligands, hPPARs LBD was fused with maltose-binding protein(MBP) using the pMAL-p2x expression system through the gene engineering technique. The radioligand binding assay showed that MBP did not affect ligand binding with hPPARs LBD in the fusion proteins, which means that MBP-hPPARs LBD can be used instead of hPPARs LBD in ligand screening work. The results show that the new strategy using MBP as a fusion tag for preparing hPPARs LBD for screening ligands is a convenient and reliable method. It may be used to easily obtain the other nuclear receptors.

Lectins discriminate between pathogenic and nonpathogenic South American trypanosomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

de Miranda Santos, I.K.; Pereira, M.E.

1984-09-01

Cell surface carbohydrates of Trypanosoma cruzi, Trypanosoma rangeli, and Trypanosoma conorhini were analyzed by a micro-agglutination assay employing 27 highly purified lectins and by binding assays using various /sup 125/I-labeled lectins. The following seven lectins discriminated between the trypanosomes: 1) tomato lectin (an N-acetyl-D-glucosamine-binding protein), both in purified form and as crude tomato juice; 2) Bauhinea purpurea and Sophora japonica lectins (both N-acetyl-D-galactosamine-binding proteins), which selectively agglutinated T. cruzi; 3) Vicia villosa (an N-acetyl-D-galactosamine-binding protein) which was specific for T. rangeli; 4) peanut lectin (a D-galactose-binding protein) both in purified form and as crude saline extract; and 5) Ulex europaeusmore » and Lotus tetragonolobus (both L-fucose-binding proteins) lectins which reacted only with T. conorhini. Binding studies with 125I-labeled lectins were performed to find whether unagglutinated cells of the three different species of trypanosomes might have receptors for these lectins, in which case absence of agglutination could be due to a peculiar arrangement of the receptors. These assays essentially confirmed the agglutination experiments.« less

Drug Target Interference in Immunogenicity Assays: Recommendations and Mitigation Strategies.

PubMed

Zhong, Zhandong Don; Clements-Egan, Adrienne; Gorovits, Boris; Maia, Mauricio; Sumner, Giane; Theobald, Valerie; Wu, Yuling; Rajadhyaksha, Manoj

2017-11-01

Sensitive and specific methodology is required for the detection and characterization of anti-drug antibodies (ADAs). High-quality ADA data enables the evaluation of potential impact of ADAs on the drug pharmacokinetic profile, patient safety, and efficacious response to the drug. Immunogenicity assessments are typically initiated at early stages in preclinical studies and continue throughout the drug development program. One of the potential bioanalytical challenges encountered with ADA testing is the need to identify and mitigate the interference mediated by the presence of soluble drug target. A drug target, when present at sufficiently high circulating concentrations, can potentially interfere with the performance of ADA and neutralizing antibody (NAb) assays, leading to either false-positive or, in some cases, false-negative ADA and NAb assay results. This publication describes various mechanisms of assay interference by soluble drug target, as well as strategies to recognize and mitigate such target interference. Pertinent examples are presented to illustrate the impact of target interference on ADA and NAb assays as well as several mitigation strategies, including the use of anti-target antibodies, soluble versions of the receptors, target-binding proteins, lectins, and solid-phase removal of targets. Furthermore, recommendations for detection and mitigation of such interference in different formats of ADA and NAb assays are provided.

A versatile assay for RNA-binding proteins in living cells

PubMed Central

Strein, Claudia; Alleaume, Anne-Marie; Rothbauer, Ulrich; Hentze, Matthias W.; Castello, Alfredo

2014-01-01

RNA-binding proteins (RBPs) control RNA fate from synthesis to decay. Since their cellular expression levels frequently do not reflect their in vivo activity, methods are needed to assess the steady state RNA-binding activity of RBPs as well as their responses to stimuli. While electrophoresis mobility shift assays (EMSA) have been used for such determinations, their results serve at best as proxies for the RBP activities in living cells. Here, we describe a quantitative dual fluorescence method to analyze protein–mRNA interactions in vivo. Known or candidate RBPs are fused to fluorescent proteins (eGFP, YFP), expressed in cells, cross-linked in vivo to RNA by ultraviolet light irradiation, and immunoprecipitated, after lysis, with a single chain antibody fragment directed against eGFP (GFP-binding protein, GBP). Polyadenylated RNA-binding activity of fusion proteins is assessed by hybridization with an oligo(DT) probe coupled with a red fluorophore. Since UV light is directly applied to living cells, the assay can be used to monitor dynamic changes in RNA-binding activities in response to biological or pharmacological stimuli. Notably, immunoprecipitation and hybridization can also be performed with commercially available GBP-coupled 96-well plates (GFP-multiTrap), allowing highly parallel RNA-binding measurements in a single experiment. Therefore, this method creates the possibility to conduct in vivo high-throughput RNA-binding assays. We believe that this fast and simple radioactivity-free method will find many useful applications in RNA biology. PMID:24664470

Concentration Gradient Immunoassay I. A Rapid Immunoassay Based on Interdiffusion and Surface Binding in a Microchannel

PubMed Central

Nelson, Kjell E.; Foley, Jennifer O.; Yager, Paul

2008-01-01

We describe a novel microfluidic immunoassay method based on the diffusion of a small molecule analyte into a parallel-flowing stream containing cognate antibody. This interdiffusion results in a steady-state gradient of antibody binding site occupancy transverse to convective flow. In contrast to the diffusion immunoassay (Hatch et al. Nature Biotechnology,19:461−465 (2001)), this antibody occupancy gradient is interrogated by a sensor surface coated with a functional analog of the analyte. Antibodies with at least one unoccupied binding site may specifically bind to this functionalized surface, leading to a quantifiable change in surface coverage by the antibody. SPR imaging is used to probe the spatial distribution of antibody binding to the surface and, therefore, the outcome of the assay. We show that the pattern of antibody binding to the SPR sensing surface correlates with the concentration of a model analyte (phenytoin) in the sample stream. Using an inexpensive disposable microfluidic device, we demonstrate assays for phenytoin ranging in concentration from 75 to 1000 nM in phosphate buffer. At a total volumetric flow rate of 90 nL/sec, the assays are complete within 10 minutes. Inclusion of an additional flow stream on the side of the antibody stream opposite to that of the sample enables simultaneous calibration of the assay. This assay method is suitable for rapid quantitative detection of low-molecular weight analytes for point-of-care diagnostic instrumentation. PMID:17437332

Improved flow cytometer measurement of binding assays

DOEpatents

Saunders, G.C.

1984-05-30

The invention relates to a method of measuring binding assays carried out with different size particles wherein the binding assay sample is run through a flow cytometer without separating the sample from the marking agent. The amount of a binding reactant present in a sample is determined by providing particles with a coating of binder and also a known quantity of smaller particles with a coating of binder reactant. The binding reactant is the same as the binding reactant present in the sample. The smaller particles also contain a fluorescent chemical. The particles are combined with the sample and the binding reaction is allowed to occur for a set length of time followed by combining the smaller particles with the mixture of the particles and the sample produced and allowing the binding reactions to proceed to equilibrium. The fluorescence and light scatter of the combined mixture is then measured as the combined mixture passes through a flow cytometer equipped with a laser to bring about fluorescence, and the number and strength of fluorescent events are compared. A similar method is also provided for determining the amount of antigen present in the sample by providing spheres with an antibody coating and some smaller spheres with an antigen coating. (LEW)

The minor house dust mite allergen Der p 13 is a fatty acid-binding protein and an activator of a TLR2-mediated innate immune response.

PubMed

Satitsuksanoa, P; Kennedy, M; Gilis, D; Le Mignon, M; Suratannon, N; Soh, W T; Wongpiyabovorn, J; Chatchatee, P; Vangveravong, M; Rerkpattanapipat, T; Sangasapaviliya, A; Piboonpocanun, S; Nony, E; Ruxrungtham, K; Jacquet, A

2016-10-01

The house dust mite (HDM) allergen Der p 13 could be a lipid-binding protein able to activate key innate signaling pathways in the initiation of the allergic response. We investigated the IgE reactivity of recombinant Der p 13 (rDer p 13), its lipid-binding activities, and its capacity to stimulate airway epithelium cells. Purified rDer p 13 was characterized by mass spectrometry, circular dichroism, fluorescence-based lipid-binding assays, and in silico structural prediction. IgE-binding activity and allergenic potential of Der p 13 were examined by ELISA, basophil degranulation assays, and in vitro airway epithelial cell activation assays. Protein modeling and biophysical analysis indicated that Der p 13 adopts a β-barrel structure with a predominately apolar pocket representing a potential binding site for hydrophobic ligands. Fluorescent lipid-binding assays confirmed that the protein is highly selective for ligands and that it binds a fatty acid with a dissociation constant typical of lipid transporter proteins. The low IgE-binding frequency (7%, n = 224) in Thai HDM-allergic patients as well as the limited propensity to activate basophil degranulation classifies Der p 13 as a minor HDM allergen. Nevertheless, the protein with its presumptively associated lipid(s) triggered the production of IL-8 and GM-CSF in respiratory epithelial cells through a TLR2-, MyD88-, NF-kB-, and MAPK-dependent signaling pathway. Although a minor allergen, Der p 13 may, through its lipid-binding capacity, play a role in the initiation of the HDM-allergic response through TLR2 activation. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Super-sensitive time-resolved fluoroimmunoassay for thyroid-stimulating hormone utilizing europium(III) nanoparticle labels achieved by protein corona stabilization, short binding time, and serum preprocessing.

PubMed

Näreoja, Tuomas; Rosenholm, Jessica M; Lamminmäki, Urpo; Hänninen, Pekka E

2017-05-01

Thyrotropin or thyroid-stimulating hormone (TSH) is used as a marker for thyroid function. More precise and more sensitive immunoassays are needed to facilitate continuous monitoring of thyroid dysfunctions and to assess the efficacy of the selected therapy and dosage of medication. Moreover, most thyroid diseases are autoimmune diseases making TSH assays very prone to immunoassay interferences due to autoantibodies in the sample matrix. We have developed a super-sensitive TSH immunoassay utilizing nanoparticle labels with a detection limit of 60 nU L -1 in preprocessed serum samples by reducing nonspecific binding. The developed preprocessing step by affinity purification removed interfering compounds and improved the recovery of spiked TSH from serum. The sensitivity enhancement was achieved by stabilization of the protein corona of the nanoparticle bioconjugates and a spot-coated configuration of the active solid-phase that reduced sedimentation of the nanoparticle bioconjugates and their contact time with antibody-coated solid phase, thus making use of the higher association rate of specific binding due to high avidity nanoparticle bioconjugates. Graphical Abstract We were able to decrease the lowest limit of detection and increase sensitivity of TSH immunoassay using Eu(III)-nanoparticles. The improvement was achieved by decreasing binding time of nanoparticle bioconjugates by small capture area and fast circular rotation. Also, we applied a step to stabilize protein corona of the nanoparticles and a serum-preprocessing step with a structurally related antibody.

Identification of RNAIII-binding proteins in Staphylococcus aureus using tethered RNAs and streptavidin aptamers based pull-down assay.

PubMed

Zhang, Xu; Zhu, Qing; Tian, Tian; Zhao, Changlong; Zang, Jianye; Xue, Ting; Sun, Baolin

2015-05-15

It has been widely recognized that small RNAs (sRNAs) play important roles in physiology and virulence control in bacteria. In Staphylococcus aureus, many sRNAs have been identified and some of them have been functionally studied. Since it is difficult to identify RNA-binding proteins (RBPs), very little has been known about the RBPs in S. aureus, especially those associated with sRNAs. Here we adopted a tRNA scaffold streptavidin aptamer based pull-down assay to identify RBPs in S. aureus. The tethered RNA was successfully captured by the streptavidin magnetic beads, and proteins binding to RNAIII were isolated and analyzed by mass spectrometry. We have identified 81 proteins, and expressed heterologously 9 of them in Escherichia coli. The binding ability of the recombinant proteins with RNAIII was further analyzed by electrophoresis mobility shift assay, and the result indicates that proteins CshA, RNase J2, Era, Hu, WalR, Pyk, and FtsZ can bind to RNAIII. This study suggests that some proteins can bind to RNA III in S. aureus, and may be involved in RNA III function. And tRSA based pull-down assay is an effective method to search for RBPs in bacteria, which should facilitate the identification and functional study of RBPs in diverse bacterial species.

Molecular characterization of the receptor binding structure-activity relationships of influenza B virus hemagglutinin.

PubMed

Carbone, V; Kim, H; Huang, J X; Baker, M A; Ong, C; Cooper, M A; Li, J; Rockman, S; Velkov, T

2013-01-01

Selectivity of α2,6-linked human-like receptors by B hemagglutinin (HA) is yet to be fully understood. This study integrates binding data with structure-recognition models to examine the impact of regional-specific sequence variations within the receptor-binding pocket on selectivity and structure activity relationships (SAR). The receptor-binding selectivity of influenza B HAs corresponding to either B/Victoria/2/1987 or the B/Yamagata/16/88 lineages was examined using surface plasmon resonance, solid-phase ELISA and gel-capture assays. Our SAR data showed that the presence of asialyl sugar units is the main determinant of receptor preference of α2,6 versus α2,3 receptor binding. Changes to the type of sialyl-glycan linkage present on receptors exhibit only a minor effect upon binding affinity. Homology-based structural models revealed that structural properties within the HA pocket, such as a glyco-conjugate at Asn194 on the 190-helix, sterically interfere with binding to avian receptor analogs by blocking the exit path of the asialyl sugars. Similarly, naturally occurring substitutions in the C-terminal region of the 190-helix and near the N-terminal end of the 140-loop narrows the horizontal borders of the binding pocket, which restricts access of the avian receptor analog LSTa. This study helps bridge the gap between ligand structure and receptor recognition for influenza B HA; and provides a consensus SAR model for the binding of human and avian receptor analogs to influenza B HA.

Solid-phase supports for the in situ assembly of quantum dot-FRET hybridization assays in channel microfluidics.

PubMed

Tavares, Anthony J; Noor, M Omair; Uddayasankar, Uvaraj; Krull, Ulrich J; Vannoy, Charles H

2014-01-01

Semiconductor quantum dots (QDs) have long served as integral components in signal transduction modalities such as Förster resonance energy transfer (FRET). The majority of bioanalytical methods using QDs for FRET-based techniques simply monitor binding-induced conformational changes. In more recent work, QDs have been incorporated into solid-phase support systems, such as microfluidic chips, to serve as physical platforms in the development of functional biosensors and bioprobes. Herein, we describe a simple strategy for the transduction of nucleic acid hybridization that combines a novel design method based on FRET with an electrokinetically controlled microfluidic technology, and that offers further potential for amelioration of sample-handling issues and for simplification of dynamic stringency control.

Determination of equilibrium dissociation constants for recombinant antibodies by high-throughput affinity electrophoresis.

PubMed

Pan, Yuchen; Sackmann, Eric K; Wypisniak, Karolina; Hornsby, Michael; Datwani, Sammy S; Herr, Amy E

2016-12-23

High-quality immunoreagents enhance the performance and reproducibility of immunoassays and, in turn, the quality of both biological and clinical measurements. High quality recombinant immunoreagents are generated using antibody-phage display. One metric of antibody quality - the binding affinity - is quantified through the dissociation constant (K D ) of each recombinant antibody and the target antigen. To characterize the K D of recombinant antibodies and target antigen, we introduce affinity electrophoretic mobility shift assays (EMSAs) in a high-throughput format suitable for small volume samples. A microfluidic card comprised of free-standing polyacrylamide gel (fsPAG) separation lanes supports 384 concurrent EMSAs in 30 s using a single power source. Sample is dispensed onto the microfluidic EMSA card by acoustic droplet ejection (ADE), which reduces EMSA variability compared to sample dispensing using manual or pin tools. The K D for each of a six-member fragment antigen-binding fragment library is reported using ~25-fold less sample mass and ~5-fold less time than conventional heterogeneous assays. Given the form factor and performance of this micro- and mesofluidic workflow, we have developed a sample-sparing, high-throughput, solution-phase alternative for biomolecular affinity characterization.

Determination of equilibrium dissociation constants for recombinant antibodies by high-throughput affinity electrophoresis

PubMed Central

Pan, Yuchen; Sackmann, Eric K.; Wypisniak, Karolina; Hornsby, Michael; Datwani, Sammy S.; Herr, Amy E.

2016-01-01

High-quality immunoreagents enhance the performance and reproducibility of immunoassays and, in turn, the quality of both biological and clinical measurements. High quality recombinant immunoreagents are generated using antibody-phage display. One metric of antibody quality – the binding affinity – is quantified through the dissociation constant (KD) of each recombinant antibody and the target antigen. To characterize the KD of recombinant antibodies and target antigen, we introduce affinity electrophoretic mobility shift assays (EMSAs) in a high-throughput format suitable for small volume samples. A microfluidic card comprised of free-standing polyacrylamide gel (fsPAG) separation lanes supports 384 concurrent EMSAs in 30 s using a single power source. Sample is dispensed onto the microfluidic EMSA card by acoustic droplet ejection (ADE), which reduces EMSA variability compared to sample dispensing using manual or pin tools. The KD for each of a six-member fragment antigen-binding fragment library is reported using ~25-fold less sample mass and ~5-fold less time than conventional heterogeneous assays. Given the form factor and performance of this micro- and mesofluidic workflow, we have developed a sample-sparing, high-throughput, solution-phase alternative for biomolecular affinity characterization. PMID:28008969

Alpha-synuclein aggregates activate calcium pump SERCA leading to calcium dysregulation.

PubMed

Betzer, Cristine; Lassen, Louise Berkhoudt; Olsen, Anders; Kofoed, Rikke Hahn; Reimer, Lasse; Gregersen, Emil; Zheng, Jin; Calì, Tito; Gai, Wei-Ping; Chen, Tong; Moeller, Arne; Brini, Marisa; Fu, Yuhong; Halliday, Glenda; Brudek, Tomasz; Aznar, Susana; Pakkenberg, Bente; Andersen, Jens Peter; Jensen, Poul Henning

2018-05-01

Aggregation of α-synuclein is a hallmark of Parkinson's disease and dementia with Lewy bodies. We here investigate the relationship between cytosolic Ca 2+ and α-synuclein aggregation. Analyses of cell lines and primary culture models of α-synuclein cytopathology reveal an early phase with reduced cytosolic Ca 2+ levels followed by a later Ca 2+ increase. Aggregated but not monomeric α-synuclein binds to and activates SERCA in vitro , and proximity ligation assays confirm this interaction in cells. The SERCA inhibitor cyclopiazonic acid (CPA) normalises both the initial reduction and the later increase in cytosolic Ca 2+ CPA protects the cells against α-synuclein-aggregate stress and improves viability in cell models and in Caenorhabditis elegans in vivo Proximity ligation assays also reveal an increased interaction between α-synuclein aggregates and SERCA in human brains affected by dementia with Lewy bodies. We conclude that α-synuclein aggregates bind SERCA and stimulate its activity. Reducing SERCA activity is neuroprotective, indicating that SERCA and down-stream processes may be therapeutic targets for treating α-synucleinopathies. © 2018 The Authors. Published under the terms of the CC BY NC ND 4.0 license.

Screening Anti-Cancer Drugs against Tubulin using Catch-and-Release Electrospray Ionization Mass Spectrometry

NASA Astrophysics Data System (ADS)

Rezaei Darestani, Reza; Winter, Philip; Kitova, Elena N.; Tuszynski, Jack A.; Klassen, John S.

2016-05-01

Tubulin, which is the building block of microtubules, plays an important role in cell division. This critical role makes tubulin an attractive target for the development of chemotherapeutic drugs to treat cancer. Currently, there is no general binding assay for tubulin-drug interactions. The present work describes the application of the catch-and-release electrospray ionization mass spectrometry (CaR-ESI-MS) assay to investigate the binding of colchicinoid drugs to αβ-tubulin dimers extracted from porcine brain. Proof-of-concept experiments using positive (ligands with known affinities) and negative (non-binders) controls were performed to establish the reliability of the assay. The assay was then used to screen a library of seven colchicinoid analogues to test their binding to tubulin and to rank their affinities.

Changes in the levels of mannan-binding lectin and ficolins during head-down tilted bed rest.

PubMed

Kelsen, Jens; Sandahl, Thomas D; Storm, Line; Frings-Meuthen, Petra; Dahlerup, Jens F; Thiel, Steffen

2014-08-01

Spaceflight studies and ground-based analogues of microgravity indicate a weakening of human immunity. Mannan-binding lectin (MBL) and H-, L-, and M-ficolin together constitute the lectin pathway and mediate the clearance of pathogens through complement activation. We hypothesized that simulated microgravity may weaken human innate immune functions and studied the impact of 6° head-down tilted bed rest (HDT) for 21 d on MBL and ficolin levels. Within a 6-mo period, seven men underwent two periods of HDT. Blood samples were analyzed for MBL, H-, L-, and M-ficolin, mannose-binding lectin-associated protein of 44 kDa (MAp44), and collectin liver 1 (CL-L1) by time-resolved immunofluorometric assays (TRIFMA). We observed well-defined individual preintervention levels of MBL and ficolins. Remarkably similar intraindividual changes occurred for MBL and MBL levels decreased (mean 282 ng · ml⁻¹) in the recovery phase. Conversely, CL-L1, a protein with MBL-like properties, increased (mean 102 ng · ml⁻¹) during the recovery phase. M-ficolin increased (mean 79 ng · ml⁻¹) within the first 2 d of HDT, followed by a decrease (mean 112 ng · ml⁻¹) during the recovery phase. L-ficolin increased (mean 304 ng · ml⁻¹) during HDT, while H-ficolin was essentially unaffected. MAp44, a down-regulator of the lectin pathway, decreased initially (mean 78 ng · ml⁻¹) in the recovery phase followed by an increase (mean 131 ng · ml⁻¹). Alterations in MBL and ficolin levels were modest and with our current knowledge do not lead to overt immunodeficiency. Pronounced changes occurred when the subjects resumed the upright position. In selected individuals, these changes appear to be a conserved response to HDT.

Multi-specificity of a Psathyrella velutina mushroom lectin: heparin/pectin binding occurs at a site different from the N-acetylglucosamine/N-acetylneuraminic acid-specific site.

PubMed

Ueda, H; Saitoh, T; Kojima, K; Ogawa, H

1999-09-01

An N-acetylglucosamine (GlcNAc)/N-acetylneuraminic acid-specific lectin from the fruiting body of Psathyrella velutina (PVL) is a useful probe for the detection and fractionation of specific carbohydrates. In this study, PVL was found to exhibit multispecificity to acidic polysaccharides and sulfatides. Purified PVL and a counterpart lectin to PVL in the mycelium interact with heparin neoproteoglycans, as detected by both membrane analysis and solid phase assay. The pH-dependencies of the binding to heparin and GlcNAc5-6 differ. The heparin binding of PVL is inhibited best by pectin, polygalacturonic acid, and highly sulfated polysaccharides, but not by GlcNAc, colominic acid, or other glycosaminoglycans. Sandwich affinity chromatography indicated that PVL can simultaneously interact with heparin- and GlcNAc-containing macromolecules. Extensive biotinylation was found to suppress the binding activity to heparin while the GlcNAc binding activity is retained. On the other hand, biotinyl PVL binds to sulfatide and the binding is not inhibited by GlcNAc, N-acetylneuraminic acid, or heparin. These results indicate that PVL is a multi-ligand adhesive lectin that can interact with various glycoconjugates. This multispecificity needs to be recognized when using PVL as a sugar-specific probe to avoid misleading information about the nature of glycoforms.

Quantitative Comparison of Human Parainfluenza Virus Hemagglutinin-Neuraminidase Receptor Binding and Receptor Cleavage

PubMed Central

Tappert, Mary M.; Porterfield, J. Zachary; Mehta-D'Souza, Padmaja; Gulati, Shelly

2013-01-01

The human parainfluenza virus (hPIV) hemagglutinin-neuraminidase (HN) protein binds (H) oligosaccharide receptors that contain N-acetylneuraminic acid (Neu5Ac) and cleaves (N) Neu5Ac from these oligosaccharides. In order to determine if one of HN′s two functions is predominant, we measured the affinity of H for its ligands by a solid-phase binding assay with two glycoprotein substrates and by surface plasmon resonance with three monovalent glycans. We compared the dissociation constant (Kd) values from these experiments with previously determined Michaelis-Menten constants (Kms) for the enzyme activity. We found that glycoprotein substrates and monovalent glycans containing Neu5Acα2-3Galβ1-4GlcNAc bind HN with Kd values in the 10 to 100 μM range. Km values for HN were previously determined to be on the order of 1 mM (M. M. Tappert, D. F. Smith, and G. M. Air, J. Virol. 85:12146–12159, 2011). A Km value greater than the Kd value indicates that cleavage occurs faster than the dissociation of binding and will dominate under N-permissive conditions. We propose, therefore, that HN is a neuraminidase that can hold its substrate long enough to act as a binding protein. The N activity can therefore regulate binding by reducing virus-receptor interactions when the concentration of receptor is high. PMID:23740997

Detection of potential (anti)progestagenic endocrine disruptors using a recombinant human progesterone receptor binding and transactivation assay.

PubMed

Viswanath, Gunda; Halder, Sujata; Divya, Gunda; Majumder, Chandrajeet B; Roy, Partha

2008-11-25

The present work describes the identification of (anti)progestin endocrine disrupting chemicals (EDC) using a two step screening system. In the first step a competitive binding assay was developed using recombinant human progesterone receptor (hPR). The tested chemicals were of various classes like insecticides, their metabolites, industrial chemicals and waste water treatment plant (WWTP) effluents. All the tested chemicals demonstrated a high affinity binding for hPR. The average IC50 values of the test chemicals were within the range of 1-25microM. In the second step of screening, a mammalian cell-based hPR transactivation assay was developed where HEK 293 cells were co-transfected with hPR and luciferase reporter gene under the control of progesterone-response element. Stimulation of the cells with progesterone resulted in about 25-fold up regulation of luciferase activity, with EC50 value of 4nM. Potent anti-progesterone, RU486, significantly inhibited progesterone-induced transactivation and non-progestagenic steroids failed to transactivate hPR till 1microM concentrations. The chemicals showing high binding affinities in competitive binding assays were then tested in transactivation assay and all of them were found to be anti-progestative except WWTP effluents. Transactivation assays using extracted water samples from five different WWTP effluents showed that it was rich in progestative compounds. The levels of induction caused by these effluents were in the range of 15-25% of induction by progesterone and they represented about 6ng/l equivalent progesterone activities. In conclusion, we demonstrated that this two step assay provides an efficient screening tool for the detection of (anti)progestative EDC in various samples.

In-Solution SH2 Domain Binding Assay Based on Proximity Ligation.

PubMed

Machida, Kazuya

2017-01-01

Protein-protein interactions mediated by SH2 domains confer specificity in tyrosine kinase pathways. Traditional assays for assessing interactions between an SH2 domain and its interacting protein such as far-Western and pull-down are inherently low throughput. We developed SH2-PLA, an in-solution SH2 domain binding assay, that takes advantage of the speed and sensitivity of proximity ligation and real-time PCR. SH2-PLA allows for rapid assessment of SH2 domain binding to a target protein using only a few microliters of cell lysate, thereby making it an attractive new tool to study tyrosine kinase signaling.

31P and 1H NMR Studies of the Molecular Organization of Lipids in the Parallel Artificial Membrane Permeability Assay.

PubMed

Assmus, Frauke; Ross, Alfred; Fischer, Holger; Seelig, Joachim; Seelig, Anna

2017-01-03

The parallel artificial membrane permeability assay (PAMPA) has emerged as a widely used primary in vitro screen for passive permeability of potential drug candidates. However, the molecular structure of the permeation barrier (consisting of a filter-supported dodecane-egg lecithin mixture) has never been characterized. Here, we investigated the long-range order of phospholipids in the PAMPA barrier by means of 31 P static solid-state NMR. Diffusion constants of PAMPA membrane components were derived from liquid state NMR and, in addition, drug distribution between the PAMPA lipid phase and buffer (log D PAMPA at pH 7.4) was systematically investigated. Increasing concentration of n-dodecane to the system egg lecithin-water (lamellar phase, L α ) induces formation of inverted hexagonal (H ii ) and isotropic phases. At n-dodecane concentrations matching those used in PAMPA (9%, w/v) a purely "isotropic" phase was observed corresponding to lipid aggregates with a diameter in the range 4-7 nm. Drug distribution studies indicate that these reverse micelles facilitate the binding to, and in turn the permeation across, the PAMPA dodecane barrier, in particular for amphiphilic solutes. The proposed model for the molecular architecture and function of the PAMPA barrier provides a fundamental, hitherto missing framework to evaluate the scope but also limitations of PAMPA for the prediction of in vivo membrane permeability.

Novel Photochrome Aptamer Switch Assay (PHASA) for adaptive binding to aptamers.

PubMed

Papper, Vladislav; Pokholenko, Oleksandr; Wu, Yuanyuan; Zhou, Yubin; Jianfeng, Ping; Steele, Terry W J; Marks, Robert S

2014-11-01

A novel Photochrome-Aptamer Switch Assay (PHASA) for the detection and quantification of small environmentally important molecules such as toxins, explosives, drugs and pollutants, which are difficult to detect using antibodies-based assays with high sensitivity and specificity, has been developed. The assay is based on the conjugation of a particular stilbene-analyte derivative to any aptamer of interest. A unique feature of the stilbene molecule is its reporting power via trans-cis photoisomerisation (from fluorescent trans-isomer to non-fluorescent cis-isomer) upon irradiation with the excitation light. The resulting fluorescence decay rate for the trans-isomer of the stilbene-analyte depends on viscosity and spatial freedom to rotate in the surrounding medium and can be used to indicate the presence of the analyte. Quantification of the assay is achieved by calibration of the fluorescence decay rate for the amount of the tested analyte. Two different formats of PHASA have been recently developed: direct conjugation and adaptive binding. New stilbene-maleimide derivatives used in the adaptive binding format have been prepared and characterised. They demonstrate effective binding to the model thiol compound and to the thiolated Malachite Green aptamer.

Characterization of an AGAMOUS-like MADS Box Protein, a Probable Constituent of Flowering and Fruit Ripening Regulatory System in Banana

PubMed Central

Roy Choudhury, Swarup; Roy, Sujit; Nag, Anish; Singh, Sanjay Kumar; Sengupta, Dibyendu N.

2012-01-01

The MADS-box family of genes has been shown to play a significant role in the development of reproductive organs, including dry and fleshy fruits. In this study, the molecular properties of an AGAMOUS like MADS box transcription factor in banana cultivar Giant governor (Musa sp, AAA group, subgroup Cavendish) has been elucidated. We have detected a CArG-box sequence binding AGAMOUS MADS-box protein in banana flower and fruit nuclear extracts in DNA-protein interaction assays. The protein fraction in the DNA-protein complex was analyzed by mass spectrometry and using this information we have obtained the full length cDNA of the corresponding protein. The deduced protein sequence showed ∼95% amino acid sequence homology with MA-MADS5, a MADS-box protein described previously from banana. We have characterized the domains of the identified AGAMOUS MADS-box protein involved in DNA binding and homodimer formation in vitro using full-length and truncated versions of affinity purified recombinant proteins. Furthermore, in order to gain insight about how DNA bending is achieved by this MADS-box factor, we performed circular permutation and phasing analysis using the wild type recombinant protein. The AGAMOUS MADS-box protein identified in this study has been found to predominantly accumulate in the climacteric fruit pulp and also in female flower ovary. In vivo and in vitro assays have revealed specific binding of the identified AGAMOUS MADS-box protein to CArG-box sequence in the promoters of major ripening genes in banana fruit. Overall, the expression patterns of this MADS-box protein in banana female flower ovary and during various phases of fruit ripening along with the interaction of the protein to the CArG-box sequence in the promoters of major ripening genes lead to interesting assumption about the possible involvement of this AGAMOUS MADS-box factor in banana fruit ripening and floral reproductive organ development. PMID:22984496

Characterization of an AGAMOUS-like MADS box protein, a probable constituent of flowering and fruit ripening regulatory system in banana.

PubMed

Roy Choudhury, Swarup; Roy, Sujit; Nag, Anish; Singh, Sanjay Kumar; Sengupta, Dibyendu N

2012-01-01

The MADS-box family of genes has been shown to play a significant role in the development of reproductive organs, including dry and fleshy fruits. In this study, the molecular properties of an AGAMOUS like MADS box transcription factor in banana cultivar Giant governor (Musa sp, AAA group, subgroup Cavendish) has been elucidated. We have detected a CArG-box sequence binding AGAMOUS MADS-box protein in banana flower and fruit nuclear extracts in DNA-protein interaction assays. The protein fraction in the DNA-protein complex was analyzed by mass spectrometry and using this information we have obtained the full length cDNA of the corresponding protein. The deduced protein sequence showed ~95% amino acid sequence homology with MA-MADS5, a MADS-box protein described previously from banana. We have characterized the domains of the identified AGAMOUS MADS-box protein involved in DNA binding and homodimer formation in vitro using full-length and truncated versions of affinity purified recombinant proteins. Furthermore, in order to gain insight about how DNA bending is achieved by this MADS-box factor, we performed circular permutation and phasing analysis using the wild type recombinant protein. The AGAMOUS MADS-box protein identified in this study has been found to predominantly accumulate in the climacteric fruit pulp and also in female flower ovary. In vivo and in vitro assays have revealed specific binding of the identified AGAMOUS MADS-box protein to CArG-box sequence in the promoters of major ripening genes in banana fruit. Overall, the expression patterns of this MADS-box protein in banana female flower ovary and during various phases of fruit ripening along with the interaction of the protein to the CArG-box sequence in the promoters of major ripening genes lead to interesting assumption about the possible involvement of this AGAMOUS MADS-box factor in banana fruit ripening and floral reproductive organ development.

Opc expression, LPS immunotype switch and pilin conversion contribute to serum resistance of unencapsulated meningococci.

PubMed

Hubert, Kerstin; Pawlik, Marie-Christin; Claus, Heike; Jarva, Hanna; Meri, Seppo; Vogel, Ulrich

2012-01-01

Neisseria meningitidis employs polysaccharides and outer membrane proteins to cope with human serum complement attack. To screen for factors influencing serum resistance, an assay was developed based on a colorimetric serum bactericidal assay. The screening used a genetically modified sequence type (ST)-41/44 clonal complex (cc) strain lacking LPS sialylation, polysaccharide capsule, the factor H binding protein (fHbp) and MutS, a protein of the DNA repair mechanism. After killing of >99.9% of the bacterial cells by serum treatment, the colorimetric assay was used to screen 1000 colonies, of which 35 showed enhanced serum resistance. Three mutant classes were identified. In the first class of mutants, enhanced expression of Opc was identified. Opc expression was associated with vitronectin binding and reduced membrane attack complex deposition confirming recent observations. Lipopolysaccharide (LPS) immunotype switch from immunotype L3 to L8/L1 by lgtA and lgtC phase variation represented the second class. Isogenic mutant analysis demonstrated that in ST-41/44 cc strains the L8/L1 immunotype was more serum resistant than the L3 immunotype. Consecutive analysis revealed that the immunotypes L8 and L1 were frequently observed in ST-41/44 cc isolates from both carriage and disease. Immunotype switch to L8/L1 is therefore suggested to contribute to the adaptive capacity of this meningococcal lineage. The third mutant class displayed a pilE allelic exchange associated with enhanced autoaggregation. The mutation of the C terminal hypervariable region D of PilE included a residue previously associated with increased pilus bundle formation. We suggest that autoaggregation reduced the surface area accessible to serum complement and protected from killing. The study highlights the ability of meningococci to adapt to environmental stress by phase variation and intrachromosomal recombination affecting subcapsular antigens.

Opc Expression, LPS Immunotype Switch and Pilin Conversion Contribute to Serum Resistance of Unencapsulated Meningococci

PubMed Central

Hubert, Kerstin; Pawlik, Marie-Christin; Claus, Heike; Jarva, Hanna; Meri, Seppo; Vogel, Ulrich

2012-01-01

Neisseria meningitidis employs polysaccharides and outer membrane proteins to cope with human serum complement attack. To screen for factors influencing serum resistance, an assay was developed based on a colorimetric serum bactericidal assay. The screening used a genetically modified sequence type (ST)-41/44 clonal complex (cc) strain lacking LPS sialylation, polysaccharide capsule, the factor H binding protein (fHbp) and MutS, a protein of the DNA repair mechanism. After killing of >99.9% of the bacterial cells by serum treatment, the colorimetric assay was used to screen 1000 colonies, of which 35 showed enhanced serum resistance. Three mutant classes were identified. In the first class of mutants, enhanced expression of Opc was identified. Opc expression was associated with vitronectin binding and reduced membrane attack complex deposition confirming recent observations. Lipopolysaccharide (LPS) immunotype switch from immunotype L3 to L8/L1 by lgtA and lgtC phase variation represented the second class. Isogenic mutant analysis demonstrated that in ST-41/44 cc strains the L8/L1 immunotype was more serum resistant than the L3 immunotype. Consecutive analysis revealed that the immunotypes L8 and L1 were frequently observed in ST-41/44 cc isolates from both carriage and disease. Immunotype switch to L8/L1 is therefore suggested to contribute to the adaptive capacity of this meningococcal lineage. The third mutant class displayed a pilE allelic exchange associated with enhanced autoaggregation. The mutation of the C terminal hypervariable region D of PilE included a residue previously associated with increased pilus bundle formation. We suggest that autoaggregation reduced the surface area accessible to serum complement and protected from killing. The study highlights the ability of meningococci to adapt to environmental stress by phase variation and intrachromosomal recombination affecting subcapsular antigens. PMID:23028802

Relative Chemical Binding Affinities for Trout and Human Estrogen Receptor Using Different Competitive Binding Assays

EPA Science Inventory

Rainbow trout-based assays for estrogenicity are currently being used for development of predictive models based upon quantitative structure activity relationships. A predictive model based on a single species raises the question of whether this information is valid for other spe...

Integrated Model of Chemical Perturbations of a Biological PathwayUsing 18 In Vitro High Throughput Screening Assays for the Estrogen Receptor

EPA Science Inventory

We demonstrate a computational network model that integrates 18 in vitro, high-throughput screening assays measuring estrogen receptor (ER) binding, dimerization, chromatin binding, transcriptional activation and ER-dependent cell proliferation. The network model uses activity pa...

Rapid solid-phase immunoassay for 6-keto prostaglandin F1 alpha on microplates

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schramm, W.; Smith, R.H.; Jackson, T.M.

1990-03-01

We describe, for the measurement of 6-keto prostaglandin F1 alpha in biological media, a solid-phase immunoassay with immobilized antibodies that requires a total processing time of less than 2 h with hands-on time less than 30 min for 40 samples. The method combines the convenience of the microplate format with the sensitivity of radiolabeled prostaglandin derivatives as tracers in a competitive immunoassay. The intra- and interassay variations at 50% displacement of the radiolabeled prostaglandin derivative as tracer were 9.0% and 11.8%, respectively. At 50% displacement of the radiolabeled tracer, the sensitivity is about 20 pg per well. Optimal incubation timemore » is between 60 and 90 min. Nonspecific binding was less than 1% if about 8 pg of tracer (approximately 25,000 counts/min per well) was used. Inhibition curves of samples in different dilutions were parallel to standard curves. The variation of bound radiolabeled prostaglandin derivative within the wells of one microplate (n = 96) was less than 3%. Human plasma samples and medium from tissue culture assayed for 6-keto prostaglandin F1 alpha correlated well with results obtained with a solid-phase assay based on use of magnetic particles (r = 0.99, n = 24) for culture-medium samples; r = 0.99; n = 26 for plasma samples.« less

Impact of assay design on test performance: lessons learned from 25-hydroxyvitamin D.

PubMed

Farrell, Christopher-John L; Soldo, Joshua; McWhinney, Brett; Bandodkar, Sushil; Herrmann, Markus

2014-11-01

Current automated immunoassays vary significantly in many aspects of their design. This study sought to establish if the theoretical advantages and disadvantages associated with different design formats of automated 25-hydroxyvitamin D (25-OHD) assays are translated into variations in assay performance in practice. 25-OHD was measured in 1236 samples using automated assays from Abbott, DiaSorin, Roche and Siemens. A subset of 362 samples had up to three liquid chromatography-tandem mass spectrometry 25-OHD analyses performed. 25-OHD₂ recovery, dilution recovery, human anti-animal antibody (HAAA) interference, 3-epi-25-OHD₃ cross-reactivity and precision of the automated assays were evaluated. The assay that combined release of 25-OHD with analyte capture in a single step showed the most accurate 25-OHD₂ recovery and the best dilution recovery. The use of vitamin D binding protein (DBP) as the capture moiety was associated with 25-OHD₂ under-recovery, a trend consistent with 3-epi-25-OHD₃ cross-reactivity and immunity to HAAA interference. Assays using animal-derived antibodies did not show 3-epi-25-OHD₃ cross-reactivity but were variably susceptible to HAAA interference. Not combining 25-OHD release and capture in one step and use of biotin-streptavidin interaction for solid phase separation were features of the assays with inferior accuracy for diluted samples. The assays that used a backfill assay format showed the best precision at high concentrations but this design did not guarantee precision at low 25-OHD concentrations. Variations in design among automated 25-OHD assays influence their performance characteristics. Consideration of the details of assay design is therefore important when selecting and validating new assays.

Timothy-specific IgG antibody levels vary with the pollen seasons.

PubMed

Nordvall, S L; Larsson, P H; Johansson, S G

1986-11-01

Serum samples were collected from eight grass pollen hypersensitive children during a 4-year period. The sera were assayed for contents of timothy-specific IgE antibodies by RAST. Timothy-specific IgG and IgA antibodies were quantified by a refined ELISA in which covalent binding of the antigen to the polystyrene solid phase had been performed. IgG antibodies were also assayed by a Sepharose-protein-A technique with radiolabelled timothy allergens as the antigen. It was possible to register clearcut seasonal variations with postseasonally boosted antibody levels not only of timothy-specific IgE but also of IgG antibody. Both IgG1 and IgG4 antibodies specific for timothy showed seasonal variations of a similar degree. It was not possible to register seasonal variations of the same magnitude of timothy-specific IgA antibodies.

A practical approach to automate randomized design of experiments for ligand-binding assays.

PubMed

Tsoi, Jennifer; Patel, Vimal; Shih, Judy

2014-03-01

Design of experiments (DOE) is utilized in optimizing ligand-binding assay by modeling factor effects. To reduce the analyst's workload and error inherent with DOE, we propose the integration of automated liquid handlers to perform the randomized designs. A randomized design created from statistical software was imported into custom macro converting the design into a liquid-handler worklist to automate reagent delivery. An optimized assay was transferred to a contract research organization resulting in a successful validation. We developed a practical solution for assay optimization by integrating DOE and automation to increase assay robustness and enable successful method transfer. The flexibility of this process allows it to be applied to a variety of assay designs.

Improved flow cytometer measurement of binding assays

NASA Astrophysics Data System (ADS)

Saunders, G. C.

1984-05-01

A method of measuring binding assays is carried out with different size particles wherein the binding assay sample is run through a flow cytometer without separating the sample from the marking agent. The amount of a binding reactant present in a sample is determined by providing particles with a coating of binder and also known quantity of smaller particles with a coating of binder reactant. The smaller particles also contain a fluorescent chemical. The particles are combined with the sample and the binding reaction is allowed to occur for a set length of time followed by combining the smaller particles with the mixture of the particles and the sample produced and allowing the binding reactions to proceed to equilibrium. The fluorescence and light scatter of the combined mixture is then measured as the combined mixture passes through a flow cytometer equipped with a laser to bring about fluorescence, and the number of fluorescent events are compared. A similar method is also provided for determining the amount of antigen present in the sample by providing spheres with an antibody coating and some smaller spheres with an antigen coating.

D2 dopaminergic and 5-HT1A serotonergic activity of 2-(1-naphthyl)ethyl- and 2-(2-naphthyl)ethyl amines.

PubMed

Šukalović, V; Roglić, G; Husinec, S; Kostić-Rajaćić, S; Andrić, D; Šoškić, Vukić

2003-11-01

Several tertiary 2-phenylethyl, 2-(1-naphthyl)ethyl and 2-(2-naphthyl)ethyl amines were synthesized and their binding affinities for dopamine D(1), D(2) and serotonin 5-HT(1A) receptors evaluated in radioligand binding assays. All compounds were inactive in D(1) dopamine radioligand binding assay. The 2-(1-naphthyl)ethyl analogues expressed a low but significant binding affinity for the D(2) and moderate one for the 5-HT(1A) receptor subtypes. Most of the remaining compounds expressed binding affinity at the 5-HT(1A) receptor subtype but were inactive in D(2) receptor binding assay. Based on these results and considering the chemical characteristics of the compounds synthesized and evaluated for dopaminergic and serotonergic activity throughout the present study it can be concluded that hydrophobic type of interaction (stacking or edge-to-face) plays a significant role in the formation of receptor-ligand complexes of 2-(1-naphthyl)ethyl amines. This structural motive can be applied to design and synthesize new, more potent dopaminergic/serotonergic ligands by slight chemical modifications.

Detection of Z DNA binding proteins in tissue culture cells.

PubMed Central

Leith, I R; Hay, R T; Russell, W C

1988-01-01

A gel electrophoresis DNA binding assay to detect Z DNA binding proteins has been developed utilising [32P] labelled poly [d(G-C)] which was converted to the Z form by incubation in 100 microM Co(NH3)6Cl3. The parameters of the assay were established using a Z DNA antibody as a model system and then applied to extracts of Hela and BHK21 cells. Using an anti-Z DNA antibody conditions were established which allowed resolution of antibody-DNA complexes and free DNA in the presence of 100 microM Co(NH3)6Cl3. The inclusion of unlabelled complementary homopolymers eliminated non-specific binding to the labelled Z-DNA probe. Competition experiments demonstrated that the assay was highly specific for double stranded non-B DNA. Application of the technique to extracts of mammalian cells demonstrated that human and hamster cells contain Z-DNA binding proteins; further characterisation by a blotting technique indicated that a 56,000 molecular weight cell protein preferentially binds Z-DNA. Images PMID:3419919

Binding of environmental carcinogens to asbestos and mineral fibres.

PubMed Central

Harvey, G; Pagé, M; Dumas, L

1984-01-01

A rapid method has been developed for measuring the binding capacity of asbestos and other mineral fibres for environmental carcinogens. Benzo(alpha)pyrene (B(alpha)P), nitrosonornicotine (NNN), and N-acetyl-2-aminofluorene (NAAF) were assayed in the presence of Canadian grade 4T30 chrysotile, chrysotile A, amosite, crocidolite, glass microfibres, glasswool, attapulgite, and titanium dioxide. Chrysotile binds significantly more carcinogens than the other mineral fibres. This binding assay is reproducible with coefficients of variation of less than 8% and 6% respectively for inter and intra assay. The influence of pH was also studied, and there is good correlation between the carcinogen binding and the charge of the tested mineral fibres. The in vitro cytotoxicity on macrophage like cell line P388D1 and the haemolytic activity of various mineral fibres were also measured; a good correlation was found between the binding capacity and the cytotoxicity of tested mineral fibres on P388D1 cells. These results give some explanations for the reported synergism between exposure to asbestos and the smoking habits of workers. PMID:6331497

Structure of AadA from Salmonella enterica: a monomeric aminoglycoside (3′′)(9) adenyltransferase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Yang; Näsvall, Joakim; Wu, Shiying

The crystal structure of the aminoglycoside-adenylating enzyme AadA is reported together with functional experiments providing insights into its oligomeric state, ligand binding and catalysis. Aminoglycoside resistance is commonly conferred by enzymatic modification of drugs by aminoglycoside-modifying enzymes such as aminoglycoside nucleotidyltransferases (ANTs). Here, the first crystal structure of an ANT(3′′)(9) adenyltransferase, AadA from Salmonella enterica, is presented. AadA catalyses the magnesium-dependent transfer of adenosine monophosphate from ATP to the two chemically dissimilar drugs streptomycin and spectinomycin. The structure was solved using selenium SAD phasing and refined to 2.5 Å resolution. AadA consists of a nucleotidyltransferase domain and an α-helical bundlemore » domain. AadA crystallizes as a monomer and is a monomer in solution as confirmed by small-angle X-ray scattering, in contrast to structurally similar homodimeric adenylating enzymes such as kanamycin nucleotidyltransferase. Isothermal titration calorimetry experiments show that ATP binding has to occur before binding of the aminoglycoside substrate, and structure analysis suggests that ATP binding repositions the two domains for aminoglycoside binding in the interdomain cleft. Candidate residues for ligand binding and catalysis were subjected to site-directed mutagenesis. In vivo resistance and in vitro binding assays support the role of Glu87 as the catalytic base in adenylation, while Arg192 and Lys205 are shown to be critical for ATP binding.« less

DNA-aptamers binding aminoglycoside antibiotics.

PubMed

Nikolaus, Nadia; Strehlitz, Beate

2014-02-21

Aptamers are short, single stranded DNA or RNA oligonucleotides that are able to bind specifically and with high affinity to their non-nucleic acid target molecules. This binding reaction enables their application as biorecognition elements in biosensors and assays. As antibiotic residues pose a problem contributing to the emergence of antibiotic-resistant pathogens and thereby reducing the effectiveness of the drug to fight human infections, we selected aptamers targeted against the aminoglycoside antibiotic kanamycin A with the aim of constructing a robust and functional assay that can be used for water analysis. With this work we show that aptamers that were derived from a Capture-SELEX procedure targeting against kanamycin A also display binding to related aminoglycoside antibiotics. The binding patterns differ among all tested aptamers so that there are highly substance specific aptamers and more group specific aptamers binding to a different variety of aminoglycoside antibiotics. Also the region of the aminoglycoside antibiotics responsible for aptamer binding can be estimated. Affinities of the different aptamers for their target substance, kanamycin A, are measured with different approaches and are in the micromolar range. Finally, the proof of principle of an assay for detection of kanamycin A in a real water sample is given.

Determination of DNA Binding Behavior of FoxA1 Constructs Using a Gold Nanoparticle-Based High Throughput Assay

NASA Astrophysics Data System (ADS)

Aung, Khin Moh Moh; Lim, Michelle Gek Liang; Hong, Shuzhen; Cheung, Edwin; Su, Xiaodi

Forkhead box protein 1 (FoxA1) is a member of the forkhead family of winged-helix transcription factors. It plays crucial roles in the development and differentiation of multiple organs and in the regulation of estrogen-stimulated genes. In this study, in order to determine the regions of FoxA1 necessary for efficient Deoxyribonucleic Acid (DNA) binding, we cloned, expressed and purified a series of FoxA1 constructs that contain either the DNA Binding Domain (DBD), the Transcription Activation Domain (TAD), or both. We determined the DNA binding behavior of these constructs using traditional electrophoretic mobility shift assay (EMSA) and a recently developed gold nanoparticles (AuNPs)-based fast screening method. We conclude that just the DBD region alone is not sufficient for protein-DNA binding activity. Amino acids flanking the upstream of the DBD region are required for maximal DNA binding activity. Through this study, we have also further validated the AuNPs assay for its generality and expanded the existing protocol for comparing the DNA binding behavior of multiple proteins of different charge properties and molecular weights.

SH2-PLA: a sensitive in-solution approach for quantification of modular domain binding by proximity ligation and real-time PCR.

PubMed

Thompson, Christopher M; Bloom, Lee R; Ogiue-Ikeda, Mari; Machida, Kazuya

2015-06-26

There is a great interest in studying phosphotyrosine dependent protein-protein interactions in tyrosine kinase pathways that play a critical role in many aspects of cellular function. We previously established SH2 profiling, a phosphoproteomic approach based on membrane binding assays that utilizes purified Src Homology 2 (SH2) domains as a molecular tool to profile the global tyrosine phosphorylation state of cells. However, in order to use this method to investigate SH2 binding sites on a specific target in cell lysate, additional procedures such as pull-down or immunoprecipitation which consume large amounts of sample are required. We have developed PLA-SH2, an alternative in-solution modular domain binding assay that takes advantage of Proximity Ligation Assay and real-time PCR. The SH2-PLA assay utilizes oligonucleotide-conjugated anti-GST and anti-EGFR antibodies recognizing a GST-SH2 probe and cellular EGFR, respectively. If the GST-SH2 and EGFR are in close proximity as a result of SH2-phosphotyrosine interactions, the two oligonucleotides are brought within a suitable distance for ligation to occur, allowing for efficient complex amplification via real-time PCR. The assay detected signal across at least 3 orders of magnitude of lysate input with a linear range spanning 1-2 orders and a low femtomole limit of detection for EGFR phosphotyrosine. SH2 binding kinetics determined by PLA-SH2 showed good agreement with established far-Western analyses for A431 and Cos1 cells stimulated with EGF at various times and doses. Further, we showed that PLA-SH2 can survey lung cancer tissues using 1 μl lysate without requiring phospho-enrichment. We showed for the first time that interactions between SH2 domain probes and EGFR in cell lysate can be determined in a microliter-scale assay using SH2-PLA. The obvious benefit of this method is that the low sample requirement allows detection of SH2 binding in samples which are difficult to analyze using traditional protein interaction assays. This feature along with short assay runtime makes this method a useful platform for the development of high throughput assays to determine modular domain-ligand interactions which could have wide-ranging applications in both basic and translational cancer research.

High-throughput receptor-based assay for the detection of spirolides by chemiluminescence.

PubMed

Rodríguez, Laura P; Vilariño, Natalia; Molgó, Jordi; Aráoz, Rómulo; Botana, Luis M

2013-12-01

The spirolides are marine toxins that belong to a new class of macrocyclic imines produced by dinoflagellates. In this study a previously described solid-phase receptor-based assay for the detection of spirolides was optimized for high-throughput screening and prevalidated. This method is based on the competition between 13-desmethyl spirolide C and biotin-α-bungarotoxin immobilized on a streptavidin-coated surface, for binding to nicotinic acetylcholine receptors. In this inhibition assay the amount of nAChR bound to the well surface is quantified using a specific antibody, followed by a second anti-mouse IgG antibody labeled with horseradish peroxidase (HRP). The assay protocol was optimized for 384-well microplates, which allowed a reduction of the amount of reagents per sample and an increase of the number of samples per plate versus previously published receptor-based assays. The sensitivity of the assay for 13-desmethyl spirolide C ranged from 5 to 150 ng mL(-1). The performance of the assay in scallop extracts was adequate, with an estimated detection limit for 13-desmethyl spirolide C of 50 μg kg(-1) of shellfish meat. The recovery rate of 13-desmethyl spirolide C for spiked samples with this assay was 80% and the inter-assay coefficient of variation was 8%. This 384-well microplate, chemiluminescence method can be used as a high-throughput screening assay to detect 13-desmethyl spirolide C in shellfish meat in order to reduce the number of samples to be processed through bioassays or analytical methods. Copyright © 2013 Elsevier Ltd. All rights reserved.

Difference in Ulex europaeus agglutinin I-binding activity of decay-accelerating factor detected in the stools of patients with colorectal cancer and ulcerative colitis.

PubMed

Okazaki, Hiroaki; Mizuno, Motowo; Nasu, Junichirou; Makidono, Chiho; Hiraoka, Sakiko; Yamamoto, Kazuhide; Okada, Hiroyuki; Fujita, Teizo; Tsuji, Takao; Shiratori, Yasushi

2004-03-01

Expression of decay-accelerating factor (DAF, CD55), a complement-regulatory glycoprotein, is enhanced in colorectal-cancer (CC) cells and colonic epithelium in ulcerative colitis (UC), and stools from these patients contain increased amounts of DAF. Carbohydrate chains of glycoproteins are often altered during malignant transformation or inflammation. In this study, we investigated whether DAF molecules in patients with CC and those with UC differ with respect to oligosaccharide side chains. We analyzed DAF in stools and homogenates of colonic-tissue specimens obtained from patients with CC or UC using solid-phase enzyme-linked assay and Western blotting for reactivity with the lectins Ulex europaeus agglutinin I (UEA-I), wheat-germ agglutinin, peanut agglutinin, and concanavalin A. UEA-I bound to DAF in stools from patients with UC but not in that from the stools of CC patients, as demonstrated on the solid-phase enzyme-linked assay (P <.05, Mann-Whitney U test) and Western blotting. Binding of UEA-I was specifically inhibited by the addition of fucose. The difference in UEA-I reactivity with DAF was observed also in colonic-tissue homogenates from patients with UC and those with CC. DAF expressed in the mucosa and excreted into the stools of UC patients is different from that expressed in CC with regard to UEA-I reactivity. Future studies should be directed toward determining whether a qualitatively unique isoform of DAF is present, of which sugar chains are specific to CC in UC patients.

Novel single-stranded DNA binding protein-assisted fluorescence aptamer switch based on FRET for homogeneous detection of antibiotics.

PubMed

Wang, Ye; Gan, Ning; Zhou, You; Li, Tianhua; Cao, Yuting; Chen, Yinji

2017-01-15

Herein, a smart single-stranded DNA binding protein (SSB)-assisted fluorescence aptamer switch based on fluorescence resonance energy transfer (FRET) was designed. The FRET switch was synthesized by connecting SSB labeled quantum dots (QDs@SSB) as donor with aptamer (apt) labeled gold nanoparticles (AuNPs@apt) as acceptor, and it was employed for detecting chloramphenicol (CAP) in a homogenous solution. In the assay, the interaction between core-shell QDs@SSB and AuNPs@apt leads to a dramatic quenching (turning off). After adding CAP in the detection system, AuNPs@apt can bind the target specifically then separate QDs@SSB with AuNPs@apt-target, resulting in restoring the fluorescence intensity of QDs (turning on). Consequently, the fluorescence intensity recovers and the recovery extent can be used for detection of CAP in homogenous phase via optical responses. Under optimal conditions, the fluorescence intensity increased linearly with increasing concentrations of CAP from 0.005 to 100ngmL -1 . The limit of this fluorescence aptamer switch was around 3pgmL -1 for CAP detection. When the analyte is changed, the assay can be applied to detect other targets only by changing relative aptamer in AuNPs@apt probe. Furthermore, it has potential to be served as a simple, sensitive and portable platform for antibiotic contaminants detection in biological and environmental samples. Copyright © 2016 Elsevier B.V. All rights reserved.

Coupling Molecular Beacons to Barcoded Metal Nanowires for Multiplexed, Sealed Chamber DNA Bioassays

PubMed Central

Stoermer, Rebecca L.; Cederquist, Kristin B.; McFarland, Sean K.; Sha, Michael Y.; Penn, Sharron G.

2010-01-01

We have combined molecular beacon (MB) probes with barcoded metal nanowires to enable no-wash, sealed chamber, multiplexed detection of nucleic acids. Probe design and experimental parameters important in nanowire-based MB assays are discussed. Loop regions of 24 bases and 5 base pair stem regions in the beacon probes gave optimal performance. Our results suggest that thermodynamic predictions for secondary structure stability of solution-phase MB can guide probe design for nanowire-based assays. Dengue virus-specific probes with predicted solution-phase ΔG of folding in 500 mM buffered NaCl of approximately −4 kcal/mol performed better than those with ΔG > −2 or < −6 kcal/mol. Buffered 300–500 mM NaCl was selected after comparison of several buffers previously reported for similar types of assays, and 200–500 mM NaCl was found to be the optimal ionic strength for the hybridization temperatures (25 and 50 °C) and probe designs used here. Target binding to the surface as a function of solution concentration fit a Sips isotherm with Kd = 1.7 ± 0.3 nM. The detection limit was ∼100 pM, limited by incomplete quenching. Single base mismatches could be discriminated from fully complementary targets. Oligonucleotide target sequences specific for human immunodeficiency, hepatitis C, and severe acute respiratory viruses were assayed simultaneously in a no-wash, sealed chamber, multiplexed experiment in which each of three probe sequences was attached to a different pattern of encoded nanowires. Finally, we demonstrated that probe-coated nanowires retain their selectivity and sensitivity in a triplexed assay after storage for over 3 months. PMID:17177440

Comprehensive analysis of T cell epitope discovery strategies using 17DD yellow fever virus structural proteins and BALB/c (H2d) mice model.

PubMed

Maciel, Milton; Kellathur, Srinivasan N; Chikhlikar, Pryia; Dhalia, Rafael; Sidney, John; Sette, Alessandro; August, Thomas J; Marques, Ernesto T A

2008-08-15

Immunomics research uses in silico epitope prediction, as well as in vivo and in vitro approaches. We inoculated BALB/c (H2d) mice with 17DD yellow fever vaccine to investigate the correlations between approaches used for epitope discovery: ELISPOT assays, binding assays, and prediction software. Our results showed a good agreement between ELISPOT and binding assays, which seemed to correlate with the protein immunogenicity. PREDBALB/c prediction software partially agreed with the ELISPOT and binding assay results, but presented low specificity. The use of prediction software to exclude peptides containing no epitopes, followed by high throughput screening of the remaining peptides by ELISPOT, and the use of MHC-biding assays to characterize the MHC restrictions demonstrated to be an efficient strategy. The results allowed the characterization of 2 MHC class I and 17 class II epitopes in the envelope protein of the YF virus in BALB/c (H2d) mice.

Development of binding assays for the SH2 domain of Grb7 and Grb2 using fluorescence polarization.

PubMed

Luzy, Jean-Philippe; Chen, Huixiong; Gril, Brunilde; Liu, Wang-Qing; Vidal, Michel; Perdereau, Dominique; Burnol, Anne-Françoise; Garbay, Christiane

2008-02-01

Adaptor proteins Grb7 and Grb2 have been implicated as being 2 potential therapeutic targets in several human cancers, especially those that overexpress ErbB2. These 2 proteins contain both a SH2 domain (Src homology 2) that binds to phosphorylated tyrosine residues contained within ErbB2 and other specific protein targets. Two assays based on enzyme-linked immunosorbent assay and fluorescence polarization methods have been developed and validated to find and rank inhibitors for both proteins binding to the pY(1139). Fluorescence polarization assays allowed the authors to determine quickly and reproducibly affinities of peptides from low nanomolar to high micromolar range and to compare them directly for Grb7 and Grb2. As a result, the assays have identified a known peptidomimetic Grb2 SH2 inhibitor (mAZ-pTyr-(alphaMe)pTyr-Asn-NH(2)) that exhibits the most potent affinity for the Grb7 SH2 domain described to date.

Screening the sequence selectivity of DNA-binding molecules using a gold nanoparticle-based colorimetric approach.

PubMed

Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A

2007-09-15

We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.

Coagulation factor VII variants resistant to inhibitory antibodies.

PubMed

Branchini, Alessio; Baroni, Marcello; Pfeiffer, Caroline; Batorova, Angelika; Giansily-Blaizot, Muriel; Schved, Jean F; Mariani, Guglielmo; Bernardi, Francesco; Pinotti, Mirko

2014-11-01

Replacement therapy is currently used to prevent and treat bleeding episodes in coagulation factor deficiencies. However, structural differences between the endogenous and therapeutic proteins might increase the risk for immune complications. This study was aimed at identifying factor (F)VII variants resistant to inhibitory antibodies developed after treatment with recombinant activated factor VII (rFVIIa) in a FVII-deficient patient homozygous for the p.A354V-p.P464Hfs mutation, which predicts trace levels of an elongated FVII variant in plasma. We performed fluorescent bead-based binding, ELISA-based competition as well as fluorogenic functional (activated FX and thrombin generation) assays in plasma and with recombinant proteins. We found that antibodies displayed higher affinity for the active than for the zymogen FVII (half-maximal binding at 0.54 ± 0.04 and 0.78 ± 0.07 BU/ml, respectively), and inhibited the coagulation initiation phase with a second-order kinetics. Isotypic analysis showed a polyclonal response with a large predominance of IgG1. We hypothesised that structural differences in the carboxyl-terminus between the inherited FVII and the therapeutic molecules contributed to the immune response. Intriguingly, a naturally-occurring, poorly secreted and 5-residue truncated FVII (FVII-462X) escaped inhibition. Among a series of truncated rFVII molecules, we identified a well-secreted and catalytically competent variant (rFVII-464X) with reduced binding to antibodies (half-maximal binding at 0.198 ± 0.003 BU/ml) as compared to the rFVII-wt (0.032 ± 0.002 BU/ml), which led to a 40-time reduced inhibition in activated FX generation assays. Taken together our results provide a paradigmatic example of mutation-related inhibitory antibodies, strongly support the FVII carboxyl-terminus as their main target and identify inhibitor-resistant FVII variants.

Preclinical characterization of anticancer gallium(III) complexes: solubility, stability, lipophilicity and binding to serum proteins.

PubMed

Rudnev, Alexander V; Foteeva, Lidia S; Kowol, Christian; Berger, Roland; Jakupec, Michael A; Arion, Vladimir B; Timerbaev, Andrei R; Keppler, Bernhard K

2006-11-01

The discovery and development of gallium(III) complexes capable of inhibiting tumor growth is an emerging area of anticancer drug research. A range of novel gallium coordination compounds with established cytotoxic efficacy have been characterized in terms of desirable chemical and biochemical properties and compared with tris(8-quinolinolato)gallium(III) (KP46), a lead anticancer gallium-based candidate that successfully finished phase I clinical trials (under the name FFC11), showing activity against renal cell cancer. In view of probable oral administration, drug-like parameters, such as solubility in water, saline and 0.5% dimethyl sulfoxide, stability against hydrolysis, measured as the rate constant of hydrolytic degradation in water or physiological buffer using a capillary zone electrophoresis (CZE) assay, and the octanol-water partition coefficient (logP) providing a rational estimate of a drug's lipophilicity, have been evaluated and compared. The differences in bioavailability characteristics between different complexes were discussed within the formalism of structure-activity relationships. The reactivity toward major serum transport proteins, albumin and transferrin, was also assayed in order to elucidate the drug's distribution pathway after intestinal absorption. According to the values of apparent binding rate constants determined by CZE, both KP46 and bis(2-acetylpyridine-4,4-dimethyl-3-thiosemicarbazonato-N,N,S)gallium(III) tetrachlorogallate(III) (KP1089) bind to transferrin faster than to albumin. This implies that transferrin would rather mediate the accumulation of gallium antineoplastic agents in solid tumors. A tendency of being faster converted into the protein-bound form found for KP1089 (due possibly to non-covalent binding) seems complementary to its greater in vitro antiproliferative activity.

Characterization of Am IT, an anti-insect β-toxin isolated from the venom of scorpion Androctonus mauretanicus.

PubMed

Oukkache, Naoual; ElJaoudi, Rachid; Chgoury, Fatima; Rocha, Marisa Teixeira; Sabatier, Jean-Marc

2015-06-25

In the present study, a 'novel' toxin, called Am IT from the venom of scorpion Androctonus mauretanicus is isolated and characterized. A detailed analysis of the action of Am IT on insect axonal sodium currents is reported. Am IT was purified through gel filtration followed by C18 reversed-phase HPLC. Toxicity of Am IT in vivo was assessed on male German cockroach (Blattella germanica) larvae and C57/BL6 mice. Cross-reactivity of Am IT with two β-toxins was evidenced using (125)I-iodinated toxin-based radioimmunoassays with synaptosomal preparations from rat brain. The complete amino acid sequence of Am IT was finally determined by Edman sequencing. Am IT was observed to compete with AaH IT4 purified from the venom of scorpion Androctonus australis in binding assays. It was recognized by an antibody raised against a β-type toxin, which indicated some structural similarity with β-toxins (or related toxin family). The 'novel' toxin exhibited dual activity since it competed with anti-mammal toxins in binding assays as well as showed contracting activity to insect. The toxin competed with radio-labeled β-toxin Css IV by binding to Na(+) channels of rat brain synaptosomes. Analysis of toxin amino acid sequences showed that Am IT shares high structural identity (92%) with AaH IT4. In conclusion, Am IT not only reveals an anti-insect compound properties secreted by 'Old World' scorpions, paralyzing insect larvae by binding to Na(+) channels on larvae's nerve-cell membranes, but also exerts toxic activity in mice, which is similar to anti-mammal toxins from 'New World' scorpions (North and South Americas). Therefore, Am IT appears to be structurally and functionally similar to AaH IT4.

Amelotin gene expression is temporarily being upregulated at the initiation of apoptosis induced by TGFβ1 in mouse gingival epithelial cells.

PubMed

Nakayama, Yohei; Matsui, Sari; Noda, Keisuke; Yamazaki, Mizuho; Iwai, Yasunobu; Matsumura, Hiroyoshi; Izawa, Takashi; Tanaka, Eiji; Ganss, Bernhard; Ogata, Yorimasa

2016-10-01

Amelotin (AMTN) is expressed and secreted by ameloblasts in the maturation stage of amelogenesis and persist with low levels in the junctional epithelium (JE) of erupted teeth. The purpose of this study is to investigate the transcriptional regulation of the AMTN gene by transforming growth factor beta1 (TGFβ1) in gingival epithelial (GE1) cells in the apoptosis phase. Apoptosis was evaluated by the fragmentation of chromosomal DNA and TUNEL staining. A real-time PCR was carried out to examine the AMTN mRNA levels induced by TGFβ1 and Smad3 overexpression. Transient transfection analyses were completed using the various lengths of mouse AMTN gene promoter constructs with or without TGFβ1. Chromatin immunoprecipitation (ChIP) assays were performed to investigate the Smad3 bindings to the AMTN gene promoter by TGFβ1. TGFβ1-induced apoptosis in GE1 cells were detected at 24 and 48 h by DNA fragmentation and TUNEL staining. AMTN mRNA levels increased at 6 h and reached maximum at 24 h in GE1 cells. Luciferase activities of the mouse AMTN gene promoter constructs were induced by TGFβ1. The results of the ChIP assays showed that there was an increase in Smad3 binding to Smad-binding element (SBE)#1 and SBE#2 after stimulation by TGFβ1. Immunohistochemical localization of AMTN was detected in the JE, and the AMTN protein levels in Smad3-deficient mice were decreased compared with wild-type mice. AMTN mRNA levels were induced at the initiation of apoptosis by TGFβ1, which mediated through the Smad3 bindings to SBEs in the mouse AMTN gene promoter.

Laboratory Testing for von Willebrand Disease: The Past, Present, and Future State of Play for von Willebrand Factor Assays that Measure Platelet Binding Activity, with or without Ristocetin.

PubMed

Just, Sarah

2017-02-01

von Willebrand disease (VWD) was first described nearly a century ago in 1924 by Erik Adolf von Willebrand. Diagnostic testing at the time was very limited and it was not until the mid to late 1900s that more tests became available to assist with the diagnosis and classification of VWD. Two of these tests are based on ristocetin, one being ristocetin-induced platelet aggregation (RIPA) and the other the von Willebrand factor (VWF) ristocetin cofactor assay (VWF:RCo). The VWF:RCo assay provides functional assessment of in vitro VWF binding to the platelet glycoprotein (Gp) complex, GPIb-IX-V. Despite some advancements and newer technologies utilizing the principles of the original VWF:RCo assay, the original assay is still referred to as the gold standard for measurement of VWF activity. This article will review the history of VWD diagnostic assays, including RIPA and VWF:RCo over the past 40 years, as well as the newer assays that measure platelet binding with or without ristocetin, and which have been developed with the aim to potentially replace platelet-based ristocetin-dependent assays. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.

Structural Transformation Detection Contributes to Screening of Behaviorally Active Compounds: Dynamic Binding Process Analysis of DhelOBP21 from Dastarcus helophoroides.

PubMed

Yang, Rui-Nan; Li, Dong-Zhen; Yu, Guangqiang; Yi, Shan-Cheng; Zhang, Yinan; Kong, De-Xin; Wang, Man-Qun

2017-12-01

In light of reverse chemical ecology, the fluorescence competitive binding assays of functional odorant binding proteins (OBPs) is a recent advanced approach for screening behaviorally active compounds of insects. Previous research on Dastareus helophoroides identified a minus-C OBP, DhelOBP21, which preferably binds to several ligands. In this study, only (+)-β-pinene proved attractive to unmated adult beetles. To obtain a more in-depth explanation of the lack of behavioral activity of other ligands we selected compounds with high (camphor) and low (β-caryophyllene) binding affinities. The structural transformation of OBPs was investigated using well-established approaches for studying binding processes, such as fluorescent quenching assays, circular dichroism, and molecular dynamics. The dynamic binding process revealed that the flexibility of DhelOBP21 seems conducive to binding specific ligands, as opposed to broad substrate binding. The compound (+)-β-pinene and DhelOBP21 formed a stable complex through a secondary structural transformation of DhelOBP21, in which its amino-terminus transformed from random coil to an α-helix to cover the binding pocket. On the other hand, camphor could not efficiently induce a stable structural transformation, and its high binding affinities were due to strong hydrogen-bonding, compromising the structure of the protein. The other compound, β-caryophyllene, only collided with DhelOBP21 and could not be positioned in the binding pocket. Studying structural transformation of these proteins through examining the dynamic binding process rather than using approaches that just measure binding affinities such as fluorescence competitive binding assays can provide a more efficient and reliable approach for screening behaviorally active compounds.

Binding determinants in the interplay between porcine aminopeptidase N and enterotoxigenic Escherichia coli F4 fimbriae.

PubMed

Xia, Pengpeng; Quan, Guomei; Yang, Yi; Zhao, Jing; Wang, Yiting; Zhou, Mingxu; Hardwidge, Philip R; Zhu, Jianzhong; Liu, Siguo; Zhu, Guoqiang

2018-02-26

The binding of F4 + enterotoxigenic Escherichia coli (ETEC) and the specific receptor on porcine intestinal epithelial cells is the initial step in F4 + ETEC infection. Porcine aminopeptidase N (APN) is a newly discovered receptor for F4 fimbriae that binds directly to FaeG adhesin, which is the major subunit of the F4 fimbriae variants F4ab, F4ac, and F4ad. We used overlapping peptide assays to map the APN-FaeG binding sites, which has facilitated in the identifying the APN-binding amino acids that are located in the same region of FaeG variants, thereby limiting the major binding regions of APN to 13 peptides. To determine the core sequence motif, a panel of FaeG peptides with point mutations and FaeG mutants were constructed. Pull-down and binding reactivity assays using piglet intestines determined that the amino acids G159 of F4ab, N209 and L212 of F4ac, and A200 of F4ad were the critical residues for APN binding of FaeG. We further show using ELISA and confocal microscopy assay that amino acids 553-568, and 652-670 of the APN comprise the linear epitope for FaeG binding in all three F4 fimbriae variants.

Substitution of synthetic chimpanzee androgen receptor for human androgen receptor in competitive binding and transcriptional activation assays for EDC screening

EPA Science Inventory

The potential effect of receptor-mediated endocrine modulators across species is of increasing concern. In attempts to address these concerns we are developing androgen and estrogen receptor binding assays using recombinant hormone receptors from a number of species across differ...

RAINBOW TROUT ANDROGEN RECEPTOR ALPHA AND THE HUMAN ANDROGEN RECEPTOR: COMPARISONS IN THE COS WHOLE CELL BINDING ASSAY

EPA Science Inventory

Rainbow Trout Androgen Receptor Alpha And Human Androgen Receptor: Comparisons in the COS Whole Cell Binding Assay
Mary C. Cardon, L. Earl Gray, Jr. and Vickie S. Wilson
U.S. Environmental Protection Agency, ORD, NHEERL, Reproductive Toxicology Division, Research Triangle...

Preclinical Evaluation of [(18)F]THK-5105 Enantiomers: Effects of Chirality on Its Effectiveness as a Tau Imaging Radiotracer.

PubMed

Tago, Tetsuro; Furumoto, Shozo; Okamura, Nobuyuki; Harada, Ryuichi; Adachi, Hajime; Ishikawa, Yoichi; Yanai, Kazuhiko; Iwata, Ren; Kudo, Yukitsuka

2016-04-01

Noninvasive imaging of tau and amyloid-β pathologies would facilitate diagnosis of Alzheimer's disease (AD). Recently, we have developed [(18)F]THK-5105 for selective detection of tau pathology by positron emission tomography (PET). The purpose of this study was to clarify biological properties of optically pure [(18)F]THK-5105 enantiomers. Binding for tau aggregates in AD brain section was evaluated by autoradiography (ARG). In vitro binding assays were performed to evaluate the binding properties of enantiomers for AD brain homogenates. The pharmacokinetics in the normal mouse brains was assessed by ex vivo biodistribution assay The ARG of enantiomers showed the high accumulation of radioactivity corresponding to the distribution of tau deposits. In vitro binding assays revealed that (S)-[(18)F]THK-5105 has slower dissociation from tau than (R)-[(18)F]THK-5105. Biodistribution assays indicated that (S)-[(18)F]THK-5105 eliminated faster from the mouse brains and blood compared with (R)-[(18)F]THK-5105. (S)-[(18)F]THK-5105 could be more suitable than (R)-enantiomer for a tau imaging agent.

Identification of the domains in cyclin A required for binding to, and activation of, p34cdc2 and p32cdk2 protein kinase subunits.

PubMed Central

Kobayashi, H; Stewart, E; Poon, R; Adamczewski, J P; Gannon, J; Hunt, T

1992-01-01

The binding of cyclin A to p34cdc2 and p32cdk2 and the protein kinase activity of the complexes has been measured by cell-free translation of the corresponding mRNA in extracts of frog eggs, followed by immunoprecipitation. A variety of mutant cyclin A molecules have been constructed and tested in this assay. Small deletions and point mutations of highly conserved residues in the 100-residue "cyclin box" abolish binding and activation of both p34cdc2 and p32cdk2. By contrast, large deletions at the N-terminus have no effect on kinase binding and activation, until they remove residues beyond 161, where the first conserved amino acids are found in all known examples of cyclin A. At the C-terminus, removal of 14 or more amino acids abolishes activity. We also demonstrate that deletion of, or point mutations, in the cyclin A homologue of the 10-residue "destruction box," previously described in cyclin B (Glotzer et al., 1991) abolish cyclin proteolysis at the transition from M-phase to interphase. Images PMID:1333843

Identification of the domains in cyclin A required for binding to, and activation of, p34cdc2 and p32cdk2 protein kinase subunits.

PubMed

Kobayashi, H; Stewart, E; Poon, R; Adamczewski, J P; Gannon, J; Hunt, T

1992-11-01

The binding of cyclin A to p34cdc2 and p32cdk2 and the protein kinase activity of the complexes has been measured by cell-free translation of the corresponding mRNA in extracts of frog eggs, followed by immunoprecipitation. A variety of mutant cyclin A molecules have been constructed and tested in this assay. Small deletions and point mutations of highly conserved residues in the 100-residue "cyclin box" abolish binding and activation of both p34cdc2 and p32cdk2. By contrast, large deletions at the N-terminus have no effect on kinase binding and activation, until they remove residues beyond 161, where the first conserved amino acids are found in all known examples of cyclin A. At the C-terminus, removal of 14 or more amino acids abolishes activity. We also demonstrate that deletion of, or point mutations, in the cyclin A homologue of the 10-residue "destruction box," previously described in cyclin B (Glotzer et al., 1991) abolish cyclin proteolysis at the transition from M-phase to interphase.

Cloning, expression and purification of a glycosylated form of the DNA-binding protein Dps from Salmonella enterica Typhimurium.

PubMed

Hanna, Ebert Seixas; Roque-Barreira, Maria-Cristina; Mendes, Guilherme Martines Teixeira; Soares, Sandro Gomes; Brocchi, Marcelo

2008-06-01

Dps, found in many eubacterial and archaebacterial species, appears to protect cells from oxidative stress and/or nutrient-limited environment. Dps has been shown to accumulate during the stationary phase, to bind to DNA non-specifically, and to form a crystalline structure that compacts and protects the chromosome. Our previous results have indicated that Dps is glycosylated at least for a certain period of the bacterial cell physiology and this glycosylation is thought to be orchestrated by some factors not yet understood, explaining our difficulties in standardizing the Dps purification process. In the present work, the open reading frame of the dps gene, together with all the upstream regulatory elements, were cloned into a PCR cloning vector. As a result, the expression of dps was also controlled by the plasmid system introduced in the bacterial cell. The gene was then over-expressed regardless of the growth phase of the culture and a glycosylated fraction was purified to homogeneity by lectin-immobilized chromatography assay. Unlike the high level expression of Dps in Salmonella cells, less than 1% of the recombinant protein was purified by affinity chromatography using jacalin column. Sequencing and mass spectrometry data confirmed the identity of the dps gene and the protein, respectively. In spite of the low level of purification of the jacalin-binding Dps, this work shall aid further investigations into the mechanism of Dps glycosylation.

Domain-specific interactions between MLN8237 and human serum albumin estimated by STD and WaterLOGSY NMR, ITC, spectroscopic, and docking techniques.

PubMed

Yang, Hongqin; Liu, Jiuyang; Huang, Yanmei; Gao, Rui; Tang, Bin; Li, Shanshan; He, Jiawei; Li, Hui

2017-03-30

Alisertib (MLN8237) is an orally administered inhibitor of Aurora A kinase. This small-molecule inhibitor is under clinical or pre-clinical phase for the treatment of advanced malignancies. The present study provides a detailed characterization of the interaction of MLN8237 with a drug transport protein called human serum albumin (HSA). STD and WaterLOGSY nuclear magnetic resonance (NMR)-binding studies were conducted first to confirm the binding of MLN8237 to HSA. In the ligand orientation assay, the binding sites of MLN8237 were validated through two site-specific spy molecules (warfarin sodium and ibuprofen, which are two known site-selective probes) by using STD and WaterLOGSY NMR competition techniques. These competition experiments demonstrate that both spy molecules do not compete with MLN8237 for the specific binding site. The AutoDock-based blind docking study recognizes the hydrophobic subdomain IB of the protein as the probable binding site for MLN8237. Thermodynamic investigations by isothermal titration calorimetry (ITC) reveal that the non-covalent interaction between MLN8237 and HSA (binding constant was approximately 10 5  M -1 ) is driven mainly by favorable entropy and unfavorable enthalpy. In addition, synchronous fluorescence, circular dichroism (CD), and 3D fluorescence spectroscopy suggest that MLN8237 may induce conformational changes in HSA.

Salmonella enterica serotype Typhimurium Std fimbriae bind terminal alpha(1,2)fucose residues in the cecal mucosa.

PubMed

Chessa, Daniela; Winter, Maria G; Jakomin, Marcello; Bäumler, Andreas J

2009-02-01

The std operon encodes a fimbrial adhesin of Salmonella enterica serotype Typhimurium that is required for attachment to intestinal epithelial cells and for cecal colonization in the mouse. To study the mechanism by which this virulence factor contributes to colonization we characterized its binding specificity. Std-mediated binding to human colonic epithelial (Caco-2) cells could be abrogated by removing N-linked glycans. Adherence of Std fimbriated S. Typhimurium to Caco-2 cells could be blocked by co-incubation with H type 2 oligosaccharide (Fucalpha1-2Galbeta1-4GlcNAc) or by pretreatment of cells with alpha1-2 fucosidase. In contrast, pretreatment of Caco-2 cells with neuraminidase or co-incubation with the type 2 disaccharide precursor (Galbeta1-4GlcNAc) did not reduce adherence of Std fimbriated S. Typhimurium. Binding of purified Std fimbriae to Fucalpha1-2Galbeta1-4GlcNAc in a solid phase binding assay was competitively inhibited by Ulex europaeus agglutinin-I (UEA-I), a lectin specific for Fucalpha1-2 moieties. Purified Std fimbriae and UEA both bound to a receptor localized in the mucus layer of the murine cecum. These data suggest that the std operon encodes an adhesin that binds an alpha1-2 fucosylated receptor(s) present in the cecal mucosa.

Domain-specific interactions between MLN8237 and human serum albumin estimated by STD and WaterLOGSY NMR, ITC, spectroscopic, and docking techniques

PubMed Central

Yang, Hongqin; Liu, Jiuyang; Huang, Yanmei; Gao, Rui; Tang, Bin; Li, Shanshan; He, Jiawei; Li, Hui

2017-01-01

Alisertib (MLN8237) is an orally administered inhibitor of Aurora A kinase. This small-molecule inhibitor is under clinical or pre-clinical phase for the treatment of advanced malignancies. The present study provides a detailed characterization of the interaction of MLN8237 with a drug transport protein called human serum albumin (HSA). STD and WaterLOGSY nuclear magnetic resonance (NMR)-binding studies were conducted first to confirm the binding of MLN8237 to HSA. In the ligand orientation assay, the binding sites of MLN8237 were validated through two site-specific spy molecules (warfarin sodium and ibuprofen, which are two known site-selective probes) by using STD and WaterLOGSY NMR competition techniques. These competition experiments demonstrate that both spy molecules do not compete with MLN8237 for the specific binding site. The AutoDock-based blind docking study recognizes the hydrophobic subdomain IB of the protein as the probable binding site for MLN8237. Thermodynamic investigations by isothermal titration calorimetry (ITC) reveal that the non-covalent interaction between MLN8237 and HSA (binding constant was approximately 105 M−1) is driven mainly by favorable entropy and unfavorable enthalpy. In addition, synchronous fluorescence, circular dichroism (CD), and 3D fluorescence spectroscopy suggest that MLN8237 may induce conformational changes in HSA. PMID:28358124

Supramolecular approach to enantioselective DNA recognition using enantiomerically resolved cationic 4-amino-1,8-naphthalimide-based Tröger's bases.

PubMed

Banerjee, Swagata; Bright, Sandra A; Smith, Jayden A; Burgeat, Jeremy; Martinez-Calvo, Miguel; Williams, D Clive; Kelly, John M; Gunnlaugsson, Thorfinnur

2014-10-03

The synthesis and photophysical studies of two cationic Tröger's base (TB)-derived bis-naphthalimides 1 and 2 and the TB derivative 6, characterized by X-ray crystallography, are presented. The enantiomers of 1 and 2 are separated by cation-exchange chromatography on Sephadex C25 using sodium (-)-dibenzoyl-l-tartarate as the chiral mobile phase. The binding of enantiomers with salmon testes (st)-DNA and synthetic polynucleotides are studied by a variety of spectroscopic methods including UV/vis absorbance, circular dichroism, linear dichroism, and ethidium bromide displacement assays, which demonstrated binding of these compounds to the DNA grooves with very high affinity (K ∼ 10(6) M(-1)) and preferential binding of (-)-enantiomer. In all cases, binding to DNA resulted in a significant stabilization of the double-helical structure of DNA against thermal denaturation. Compound (±)-2 and its enantiomers possessed significantly higher binding affinity for double-stranded DNA compared to 1, possibly due to the presence of the methyl group, which allows favorable hydrophobic and van der Waals interactions with DNA. The TB derivatives exhibited marked preference for AT rich sequences, where the binding affinities follow the order (-)-enantiomer > (±) > (+)-enantiomer. The compounds exhibited significant photocleavage of plasmid DNA upon visible light irradiation and are rapidly internalized into malignant cell lines.

Salmonella enterica serotype Typhimurium Std fimbriae bind terminal α (1,2)fucose residues in the cecal mucosa

PubMed Central

Chessa, Daniela; Winter, Maria G.; Jakomin, Marcello; Bäumler, Andreas J.

2013-01-01

SUMMARY The std operon encodes a fimbrial adhesin of Salmonella enterica serotype Typhimurium that is required for attachment to intestinal epithelial cells and for cecal colonization in the mouse. To study the mechanism by which this virulence factor contributes to colonization we characterized its binding specificity. Std-mediated binding to human colonic epithelial (Caco-2) cells could be abrogated by removing N-linked glycans. Adherence of Std fimbriated S. Typhimurium to Caco-2 cells could be blocked by co-incubation with H type 2 oligosaccharide (Fucα1-2Galβ1-4GlcNAc) or by pretreatment of cells with α1-2 fucosidase. In contrast, pretreatment of Caco-2 cells with neuraminidase or co-incubation with the type 2 disaccharide precursor (Galβ1-4GlcNAc) did not reduce adherence of Std fimbriated S. Typhimurium. Binding of purified Std fimbriae to Fucα1-2Galβ1-4GlcNAc in a solid phase binding assay was competitively inhibited by Ulex europaeus agglutinin-I (UEA-I), a lectin specific for Fucα1-2 moieties. Purified Std fimbriae and UEA both bound to a receptor localized in the mucus layer of the murine cecum. These data suggest that the std operon encodes an adhesin that binds an α1-2 fucosylated receptor(s) present in the cecal mucosa. PMID:19183274

Domain-specific interactions between MLN8237 and human serum albumin estimated by STD and WaterLOGSY NMR, ITC, spectroscopic, and docking techniques

NASA Astrophysics Data System (ADS)

Yang, Hongqin; Liu, Jiuyang; Huang, Yanmei; Gao, Rui; Tang, Bin; Li, Shanshan; He, Jiawei; Li, Hui

2017-03-01

Alisertib (MLN8237) is an orally administered inhibitor of Aurora A kinase. This small-molecule inhibitor is under clinical or pre-clinical phase for the treatment of advanced malignancies. The present study provides a detailed characterization of the interaction of MLN8237 with a drug transport protein called human serum albumin (HSA). STD and WaterLOGSY nuclear magnetic resonance (NMR)-binding studies were conducted first to confirm the binding of MLN8237 to HSA. In the ligand orientation assay, the binding sites of MLN8237 were validated through two site-specific spy molecules (warfarin sodium and ibuprofen, which are two known site-selective probes) by using STD and WaterLOGSY NMR competition techniques. These competition experiments demonstrate that both spy molecules do not compete with MLN8237 for the specific binding site. The AutoDock-based blind docking study recognizes the hydrophobic subdomain IB of the protein as the probable binding site for MLN8237. Thermodynamic investigations by isothermal titration calorimetry (ITC) reveal that the non-covalent interaction between MLN8237 and HSA (binding constant was approximately 105 M-1) is driven mainly by favorable entropy and unfavorable enthalpy. In addition, synchronous fluorescence, circular dichroism (CD), and 3D fluorescence spectroscopy suggest that MLN8237 may induce conformational changes in HSA.

A sensitive epitope-blocking ELISA for the detection of Chikungunya virus-specific antibodies in patients.

PubMed

Goh, Lucas Y H; Kam, Yiu-Wing; Metz, Stefan W; Hobson-Peters, Jody; Prow, Natalie A; McCarthy, Suzi; Smith, David W; Pijlman, Gorben P; Ng, Lisa F P; Hall, Roy A

2015-09-15

Chikungunya fever (CHIKF) has re-emerged as an arboviral disease that mimics clinical symptoms of other diseases such as dengue, malaria, as well as other alphavirus-related illnesses leading to problems with definitive diagnosis of the infection. Herein we describe the development and evaluation of a sensitive epitope-blocking ELISA (EB-ELISA) capable of specifically detecting anti-chikungunya virus (CHIKV) antibodies in clinical samples. The assay uses a monoclonal antibody (mAb) that binds an epitope on the E2 protein of CHIKV and does not exhibit cross-reactivity to other related alphaviruses. We also demonstrated the use of recombinant CHIK virus-like particles (VLPs) as a safe alternative antigen to infectious virions in the assay. Based on testing of 60 serum samples from patients in the acute or convalescent phase of CHIKV infection, the EB-ELISA provided us with 100% sensitivity, and exhibited 98.5% specificity when Ross River virus (RRV)- or Barmah Forest virus (BFV)-immune serum samples were included. This assay meets the public health demands of a rapid, robust, sensitive and specific, yet simple assay for specifically diagnosing CHIK-infections in humans. Copyright © 2015. Published by Elsevier B.V.

Bile Salt-induced Biofilm Formation in Enteric Pathogens: Techniques for Identification and Quantification.

PubMed

Nickerson, Kourtney P; Faherty, Christina S

2018-05-06

Biofilm formation is a dynamic, multistage process that occurs in bacteria under harsh environmental conditions or times of stress. For enteric pathogens, a significant stress response is induced during gastrointestinal transit and upon bile exposure, a normal component of human digestion. To overcome the bactericidal effects of bile, many enteric pathogens form a biofilm hypothesized to permit survival when transiting through the small intestine. Here we present methodologies to define biofilm formation through solid-phase adherence assays as well as extracellular polymeric substance (EPS) matrix detection and visualization. Furthermore, biofilm dispersion assessment is presented to mimic the analysis of events triggering release of bacteria during the infection process. Crystal violet staining is used to detect adherent bacteria in a high-throughput 96-well plate adherence assay. EPS production assessment is determined by two assays, namely microscopy staining of the EPS matrix and semi-quantitative analysis with a fluorescently-conjugated polysaccharide binding lectin. Finally, biofilm dispersion is measured through colony counts and plating. Positive data from multiple assays support the characterization of biofilms and can be utilized to identify bile salt-induced biofilm formation in other bacterial strains.

Profiling 976 ToxCast Chemicals across 331 Enzymatic and Receptor Signaling Assays

PubMed Central

2013-01-01

Understanding potential health risks is a significant challenge due to the large numbers of diverse chemicals with poorly characterized exposures and mechanisms of toxicities. The present study analyzes 976 chemicals (including failed pharmaceuticals, alternative plasticizers, food additives, and pesticides) in Phases I and II of the U.S. EPA’s ToxCast project across 331 cell-free enzymatic and ligand-binding high-throughput screening (HTS) assays. Half-maximal activity concentrations (AC50) were identified for 729 chemicals in 256 assays (7,135 chemical–assay pairs). Some of the most commonly affected assays were CYPs (CYP2C9 and CYP2C19), transporters (mitochondrial TSPO, norepinephrine, and dopaminergic), and GPCRs (aminergic). Heavy metals, surfactants, and dithiocarbamate fungicides showed promiscuous but distinctly different patterns of activity, whereas many of the pharmaceutical compounds showed promiscuous activity across GPCRs. Literature analysis confirmed >50% of the activities for the most potent chemical–assay pairs (54) but also revealed 10 missed interactions. Twenty-two chemicals with known estrogenic activity were correctly identified for the majority (77%), missing only the weaker interactions. In many cases, novel findings for previously unreported chemical–target combinations clustered with known chemical–target interactions. Results from this large inventory of chemical–biological interactions can inform read-across methods as well as link potential targets to molecular initiating events in adverse outcome pathways for diverse toxicities. PMID:23611293

Functional coupling between adenosine A1 receptors and G-proteins in rat and postmortem human brain membranes determined with conventional guanosine-5'-O-(3-[35S]thio)triphosphate ([35S]GTPγS) binding or [35S]GTPγS/immunoprecipitation assay.

PubMed

Odagaki, Yuji; Kinoshita, Masakazu; Ota, Toshio; Meana, J Javier; Callado, Luis F; Matsuoka, Isao; García-Sevilla, Jesús A

2018-06-01

Adenosine signaling plays a complex role in multiple physiological processes in the brain, and its dysfunction has been implicated in pathophysiology of neuropsychiatric diseases such as schizophrenia and affective disorders. In the present study, the coupling between adenosine A 1 receptor and G-protein was assessed by means of two [ 35 S]GTPγS binding assays, i.e., conventional filtration method and [ 35 S]GTPγS binding/immunoprecipitation in rat and human brain membranes. The latter method provides information about adenosine A 1 receptor-mediated Gα i-3 activation in rat as well as human brain membranes. On the other hand, adenosine-stimulated [ 35 S]GTPγS binding determined with conventional assay derives from functional activation of Gα i/o proteins (not restricted only to Gα i-3 ) coupled to adenosine A 1 receptors. The determination of adenosine concentrations in the samples used in the present study indicates the possibility that the assay mixture under our experimental conditions contains residual endogenous adenosine at nanomolar concentrations, which was also suggested by the results on the effects of adenosine receptor antagonists on basal [ 35 S]GTPγS binding level. The effects of adenosine deaminase (ADA) on basal binding also support the presence of adenosine. Nevertheless, the varied patterns of ADA discouraged us from adding ADA into assay medium routinely. The concentration-dependent increases elicited by adenosine were determined in 40 subjects without any neuropsychiatric disorders. The increases in %E max values determined by conventional assay according to aging and postmortem delay should be taken into account in future studies focusing on the effects of psychiatric disorders on adenosine A 1 receptor/G-protein interaction in postmortem human brain tissue.

Method for screening inhibitors of the toxicity of Bacillus anthracis

DOEpatents

Cirino, Nick M.; Jackson, Paul J.; Lehnert, Bruce E.

2001-01-01

The protective antigen (PA) of Bacillus anthracis is integral to the mechanism of anthrax poisoning. The cloning, expression and purification of a 32 kDa B. anthracis PA fragment (PA32) is described. This fragment has also been expressed as a fusion construct to stabilized green fluorescent protein (EGFP-PA32). Both proteins were capable of binding to specific cell surface receptors as determined by fluorescent microscopy and a flow cytometric assay. To confirm binding specificity in the flow cytometric assay, non-fluorescent PA83 or PA32 was used to competitively inhibit fluorescent EGFP-PA32 binding to cell receptors. This assay can be employed as a rapid screen for compounds which disrupts binding of PA to cells. Additionally, the high intracellular expression levels and ease of purification make this recombinant protein an attractive vaccine candidate or therapeutic treatment for anthrax poisoning.

Surface plasmon resonance as a tool for ligand-binding assay reagent characterization in bioanalysis of biotherapeutics.

PubMed

Duo, Jia; Bruno, JoAnne; Kozhich, Alexander; David-Brown, Donata; Luo, Linlin; Kwok, Suk; Santockyte, Rasa; Haulenbeek, Jonathan; Liu, Rong; Hamuro, Lora; Peterson, Jon E; Piccoli, Steven; DeSilva, Binodh; Pillutla, Renuka; Zhang, Yan J

2018-04-01

Ligand-binding assay (LBA) performance depends on quality reagents. Strategic reagent screening and characterization is critical to LBA development, optimization and validation. Application of advanced technologies expedites the reagent screening and assay development process. By evaluating surface plasmon resonance technology that offers high-throughput kinetic information, this article aims to provide perspectives on applying the surface plasmon resonance technology to strategic LBA critical reagent screening and characterization supported by a number of case studies from multiple biotherapeutic programs.

A Comparison of Protein Kinases Inhibitor Screening Methods Using Both Enzymatic Activity and Binding Affinity Determination

PubMed Central

Rudolf, Amalie Frederikke; Skovgaard, Tine; Knapp, Stefan; Jensen, Lars Juhl; Berthelsen, Jens

2014-01-01

Binding assays are increasingly used as a screening method for protein kinase inhibitors; however, as yet only a weak correlation with enzymatic activity-based assays has been demonstrated. We show that the correlation between the two types of assays can be improved using more precise screening conditions. Furthermore a marked improvement in the correlation was found by using kinase constructs containing the catalytic domain in presence of additional domains or subunits. PMID:24915177

Binding Assays Using Recombinant SH2 Domains: Far-Western, Pull-Down, and Fluorescence Polarization.

PubMed

Machida, Kazuya; Liu, Bernard

2017-01-01

Recognition of phosphotyrosine-containing sequences by SH2 domains confers specificity in tyrosine kinase pathways. By assessing interactions between isolated SH2 domains and their binding proteins, it is possible to gain insight into otherwise inaccessible complex cellular systems. Far-Western, pull-down, and fluorescence polarization (FP) have been frequently used for characterization of phosphotyrosine signaling. Here, we outline standard protocols for these established assays using recombinant SH2 domain, emphasizing the importance of appropriate sample preparation and assay controls.

New Horizons on Molecular Pharmacology Applied to Drug Discovery: When Resonance Overcomes Radioligand Binding.

PubMed

Pernomian, Larissa; Gomes, Mayara Santos; Moreira, Josimar Dornelas; da Silva, Carlos Henrique Tomich de Paula; Rosa, Joaquin Maria Campos; Cardoso, Cristina Ribeiro de Barros

2017-01-01

One of the cornerstones of rational drug development is the measurement of molecular parameters derived from ligand-receptor interaction, which guides therapeutic windows definition. Over the last decades, radioligand binding has provided valuable contributions in this field as key method for such purposes. However, its limitations spurred the development of more exquisite techniques for determining such parameters. For instance, safety risks related to radioactivity waste, expensive and controlled disposal of radioisotopes, radiotracer separation-dependence for affinity analysis, and one-site mathematical models-based fitting of data make radioligand binding a suboptimal approach in providing measures of actual affinity conformations from ligands and G proteincoupled receptors (GPCR). Current advances on high-throughput screening (HTS) assays have markedly extended the options of sparing sensitive ways for monitoring ligand affinity. The advent of the novel bioluminescent donor NanoLuc luciferase (Nluc), engineered from Oplophorus gracilirostris luciferase, allowed fitting bioluminescence resonance energy transfer (BRET) for monitoring ligand binding. Such novel approach named Nluc-based BRET (NanoBRET) binding assay consists of a real-time homogeneous proximity assay that overcomes radioligand binding limitations but ensures the quality in affinity measurements. Here, we cover the main advantages of NanoBRET protocol and the undesirable drawbacks of radioligand binding as molecular methods that span pharmacological toolbox applied to Drug Discovery. Also, we provide a novel perspective for the application of NanoBRET technology in affinity assays for multiple-state binding mechanisms involving oligomerization and/or functional biased selectivity. This new angle was proposed based on specific biophysical criteria required for the real-time homogeneity assigned to the proximity NanoBRET protocol. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Lipid Microarray Biosensor for Biotoxin Detection.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singh, Anup K.; Throckmorton, Daniel J.; Moran-Mirabal, Jose C.

2006-05-01

We present the use of micron-sized lipid domains, patterned onto planar substrates and within microfluidic channels, to assay the binding of bacterial toxins via total internal reflection fluorescence microscopy (TIRFM). The lipid domains were patterned using a polymer lift-off technique and consisted of ganglioside-populated DSPC:cholesterol supported lipid bilayers (SLBs). Lipid patterns were formed on the substrates by vesicle fusion followed by polymer lift-off, which revealed micron-sized SLBs containing either ganglioside GT1b or GM1. The ganglioside-populated SLB arrays were then exposed to either Cholera toxin subunit B (CTB) or Tetanus toxin fragment C (TTC). Binding was assayed on planar substrates bymore » TIRFM down to 1 nM concentration for CTB and 100 nM for TTC. Apparent binding constants extracted from three different models applied to the binding curves suggest that binding of a protein to a lipid-based receptor is strongly affected by the lipid composition of the SLB and by the substrate on which the bilayer is formed. Patterning of SLBs inside microfluidic channels also allowed the preparation of lipid domains with different compositions on a single device. Arrays within microfluidic channels were used to achieve segregation and selective binding from a binary mixture of the toxin fragments in one device. The binding and segregation within the microfluidic channels was assayed with epifluorescence as proof of concept. We propose that the method used for patterning the lipid microarrays on planar substrates and within microfluidic channels can be easily adapted to proteins or nucleic acids and can be used for biosensor applications and cell stimulation assays under different flow conditions. KEYWORDS. Microarray, ganglioside, polymer lift-off, cholera toxin, tetanus toxin, TIRFM, binding constant.4« less

Identification of second arginine-glycine-aspartic acid motif of ovine vitronectin as the complement C9 binding site and its implication in bacterial infection.

PubMed

Prasada, Rao T; Lakshmi, Prasanth T; Parvathy, R; Murugavel, S; Karuna, Devi; Paritosh, Joshi

2017-02-01

Vitronectin (Vn), a multifunctional protein of blood and extracellular matrix, interacts with complement C9. This interaction may modulate innate immunity. Details of Vn-C9 interactions are limited. Vn-C9 interactions were assessed by employing a goat homologous system and observing Vn binding to C9 in three different assays. Using recombinant fragments, C9 binding was mapped to the N-terminus of Vn. Site directed mutagenesis was performed to alter the second arginine glycine aspartic acid (RGD) sequence (RGD-2) of Vn. Changing R to G or D to A in RGD-2 caused significant decrease in Vn binding to C9 whereas changing of R to G in the first RGD motif (RGD-1) had no effect on Vn binding to C9. These results imply that the RGD-2 of goat Vn is involved in C9 binding. In a competitive binding assay, the presence of soluble RGD peptide inhibited Vn binding to C9 whereas heparin had no effect. Vn binding to C9 was also evaluated in terms of bacterial pathogenesis. Serum dependent inhibition of Escherichia coli growth was significantly reverted when Vn or its N-fragment were included in the assay. The C-fragment, which did not support C9 binding, also partly nullified serum-dependent inhibition of bacterial growth, probably through other serum component(s). © 2017 The Societies and John Wiley & Sons Australia, Ltd.

SKLB060 Reversibly Binds to Colchicine Site of Tubulin and Possesses Efficacy in Multidrug-Resistant Cell Lines.

PubMed

Yan, Wei; Yang, Tao; Yang, Jianhong; Wang, Taijin; Yu, Yamei; Wang, Yuxi; Chen, Qiang; Bai, Peng; Li, Dan; Ye, Haoyu; Qiu, Qiang; Zhou, Yongzhao; Hu, Yiguo; Yang, Shengyong; Wei, Yuquan; Li, Weimin; Chen, Lijuan

2018-05-22

Many tubulin inhibitors are in clinical use as anti-cancer drugs. In our previous study, a novel series of 4-substituted coumarins derivatives were identified as novel tubulin inhibitors. Here, we report the anti-cancer activity and underlying mechanism of one of the 4-substituted coumarins derivatives (SKLB060). The anti-cancer activity of SKLB060 was tested on 13 different cancer cell lines and four xenograft cancer models. Immunofluorescence staining, cell cycle analysis, and tubulin polymerization assay were employed to study the inhibition of tubulin. N, N '-Ethylenebis(iodoacetamide) assay was used to measure binding to the colchicine site. Wound-healing migration and tube formation assays were performed on human umbilical vascular endothelial cells to study anti-vascular activity (the ability to inhibit blood vessel growth). Mitotic block reversibility and structural biology assays were used to investigate the SKLB060-tubulin bound model. SKLB060 inhibited tubulin polymerization and subsequently induced G2/M cell cycle arrest and apoptosis in cancer cells. SKLB060 bound to the colchicine site of β-tubulin and showed antivascular activity in vitro. Moreover, SKLB060 induced reversible cell cycle arrest and reversible inhibition of tubulin polymerization. A mitotic block reversibility assay showed that the effects of SKLB060 have greater reversibility than those of colcemid (a reversible tubulin inhibitor), indicating that SKLB060 binds to tubulin in a totally reversible manner. The crystal structures of SKLB060-tubulin complexes confirmed that SKLB060 binds to the colchicine site, and the natural coumarin ring in SKLB060 enables reversible binding. These results reveal that SKLB060 is a powerful and reversible microtubule inhibitor that binds to the colchicine site and is effective in multidrug-resistant cell lines. © 2018 The Author(s). Published by S. Karger AG, Basel.

Two novel assays for the detection of haemin-binding properties of antimalarials evaluated with compounds isolated from medicinal plants.

PubMed

Steele, J C P; Phelps, R J; Simmonds, M S J; Warhurst, D C; Meyer, D J

2002-07-01

Forty-two compounds isolated from nine plants used within South America for the treatment of malaria were tested for haemin binding using two novel, rapid screening methods. The data obtained were analysed with respect to IC(50) values for in vitro toxicity to Plasmodium falciparum trophozoites. One method, a multiwell assay based on the inhibition of the interaction of haemin with glutathione (GSH), is sensitive in the 10 microM range, takes c. 1 h and is suitable for either a high throughput screen or rapid assay during natural product isolation. Of 19 compounds showing antiplasmodial activity (IC(50) < 40 microM), 16 (84%) showed >40% inhibition of GSH-haemin reaction. The sensitivity and specificity of the assay were 0.85 and 0.82, respectively. The positive predictive value was 0.81 and the negative predictive value 0.86. A more sensitive assay (0.1 microM range) is based on the reversal by haemin-binding compounds of the haemin inhibition of the L-dopachrome-methyl ester tautomerase activity of human macrophage migration inhibitory factor. This assay gives a better idea of the affinity of interaction and uses very small amounts of test compound. The log[RI(50)] of eight of the compounds that tested positive in the above assays together with those of quinine and chloroquine showed a positive correlation with log[antiplasmodial IC(50)] for strain T9-96 (r = 0.824) and strain K1 (r = 0.904). Several of the antimalarial compounds that bind haemin are isoquinolines, a class not shown previously to interact with haemin.

Technological advances in diagnostic testing for von Willebrand disease: new approaches and challenges.

PubMed

Hayward, C P M; Moffat, K A; Graf, L

2014-06-01

Diagnostic tests for von Willebrand disease (VWD) are important for the assessment of VWD, which is a commonly encountered bleeding disorder worldwide. Technical innovations have been applied to improve the precision and lower limit of detection of von Willebrand factor (VWF) assays, including the ristocetin cofactor activity assay (VWF:RCo) that uses the antibiotic ristocetin to induce plasma VWF binding to glycoprotein (GP) IbIXV on target platelets. VWF-collagen-binding assays, depending on the type of collagen used, can improve the detection of forms of VWD with high molecular weight VWF multimer loss, although the best method is debatable. A number of innovations have been applied to VWF:RCo (which is commonly performed on an aggregometer), including replacing the target platelets with immobilized GPIbα, and quantification by an enzyme-linked immunosorbent assay (ELISA), immunoturbidimetric, or chemiluminescent end-point. Some common polymorphisms in the VWF gene that do not cause bleeding are associated with falsely low VWF activity by ristocetin-dependent methods. To overcome the need for ristocetin, some new VWF activity assays use gain-of-function GPIbα mutants that bind VWF without the need for ristocetin, with an improved precision and lower limit of detection than measuring VWF:RCo by aggregometry. ELISA of VWF binding to mutated GPIbα shows promise as a method to identify gain-of-function defects from type 2B VWD. The performance characteristics of many new VWF activity assays suggest that the detection of VWD, and monitoring of VWD therapy, by clinical laboratories could be improved through adopting newer generation VWF assays. © 2014 John Wiley & Sons Ltd.

Analysis of molecular determinants of affinity and relative efficacy of a series of R- and S-2-(dipropylamino)tetralins at the 5-HT1A serotonin receptor

PubMed Central

Alder, J Tracy; Hacksell, Uli; Strange, Philip G

2003-01-01

Factors influencing agonist affinity and relative efficacy have been studied for the 5-HT1A serotonin receptor using membranes of CHO cells expressing the human form of the receptor and a series of R-and S-2-(dipropylamino)tetralins (nonhydroxylated and monohydroxylated (5-OH, 6-OH, 7-OH, 8-OH) species). Ligand binding studies were used to determine dissociation constants for agonist binding to the 5-HT1A receptor: Ki values for agonists were determined in competition versus the binding of the agonist [3H]-8-OH DPAT. Competition data were all fitted best by a one-binding site model.Ki values for agonists were also determined in competition versus the binding of the antagonist [3H]-NAD-199. Competition data were all fitted best by a two-binding site model, and agonist affinities for the higher (Kh) and lower affinity (Kl) sites were determined. The ability of the agonists to activate the 5-HT1A receptor was determined using stimulation of [35S]-GTPγS binding. Maximal effects of agonists (Emax) and their potencies (EC50) were determined from concentration/response curves for stimulation of [35S]-GTPγS binding. Kl/Kh determined from ligand binding assays correlated with the relative efficacy (relative Emax) of agonists determined in [35S]-GTPγS binding assays. There was also a correlation between Kl/Kh and Kl/EC50 for agonists determined from ligand binding and [35S]-GTPγS binding assays. Simulations of agonist binding and effect data were performed using the Ternary Complex Model in order to assess the use of Kl/Kh for predicting the relative efficacy of agonists. PMID:12684269

The heat-shock protein Apg-2 binds to the tight junction protein ZO-1 and regulates transcriptional activity of ZONAB.

PubMed

Tsapara, Anna; Matter, Karl; Balda, Maria S

2006-03-01

The tight junction adaptor protein ZO-1 regulates intracellular signaling and cell proliferation. Its Src homology 3 (SH3) domain is required for the regulation of proliferation and binds to the Y-box transcription factor ZO-1-associated nucleic acid binding protein (ZONAB). Binding of ZO-1 to ZONAB results in cytoplasmic sequestration and hence inhibition of ZONAB's transcriptional activity. Here, we identify a new binding partner of the SH3 domain that modulates ZO-1-ZONAB signaling. Expression screening of a cDNA library with a fusion protein containing the SH3 domain yielded a cDNA coding for Apg-2, a member of the heat-shock protein 110 (Hsp 110) subfamily of Hsp70 heat-shock proteins, which is overexpressed in carcinomas. Regulated depletion of Apg-2 in Madin-Darby canine kidney cells inhibits G(1)/S phase progression. Apg-2 coimmunoprecipitates with ZO-1 and partially localizes to intercellular junctions. Junctional recruitment and coimmunoprecipitation with ZO-1 are stimulated by heat shock. Apg-2 competes with ZONAB for binding to the SH3 domain in vitro and regulates ZONAB's transcriptional activity in reporter gene assays. Our data hence support a model in which Apg-2 regulates ZONAB function by competing for binding to the SH3 domain of ZO-1 and suggest that Apg-2 functions as a regulator of ZO-1-ZONAB signaling in epithelial cells in response to cellular stress.

The Heat-Shock Protein Apg-2 Binds to the Tight Junction Protein ZO-1 and Regulates Transcriptional Activity of ZONAB

PubMed Central

Tsapara, Anna; Matter, Karl; Balda, Maria S.

2006-01-01

The tight junction adaptor protein ZO-1 regulates intracellular signaling and cell proliferation. Its Src homology 3 (SH3) domain is required for the regulation of proliferation and binds to the Y-box transcription factor ZO-1-associated nucleic acid binding protein (ZONAB). Binding of ZO-1 to ZONAB results in cytoplasmic sequestration and hence inhibition of ZONAB's transcriptional activity. Here, we identify a new binding partner of the SH3 domain that modulates ZO-1–ZONAB signaling. Expression screening of a cDNA library with a fusion protein containing the SH3 domain yielded a cDNA coding for Apg-2, a member of the heat-shock protein 110 (Hsp 110) subfamily of Hsp70 heat-shock proteins, which is overexpressed in carcinomas. Regulated depletion of Apg-2 in Madin-Darby canine kidney cells inhibits G1/S phase progression. Apg-2 coimmunoprecipitates with ZO-1 and partially localizes to intercellular junctions. Junctional recruitment and coimmunoprecipitation with ZO-1 are stimulated by heat shock. Apg-2 competes with ZONAB for binding to the SH3 domain in vitro and regulates ZONAB's transcriptional activity in reporter gene assays. Our data hence support a model in which Apg-2 regulates ZONAB function by competing for binding to the SH3 domain of ZO-1 and suggest that Apg-2 functions as a regulator of ZO-1–ZONAB signaling in epithelial cells in response to cellular stress. PMID:16407410

Comparison of Chemical Binding to Recombinant Fathead minnow and Human Estrogen Receptor alpha (ERα) in Whole Cell and Cell-Free Assay Systems.

EPA Science Inventory

Our objectives were to assess whether binding of chemicals differs significantly between recombinant estrogen receptors from fathead minnow (fhERα) and human (hERα) and to evaluate the performance of these receptors using two different in vitro assay systems: a COS whole cell bin...

RAINBOW TROUT ANDROGEN RECEPTOR ALPHA AND THE HUMAN ANDROGEN RECEPTOR: COMPARISONS IN THE COS WHOLE CELL BINDING ASSAY

EPA Science Inventory

RAINBOW TROUT ANDROGEN RECEPTOR ALPHA AND HUMAN ANDROGEN RECEPTOR: COMPARISONS IN THE COS WHOLE CELL BINDING ASSAY.
MC Cardon, PC Hartig,LE Gray, Jr. and VS Wilson.
U.S. EPA, ORD, NHEERL, RTD, Research Triangle Park, NC, USA.
Typically, in vitro hazard assessments for ...

Measurement of Bluetongue Virus Binding to a Mammalian Cell Surface Receptor by an In Situ Immune Fluorescent Staining Technique

USDA-ARS?s Scientific Manuscript database

A quantifiable in situ immune fluorescent assay (IFA) was developed to measure bluetongue virus (BTV) binding to mammalian cells. The utility of the assay was demonstrated with both Chinese hamster ovary (CHO) and bovine pulmonary artery endothelial (CPAE) cells. Since heparin sulfate (HS) has been ...

Characterization of the swine adipocyte A1 adenosine receptor using an optimized assay system.

PubMed

Dong, Q; Schuchman, J; Carey, G B

1994-07-01

The radioligand binding assay of A1 adenosine receptors in adipocyte crude plasma membrane from Yucatan miniature swine was optimized by evaluating 17 factors involved in the assay. Significant effects of CHAPS, adenosine deaminase, EDTA, pre-rinsing glass fiber filters and pH were found for the binding measurements. Using the optimized procedure, [3H]8-cyclopentyl-1,3-dipropylxanthine, ([3H]-DPCPX) binding to A1 adenosine receptors in swine subcutaneous adipocyte crude plasma membrane was measured; Bmax and Kd values were 479 +/- 77 fmol/mg protein and 0.87 +/- 0.10 nM, respectively. Values for mesenteric adipose tissue from sedentary swine and subcutaneous adipose tissue from exercise-trained swine were also measured.

An innovative and highly drug-tolerant approach for detecting neutralizing antibodies directed to therapeutic antibodies.

PubMed

Sloan, John H; Conway, Richard G; Pottanat, Thomas G; Troutt, Jason S; Higgs, Richard E; Konrad, Robert J; Qian, Yue-Wei

2016-10-01

Immunogenicity testing of biotherapeutic drugs is a regulatory requirement. Herein, we describe a drug-tolerant assay for detecting neutralizing antibodies against a therapeutic antibody. Excess target of the therapeutic antibody was incorporated into the detection step of an affinity capture elution assay. Signal generated from binding of antidrug antibody (ADA) to the therapeutic antibody was compared with signal from binding of ADA to the therapeutic antibody preincubated with its target. The results demonstrated that the target blocked binding of the therapeutic antibody to neutralizing monkey ADA and to two anti-idiotypic antibodies. This highly drug-tolerant novel approach enables the detection of neutralizing antibodies and allows for one basic assay format to achieve complete characterization of ADA responses.

Performance evaluation and multicentre study of a von Willebrand factor activity assay based on GPIb binding in the absence of ristocetin.

PubMed

Patzke, Juergen; Budde, Ulrich; Huber, Andreas; Méndez, Adriana; Muth, Heidrun; Obser, Tobias; Peerschke, Ellinor; Wilkens, Matthias; Schneppenheim, Reinhard

2014-12-01

The functional activity of von Willebrand factor (VWF) is most frequently measured by using the ristocetin cofactor assay (VWF:RCo). However, the method's drawbacks include unsatisfactory precision, sensitivity and availability of automated system applications. We have developed an alternative assay (INNOVANCE VWF Ac) that is based on the binding of VWF to recombinant glycoprotein Ib (GPIb). Two gain-of-function mutations were introduced into a GPIb fragment, allowing an assay format without ristocetin. Fully automated assay applications are available for the BCS/BCS XP systems and the Sysmex CS-2000i, Sysmex CA-7000, Sysmex CA-1500 and Sysmex CA-560 systems.The INNOVANCE VWF Ac assay measuring range extends from 4 to 600% VWF for all systems except the Sysmex CA-560 system. Within-device precision values were found to be between 2 and 7%. The limit of detection was below 2.2% VWF. In a study on the BCS XP system, a total number of 580 sample results yielded a correlation to the VWF:RCo assay of r equal to 0.99 (slope = 0.96). Very similar results were observed when von Willebrand disease samples type 1, 2A, 2B, 2M, 2N and 3 were investigated with the new assay and the VWF:RCo assay. The excellent performance data and comparability to VWF:RCo, together with the ease of use, led us to the conclusion that the ristocetin cofactor assay can be replaced by the new GPIb-binding assay to reliably diagnosing patients with von Willebrand disease.

Small Molecule Regulation of Protein Conformation by Binding in the Flap of HIV Protease

PubMed Central

Tiefenbrunn, Theresa; Forli, Stefano; Baksh, Michael M.; Chang, Max W.; Happer, Meaghan; Lin, Ying-Chuan; Perryman, Alexander L.; Rhee, Jin-Kyu; Torbett, Bruce E.; Olson, Arthur J.; Elder, John H.; Finn, M. G.; Stout, C. David

2013-01-01

The fragment indole-6-carboxylic acid (1F1), previously identified as a flap site binder in a fragment-based screen against HIV protease (PR), has been co-crystallized with pepstatin-inhibited PR and with apo-PR. Another fragment, 3-indolepropionic acid (1F1-N), predicted by AutoDock calculations and confirmed in a novel ‘inhibition of nucleation’ crystallization assay, exploits the same interactions in the flap site in two crystal structures. Both 1F1 and 1F1-N bind to the closed form of apo-PR and to pepstatin:PR. In solution, 1F1 and 1F1-N raise the Tm of apo-PR by 3.5–5 °C as assayed by differential scanning fluorimetry (DSF), and show equivalent low-micromolar binding constants to both apo-PR and pepstatin:PR, assayed by backscattering interferometry (BSI). The observed signal intensities in BSI are greater for each fragment upon binding to apo-PR than to pepstatin-bound PR, consistent with greater conformational change in the former binding event. Together, these data indicate that fragment binding in the flap site favors a closed conformation of HIV PR. PMID:23540839

Holotrichia oblita Midgut Proteins That Bind to Bacillus thuringiensis Cry8-Like Toxin and Assembly of the H. oblita Midgut Tissue Transcriptome

PubMed Central

Jiang, Jian; Huang, Ying; Shu, Changlong; Soberón, Mario; Bravo, Alejandra; Liu, Chunqing; Song, Fuping; Lai, Jinsheng

2017-01-01

ABSTRACT The Bacillus thuringiensis strain HBF-18 (CGMCC 2070), containing two cry genes (cry8-like and cry8Ga), is toxic to Holotrichia oblita larvae. Both Cry8-like and Cry8Ga proteins are active against this insect pest, and Cry8-like is more toxic. To analyze the characteristics of the binding of Cry8-like and Cry8Ga proteins to brush border membrane vesicles (BBMVs) in H. oblita larvae, binding assays were conducted with a fluorescent DyLight488-labeled Cry8-like toxin. The results of saturation binding assays demonstrated that Cry8-like bound specifically to binding sites on BBMVs from H. oblita, and heterologous competition assays revealed that Cry8Ga shared binding sites with Cry8-like. Furthermore, Cry8-like-binding proteins in the midgut from H. oblita larvae were identified by pulldown assays and liquid chromatography-tandem mass spectrometry (LC-MS/MS). In addition, the H. oblita midgut transcriptome was assembled by high-throughput RNA sequencing and used for identification of Cry8-like-binding proteins. Eight Cry8-like-binding proteins were obtained from pulldown assays conducted with BBMVs. The LC-MS/MS data for these proteins were successfully matched with the H. oblita transcriptome, and BLASTX results identified five proteins as serine protease, transferrin-like, uncharacterized protein LOC658236 of Tribolium castaneum, ATPase catalytic subunit, and actin. These identified Cry8-like-binding proteins were different from those confirmed previously as receptors for Cry1A proteins in lepidopteran insect species, such as aminopeptidase, alkaline phosphatase, and cadherin. IMPORTANCE Holotrichia oblita is one of the main soil-dwelling pests in China. The larvae damage the roots of crops, resulting in significant yield reductions and economic losses. H. oblita is difficult to control, principally due to its soil-dwelling habits. In recent years, some Cry8 toxins from Bacillus thuringiensis were shown to be active against this pest. Study of the mechanism of action of these Cry8 toxins is needed for their effective use in the control of H. oblita and for their future utilization in transgenic plants. Our work provides important basic data and promotes understanding of the insecticidal mechanism of Cry8 proteins against H. oblita larvae. PMID:28389549

A high-throughput fluorescence polarization assay for inhibitors of gyrase B.

PubMed

Glaser, Bryan T; Malerich, Jeremiah P; Duellman, Sarah J; Fong, Julie; Hutson, Christopher; Fine, Richard M; Keblansky, Boris; Tang, Mary J; Madrid, Peter B

2011-02-01

DNA gyrase, a type II topoisomerase that introduces negative supercoils into DNA, is a validated antibacterial drug target. The holoenzyme is composed of 2 subunits, gyrase A (GyrA) and gyrase B (GyrB), which form a functional A(2)B(2) heterotetramer required for bacterial viability. A novel fluorescence polarization (FP) assay has been developed and optimized to detect inhibitors that bind to the adenosine triphosphate (ATP) binding domain of GyrB. Guided by the crystal structure of the natural product novobiocin bound to GyrB, a novel novobiocin-Texas Red probe (Novo-TRX) was designed and synthesized for use in a high-throughput FP assay. The binding kinetics of the interaction of Novo-TRX with GyrB from Francisella tularensis has been characterized, as well as the effect of common buffer additives on the interaction. The assay was developed into a 21-µL, 384-well assay format and has been validated for use in high-throughput screening against a collection of Food and Drug Administration-approved compounds. The assay performed with an average Z' factor of 0.80 and was able to identify GyrB inhibitors from a screening library.

Method for estimating protein binding capacity of polymeric systems.

PubMed

Sharma, Vaibhav; Blackwood, Keith A; Haddow, David; Hook, Lilian; Mason, Chris; Dye, Julian F; García-Gareta, Elena

2015-01-01

Composite biomaterials made from synthetic and protein-based polymers are extensively researched in tissue engineering. To successfully fabricate a protein-polymer composite, it is critical to understand how strongly the protein binds to the synthetic polymer, which occurs through protein adsorption. Currently, there is no cost-effective and simple method for characterizing this interfacial binding. To characterize this interfacial binding, we introduce a simple three-step method that involves: 1) synthetic polymer surface characterisation, 2) a quick, inexpensive and robust novel immuno-based assay that uses protein extraction compounds to characterize protein binding strength followed by 3) an in vitro 2D model of cell culture to confirm the results of the immuno-based assay. Fibrinogen, precursor of fibrin, was adsorbed (test protein) on three different polymeric surfaces: silicone, poly(acrylic acid)-coated silicone and poly(allylamine)-coated silicone. Polystyrene surface was used as a reference. Characterisation of the different surfaces revealed different chemistry and roughness. The novel immuno-based assay showed significantly stronger binding of fibrinogen to both poly(acrylic acid) and poly(allylamine) coated silicone. Finally, cell studies showed that the strength of the interaction between the protein and the polymer had an effect on cell growth. This novel immuno-based assay is a valuable tool in developing composite biomaterials of synthetic and protein-based polymers with the potential to be applied in other fields of research where protein adsorption onto surfaces plays an important role.

Calcyclin Binding Protein/Siah-1 Interacting Protein Is a Hsp90 Binding Chaperone

PubMed Central

Góral, Agnieszka; Bieganowski, Paweł; Prus, Wiktor; Krzemień-Ojak, Łucja; Kądziołka, Beata; Fabczak, Hanna; Filipek, Anna

2016-01-01

The Hsp90 chaperone activity is tightly regulated by interaction with many co-chaperones. Since CacyBP/SIP shares some sequence homology with a known Hsp90 co-chaperone, Sgt1, in this work we performed a set of experiments in order to verify whether CacyBP/SIP can interact with Hsp90. By applying the immunoprecipitation assay we have found that CacyBP/SIP binds to Hsp90 and that the middle (M) domain of Hsp90 is responsible for this binding. Furthermore, the proximity ligation assay (PLA) performed on HEp-2 cells has shown that the CacyBP/SIP-Hsp90 complexes are mainly localized in the cytoplasm of these cells. Using purified proteins and applying an ELISA we have shown that Hsp90 interacts directly with CacyBP/SIP and that the latter protein does not compete with Sgt1 for the binding to Hsp90. Moreover, inhibitors of Hsp90 do not perturb CacyBP/SIP-Hsp90 binding. Luciferase renaturation assay and citrate synthase aggregation assay with the use of recombinant proteins have revealed that CacyBP/SIP exhibits chaperone properties. Also, CacyBP/SIP-3xFLAG expression in HEp-2 cells results in the appearance of more basic Hsp90 forms in 2D electrophoresis, which may indicate that CacyBP/SIP dephosphorylates Hsp90. Altogether, the obtained results suggest that CacyBP/SIP is involved in regulation of the Hsp90 chaperone machinery. PMID:27249023

Time-Resolved Fluorescence Resonance Energy Transfer Assay for Discovery of Small-Molecule Inhibitors of Methyl-CpG Binding Domain Protein 2.

PubMed

Wyhs, Nicolas; Walker, David; Giovinazzo, Hugh; Yegnasubramanian, Srinivasan; Nelson, William G

2014-08-01

Methylated DNA binding proteins such as Methyl-CpG Binding Domain Protein 2 (MBD2) can transduce DNA methylation alterations into a repressive signal by recruiting transcriptional co-repressor complexes. Interfering with MBD2 could lead to reactivation of tumor suppressor genes and therefore represents an attractive strategy for epigenetic therapy. We developed and compared fluorescence polarization (FP) and time-resolved fluorescence resonance energy transfer (TR-FRET)-based high-throughput screening (HTS) assays to identify small-molecule inhibitors of the interaction between the methyl binding domain of MBD2 (MBD2-MBD) and methylated DNA. Although both assays performed well in 96-well format, the TR-FRET assay (Z' factor = 0.58) emerged as a superior screening strategy compared with FP (Z' factor = 0.08) when evaluated in an HTS 384-well plate format. Using TR-FRET, we screened the Sigma LOPAC library for MBD2-MBD inhibitors and identified four compounds that also validated in a dose-response series. This included two known DNA intercalators (mitoxantrone and idarubicin) among two other inhibitory compounds (NF449 and aurintricarboxylic acid). All four compounds also inhibited the binding of SP-1, a transcription factor with a GC-rich binding sequence, to a methylated oligonucleotide, demonstrating that the activity was nonspecific. Our results provide proof of principle for using TR-FRET-based HTS to identify small-molecule inhibitors of MBD2 and other DNA-protein interactions. © 2014 Society for Laboratory Automation and Screening.

Assessment of the nickel-albumin binding assay for diagnosis of acute coronary syndrome.

PubMed

da Silva, Sandra Huber; Pereira, Renata da Silva; Hausen, Bruna dos Santos; Signor, Cristiane; Gomes, Patrícia; de Campos, Marli Matiko Anraku; Moresco, Rafael Noal

2011-03-01

Myocardial ischemia may alter the metal binding capacity of circulating serum albumin. Thus, the aim of this study was to describe an automated method to measure ischemia-induced alterations in the binding capacity of serum albumin for exogenous nickel, and to evaluate the diagnostic characteristics of this assay for the assessment of acute coronary syndrome (ACS) in patients presenting to the emergency room (ER) with acute chest pain. We assessed the concentrations of cardiac troponin I (cTnI), serum albumin, ischemia-modified albumin (IMA) measured by the cobalt-albumin binding assay (CABA), and by an automated nickel-albumin binding assay (NABA) in the following groups: ACS (n=63) and non-ischemic chest pain (NICP, n=26). Biochemical markers were determined in blood samples obtained from patients within 3 h of ER admission. cTnI, CABA and NABA concentrations were higher in ACS group in comparison to the NICP group. A significant correlation between NABA and CABA was observed (r=0.5387, p<0.001). Areas under the curve for CABA and NABA were 0.7289 and 0.7582, respectively. Both CABA and NABA have the ability to discriminate patients with ACS. However, NABA has a slightly higher ability to discriminate ACS compared with CABA. Patients with ACS have reduced nickel binding to human serum albumin, and NABA may have an important role as an early marker of myocardial ischemia, particularly in patients presenting to the ER with acute chest pain.

Ligand induced stabilization of the melting temperature of the HSV-1 single-strand DNA binding protein using the thermal shift assay.

PubMed

Rupesh, Kanchi Ravi; Smith, Aaron; Boehmer, Paul E

2014-11-28

We have adapted the thermal shift assay to measure the ligand binding properties of the herpes simplex virus-1 single-strand DNA binding protein, ICP8. By measuring SYPRO Orange fluorescence in microtiter plates using a fluorescence-enabled thermal cycler, we have quantified the effects of oligonucleotide ligands on the melting temperature of ICP8. We found that single-stranded oligomers raise the melting temperature of ICP8 in a length- and concentration-dependent manner, ranging from 1°C for (dT)5 to a maximum of 9°C with oligomers ⩾10 nucleotides, with an apparent Kd of <1μM for (dT)20. Specifically, the results indicate that ICP8 is capable of interacting with oligomers as short as 5 nucleotides. Moreover, the observed increases in melting temperature of up to 9°C, indicates that single-strand DNA binding significantly stabilizes the structure of ICP8. This assay may be applied to investigate the ligand binding proteins of other single-strand DNA binding proteins and used as a high-throughput screen to identify compounds with therapeutic potential that inhibit single-strand DNA binding. As proof of concept, the single-strand DNA binding agent ciprofloxacin reduces the ligand induced stabilization of the melting temperature of ICP8 in a dose-dependent manner. Copyright © 2014 Elsevier Inc. All rights reserved.

Actin Polymerization is Stimulated by Actin Crosslinking Protein Palladin

PubMed Central

Gurung, Ritu; Yadav, Rahul; Brungardt, Joseph G.; Orlova, Albina; Egelman, Edward H.; Beck, Moriah R.

2016-01-01

The actin scaffold protein palladin regulates both normal cell migration and invasive cell motility, processes that require the coordinated regulation of actin dynamics. However, the potential effect of palladin on actin dynamics has remained elusive. Here we show that the actin binding immunoglobulin-like domain of palladin, which is directly responsible for both actin binding and bundling, also stimulates actin polymerization in vitro. Palladin eliminated the lag phase that is characteristic of the slow nucleation step of actin polymerization. Furthermore, palladin dramatically reduced depolymerization, slightly enhanced the elongation rate, and did not alter the critical concentration. Microscopy and in vitro crosslinking assays reveal differences in actin bundle architecture when palladin is incubated with actin before or after polymerization. These results suggest a model whereby palladin stimulates a polymerization-competent form of G-actin, akin to metal ions, either through charge neutralization or conformational changes. PMID:26607837

Use of superparamagnetic beads for the isolation of a peptide with specificity to cymbidium mosaic virus.

PubMed

Ooi, Diana Jia Miin; Dzulkurnain, Adriya; Othman, Rofina Yasmin; Lim, Saw Hoon; Harikrishna, Jennifer Ann

2006-09-01

A modified method for the rapid isolation of specific ligands to whole virus particles is described. Biopanning against cymbidium mosaic virus was carried out with a commercial 12-mer random peptide display library. A solution phase panning method was devised using streptavidin-coated superparamagnetic beads. The solution based panning method was more efficient than conventional immobilized target panning when using whole viral particles of cymbidium mosaic virus as a target. Enzyme-linked immunosorbent assay of cymbidium mosaic virus-binding peptides isolated from the library identified seven peptides with affinity for cymbidium mosaic virus and one peptide which was specific to cymbidium mosaic virus and had no significant binding to odontoglossum ringspot virus. This method should have broad application for the screening of whole viral particles towards the rapid development of diagnostic reagents without the requirement for cloning and expression of single antigens.

Effect of etodolac on methotrexate pharmacokinetics in patients with rheumatoid arthritis.

PubMed

Anaya, J M; Fabre, D; Bressolle, F; Bologna, C; Alric, R; Cocciglio, M; Dropsy, R; Sany, J

1994-02-01

To determine if the pharmacokinetics of methotrexate (MTX) is modified by the coadministration of etodolac. MTX (10 mg) was administered intramuscularly in the absence and presence of steady state levels of etodolac in 19 patients with rheumatoid arthritis. MTX levels were assayed by fluorescence polarization immunoassay. Concentrations of 7-hydroxymethotrexate (7-OH-MTX) were assayed by a reverse phase high performance liquid chromatography method. The unbound fraction was determined by ultrafiltration. When etodolac was coadministered with MTX, the highest observed concentration decreased and the mean residence time increased to become statistically significant. However, these differences are not of great clinical importance especially given that the area under the curve and clearances were unchanged. There were no significant differences in binding protein and 7-OH-MTX concentrations between MTX with and without etodolac administration. The pharmacokinetics of MTX is slightly modified by coadministration of etodolac. Moreover, no clinical toxicity was observed.

In vitro evidence for the participation of Drosophila melanogaster sperm β-N-acetylglucosaminidases in the interactions with glycans carrying terminal N-acetylglucosamine residues on the egg's envelopes.

PubMed

Intra, Jari; Veltri, Concetta; De Caro, Daniela; Perotti, Maria Elisa; Pasini, Maria Enrica

2017-09-01

Fertilization is a complex and multiphasic process, consisting of several steps, where egg-coating envelope's glycoproteins and sperm surface receptors play a critical role. Sperm-associated β-N-acetylglucosaminidases, also known as hexosaminidases, have been identified in a variety of organisms. Previously, two isoforms of hexosaminidases, named here DmHEXA and DmHEXB, were found as intrinsic proteins in the sperm plasma membrane of Drosophila melanogaster. In the present work, we carried out different approaches using solid-phase assays in order to analyze the oligosaccharide recognition ability of D. melanogaster sperm hexosaminidases to interact with well-defined carbohydrate chains that might functionally mimic egg glycoconjugates. Our results showed that Drosophila hexosaminidases prefer glycans carrying terminal β-N-acetylglucosamine, but not core β-N-acetylglucosamine residues. The capacity of sperm β-N-acetylhexosaminidases to bind micropylar chorion and vitelline envelope was examined in vitro assays. Binding was completely blocked when β-N-acetylhexosaminidases were preincubated with the glycoproteins ovalbumin and transferrin, and the monosaccharide β-N-acetylglucosamine. Overall, these data support the hypothesis of the potential role of these glycosidases in sperm-egg interactions in Drosophila. © 2017 Wiley Periodicals, Inc.

New approaches for the reliable in vitro assessment of binding affinity based on high-resolution real-time data acquisition of radioligand-receptor binding kinetics.

PubMed

Zeilinger, Markus; Pichler, Florian; Nics, Lukas; Wadsak, Wolfgang; Spreitzer, Helmut; Hacker, Marcus; Mitterhauser, Markus

2017-12-01

Resolving the kinetic mechanisms of biomolecular interactions have become increasingly important in early-phase drug development. Since traditional in vitro methods belong to dose-dependent assessments, binding kinetics is usually overlooked. The present study aimed at the establishment of two novel experimental approaches for the assessment of binding affinity of both, radiolabelled and non-labelled compounds targeting the A 3 R, based on high-resolution real-time data acquisition of radioligand-receptor binding kinetics. A novel time-resolved competition assay was developed and applied to determine the K i of eight different A 3 R antagonists, using CHO-K1 cells stably expressing the hA 3 R. In addition, a new kinetic real-time cell-binding approach was established to quantify the rate constants k on and k off , as well as the dedicated K d of the A 3 R agonist [ 125 I]-AB-MECA. Furthermore, lipophilicity measurements were conducted to control influences due to physicochemical properties of the used compounds. Two novel real-time cell-binding approaches were successfully developed and established. Both experimental procedures were found to visualize the kinetic binding characteristics with high spatial and temporal resolution, resulting in reliable affinity values, which are in good agreement with values previously reported with traditional methods. Taking into account the lipophilicity of the A 3 R antagonists, no influences on the experimental performance and the resulting affinity were investigated. Both kinetic binding approaches comprise tracer administration and subsequent binding to living cells, expressing the dedicated target protein. Therefore, the experiments resemble better the true in vivo physiological conditions and provide important markers of cellular feedback and biological response.

Competitive Binding Assay for the G-Protein-Coupled Receptor 30 (GPR30) or G-Protein-Coupled Estrogen Receptor (GPER).

PubMed

Thekkumkara, Thomas; Snyder, Russell; Karamyan, Vardan T

2016-01-01

The role of 2-methoxyestradiol is becoming a major area of investigation because of its therapeutic utility, though its mechanism is not fully explored. Recent studies have identified the G-protein-coupled receptor 30 (GPR30, GPER) as a high-affinity membrane receptor for 2-methoxyestradiol. However, studies aimed at establishing the binding affinities of steroid compounds for specific targets are difficult, as the tracers are highly lipophilic and often result in nonspecific binding in lipid-rich membrane preparations with low-level target receptor expression. 2-Methoxyestradiol binding studies are essential to elucidate the underlying effects of this novel estrogen metabolite and to validate its targets; therefore, this competitive receptor-binding assay protocol was developed in order to assess the membrane receptor binding and affinity of 2-methyoxyestradiol.

FRET-based binding assay between a fluorescent cAMP analogue and a cyclic nucleotide-binding domain tagged with a CFP.

PubMed

Romero, Francisco; Santana-Calvo, Carmen; Sánchez-Guevara, Yoloxochitl; Nishigaki, Takuya

2017-09-01

The cyclic nucleotide-binding domain (CNBD) functions as a regulatory domain of many proteins involved in cyclic nucleotide signalling. We developed a straightforward and reliable binding assay based on intermolecular fluorescence resonance energy transfer (FRET) between an adenosine-3', 5'-cyclic monophosphate analogue labelled with fluorescein and a recombinant CNBD of human EPAC1 tagged with a cyan fluorescence protein (CFP). The high FRET efficiency of this method (~ 80%) allowed us to perform several types of binding experiments with nanomolar range of sample using conventional equipment. In addition, the CFP tag on the CNBD enabled us to perform a specific binding experiment using an unpurified protein. Considering these advantages, this technique is useful to study poorly characterized CNBDs. © 2017 Federation of European Biochemical Societies.

Bead mediated separation of microparticles in droplets.

PubMed

Wang, Sida; Sung, Ki-Joo; Lin, Xiaoxia Nina; Burns, Mark A

2017-01-01

Exchange of components such as particles and cells in droplets is important and highly desired in droplet microfluidic assays, and many current technologies use electrical or magnetic fields to accomplish this process. Bead-based microfluidic techniques offer an alternative approach that uses the bead's solid surface to immobilize targets like particles or biological material. In this paper, we demonstrate a bead-based technique for exchanging droplet content by separating fluorescent microparticles in a microfluidic device. The device uses posts to filter surface-functionalized beads from a droplet and re-capture the filtered beads in a new droplet. With post spacing of 7 μm, beads above 10 μm had 100% capture efficiency. We demonstrate the efficacy of this system using targeted particles that bind onto the functionalized beads and are, therefore, transferred from one solution to another in the device. Binding capacity tests performed in the bulk phase showed an average binding capacity of 5 particles to each bead. The microfluidic device successfully separated the targeted particles from the non-targeted particles with up to 98% purity and 100% yield.

Bead mediated separation of microparticles in droplets

PubMed Central

Sung, Ki-Joo; Lin, Xiaoxia Nina; Burns, Mark A.

2017-01-01

Exchange of components such as particles and cells in droplets is important and highly desired in droplet microfluidic assays, and many current technologies use electrical or magnetic fields to accomplish this process. Bead-based microfluidic techniques offer an alternative approach that uses the bead’s solid surface to immobilize targets like particles or biological material. In this paper, we demonstrate a bead-based technique for exchanging droplet content by separating fluorescent microparticles in a microfluidic device. The device uses posts to filter surface-functionalized beads from a droplet and re-capture the filtered beads in a new droplet. With post spacing of 7 μm, beads above 10 μm had 100% capture efficiency. We demonstrate the efficacy of this system using targeted particles that bind onto the functionalized beads and are, therefore, transferred from one solution to another in the device. Binding capacity tests performed in the bulk phase showed an average binding capacity of 5 particles to each bead. The microfluidic device successfully separated the targeted particles from the non-targeted particles with up to 98% purity and 100% yield. PMID:28282412

B7H6-derived peptides trigger TNF-α-dependent immunostimulatory activity of lymphocytic NK92-MI cells.

PubMed

Phillips, Mariana; Romeo, Francesca; Bitsaktsis, Constantine; Sabatino, David

2016-09-01

The rise of biologics that can stimulate immune responses towards the eradication of tumors has led to the evolution of cancer-based immunotherapy. Representatively, B7H6 has been recently identified as a protein ligand on tumor cells that binds specifically to the NKp30 receptor and triggers NK cell-derived cytokine production, which ultimately leads to tumor cell lysis and death. In an effort to develop effective immunotherapy approaches, the rational design of a novel class of immunostimulatory peptides (IPs) derived from the binding interface of B7H6:NKp30 is described in this study. The IPs comprised the B7H6 active site sequence for NKp30 binding and immunostimulatory activity. An aminohexanoic acid linker was also introduced at the N-terminus of the peptides for FITC-labeling by Fmoc-solid phase peptide synthesis. The peptides were characterized by LCMS to confirm identities and purities >95%. The secondary structures of the peptides were examined by CD spectroscopy in H2 O, PBS and a H2 O:TFE mixture which demonstrated versatile peptide structures which transitioned from random coil (H2 O) to α-helical (PBS) and turn-type (H2 O:TFE) conformations. Their biological properties were then evaluated by flow cytometry, enzyme-linked immunosorbent assays (ELISAs), and cell death assays. The occupancy of the synthetic peptides to a human NK cell line demonstrated comparable binding relative to the natural NKp30 ligand, B7H6, and the human anti-NKp30 monoclonal antibody (mAb), in a concentration dependent manner. A competitive binding assay between the human anti-NKp30 mAb or B7H6, and the synthetic peptides, demonstrated partial displacement of the ligands upon anti-NKp30 mAb treatment, suggesting NKp30 receptor specificities by the synthetic peptides. Moreover, the immunostimulatory activity of B7H6 was demonstrated by the secretion of the pro-inflammatory cytokines tumor necrosis factor-alfa (TNF-α) and interferon gamma (IFN-γ) by the human NK cell line. The immunostimulatory effects of IPs on the NK cells was assessed by the production of TNF-α alone as IFN-γ was undetectable. In a cell death assay, the IPs were found to be nontoxic, without any observable evidence of early or late stage apoptosis within the NK92-MI cells. Taking these findings together, this novel class of synthetic peptides may prove to be a promising lead in the development of a peptide-based immunotherapy approach, especially against B7H6 expressing tumors. © 2016 Wiley Periodicals, Inc. Biopolymers (Pept Sci) 106: 658-672, 2016. © 2016 Wiley Periodicals, Inc.

Peptide arrays on cellulose support: SPOT synthesis, a time and cost efficient method for synthesis of large numbers of peptides in a parallel and addressable fashion.

PubMed

Hilpert, Kai; Winkler, Dirk F H; Hancock, Robert E W

2007-01-01

Peptide synthesis on cellulose using SPOT technology allows the parallel synthesis of large numbers of addressable peptides in small amounts. In addition, the cost per peptide is less than 1% of peptides synthesized conventionally on resin. The SPOT method follows standard fluorenyl-methoxy-carbonyl chemistry on conventional cellulose sheets, and can utilize more than 600 different building blocks. The procedure involves three phases: preparation of the cellulose membrane, stepwise coupling of the amino acids and cleavage of the side-chain protection groups. If necessary, peptides can be cleaved from the membrane for assays performed using soluble peptides. These features make this method an excellent tool for screening large numbers of peptides for many different purposes. Potential applications range from simple binding assays, to more sophisticated enzyme assays and studies with living microbes or cells. The time required to complete the protocol depends on the number and length of the peptides. For example, 400 9-mer peptides can be synthesized within 6 days.

A solid-phase combinatorial approach for indoloquinolizidine-peptides with high affinity at D(1) and D(2) dopamine receptors.

PubMed

Molero, Anabel; Vendrell, Marc; Bonaventura, Jordi; Zachmann, Julian; López, Laura; Pardo, Leonardo; Lluis, Carme; Cortés, Antoni; Albericio, Fernando; Casadó, Vicent; Royo, Miriam

2015-06-05

Ligands acting at multiple dopamine receptors hold potential as therapeutic agents for a number of neurodegenerative disorders. Specifically, compounds able to bind at D1R and D2R with high affinity could restore the effects of dopamine depletion and enhance motor activation on degenerated nigrostriatal dopaminergic systems. We have directed our research towards the synthesis and characterisation of heterocycle-peptide hybrids based on the indolo[2,3-a]quinolizidine core. This privileged structure is a water-soluble and synthetically accessible scaffold with affinity for diverse GPCRs. Herein we have prepared a solid-phase combinatorial library of 80 indoloquinolizidine-peptides to identify compounds with enhanced binding affinity at D2R, a receptor that is crucial to re-establish activity on dopamine-depleted degenerated GABAergic neurons. We applied computational tools and high-throughput screening assays to identify 9a{1,3,3} as a ligand for dopamine receptors with nanomolar affinity and agonist activity at D2R. Our results validate the application of indoloquinolizidine-peptide combinatorial libraries to fine-tune the pharmacological profiles of multiple ligands at D1 and D2 dopamine receptors. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

A cooperative-binding split aptamer assay for rapid, specific and ultra-sensitive fluorescence detection of cocaine in saliva.

PubMed

Yu, Haixiang; Canoura, Juan; Guntupalli, Bhargav; Lou, Xinhui; Xiao, Yi

2017-01-01

Sensors employing split aptamers that reassemble in the presence of a target can achieve excellent specificity, but the accompanying reduction of target affinity mitigates any overall gains in sensitivity. We for the first time have developed a split aptamer that achieves enhanced target-binding affinity through cooperative binding. We have generated a split cocaine-binding aptamer that incorporates two binding domains, such that target binding at one domain greatly increases the affinity of the second domain. We experimentally demonstrate that the resulting cooperative-binding split aptamer (CBSA) exhibits higher target binding affinity and is far more responsive in terms of target-induced aptamer assembly compared to the single-domain parent split aptamer (PSA) from which it was derived. We further confirm that the target-binding affinity of our CBSA can be affected by the cooperativity of its binding domains and the intrinsic affinity of its PSA. To the best of our knowledge, CBSA-5335 has the highest cocaine affinity of any split aptamer described to date. The CBSA-based assay also demonstrates excellent performance in target detection in complex samples. Using this CBSA, we achieved specific, ultra-sensitive, one-step fluorescence detection of cocaine within fifteen minutes at concentrations as low as 50 nM in 10% saliva without signal amplification. This limit of detection meets the standards recommended by the European Union's Driving under the Influence of Drugs, Alcohol and Medicines program. Our assay also demonstrates excellent reproducibility of results, confirming that this CBSA-platform represents a robust and sensitive means for cocaine detection in actual clinical samples.

An Undergraduate Laboratory Experiment that Utilizes a Glass Fiber Filter Assay to Determine the Steroid Specificity and Equilibrium Binding Properties of Glucocorticoid Receptors.

ERIC Educational Resources Information Center

John, Nancy J.; Firestone, Gary L.

1987-01-01

Describes two complementary laboratory exercises that use the glass fiber assay to assess receptor specificity and hormone binding affinity in rat liver cytoplasmic extracts. Details the methods, materials and protocol of the experiments. Discusses the basic concepts illustrated and the feasibility of using the experiments at the undergraduate…

Monoclonal Antibody Binding to a Surface-Exposed Epitope on Cowdria ruminantium That Is Conserved among Eight Strains

PubMed Central

Shompole, Sankale; Rurangirwa, Fred R.; Wambugu, Anderson; Sitienei, John; Mwangi, Duncan M.; Musoke, Anthony J.; Mahan, Suman; Wells, Clive W.; McGuire, Travis C.

2000-01-01

Monoclonal antibodies (MAb) binding to Cowdria ruminantium elementary bodies (EB) were identified by enzyme-linked immunosorbent assay, and surface binding of one MAb (446.15) to intact EB was determined by immunofluorescence, immunogold labeling, and transmission electron microscopy. MAb 446.15 bound an antigen of approximately 43 kDa in immunoblots of eight geographically distinct strains. The MAb did not react with Ehrlichia canis antigens or uninfected bovine endothelial cell lysate and may be useful in diagnostic assays and vaccine development. PMID:11063511

JAK2 JH2 Fluorescence Polarization Assay and Crystal Structures for Complexes with Three Small Molecules.

PubMed

Newton, Ana S; Deiana, Luca; Puleo, David E; Cisneros, José A; Cutrona, Kara J; Schlessinger, Joseph; Jorgensen, William L

2017-06-08

A competitive fluorescence polarization (FP) assay is reported for determining binding affinities of probe molecules with the pseudokinase JAK2 JH2 allosteric site. The syntheses of the fluorescent 5 and 6 used in the assay are reported as well as K d results for 10 compounds, including JNJ7706621, NVP-BSK805, and filgotinib (GLPG0634). X-ray crystal structures of JAK2 JH2 in complex with NVP-BSK805, filgotinib, and diaminopyrimidine 8 elucidate the binding poses.

JAK2 JH2 Fluorescence Polarization Assay and Crystal Structures for Complexes with Three Small Molecules

PubMed Central

2017-01-01

A competitive fluorescence polarization (FP) assay is reported for determining binding affinities of probe molecules with the pseudokinase JAK2 JH2 allosteric site. The syntheses of the fluorescent 5 and 6 used in the assay are reported as well as Kd results for 10 compounds, including JNJ7706621, NVP-BSK805, and filgotinib (GLPG0634). X-ray crystal structures of JAK2 JH2 in complex with NVP-BSK805, filgotinib, and diaminopyrimidine 8 elucidate the binding poses. PMID:28626520

Molecular mechanisms of lymphocyte extravasation. II. Studies of in vitro lymphocyte adherence to high endothelial venules.

PubMed

Braaten, B A; Spangrude, G J; Daynes, R A

1984-07-01

Lymphocyte migration from the blood into the lymph nodes in most species occurs across post-capillary high endothelial venules (HEV). In a previous study, we proposed that lymphocyte extravasation involves receptor-mediated binding followed by adenylate cyclase-dependent activation of lymphocyte motility. This hypothesis was, in part, based on observations of in vitro lymphocyte adherence to HEV by employing pertussigen, which is a known inhibitor of lymphocyte recirculation. In vitro lymphocyte-HEV binding requires a cold (6 degrees C) incubation step and binding is poor to nil if the assay is attempted at room (23 degrees C) or physiologic temperature. We decided to investigate why this assay is temperature restricted, because of the possibility that pertussigen or fucoidin -treated lymphocytes might interact with HEV differently at higher temperatures. We now report that O.C.T. compound (OCT), the embedding matrix generally used to cut frozen lymph node sections, is toxic to lymphocytes at temperatures above 6 degrees C. Exclusion of OCT from the assay system will allow lymphocyte-HEV binding to occur at 23 degrees C and to a lesser extent at 37 degrees C. With this modified protocol, lymphocytes treated with either pertussigen, fucoidin , or neuraminidase were tested for adherence to HEV at 23 degrees C. No essential difference in binding properties was observed from what had been reported at 6 degrees C. In contrast, trypsin-treated lymphocytes that did not bind to HEV with the standard technique at 6 degrees C did adhere to a minimal extent to HEV at 23 degrees C using the modified procedure. We also report some preliminary work, using the modified assay, on in vitro lymphocyte-HEV binding of rat, rabbit, and guinea pig lymphocytes to sections of lymph nodes from the respective species.

Characterization of Lactic Acid Bacteria as Poultry Probiotic Candidates with Aflatoxin B1 Binding Activities

NASA Astrophysics Data System (ADS)

Damayanti, E.; Istiqomah, L.; Saragih, J. E.; Purwoko, T.; Sardjono

2017-12-01

Our previous studies have selected lactic acid bacteria (LAB) with antifungal activities from traditional fermented foods made from cassava (G7) and silage feed palm leaf (PDS5 and PDS3). In this study we evaluated their ability to bind aflatoxin B1 (AFB1) and probiotic characteristic. The probiotic characteristic assays of LAB consisted of resistance to acidic conditions (pH 3), gastric juice and bile salts 0.3%. We also carried out an in vitro evaluation of LAB aflatoxin binding ability in viable and non-viable cell for 24 and 48 hours of incubation. The measurement of aflatoxin content was performed by ELISA method using AgraQuant Total Aflatoxin Assay kit. The results showed that all isolates were potential as probiotics and the G7 isolate had the highest viability among other isolates in pH 3 (92.61 %) and the bile salts assay (97.71 %). The percentage of aflatoxin reduction between viable and non-viable cell from each LAB isolate were different. The highest aflatoxin reduction in viable cell assay was performed by G7 isolate (69.11 %) whereas in non-viable cell assay was performed by PDS3 isolate (73.75 %) during incubation time 48 hours. In this study, G7 isolate performed the best probiotic characteristics with the highest viability in acid pH assay, bile salt 0.3% assay and percentage of aflatoxin B1 reduction in viable cell condition. Molecular identification using 16S rRNA sequence analysis showed that G7 isolate had homology with Lactobacillus plantarum (99.9%). It was concluded that Lactobacillus plantarum G7 was potential as probiotic with aflatoxin binding activities.

Flexible Label-Free Quantitative Assay for Antibodies to Influenza Virus Hemagglutinins ▿

PubMed Central

Carney, Paul J.; Lipatov, Aleksandr S.; Monto, Arnold S.; Donis, Ruben O.; Stevens, James

2010-01-01

During the initial pandemic influenza H1N1 virus outbreak, assays such as hemagglutination inhibition and microneutralization provided important information on the relative protection afforded by the population's cross-reactivity from prior infections and immunizations with seasonal vaccines. However, these assays continue to be limited in that they are difficult to automate for high throughput, such as in pandemic situations, as well as to standardize between labs. Thus, new technologies are being sought to improve standardization, reliability, and throughput by using chemically defined reagents rather than whole cells and virions. We now report the use of a cell-free and label-free flu antibody biosensor assay (f-AbBA) for influenza research and diagnostics that utilizes recombinant hemagglutinin (HA) in conjunction with label-free biolayer interferometry technology to measure biomolecular interactions between the HA and specific anti-HA antibodies or sialylated ligands. We evaluated f-AbBA to determine anti-HA antibody binding activity in serum or plasma to assess vaccine-induced humoral responses. This assay can reveal the impact of antigenic difference on antibody binding to HA and also measure binding to different subtypes of HA. We also show that the biosensor assay can measure the ability of HA to bind a model sialylated receptor-like ligand. f-AbBA could be used in global surveillance laboratories since preliminary tests on desiccated HA probes showed no loss of activity after >2 months in storage at room temperature, indicating that the same reagent lots could be used in different laboratories to minimize interlaboratory assay fluctuation. Future development of such reagents and similar technologies may offer a robust platform for future influenza surveillance activities. PMID:20660137

Coupling the Torpedo microplate-receptor binding assay with mass spectrometry to detect cyclic imine neurotoxins.

PubMed

Aráoz, Rómulo; Ramos, Suzanne; Pelissier, Franck; Guérineau, Vincent; Benoit, Evelyne; Vilariño, Natalia; Botana, Luis M; Zakarian, Armen; Molgó, Jordi

2012-12-04

Cyclic imine neurotoxins constitute an emergent family of neurotoxins of dinoflagellate origin that are potent antagonists of nicotinic acetylcholine receptors. We developed a target-directed functional method based on the mechanism of action of competitive agonists/antagonists of nicotinic acetylcholine receptors for the detection of marine cyclic imine neurotoxins. The key step for method development was the immobilization of Torpedo electrocyte membranes rich in nicotinic acetylcholine receptors on the surface of microplate wells and the use of biotinylated-α-bungarotoxin as tracer. Cyclic imine neurotoxins competitively inhibit biotinylated-α-bungarotoxin binding to Torpedo-nicotinic acetylcholine receptors in a concentration-dependent manner. The microplate-receptor binding assay allowed rapid detection of nanomolar concentrations of cyclic imine neurotoxins directly in shellfish samples. Although highly sensitive and specific for the detection of neurotoxins targeting nicotinic acetylcholine receptors as a class, the receptor binding assay cannot identify a given analyte. To address the low selectivity of the microplate-receptor binding assay, the cyclic imine neurotoxins tightly bound to the coated Torpedo nicotinic receptor were eluted with methanol, and the chemical nature of the eluted ligands was identified by mass spectrometry. The immobilization of Torpedo electrocyte membranes on the surface of microplate wells proved to be a high-throughput format for the survey of neurotoxins targeting nicotinic acetylcholine receptors directly in shellfish matrixes with high sensitivity and reproducibility.

Transcriptional regulation of human MUC4 gene: identification of a novel inhibitory element and its nuclear binding protein.

PubMed

Zhang, Jing-Jing; Zhu, Yi; Zhang, Xiong-Fei; Liang, Wen-Biao; Xie, Kun-Ling; Tao, Jin-Qiu; Peng, Yun-Peng; Xu, Ze-Kuan; Miao, Yi

2013-08-01

The human mucin 4 (MUC4) is aberrantly expressed in pancreatic adenocarcinoma and tumor cell lines, while remaining undetectable in normal pancreas, indicating its important role in pancreatic cancer development. Although its transcriptional regulation has been investigated in considerable detail, some important elements remain unknown. The aim of the present study was to demonstrate the existence of a novel inhibitory element in the MUC4 promoter and characterize some of its binding proteins. By luciferase reporter assay, we located the inhibitory element between nucleotides -2530 and -2521 in the MUC4 promoter using a series of deletion and mutant reporter constructs. Electrophoretic mobility shift assay (EMSA) with Bxpc-3 cell nuclear extracts revealed that one protein or protein complex bind to this element. The proteins binding to this element were purified and identified as Yin Yang 1 (YY1) by mass spectrometry. Supershift assay and chromatin immunoprecipitation (ChIP) assay confirmed that YY1 binds to this element in vitro and in vivo. Moreover, transient YY1 overexpression significantly inhibited MUC4 promoter activity and endogenous MUC4 protein expression. In conclusion, we reported here a novel inhibitory element in the human MUC4 promoter. This provides additional data on MUC4 gene regulation and indicates that YY1 may be a potential target for abnormal MUC4 expression.

Coupling the Torpedo Microplate-Receptor Binding Assay with Mass Spectrometry to Detect Cyclic Imine Neurotoxins

PubMed Central

Aráoz, Rómulo; Ramos, Suzanne; Pelissier, Franck; Guérineau, Vincent; Benoit, Evelyne; Vilariño, Natalia; Botana, Luis M.; Zakarian, Armen; Molgó, Jordi

2014-01-01

Cyclic imine neurotoxins constitute an emergent family of neurotoxins of dinoflagellate origin that are potent antagonists of nicotinic acetylcholine receptors. We developed a target-directed functional method based on the mechanism of action of competitive agonists/antagonists of nicotinic acetylcholine receptors for the detection of marine cyclic imine neurotoxins. The key step for method development was the immobilization of Torpedo electrocyte membranes rich in nicotinic acetylcholine receptors on the surface of microplate wells and the use of biotinylated-α-bungarotoxin as tracer. Cyclic imine neurotoxins competitively inhibit biotinylated-α-bungarotoxin binding to Torpedo-nicotinic acetylcholine receptors in a concentration-dependent manner. The microplate-receptor binding assay allowed rapid detection of nanomolar concentrations of cyclic imine neurotoxins directly in shellfish samples. Although highly sensitive and specific for the detection of neurotoxins targeting nicotinic acetylcholine receptors as a class, the receptor binding assay cannot identify a given analyte. To address the low selectivity of the microplate-receptor binding assay, the cyclic imine neurotoxins tightly bound to the coated Torpedo nicotinic receptor were eluted with methanol, and the chemical nature of the eluted ligands was identified by mass spectrometry. The immobilization of Torpedo electrocyte membranes on the surface of microplate wells proved to be a high-throughput format for the survey of neurotoxins targeting nicotinic acetylcholine receptors directly in shellfish matrixes with high sensitivity and reproducibility. PMID:23131021

Domain-based assays of individual antibody concentrations in an oligoclonal combination targeting a single protein.

PubMed

Meng, Q; Li, M; Silberg, M A; Conrad, F; Bettencourt, J; To, R; Huang, C; Ma, J; Meyer, K; Shimizu, R; Cao, L; Tomic, M T; Marks, J D

2012-02-15

Quantitation of individual monoclonal antibodies (mAbs) within a combined antibody drug product is required for preclinical and clinical drug development, including pharmacokinetic (PK), toxicology, stability, and biochemical characterization studies of such drugs. We have developed an antitoxin, XOMA 3AB, consisting of three recombinant mAbs that potently neutralize the known subtypes of type A botulinum neurotoxin (BoNT/A). The three mAbs bind nonoverlapping BoNT/A epitopes with high affinity. XOMA 3AB is being developed as a treatment for botulism resulting from BoNT/A. To develop antibody-specific assays, we cloned, expressed, and purified BoNT/A domains from Escherichia coli. Each mAb bound only to its specific domain with affinity comparable to the binding to holotoxin. mAb-specific domains were used to develop an enzyme-linked immunosorbent assay (ELISA) for characterization of the integrity and binding activity of the three mAbs in the drug product. An electrochemiluminescence bridging assay that is robust to interference from components in serum was also developed, and we demonstrate that it can be used for PK assays. This type of antigen engineering to generate mAb-specific domains is a general method allowing quantitation and characterization of individual mAbs in a mAb cocktail that binds the same protein and is superior to anti-idiotype approaches. Copyright © 2011 Elsevier Inc. All rights reserved.

miR-21 modulates resistance of HR-HPV positive cervical cancer cells to radiation through targeting LATS1.

PubMed

Liu, Shikai; Song, Lili; Zhang, Liang; Zeng, Saitian; Gao, Fangyuan

2015-04-17

Although multiple miRNAs are found involved in radioresistance development in HR-HPV positive (+) cervical cancer, only limited studies explored the regulative mechanism of the miRNAs. miR-21 is one of the miRNAs significantly upregulated in HR-HPV (+) cervical cancer is also significantly associated with radioresistance. However, the detailed regulative network of miR-21 in radioresistance is still not clear. In this study, we confirmed that miR-21 overexpression was associated with higher level of radioresistance in HR-HPV (+) cervical cancer patients and thus decided to further explore its role. Findings of this study found miR-21 can negatively affect radiosensitivity of HR-HPV (+) cervical cancer cells and decrease radiation induced G2/M block and increase S phase accumulation. By using dual luciferase assay, we verified a binding site between miR-21 and 3'-UTR of large tumor suppressor kinase 1 (LATS1). Through direct binding, miR-21 can regulate LATS1 expression in cervical cancer cells. LATS1 overexpression can reverse miR-21 induced higher colony formation rate and also reduced miR-21 induced S phase accumulation and G2/M phase block reduction under radiation treatment. These results suggested that miR-21-LATS1 axis plays an important role in regulating radiosensitivity. Copyright © 2015 Elsevier Inc. All rights reserved.

Detoxification of ivermectin by ATP binding cassette transporter C4 and cytochrome P450 monooxygenase 6CJ1 in the human body louse, Pediculus humanus humanus.

PubMed

Kim, J H; Gellatly, K J; Lueke, B; Kohler, M; Nauen, R; Murenzi, E; Yoon, K S; Clark, J M

2018-02-01

We previously observed that ivermectin-induced detoxification genes, including ATP binding cassette transporter C4 (PhABCC4) and cytochrome P450 6CJ1 (CYP6CJ1) were identified from body lice following a brief exposure to a sublethal dose of ivermectin using a non-invasive induction assay. In this current study, the functional properties of PhABCC4 and CYP6CJ1 were investigated after expression in either X. laevis oocytes or using a baculovirus expression system, respectively. Efflux of [ 3 H]-9-(2-phosphonomethoxyethyl) adenine ([ 3 H]-PMEA), a known ABCC4 substrate in humans, was detected from PhABCC4 cRNA-injected oocytes by liquid scintillation spectrophotometric analysis and PhABCC4 expression in oocytes was confirmed using ABC transporter inhibitors. Efflux was also determined to be ATP-dependent. Using a variety of insecticides in a competition assay, only co-injection of ivermectin and dichlorodiphenyltrichloroethane led to decreased efflux of [ 3 H]-PMEA. PhABCC4-expressing oocytes also directly effluxed [ 3 H]-ivermectin, which increased over time. In addition, ivermectin appeared to be oxidatively metabolized and/or sequestered, although at low levels, following functional expression of CYP6CJ1 along with cytochrome P450 reductase in Sf9 cells. Our study suggests that PhABCC4 and perhaps CYP6CJ1 are involved in the Phase III and Phase I xenobiotic metabolism of ivermectin, respectively, and may play an important role in the evolution of ivermectin resistance in lice and other insects as field selection occurs. © 2017 The Royal Entomological Society.

Identification and Characterization of a High-Affinity Choline Uptake System of Brucella abortus

PubMed Central

Herrmann, Claudia K.; Bukata, Lucas; Melli, Luciano; Marchesini, M. Ines; Caramelo, Julio J.

2013-01-01

Phosphatidylcholine (PC), a common phospholipid of the eukaryotic cell membrane, is present in the cell envelope of the intracellular pathogen Brucella abortus, the etiological agent of bovine brucellosis. In this pathogen, the biosynthesis of PC proceeds mainly through the phosphatidylcholine synthase pathway; hence, it relies on the presence of choline in the milieu. These observations imply that B. abortus encodes an as-yet-unknown choline uptake system. Taking advantage of the requirement of choline uptake for PC synthesis, we devised a method that allowed us to identify a homologue of ChoX, the high-affinity periplasmic binding protein of the ABC transporter ChoXWV. Disruption of the choX gene completely abrogated PC synthesis at low choline concentrations in the medium, thus indicating that it is a high-affinity transporter needed for PC synthesis via the PC synthase (PCS) pathway. However, the synthesis of PC was restored when the mutant was incubated in media with higher choline concentrations, suggesting the presence of an alternative low-affinity choline uptake activity. By means of a fluorescence-based equilibrium-binding assay and using the kinetics of radiolabeled choline uptake, we show that ChoX binds choline with an extremely high affinity, and we also demonstrate that its activity is inhibited by increasing choline concentrations. Cell infection assays indicate that ChoX activity is required during the first phase of B. abortus intracellular traffic, suggesting that choline concentrations in the early and intermediate Brucella-containing vacuoles are limited. Altogether, these results suggest that choline transport and PC synthesis are strictly regulated in B. abortus. PMID:23161032

Multiple Length Peptide-Pheromone Variants Produced by Streptococcus pyogenes Directly Bind Rgg Proteins to Confer Transcriptional Regulation*

PubMed Central

Aggarwal, Chaitanya; Jimenez, Juan Cristobal; Nanavati, Dhaval; Federle, Michael J.

2014-01-01

Streptococcus pyogenes, a human-restricted pathogen, accounts for substantial mortality related to infections worldwide. Recent studies indicate that streptococci produce and respond to several secreted peptide signaling molecules (pheromones), including those known as short hydrophobic peptides (SHPs), to regulate gene expression by a quorum-sensing mechanism. Upon transport into the bacterial cell, pheromones bind to and modulate activity of receptor proteins belonging to the Rgg family of transcription factors. Previously, we reported biofilm regulation by the Rgg2/3 quorum-sensing circuit in S. pyogenes. The aim of this study was to identify the composition of mature pheromones from cell-free culture supernatants that facilitate biofilm formation. Bioluminescent reporters were employed to detect active pheromones in culture supernatants fractionated by reverse-phase chromatography, and mass spectrometry was used to characterize their properties. Surprisingly, multiple SHPs that varied by length were detected. Synthetic peptides of each variant were tested individually using bioluminescence reporters and biofilm growth assays, and although activities differed widely among the group, peptides comprising the C-terminal eight amino acids of the full-length native peptide were most active. Direct Rgg/SHP interactions were determined using a fluorescence polarization assay that utilized FITC-labeled peptide ligands. Peptide receptor affinities were seen to be as low as 500 nm and their binding affinities directly correlated with observed bioactivity. Revelation of naturally produced pheromones along with determination of their affinity for cognate receptors are important steps forward in designing compounds whose purpose is positioned for future therapeutics aimed at treating infections through the interference of bacterial communication. PMID:24958729

Different Roles of GRP78 on Cell Proliferation and Apoptosis in Cartilage Development.

PubMed

Xiong, Zhangyuan; Jiang, Rong; Li, Xiangzhu; Liu, Yanna; Guo, Fengjin

2015-09-07

Eukaryotic cells possess several mechanisms to adapt to endoplasmic reticulum (ER) stress and thereby survive. ER stress activates a set of signaling pathways collectively termed as the unfolded protein response (UPR). We previously reported that Bone morphogenetic protein 2 (BMP2) mediates mild ER stress and activates UPR signal molecules in chondrogenesis. The mammalian UPR protects the cell against the stress of misfolded proteins in the endoplasmic reticulum. Failure to adapt to ER stress causes the UPR to trigger apoptosis. Glucose regulated protein 78 (GRP78), as an important molecular chaperone in UPR signaling pathways, is responsible for binding to misfolded or unfolded protein during ER stress. However the influence on GRP78 in BMP2-induced chondrocyte differentiation has not yet been elucidated and the molecular mechanism underlyng these processes remain unexplored. Herein we demonstrate that overexpression of GRP78 enhanced cell proliferation in chondrocyte development with G1 phase advance, S phase increasing and G2-M phase transition. Furthermore, overexpression of GRP78 inhibited ER stress-mediated apoptosis and then reduced apoptosis in chondrogenesis induced by BMP2, as assayed by cleaved caspase3, caspase12, C/EBP homologous protein (CHOP/DDIT3/GADD153), p-JNK (phosphorylated c-Jun N-terminal kinase) expression during the course of chondrocyte differentiation by Western blot. In addition, flow cytometry (FCM) assay, terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate-biotin nick end-labeling (TUNEL) assay and immune-histochemistry analysis also proved this result in vitro and in vivo. It was demonstrated that GRP78 knockdown via siRNA activated the ER stress-specific caspase cascade in developing chondrocyte tissue. Collectively, these findings reveal a novel critical role of GRP78 in regulating ER stress-mediated apoptosis in cartilage development and the molecular mechanisms involved.

Antiviral and Anticancer Optimization Studies of the DNA-binding Marine Natural Product Aaptamine

PubMed Central

Bowling, John J.; Pennaka, Hari K.; Ivey, Kelly; Wahyuono, Subagus; Kelly, Michelle; Schinazi, Raymond F.; Valeriote, Frederick A.; Graves, David E.; Hamann, Mark T.

2016-01-01

Aaptamine has potent cytotoxicity that may be explained by its ability to intercalate DNA. Aaptamine was evaluated for its ability to bind to DNA to validate DNA binding as the primary mechanism of cytotoxicity. Based on UV–vis absorbance titration data, the Kobs for aaptamine was 4.0 (±0.2) × 103 which was essentially equivalent to the known DNA intercalator N-[2-(diethylamino)ethyl]-9-aminoacridine-4-carboxamide. Semi-synthetic core modifications were performed to improve the general structural diversity of known aaptamine analogs and vary its absorption characteristics. Overall, 26 aaptamine derivatives were synthesized which consisted of a simple homologous range of mono and di-N-alkylations as well as some 9-O-sulfonylation and bis-O-isoaaptamine dimer products. Each product was evaluated for activity in a variety of whole cell and viral assays including a unique solid tumor disk diffusion assay. Details of aaptamine's DNA-binding activity and its derivatives’ whole cell and viral assay results are discussed. PMID:18251774

Dye-binding protein assay using a long-wave-absorbing cyanine probe.

PubMed

Zheng, Hong; Mao, Yu Xia; Li, Dong Hui; Zhu, Chang Qing

2003-07-01

A simple and fast protein assay that involves the binding of water-soluble sulfonate heptamethylene cyanine to protein is described. The binding of the dye to protein causes a shift in the absorption maximum of the dye from 778 to 904 nm, and the increase in absorption at 904 nm is monitored. This assay is very reproducible, of good color stability for at least 80 min, and sensitive at the 100 ng/mL level of human serum albumin (HSA) when a spectrophotometer with near-infrared wavelength is used to measure absorbance. Few chemicals except ionic surfactants such as cetyltrimethylammonium bromide and sodium dodecyl sulfonate interfere with the assay. Purified proteins have different capacities to interact with the dye; under the experimental conditions, the linear ranges of bovine serum albumin (BSA), HSA and gamma-IgG were 200-2000, 100-2400, and 200-3000 ng/mL, respectively. The relative standard deviation for the five replicate determinations of 1200 ng/mL BSA is 2.1%.

Lipid-binding analysis using a fat blot assay.

PubMed

Munnik, Teun; Wierzchowiecka, Magdalena

2013-01-01

Protein-lipid interactions play an important role in lipid metabolism, membrane trafficking and cell -signaling by regulating protein localization, activation, and function. The Fat Blot assay is a relatively simple and inexpensive method to examine these interactions using nitrocellulose membrane-immobilized lipids. The assay is adapted from the method by Dowler et al. (Sci STKE 129:pl6, 2002) and provides qualitative and quantitative information on the relative affinity with which a protein binds to a particular lipid. To perform a Fat Blot assay, serial dilutions of different phospholipids are spotted onto a nitrocellulose membrane. These membranes are then incubated with a lipid-binding protein possessing a GST (or other epitope) tag. The membranes are washed and the protein, which is bound to the membrane by virtue of its interaction with the lipid's head group, is detected by immunoblotting with an antibody against GST (or other epitope). The procedure only requires a few micrograms of protein and is quick, simple and cheap to perform.

Beyond radio-displacement techniques for Identification of CB1 Ligands: The First Application of a Fluorescence-quenching Assay

PubMed Central

Bruno, Agostino; Lembo, Francesca; Novellino, Ettore; Stornaiuolo, Mariano; Marinelli, Luciana

2014-01-01

Cannabinoid type 1 Receptor (CB1) belongs to the GPCR family and it has been targeted, so far, for the discovery of drugs aimed at the treatment of neuropathic pain, nausea, vomit, and food intake disorders. Here, we present the development of the first fluorescent assay enabling the measurement of kinetic binding constants for CB1orthosteric ligands. The assay is based on the use of T1117, a fluorescent analogue of AM251. We prove that T1117 binds endogenous and recombinant CB1 receptors with nanomolar affinity. Moreover, T1117 binding to CB1 is sensitive to the allosteric ligand ORG27569 and thus it is applicable to the discovery of new allosteric drugs. The herein presented assay constitutes a sustainable valid alternative to the expensive and environmental impacting radiodisplacement techniques and paves the way for an easy, fast and cheap high-throughput drug screening toward CB1 for identification of new orthosteric and allosteric modulators. PMID:24441508

Advantages and application of label-free detection assays in drug screening.

PubMed

Cunningham, Brian T; Laing, Lance G

2008-08-01

Adoption is accelerating for a new family of label-free optical biosensors incorporated into standard format microplates owing to their ability to enable highly sensitive detection of small molecules, proteins and cells for high-throughput drug discovery applications. Label-free approaches are displacing other detection technologies owing to their ability to provide simple assay procedures for hit finding/validation, accessing difficult target classes, screening the interaction of cells with drugs and analyzing the affinity of small molecule inhibitors to target proteins. This review describes several new drug discovery applications that are under development for microplate-based photonic crystal optical biosensors and the key issues that will drive adoption of the technology. Microplate-based optical biosensors are enabling a variety of cell-based assays, inhibition assays, protein-protein binding assays and protein-small molecule binding assays to be performed with high-throughput and high sensitivity.

Non-Enzymatic Detection of Bacterial Genomic DNA Using the Bio-Barcode Assay

PubMed Central

Hill, Haley D.; Vega, Rafael A.; Mirkin, Chad A.

2011-01-01

The detection of bacterial genomic DNA through a non-enzymatic nanomaterials based amplification method, the bio-barcode assay, is reported. The assay utilizes oligonucleotide functionalized magnetic microparticles to capture the target of interest from the sample. A critical step in the new assay involves the use of blocking oligonucleotides during heat denaturation of the double stranded DNA. These blockers bind to specific regions of the target DNA upon cooling, and prevent the duplex DNA from re-hybridizing, which allows the particle probes to bind. Following target isolation using the magnetic particles, oligonucleotide functionalized gold nanoparticles act as target recognition agents. The oligonucleotides on the nanoparticle (barcodes) act as amplification surrogates. The barcodes are then detected using the Scanometric method. The limit of detection for this assay was determined to be 2.5 femtomolar, and this is the first demonstration of a barcode type assay for the detection of double stranded, genomic DNA. PMID:17927207

Real-time biochemical assay telemetering system

NASA Technical Reports Server (NTRS)

Kern, Roger G. (Inventor); Mintz, Frederick W. (Inventor); Richards, Gil F. (Inventor); Kidwell, David A. (Inventor)

1999-01-01

The present invention is an apparatus and a method of detecting a chemical released by perspiration, typically through sweat and broadcasting the detection to a receiver. The chemical may be a drug of abuse. The device which is attached to the skin of a subject contains labeled antibodies or label containing microspheres attached to antibodies. The labeled antibodies are bound to solid phase drug via antigen-antibody interaction. These labeled antibodies are displaced from the solid phase support to which they are bound by free drug molecules in the perspiration. These labeled antibodies then migrate through a spacer layer and are trapped by a layer containing a suitable selective binding material. The label is illuminated or excited by a light source and detected by a photodetector. The signal can be recorded, or transmitted to a remote radio monitor.

Stimulation of iodine organification in porcine thyroid cells by thyroid stimulators.

PubMed

Ginsberg, J; Shewring, G; Howells, R; Smith, B R; Hall, R

Several Graves' sera were simultaneously assessed in a bioassay based on the ability of porcine thyroid cells to organify 125I and in a radioreceptor assay for TSH receptor binding activity. Both assay systems were sensitive to 1 mcU/ml (final concentration) of unlabelled bovine TSH. Six Graves' sera were studied in detail over a wide (0-1.0 mcl sera) dose response range in repeat determinations. Two sera exhibited parallel binding and stimulating. However, two sera revealed significant inhibition of 125I-TSH binding prior to the demonstration of stimulation and the other two sera showed stimulatory capabilities before significant binding was evident. IgG was prepared from one serum by ammonium sulphate precipitation and chromatography on Sepharose 6B and then subjected to preparative isoelectric focusing. The isoelectric distribution of the two activities were found to be identical with major peaks of activity at pl=9.5 and pl=8.5. In summary: 1) each Graves' sera exhibits different dose-response curves with respect to binding and stimulation, 2) at certain concentrations of sera, only binding or stimulation were evident, 3) neither assay was consistently more sensitive for the presence of Graves' immunoglobulins, 4) for one Graves' sera, binding and stimulation could not be separated by isoelectric focusing. These studies would suggest each Graves' immunoglobulin has inherently different characteristics in its interaction with the TSH receptor.

Binding of (/sup 3/H)Forskolin to rat brain membranes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Seamon, K.B.; Vaillancourt, R.; Edwards, M.

1984-08-01

(12-/sup 3/H)Forskolin (27 Ci/mmol) has been used to study binding sites in rat brain tissue by using both centrifugation and filtration assays. The binding isotherm measured in the presence of 5 mM MgCl/sub 2/ by using the centrifugation assay is described best by a two-site model: K/sub d1/ = 15 nM, B/sub max/sub 1// (maximal binding) = 270 fmol/mg of protein; K/sub d2/ = 1.1 ..mu..M; B/sub max/sub 2// = 4.2 pmol/mg of protein. Only the high-affinity binding sites are detected when the binding is determined by using a filtration assay; K/sub d/ = 26 nM, B/sub max/ = 400more » fmol/mg of protein. Analogs of forskolin that do not activate adenylate cyclase (EC 4.6.1.1) do not compete effectively for (/sup 3/H)forskolin binding sites. Analogs of forskolin that are less potent than forskolin in activating adenylate cyclase are also less potent in competing for forskolin binding sites. The presence of 5 mM MgCl/sub 2/ or MnCl/sub 2/ was found to enhance binding. In the presence of 1 mM EDTA the amount of high-affinity binding is reduced to 110 fmol/mg of protein with no change in K/sub d/. There is no effect of CaCl/sub 2/ (20 mM) or NaCl (100 mM) on the binding. No high-affinity binding can be detected in membranes from ram sperm, which contains an adenylate cyclase that is not activated by forskolin. It is proposed that the high-affinity binding sites for forskolin are associated with the activated complex of catalytic subunit and stimulatory guanine nucleotide binding protein. 23 references, 5 figures, 2 tables.« less

The RNA-Binding Site of Poliovirus 3C Protein Doubles as a Phosphoinositide-Binding Domain.

PubMed

Shengjuler, Djoshkun; Chan, Yan Mei; Sun, Simou; Moustafa, Ibrahim M; Li, Zhen-Lu; Gohara, David W; Buck, Matthias; Cremer, Paul S; Boehr, David D; Cameron, Craig E

2017-12-05

Some viruses use phosphatidylinositol phosphate (PIP) to mark membranes used for genome replication or virion assembly. PIP-binding motifs of cellular proteins do not exist in viral proteins. Molecular-docking simulations revealed a putative site of PIP binding to poliovirus (PV) 3C protein that was validated using nuclear magnetic resonance spectroscopy. The PIP-binding site was located on a highly dynamic α helix, which also functions in RNA binding. Broad PIP-binding activity was observed in solution using a fluorescence polarization assay or in the context of a lipid bilayer using an on-chip, fluorescence assay. All-atom molecular dynamics simulations of the 3C protein-membrane interface revealed PIP clustering and perhaps PIP-dependent conformations. PIP clustering was mediated by interaction with residues that interact with the RNA phosphodiester backbone. We conclude that 3C binding to membranes will be determined by PIP abundance. We suggest that the duality of function observed for 3C may extend to RNA-binding proteins of other viruses. Copyright © 2017 Elsevier Ltd. All rights reserved.

Alkylating derivative of oxotremorine interacts irreversibly with the muscarinic receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ehlert, F.J.; Jenden, D.J.; Ringdahl, B.

A 2-chloroethylamine derivative of oxotremorine was studied in pharmacological experiments and muscarinic receptor binding assays. The compound, N-(4-(2-chloroethylmethylamino)-2-butynyl)-2-pyrrolidone (BM 123), forms an aziridinium ion in aqueous solution at neutral pH that stimulates contractions of guinea pig ileum with a potency similar to that of oxotremorine. Following the initial stimulation, there is a long lasting period of lack of sensitivity of the guinea pig ileum to muscarinic agonists. BM 123 also produces muscarinic effects in vivo. When homogenates of the rat cerebral cortex were incubated with BM 123 and assayed subsequently in muscarinic receptor binding assays, a loss of binding capacitymore » for the muscarinic antagonist, (/sup 3/H)N-methylscopolamine ((/sup 3/H)NMS), was noted without a change in affinity. Similar observations were made in (/sup 3/H)1-3-quinuclidinyl benzilate ((/sup 3/H)-QNB) binding assays on the forebrains of mice that had been injected with BM 123 24 hr earlier. The loss in receptor capacity for both (/sup 3/H)NMS and (/sup 3/H)-QNB was prevented by atropine treatment. Kinetic studies of the interaction of BM 123 with homogenates of the rat cerebral cortex in vitro showed that the half-time for the loss of (/sup 3/H)-QNB binding sites increased from 10 to 45 min as the concentration of BM 123 decreased from 10 to 1 ..mu..M. In contrast to the aziridinium ion, the parent 2-chloroethylamine compound and the alcoholic hydrolysis product were largely devoid of pharmacological and binding activity.« less

Activity-Based Probes for Isoenzyme- and Site-Specific Functional Characterization of Glutathione S -Transferases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stoddard, Ethan G.; Killinger, Bryan J.; Nair, Reji N.

Glutathione S-transferases (GSTs) comprise a highly diverse family of phase II drug metabolizing enzymes whose shared function is the conjugation of reduced glutathione to various endo- and xenobiotics. Although the conglomerate activity of these enzymes can be measured by colorimetric assays, measurement of the individual contribution from specific isoforms and their contribution to the detoxification of xenobiotics in complex biological samples has not been possible. For this reason, we have developed two activity-based probes that characterize active glutathione transferases in mammalian tissues. The GST active site is comprised of a glutathione binding “G site” and a distinct substrate binding “Hmore » site”. Therefore, we developed (1) a glutathione-based photoaffinity probe (GSH-ABP) to target the “G site”, and (2) a probe designed to mimic a substrate molecule and show “H site” activity (GST-ABP). The GSH-ABP features a photoreactive moiety for UV-induced covalent binding to GSTs and glutathione-binding enzymes. The GST-ABP is a derivative of a known mechanism-based GST inhibitor that binds within the active site and inhibits GST activity. Validation of probe targets and “G” and “H” site specificity was carried out using a series of competitors in liver homogenates. Herein, we present robust tools for the novel characterization of enzyme- and active site-specific GST activity in mammalian model systems.« less

Rapid characterization of a novel taspine derivative-HMQ1611 binding to EGFR by a cell membrane chromatography method.

PubMed

Du, Hui; Lv, Nan; Wang, Sicen; He, Langchong

2013-05-01

A new high-expression endothelial growth factor receptor (EGFR) cell membrane chromatography (CMC) method was applied to recognize the ligands acting on EGFR specifically, and investigate the affinity of gefitinib/HMQ1611 to EGFR. In the self and direct competitive assay, gefitinib/HMQ1611 was used as a competitor in the mobile phase to evaluate the effect of the competitor's concentrations on the retention of the ligands, respectively, and the competition between gefitinib and HMQ1611 binding to EGFR was also been examined. The retention behavior indicated that gefitinib had one type of binding sites on the EGFR, and the equilibrium dissociation constant (K(D)) was (9.11 ± 1.89) × 10(-6) M; HMQ1611 had two major binding regions on the EGFR, and the K(D) values obtained from the model were (2.39 ± 0.33) × 10(-7) and (3.87 ± 0.93) × 10(-5) M for HMQ1611 at the high- and low-affinity sites, respectively. The competition between gefitinib and HMQ1611 occurred at the low-affinity sites on the EGFR. The low-affinity sites were of higher concentrations and contributed to a much larger part of retention of HMQ1611. The results suggested that gefitinib and HMQ1611 competed for the common binding sites on the EGFR, no matter the ligand was used as an analyte or a competitor.

[Pathomechanism and therapeutic strategy of Fukuyama congenital muscular dystrophy and related disorders].

PubMed

Toda, Tatsushi

2009-11-01

Hypoglycosylation and reduced laminin-binding activity of alpha-dystroglycan are common characteristics of dystroglycanopathy, which is a group of congenital and limb-girdle muscular dystrophies. We previously identified the genes for Fukuyama congenital muscular dystrophy (FCMD) and muscle-eye-brain disease (MEB). FCMD, caused by a mutation in the fukutin gene, is a severe form of dystroglycanopathy. Knock-in mice carrying the founder retrotransposal insertion exhibited hypoglycosylated alpha-dystroglycan; however, no signs of muscular dystrophy were observed. More sensitive methods detected minor levels of intact alpha-dystroglycan, and solid-phase assays determined laminin binding levels to be approximately 50% of normal. In contrast, intact alpha-dystroglycan is undetectable in the dystrophic Large mouse, and laminin-binding activity is markedly reduced. These data indicate that a small amount of intact alpha-dystroglycan is sufficient to maintain muscle cell integrity in knock-in mice, suggesting that the treatment of dystroglycanopathies might not require the full recovery of glycosylation. Transfer of fukutin into knock-in mice restored glycosylation of alpha-dystroglycan. Transfer of LARGE produced laminin-binding forms of alpha-dystroglycan in both knock-in mice and the POMGnT1 mutant mouse. These data suggest that even partial restoration of alpha-dystroglycan glycosylation and laminin-binding activity by replacing or augmenting glycosylation-related genes might effectively deter dystroglycanopathy progression and thus provide therapeutic benefits.

A model of high-affinity antibody binding to type III group B Streptococcus capsular polysaccharide.

PubMed

Wessels, M R; Muñoz, A; Kasper, D L

1987-12-01

We recently reported that the single repeating-unit pentasaccharide of type III group B Streptococcus (GBS) capsular polysaccharide is only weakly reactive with type III GBS antiserum. To further elucidate the relationship between antigen-chain length and antigenicity, tritiated oligosaccharides derived from type III capsular polysaccharide were used to generate detailed saturation binding curves with a fixed concentration of rabbit antiserum in a radioactive antigen-binding assay. A graded increase in affinity of antigen-antibody binding was seen as oligosaccharide size increased from 2.6 repeating units to 92 repeating units. These differences in affinity of antibody binding to oligosaccharides of different molecular size were confirmed by immunoprecipitation and competitive ELISA, two independent assays of antigen-antibody binding. Analysis of the saturation binding experiment indicated a difference of 300-fold in antibody-binding affinity for the largest versus the smallest tested oligosaccharides. Unexpectedly, the saturation binding values approached by the individual curves were inversely related to oligosaccharide chain length on a molar basis but equivalent on a weight basis. This observation is compatible with a model in which binding of an immunoglobulin molecule to an antigenic site on the polysaccharide facilitates subsequent binding of antibody to that antigen.

A new assay format for NF-kappaB based on a DNA triple helix and a fluorescence resonance energy transfer.

PubMed

Altevogt, Dominik; Hrenn, Andrea; Kern, Claudia; Clima, Lilia; Bannwarth, Willi; Merfort, Irmgard

2009-10-07

Herein we report a feasibility study for a new concept to detect DNA binding protein NF-kappaB based on a DNA triple helix formation in combination with a fluorescence resonance energy transfer (FRET). The new principle avoids expensive antibodies and radioactivity and might have implications for assays of other DNA binding proteins.

The fibrinogen-binding M1 protein reduces pharyngeal cell adherence and colonization phenotypes of M1T1 group A Streptococcus.

PubMed

Anderson, Ericka L; Cole, Jason N; Olson, Joshua; Ryba, Bryan; Ghosh, Partho; Nizet, Victor

2014-02-07

Group A Streptococcus (GAS) is a leading human pathogen producing a diverse array of infections from simple pharyngitis ("strep throat") to invasive conditions, including necrotizing fasciitis and toxic shock syndrome. The surface-anchored GAS M1 protein is a classical virulence factor that promotes phagocyte resistance and exaggerated inflammation by binding host fibrinogen (Fg) to form supramolecular networks. In this study, we used a virulent WT M1T1 GAS strain and its isogenic M1-deficient mutant to examine the role of M1-Fg binding in a proximal step in GAS infection-interaction with the pharyngeal epithelium. Expression of the M1 protein reduced GAS adherence to human pharyngeal keratinocytes by 2-fold, and this difference was increased to 4-fold in the presence of Fg. In stationary phase, surface M1 protein cleavage by the GAS cysteine protease SpeB eliminated Fg binding and relieved its inhibitory effect on GAS pharyngeal cell adherence. In a mouse model of GAS colonization of nasal-associated lymphoid tissue, M1 protein expression was associated with an average 6-fold decreased GAS recovery in isogenic strain competition assays. Thus, GAS M1 protein-Fg binding reduces GAS pharyngeal cell adherence and colonization in a fashion that is counterbalanced by SpeB. Inactivation of SpeB during the shift to invasive GAS disease allows M1-Fg binding, increasing pathogen phagocyte resistance and proinflammatory activities.

Automated data processing and radioassays.

PubMed

Samols, E; Barrows, G H

1978-04-01

Radioassays include (1) radioimmunoassays, (2) competitive protein-binding assays based on competition for limited antibody or specific binding protein, (3) immunoradiometric assay, based on competition for excess labeled antibody, and (4) radioreceptor assays. Most mathematical models describing the relationship between labeled ligand binding and unlabeled ligand concentration have been based on the law of mass action or the isotope dilution principle. These models provide useful data reduction programs, but are theoretically unfactory because competitive radioassay usually is not based on classical dilution principles, labeled and unlabeled ligand do not have to be identical, antibodies (or receptors) are frequently heterogenous, equilibrium usually is not reached, and there is probably steric and cooperative influence on binding. An alternative, more flexible mathematical model based on the probability or binding collisions being restricted by the surface area of reactive divalent sites on antibody and on univalent antigen has been derived. Application of these models to automated data reduction allows standard curves to be fitted by a mathematical expression, and unknown values are calculated from binding data. The vitrues and pitfalls are presented of point-to-point data reduction, linear transformations, and curvilinear fitting approaches. A third-order polynomial using the square root of concentration closely approximates the mathematical model based on probability, and in our experience this method provides the most acceptable results with all varieties of radioassays. With this curvilinear system, linear point connection should be used between the zero standard and the beginning of significant dose response, and also towards saturation. The importance is stressed of limiting the range of reported automated assay results to that portion of the standard curve that delivers optimal sensitivity. Published methods for automated data reduction of Scatchard plots for radioreceptor assay are limited by calculation of a single mean K value. The quality of the input data is generally the limiting factor in achieving good precision with automated as it is with manual data reduction. The major advantages of computerized curve fitting include: (1) handling large amounts of data rapidly and without computational error; (2) providing useful quality-control data; (3) indicating within-batch variance of the test results; (4) providing ongoing quality-control charts and between assay variance.

Dynamics of TBP binding to the TATA box

NASA Astrophysics Data System (ADS)

Schluesche, Peter; Heiss, Gregor; Meisterernst, Michael; Lamb, Don C.

2008-02-01

Gene expression is highly controlled and regulated in living cells. One of the first steps in gene transcription is recognition of the promoter site by the TATA box Binding Protein (TBP). TBP recruits other transcriptions factors and eventually the RNA polymerase II to transcribe the DNA in mRNA. We developed a single pair Förster Resonance Energy Transfer (spFRET) assay to investigate the mechanism of gene regulation. Here, we apply this assay to investigate the initial binding process of TBP to the adenovirus major late (AdML) promoter site. From the spFRET measurements, we were able to identify two conformations of the TBP-DNA complex that correspond to TBP bound in the correct and the opposite orientation. Increased incubation times or the presence of the transcription factor TFIIA improved the alignment of TBP on the promoter site. Binding of TBP to the TATA box shows a rich dynamics with abrupt transitions between multiple FRET states. A frame-wise histogram analysis revealed the presence of at least six discrete states, showing that TBP binding is more complicated than previously thought. Hence, the spFRET assay is very sensitive to the conformation of the TBP-DNA complex and is very promising tool for investigating the pathway of TBP binding in detail.

Engineering and exploitation of a fluorescent HIV-1 gp120 for live cell CD4 binding assays

DOE Office of Scientific and Technical Information (OSTI.GOV)

Costantini, Lindsey M.; Irvin, Susan C.; Department of Microbiology and Immunology, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, NY 10461

The HIV-1 envelope glycoprotein, gp120, binds the host cell receptor, CD4, in the initial step of HIV viral entry and infection. This process is an appealing target for the development of inhibitory drugs and neutralizing antibodies. To study gp120 binding and intracellular trafficking, we engineered a fluorescent fusion of the humanized gp120 JRFL HIV-1 variant and GFP. Gp120-sfGFP is glycosylated with human sugars, robustly expressed, and secreted from cultured human cells. Protein dynamics, quality control, and trafficking can be visualized in live cells. The fusion protein can be readily modified with different gp120 variants or fluorescent proteins. Finally, secreted gp120-sfGFPmore » enables a sensitive and easy binding assay that can quantitatively screen potential inhibitors of gp120-CD4 binding on live cells via fluorescence imaging or laser scanning cytometry. This adaptable research tool should aid in studies of gp120 cell biology and the development of novel anti-HIV drugs. - Highlights: • Development of fluorescent protein labeled HIV-1 envelope gp120. • Imaging of gp120 dynamics and trafficking in live cells. • Quantitative visual assay of antibody-mediated inhibition of gp120 binding to CD4 on live cells.« less

Data quality in drug discovery: the role of analytical performance in ligand binding assays

NASA Astrophysics Data System (ADS)

Wätzig, Hermann; Oltmann-Norden, Imke; Steinicke, Franziska; Alhazmi, Hassan A.; Nachbar, Markus; El-Hady, Deia Abd; Albishri, Hassan M.; Baumann, Knut; Exner, Thomas; Böckler, Frank M.; El Deeb, Sami

2015-09-01

Despite its importance and all the considerable efforts made, the progress in drug discovery is limited. One main reason for this is the partly questionable data quality. Models relating biological activity and structures and in silico predictions rely on precisely and accurately measured binding data. However, these data vary so strongly, such that only variations by orders of magnitude are considered as unreliable. This can certainly be improved considering the high analytical performance in pharmaceutical quality control. Thus the principles, properties and performances of biochemical and cell-based assays are revisited and evaluated. In the part of biochemical assays immunoassays, fluorescence assays, surface plasmon resonance, isothermal calorimetry, nuclear magnetic resonance and affinity capillary electrophoresis are discussed in details, in addition radiation-based ligand binding assays, mass spectrometry, atomic force microscopy and microscale thermophoresis are briefly evaluated. In addition, general sources of error, such as solvent, dilution, sample pretreatment and the quality of reagents and reference materials are discussed. Biochemical assays can be optimized to provide good accuracy and precision (e.g. percental relative standard deviation <10 %). Cell-based assays are often considered superior related to the biological significance, however, typically they cannot still be considered as really quantitative, in particular when results are compared over longer periods of time or between laboratories. A very careful choice of assays is therefore recommended. Strategies to further optimize assays are outlined, considering the evaluation and the decrease of the relevant error sources. Analytical performance and data quality are still advancing and will further advance the progress in drug development.

Intestinal Fatty Acid Binding Protein and Citrulline as Markers of Gut Injury and Prognosis in Patients With Acute Pancreatitis.

PubMed

Goswami, Pooja; Sonika, Ujjwal; Moka, Praneeth; Sreenivas, Vishnubhatla; Saraya, Anoop

Severe acute pancreatitis (AP) is associated with high mortality due to systemic inflammatory response syndrome in the early phase and secondary infection in the later phase. Concomitant intestinal ischemia often results in gut injury. We studied intestinal fatty acid binding protein (IFABP) and citrulline levels as markers of gut injury to predict prognosis in AP. Acute pancreatitis patients at admission and controls were studied. Serum IFABP was measured by enzyme-linked immunosorbent assay and plasma citrulline by high-performance liquid chromatography technique. Ultrastructural changes in duodenal biopsy were also compared between the 2 groups. The IFABP concentration was significantly higher in AP cases (n = 94) compared with controls (n = 100) (mean [standard deviation], 592.5 [753.6] vs 87.8 [67.6] pg/mL; P < 0.001) and in patients with severe AP versus mild AP (738.3 [955.3] vs 404.0 [263.3] pg/ mL, P = 0.03). Citrulline concentration was lower in AP versus controls (29.9 [33.8] vs 83.9 [60.1] μg/L, P < 0.001). We propose a model by which these biomarkers (IFABP >350 pg/mL and citrulline <18 μg/L) are able to predict poor prognosis in 33.9% of patients with AP. The gut injury was also validated via ultrastructural changes. Intestinal fatty acid binding protein is a promising prognostic marker in acute pancreatitis.

Protein domains connect cell cycle stimulation directly to initiation of DNA replication.

PubMed Central

Gjørup, O V; Rose, P E; Holman, P S; Bockus, B J; Schaffhausen, B S

1994-01-01

Polyoma large T antigen (LT) is the only viral gene product required for viral DNA replication. LT can be divided into two domains, one N-terminal (NT) spanning residues 1-260 and one C-terminal (CT) comprising approximately residues 264-785. NT is known to immortalize primary cells in a manner dependent on binding of pRB/p107. Here a CT construct comprising residues 264-785 was shown to have independent function in DNA replication. CT is entirely sufficient for driving viral DNA replication in vivo in growing mouse cells at a level approaching that of full-length LT. In contrast, CT is strikingly deficient for replication in serum-starved cells. However, this deficiency can be complemented by coexpression of NT. BrdUrd incorporation in transfected, starved cells showed that NT was sufficient for inducing S phase, suggesting a mechanism for complementation. By contrast, CT was unable to induce S phase when tested in the same assay. NT also promotes phosphorylation of sites in CT that are likely to be important for replication. Other DNA tumor virus gene products such as adenovirus E1A 12S and human papillomavirus 16 E7 could also complement CT for replication. Although NT, E1A 12S, and E7 all bind the retinoblastoma gene product (pRB) and p107, genetic analysis demonstrates an additional function, independent of that binding, is responsible for complementation. Images PMID:7991595

Evaluation of simultaneous binding of Chromomycin A3 to the multiple sites of DNA by the new restriction enzyme assay.

PubMed

Murase, Hirotaka; Noguchi, Tomoharu; Sasaki, Shigeki

2018-06-01

Chromomycin A3 (CMA3) is an aureolic acid-type antitumor antibiotic. CMA3 forms dimeric complexes with divalent cations, such as Mg 2+ , which strongly binds to the GC rich sequence of DNA to inhibit DNA replication and transcription. In this study, the binding property of CMA3 to the DNA sequence containing multiple GC-rich binding sites was investigated by measuring the protection from hydrolysis by the restriction enzymes, AccII and Fnu4HI, for the center of the CGCG site and the 5'-GC↓GGC site, respectively. In contrast to the standard DNase I footprinting method, the DNA substrates are fully hydrolyzed by the restriction enzymes, therefore, the full protection of DNA at all the cleavable sites indicates that CMA3 simultaneously binds to all the binding sites. The restriction enzyme assay has suggested that CMA3 has a high tendency to bind the successive CGCG sites and the CGG repeat. Copyright © 2018 Elsevier Ltd. All rights reserved.

Simple method provides resolution of albumin, lipoprotein, free fraction, and chylomicron to enhance the utility of protein binding assays.

PubMed

Brockman, Adam H; Oller, Haley R; Moreau, Benoît; Kriksciukaite, Kristina; Bilodeau, Mark T

2015-02-12

Medicinal chemists have been encouraged in recent years to embrace high speed protein binding assays. These methods employ dialysis membranes in 96-well format or spin filters. Membrane-based methods do not separate lipoprotein binding from albumin binding and introduce interference despite membrane binding controls. Ultracentrifugation methods, in contrast, do not introduce interference if density gradients can be avoided and they resolve lipoprotein from albumin. A new generation of compact, fast ultracentrifuges facilitates the rapid and fully informative separation of plasma into albumin, albumin/fatty acid complex, lipoprotein, protein-free, and chylomicron fractions with no need of salt or sugar density gradients. We present a simple and fast ultracentrifuge method here for two platinum compounds and a taxane that otherwise bound irreversibly to dialysis membranes and which exhibited distinctive lipoprotein binding behaviors. This new generation of ultracentrifugation methods underscores a need to further discuss protein binding assessments as they relate to medicinal chemistry efforts.

A Spectrophotometric Assay Optimizing Conditions for Pepsin Activity.

ERIC Educational Resources Information Center

Harding, Ethelynda E.; Kimsey, R. Scott

1998-01-01

Describes a laboratory protocol optimizing the conditions for the assay of pepsin activity using the Coomasie Blue dye binding assay of protein concentration. The dye bonds through strong, noncovalent interactions to basic and aromatic amino acid residues. (DDR)

Study of nucleic acid-gold nanorod interactions and detecting nucleic acid hybridization using gold nanorod solutions in the presence of sodium citrate.

PubMed

Kanjanawarut, Roejarek; Su, Xiaodi

2010-09-01

In this study, the authors report that sodium citrate can aggregate hexadecyl-trimethyl-ammonium ion(+)-coated gold nanorods (AuNRs), and nucleic acids of different charge and structure properties, i.e., single-stranded DNA (ssDNA), double-stranded DNA (dsDNA), single-stranded peptide nucleic acid (PNA), and PNA-DNA complex, can bind to the AuNRs and therefore retard the sodium citrate-induced aggregation to different extents. The discovery that hybridized dsDNA (and the PNA-DNA complex) has a more pronounced protection effect than ssDNA (and PNA) allows the authors to develop a homogeneous phase AuNRs-based UV-visible (UV-vis) spectral assay for detecting specific sequences of oligonucleotides (20 mer) with a single-base-mismatch selectivity and a limit of detection of 5 nM. This assay involves no tedious bioconjugation and on-particle hybridization. The simple "set and test" format allows for a highly efficient hybridization in a homogeneous phase and a rapid display of the results in less than a minute. By measuring the degree of reduction in AuNR aggregation in the presence of different nucleic acid samples, one can assess how different nucleic acids interact with the AuNRs to complement the knowledge of spherical gold nanoparticles. Besides UV-vis characterization, transmission electron microscopy and zeta potential measurements were conduced to provide visual evidence of the particle aggregation and to support the discussion of the assay principle.

Inactivation of human norovirus and Tulane virus in simple media and fresh whole strawberries by ionizing radiation.

PubMed

DiCaprio, Erin; Phantkankum, Nuttapong; Culbertson, Doug; Ma, Yuanmei; Hughes, John H; Kingsley, David; Uribe, Roberto M; Li, Jianrong

2016-09-02

Human norovirus (NoV) is a major cause of fresh produce-associated outbreaks and human NoV in irrigation water can potentially lead to viral internalization in fresh produce. Therefore, there is a need to develop novel intervention strategies to target internalized viral pathogens while maintaining fresh produce quality. In this study electron beam (E-beam) and gamma radiation were evaluated for efficacy against a human NoV GII.4 strain and Tulane virus (TV). Virus survival following ionizing radiation treatments was determined using direct quantitative reverse transcriptase PCR (RT-qPCR), the porcine gastric mucin magnetic bead (PGM-MB) binding assay followed by RT-qPCR, and plaque assay. In simple media, a high dose of E-beam treatment was required to completely abolish the receptor binding ability of human NoV (35.3kGy) and TV (19.5-24.1kGy), as assessed using the PGM-MB binding assay. Both human NoV and TV were more susceptible to gamma irradiation than E-beam, requiring 22.4kGy to achieve complete inactivation. In whole strawberries, no human NoV or TV RNA was detected following 28.7kGy of E-beam treatment using the PGM-MB binding assay. Overall, human NoV and TV are highly resistant to ionizing radiation and therefore the technology may not be suitable to eliminate viruses in fresh produce at the currently approved levels. In addition, the PGM-MB binding assay is an improved method to detect viral infectivity compared to direct RT-qPCR. Copyright © 2016. Published by Elsevier B.V.

Lipid contribution to the affinity of antigen association with specific antibodies conjugated to liposomes.

PubMed

Klegerman, Melvin E; Huang, Shaoling; Parikh, Devang; Martinez, Janet; Demos, Sasha M; Onyuksel, Hayat A; McPherson, David D

2007-07-01

Immunoliposomes, directed to clinically relevant cell-surface molecules with antibodies, antibody fragments or peptides, are used for site-specific diagnostic evaluation or delivery of therapeutic agents. We have developed intrinsically echogenic liposomes (ELIP) covalently linked to fibrin(ogen)-specific antibodies and Fab fragments for ultrasonic imaging of atherosclerotic plaques. In order to determine the effect of liposomal conjugation on the molecular dynamics of fibrinogen binding, we studied the thermodynamic characteristics of unconjugated and ELIP-conjugated antibody molecules. Utilizing radioimmunoassay and enzyme-linked immunosorbent assay protocols, binding affinities were derived from data obtained at three temperatures. The thermodynamic functions DeltaH(o) , DeltaG(o) and DeltaS(o) were determined from van't Hoff plots and equations of state. The resultant functions indicated that both specific and nonspecific associations of antibody molecules with fibrinogen occurred through a variety of molecular interactions, including hydrophophic, ionic and hydrogen bonding mechanisms. ELIP conjugation of antibodies and Fab fragments introduced a characteristic change in both DeltaH(o) and DeltaS(o) of association, which corresponded to a variable contribution to binding by phospholipid gel-liquid crystal phase transitions. These observations suggest that a reciprocal energy transduction, affecting the strength of antibody-antigen binding, may be a singular characteristic of immunoliposomes, having utility for optimization and further development of the technology.

Microtubule Binding and Disruption and Induction of Premature Senescence by Disorazole C1S⃞

PubMed Central

Tierno, Marni Brisson; Kitchens, Carolyn A.; Petrik, Bethany; Graham, Thomas H.; Wipf, Peter; Xu, Fengfeng L.; Saunders, William S.; Raccor, Brianne S.; Balachandran, Raghavan; Day, Billy W.; Stout, Jane R.; Walczak, Claire E.; Ducruet, Alexander P.; Reese, Celeste E.; Lazo, John S.

2009-01-01

Disorazoles comprise a family of 29 macrocyclic polyketides isolated from the fermentation broth of the myxobacterium Sorangium cellulosum. The major fermentation product, disorazole A1, was found previously to irreversibly bind to tubulin and to have potent cytotoxic activity against tumor cells, possibly because of its highly electrophilic epoxide moiety. To test this hypothesis, we synthesized the epoxide-free disorazole C1 and found it retained potent antiproliferative activity against tumor cells, causing prominent G2/M phase arrest and inhibition of in vitro tubulin polymerization. Furthermore, disorazole C1 produced disorganized microtubules at interphase, misaligned chromosomes during mitosis, apoptosis, and premature senescence in the surviving cell populations. Using a tubulin polymerization assay, we found disorazole C1 inhibited purified bovine tubulin polymerization, with an IC50 of 11.8 ± 0.4 μM, and inhibited [3H]vinblastine binding noncompetitively, with a Ki of 4.5 ± 0.6 μM. We also found noncompetitive inhibition of [3H]dolastatin 10 binding by disorazole C1, with a Ki of 10.6 ± 1.5 μM, indicating that disorazole C1 bound tubulin uniquely among known antimitotic agents. Disorazole C1 could be a valuable chemical probe for studying the process of mitotic spindle disruption and its relationship to premature senescence. PMID:19066338

Antigen-mediated regulation in monoclonal gammopathies and myeloma

PubMed Central

Nair, Shiny; Sng, Joel; Boddupalli, Chandra Sekhar; Seckinger, Anja; Fulciniti, Mariateresa; Zhang, Lin; Rauniyar, Navin; Lopez, Michael; Neparidze, Natalia; Parker, Terri; Munshi, Nikhil C.; Sexton, Rachael; Barlogie, Bart; Orlowski, Robert; Bergsagel, Leif; Hose, Dirk; Mistry, Pramod K.; Meffre, Eric; Dhodapkar, Madhav V.

2018-01-01

A role for antigen-driven stimulation has been proposed in the pathogenesis of monoclonal gammopathy of undetermined significance (MGUS) and multiple myeloma (MM) based largely on the binding properties of monoclonal Ig. However, insights into antigen binding to clonal B cell receptors and in vivo responsiveness of the malignant clone to antigen-mediated stimulation are needed to understand the role of antigenic stimulation in tumor growth. Lysolipid-reactive clonal Ig were detected in Gaucher disease (GD) and some sporadic gammopathies. Here, we show that recombinant Ig (rIg) cloned from sort-purified single tumor cells from lipid-reactive sporadic and GD-associated gammopathy specifically bound lysolipids. Liposome sedimentation and binding assays confirmed specific interaction of lipid-reactive monoclonal Ig with lysolipids. The clonal nature of lysolipid-binding Ig was validated by protein sequencing. Gene expression profiling and cytogenetic analyses from 2 patient cohorts showed enrichment of nonhyperdiploid tumors in lipid-reactive patients. In vivo antigen-mediated stimulation led to an increase in clonal Ig and plasma cells (PCs) in GD gammopathy and also reactivated previously suppressed antigenically related nonclonal PCs. These data support a model wherein antigenic stimulation mediates an initial polyclonal phase, followed by evolution of monoclonal tumors enriched in nonhyperdiploid genomes, responsive to underlying antigen. Targeting underlying antigens may therefore prevent clinical MM. PMID:29669929

Antigen-mediated regulation in monoclonal gammopathies and myeloma.

PubMed

Nair, Shiny; Sng, Joel; Boddupalli, Chandra Sekhar; Seckinger, Anja; Chesi, Marta; Fulciniti, Mariateresa; Zhang, Lin; Rauniyar, Navin; Lopez, Michael; Neparidze, Natalia; Parker, Terri; Munshi, Nikhil C; Sexton, Rachael; Barlogie, Bart; Orlowski, Robert; Bergsagel, Leif; Hose, Dirk; Flavell, Richard A; Mistry, Pramod K; Meffre, Eric; Dhodapkar, Madhav V

2018-04-19

A role for antigen-driven stimulation has been proposed in the pathogenesis of monoclonal gammopathy of undetermined significance (MGUS) and multiple myeloma (MM) based largely on the binding properties of monoclonal Ig. However, insights into antigen binding to clonal B cell receptors and in vivo responsiveness of the malignant clone to antigen-mediated stimulation are needed to understand the role of antigenic stimulation in tumor growth. Lysolipid-reactive clonal Ig were detected in Gaucher disease (GD) and some sporadic gammopathies. Here, we show that recombinant Ig (rIg) cloned from sort-purified single tumor cells from lipid-reactive sporadic and GD-associated gammopathy specifically bound lysolipids. Liposome sedimentation and binding assays confirmed specific interaction of lipid-reactive monoclonal Ig with lysolipids. The clonal nature of lysolipid-binding Ig was validated by protein sequencing. Gene expression profiling and cytogenetic analyses from 2 patient cohorts showed enrichment of nonhyperdiploid tumors in lipid-reactive patients. In vivo antigen-mediated stimulation led to an increase in clonal Ig and plasma cells (PCs) in GD gammopathy and also reactivated previously suppressed antigenically related nonclonal PCs. These data support a model wherein antigenic stimulation mediates an initial polyclonal phase, followed by evolution of monoclonal tumors enriched in nonhyperdiploid genomes, responsive to underlying antigen. Targeting underlying antigens may therefore prevent clinical MM.

Insight into the novel inhibition mechanism of apigenin to Pneumolysin by molecular modeling

NASA Astrophysics Data System (ADS)

Niu, Xiaodi; Yang, Yanan; Song, Meng; Wang, Guizhen; Sun, Lin; Gao, Yawen; Wang, Hongsu

2017-11-01

In this study, the mechanism of apigenin inhibition was explored using molecular modelling, binding energy calculation, and mutagenesis assays. Energy decomposition analysis indicated that apigenin binds in the gap between domains 3 and 4 of PLY. Using principal component analysis, we found that binding of apigenin to PLY weakens the motion of domains 3 and 4. Consequently, these domains cannot complete the transition from monomer to oligomer, thereby blocking oligomerisation of PLY and counteracting its haemolytic activity. This inhibitory mechanism was confirmed by haemolysis assays, and these findings will promote the future development of an antimicrobial agent.

A CE-FL based method for real-time detection of in-capillary self-assembly of the nanoconjugates of polycysteine ligand and quantum dots.

PubMed

Wang, Jianhao; Zhu, Zhilan; Qiu, Lin; Wang, Jianpeng; Wang, Xiang; Xiao, Qicai; Xia, Jiang; Liu, Li; Liu, Xiaoqian; Feng, Wei; Wang, Jinmei; Miao, Peng; Gao, Liqian

2018-07-06

Small molecules with free thiol groups always show high binding affinity to quantum dots (QDs). However, it is still highly challenging to detect the binding capacity between thiol-containing molecules and QDs inside a capillary. To conquer this limitation, a capillary electrophoresis with fluorescence detection (CE-FL) based assay was proposed and established to investigate the binding capacity between QDs and a poly-thiolated peptide (ATTO 590-DDSSGGCCPGCC, ATTO-C4). Interestingly, the results showed that interval time had a great influence on QDs and ATTO-C4 self-assembly, which can be attributed to longer interval time benefitting the binding of QDs to ATTO-C4. The stability assays on ATTO-C4-QD assembly indicated that high concentration of imidazole or GSH had a high capability of competing with the bound ATTO-C4, evidenced by dramatically dropping of S 625 /S 565 ratio from 0.78 to 0.30 or 0.29. Therefore, all these results above suggested that this novel CE-FL based detection assay could be successfully applied to the binding studies between QDs and thiol-containing biomolecules.

Transcriptional regulation of podoplanin expression by Prox1 in lymphatic endothelial cells.

PubMed

Pan, Yanfang; Wang, Wen-di; Yago, Tadayuki

2014-07-01

Transcription factor prospero homeobox 1 (Prox-1) and podoplanin (PDPN), mucin-type transmembane protein, are both constantly expressed in lymphatic endothelial cells (LECs) and appear to function in an LEC-autonomous manner. Mice globally lacking PDPN (Pdpn(-/-)) develop abnormal and blood-filled lymphatic vessels that highly resemble those in inducible mice lacking Prox-1 (Prox1(-/-)). Prox1 has also been reported to induce PDPN expression in cultured ECs. Thus, we hypothesize that PDPN functions downstream of Prox1 and that its expression is regulated by Prox1 in LECs at the transcriptional level. We first identified four putative binding elements for Prox1 in the 5' upstream regulatory region of Pdpn gene and found that Prox1 directly binds to the 5' regulatory sequence of Pdpn gene in LECs by chromatin immunoprecipitation assay. DNA pull down assay confirmed that Prox1 binds to the putative binding element. In addition, luciferase reporter assay indicated that Prox1 binding to the 5' regulatory sequence of Pdpn regulates Pdpn gene expression. We are therefore the first to experimentally demonstrate that Prox1 regulates PDPN expression at the transcriptional level in the lymphatic vascular system. Copyright © 2014 Elsevier Inc. All rights reserved.

A CE-FL based method for real-time detection of in-capillary self-assembly of the nanoconjugates of polycysteine ligand and quantum dots

NASA Astrophysics Data System (ADS)

Wang, Jianhao; Zhu, Zhilan; Qiu, Lin; Wang, Jianpeng; Wang, Xiang; Xiao, Qicai; Xia, Jiang; Liu, Li; Liu, Xiaoqian; Feng, Wei; Wang, Jinmei; Miao, Peng; Gao, Liqian

2018-07-01

Small molecules with free thiol groups always show high binding affinity to quantum dots (QDs). However, it is still highly challenging to detect the binding capacity between thiol-containing molecules and QDs inside a capillary. To conquer this limitation, a capillary electrophoresis with fluorescence detection (CE-FL) based assay was proposed and established to investigate the binding capacity between QDs and a poly-thiolated peptide (ATTO 590-DDSSGGCCPGCC, ATTO-C4). Interestingly, the results showed that interval time had a great influence on QDs and ATTO-C4 self-assembly, which can be attributed to longer interval time benefitting the binding of QDs to ATTO-C4. The stability assays on ATTO-C4-QD assembly indicated that high concentration of imidazole or GSH had a high capability of competing with the bound ATTO-C4, evidenced by dramatically dropping of S 625/S 565 ratio from 0.78 to 0.30 or 0.29. Therefore, all these results above suggested that this novel CE-FL based detection assay could be successfully applied to the binding studies between QDs and thiol-containing biomolecules.

An exonuclease I-based label-free fluorometric aptasensor for adenosine triphosphate (ATP) detection with a wide concentration range.

PubMed

Wei, Yanli; Chen, Yanxia; Li, Huanhuan; Shuang, Shaomin; Dong, Chuan; Wang, Gufeng

2015-01-15

A novel aptamer-based label-free assay for sensitive and selective detection of ATP was developed. This assay employs a new aptamer/fluorescent probe system that shows resistance to exonuclease I (Exo I) digestion upon binding to ATP molecules. In the absence of ATP, the complex between the ATP-binding aptamer (ATP-aptamer) and a DNA binding dye, berberine, is digested upon the addition of exonuclease I, leading to the release of berberine into solution and consequently, quenched berberine fluorescence. In the presence of ATP, the ATP-binding aptamer folds into a G-quadruplex structure that is resistant to Exo I digestion. Accordingly, berberine is protected in the G-quadruplex structure and high fluorescence intensity is observed. As such, based on the fluorescence signal change, a label-free fluorescence assay for ATP was developed. Factors affecting the analysis of ATP including the concentration of ATP-binding aptamer, reaction time, temperature and the concentration of Exo I were comprehensively investigated. Under optimal conditions, the fluorescence intensity of the sensing system displayed a response for ATP in a wide range up to 17.5 mM with a detection limit of 140 nM.

Evaluation of an Immunochromatographic Assay for Rapid Detection of Penicillin-Binding Protein 2a in Human and Animal Staphylococcus intermedius Group, Staphylococcus lugdunensis, and Staphylococcus schleiferi Clinical Isolates.

PubMed

Arnold, A R; Burnham, C-A D; Ford, B A; Lawhon, S D; McAllister, S K; Lonsway, D; Albrecht, V; Jerris, R C; Rasheed, J K; Limbago, B; Burd, E M; Westblade, L F

2016-03-01

The performance of a rapid penicillin-binding protein 2a (PBP2a) detection assay, the Alere PBP2a culture colony test, was evaluated for identification of PBP2a-mediated beta-lactam resistance in human and animal clinical isolates of Staphylococcus intermedius group, Staphylococcus lugdunensis, and Staphylococcus schleiferi. The assay was sensitive and specific, with all PBP2a-negative and PBP2a-positive strains testing negative and positive, respectively. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Synthesis and biological evaluation of guanylhydrazone coactivator binding inhibitors for the estrogen receptor.

PubMed

LaFrate, Andrew L; Gunther, Jillian R; Carlson, Kathryn E; Katzenellenbogen, John A

2008-12-01

Most patients with hormone-responsive breast cancer eventually develop resistance to traditional antiestrogens such as tamoxifen, and this has become a major obstacle in their treatment. We prepared and characterized the activity of a series of 16 guanylhydrazone small molecules that are designed to block estrogen receptor (ER) activity through a non-traditional mechanism, by directly interfering with coactivator binding to agonist-liganded ER. The inhibitory activity of these compounds was determined in cell-based transcription assays using ER-responsive reporter gene and mammalian two-hybrid assays. Several of the compounds gave IC(50) values in the low micromolar range. Two secondary assays were used to confirm that these compounds were acting through the proposed non-traditional mode of estrogen inhibitory action and not as conventional antagonists at the ligand binding site.

Ribosomal targets for antibiotic drug discovery

DOEpatents

Blanchard, Scott C.; Feldman, Michael Brian; Wang, Leyi; Doudna Cate, James H.; Pulk, Arto; Altman, Roger B.; Wasserman, Michael R

2016-09-13

The present invention relates to methods to identify molecules that binds in the neomycin binding pocket of a bacterial ribosome using structures of an intact bacterial ribosome that reveal how the ribosome binds tRNA in two functionally distinct states, determined by x-ray crystallography. One state positions tRNA in the peptidyl-tRNA binding site. The second, a fully rotated state, is stabilized by ribosome recycling factor (RRF) and binds tRNA in a highly bent conformation in a hybrid peptidyl/exit (P/E) site. Additionally, the invention relates to various assays, including single-molecule assay for ribosome recycling, and methods to identify compounds that interfere with ribosomal function by detecting newly identified intermediate FRET states using known and novel FRET pairs on the ribosome. The invention also provides vectors and compositions with an N-terminally tagged S13 protein.

BiFC Assay to Detect Calmodulin Binding to Plant Receptor Kinases.

PubMed

Fischer, Cornelia; Sauter, Margret; Dietrich, Petra

2017-01-01

Plant receptor-like kinases (RLKs) are regulated at various levels including posttranscriptional modification and interaction with regulatory proteins. Calmodulin (CaM) is a calcium-sensing protein that was shown to bind to some RLKs such as the PHYTOSULFOKINE RECEPTOR1 (PSKR1). The CaM-binding site is embedded in subdomain VIa of the kinase domain. It is possible that many more of RLKs interact with CaM than previously described. To unequivocally confirm CaM binding, several methods exist. Bimolecular fluorescence complementation (BiFC) and pull-down assays have been successfully used to study CaM binding to PSKR1 and are described in this chapter (BiFC) and in Chapter 15 (pull down). The two methods are complementary. BiFC is useful to show localization and interaction of soluble as well as of membrane-bound proteins in planta.

Lignans from the roots of Urtica dioica and their metabolites bind to human sex hormone binding globulin (SHBG).

PubMed

Schöttner, M; Gansser, D; Spiteller, G

1997-12-01

Polar extracts of the stinging nettle (Urtica dioica L.) roots contain the ligans (+)-neoolivil, (-)-secoisolariciresinol, dehydrodiconiferyl alcohol, isolariciresinol, pinoresinol, and 3,4-divanillyltetrahydrofuran. These compounds were either isolated from Urtica roots, or obtained semisynthetically. Their affinity to human sex hormone binding globulin (SHBG) was tested in an in vitro assay. In addition, the main intestinal transformation products of plant lignans in humans, enterodiol and enterolactone, together with enterofuran were checked for their activity. All lignans except (-)-pinoresinol developed a binding affinity to SHBG in the in vitro assay. The affinity of (-)-3,4-divanillyltetrahydrofuran was outstandingly high. These findings are discussed with respect to potential beneficial effects of plant lignans on benign prostatic hyperplasia (BPH).

Tissue Specific and Hormonal Regulation of Gene Expression

DTIC Science & Technology

1997-08-01

interference assays were performed. These assays identify DNA bases that, when modified, interfere with the binding of the nuclear factor to the hCRH promoter...thymidine residues. The DNA bases that when modified affected the binding of the protein are noted with arrows, and their location in the hCRH...indicated. B. Methylation interference. The fragments were partially methylated using dimethyl sulfate. The DNA bases that when modified affected the

Binding of selected extracellular matrix proteins to enterococci and Streptococcus bovis of animal origin.

PubMed

Styriak, I; Lauková, A; Fallgren, C; Wadström, T

1999-12-01

Thirty-three enterococcal strains and 10 Streptococcus bovis strains were investigated for their protein-binding cell surface components. Seven extracellular matrix (ECM) proteins were immobilized on Difco latex beads to detect these components on the surface of all enterococcal strains and eight non-autoaggregating S. bovis strains by a particle agglutination assay (PAA). Twenty-three selected strains were also examined in microtiter plate assays. According to the absorbance readings (A(570nm)), 11 strains were classified as nonadherent (A(570nm) < 0.1), 10 strains as weakly adherent (0.1 < A(570nm) > 0.3), and 2 strains as strongly adherent (A(570nm) > 0.3) in these assays. A direct correlation was found between the values obtained in PAA and A(570nm) readings of microtiter plate assays. Binding of (125)I-labeled bovine lactoferrin to enterococci and streptococci was in the range of 6%-30% and of (125)I-labeled human vitronectin in the range of 9%-33% to streptococci. The binding of(125)I-labeled ECM proteins to selected strains was much more effectively inhibited by sulfated carbohydrates than by non-sulfated hyaluronic acid, indicating the importance of the sulfate groups of these inhibitors. An inhibition effect of heparin on bLf binding to four selected strains was higher in comparison with fucoidan in the microtiter plates. Thirty-five out of 44 strains had agglutinated rabbit erythrocytes. However, these strains showed no ability to agglutinate bovine or sheep erythrocytes.

Receptor binding sites for atrial natriuretic factor are expressed by brown adipose tissue

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bacay, A.C.; Mantyh, C.R.; Vigna, S.R.

1988-09-01

To explore the possibility that atrial natriuretic factor (ANF) is involved in thermoregulation we used quantitative receptor autoradiography and homogenate receptor binding assays to identify ANF bindings sites in neonatal rat and sheep brown adipose tissue, respectively. Using quantitative receptor autoradiography were were able to localize high levels of specific binding sites for {sup 125}I-rat ANF in neonatal rat brown adipose tissue. Homogenate binding assays on sheep brown fat demonstrated that the radioligand was binding to the membrane fraction and that the specific binding was not due to a lipophilic interaction between {sup 125}I-rat ANF and brown fat. Specific bindingmore » of {sup 125}I-rat ANF to the membranes of brown fat cells was inhibited by unlabeled rat ANF with a Ki of 8.0 x 10(-9) M, but not by unrelated peptides. These studies demonstrate that brown fat cells express high levels of ANF receptor binding sites in neonatal rat and sheep and suggest that ANF may play a role in thermoregulation.« less

Evaluation of Impermeant, DNA-Binding Dye Fluorescence as a Real-Time Readout of Eukaryotic Cell Toxicity in a High Throughput Screening Format

PubMed Central

Chiaraviglio, Lucius

2014-01-01

Abstract Interpretation of high throughput screening (HTS) data in cell-based assays may be confounded by cytotoxic properties of screening compounds. Therefore, assessing cell toxicity in real time during the HTS process itself would be highly advantageous. Here, we investigate the potential of putatively impermeant, fluorescent, DNA-binding dyes to give cell toxicity readout during HTS. Amongst 19 DNA-binding dyes examined, three classes were identified that were (1) permeant, (2) cytotoxic, or (3) neither permeant nor cytotoxic during 3-day incubation with a macrophage cell line. In the last class, four dyes (SYTOX Green, CellTox Green, GelGreen, and EvaGreen) gave highly robust cytotoxicity data in 384-well screening plates. As proof of principle, successful combination with a luminescence-based assay in HTS format was demonstrated. Here, both intracellular growth of Legionella pneumophila (luminescence) and host cell viability (SYTOX Green exclusion) were assayed in the same screening well. Incorporation of membrane-impermeant, DNA-binding, fluorescent dyes in HTS assays should prove useful by allowing evaluation of cytotoxicity in real time, eliminating reagent addition steps and effort associated with endpoint cell viability analysis, and reducing the need for follow-up cytotoxicity screening. PMID:24831788

Competitive Binding to Cuprous Ions of Protein and BCA in the Bicinchoninic Acid Protein Assay

PubMed Central

Huang, Tao; Long, Mian; Huo, Bo

2010-01-01

Although Bicinchoninic acid (BCA) has been widely used to determine protein concentration, the mechanism of interaction between protein, copper ion and BCA in this assay is still not well known. Using the Micro BCA protein assay kit (Pierce Company), we measured the absorbance at 562 nm of BSA solutions with different concentrations of protein, and also varied the BCA concentration. When the concentration of protein was increased, the absorbance exhibited the known linear and nonlinear increase, and then reached an unexpected plateau followed by a gradual decrease. We introduced a model in which peptide chains competed with BCA for binding to cuprous ions. Formation of the well-known chromogenic complex of BCA-Cu1+-BCA was competed with the binding of two peptide bonds (NTPB) to cuprous ion, and there is the possibility of the existence of two new complexes. A simple equilibrium equation was established to describe the correlations between the substances in solution at equilibrium, and an empirical exponential function was introduced to describe the reduction reaction. Theoretical predictions of absorbance from the model were in good agreement with the measurements, which not only validated the competitive binding model, but also predicted a new complex of BCA-Cu1+-NTPB that might exist in the final solution. This work provides a new insight into understanding the chemical bases of the BCA protein assay and might extend the assay to higher protein concentration. PMID:21625379

High-Throughput Screens To Identify Autophagy Inducers That Function by Disrupting Beclin 1/Bcl-2 Binding.

PubMed

Chiang, Wei-Chung; Wei, Yongjie; Kuo, Yi-Chun; Wei, Shuguang; Zhou, Anwu; Zou, Zhongju; Yehl, Jenna; Ranaghan, Matthew J; Skepner, Adam; Bittker, Joshua A; Perez, Jose R; Posner, Bruce A; Levine, Beth

2018-06-21

Autophagy, a lysosomal degradation pathway, plays a crucial role in cellular homeostasis, development, immunity, tumor suppression, metabolism, prevention of neurodegeneration, and lifespan extension. Thus, pharmacological stimulation of autophagy may be an effective approach for preventing or treating certain human diseases and/or aging. We sought to establish a method for developing new chemical compounds that specifically induce autophagy. To do this, we developed two assays to identify compounds that target a key regulatory node of autophagy induction-specifically, the binding of Bcl-2 (a negative regulator of autophagy) to Beclin 1 (an allosteric modulator of the Beclin 1/VPS34 lipid kinase complex that functions in autophagy initiation). These assays use either a split-luciferase assay to measure Beclin 1/Bcl-2 binding in cells or an AlphaLISA assay to directly measure direct Beclin 1/Bcl-2 binding in vitro. We screened two different chemical compound libraries, comprising ∼300 K compounds, to identify small molecules that disrupt Beclin 1/Bcl-2 binding and induce autophagy. Three novel compounds were identified that directly inhibit Beclin 1/Bcl-2 interaction with an IC 50 in the micromolar range and increase autophagic flux. These compounds do not demonstrate significant cytotoxicity, and they exert selectivity for disruption of Bcl-2 binding to the BH3 domain of Beclin 1 compared with the BH3 domain of the pro-apoptotic Bcl-2 family members, Bax and Bim. Thus, we have identified candidate molecules that serve as lead templates for developing potent and selective Beclin 1/Bcl-2 inhibitors that may be clinically useful as autophagy-inducing agents.

Involvement of sulfates from cruzipain, a major antigen of Trypanosoma cruzi, in the interaction with immunomodulatory molecule Siglec-E.

PubMed

Ferrero, Maximiliano R; Heins, Anja M; Soprano, Luciana L; Acosta, Diana M; Esteva, Mónica I; Jacobs, Thomas; Duschak, Vilma G

2016-02-01

In order to investigate the involvement of sulfated groups in the Trypanosoma cruzi host-parasite relationship, we studied the interaction between the major cysteine proteinase of T. cruzi, cruzipain (Cz), a sulfate-containing sialylated molecule and the sialic acid-binding immunoglobulin like lectin-E (Siglec-E). To this aim, ELISA, indirect immunofluorescence assays and flow cytometry, using mouse Siglec-E-Fc fusion molecules and glycoproteins of parasites, were performed. Competition assays verified that the lectins, Maackia amurensis II (Mal II) and Siglec-E-Fc, compete for the same binding sites. Taking into account that Mal II binding remains unaltered by sulfation, we established this lectin as sialylation degree control. Proteins of an enriched microsomal fraction showed the highest binding to Siglec-E as compared with those from the other parasite subcellular fractions. ELISA assays and the affinity purification of Cz by a Siglec-E column confirmed the interaction between both molecules. The significant decrease in binding of Siglec-E-Fc to Cz and to its C-terminal domain (C-T) after desulfation of these molecules suggests that sulfates contribute to the interaction between Siglec-E-Fc and these glycoproteins. Competitive ELISA assays confirmed the involvement of sulfated epitopes in the affinity between Siglec-E and Cz, probably modified by natural protein environment. Interestingly, data from flow cytometry of untreated and chlorate-treated parasites suggested that sulfates are not primary receptors, but enhance the binding of Siglec-E to trypomastigotic forms. Altogether, our findings support the notion that sulfate-containing sialylated glycoproteins interact with Siglec-E, an ortholog protein of human Siglec-9, and might modulate the immune response of the host, favoring parasitemia and persistence of the parasite.

Quantitative pharmacological analysis of antagonist binding kinetics at CRF1 receptors in vitro and in vivo

PubMed Central

Ramsey, Simeon J; Attkins, Neil J; Fish, Rebecca; van der Graaf, Piet H

2011-01-01

BACKGROUND AND PURPOSE A series of novel non-peptide corticotropin releasing factor type-1 receptor (CRF1) antagonists were found to display varying degrees of insurmountable and non-competitive behaviour in functional in vitro assays. We describe how we attempted to relate this behaviour to ligand receptor-binding kinetics in a quantitative manner and how this resulted in the development and implementation of an efficient pharmacological screening method based on principles described by Motulsky and Mahan. EXPERIMENTAL APPROACH A non-equilibrium binding kinetic assay was developed to determine the receptor binding kinetics of non-peptide CRF1 antagonists. Nonlinear, mixed-effects modelling was used to obtain estimates of the compounds association and dissociation rates. We present an integrated pharmacokinetic–pharmacodynamic (PKPD) approach, whereby the time course of in vivo CRF1 receptor binding of novel compounds can be predicted on the basis of in vitro assays. KEY RESULTS The non-competitive antagonist behaviour appeared to be correlated to the CRF1 receptor off-rate kinetics. The integrated PKPD model suggested that, at least in a qualitative manner, the in vitro assay can be used to triage and select compounds for further in vivo investigations. CONCLUSIONS AND IMPLICATIONS This study provides evidence for a link between ligand offset kinetics and insurmountable/non-competitive antagonism at the CRF1 receptor. The exact molecular pharmacological nature of this association remains to be determined. In addition, we have developed a quantitative framework to study and integrate in vitro and in vivo receptor binding kinetic behaviour of CRF1 receptor antagonists in an efficient manner in a drug discovery setting. PMID:21449919

A mutagenic analysis of the RNase mechanism of the bacterial Kid toxin by mass spectrometry.

PubMed

Diago-Navarro, Elizabeth; Kamphuis, Monique B; Boelens, Rolf; Barendregt, Arjan; Heck, Albert J; van den Heuvel, Robert H; Díaz-Orejas, Ramón

2009-09-01

Kid, the toxin of the parD (kis, kid) maintenance system of plasmid R1, is an endoribonuclease that preferentially cleaves RNA at the 5' of A in the core sequence 5'-UA(A/C)-3'. A model of the Kid toxin interacting with the uncleavable mimetic 5'-AdUACA-3' is available. To evaluate this model, a significant collection of mutants in some of the key residues proposed to be involved in RNA binding (T46, A55, T69 and R85) or RNA cleavage (R73, D75 and H17) were analysed by mass spectrometry in RNA binding and cleavage assays. A pair of substrates, 5'-AUACA-3', and its uncleavable mimetic 5'-AdUACA-3', used to establish the model and structure of the Kid-RNA complex, were used in both the RNA cleavage and binding assays. A second RNA substrate, 5'-UUACU-3' efficiently cleaved by Kid both in vivo and in vitro, was also used in the cleavage assays. Compared with the wild-type protein, mutations in the residues of the catalytic site abolished RNA cleavage without substantially altering RNA binding. Mutations in residues proposed to be involved in RNA binding show reduced binding efficiency and a corresponding decrease in RNA cleavage efficiency. The cleavage profiles of the different mutants were similar with the two substrates used, but RNA cleavage required much lower protein concentrations when the 5'-UUACU-3' substrate was used. Protein synthesis and growth assays are consistent with there being a correlation between the RNase activity of Kid and its inhibitory potential. These results give important support to the available models of Kid RNase and the Kid-RNA complex.

Retinoid X receptor and peroxisome proliferator-activated receptor activate an estrogen responsive gene independent of the estrogen receptor.

PubMed

Nuñez, S B; Medin, J A; Braissant, O; Kemp, L; Wahli, W; Ozato, K; Segars, J H

1997-03-14

Estrogen receptors regulate transcription of genes essential for sexual development and reproductive function. Since the retinoid X receptor (RXR) is able to modulate estrogen responsive genes and both 9-cis RA and fatty acids influenced development of estrogen responsive tumors, we hypothesized that estrogen responsive genes might be modulated by RXR and the fatty acid receptor (peroxisome proliferator-activated receptor, PPAR). To test this hypothesis, transfection assays in CV-1 cells were performed with an estrogen response element (ERE) coupled to a luciferase reporter construct. Addition of expression vectors for RXR and PPAR resulted in an 11-fold increase in luciferase activity in the presence of 9-cis RA. Furthermore, mobility shift assays demonstrated binding of RXR and PPAR to the vitellogenin A2-ERE and an ERE in the oxytocin promoter. Methylation interference assays demonstrated that specific guanine residues required for RXR/PPAR binding to the ERE were similar to residues required for ER binding. Moreover, RXR domain-deleted constructs in transfection assays showed that activation required RXR since an RXR delta AF-2 mutant completely abrogated reporter activity. Oligoprecipitation binding studies with biotinylated ERE and (35)S-labeled in vitro translated RXR constructs confirmed binding of delta AF-2 RXR mutant to the ERE in the presence of baculovirus-expressed PPAR. Finally, in situ hybridization confirmed RXR and PPAR mRNA expression in estrogen responsive tissues. Collectively, these data suggest that RXR and PPAR are present in reproductive tissues, are capable of activating estrogen responsive genes and suggest that the mechanism of activation may involve direct binding of the receptors to estrogen response elements.

Replacing antibodies with modified DNA aptamers in vaccine potency assays.

PubMed

Trausch, Jeremiah J; Shank-Retzlaff, Mary; Verch, Thorsten

2017-10-04

Vaccine in vitro potency assays are vital regulatory tests that are used to confirm the presence and concentration of an antigen of interest in a form that directly or indirectly relates to protective activity in patients. Current assays come in many forms, but they almost exclusively use antibody reagents for selective detection of the target antigen. Antibodies provide specific recognition of vaccine antigens but also exhibit drawbacks such as stability limitations, cost, and lot-to-lot variation, which can make it challenging to maintain the reagent throughout the lifetime of the vaccine. We explored replacing antibodies with aptamers. Aptamers are macromolecules, such as nucleic acids, which can bind to their targets with high specificity and affinity, similar to that of antibodies. Some of the advantages of using aptamers over antibodies is that aptamers can be more stable, smaller, less expensive to produce, synthesized in vitro, and logistically easier to supply throughout the multi-decade lifespan of a commercial vaccine. We created modified DNA aptamers against the common vaccine carrier protein, CRM 197 . Several aptamers were discovered and one was chosen for further characterization. The binding kinetics of the aptamer revealed an off-rate 16-fold slower than anti-CRM 197 antibodies used for comparison. The aptamers were more sensitive than available antibodies in some assay formats and comparable in others. The aptamer epitope was mapped to the receptor-binding domain of CRM 197 , a site adjacent to a known antibody binding site. These data address some key aspects for a path forward in replacing antibodies with aptamers for use as critical reagents in vaccine assays. We further highlight the possibility of using nucleic acid reagents to develop next generation potency assays. Copyright © 2017 Elsevier Ltd. All rights reserved.

Image-based ELISA on an activated polypropylene microtest plate--a spectrophotometer-free low cost assay technique.

PubMed

Parween, Shahila; Nahar, Pradip

2013-10-15

In this communication, we report ELISA technique on an activated polypropylene microtest plate (APPµTP) as an illustrative example of a low cost diagnostic assay. Activated test zone in APPµTP binds a capture biomolecule through covalent linkage thereby, eliminating non-specific binding often prevalent in absorption based techniques. Efficacy of APPµTP is demonstrated by detecting human immunoglobulin G (IgG), human immunoglobulin E (IgE) and Aspergillus fumigatus antibody in patient's sera. Detection is done by taking the image of the assay solution by a desktop scanner and analyzing the color of the image. Human IgE quantification by color saturation in the image-based assay shows excellent correlation with absorbance-based assay (Pearson correlation coefficient, r=0.992). Significance of the relationship is seen from its p value which is 4.087e-11. Performance of APPµTP is also checked with respect to microtiter plate and paper-based ELISA. APPµTP can quantify an analyte as precisely as in microtiter plate with insignificant non-specific binding, a necessary prerequisite for ELISA assay. In contrast, paper-ELISA shows high non-specific binding in control sera (false positive). Finally, we have carried out ELISA steps on APPµTP by ultrasound waves on a sonicator bath and the results show that even in 8 min, it can convincingly differentiate a test sample from a control sample. In short, spectrophotometer-free image-based miniaturized ELISA on APPµTP is precise, reliable, rapid, and sensitive and could be a good substitute for conventional immunoassay procedures widely used in clinical and research laboratories. Copyright © 2013 Elsevier B.V. All rights reserved.

Identification of cis-elements for ethylene and circadian regulation of the Solanum melongena gene encoding cysteine proteinase.

PubMed

Rawat, Reetika; Xu, Zeng-Fu; Yao, Kwok-Ming; Chye, Mee-Len

2005-03-01

We have previously shown that the expression of SmCP which encodes Solanum melongena cysteine proteinase is ethylene-inducible and is under circadian control. To understand the regulation of SmCP, a 1.34-kb SmCP 5'-flanking region and its deletion derivatives were analyzed for cis-elements using GUS and luc fusions and by in vitro binding assays. Analysis of transgenic tobacco transformed with SmCP promoter-GUS constructs confirmed that the promoter region -415/+54 containing Ethylene Responsive Element ERE(-355/-348) conferred threefold ethylene-induction of GUS expression, while -827/+54 which also contains ERE(-683/-676), produced fivefold induction. Using gel mobility shift assays, we demonstrated that each ERE binds nuclear proteins from both ethephon-treated and untreated 5-week-old seedlings, suggesting that different transcriptions factors bind each ERE under varying physiological conditions. Binding was also observed in extracts from senescent, but not young, fruits. The variation in binding at the EREs in fruits and seedlings imply that organ-specific factors may participate in binding. Analysis of transgenic tobacco expressing various SmCP promoter-luc constructs containing wild-type or mutant Evening Elements (EEs) confirmed that both conserved EEs at -795/-787 and -785/-777 are important in circadian control. We confirmed the binding of total nuclear proteins to EEs in gel mobility shift assays and in DNase I footprinting. Our results suggest that multiple proteins bind the EEs which are conserved in plants other than Arabidopsis and that functional EEs and EREs are present in the 5'-flanking region of a gene encoding cysteine proteinase.

Characterization of 12 GnRH peptide agonists - a kinetic perspective.

PubMed

Nederpelt, Indira; Georgi, Victoria; Schiele, Felix; Nowak-Reppel, Katrin; Fernández-Montalván, Amaury E; IJzerman, Adriaan P; Heitman, Laura H

2016-01-01

Drug-target residence time is an important, yet often overlooked, parameter in drug discovery. Multiple studies have proposed an increased residence time to be beneficial for improved drug efficacy and/or longer duration of action. Currently, there are many drugs on the market targeting the gonadotropin-releasing hormone (GnRH) receptor for the treatment of hormone-dependent diseases. Surprisingly, the kinetic receptor-binding parameters of these analogues have not yet been reported. Therefore, this project focused on determining the receptor-binding kinetics of 12 GnRH peptide agonists, including many marketed drugs. A novel radioligand-binding competition association assay was developed and optimized for the human GnRH receptor with the use of a radiolabelled peptide agonist, [(125) I]-triptorelin. In addition to radioligand-binding studies, a homogeneous time-resolved FRET Tag-lite™ method was developed as an alternative assay for the same purpose. Two novel competition association assays were successfully developed and applied to determine the kinetic receptor-binding characteristics of 12 high-affinity GnRH peptide agonists. Results obtained from both methods were highly correlated. Interestingly, the binding kinetics of the peptide agonists were more divergent than their affinities with residence times ranging from 5.6 min (goserelin) to 125 min (deslorelin). Our research provides new insights by incorporating kinetic, next to equilibrium, binding parameters in current research and development that can potentially improve future drug discovery targeting the GnRH receptor. © 2015 The British Pharmacological Society.

Characterization of 12 GnRH peptide agonists – a kinetic perspective

PubMed Central

Nederpelt, Indira; Georgi, Victoria; Schiele, Felix; Nowak‐Reppel, Katrin; Fernández‐Montalván, Amaury E.; IJzerman, Adriaan P.

2015-01-01

Background and Purpose Drug‐target residence time is an important, yet often overlooked, parameter in drug discovery. Multiple studies have proposed an increased residence time to be beneficial for improved drug efficacy and/or longer duration of action. Currently, there are many drugs on the market targeting the gonadotropin‐releasing hormone (GnRH) receptor for the treatment of hormone‐dependent diseases. Surprisingly, the kinetic receptor‐binding parameters of these analogues have not yet been reported. Therefore, this project focused on determining the receptor‐binding kinetics of 12 GnRH peptide agonists, including many marketed drugs. Experimental Approach A novel radioligand‐binding competition association assay was developed and optimized for the human GnRH receptor with the use of a radiolabelled peptide agonist, [125I]‐triptorelin. In addition to radioligand‐binding studies, a homogeneous time‐resolved FRET Tag‐lite™ method was developed as an alternative assay for the same purpose. Key Results Two novel competition association assays were successfully developed and applied to determine the kinetic receptor‐binding characteristics of 12 high‐affinity GnRH peptide agonists. Results obtained from both methods were highly correlated. Interestingly, the binding kinetics of the peptide agonists were more divergent than their affinities with residence times ranging from 5.6 min (goserelin) to 125 min (deslorelin). Conclusions and Implications Our research provides new insights by incorporating kinetic, next to equilibrium, binding parameters in current research and development that can potentially improve future drug discovery targeting the GnRH receptor. PMID:26398856

(+)-3-( sup 123 I)Iodo-MK-801: Synthesis and characterization of binding to the N-methyl-D-aspartate receptor complex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ransom, R.W.; Wai-si Eng; Burns, H.D.

1990-01-01

Synthetic methods have been established for preparing high specific activity (+)-3-({sup 123}I)Iodo-MK-801 in high radiochemical yield. The binding of the radiotracer to rat cortical membranes has been examine to assess its potential use as an in vivo imaging agent for the N-methyl-D-aspartate (NMDA) receptor-ion channel complex. Under the conditions of the assay, specific (+)-3-({sup 123}I)Iodo-MK-801 binding to membrane homogenates represented greater than 95% of the total binding. Several structurally distinct, noncompetitive NMDA receptor antagonists inhibited binding with potencies in accordance with their reported inhibitory activity at the receptor complex. The concentration of ({plus minus})-3-Iodo-MK-801 required to inhibit 50% of (+)-3-({supmore » 123}I)Iodo-MK-801 binding (IC{sub 50}) was 3.4 nM when using a low ionic strength assay buffer and 5.5 nM in a physiological buffer. In a thoroughly washed membrane preparation, (+)-3-({sup 123}I)Iodo-MK-801 binding was enhanced by L-glutamate and glycine at concentrations known to activate the NMDA receptor. The results indicate that (+)-3-({sup 123}I)Iodo-MK-801 specifically labels the NMDA receptor complex in rat brain membranes and the retention of high affinity under near physiological assay conditions suggests that it may be useful as a SPECT imaging agent for the receptor in vivo.« less

Zinc finger transcription factor CASZ1 interacts with histones, DNA repair proteins and recruits NuRD complex to regulate gene transcription.

PubMed

Liu, Zhihui; Lam, Norris; Thiele, Carol J

2015-09-29

The zinc finger transcription factor CASZ1 has been found to control neural fate-determination in flies, regulate murine and frog cardiac development, control murine retinal cell progenitor expansion and function as a tumor suppressor gene in humans. However, the molecular mechanism by which CASZ1 regulates gene transcription to exert these diverse biological functions has not been described. Here we identify co-factors that are recruited by CASZ1b to regulate gene transcription using co-immunoprecipitation (co-IP) and mass spectrometry assays. We find that CASZ1b binds to the nucleosome remodeling and histone deacetylase (NuRD) complex, histones and DNA repair proteins. Mutagenesis of the CASZ1b protein assay demonstrates that the N-terminus of CASZ1b is required for NuRD binding, and a poly(ADP-ribose) binding motif in the CASZ1b protein is required for histone H3 and DNA repair proteins binding. The N-terminus of CASZ1b fused to an artificial DNA-binding domain (GAL4DBD) causes a significant repression of transcription (5xUAS-luciferase assay), which could be blocked by treatment with an HDAC inhibitor. Realtime PCR results show that the transcriptional activity of CASZ1b mutants that abrogate NuRD or histone H3/DNA binding is significantly decreased. This indicates a model in which CASZ1b binds to chromatin and recruits NuRD complexes to orchestrate epigenetic-mediated transcriptional programs.

Hydroxylated polybrominated diphenyl ethers exhibit different activities on thyroid hormone receptors depending on their degree of bromination.

PubMed

Ren, Xiao-Min; Guo, Liang-Hong; Gao, Yu; Zhang, Bin-Tian; Wan, Bin

2013-05-01

Polybrominated diphenyl ethers (PBDEs) have been shown to disrupt thyroid hormone (TH) functions in experimental animals, and one of the proposed disruption mechanisms is direct binding of hydroxylated PBDE (OH-PBDE) to TH receptors (TRs). However, previous data on TH receptor binding and TH activity of OH-PBDEs were very limited and sometimes inconsistent. In the present paper, we examined the binding potency of ten OH-PBDEs with different degrees of bromination to TR using a fluorescence competitive binding assay. The results showed that the ten OH-PBDEs bound to TR with potency that correlated to their bromination level. We further examined their effect on TR using a coactivator binding assay and GH3 cell proliferation assay. Different TR activities of OH-PBDEs were observed depending on their degree of bromination. Four low-brominated OH-PBDEs (2'-OH-BDE-28, 3'-OH-BDE-28, 5-OH-BDE-47, 6-OH-BDE-47) were found to be TR agonists, which recruited the coactivator peptide and enhanced GH3 cell proliferation. However, three high-brominated OH-PBDEs (3-OH-BDE-100, 3'-OH-BDE-154, 4-OH-BDE-188) were tested to be antagonists. Molecular docking was employed to simulate the interactions of OH-PBDEs with TR and identify the structural determinants for TR binding and activity. According to the docking results, low-brominated OH-PBDEs, which are weak binders but TR agonists, bind with TR at the inner side of its binding pocket, whereas high-brominated compounds, which are potent binders but TR antagonists, reside at the outer region. These results indicate that OH-PBDEs have different activities on TR (agonistic or antagonistic), possibly due to their different binding geometries with the receptor. Copyright © 2013 Elsevier Inc. All rights reserved.

A High Content Drug Screen Identifies Ursolic Acid as an Inhibitor of Amyloid β Protein Interactions with Its Receptor CD36*

PubMed Central

Wilkinson, Kim; Boyd, Justin D.; Glicksman, Marcie; Moore, Kathryn J.; El Khoury, Joseph

2011-01-01

A pathological hallmark of Alzheimer disease (AD) is deposition of amyloid β (Aβ) in the brain. Aβ binds to microglia via a receptor complex that includes CD36 leading to production of proinflammatory cytokines and neurotoxic reactive oxygen species and subsequent neurodegeneration. Interruption of Aβ binding to CD36 is a potential therapeutic strategy for AD. To identify pharmacologic inhibitors of Aβ binding to CD36, we developed a 384-well plate assay for binding of fluorescently labeled Aβ to Chinese hamster ovary cells stably expressing human CD36 (CHO-CD36) and screened an Food and Drug Administration-approved compound library. The assay was optimized based on the cells' tolerance to dimethyl sulfoxide, Aβ concentration, time required for Aβ binding, reproducibility, and signal-to-background ratio. Using this assay, we identified four compounds as potential inhibitors of Aβ binding to CD36. These compounds were ursolic acid, ellipticine, zoxazolamine, and homomoschatoline. Of these compounds, only ursolic acid, a naturally occurring pentacyclic triterpenoid, successfully inhibited binding of Aβ to CHO-CD36 cells in a dose-dependent manner. The ursolic acid effect reached a plateau at ∼20 μm, with a maximal inhibition of 64%. Ursolic acid also blocked binding of Aβ to microglial cells and subsequent ROS production. Our data indicate that cell-based high-content screening of small molecule libraries for their ability to block binding of Aβ to its receptors is a useful tool to identify novel inhibitors of receptors involved in AD pathogenesis. Our data also suggest that ursolic acid is a potential therapeutic agent for AD via its ability to block Aβ-CD36 interactions. PMID:21835916

A receptor binding assay for paralytic shellfish poisoning toxins: recent advances and applications.

PubMed

Powell, C L; Doucette, G J

1999-01-01

We recently described a high throughput receptor binding assay for paralytic shellfish poisoning (PSP) toxins, the use of the assay for detecting toxic activity in shellfish and algal extracts, and the validation of 11-[3H]-tetrodotoxin as an alternative radioligand to the [3H]-saxitoxin conventionally employed in the assay. Here, we report a dramatic increase in assay efficiency through application of microplate scintillation technology, resulting in an assay turn around time of 4 h. Efforts are now focused on demonstrating the range of applications for which this receptor assay can provide data comparable to the more time consuming, technically demanding HPLC analysis of PSP toxins, currently the method of choice for researchers. To date, we have compared the results of both methods for a variety of sample types, including different genera of PSP toxin producing dinoflagellates (e.g. Alexandrium lusitanicum, r2 = 0.9834, n = 12), size-fractioned field samples of Alexandrium spp. (20-64 microm; r2 = 0.9997, n = 10) as well as its associated zooplankton grazer community (200-500 microm: r2 = 0.6169, n = 10; >500 microm: r2 = 0.5063, n = 10), and contaminated human fluids (r2 = 0.9661, n = 7) from a PSP outbreak. Receptor-based STX equivalent values for all but the zooplankton samples were highly correlated and exhibited close quantitative agreement with those produced by HPLC. While the PSP receptor binding assay does not provide information on toxin composition obtainable by HPLC, it does represent a robust and reliable means of rapidly assessing PSP-like toxicity in laboratory and field samples. Moreover, this assay should be effective as a screening tool for use by public health officials in responding to suspected cases of PSP intoxication.

Identification of the plant compound geraniin as a novel Hsp90 inhibitor.

PubMed

Vassallo, Antonio; Vaccaro, Maria Carmela; De Tommasi, Nunziatina; Dal Piaz, Fabrizio; Leone, Antonella

2013-01-01

Besides its function in normal cellular growth, the molecular chaperone heat shock protein 90 (Hsp90) binds to a large number of client proteins required for promoting cancer cell growth and/or survival. In an effort to discover new small molecules able to inhibit the Hsp90 ATPase and chaperoning activities, we screened, by a surface plasmon resonance assay, a small library including different plant polyphenols. The ellagitannin geraniin, was identified as the most promising molecule, showing a binding affinity to Hsp90α similar to that of 17-(allylamino)-17-demethoxygeldanamycin (17AGG). Geraniin was able to inhibit in vitro the Hsp90α ATPase activity in a dose-dependent manner, with an inhibitory efficiency comparable to that measured for 17-AAG. In addition, this compound compromised the chaperone activity of Hsp90α, monitored by the citrate synthase thermal induced aggregation assay. Geraniin decreased the viability of HeLa and Jurkat cell lines and caused an arrest in G2/M phase. We also proved that following exposure to different concentrations of geraniin, the level of expression of the client proteins c-Raf, pAkt, and EGFR was strongly down-regulated in both the cell lines. These results, along with the finding that geraniin did not exert any appreciable cytotoxicity on normal cells, encourage further studies on this compound as a promising chemical scaffold for the design of new Hsp90 inhibitors.

Folate receptor {alpha} regulates cell proliferation in mouse gonadotroph {alpha}T3-1 cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yao, Congjun; Evans, Chheng-Orn; Stevens, Victoria L.

We have previously found that the mRNA and protein levels of the folate receptor alpha (FR{alpha}) are uniquely over-expressed in clinically human nonfunctional (NF) pituitary adenomas, but the mechanistic role of FR{alpha} has not fully been determined. We investigated the effect of FR{alpha} over-expression in the mouse gonadotroph {alpha}T3-1 cell line as a model for NF pituitary adenomas. We found that the expression and function of FR{alpha} were strongly up-regulated, by Western blotting and folic acid binding assay. Furthermore, we found a higher cell growth rate, an enhanced percentage of cells in S-phase by BrdU assay, and a higher PCNAmore » staining. These observations indicate that over-expression of FR{alpha} promotes cell proliferation. These effects were abrogated in the same {alpha}T3-1 cells when transfected with a mutant FR{alpha} cDNA that confers a dominant-negative phenotype by inhibiting folic acid binding. Finally, by real-time quantitative PCR, we found that mRNA expression of NOTCH3 was up-regulated in FR{alpha} over-expressing cells. In summary, our data suggests that FR{alpha} regulates pituitary tumor cell proliferation and mechanistically may involve the NOTCH pathway. Potentially, this finding could be exploited to develop new, innovative molecular targeted treatment for human NF pituitary adenomas.« less

Cytometer on a chip

NASA Technical Reports Server (NTRS)

Lynes, Michael A. (Inventor); Fernandez, Salvador M. (Inventor)

2010-01-01

An assay technique for label-free, highly parallel, qualitative and quantitative detection of specific cell populations in a sample and for assessing cell functional status, cell-cell interactions and cellular responses to drugs, environmental toxins, bacteria, viruses and other factors that may affect cell function. The technique includes a) creating a first array of binding regions in a predetermined spatial pattern on a sensor surface capable of specifically binding the cells to be assayed; b) creating a second set of binding regions in specific spatial patterns relative to the first set designed to efficiently capture potential secreted or released products from cells captured on the first set of binding regions; c) contacting the sensor surface with the sample, and d) simultaneously monitoring the optical properties of all the binding regions of the sensor surface to determine the presence and concentration of specific cell populations in the sample and their functional status by detecting released or secreted bioproducts.

DNA-binding activity of TNF-{alpha} inducing protein from Helicobacter pylori

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuzuhara, T.; Suganuma, M.; Oka, K.

2007-11-03

Tumor necrosis factor-{alpha} (TNF-{alpha}) inducing protein (Tip{alpha}) is a carcinogenic factor secreted from Helicobacter pylori (H. pylori), mediated through both enhanced expression of TNF-{alpha} and chemokine genes and activation of nuclear factor-{kappa}B. Since Tip{alpha} enters gastric cancer cells, the Tip{alpha} binding molecules in the cells should be investigated. The direct DNA-binding activity of Tip{alpha} was observed by pull down assay using single- and double-stranded genomic DNA cellulose. The surface plasmon resonance assay, indicating an association between Tip{alpha} and DNA, revealed that the affinity of Tip{alpha} for (dGdC)10 is 2400 times stronger than that of del-Tip{alpha}, an inactive Tip{alpha}. This suggestsmore » a strong correlation between DNA-binding activity and carcinogenic activity of Tip{alpha}. And the DNA-binding activity of Tip{alpha} was first demonstrated with a molecule secreted from H. pylori.« less

Radioligand Recognition of Insecticide Targets.

PubMed

Casida, John E

2018-04-04

Insecticide radioligands allow the direct recognition and analysis of the targets and mechanisms of toxic action critical to effective and safe pest control. These radioligands are either the insecticides themselves or analogs that bind at the same or coupled sites. Preferred radioligands and their targets, often in both insects and mammals, are trioxabicyclooctanes for the γ-aminobutyric acid (GABA) receptor, avermectin for the glutamate receptor, imidacloprid for the nicotinic receptor, ryanodine and chlorantraniliprole for the ryanodine receptor, and rotenone or pyridaben for NADH + ubiquinone oxidoreductase. Pyrethroids and other Na + channel modulator insecticides are generally poor radioligands due to lipophilicity and high nonspecific binding. For target site validation, the structure-activity relationships competing with the radioligand in the binding assays should be the same as that for insecticidal activity or toxicity except for rapidly detoxified or proinsecticide analogs. Once the radioligand assay is validated for relevance, it will often help define target site modifications on selection of resistant pest strains, selectivity between insects and mammals, and interaction with antidotes and other chemicals at modulator sites. Binding assays also serve for receptor isolation and photoaffinity labeling to characterize the interactions involved.

Streptomyces coelicolor SCO4226 Is a Nickel Binding Protein

PubMed Central

Jin, Hua; Zhang, Rong-Guang; Virolle, Marie-Joelle; Chen, Yuxing; Zhou, Cong-Zhao

2014-01-01

The open reading frame SCO4226 of Streptomyces coelicolor A3(2) encodes an 82-residue hypothetical protein. Biochemical assays revealed that each SCO4226 dimer binds four nickel ions. To decipher the molecular function, we solved the crystal structures of SCO4226 in both apo- and nickel-bound (Ni-SCO4226) forms at 1.30 and 2.04 Å resolution, respectively. Each subunit of SCO4226 dimer adopts a canonical ferredoxin-like fold with five β-strands flanked by two α-helices. In the structure of Ni-SCO4226, four nickel ions are coordinated at the surface of the dimer. Further biochemical assays suggested that the binding of Ni2+ triggers the self-aggregation of SCO4226 in vitro. In addition, RT-qPCR assays demonstrated that the expression of SCO4226 gene in S. coelicolor is specifically up-regulated by the addition of Ni2+, but not other divalent ions such as Cu2+, Mn2+ or Co2+. All these results suggested that SCO4226 acts as a nickel binding protein, probably required for nickel sequestration and/or detoxification. PMID:25285530

How Much Binding Affinity Can be Gained by Filling a Cavity?

PubMed Central

Kawasaki, Yuko; Chufan, Eduardo E.; Lafont, Virginie; Hidaka, Koushi; Kiso, Yoshiaki; Amzel, L. Mario; Freire, Ernesto

2011-01-01

Binding affinity optimization is critical during drug development. Here we evaluate the thermodynamic consequences of filling a binding cavity with functionalities of increasing van der Waals radii (-H, -F, -Cl and CH3) that improve the geometric fit without participating in hydrogen bonding or other specific interactions. We observe a binding affinity increase of two orders of magnitude. There appears to be three phases in the process. The first phase is associated with the formation of stable van der Waals interactions. This phase is characterized by a gain in binding enthalpy and a loss in binding entropy, attributed to a loss of conformational degrees of freedom. For the specific case presented in this paper, the enthalpy gain amounts to −1.5 kcal/mol while the entropic losses amount to +0.9 kcal/mol resulting in a net 3.5-fold affinity gain. The second phase is characterized by simultaneous enthalpic and entropic gains. This phase improves the binding affinity 25-fold. The third phase represents the collapse of the trend and is triggered by the introduction of chemical functionalities larger than the binding cavity itself (CH(CH3)2). It is characterized by large enthalpy and affinity losses. The thermodynamic signatures associated with each phase provide guidelines for lead optimization. PMID:20028396

A PROP1-binding factor, AES cloned by yeast two-hybrid assay represses PROP1-induced Pit-1 gene expression.

PubMed

Sugiyama, Yuka; Ikeshita, Nobuko; Shibahara, Hiromi; Yamamoto, Daisuke; Kawagishi, Mayuko; Iguchi, Genzo; Iida, Keiji; Takahashi, Yutaka; Kaji, Hidesuke; Chihara, Kazuo; Okimura, Yasuhiko

2013-08-25

PROP1 mutation causes combined pituitary hormone deficiency (CPHD). Several mutations are located in a transactivation domain (TAD) of Prop1, and the loss of TAD binding to cofactors is likely the cause of CPHD. PROP1 cofactors have not yet been identified. In the present study, we aimed to identify the PROP1-interacting proteins from the human brain cDNA library. Using a yeast two-hybrid assay, we cloned nine candidate proteins that may bind to PROP1. Of those nine candidates, amino-terminal enhancer of split (AES) was the most abundant, and we analyzed the AES function. AES dose-dependently decreased the PROP1-induced Pit-1 reporter gene expression. An immunoprecipitation assay revealed the relationship between AES and PROP1. In a mammalian two-hybrid assay, a leucine zipper-like motif of the AES Q domain was identified as a region that interacted with TAD. These results indicated that AES was a corepressor of PROP1. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Identification of Tight-Binding Plasmepsin II and Falcipain 2 Inhibitors in Aqueous Extracts of Marine Invertebrates by the Combination of Enzymatic and Interaction-Based Assays

PubMed Central

Salas-Sarduy, Emir; Guerra, Yasel; Covaleda Cortés, Giovanni; Avilés, Francesc Xavier; Chávez Planes, María A.

2017-01-01

Natural products from marine origin constitute a very promising and underexplored source of interesting compounds for modern biotechnological and pharmaceutical industries. However, their evaluation is quite challenging and requires specifically designed assays to reliably identify the compounds of interest in a highly heterogeneous and interfering context. In the present study, we describe a general strategy for the confident identification of tight-binding protease inhibitors in the aqueous extracts of 62 Cuban marine invertebrates, using Plasmodium falciparum hemoglobinases Plasmepsin II and Falcipain 2 as model enzymes. To this end, we first developed a screening strategy that combined enzymatic with interaction-based assays and then validated screening conditions using five reference extracts. Interferences were evaluated and minimized. The results from the massive screening of such extracts, the validation of several hits by a variety of interaction-based assays and the purification and functional characterization of PhPI, a multifunctional and reversible tight-binding inhibitor for Plasmepsin II and Falcipain 2 from the gorgonian Plexaura homomalla, are presented. PMID:28430158

Structural Requirements For Bone Sialoprotein Binding And Modulation Of Matrix Metalloproteinase-2

PubMed Central

Jain, Alka; Karadag, Abdullah; Fisher, Larry W.; Fedarko, Neal S.

2008-01-01

Bone sialoprotein (BSP) has been shown to induce limited gelatinase activity in latent matrix metalloproteinase-2 (MMP-2) without removal of the propeptide and to restore enzymatic activity to MMP-2 previously inhibited by tissue inhibitor of matrix metalloproteinase-2 (TIMP2). The current study identifies structural domains in human BSP and MMP-2 that contribute to these interactions. The 26 amino acid domain encoded by exon 4 of BSP is shown by a series of binding and activity assays to be involved in the displacement of MMP-2′s propeptide from the active site and thereby inducing the protease activity. Binding assays in conjunction with enzyme activity assays demonstrate that both amino- and carboxy-terminal domains of BSP contribute to restoration of activity to TIMP2-inhibited MMP-2, while the MMP-2 hemopexin domain is not required for reactivation. PMID:18729384

Structural requirements for bone sialoprotein binding and modulation of matrix metalloproteinase-2.

PubMed

Jain, Alka; Karadag, Abdullah; Fisher, Larry W; Fedarko, Neal S

2008-09-23

Bone sialoprotein (BSP) has been shown to induce limited gelatinase activity in latent matrix metalloproteinase-2 (MMP-2) without removal of the propeptide and to restore enzymatic activity to MMP-2 previously inhibited by tissue inhibitor of matrix metalloproteinase-2 (TIMP2). The current study identifies structural domains in human BSP and MMP-2 that contribute to these interactions. The 26 amino acid domain encoded by exon 4 of BSP is shown by a series of binding and activity assays to be involved in the displacement of MMP-2's propeptide from the active site and thereby inducing the protease activity. Binding assays in conjunction with enzyme activity assays demonstrate that both amino- and carboxy-terminal domains of BSP contribute to restoration of activity to TIMP2-inhibited MMP-2, while the MMP-2 hemopexin domain is not required for reactivation.

Addressing matrix effects in ligand-binding assays through the use of new reagents and technology.

PubMed

Chilewski, Shannon D; Mora, Johanna R; Gleason, Carol; DeSilva, Binodh

2014-04-01

Ligand-binding assays (LBAs) used in the quantification of biotherapeutics for pharmacokinetic determinations rely on interactions between reagents (antibodies or target molecule) and the biotherapeutic. Most LBAs do not employ an analyte extraction procedure and are susceptible to matrix interference. Here, we present a case study on the development of a LBA for the quantification of a PEGylated domain antibody where matrix interference was observed. The assay used to support the single ascending dose study was a plate-based electrochemiluminescent assay with a lower limit of quantification of 80 ng/mL. To meet sensitivity requirements of future studies, new reagents and the Gyrolab™ Workstation were evaluated. Assay sensitivity improved nearly threefold in the final method utilizing new antibody reagents, a buffer containing blockers to human anti-animal antibodies, and the Gyrolab Workstation. Experimental data indicate that all factors changed played a role in overcoming matrix effects.

Paraffin section immunocytochemistry and cytosol-based ligand-binding assays for ER and PR detection in breast cancer: the time has come for more objectivity.

PubMed

Goussard, J

1998-10-23

The importance of the receptor level in breast cancer as an indicator of hormone response has been extensively studied for more than 20 years. Besides cytosol-based ligand-binding assays (dextran-coated charcoal assay, DCC), new methods using monoclonal antibodies raised against estrogen and progesterone receptors allow for the detection of receptors both in cytosol extracts (enzyme immunoassay, EIA) and in tissue sections (immunocytochemical assay, ICA). The biochemical assays (DCC and EIA) as well as the immunochemical detection (ICA) have specific qualities and produce original information which is useful for the therapeutic decision. While DCC gives a measure of the receptor level, whatever the real source of synthesis (normal and/or neoplastic tissue), ICA locates the positive cells and their relative proportion in the tumor. Both methods present their own advantages and disadvantages which are summarized in this study.

Multiplexed analysis of protein-ligand interactions by fluorescence anisotropy in a microfluidic platform.

PubMed

Cheow, Lih Feng; Viswanathan, Ramya; Chin, Chee-Sing; Jennifer, Nancy; Jones, Robert C; Guccione, Ernesto; Quake, Stephen R; Burkholder, William F

2014-10-07

Homogeneous assay platforms for measuring protein-ligand interactions are highly valued due to their potential for high-throughput screening. However, the implementation of these multiplexed assays in conventional microplate formats is considerably expensive due to the large amounts of reagents required and the need for automation. We implemented a homogeneous fluorescence anisotropy-based binding assay in an automated microfluidic chip to simultaneously interrogate >2300 pairwise interactions. We demonstrated the utility of this platform in determining the binding affinities between chromatin-regulatory proteins and different post-translationally modified histone peptides. The microfluidic chip assay produces comparable results to conventional microtiter plate assays, yet requires 2 orders of magnitude less sample and an order of magnitude fewer pipetting steps. This approach enables one to use small samples for medium-scale screening and could ease the bottleneck of large-scale protein purification.

Quantitation of proteins using a dye-metal-based colorimetric protein assay.

PubMed

Antharavally, Babu S; Mallia, Krishna A; Rangaraj, Priya; Haney, Paul; Bell, Peter A

2009-02-15

We describe a dye-metal (polyhydroxybenzenesulfonephthalein-type dye and a transition metal) complex-based total protein determination method. The binding of the complex to protein causes a shift in the absorption maximum of the dye-metal complex from 450 to 660 nm. The dye-metal complex has a reddish brown color that changes to green on binding to protein. The color produced from this reaction is stable and increases in a proportional manner over a broad range of protein concentrations. The new Pierce 660 nm Protein Assay is very reproducible, rapid, and more linear compared with the Coomassie dye-based Bradford assay. The assay reagent is room temperature stable, and the assay is a simple and convenient mix-and-read format. The assay has a moderate protein-to-protein variation and is compatible with most detergents, reducing agents, and other commonly used reagents. This is an added advantage for researchers needing to determine protein concentrations in samples containing both detergents and reducing agents.

Beta-endorphin. Biological activity of synthetic analogs with analgesia inhibiting property in rat vas deferens and guinea pig ileum assays.

PubMed

Ho, C L; Li, C H

1985-03-01

Three synthetic analogs of human beta-endorphin (beta h-EP) (I, [Gln8, Gly31]-beta h-EP-Gly-Gly-NH2; II, [Arg9,12,24,28,29]-beta h-EP and III, [Cys11,26, Phe27, Gly31]-beta h-EP), which have been shown to possess potent inhibiting activity to beta h-EP-induced analgesia, were assayed in rat vas deferens and guinea pig ileum bioassay systems. In the rat vas deferens assay, relative potencies of these analogs were beta h-EP, 100; I, 30; II, 40; III, 1, whereas in the guinea pig ileum assay: beta h-EP, 100; I, 184; II, 81; III, 163. From previous studies on their analgesia potency in mice and opiate receptor-binding activity in rat brain membranes, their activity in rat vas deferens correlates well with the analgesic potency and the activity from guinea pig ileum assay shows good correlations with that from the opiate receptor-binding assay.

Isolation and purification of an early pregnancy factor-like molecule from culture supernatants obtained from lymphocytes of pregnant women: II. Identification of the molecule as a Fc-receptor-like molecule: a preliminary report.

PubMed

Aranha, C; Bordekar, A; Shahani, S

1998-11-01

Early pregnancy factor (EPF)-like activity from culture supernatants obtained from stimulated lymphocytes of pregnant women was characterized and identified. The enzyme-linked immunosorbent assay depending on the presence of "Fc" receptors on bovine spermatozoa was used to identify the EPF-like molecule purified by gel filtration and reverse-phase high-performance liquid chromatography. The results indicated that the crude lymphocyte culture supernatant, the EPF-positive G IV fraction obtained on gel filtration, and the EPF-positive reverse-phase high-performance liquid chromatography protein readily bound with the different concentrations of aggregated human gamma-globulin in a manner similar to that in which the standard control of aggregated human gamma-globulin binds to the bovine spermatozoa. EPF-like activity synthesized and secreted by lymphocytes during pregnancy may be a Fc-receptor-like molecule.

Probing structurally altered and aggregated states of therapeutically relevant proteins using GroEL coupled to bio-layer interferometry.

PubMed

Naik, Subhashchandra; Kumru, Ozan S; Cullom, Melissa; Telikepalli, Srivalli N; Lindboe, Elizabeth; Roop, Taylor L; Joshi, Sangeeta B; Amin, Divya; Gao, Phillip; Middaugh, C Russell; Volkin, David B; Fisher, Mark T

2014-10-01

The ability of a GroEL-based bio-layer interferometry (BLI) assay to detect structurally altered and/or aggregated species of pharmaceutically relevant proteins is demonstrated. Assay development included optimizing biotinylated-GroEL immobilization to streptavidin biosensors, combined with biophysical and activity measurements showing native and biotinylated GroEL are both stable and active. First, acidic fibroblast growth factor (FGF-1) was incubated under conditions known to promote (40°C) and inhibit (heparin addition) molten globule formation. Heat exposed (40°C) FGF-1 exhibited binding to GroEL-biosensors, which was significantly diminished in the presence of heparin. Second, a polyclonal human IgG solution containing 6-8% non-native dimer showed an increase in higher molecular weight aggregates upon heating by size exclusion chromatography (SEC). The poly IgG solution displayed binding to GroEL-biosensors initially with progressively increased binding upon heating. Enriched preparations of the IgG dimers or monomers showed significant binding to GroEL-biosensors. Finally, a thermally treated IgG1 monoclonal antibody (mAb) solution also demonstrated increased GroEL-biosensor binding, but with different kinetics. The bound complexes could be partially to fully dissociated after ATP addition (i.e., specific GroEL binding) depending on the protein, environmental stress, and the assay's experimental conditions. Transmission electron microscopy (TEM) images of GroEL-mAb complexes, released from the biosensor, also confirmed interaction of bound complexes at the GroEL binding site with heat-stressed mAb. Results indicate that the GroEL-biosensor-BLI method can detect conformationally altered and/or early aggregation states of proteins, and may potentially be useful as a rapid, stability-indicating biosensor assay for monitoring the structural integrity and physical stability of therapeutic protein candidates. © 2014 The Protein Society.

Reactive arthritis and serum levels of mannose binding lectin – lack of association

PubMed Central

LOCHT, H; CHRISTIANSEN, M; LAURSEN, I

2003-01-01

The purpose was to evaluate the possible association of serum mannose binding lectin (s-MBL) levels on type of triggering microbe, duration of diarrhoea, incidence and course of reactive arthritis (ReA) caused by Salmonella, Yersinia and Campylobacter. Sixty patients with ReA of 1–228 months duration, 173 patients with ReA or uncomplicated enterocolitis caused by Campylobacter, 226 sera from patients with elevated antibody levels against Salmonella, Yersinia or Campylobacter, and 114 blood donors were tested for s-MBL using ELISA technique, both direct mannan binding assay and sandwich ELISA. s-MBL was compared with C-reactive protein (CRP) levels and with the ability of activating complement C4. Among the 114 donors 9% had s-MBL <50 µg/l, 16% had from 50–500 µg/l and 75% had >500 µg/l. The distribution of s-MBL levels in the three-patient groups did not differ significantly from the controls. There were no indications that low s-MBL was associated with prolonged duration of arthritis, diarrhoea or individual bacterial infections. The two MBL assays were comparable with respect to serum concentrations, indicating that the actual circulating MBL was also functionally active. s-MBL exhibited acute phase reactant behaviour and correlated to CRP level, but only in patients with s-MBL concentrations exceeding 1000 µg/l. MBL in 10 randomly selected ReA sera were tested for the ability to activate complement C4. The results did not differ from those of donor controls. This study demonstrates that the distributions of s-MBL levels in serum among patients with ReA are not different from donor controls. The course, outcome or triggering bacteria are not associated with a particular level of s-MBL. PMID:12519401

Tandem E2F Binding Sites in the Promoter of the p107 Cell Cycle Regulator Control p107 Expression and Its Cellular Functions

PubMed Central

Burkhart, Deborah L.; Wirt, Stacey E.; Zmoos, Anne-Flore; Kareta, Michael S.; Sage, Julien

2010-01-01

The retinoblastoma tumor suppressor (Rb) is a potent and ubiquitously expressed cell cycle regulator, but patients with a germline Rb mutation develop a very specific tumor spectrum. This surprising observation raises the possibility that mechanisms that compensate for loss of Rb function are present or activated in many cell types. In particular, p107, a protein related to Rb, has been shown to functionally overlap for loss of Rb in several cellular contexts. To investigate the mechanisms underlying this functional redundancy between Rb and p107 in vivo, we used gene targeting in embryonic stem cells to engineer point mutations in two consensus E2F binding sites in the endogenous p107 promoter. Analysis of normal and mutant cells by gene expression and chromatin immunoprecipitation assays showed that members of the Rb and E2F families directly bound these two sites. Furthermore, we found that these two E2F sites controlled both the repression of p107 in quiescent cells and also its activation in cycling cells, as well as in Rb mutant cells. Cell cycle assays further indicated that activation of p107 transcription during S phase through the two E2F binding sites was critical for controlled cell cycle progression, uncovering a specific role for p107 to slow proliferation in mammalian cells. Direct transcriptional repression of p107 by Rb and E2F family members provides a molecular mechanism for a critical negative feedback loop during cell cycle progression and tumorigenesis. These experiments also suggest novel therapeutic strategies to increase the p107 levels in tumor cells. PMID:20585628

Multiple length peptide-pheromone variants produced by Streptococcus pyogenes directly bind Rgg proteins to confer transcriptional regulation.

PubMed

Aggarwal, Chaitanya; Jimenez, Juan Cristobal; Nanavati, Dhaval; Federle, Michael J

2014-08-08

Streptococcus pyogenes, a human-restricted pathogen, accounts for substantial mortality related to infections worldwide. Recent studies indicate that streptococci produce and respond to several secreted peptide signaling molecules (pheromones), including those known as short hydrophobic peptides (SHPs), to regulate gene expression by a quorum-sensing mechanism. Upon transport into the bacterial cell, pheromones bind to and modulate activity of receptor proteins belonging to the Rgg family of transcription factors. Previously, we reported biofilm regulation by the Rgg2/3 quorum-sensing circuit in S. pyogenes. The aim of this study was to identify the composition of mature pheromones from cell-free culture supernatants that facilitate biofilm formation. Bioluminescent reporters were employed to detect active pheromones in culture supernatants fractionated by reverse-phase chromatography, and mass spectrometry was used to characterize their properties. Surprisingly, multiple SHPs that varied by length were detected. Synthetic peptides of each variant were tested individually using bioluminescence reporters and biofilm growth assays, and although activities differed widely among the group, peptides comprising the C-terminal eight amino acids of the full-length native peptide were most active. Direct Rgg/SHP interactions were determined using a fluorescence polarization assay that utilized FITC-labeled peptide ligands. Peptide receptor affinities were seen to be as low as 500 nm and their binding affinities directly correlated with observed bioactivity. Revelation of naturally produced pheromones along with determination of their affinity for cognate receptors are important steps forward in designing compounds whose purpose is positioned for future therapeutics aimed at treating infections through the interference of bacterial communication. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Hsp90 Binds Directly to Fibronectin (FN) and Inhibition Reduces the Extracellular Fibronectin Matrix in Breast Cancer Cells

PubMed Central

Kenyon, Amy; Dhanani, Karim C. H.; Prinsloo, Earl; Edkins, Adrienne L.

2014-01-01

Heat shock protein 90 (Hsp90) has been identified in the extracellular space and has been shown to chaperone a finite number of extracellular proteins involved in cell migration and invasion. We used chemical cross-linking and immunoprecipitation followed by tandem mass spectrometry (MS/MS) to isolate a complex containing Hsp90 and the matrix protein fibronectin (FN) from breast cancer cells. Further analysis showed direct binding of Hsp90 to FN using an in vitro co-immunoprecipitation assay, a solid phase binding assay and surface plasmon resonance (SPR) spectroscopy. Confocal microscopy showed regions of co-localisation of Hsp90 and FN in breast cancer cell lines. Exogenous Hsp90β was shown to increase the formation of extracellular FN matrix in the Hs578T cell line, whilst knockdown or inhibition of Hsp90 led to a reduction in the levels of both soluble and insoluble FN and could be partially rescued by addition of exogenous Hsp90β. Treatment of cells with novobiocin led to internalization of FN into vesicles that were positive for the presence of the lysosomal marker, LAMP-1. Taken together, the direct interaction between FN and Hsp90, as well as the decreased levels of both soluble and insoluble FN upon Hsp90 inhibition or knockdown, suggested that FN may be a new client protein for Hsp90 and that Hsp90 was involved in FN matrix assembly and/or stability. The identification of FN as a putative client protein of Hsp90 suggests a role for Hsp90 in FN matrix stability, which is important for a number of fundamental cellular processes including embryogenesis, wound healing, cell migration and metastasis. PMID:24466266

Hsp90 binds directly to fibronectin (FN) and inhibition reduces the extracellular fibronectin matrix in breast cancer cells.

PubMed

Hunter, Morgan C; O'Hagan, Kyle L; Kenyon, Amy; Dhanani, Karim C H; Prinsloo, Earl; Edkins, Adrienne L

2014-01-01

Heat shock protein 90 (Hsp90) has been identified in the extracellular space and has been shown to chaperone a finite number of extracellular proteins involved in cell migration and invasion. We used chemical cross-linking and immunoprecipitation followed by tandem mass spectrometry (MS/MS) to isolate a complex containing Hsp90 and the matrix protein fibronectin (FN) from breast cancer cells. Further analysis showed direct binding of Hsp90 to FN using an in vitro co-immunoprecipitation assay, a solid phase binding assay and surface plasmon resonance (SPR) spectroscopy. Confocal microscopy showed regions of co-localisation of Hsp90 and FN in breast cancer cell lines. Exogenous Hsp90β was shown to increase the formation of extracellular FN matrix in the Hs578T cell line, whilst knockdown or inhibition of Hsp90 led to a reduction in the levels of both soluble and insoluble FN and could be partially rescued by addition of exogenous Hsp90β. Treatment of cells with novobiocin led to internalization of FN into vesicles that were positive for the presence of the lysosomal marker, LAMP-1. Taken together, the direct interaction between FN and Hsp90, as well as the decreased levels of both soluble and insoluble FN upon Hsp90 inhibition or knockdown, suggested that FN may be a new client protein for Hsp90 and that Hsp90 was involved in FN matrix assembly and/or stability. The identification of FN as a putative client protein of Hsp90 suggests a role for Hsp90 in FN matrix stability, which is important for a number of fundamental cellular processes including embryogenesis, wound healing, cell migration and metastasis.

Sulforaphane and alpha-lipoic acid upregulate the expression of the pi class of glutathione S-transferase through c-jun and Nrf2 activation.

PubMed

Lii, Chong-Kuei; Liu, Kai-Li; Cheng, Yi-Ping; Lin, Ai-Hsuan; Chen, Haw-Wen; Tsai, Chia-Wen

2010-05-01

The anticarcinogenic effect of dietary organosulfur compounds has been partly attributed to their modulation of the activity and expression of phase II detoxification enzymes. Our previous studies indicated that garlic allyl sulfides upregulate the expression of the pi class of glutathione S-transferase (GSTP) through the activator protein-1 pathway. Here, we examined the modulatory effect of sulforaphane (SFN) and alpha-lipoic acid (LA) or dihydrolipoic acid (DHLA) on GSTP expression in rat Clone 9 liver cells. Cells were treated with LA or DHLA (50-600 micromol/L) or SFN (0.2-5 micromol/L) for 24 h. Immunoblots and real-time PCR showed that SFN, LA, and DHLA dose dependently induced GSTP protein and mRNA expression. Compared with the induction by the garlic organosulfur compound diallyl trisulfide (DATS), the effectiveness was in the order of SFN > DATS > LA = DHLA. The increase in GSTP enzyme activity in cells treated with 5 micromol/L SFN, 50 micromol/L DATS, and 600 micromol/L LA and DHLA was 172, 75, 122, and 117%, respectively (P < 0.05). A reporter assay showed that the GSTP enhancer I (GPEI) was required for GSTP induction by the organosulfur compounds. Electromobility gel shift assays showed that the DNA binding of GPEI to nuclear proteins reached a maximum at 0.5-1 h after SFN, LA, and DHLA treatment. Super-shift assay revealed that the transcription factors c-jun and nuclear factor erythroid-2 related factor 2 (Nrf2) were bound to GPEI. These results suggest that SFN and LA in either its oxidized or reduced form upregulate the transcription of the GSTP gene by activating c-jun and Nrf2 binding to the enhancer element GPEI.

Monitoring methotrexate in clinical samples from cancer patients during chemotherapy with a LSPR-based competitive sensor.

PubMed

Zhao, Sandy Shuo; Bichelberger, Mathilde A; Colin, Damien Y; Robitaille, Robert; Pelletier, Joelle N; Masson, Jean-François

2012-10-21

A competitive binding assay based on localized surface plasmon resonance (LSPR) of folic acid-functionalized gold nanoparticles (FA-AuNPs) and human dihydrofolate reductase enzyme (hDHFR) was developed to detect nanomolar to micromolar concentrations of the widely applied anti-cancer drug, methotrexate (MTX). By the nature of the competitive assay for MTX, the LSPR shift from specific binding between FA-AuNPs and the free enzyme was inversely proportional to the concentration of MTX. In addition, the dynamic range for MTX was tuned from 10(-11) to 10(-6) M by varying the concentration of hDHFR from 1 to 100 nM. Inter-day reproducibility and recovery of MTX spiked in phosphate buffer saline (PBS) were excellent. Potential interferents such as FA, trimethoprim (TMP) and 4-amino-4-deoxy-N-methylpteroic acid (DAMPA) did not occur in the concentration range of interest for MTX. Clinical samples of human serum from patients undergoing MTX chemotherapy were analyzed following a simple solid-phase extraction step to isolate MTX from the serum matrix, with a limit of detection of 155 nM. Validation of the LSPR method was carried out in comparison to Fluorescence Polarization Immunoassay (FPIA), a commonly used method in clinical settings, and LC-MS/MS, a reference technique. The results of the LSPR competitive assay compared well to FPIA and LC-MS/MS, with a slope of 2.4 and 1.1, respectively, for the correlation plots. The method established herein is intended for therapeutic drug monitoring (TDM) of MTX levels in patients undergoing chemotherapy to ensure safety and efficacy of the treatment.

Rice black streaked dwarf virus P7-2 forms a SCF complex through binding to Oryza sativa SKP1-like proteins, and interacts with GID2 involved in the gibberellin pathway.

PubMed

Tao, Tao; Zhou, Cui-Ji; Wang, Qian; Chen, Xiang-Ru; Sun, Qian; Zhao, Tian-Yu; Ye, Jian-Chun; Wang, Ying; Zhang, Zong-Ying; Zhang, Yong-Liang; Guo, Ze-Jian; Wang, Xian-Bing; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui

2017-01-01

As a core subunit of the SCF complex that promotes protein degradation through the 26S proteasome, S-phase kinase-associated protein 1 (SKP1) plays important roles in multiple cellular processes in eukaryotes, including gibberellin (GA), jasmonate, ethylene, auxin and light responses. P7-2 encoded by Rice black streaked dwarf virus (RBSDV), a devastating viral pathogen that causes severe symptoms in infected plants, interacts with SKP1 from different plants. However, whether RBSDV P7-2 forms a SCF complex and targets host proteins is poorly understood. In this study, we conducted yeast two-hybrid assays to further explore the interactions between P7-2 and 25 type I Oryza sativa SKP1-like (OSK) proteins, and found that P7-2 interacted with eight OSK members with different binding affinity. Co-immunoprecipitation assay further confirmed the interaction of P7-2 with OSK1, OSK5 and OSK20. It was also shown that P7-2, together with OSK1 and O. sativa Cullin-1, was able to form the SCF complex. Moreover, yeast two-hybrid assays revealed that P7-2 interacted with gibberellin insensitive dwarf2 (GID2) from rice and maize plants, which is essential for regulating the GA signaling pathway. It was further demonstrated that the N-terminal region of P7-2 was necessary for the interaction with GID2. Overall, these results indicated that P7-2 functioned as a component of the SCF complex in rice, and interaction of P7-2 with GID2 implied possible roles of the GA signaling pathway during RBSDV infection.

Rice black streaked dwarf virus P7-2 forms a SCF complex through binding to Oryza sativa SKP1-like proteins, and interacts with GID2 involved in the gibberellin pathway

PubMed Central

Wang, Qian; Chen, Xiang-Ru; Sun, Qian; Zhao, Tian-Yu; Ye, Jian-Chun; Wang, Ying; Zhang, Zong-Ying; Zhang, Yong-Liang; Guo, Ze-Jian; Wang, Xian-Bing; Li, Da-Wei; Yu, Jia-Lin

2017-01-01

As a core subunit of the SCF complex that promotes protein degradation through the 26S proteasome, S-phase kinase-associated protein 1 (SKP1) plays important roles in multiple cellular processes in eukaryotes, including gibberellin (GA), jasmonate, ethylene, auxin and light responses. P7-2 encoded by Rice black streaked dwarf virus (RBSDV), a devastating viral pathogen that causes severe symptoms in infected plants, interacts with SKP1 from different plants. However, whether RBSDV P7-2 forms a SCF complex and targets host proteins is poorly understood. In this study, we conducted yeast two-hybrid assays to further explore the interactions between P7-2 and 25 type I Oryza sativa SKP1-like (OSK) proteins, and found that P7-2 interacted with eight OSK members with different binding affinity. Co-immunoprecipitation assay further confirmed the interaction of P7-2 with OSK1, OSK5 and OSK20. It was also shown that P7-2, together with OSK1 and O. sativa Cullin-1, was able to form the SCF complex. Moreover, yeast two-hybrid assays revealed that P7-2 interacted with gibberellin insensitive dwarf2 (GID2) from rice and maize plants, which is essential for regulating the GA signaling pathway. It was further demonstrated that the N-terminal region of P7-2 was necessary for the interaction with GID2. Overall, these results indicated that P7-2 functioned as a component of the SCF complex in rice, and interaction of P7-2 with GID2 implied possible roles of the GA signaling pathway during RBSDV infection. PMID:28494021

Optimized multimodal nanoplatforms for targeting αvβ3 integrins

NASA Astrophysics Data System (ADS)

Bolley, Julie; Lalatonne, Yoann; Haddad, Oualid; Letourneur, Didier; Soussan, Michael; Pérard-Viret, Joelle; Motte, Laurence

2013-11-01

Magnetic Resonance Imaging (MRI) using contrast agents is a very powerful technique for diagnosis in clinical medicine and biomedical research. The synthesis of ultrasmall superparamagnetic iron oxide (USPIO) nanoparticles targeting αvβ3 integrins and acting as new MRI contrast agents seems to be a promising way for cancer diagnosis. Indeed, it is well established that αvβ3 integrin plays a key role in tumor angiogenesis acting like a receptor for the extracellular matrix proteins like vitronectin, fibronectin through the arginine-glycine-aspartic acid (RGD) sequence. Up-regulation of αvβ3 has been found to be associated with a wide range of cancers, making it a broad-spectrum tumor-marker. In this study, USPIO nanocrystals were synthesized and surface passivated with caffeic acid. The large number of the carboxylic acid functions at the outer surface of the nanoplatforms was used for the covalent coupling of Rhodamine123, polyethylene glycol (PEG) and cyclic RGD. Soluble carbodiimide (EDC) and N-hydroxysuccinimide (NHS) were used to crosslink carboxylic acid with the amino group of the ligands. We examined the design of the nanoplatforms with each individual entity and then the combination of two and three of them. Several methods were used to characterize the nanoparticle surface functionalization and the magnetic properties of these contrast agents were studied using a 1.5 T clinical MRI scanner. The affinity towards integrins was evidenced by surface plasmon resonance and solid-phase receptor-binding assay.Magnetic Resonance Imaging (MRI) using contrast agents is a very powerful technique for diagnosis in clinical medicine and biomedical research. The synthesis of ultrasmall superparamagnetic iron oxide (USPIO) nanoparticles targeting αvβ3 integrins and acting as new MRI contrast agents seems to be a promising way for cancer diagnosis. Indeed, it is well established that αvβ3 integrin plays a key role in tumor angiogenesis acting like a receptor for the extracellular matrix proteins like vitronectin, fibronectin through the arginine-glycine-aspartic acid (RGD) sequence. Up-regulation of αvβ3 has been found to be associated with a wide range of cancers, making it a broad-spectrum tumor-marker. In this study, USPIO nanocrystals were synthesized and surface passivated with caffeic acid. The large number of the carboxylic acid functions at the outer surface of the nanoplatforms was used for the covalent coupling of Rhodamine123, polyethylene glycol (PEG) and cyclic RGD. Soluble carbodiimide (EDC) and N-hydroxysuccinimide (NHS) were used to crosslink carboxylic acid with the amino group of the ligands. We examined the design of the nanoplatforms with each individual entity and then the combination of two and three of them. Several methods were used to characterize the nanoparticle surface functionalization and the magnetic properties of these contrast agents were studied using a 1.5 T clinical MRI scanner. The affinity towards integrins was evidenced by surface plasmon resonance and solid-phase receptor-binding assay. Electronic supplementary information (ESI) available: TEM image and size distribution of γFe2O3@CA nanoplatforms, determination of CA number per nanoparticle, dye R123, NH2-PEG-COOH and cRGD derivative coupling, biological stability, SPR analysis - theoretical analyte binding capacity, solid phase binding assay - determination of echistatin Kd. See DOI: 10.1039/c3nr03763k

Fluorine Scan of Inhibitors of the Cysteine Protease Human Cathepsin L: Dipolar and Quadrupolar Effects in the π-Stacking of Fluorinated Phenyl Rings on Peptide Amide Bonds.

PubMed

Giroud, Maude; Harder, Michael; Kuhn, Bernd; Haap, Wolfgang; Trapp, Nils; Schweizer, W Bernd; Schirmeister, Tanja; Diederich, François

2016-05-19

The π-stacking of fluorinated benzene rings on protein backbone amide groups was investigated, using a dual approach comprising enzyme-ligand binding studies complemented by high-level quantum chemical calculations. In the experimental study, the phenyl substituent of triazine nitrile inhibitors of human cathepsin L (hCatL), which stacks onto the peptide amide bond Gly67-Gly68 at the entrance of the S3 pocket, was systematically fluorinated, and differences in inhibitory potency were measured in a fluorimetric assay. Binding affinity is influenced by lipophilicity (clog P), the dipole and quadrupole moments of the fluorinated rings, but also by additional interactions of the introduced fluorine atoms with the local environment of the pocket. Generally, the higher the degree of fluorination, the better the binding affinities. Gas phase calculations strongly support the contributions of the molecular quadrupole moments of the fluorinated phenyl rings to the π-stacking interaction with the peptide bond. These findings provide useful guidelines for enhancing π-stacking on protein amide fragments. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Comparison of developmental gradients for growth, ATPase, and fusicoccin-binding activity in mung bean hypocotyls

NASA Technical Reports Server (NTRS)

Basel, L. E.; Cleland, R. E.

1992-01-01

A comparison has been made of the developmental gradients along a mung bean (Vigna radiata L.) hypocotyl of the growth rate, plasma membrane ATPase, and fusicoccin-binding protein (FCBP) activity to determine whether they are interrelated. The hook and four sequential 7.5 millimeter segments of the hypocotyl below the hook were cut. A plasma membrane-enriched fraction was isolated from each section by aqueous two-phase partitioning and assayed for vanadate-sensitive ATPase and FCBP activity. Each gradient had a distinctive and different pattern. Endogenous growth rate was maximal in the second section and much lower in the others. Vanadate-sensitive ATPase activity was maximal in the third section, but remained high in the older sections. Amounts of ATPase protein, shown by specific antibody binding, did not correlate with the amount of vanadate-sensitive ATPase activity in the three youngest sections. FCBP activity was almost absent in the first section, then increased to a maximum in the oldest sections. These data show that the growth rate is not determined by the ATPase activity, and that there are no fixed ratios between the ATPase and FCBP.

A novel antifungal peptide from leaves of the weed Stellaria media L.

PubMed

Rogozhin, Eugene A; Slezina, Marina P; Slavokhotova, Anna A; Istomina, Ekaterina A; Korostyleva, Tatyana V; Smirnov, Alexey N; Grishin, Eugene V; Egorov, Tsezi A; Odintsova, Tatyana I

2015-09-01

A novel peptide named SmAMP3 was isolated from leaves of common chickweed (Stellaria media L.) by a combination of acidic extraction and a single-step reversed-phase HPLC and sequenced. The peptide is basic and cysteine-rich, consists of 35 amino acids, and contains three disulphide bridges. Homology search revealed that SmAMP3 belongs to the family of hevein-like antimicrobial peptides carrying a conserved chitin-binding site. Efficient binding of chitin by SmAMP3 was proved by in vitro assays. Molecular modeling confirmed conservation of the chitin-binding module in SmAMP3 locating the variable amino acid residues to the solvent-exposed loops of the molecule. The peptide exhibits potent antifungal activity against important plant pathogens in the micromolar range, although it is devoid of antibacterial activity at concentrations below 10 μM. As judged by chromatographic behavior and mass spectrometric data, the peptide is constitutively expressed in above-ground organs and seeds of S. media plants, thus representing an important player in the preformed branch of the plant immune system. Copyright © 2015 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

Assessment of ability of murine and human anti-lipid A monoclonal antibodies to bind and neutralize lipopolysaccharide

PubMed Central

1993-01-01

The use of monoclonal antibodies (mAbs) directed to lipid A for the therapy of gram-negative sepsis is controversial. In an attempt to understand their biologic basis of action, we used a fluid-phase radioimmunoassay to measure binding between bacterial lipopolysaccharide (LPS) and two IgM mAbs directed to lipid A that are being evaluated for the treatment of gram-negative bacterial sepsis. Both antibodies bound 3H-LPS prepared from multiple strains of gram- negative bacteria when large excesses of antibody were used, although binding was modest and only slightly greater than control preparations. We also studied the ability of each anti-lipid A antibody to neutralize some of the biological effects of LPS in vitro. Despite large molar excesses, neither antibody neutralized LPS as assessed by the limulus lysate test, by a mitogenic assay for murine splenocytes, or by the production of cytokines interleukin (IL)-1, IL-6, or tumor necrosis factor from human monocytes in culture medium or in whole blood. Our experiments do not support the hypothesis that either of these anti- lipid A mAbs function by neutralizing the toxic effects of LPS. PMID:8418211

Fab Chaperone-Assisted RNA Crystallography (Fab CARC).

PubMed

Sherman, Eileen; Archer, Jennifer; Ye, Jing-Dong

2016-01-01

Recent discovery of structured RNAs such as ribozymes and riboswitches shows that there is still much to learn about the structure and function of RNAs. Knowledge learned can be employed in both biochemical research and clinical applications. X-ray crystallography gives unparalleled atomic-level structural detail from which functional inferences can be deduced. However, the difficulty in obtaining high-quality crystals and their phasing information make it a very challenging task. RNA crystallography is particularly arduous due to several factors such as RNA's paucity of surface chemical diversity, lability, repetitive anionic backbone, and flexibility, all of which are counterproductive to crystal packing. Here we describe Fab chaperone assisted RNA crystallography (CARC), a systematic technique to increase RNA crystallography success by facilitating crystal packing as well as expediting phase determination through molecular replacement of conserved Fab domains. Major steps described in this chapter include selection of a synthetic Fab library displayed on M13 phage against a structured RNA crystallization target, ELISA for initial choice of binding Fabs, Fab expression followed by protein A affinity then cation exchange chromatography purification, final choice of Fab by binding specificity and affinity as determined by a dot blot assay, and lastly gel filtration purification of a large quantity of chosen Fabs for crystallization.

[Radiolabelling and assay of Chinese agkistrodon acutus venom with carrier-free Na 125I].

PubMed

Gong, Y; Deng, C; Li, S; Li, L; Guan, J

1995-03-01

Chinese agkistroden acutus venom (CAAV) was radiolabelled with carrier-free Na 125I by the method of Iodogen. The specific activity and radiochemical purity for radiolabelled products were 4236.5 x 10(10) Bq/mmol and 98%, respectively. Each CAAV molecule carried 0.52 125I atom. Physical and chemical characterization of radiolabelled CAAV was similar to unradiolabelled CAAV. Binding analysis showed that 125I-CAAV was bound to platelet in a saturable manner. Binding sites per platelet were 13,255 +/- 6292/platelet. The dissociation constant (Kd) was 3.2 +/- 0.69 x 10(-10) mol/L. These results are similar to binding sites of other snake venom on platelet. The investigation showed that radiolabelled CAAV made by our laboratory was useful for radioligand binding assay.

Novel derivatives of 1,3,4-oxadiazoles are potent mitostatic agents featuring strong microtubule depolymerizing activity in the sea urchin embryo and cell culture assays.

PubMed

Kiselyov, Alex S; Semenova, Marina N; Chernyshova, Natalya B; Leitao, Andrei; Samet, Alexandr V; Kislyi, Konstantine A; Raihstat, Mikhail M; Oprea, Tudor; Lemcke, Heiko; Lantow, Margaréta; Weiss, Dieter G; Ikizalp, Nazli N; Kuznetsov, Sergei A; Semenov, Victor V

2010-05-01

A series of novel 1,3,4-oxadiazole derivatives based on structural and electronic overlap with combretastatins have been designed and synthesized. Initially, we tested all new compounds in vivo using the phenotypic sea urchin embryo assay to yield a number of agents with anti-proliferative, anti-mitotic, and microtubule destabilizing activities. The experimental data led to identification of 1,3,4-oxadiazole derivatives with isothiazole (5-8) and phenyl (9-12) pharmacophores featuring activity profiles comparable to that of combretastatins, podophyllotoxin and nocodazole. Cytotoxic effects of the two lead molecules, namely 6 and 12, were further confirmed and evaluated by conventional assays with the A549 human cancer cell line including cell proliferation, cell cycle arrest at the G2/M phase, cellular microtubule distribution, and finally in vitro microtubule assembly with purified tubulin. The modeling results using 3D similarity (ROCS) and docking (FRED) correlated well with the observed activity of the molecules. Docking data suggested that the most potent molecules are likely to target the colchicine binding site. Copyright (c) 2010 Elsevier Masson SAS. All rights reserved.

Concanavalin A-mediated polyclonal helper assay of normal thymocytes and its use for the analysis of ontogeny.

PubMed

Kina, T; Nishikawa, S; Amagai, T; Katsura, Y

1987-01-01

A concanavalin A (Con A)-mediated polyclonal helper assay system was established by using the thymus cells or splenic T cells as a source of helper T cells. When splenic B cells were cocultured with thymus cells or splenic Lyt-2- T cells in the presence of an optimal dose of Con A, B Cells were polyclonally activated and differentiated into immunoglobulin-secreting cells. This Con A-mediated helper activity was completely inhibited by the addition of alpha-methyl-D-mannoside and could not be substituted by culture supernatant of Con A-stimulated thymocytes or splenic T cells. Almost all the activity of the thymus cells was carried by peanut agglutinin low binding population. Genetic restriction between T and B cells was not observed in this helper function. In ontogeny, Con A-mediated helper activity in the thymus was first detected at a few days after birth and reached the adult level at about 1 week of age. The polyclonal helper assay system developed in the present study provides a sensitive system to analyse the helper function of thymus cells and also to delineate the early phase of the differentiation of helper T cell population.

Ultrasensitive and rapid detection of β-conglutin combining aptamers and isothermal recombinase polymerase amplification.

PubMed

Jauset-Rubio, Miriam; Sabaté Del Río, Jonathan; Mairal, Teresa; Svobodová, Markéta; El-Shahawi, Mohammad S; Bashammakh, Abdulaziz S; Alyoubi, Abdulrahman O; O'Sullivan, Ciara K

2017-01-01

Lupin is increasingly being used in a variety of food products due to its nutritional, functional and nutraceutical properties. However, several examples of severe and even fatal food-associated anaphylaxis due to lupin inhalation or ingestion have been reported, resulting in the lupin subunit β-conglutin, being defined as the Lup an 1 allergen by the International Union of Immunological Societies (IUIS) in 2008. Here, we report an innovative method termed aptamer-recombinase polymerase amplification (Apta-RPA) exploiting the affinity and specificity of a DNA aptamer selected against the anaphylactic β-conglutin allergen termed β-conglutin binding aptamer II (β-CBA II), facilitating ultrasensitive detection via isothermal amplification. Combining magnetic beads as the solid phase with Apta-RPA detection, the total assay time was reduced from 210 min to just 25 min, with a limit of detection of 3.5 × 10 -11  M, demonstrating a rapid and ultrasensitive generic methodology that can be used with any aptamer. Future work will focus on further simplification of the assay to a lateral flow format. Graphical Abstract Schematic representation of the rapid and novel bead-based Apta-RPA assay.

Sponsor relationships, analyte stability in ligand-binding assays and critical reagent management: a bioanalytical CRO perspective.

PubMed

Lefor Bradford, Julia

2015-01-01

This perspective article discusses key points to address in the establishment of sound partnerships between sponsors and bioanalytical CROs to assure the timeliness, quality and consistency of bioanalysis throughout biological therapeutic development. The performance of ligand-binding assays can be greatly impacted by low-grade reagents, lot-to-lot variability and lack of stability of the analyte in matrix, impacting both timelines and cost. Thorough characterization of the biologic of interest and its assay-enabling critical reagents will lend itself well to conservation of materials and continuity of assay performance. When unplanned events occur, such as performance declines or premature depletion of material, structured procedures are paramount to supplement the current loosely defined regulatory guidance on critical reagent characterization and method bridging.

Shikonin, a natural product from the root of Lithospermum erythrorhizon, is a cytotoxic DNA-binding agent.

PubMed

Chen, Changmin; Shanmugasundaram, Kumaran; Rigby, Alan C; Kung, Andrew L

2013-04-11

To search for compounds that disrupt binding of the EWS-FLI1 fusion protein to its cognate targets, we developed a homogeneous high-throughput proximity assay and screened 5200 small molecule compounds. Many well-known DNA-binding chemotherapeutic agents, such as actinomycin D, cisplatin, doxorubicin, daunorubicin, and epirubicin scored in the assay and not surprising also disrupted the binding of other transcription factors. Unexpectedly, we found that Shikonin, a natural product from the root of Lithospermum erythrorhizon, similarly disrupted protein-DNA interactions. Mechanistic studies demonstrated that Shikonin displaces SYBR green from binding to the minor groove of DNA and is able to inhibit topoisomerase mediated DNA relaxation. In cells, Shikonin blocked the binding of EWS-FLI1 to the NR0B1 promoter, and attenuated gene expression. Shikonin rapidly induced G2/M arrest and apoptosis in Ewing sarcoma cells. These results demonstrate that contrary to other purported mechanisms of action, Shikonin is a DNA-binding cytotoxic agent. Copyright © 2013 Elsevier B.V. All rights reserved.

Interpretation of the Raji cell assay in sera containing anti-nuclear antibodies and immune complexes.

PubMed Central

Horsfall, A C; Venables, P J; Mumford, P A; Maini, R N

1981-01-01

The Raji cell assay is regarded as a test for the detection and quantitation of immune complexes. It is frequently positive in sera from patients with SLE. We have demonstrated a relationship between Raji cell binding and antibodies to DNA and soluble cellular antigens. In five sera containing high titres of antibodies of known single specificity, most of the Raji cell binding occurred in the 7S IgG fraction where the majority of anti-nuclear antibody was also found. When each of these sera was incubated with its specific antigen, Raji cell binding increased. Subsequent fractionation showed that this binding was in the high molecular weight fraction (greater than 200,000 daltons) and that Raji cell binding and antibody activity were abolished in the 7S fraction. These data confirm that Raji cell bind immune complexes but also indicate that 7S anti-nuclear antibodies may interact directly with Raji cells by an unknown mechanism. Therefore, in sera of patients with anti-nuclear antibodies, binding to Raji cells does not necessarily imply the presence of immune complexes alone. PMID:6975676

An assay that may predict the development of IgG enhancing allergen-specific IgE binding during birch immunotherapy

PubMed Central

Selb, R.; Eckl-Dorna, J.; Vrtala, S.; Valenta, R.; Niederberger, V.

2017-01-01

Background It has been shown that birch pollen immunotherapy can induce IgG antibodies which enhance IgE binding to Bet v 1. We aimed to develop a serological assay to predict the development of antibodies which enhance IgE binding to Bet v 1 during immunotherapy. Methods In 18 patients treated by Bet v 1-fragment-specific immunotherapy, the effects of IgG antibodies specific for the fragments on the binding of IgE antibodies to Bet v 1 were measured by ELISA. Blocking and possible enhancing effects on IgE binding were compared with skin sensitivity to Bet v 1 after treatment. Results We found that fragment-specific IgG enhanced IgE binding to Bet v 1 in two patients who also showed an increase of skin sensitivity to Bet v 1. Conclusion Our results indicate that it may be possible to develop serological tests which predict the induction of unfavourable IgG antibodies enhancing the binding of IgE to Bet v 1 during immunotherapy. PMID:23998344

Low incidence of anti-drug antibodies in patients with type 2 diabetes treated with once-weekly glucagon-like peptide-1 receptor agonist dulaglutide.

PubMed

Milicevic, Z; Anglin, G; Harper, K; Konrad, R J; Skrivanek, Z; Glaesner, W; Karanikas, C A; Mace, K

2016-05-01

Therapeutic administration of peptides may result in anti-drug antibody (ADA) formation, hypersensitivity adverse events (AEs) and reduced efficacy. As a large peptide, the immunogenicity of once-weekly glucagon-like peptide-1 (GLP-1) receptor agonist dulaglutide is of considerable interest. The present study assessed the incidence of treatment-emergent dulaglutide ADAs, hypersensitivity AEs, injection site reactions (ISRs), and glycaemic control in ADA-positive patients in nine phase II and phase III trials (dulaglutide, N = 4006; exenatide, N = 276; non-GLP-1 comparators, N = 1141). Treatment-emergent dulaglutide ADAs were detected using a solid-phase extraction acid dissociation binding assay. Neutralizing ADAs were detected using a cell-based assay derived from human endothelial kidney cells (HEK293). A total of 64 dulaglutide-treated patients (1.6% of the population) tested ADA-positive versus eight (0.7%) from the non-GLP-1 comparator group. Of these 64 patients, 34 (0.9%) had dulaglutide-neutralizing ADAs, 36 (0.9%) had native-sequence GLP-1 (nsGLP-1) cross-reactive ADAs and four (0.1%) had nsGLP-1 neutralization ADAs. The incidence of hypersensitivity AEs and ISRs was similar in the dulaglutide versus placebo groups. No dulaglutide ADA-positive patient reported hypersensitivity AEs. Because of the low incidence of ADAs, it was not possible to establish their effect on glycaemic control. © 2016 John Wiley & Sons Ltd.

Hormone Binding to Recombinant Estrogen Receptors from Human, Alligator, Quail, Salamander, and Fathead Minnow

EPA Science Inventory

In this work, a 96-well plate estrogen receptor binding assay was developed to facilitate the direct comparison of chemical binding to full-length recombinant estrogen receptors across vertebrate classes. Receptors were generated in a baculovirus expression system. This approach ...

The Application of a Three-Step Proteome Analysis for Identification of New Biomarkers of Pancreatic Cancer

PubMed Central

Abulaizi, Mayinuer; Tomonaga, Takeshi; Satoh, Mamoru; Sogawa, Kazuyuki; Matsushita, Kazuyuki; Kodera, Yoshio; Obul, Jurat; Takano, Shigetsugu; Yoshitomi, Hideyuki; Miyazaki, Masaru; Nomura, Fumio

2011-01-01

We searched for novel tumor markers of pancreatic cancer by three-step serum proteome analysis. Twelve serum abundant proteins were depleted using immunoaffinity columns followed by fractionation by reverse-phase high-performance liquid chromatography. Proteins in each fraction were separated by two-dimensional gel electrophoresis. Then the gel was stained by Coomassie Brilliant Blue. Protein spots in which the expression levels were significantly different between cancer and normal control were identified by LC-MS/MS. One hundred and two spots were upregulated, and 84 spots were downregulated in serum samples obtained from patients with pancreatic cancers, and 58 proteins were identified by mass spectrometry. These candidate proteins were validated using western blot analysis and enzyme-linked immunosorbent assay (ELISA). As a result of these validation process, we could confirm that the serum levels of apolipoprotein A-IV, vitamin D-binding protein, plasma retinol-binding protein 4, and tetranectin were significantly decreased in patients with pancreatic cancer. PMID:22091389

Anti-DNA antibodies--quintessential biomarkers of SLE.

PubMed

Pisetsky, David S

2016-02-01

Antibodies that recognize and bind to DNA (anti-DNA antibodies) are serological hallmarks of systemic lupus erythematosus (SLE) and key markers for diagnosis and disease activity. In addition to common use in the clinic, anti-DNA antibody testing now also determines eligibility for clinical trials, raising important questions about the nature of the antibody-antigen interaction. At present, no 'gold standard' for serological assessment exists, and anti-DNA antibody binding can be measured with a variety of assay formats, which differ in the nature of the DNA substrates and in the conditions for binding and detection of antibodies. A mechanism called monogamous bivalency--in which high avidity results from simultaneous interaction of IgG Fab sites with a single polynucleotide chain--determines anti-DNA antibody binding; this mechanism might affect antibody detection in different assay formats. Although anti-DNA antibodies can promote pathogenesis by depositing in the kidney or driving cytokine production, they are not all alike, pathologically, and anti-DNA antibody expression does not necessarily correlate with active disease. Levels of anti-DNA antibodies in patients with SLE can vary over time, distinguishing anti-DNA antibodies from other pathogenic antinuclear antibodies. Elucidation of the binding specificities and the pathogenic roles of anti-DNA antibodies in SLE should enable improvements in the design of informative assays for both clinical and research purposes.

POZ domain transcription factor, FBI-1, represses transcription of ADH5/FDH by interacting with the zinc finger and interfering with DNA binding activity of Sp1.

PubMed

Lee, Dong-Kee; Suh, Dongchul; Edenberg, Howard J; Hur, Man-Wook

2002-07-26

The POZ domain is a protein-protein interaction motif that is found in many transcription factors, which are important for development, oncogenesis, apoptosis, and transcription repression. We cloned the POZ domain transcription factor, FBI-1, that recognizes the cis-element (bp -38 to -22) located just upstream of the core Sp1 binding sites (bp -22 to +22) of the ADH5/FDH minimal promoter (bp -38 to +61) in vitro and in vivo, as revealed by electrophoretic mobility shift assay and chromatin immunoprecipitation assay. The ADH5/FDH minimal promoter is potently repressed by the FBI-1. Glutathione S-transferase fusion protein pull-down showed that the POZ domains of FBI-1, Plzf, and Bcl-6 directly interact with the zinc finger DNA binding domain of Sp1. DNase I footprinting assays showed that the interaction prevents binding of Sp1 to the GC boxes of the ADH5/FDH promoter. Gal4-POZ domain fusions targeted proximal to the GC boxes repress transcription of the Gal4 upstream activator sequence-Sp1-adenovirus major late promoter. Our data suggest that POZ domain represses transcription by interacting with Sp1 zinc fingers and by interfering with the DNA binding activity of Sp1.

Nanoprobe-Enhanced, Split Aptamer-Based Electrochemical Sandwich Assay for Ultrasensitive Detection of Small Molecules.

PubMed

Zhao, Tao; Liu, Ran; Ding, Xiaofan; Zhao, Juncai; Yu, Haixiang; Wang, Lei; Xu, Qing; Wang, Xuan; Lou, Xinhui; He, Miao; Xiao, Yi

2015-08-04

It is quite challenging to improve the binding affinity of antismall molecule aptamers. We report that the binding affinity of anticocaine split aptamer pairs improved by up to 66-fold by gold nanoparticles (AuNP)-attached aptamers due to the substantially increased local concentration of aptamers and multiple and simultaneous ligand interactions. The significantly improved binding affinity enables the detection of small molecule targets with unprecedented sensitivity, as demonstrated in nanoprobe-enhanced split aptamer-based electrochemical sandwich assays (NE-SAESA). NE-SAESA replaces the traditional molecular reporter probe with AuNPs conjugated to multiple reporter probes. The increased binding affinity allowed us to use 1,000-fold lower reporter probe concentrations relative to those employed in SAESA. We show that the near-elimination of background in NE-SAESA effectively improves assay sensitivity by ∼1,000-100,000-fold for ATP and cocaine detection, relative to equivalent SAESA. With the ongoing development of new strategies for the selection of aptamers, we anticipate that our sensor platform should offer a generalizable approach for the high-sensitivity detection of diverse targets. More importantly, we believe that NE-SAESA represents a novel strategy to improve the binding affinity between a small molecule and its aptamer and potentially can be extended to other detection platforms.

Inhibition of HMGA2 binding to DNA by netropsin

PubMed Central

Miao, Yi; Cui, Tengjiao; Leng, Fenfei; Wilson, W. David

2008-01-01

The design of small synthetic molecules that can be used to affect gene expression is an area of active interest for development of agents in therapeutic and biotechnology applications. Many compounds that target the minor groove in AT sequences in DNA are well characterized and are promising reagents for use as modulators of protein-DNA complexes. The mammalian high mobility group transcriptional factor, HMGA2, also targets the DNA minor groove and plays critical roles in disease processes from cancer to obesity. Biosensor-surface plasmon resonance methods were used to monitor HMGA2 binding to target sites on immobilized DNA and a competition assay for inhibition of the HMGA2-DNA complex was designed. HMGA2 binds strongly to the DNA through AT hook domains with KD values of 20 - 30 nM depending on the DNA sequence. The well-characterized minor groove binder, netropsin, was used to develop and test the assay. The compound has two binding sites in the protein-DNA interaction sequence and this provides an advantage for inhibition. An equation for analysis of results when the inhibitor has two binding sites in the biopolymer recognition surface is presented with the results. The assay provides a platform for discovery of HMGA2 inhibitors. PMID:18023407

Identification of berberine as a direct thrombin inhibitor from traditional Chinese medicine through structural, functional and binding studies

NASA Astrophysics Data System (ADS)

Wang, Xing; Zhang, Yuxin; Yang, Ying; Wu, Xia; Fan, Hantian; Qiao, Yanjiang

2017-03-01

Thrombin acts as a key enzyme in the blood coagulation cascade and represents a potential drug target for the treatment of several cardiovascular diseases. The aim of this study was to identify small-molecule direct thrombin inhibitors from herbs used in traditional Chinese medicine (TCM). A pharmacophore model and molecular docking were utilized to virtually screen a library of chemicals contained in compositions of traditional Chinese herbs, and these analyses were followed by in vitro bioassay validation and binding studies. Berberine (BBR) was first confirmed as a thrombin inhibitor using an enzymatic assay. The BBR IC50 value for thrombin inhibition was 2.92 μM. Direct binding studies using surface plasmon resonance demonstrated that BBR directly interacted with thrombin with a KD value of 16.39 μM. Competitive binding assay indicated that BBR could bind to the same argartroban/thrombin interaction site. A platelet aggregation assay demonstrated that BBR had the ability to inhibit thrombin-induced platelet aggregation in washed platelets samples. This study proved that BBR is a direct thrombin inhibitor that has activity in inhibiting thrombin-induced platelet aggregation. BBR may be a potential candidate for the development of safe and effective thrombin-inhibiting drugs.

High-throughput screening and mechanism-based evaluation of estrogenic botanical extracts

PubMed Central

Overk, Cassia R.; Yao, Ping; Chen, Shaonong; Deng, Shixing; Imai, Ayano; Main, Matthew; Schinkovitz, Andreas; Farnsworth, Norman R.; Pauli, Guido F.; Bolton, Judy L.

2009-01-01

Symptoms associated with menopause can greatly affect the quality of life for women. Botanical dietary supplements have been viewed by the public as safe and effective despite a lack of evidence indicating a urgent necessity to standardize these supplements chemically and biologically. Seventeen plants were evaluated for estrogenic biological activity using standard assays: competitive estrogen receptor (ER) binding assay for both alpha and beta subtypes, transient transfection of the estrogen response element luciferase plasmid into MCF-7 cells expressing either ER alpha or ER beta, and the Ishikawa alkaline phosphatase induction assay for both estrogenic and antiestrogenic activities. Based on the combination of data pooled from these assays, the following was determined: a) a high rate of false positive activity for the competitive binding assays, b) some extracts had estrogenic activity despite a lack of ability to bind the ER, c) one extract exhibited selective estrogen receptor modulator (SERM) activity, and d) several extracts show additive/synergistic activity. Taken together, these data indicate a need to reprioritize the order in which the bioassays are performed for maximal efficiency of programs involving bioassay-guided fractionation. In addition, possible explanations for the conflicts in the literature over the estrogenicity of Cimicifuga racemosa (black cohosh) are suggested. PMID:18473738

Primers of glycosaminoglycan biosynthesis from Peruvian rain forest plants.

PubMed

Taylor, W H; Sinha, A; Khan, I A; McDaniel, S T; Esko, J D

1998-08-28

We have developed a rapid, high throughput screening assay for compounds that alter the assembly of glycosaminoglycan chains in Chinese hamster ovary cells. The assay uses autoradiography to measure the binding of newly synthesized [35S]proteoglycans and [35S]glycosaminoglycans to a positively charged membrane. Screening over 1000 extracts from a random plant collection obtained from the Amazon rain forest yielded five plants that stimulated glycosaminoglycan assembly in both wild-type cells and a mutant cell line defective in xylosyltransferase (the first committed enzyme involved in glycosaminoglycan biosynthesis). Fractionation of an extract of Maieta guianensis by silica gel and reverse-phase chromatography yielded two pure compounds with stimulatory activity. Spectroscopic analysis by NMR and mass spectrometry revealed that the active principles were xylosides of dimethylated ellagic acid. One of the compounds also contained a galloyl group at C-3 of the xylose moiety. These findings suggest that plants and other natural products may be a source of agents that can potentially alter glycosaminoglycan and proteoglycan formation in animal cells.

SpermCheck: a simplified screening assay for immunological infertility.

PubMed

McClure, R D; Tom, R A; Watkins, M; Murthy, S

1989-10-01

SpermCheck (Bio-Rad Laboratories, Hercules, CA), a new screening test for regional surface antibodies on motile sperm, uses monodispersed latex microspheres of uniform size as a vehicle to link rabbit antihuman immunoglobulins (IgA, IgG, IgM) and provides both negative and positive control sera, as well as sufficient buffer for sperm preparation in ambient CO2 atmosphere. When compared with reference data available for the immunobead test (IBT), the direct protocol (semen) for SpermCheck yielded 94.4% sensitivity with 100% specificity; the indirect protocol (serum) provided a sensitivity of 100% with 94.7% specificity. The microspheres of SpermCheck maintain a nearly uniform concentration per volume, with none to negligible clumping. The greater difference between the optical densities of latex and cytoplasm allows use of a light microscope for the rapid assessment of the percent of regional binding rather than the phase-contrast microscope required for the IBT. SpermCheck eliminates many difficulties encountered with the IBT, making SpermCheck a convenient screening assay for use in the physician's office.

Chemoprevention of Colorectal Cancer by Artocarpin, a Dietary Phytochemical from Artocarpus heterophyllus.

PubMed

Sun, Guochuan; Zheng, Zongping; Lee, Mee-Hyun; Xu, Yijuan; Kang, Soouk; Dong, Zigang; Wang, Mingfu; Gu, Zhennan; Li, Haitao; Chen, Wei

2017-05-03

Artocarpus heterophyllus is an evergreen tree distributed in tropical regions, and its fruit (jackfruit) is well-known as the world's largest tree-borne fruit. Although A. heterophyllus has been widely used in folk medicines against inflammation, its potential in cancer chemoprevention remains unclear. Herein we identified artocarpin from A. heterophyllus as a promising colorectal cancer chemopreventive agent by targeting Akt kinase. Phenotypically, artocarpin exhibited selective cytotoxicity against human colon cancer cells. Artocarpin impaired the anchorage-independent growth capability, suppressed colon cancer cell growth, and induced a G1 phase cell cycle arrest which was followed by apoptotic as well as autophagic cell death. Mechanistic studies revealed that artocarpin directly targeted Akt 1 and 2 kinase activity evidenced by in vitro kinase assay, ex vivo binding assay as well as Akt downstream cellular signal transduction. Importantly, oral administration of artocarpin attenuated colitis-associated colorectal tumorigenesis in mice. Taken together, artocarpin, a bioactive component of A. heterophyllus, might merit investigation as a potential colorectal cancer chemopreventive agent.

Replacement of Cetyltrimethylammoniumbromide Bilayer on Gold Nanorod by Alkanethiol Crosslinker for Enhanced Plasmon Resonance Sensitivity

PubMed Central

Casas, Justin; Venkataramasubramani, Meenakshi; Wang, Yanyan; Tang, Liang

2013-01-01

Surface modification of gold nanorods (GNRs) is often problematic due to tightly packed cetyltrimethylammoniumbromide (CTAB) bilayer. Herein, we performed a double phase transfer ligand exchange to achieve displacement of CTAB on nanorods. During the removal, 11-mercaptoundecanoic acid (MUDA) crosslinker is simultaneously assembled on nanorod surfaces to prevent aggregation. The resulting MUDA-GNRs retain the shape and position of plasmon peaks similar to CTAB-capped GNRs. The introduction of carboxyl groups allows covalent conjugation of biological receptors in a facile fashion to construct a robust, label-free biosensor based on localized surface plasmon resonance (LSPR) transduction of biomolecular interaction. More importantly, smaller MUDA layer on the GNRs reduces the distance of target binding to the plasmonic nanostructure interface, leading to a significant enhancement in LSPR assay sensitivity and specificity. Compared to modification using conventional electropolymer adsorption, MUDA-coated gold nanosensor exhibits five times lower detection limit for cardiac troponin I assay with a high selectivity. PMID:23816849

Establishment and characterization of a new and stable collagen-binding assay for the assessment of von Willebrand factor activity

PubMed Central

Ni, Y; Nesrallah, J; Agnew, M; Geske, F J; Favaloro, E J

2013-01-01

Introduction Laboratory diagnosis of von Willebrand disease (VWD) requires determination of both von Willebrand factor (VWF) protein levels and activity. Current VWF activity tests include the ristocetin cofactor assay and the collagen-binding assay (VWF:CB). The goal of this investigation is to characterize a new collagen-binding assay and to determine its effectiveness in identifying VWD. Methods Analytical studies were carried out to characterize the performance of a new VWF:CB ELISA. Additionally, samples from a normal population were tested as were well-characterized type 1 and type 2 VWD samples. Results Repeatability and within-laboratory precision studies resulted in coefficients of variation (CVs) of ≤11%. A linear range of 1–354% (0.01–3.54 IU/mL) was determined, along with a limit of detection and a lower limit of quantitation of 1.6% and 4.0% (0.016 and 0.04 IU/mL), respectively. Samples tested from apparently healthy individuals resulted in a normal range of 54–217% (0.54–2.17 IU/mL). Known VWD type 1 and type 2 samples were also analyzed by the ELISA, with 99% of samples having VWF:CB below the normal reference range and an estimated 96% sensitivity and 87% specificity using a VWF collagen-binding/antigen cutoff ratio of 0.50. Conclusion This new VWF:CB ELISA provides an accurate measure of collagen-binding activity that aids in the diagnosis and differentiation of type 1 from type 2 VWD. PMID:23107512

The Activation of the Rat Insulin Gene II by BETA2 and PDX-1 in Rat Insulinoma Cells Is Repressed by Pax6

PubMed Central

Wolf, Gabriele; Hessabi, Behnam; Karkour, Anke; Henrion, Ulrike; Dahlhaus, Meike; Ostmann, Annett; Giese, Bernd; Fraunholz, Martin; Grabarczyk, Piotr; Jack, Robert; Walther, Reinhard

2010-01-01

The transcriptional transactivator Pax6 binds the pancreatic islet cell-specific enhancer sequence (PISCES) of the rat insulin I gene. However the human, mouse, and rat insulin gene II promoters do not contain a PISCES element. To analyze the role of Pax6 in those PISCES-less promoters, we investigated its influence on rat insulin gene II expression and included in our studies the main activators: pancreatic and duodenal homeobox protein-1 (PDX-1) and BETA2/E47. Luciferase assays, Northern blots, and RIA were used to study effects of Pax6 overexpression, gel shift and chromatin precipitation assays to study its binding to the DNA, and yeast two-hybrid assays and glutathione S transferase capture assays to investigate its interactions with PDX-1 and BETA2. Finally, glucose-dependent intracellular transport of Pax6 was demonstrated by fluorescence microscopy. Overexpression of Pax6 prevents activation of the rat insulin II gene by BETA2 and PDX-1 and hence suppresses insulin synthesis and secretion. In vitro, Pax6 binds to the A-boxes, thereby blocking binding of PDX-1, and at the same time, its paired domain interacts with BETA2. Fluorescence microscopy demonstrated that the nuclear-cytoplasmic localization of Pax6 and PDX-1 are oppositely regulated by glucose. From the results, it is suggested that at low concentrations of glucose, Pax6 is localized in the nucleus and prevents the activation of the insulin gene by occupying the PDX-1 binding site and by interacting with BETA2. PMID:20943817

Agglutination Assays of the Plasmodium falciparum-Infected Erythrocyte.

PubMed

Tan, Joshua; Bull, Peter C

2015-01-01

The agglutination assay is used to determine the ability of antibodies to recognize parasite variant antigens on the surface of Plasmodium falciparum-infected erythrocytes. In this technique, infected erythrocytes are selectively labelled with a DNA-binding fluorescent dye and mixed with antibodies of interest to allow antibody-surface antigen binding. Recognition of surface antigens by the antibodies can result in the formation of agglutinates containing multiple parasite-infected erythrocytes. These can be viewed and quantified using a fluorescence microscope.

Domain based assays of individual antibody concentrations in an oligoclonal combination targeting a single protein

PubMed Central

Meng, Q.; Li, M.; Silberg, M.A.; Conrad, F.; Bettencourt, J.; To, R.; Huang, C.; Ma, J.; Meyer, K.; Shimizu, R.; Cao, L.; Tomic, M.T.; Marks, J.D.

2014-01-01

Quantitation of individual mAbs within a combined antibody drug product is required for preclinical and clinical drug development including pharmacokinetics (PK), toxicology, stability and biochemical characterization studies of such drugs. We have developed an antitoxin (XOMA 3AB) consisting of three recombinant monoclonal antibodies (mAbs) that potently neutralizes the known subtypes of type A botulinum neurotoxin (BoNT/A). The three mAbs bind non-overlapping BoNT/A epitopes with high affinity. XOMA3AB is being developed as a treatment for botulism resulting from BoNT/A. To develop antibody-specific assays, we cloned, expressed, and purified BoNT/A domains from E. coli. Each mAb bound only to its specific domain with affinity comparable to the binding to holotoxin. MAb specific domains were used to develop an ELISA for characterization of the integrity and binding activity of the three mAbs in the drug product. An electrochemiluminescence bridging assay was also developed that is robust to interference from components in serum and we demonstrate that it can be used for PK assays. This type of antigen engineering to generate mAb-specific domains is a general method allowing quantitation and characterization of individual mAbs in a mAb cocktail that bind the same protein and is superior to anti-idiotype approaches. PMID:22037290

Optimization of Time-Resolved Fluorescence Assay for Detection of Eu-DOTA-labeled Ligand-Receptor Interactions

PubMed Central

De Silva, Channa R.; Vagner, Josef; Lynch, Ronald; Gillies, Robert J.; Hruby, Victor J.

2010-01-01

Lanthanide-based luminescent ligand binding assays are superior to traditional radiolabel assays due to improved sensitivity and affordability in high throughput screening while eliminating the use of radioactivity. Despite significant progress using lanthanide(III)-coordinated chelators such as DTPA derivatives, dissociation-enhanced lanthanide fluoroimmunoassays (DELFIA) have not yet been successfully used with more stable chelators, e.g. DOTA derivatives, due to the incomplete release of lanthanide(III) ions from the complex. Here, a modified and an optimized DELFIA procedure incorporating an acid treatment protocol is introduced for use with Eu(III)-DOTA labeled peptides. Complete release of Eu(III) ions from DOTA labeled ligands was observed using hydrochloric acid (2.0 M) prior to the luminescent enhancement step. NDP-α-MSH labeled with Eu(III)-DOTA was synthesized and the binding affinity to cells overexpressing the human melanocortin-4 receptors (hMC4R) was evaluated using the modified protocol. Binding data indicate that the Eu(III)-DOTA linked peptide bound to these cells with an affinity similar to its DTPA analogue. The modified DELFIA procedure was further used to monitor the binding of an Eu(III)-DOTA labeled heterobivalent peptide to the cells expressing both hMC4R and CCK-2 (Cholecystokinin) receptors. The modified assay provides superior results and is appropriate for high-throughput screening of ligand libraries. PMID:19852924

Natural product (-)-gossypol inhibits colon cancer cell growth by targeting RNA-binding protein Musashi-1.

PubMed

Lan, Lan; Appelman, Carl; Smith, Amber R; Yu, Jia; Larsen, Sarah; Marquez, Rebecca T; Liu, Hao; Wu, Xiaoqing; Gao, Philip; Roy, Anuradha; Anbanandam, Asokan; Gowthaman, Ragul; Karanicolas, John; De Guzman, Roberto N; Rogers, Steven; Aubé, Jeffrey; Ji, Min; Cohen, Robert S; Neufeld, Kristi L; Xu, Liang

2015-08-01

Musashi-1 (MSI1) is an RNA-binding protein that acts as a translation activator or repressor of target mRNAs. The best-characterized MSI1 target is Numb mRNA, whose encoded protein negatively regulates Notch signaling. Additional MSI1 targets include the mRNAs for the tumor suppressor protein APC that regulates Wnt signaling and the cyclin-dependent kinase inhibitor P21(WAF-1). We hypothesized that increased expression of NUMB, P21 and APC, through inhibition of MSI1 RNA-binding activity might be an effective way to simultaneously downregulate Wnt and Notch signaling, thus blocking the growth of a broad range of cancer cells. We used a fluorescence polarization assay to screen for small molecules that disrupt the binding of MSI1 to its consensus RNA binding site. One of the top hits was (-)-gossypol (Ki = 476 ± 273 nM), a natural product from cottonseed, known to have potent anti-tumor activity and which has recently completed Phase IIb clinical trials for prostate cancer. Surface plasmon resonance and nuclear magnetic resonance studies demonstrate a direct interaction of (-)-gossypol with the RNA binding pocket of MSI1. We further showed that (-)-gossypol reduces Notch/Wnt signaling in several colon cancer cell lines having high levels of MSI1, with reduced SURVIVIN expression and increased apoptosis/autophagy. Finally, we showed that orally administered (-)-gossypol inhibits colon cancer growth in a mouse xenograft model. Our study identifies (-)-gossypol as a potential small molecule inhibitor of MSI1-RNA interaction, and suggests that inhibition of MSI1's RNA binding activity may be an effective anti-cancer strategy. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

miR-128 modulates chemosensitivity and invasion of prostate cancer cells through targeting ZEB1.

PubMed

Sun, Xianglun; Li, Youkong; Yu, Jie; Pei, Hong; Luo, Pengcheng; Zhang, Jie

2015-05-01

Recent reports strongly suggest the profound role of miRNAs in cancer therapeutic response and progression, including invasion and metastasis. The sensitivity to therapy and invasion is the major obstacle for successful treatment in prostate cancer. We aimed to investigate the regulative effect of miR-128/zinc-finger E-box-binding homeobox 1 axis on prostate cancer cell chemosensitivity and invasion. The miR-128 expression pattern of prostate cancer cell lines and tissues was detected by real-time reverse transcriptase-polymerase chain reaction, while the mRNA and protein expression levels of zinc-finger E-box-binding homeobox 1 were measured by real-time reverse transcriptase-polymerase chain reaction and western blot assay, respectively. Dual-luciferase reporter gene assay was used to find the direct target of miR-128. Furthermore, prostate cancer cells were treated with miR-128 mimic or zinc-finger E-box-binding homeobox 1-siRNA, and then the cells' chemosensitivity and invasion were detected by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay and transwell assay, respectively. We found miR-128 expression obviously decreased in prostate cancer tissues compared with paired normal tissues. Restored miR-128 expression sensitized prostate cancer cells to cisplatin and inhibited the invasion. Furthermore, there was an inverse expression pattern between miR-128 and zinc-finger E-box-binding homeobox 1 in prostate cancer cells and tissues, and zinc-finger E-box-binding homeobox 1 was identified as a direct target of miR-128 in prostate cancer. Knockdown of zinc-finger E-box-binding homeobox 1 expression efficiently sensitized prostate cancer cells to cisplatin and inhibited the invasion. However, ectopic zinc-finger E-box-binding homeobox 1 expression impaired the effects of miR-128 on chemosensitivity and invasion in prostate cancer cells. miR-128 functions as a potential cancer suppressor in prostate cancer progression and rational therapeutic strategies for prostate cancer would be developed based on miR-128/zinc-finger E-box-binding homeobox 1 axis. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Identification of Inhibitors of ABCG2 by a Bioluminescence Imaging-based High-throughput Assay

PubMed Central

Zhang, Yimao; Byun, Youngjoo; Ren, Yunzhao R.; Liu, Jun O.; Laterra, John; Pomper, Martin G.

2009-01-01

ABCG2 is a member of the ATP-binding cassette (ABC) family of transporters, the overexpression of which is associated with tumor resistance to a variety of chemotherapeutic agents. Accordingly, combining ABCG2 inhibitor(s) with chemotherapy has the potential to improve treatment outcome. To search for clinically useful ABCG2 inhibitors, a bioluminescence imaging (BLI)-based assay was developed to allow high-throughput compound screening. This assay exploits our finding that D-luciferin, the substrate of firefly luciferase (fLuc), is a specific substrate of ABCG2, and ABCG2 inhibitors block the export of D-luciferin and enhance bioluminescence signal by increasing intracellular D-luciferin concentrations. HEK293 cells, engineered to express ABCG2 and fLuc, were used to screen the Hopkins Drug Library that includes drugs approved by the US Food and Drug Administration (FDA) as well as drug candidates that have entered phase II clinical trials. Forty seven compounds demonstrated BLI enhancement, a measure of anti-ABCG2 activity, of five-fold or greater, the majority of which were not previously known as ABCG2 inhibitors. The assay was validated by its identification of known ABCG2 inhibitors and by confirming previously unknown ABCG2 inhibitors using established in vitro assays (e.g. mitoxantrone resensitization and BODIPY-prazosin assays). Glafenine, a potent new inhibitor, also inhibited ABCG2 activity in vivo. The BLI-based assay is an efficient method to identify new inhibitors of ABCG2. As they were derived from an FDA-approved compound library, many of the inhibitors uncovered in this study are ready for clinical testing. PMID:19567678

Measuring Positive Cooperativity Using the Direct ESI-MS Assay. Cholera Toxin B Subunit Homopentamer Binding to GM1 Pentasaccharide

NASA Astrophysics Data System (ADS)

Lin, Hong; Kitova, Elena N.; Klassen, John S.

2014-01-01

Direct electrospray ionization mass spectrometry (ESI-MS) assay was used to investigate the stepwise binding of the GM1 pentasaccharide β- D-Gal p-(1→3)-β-D-Gal pNAc-(1→4)[α-D-Neu5Ac-(2→3)]-β- D-Gal p-(1→4)-β-D-Glc p (GM1os) to the cholera toxin B subunit homopentamer (CTB5) and to establish conclusively whether GM1os binding is cooperative. Apparent association constants were measured for the stepwise addition of one to five GM1os to CTB5 at pH 6.9 and 22 °C. The intrinsic association constant, which was established from the apparent association constant for the addition of a single GM1os to CTB5, was found to be (3.2 ± 0.2) × 106 M-1. This is in reasonable agreement with the reported value of (6.4 ± 0.3) × 106 M-1, which was measured at pH 7.4 and 25 °C using isothermal titration calorimetry (ITC). Analysis of the apparent association constants provides direct and unambiguous evidence that GM1os binding exhibits small positive cooperativity. Binding was found to be sensitive to the number of ligand-bound nearest neighbor subunits, with the affinities enhanced by a factor of 1.7 and 2.9 when binding occurs next to one or two ligand-bound subunits, respectively. These findings, which provide quantitative support for the binding model proposed by Homans and coworkers [14], highlight the unique strengths of the direct ESI-MS assay for measuring cooperative ligand binding.

Estrogenicity of halogenated bisphenol A: in vitro and in silico investigations.

PubMed

Zhang, Jie; Li, Tiezhu; Wang, Tuoyi; Yuan, Cuiping; Zhong, Shuning; Guan, Tianzhu; Li, Zhuolin; Wang, Yongzhi; Yu, Hansong; Luo, Quan; Wang, Yongjun; Zhang, Tiehua

2018-03-01

The binding interactions of bisphenol A (BPA) and its halogenated derivatives (halogenated BPAs) to human estrogen receptor α ligand binding domain (hERα-LBD) was investigated using a combined in vitro and in silico approach. First, the recombinant hERα-LBD was prepared as a soluble protein in Escherichia coli BL21(DE3)pLysS. A native fluorescent phytoestrogen, coumestrol, was employed as tracer for the fluorescence polarization assay. The results of the in vitro binding assay showed that bisphenol compounds could bind to hERα-LBD as the affinity ligands. All the tested halogenated BPAs exhibited weaker receptor binding than BPA, which might be explained by the steric effect of substituents. Molecular docking studies elucidated that the halogenated BPAs adopted different conformations in the flexible hydrophobic ligand binding pocket (LBP), which is mainly dependent on their distinct halogenation patterns. The compounds with halogen substituents on the phenolic rings and on the bridging alkyl moiety acted as agonists and antagonists for hERα, respectively. Interestingly, all the compounds in the agonist conformation of hERα formed a hydrogen bond with His524, while the compounds in the antagonist conformation formed a hydrogen bond with Thr347. These docking results suggested a pivotal role of His524/Thr347 in maintaining the hERα structure in the biologically active agonist/antagonist conformation. Comparison of the calculated binding energies vs. experimental binding affinities yielded a good correlation, which might be applicable for the structure-based design of novel bisphenol compounds with reduced toxicities and for environmental risk assessment. In addition, based on hERα-LBD as a recognition element, the proposed fluorescence polarization assay may offer an alternative to chromatographic techniques for the multi-residue determination of bisphenol compounds.

Functionalization of DNA Nanostructures for Cell Signaling Applications

NASA Astrophysics Data System (ADS)

Pedersen, Ronnie O.

Transforming growth factor beta (TGF-beta) is an important cytokine responsible for a wide range of different cellular functions including extracellular matrix formation, angiogenesis and epithelial-mesenchymal transition. We have sought to use self-assembling DNA nanostructures to influence TGF-beta signaling. The predictable Watson Crick base pairing allows for designing self-assembling nanoscale structures using oligonucleotides. We have used the method of DNA origami to assemble structures functionalized with multiple peptides that bind TGF-beta receptors outside the ligand binding domain. This allows the nanostructures to cluster TGF-beta receptors and lower the energy barrier of ligand binding thus sensitizing the cells to TGF-beta stimulation. To prove efficacy of our nanostructures we have utilized immunofluorescent staining of Smad2/4 in order to monitor TGF-beta mediated translocation of Smad2/4 to the cell nucleus. We have also utilized Smad2/4 responsive luminescence constructs that allows us to quantify TGF-beta stimulation with and without nanostructures. To functionalize our nanostructures we relied on biotin-streptavidin linkages. This introduces a multivalency that is not necessarily desirable in all designs. Therefore we have investigated alternative means of functionalization. The first approach is based on targeting DNA nanostructure by using zinc finger binding proteins. Efficacy of zinc finger binding proteins was assayed by the use of enzyme-linked immunosorbent (ELISA) assay and atomic force microscopy (AFM). While ELISA indicated a relative specificity of zinc finger proteins for target DNA sequences AFM showed a high degree of non-specific binding and insufficient affinity. The second approach is based on using peptide nucleic acid (PNA) incorporated in the nanostructure through base pairing. PNA is a synthetic DNA analog consisting of a backbone of repeating N-(2-aminoethyl)-glycine units to which purine and pyrimidine bases are linked by amide bonds. The solid phase synthesis of PNA allows for convenient extension of the backbone into a peptide segment enabling peptide functionalization of DNA nanostructures. We have investigated how the neutral character of PNA alters the incorporation in DNA based nanostructures compared to a DNA control using biotinylation and AFM. Results indicate that PNA can successfully be used as a way of functionalizing DNA nanostructures. Additionally we have shown that functionalized nanostructures are capable of sensitizing cells to TGF-beta stimulation.

Comparison of Relative Binding Affinities for Trout and Human Estrogen Receptor Based upon Different Competitive Binding Assays

EPA Science Inventory

The development of a predictive model based upon a single aquatic species inevitably raises the question of whether this information is valid for other species. To partially address this question, relative binding affinities (RBA) for six alkylphenols (para-substituted, n- and b...

A Novel Assay for Antibody-Dependent Cell-Mediated Cytotoxicity against HIV-1- or SIV-Infected Cells Reveals Incomplete Overlap with Antibodies Measured by Neutralization and Binding Assays

PubMed Central

Alpert, Michael D.; Heyer, Lisa N.; Williams, David E. J.; Harvey, Jackson D.; Greenough, Thomas; Allhorn, Maria

2012-01-01

The resistance of human immunodeficiency virus type 1 (HIV-1) to antibody-mediated immunity often prevents the detection of antibodies that neutralize primary isolates of HIV-1. However, conventional assays for antibody functions other than neutralization are suboptimal. Current methods for measuring the killing of virus-infected cells by antibody-dependent cell-mediated cytotoxicity (ADCC) are limited by the number of natural killer (NK) cells obtainable from individual donors, donor-to-donor variation, and the use of nonphysiological targets. We therefore developed an ADCC assay based on NK cell lines that express human or macaque CD16 and a CD4+ T-cell line that expresses luciferase from a Tat-inducible promoter upon HIV-1 or simian immunodeficiency virus (SIV) infection. NK cells and virus-infected targets are mixed in the presence of serial plasma dilutions, and ADCC is measured as the dose-dependent loss of luciferase activity. Using this approach, ADCC titers were measured in plasma samples from HIV-infected human donors and SIV-infected macaques. For the same plasma samples paired with the same test viruses, this assay was approximately 2 orders of magnitude more sensitive than optimized assays for neutralizing antibodies—frequently allowing the measurement of ADCC in the absence of detectable neutralization. Although ADCC correlated with other measures of Env-specific antibodies, neutralizing and gp120 binding titers did not consistently predict ADCC activity. Hence, this assay affords a sensitive method for measuring antibodies capable of directing ADCC against HIV- or SIV-infected cells expressing native conformations of the viral envelope glycoprotein and reveals incomplete overlap of the antibodies that direct ADCC and those measured in neutralization and binding assays. PMID:22933282

76 FR 4920 - Government-Owned Inventions; Availability for Licensing

Federal Register 2010, 2011, 2012, 2013, 2014

2011-01-27

... appear to be distinct from each other. Available for licensing is a Plk1 ELISA assay using peptide... binding property, an easy and reliable ELISA assay has been developed to quantify Plk1 expression levels... sequence. ELISA assay to quantify Plk1 expression and kinase activity. Advantages: Rapid, highly sensitive...

Periplasmic binding protein-based detection of maltose using liposomes: a new class of biorecognition elements in competitive assays.

PubMed

Edwards, Katie A; Baeumner, Antje J

2013-03-05

A periplasmic binding protein (PBP) was investigated as a novel binding species in a similar manner to an antibody in a competitive enzyme linked immunosorbent assay (ELISA), resulting in a highly sensitive and specific assay utilizing liposome-based signal amplification. PBPs are located at high concentrations (10(-4) M) between the inner and outer membranes of gram negative bacteria and are involved in the uptake of solutes and chemotaxis of bacteria toward nutrient sources. Previous sensors relying on PBPs took advantage of the change in local environment or proximity of site-specific fluorophore labels resulting from the significant conformational shift of these proteins' two globular domains upon target binding. Here, rather than monitoring conformational shifts, we have instead utilized the maltose binding protein (MBP) in lieu of an antibody in an ELISA. To our knowledge, this is the first PBP-based sensor without the requirement for engineering site-specific modifications within the protein. MBP conjugated fluorescent dye-encapsulating liposomes served to provide recognition and signal amplification in a competitive assay for maltose using amylose magnetic beads in a microtiter plate-based format. The development of appropriate binding buffers and competitive surfaces are described, with general observations expected to extend to PBPs for other analytes. The resulting assay was specific for d-(+)-maltose versus other sugar analogs including d-(+)-raffinose, sucrose, d-trehalose, d-(+)-xylose, d-fructose, 1-thio-β-d-glucose sodium salt, d-(+)-galactose, sorbitol, glycerol, and dextrose. Cross-reactivity with d-lactose and d-(+)-glucose occurred only at concentrations >10(4)-fold greater than d-(+)-maltose. The limit of detection was 78 nM with a dynamic range covering over 3 orders of magnitude. Accurate detection of maltose as an active ingredient in a pharmaceutical preparation was demonstrated. This method offers a significant improvement over existing enzymatic detection approaches that cannot discriminate between maltose and glucose and over existing fluorescence resonance energy transfer (FRET)-based detection methods that are sensitivity limited. In addition, it opens up a new strategy for the development of biosensors to difficult analytes refractory to immunological detection.

Production of Antiserum to LH-Releasing Hormone (LH-RH) Associated with Gonadal Atrophy in Rabbits: Development of Radioimmunoassays for LH-RH

DOE Office of Scientific and Technical Information (OSTI.GOV)

ARIMURA, A.; SATO, H.; KUMASAKA, T.

1973-11-01

Repeated injections of synthetic LH -- RH decapeptide, adsorbed on polyvinylpyrrolidone and emulsified with complete Freund's adjuvant, resulted in the production of a specific antiserum to LH-- RH in two of three rabbits. The animals that produced this antiserum showed a reduction of pituitary LH content and marked atrophy of the testes. The antiserum-antibody complex was detected by the complement flxation test. The antiserum was capable of binding /sup 125/I- labeled LH--RH. After iodination of LHRH (using /sup 125/I and either the chloramine T or lactoperoxidase method) separation of the iodination products on CMC yielded three main peaks of radioactivity:more » The first was free iodide, the second was labeled peptide with low immunoreactivity, and the third was immunoreactive peptide. This 3rd peak consisted of two or three subpeaks; the leading subpeak(s) were more readily bound by antiserum than the trailing one(s). Binding of these fractions to antiserum was increased in the presence of small amounts of unlabeled LH--RH (a phenomenon called paradoxical binding or hock effect) but inhibited by larger amounts. Both the augmentation and the inhibition effects were dose-related, allowing the development of two different radioimmunoassay (RIA) systems for LH--RH. An ordinary (coinpetitive) type of RIA was developed in which a small amount (0.31 ng/assay tube) of unlabeled LH-- RH was added to the labeled peptide. This saturated the antiserum's capacity for paradoxical binding, so that further addition of LH-- RH (from 0.04 to 2.5 ng/ tube) inhibited binding of labeled LH--RH. The assay developed using paradoxical binding omitted the premixing of labeled and unlabeled LH--RH; in this assay addition of very small amounts (0.5 to 310 pg) of unlabeled LH--RH to the assay tubes increased the amount of label bound to antiserum and allowed construction of a parabolic curve of positive slope when B/T was plotted against arithmetic dose. The assays seem to be highly specific for LH--RH although both polymers and degradation products of LH--RH appeared to have some immunoreactivity.« less

Dimeric PROP1 binding to diverse palindromic TAAT sequences promotes its transcriptional activity.

PubMed

Nakayama, Michie; Kato, Takako; Susa, Takao; Sano, Akiko; Kitahara, Kousuke; Kato, Yukio

2009-08-13

Mutations in the Prop1 gene are responsible for murine Ames dwarfism and human combined pituitary hormone deficiency with hypogonadism. Recently, we reported that PROP1 is a possible transcription factor for gonadotropin subunit genes through plural cis-acting sites composed of AT-rich sequences containing a TAAT motif which differs from its consensus binding sequence known as PRDQ9 (TAATTGAATTA). This study aimed to verify the binding specificity and sequence of PROP1 by applying the method of SELEX (Systematic Evolution of Ligands by EXponential enrichment), EMSA (electrophoretic mobility shift assay) and transient transfection assay. SELEX, after 5, 7 and 9 generations of selection using a random sequence library, showed that nucleotides containing one or two TAAT motifs were accumulated and accounted for 98.5% at the 9th generation. Aligned sequences and EMSA demonstrated that PROP1 binds preferentially to 11 nucleotides composed of an inverted TAAT motif separated by 3 nucleotides with variation in the half site of palindromic TAAT motifs and with preferential requirement of T at the nucleotide number 5 immediately 3' to a TAAT motif. Transient transfection assay demonstrated first that dimeric binding of PROP1 to an inverted TAAT motif and its cognates resulted in transcriptional activation, whereas monomeric binding of PROP1 to a single TAAT motif and an inverted ATTA motif did not mediate activation. Thus, this study demonstrated that dimeric binding of PROP1 is able to recognize diverse palindromic TAAT sequences separated by 3 nucleotides and to exhibit its transcriptional activity.

Selective molecularly imprinted polymer combined with restricted access material for in-tube SPME/UHPLC-MS/MS of parabens in breast milk samples.

PubMed

Souza, Israel D; Melo, Lidervan P; Jardim, Isabel C S F; Monteiro, Juliana C S; Nakano, Ana Marcia S; Queiroz, Maria Eugênia C

2016-08-17

A new molecularly imprinted polymer modified with restricted access material (a hydrophilic external layer), (MIP-RAM) was synthesized via polymerization in situ in an open fused silica capillary. This stationary phase was used as sorbent for in-tube solid phase microextraction (in-tube SPME) to determine parabens in breast milk samples by ultra-high-performance liquid chromatography-tandem mass spectrometry (UHPLC-MS/MS). Scanning electron micrographs (SEM) illustrate MIP surface modification after glycerol dimethacrylate (hydrophilic monomer) incorporation. The interaction between parabens and MIP-RAM was investigated by Fourier-transform infrared (FTIR) spectroscopy. The Scatchard plot for MIP-RAM presented two linear parts with different slopes, illustrating binding sites with high- and low-affinity. Endogenous compounds exclusion from the MIP-RAM capillary was demonstrated by in-tube SPME/LC-UV assays carried out with blank milk samples. The in-tube SPME/UHPLC-MS/MS method presented linear range from 10 ng mL(-1) (LLOQ) to 400 ng mL(-1) with coefficients of determination higher than 0.99, inter-assay precision with coefficient of variation (CV) values ranging from 2 to 15%, and inter-assay accuracy with relative standard deviation (RSD) values ranging from -1% to 19%. Analytical validation parameters attested that in-tube SPME/UHPLC-MS/MS is an appropriate method to determine parabens in human milk samples to assess human exposure to these compounds. Analysis of breast milk samples from lactating women demonstrated that the proposed method is effective. Copyright © 2016 Elsevier B.V. All rights reserved.

6-Gingerol Mediates its Anti Tumor Activities in Human Oral and Cervical Cancer Cell Lines through Apoptosis and Cell Cycle Arrest.

PubMed

Kapoor, Vaishali; Aggarwal, Sadhna; Das, Satya N

2016-04-01

6-Gingerol, a potent nutraceutical, has been shown to have antitumor activity in different tumors, although its mechanism of action is not well understood. In this study, we evaluated antitumor activities of 6-gingerol on human oral (SCC4, KB) and cervical cancer (HeLa) cell lines with or without wortmannin, rapamycin, and cisplatin. Tumor cell proliferation was observed using 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H tetrazolium, inner salt assay, cell cycle analysis by propidium iodide labeling and flow cytometry, apoptosis by Annexin-V binding assay, and caspase activity by chemiluminescence assay. 6-Gingerol showed dose-dependent cytotoxicity in all three cell lines. Combinations of 6-gingerol with wortmannin and cisplatin showed additive effects, while with rapamycin, it showed 50% cytotoxicity that was equivalent to IC50 of 6-gingerol alone. Treatment with 6-gingerol resulted in G2-phase arrest in KB and HeLa cells and S-phase arrest in SCC4 cells. 6-Gingerol, wortmannin, and rapamycin treatment showed almost two-fold higher expression of caspase 3 in all cell lines. The results imply that 6-gingerol either alone or in combination with PI-3 K inhibitor and cisplatin may provide better therapeutic effects in oral and cervical carcinoma. Thus, 6-gingerol appears to be a safe and potent chemotherapeutic/chemopreventive compound acting through cell cycle arrest and induction of apoptosis in human oral and cervical tumor cells. Copyright © 2016 John Wiley & Sons, Ltd.

Effects of egg-adaptation on receptor-binding and antigenic properties of recent influenza A (H3N2) vaccine viruses.

PubMed

Parker, Lauren; Wharton, Stephen A; Martin, Stephen R; Cross, Karen; Lin, Yipu; Liu, Yan; Feizi, Ten; Daniels, Rodney S; McCauley, John W

2016-06-01

Influenza A virus (subtype H3N2) causes seasonal human influenza and is included as a component of influenza vaccines. The majority of vaccine viruses are isolated and propagated in eggs, which commonly results in amino acid substitutions in the haemagglutinin (HA) glycoprotein. These substitutions can affect virus receptor-binding and alter virus antigenicity, thereby, obfuscating the choice of egg-propagated viruses for development into candidate vaccine viruses. To evaluate the effects of egg-adaptive substitutions seen in H3N2 vaccine viruses on sialic acid receptor-binding, we carried out quantitative measurement of virus receptor-binding using surface biolayer interferometry with haemagglutination inhibition (HI) assays to correlate changes in receptor avidity with antigenic properties. Included in these studies was a panel of H3N2 viruses generated by reverse genetics containing substitutions seen in recent egg-propagated vaccine viruses and corresponding cell culture-propagated wild-type viruses. These assays provide a quantitative approach to investigating the importance of individual amino acid substitutions in influenza receptor-binding. Results show that viruses with egg-adaptive HA substitutions R156Q, S219Y, and I226N, have increased binding avidity to α2,3-linked receptor-analogues and decreased binding avidity to α2,6-linked receptor-analogues. No measurable binding was detected for the viruses with amino acid substitution combination 156Q+219Y and receptor-binding increased in viruses where egg-adaptation mutations were introduced into cell culture-propagated virus. Substitutions at positions 156 and 190 appeared to be primarily responsible for low reactivity in HI assays with post-infection ferret antisera raised against 2012-2013 season H3N2 viruses. Egg-adaptive substitutions at position 186 caused substantial differences in binding avidity with an insignificant effect on antigenicity.

Image Restoration and Analysis of Influenza Virions Binding to Membrane Receptors Reveal Adhesion-Strengthening Kinetics

PubMed Central

Lee, Donald W.; Hsu, Hung-Lun; Bacon, Kaitlyn B.; Daniel, Susan

2016-01-01

With the development of single-particle tracking (SPT) microscopy and host membrane mimics called supported lipid bilayers (SLBs), stochastic virus-membrane binding interactions can be studied in depth while maintaining control over host receptor type and concentration. However, several experimental design challenges and quantitative image analysis limitations prevent the widespread use of this approach. One main challenge of SPT studies is the low signal-to-noise ratio of SPT videos, which is sometimes inevitable due to small particle sizes, low quantum yield of fluorescent dyes, and photobleaching. These situations could render current particle tracking software to yield biased binding kinetic data caused by intermittent tracking error. Hence, we developed an effective image restoration algorithm for SPT applications called STAWASP that reveals particles with a signal-to-noise ratio of 2.2 while preserving particle features. We tested our improvements to the SPT binding assay experiment and imaging procedures by monitoring X31 influenza virus binding to α2,3 sialic acid glycolipids. Our interests lie in how slight changes to the peripheral oligosaccharide structures can affect the binding rate and residence times of viruses. We were able to detect viruses binding weakly to a glycolipid called GM3, which was undetected via assays such as surface plasmon resonance. The binding rate was around 28 folds higher when the virus bound to a different glycolipid called GD1a, which has a sialic acid group extending further away from the bilayer surface than GM3. The improved imaging allowed us to obtain binding residence time distributions that reflect an adhesion-strengthening mechanism via multivalent bonds. We empirically fitted these distributions using a time-dependent unbinding rate parameter, koff, which diverges from standard treatment of koff as a constant. We further explain how to convert these models to fit ensemble-averaged binding data obtained by assays such as surface plasmon resonance. PMID:27695072

Identification of Dmt-D-Lys-Phe-Phe-OH as a highly antinociceptive tetrapeptide metabolite of the opioid-neurotensin hybrid peptide PK20.

PubMed

Kleczkowska, Patrycja; Bojnik, Engin; Leśniak, Anna; Kosson, Piotr; Van den Eynde, Isabelle; Ballet, Steven; Benyhe, Sandor; Tourwé, Dirk; Lipkowski, Andrzej W

2013-01-01

Recently, we presented a novel compound (PK20, Dmt-D-Lys-Phe-Phe-Lys-Lys-Pro-Phe-Tle-Leu-OH) that targets single entity opioid and neurotensin pharmacophores. This endomorphin-2-like opioid peptide was introduced as a highly active analgesic because it elicited a strong dose- and time-dependent antinociceptive response when administered centrally and peripherally. Its pain-relieving activity was observed as rapidly as 5 min after drug injection. Such promising results led us to perform further studies, such as determining the resistance to enzymatic degradation, which resulted in obtaining a very stable opioid pharmacore PK20 metabolite. The synthesis of PK20 and its N-terminal tetrapeptide fragment has been accomplished using solid phase peptide chemistry. The biological stability of peptides has been measured in human serum and analyzed by HPLC/MS. Peptides were pharmacologically characterized in in vitro MOP and DOP receptor binding as well as [(35)S]GTPγS receptor binding assays. Antinociceptive properties of compounds were measured by in vivo assays in C57Bl6 mice after intravenous or intrathecal applications. Dmt-D-Lys-Phe-Phe-OH (PK20M), an N-terminal tetrapeptide metabolite of the opioid-neurotensin hybrid peptide PK20, is characterized by a long duration of action, as demonstrated by a preserved, long-lasting analgesic effect even 2 h post-injection (average % MPE = 69.33). In rat brain membranes, PK20M efficiently displaced both the MOP and DOP receptor selective radioprobes [(3)H]DAMGO and [(3)H]DIDI (pKi of 9.52 and 7.86, respectively) and potently stimulated [(35)S]GTPγS binding, proving full agonism at both receptor types. In the [(35)S]GTPγS assay, which measured the agonist-mediated G protein activation, PK20M together with PK20 and Met-enkephalin were potent stimulators of the regulatory G proteins. The relative affinities of PK20M for the μ and δ receptor subtypes revealed μ-receptor selectivity. The novel MOP receptor selective metabolite has been shown to possess opioid subtype receptor selectivity, high potency, and effective analgesic activities as measured in various bioassays.

A reversed-phase compatible thin-layer chromatography autography for the detection of acetylcholinesterase inhibitors.

PubMed

Ramallo, I Ayelen; García, Paula; Furlan, Ricardo L E

2015-11-01

A dual readout autographic assay to detect acetylcholinesterase inhibitors present in complex matrices adsorbed on reversed-phase or normal-phase thin-layer chromatography plates is described. Enzyme gel entrapment with an amphiphilic copolymer was used for assay development. The effects of substrate and enzyme concentrations, pH, incubation time, and incubation temperature on the sensitivity and the detection limit of the assay were evaluated. Experimental design and response surface methodology were used to optimize conditions with a minimum number of experiments. The assay allowed the detection of 0.01% w/w of physostigmine in both a spiked Sonchus oleraceus L. extract chromatographed on normal phase and a spiked Pimenta racemosa (Mill.) J.W. Moore leaf essential oil chromatographed on reversed phase. Finally, the reversed-phase thin-layer chromatography assay was applied to reveal the presence of an inhibitor in the Cymbopogon citratus (DC.) Stapf essential oil. The developed assay is able to detect acetylcholinesterase inhibitors present in complex matrixes that were chromatographed in normal phase or reversed-phase thin-layer chromatography. The detection limit for physostigmine on both normal and reversed phase was of 1×10(-4) μg. The results can be read by a change in color and/or a change in fluorescence. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

CHD3 and CHD4 recruitment and chromatin remodeling activity at DNA breaks is promoted by early poly(ADP-ribose)-dependent chromatin relaxation.

PubMed

Smith, Rebecca; Sellou, Hafida; Chapuis, Catherine; Huet, Sébastien; Timinszky, Gyula

2018-05-04

One of the first events to occur upon DNA damage is the local opening of the compact chromatin architecture, facilitating access of repair proteins to DNA lesions. This early relaxation is triggered by poly(ADP-ribosyl)ation by PARP1 in addition to ATP-dependent chromatin remodeling. CHD4 recruits to DNA breaks in a PAR-dependent manner, although it lacks any recognizable PAR-binding domain, and has the ability to relax chromatin structure. However, its role in chromatin relaxation at the site of DNA damage has not been explored. Using a live cell fluorescence three-hybrid assay, we demonstrate that the recruitment of CHD4 to DNA damage, while being poly(ADP-ribosyl)ation-dependent, is not through binding poly(ADP-ribose). Additionally, we show that CHD3 is recruited to DNA breaks in the same manner as CHD4 and that both CHD3 and CHD4 play active roles in chromatin remodeling at DNA breaks. Together, our findings reveal a two-step mechanism for DNA damage induced chromatin relaxation in which PARP1 and the PAR-binding remodeler activities of Alc1/CHD1L induce an initial chromatin relaxation phase that promotes the subsequent recruitment of CHD3 and CHD4 via binding to DNA for further chromatin remodeling at DNA breaks.

Kinetic Analyses of Data from a Human Serum Albumin Assay Using the liSPR System.

PubMed

Henseleit, Anja; Pohl, Carolin; Kaltenbach, Hans-Michael; Hettwer, Karina; Simon, Kirsten; Uhlig, Steffen; Haustein, Natalie; Bley, Thomas; Boschke, Elke

2015-01-19

We used the interaction between human serum albumin (HSA) and a high-affinity antibody to evaluate binding affinity measurements by the bench-top liSPR system (capitalis technology GmbH). HSA was immobilized directly onto a carboxylated sensor layer, and the mechanism of interaction between the antibody and HSA was investigated. The bivalence and heterogeneity of the antibody caused a complex binding mechanism. Three different interaction models (1:1 binding, heterogeneous analyte, bivalent analyte) were compared, and the bivalent analyte model best fit the curves obtained from the assay. This model describes the interaction of a bivalent analyte with one or two ligands (A + L ↔ LA + L ↔ LLA). The apparent binding affinity for this model measured 37 pM for the first reaction step, and 20 pM for the second step.

Kinetic Analyses of Data from a Human Serum Albumin Assay Using the liSPR System

PubMed Central

Henseleit, Anja; Pohl, Carolin; Kaltenbach, Hans-Michael; Hettwer, Karina; Simon, Kirsten; Uhlig, Steffen; Haustein, Natalie; Bley, Thomas; Boschke, Elke

2015-01-01

We used the interaction between human serum albumin (HSA) and a high-affinity antibody to evaluate binding affinity measurements by the bench-top liSPR system (capitalis technology GmbH). HSA was immobilized directly onto a carboxylated sensor layer, and the mechanism of interaction between the antibody and HSA was investigated. The bivalence and heterogeneity of the antibody caused a complex binding mechanism. Three different interaction models (1:1 binding, heterogeneous analyte, bivalent analyte) were compared, and the bivalent analyte model best fit the curves obtained from the assay. This model describes the interaction of a bivalent analyte with one or two ligands (A + L ↔ LA + L ↔ LLA). The apparent binding affinity for this model measured 37 pM for the first reaction step, and 20 pM for the second step. PMID:25607476

A force-based protein biochip

NASA Astrophysics Data System (ADS)

Blank, K.; Mai, T.; Gilbert, I.; Schiffmann, S.; Rankl, J.; Zivin, R.; Tackney, C.; Nicolaus, T.; Spinnler, K.; Oesterhelt, F.; Benoit, M.; Clausen-Schaumann, H.; Gaub, H. E.

2003-09-01

A parallel assay for the quantification of single-molecule binding forces was developed based on differential unbinding force measurements where ligand-receptor interactions are compared with the unzipping forces of DNA hybrids. Using the DNA zippers as molecular force sensors, the efficient discrimination between specific and nonspecific interactions was demonstrated for small molecules binding to specific receptors, as well as for protein-protein interactions on protein arrays. Finally, an antibody sandwich assay with different capture antibodies on one chip surface and with the detection antibodies linked to a congruent surface via the DNA zippers was used to capture and quantify a recombinant hepatitis C antigen from solution. In this case, the DNA zippers enable not only discrimination between specific and nonspecific binding, but also allow for the local application of detection antibodies, thereby eliminating false-positive results caused by cross-reactive antibodies and nonspecific binding.

What Do Chaotrope-Based Avidity Assays for Antibodies to HIV-1 Envelope Glycoproteins Measure?

PubMed Central

Alexander, Marina R.; Ringe, Rajesh; Sanders, Rogier W.; Voss, James E.; Moore, John P.

2015-01-01

ABSTRACT When HIV-1 vaccine candidates that include soluble envelope glycoproteins (Env) are tested in humans and other species, the resulting antibody responses to Env are sifted for correlates of protection or risk. One frequently used assay measures the reduction in antibody binding to Env antigens by an added chaotrope (such as thiocyanate). Based on that assay, an avidity index was devised for assessing the affinity maturation of antibodies of unknown concentration in polyclonal sera. Since a high avidity index was linked to protection in animal models of HIV-1 infection, it has become a criterion for evaluating antibody responses to vaccine candidates. But what does the assay measure and what does an avidity index mean? Here, we have used a panel of monoclonal antibodies to well-defined epitopes on Env (gp120, gp41, and SOSIP.664 trimers) to explore how the chaotrope acts. We conclude that the chaotrope sensitivity of antibody binding to Env depends on several properties of the epitopes (continuity versus tertiary- and quaternary-structural dependence) and that the avidity index has no simple relationship to antibody affinity for functional Env spikes on virions. We show that the binding of broadly neutralizing antibodies against quaternary-structural epitopes is particularly sensitive to chaotrope treatment, whereas antibody binding to epitopes in variable loops and to nonneutralization epitopes in gp41 is generally resistant. As a result of such biases, the avidity index may at best be a mere surrogate for undefined antibody or other immune responses that correlate weakly with protection. IMPORTANCE An effective HIV-1 vaccine is an important goal. Such a vaccine will probably need to induce antibodies that neutralize typically transmitted variants of HIV-1, preventing them from infecting target cells. Vaccine candidates have so far failed to induce such antibody responses, although some do protect weakly against infection in animals and, possibly, humans. In the search for responses associated with protection, an avidity assay based on chemical disruption is often used to measure the strength of antibody binding. We have analyzed this assay mechanistically and found that the epitope specificity of an antibody has a greater influence on the outcome than does its affinity. As a result, the avidity assay is biased toward the detection of some antibody specificities while disfavoring others. We conclude that the assay may yield merely indirect correlations with weak protection, specifically when Env vaccination has failed to induce broad neutralizing responses. PMID:25810537

Assays for the determination of the activity of DNA nucleases based on the fluorometric properties of the YOYO dye.

PubMed

Fernández-Sierra, Mónica; Quiñones, Edwin

2015-03-15

Here we characterize the fluorescence of the YOYO dye as a tool for studying DNA-protein interactions in real time and present two continuous YOYO-based assays for sensitively monitoring the kinetics of DNA digestion by λ-exonuclease and the endonuclease EcoRV. The described assays rely on the different fluorescence intensities between single- and double-stranded DNA-YOYO complexes, allowing straightforward determination of nuclease activity and quantitative determination of reaction products. The assays were also employed to assess the effect of single-stranded DNA-binding proteins on the λ-exonuclease reaction kinetics, showing that the extreme thermostable single-stranded DNA-binding protein (ET-SSB) significantly reduced the reaction rate, while the recombination protein A (RecA) displayed no effect. Copyright © 2015 Elsevier Inc. All rights reserved.

Enzyme-linked immunosorbent assays for determination of plasma aldosterone using highly specific polyclonal antibodies.

PubMed

Schwartz, F; Hadas, E; Harnik, M; Solomon, B

1990-01-01

Two enzyme-linked immunosorbent assays were established and compared for the estimation of plasma aldosterone. In the first method immobilized aldosterone-protein complexes on the ELISA plates compete with aldosterone to be determined for the binding of certain amount of anti-aldosterone antibodies. The sensitivity of this method depends on the protein carrier used to conjugate with aldosterone. In the second method, anti-aldosterone antibodies adsorbed on ELISA plates compete for binding of known amount of the enzyme-labeled aldosterone and aldosterone to be determined. The highly specific rabbit anti-aldosterone antibodies were obtained by injection of aldosterone-oxime thyroglobulin. The detection limit of aldosterone in both methods ranged between 2-20 pg. The proposed assays are suitable for the determination of aldosterone in biological fluids compared with other reported ELISA assays, as well as with RIA.

Production and assay of forskolin antibodies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ho, L.T.; Ho, R.J.

1986-05-01

Forskolin (Fo), a cardiovascular active diterpene of plant origin, has been widely used as a research tool in regulation of the catalytic activity of adenylate cyclase (AC). A linear relationship of Fo binding to plasma membrane with activation of AC has been reported. The present abstract describes the production and assay of Fo antibodies (AB). 7-0-Hemisuccinyl-7-deacetyl Fo, coupled to either human serum albumin or goat IgG, was injected into goats to elicit AB to Fo haptan. AB to Fo in antiserum or an isolated IgG fraction was tested by two assay methods, a radioimmunoassay using /sup 3/H-Fo as a tracermore » and a colorimetric enzyme-linked immunosorbent assay (ELISA) using horse radish peroxidase-rabbit anti goat IgG as indicator. The titers for Fo antiserum were 4000-10,000. In the defined assay condition, approximately 20-25% of the added /sup 3/H-Fo was found to bind to AB. The bound radioactivity was displaced by Fo-HSA or Fo-goat IgG or free unlabelled Fo ranging from 0.5-50 pmol/tube, or 5-500 nM. The IC/sub 50/ was approximately 8-10 pmol/tube or 80-100 nM. The binding of HRP-rabbit anti goat IgG in the ELISA was inhibited by proper Fo conjugate. The development of methods for production and assay for Fo AB may be useful in the study of mechanism of activation of AC by Fo and Fo-like compound.« less

Functional efficacy of adenosine A2A receptor agonists is positively correlated to their receptor residence time

PubMed Central

Guo, Dong; Mulder-Krieger, Thea; IJzerman, Adriaan P; Heitman, Laura H

2012-01-01

BACKGROUND AND PURPOSE The adenosine A2A receptor belongs to the superfamily of GPCRs and is a promising therapeutic target. Traditionally, the discovery of novel agents for the A2A receptor has been guided by their affinity for the receptor. This parameter is determined under equilibrium conditions, largely ignoring the kinetic aspects of the ligand-receptor interaction. The aim of this study was to assess the binding kinetics of A2A receptor agonists and explore a possible relationship with their functional efficacy. EXPERIMENTAL APPROACH We set up, validated and optimized a kinetic radioligand binding assay (a so-called competition association assay) at the A2A receptor from which the binding kinetics of unlabelled ligands were determined. Subsequently, functional efficacies of A2A receptor agonists were determined in two different assays: a novel label-free impedance-based assay and a more traditional cAMP determination. KEY RESULTS A simplified competition association assay yielded an accurate determination of the association and dissociation rates of unlabelled A2A receptor ligands at their receptor. A correlation was observed between the receptor residence time of A2A receptor agonists and their intrinsic efficacies in both functional assays. The affinity of A2A receptor agonists was not correlated to their functional efficacy. CONCLUSIONS AND IMPLICATIONS This study indicates that the molecular basis of different agonist efficacies at the A2A receptor lies within their different residence times at this receptor. PMID:22324512

Metal-amplified Density Assays, (MADAs), including a Density-Linked Immunosorbent Assay (DeLISA).

PubMed

Subramaniam, Anand Bala; Gonidec, Mathieu; Shapiro, Nathan D; Kresse, Kayleigh M; Whitesides, George M

2015-02-21

This paper reports the development of Metal-amplified Density Assays, or MADAs - a method of conducting quantitative or multiplexed assays, including immunoassays, by using Magnetic Levitation (MagLev) to measure metal-amplified changes in the density of beads labeled with biomolecules. The binding of target analytes (i.e. proteins, antibodies, antigens) to complementary ligands immobilized on the surface of the beads, followed by a chemical amplification of the binding in a form that results in a change in the density of the beads (achieved by using gold nanoparticle-labeled biomolecules, and electroless deposition of gold or silver), translates analyte binding events into changes in density measureable using MagLev. A minimal model based on diffusion-limited growth of hemispherical nuclei on a surface reproduces the dynamics of the assay. A MADA - when performed with antigens and antibodies - is called a Density-Linked Immunosorbent Assay, or DeLISA. Two immunoassays provided a proof of principle: a competitive quantification of the concentration of neomycin in whole milk, and a multiplexed detection of antibodies against Hepatitis C virus NS3 protein and syphilis T. pallidum p47 protein in serum. MADAs, including DeLISAs, require, besides the requisite biomolecules and amplification reagents, minimal specialized equipment (two permanent magnets, a ruler or a capillary with calibrated length markings) and no electrical power to obtain a quantitative readout of analyte concentration. With further development, the method may be useful in resource-limited or point-of-care settings.

Development and validation of receptor occupancy pharmacodynamic assays used in the clinical development of the monoclonal antibody vedolizumab.

PubMed

Wyant, Tim; Estevam, Jose; Yang, Lili; Rosario, Maria

2016-03-01

Vedolizumab is a monoclonal antibody approved for use in ulcerative colitis and Crohn's disease. By specifically binding to α4 β7 integrin, vedolizumab prevents trafficking of lymphocytes to the gut, thereby interfering with disease pathology. During the clinical development program, the pharmacodynamic effect of vedolizumab was evaluated by 2 flow cytometry receptor occupancy assays: act-1 (ACT-1) and mucosal addressin cell adhesion molecule-1 (MAdCAM-1). Here we describe the development and validation of these assays. The ACT-1 assay is a receptor occupancy free-site assay that uses a monoclonal antibody with the same binding epitope as vedolizumab to detect free (unbound) sites on α4 β7 integrin. The MAdCAM-1 assay used a soluble version of the natural ligand for α4 β7 integrin to detect free sites. The assays were validated using a fit-for-purpose approach throughout the clinical development of vedolizumab. Both the ACT-1 assay and the MAdCAM-1 assay demonstrated acceptable reproducibility and repeatability. The assays were sufficiently stable to allow for clinical use. During clinical testing the assays demonstrated that vedolizumab was able to saturate peripheral cells at all doses tested. Two pharmacodynamic receptor occupancy assays were developed and validated to assess the effect of vedolizumab on peripheral blood cells. The results of these assays demonstrated the practical use of flow cytometry to examine pharmacodynamic response in clinical trials. © 2015 International Clinical Cytometry Society.

Beta-Endorphin: dissociation of receptor binding activity from analgesic potency.

PubMed

Li, C H; Tseng, L F; Ferrara, P; Yamashiro, D

1980-04-01

Biological activities of synthetic camel beta-endorphin and human beta-endorphin (beta h-EP) have been measured by the radioreceptor binding assay, using [Tyr27-3H]-beta h-EP as the primary ligand and by the tail-flick test for analgesic potency. Four synthetic analogs of beta h-EP, namely [Gly31]-beta h-EP-Gly-NH2, [Gly31]-beta h-EP-Gly-Gly-NH2, [Gln8,Gly31]-beta h-EP-Gly-Gly-NH2, and [CH3(CH2)4NH231]-beta h-EP, have also been assayed by the same procedures. Results indicate a clear dissociation of radioreceptor binding activity from analgesic potency.

Beta-Endorphin: dissociation of receptor binding activity from analgesic potency.

PubMed Central

Li, C H; Tseng, L F; Ferrara, P; Yamashiro, D

1980-01-01

Biological activities of synthetic camel beta-endorphin and human beta-endorphin (beta h-EP) have been measured by the radioreceptor binding assay, using [Tyr27-3H]-beta h-EP as the primary ligand and by the tail-flick test for analgesic potency. Four synthetic analogs of beta h-EP, namely [Gly31]-beta h-EP-Gly-NH2, [Gly31]-beta h-EP-Gly-Gly-NH2, [Gln8,Gly31]-beta h-EP-Gly-Gly-NH2, and [CH3(CH2)4NH231]-beta h-EP, have also been assayed by the same procedures. Results indicate a clear dissociation of radioreceptor binding activity from analgesic potency. PMID:6246537

Measurement of monomolecular binding constants of neutral phenols into the beta-cyclodextrin by continuous frontal analysis in capillary and microchip electrophoresis via a competitive assay.

PubMed

Le Saux, Thomas; Hisamoto, Hideaki; Terabe, Shigeru

2006-02-03

Measurement of binding constant by chip electrophoresis is a very promising technique for the high throughput screening of non-covalent interactions. Among the different electrophoretic methods available that yield the binding parameters, continuous frontal analysis is the most appropriate for a transposition from capillary electrophoresis (CE) to microchip electrophoresis. Implementation of this methodology in microchip was exemplified by the measurement of inclusion constants of 2-naphtalenesulfonate and neutral phenols (phenol, 4-chlorophenol and 4-nitrophenol) into beta-cyclodextrin by competitive assays. The issue of competitor choice is discussed in relation to its appropriateness for proper monitoring of the interaction.

System and method for detecting components of a mixture including a valving scheme for competition assays

DOEpatents

Koh, Chung-Yan; Piccini, Matthew E.; Singh, Anup K.

2017-09-19

Examples are described including measurement systems for conducting competition assays. A first chamber of an assay device may be loaded with a sample containing a target antigen. The target antigen in the sample may be allowed to bind to antibody-coated beads in the first chamber. A control layer separating the first chamber from a second chamber may then be opened to allow a labeling agent loaded in a first portion of the second chamber to bind to any unoccupied sites on the antibodies. A centrifugal force may then be applied to transport the beads through a density media to a detection region for measurement by a detection unit.

System and method for detecting components of a mixture including a valving scheme for competition assays

DOEpatents

Koh, Chung-Yan; Piccini, Matthew E.; Singh, Anup K.

2017-07-11

Examples are described including measurement systems for conducting competition assays. A first chamber of an assay device may be loaded with a sample containing a target antigen. The target antigen in the sample may be allowed to bind to antibody-coated beads in the first chamber. A control layer separating the first chamber from a second chamber may then be opened to allow a labeling agent loaded in a first portion of the second chamber to bind to any unoccupied sites on the antibodies. A centrifugal force may then be applied to transport the beads through a density media to a detection region for measurement by a detection unit.

miR-21 modulates resistance of HR-HPV positive cervical cancer cells to radiation through targeting LATS1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Shikai; Song, Lili, E-mail: commasll@163.com; Zhang, Liang

Although multiple miRNAs are found involved in radioresistance development in HR-HPV positive (+) cervical cancer, only limited studies explored the regulative mechanism of the miRNAs. miR-21 is one of the miRNAs significantly upregulated in HR-HPV (+) cervical cancer is also significantly associated with radioresistance. However, the detailed regulative network of miR-21 in radioresistance is still not clear. In this study, we confirmed that miR-21 overexpression was associated with higher level of radioresistance in HR-HPV (+) cervical cancer patients and thus decided to further explore its role. Findings of this study found miR-21 can negatively affect radiosensitivity of HR-HPV (+) cervicalmore » cancer cells and decrease radiation induced G2/M block and increase S phase accumulation. By using dual luciferase assay, we verified a binding site between miR-21 and 3′-UTR of large tumor suppressor kinase 1 (LATS1). Through direct binding, miR-21 can regulate LATS1 expression in cervical cancer cells. LATS1 overexpression can reverse miR-21 induced higher colony formation rate and also reduced miR-21 induced S phase accumulation and G2/M phase block reduction under radiation treatment. These results suggested that miR-21-LATS1 axis plays an important role in regulating radiosensitivity. - Highlights: • miR-21 is highly expressed in HR-HPV (+) radioresistant cervical cancer patients. • miR-21 can negatively affect radiosensitivity of HR-HPV (+) cervical cancer cells. • miR-21 can decrease radiation induced G2/M block and increase S phase accumulation. • miR-21 modulates radiosensitivity cervical cancer cell by directly targeting LATS1.« less

Phosphatidic acid binding proteins display differential binding as a function of membrane curvature stress and chemical properties.

PubMed

Putta, Priya; Rankenberg, Johanna; Korver, Ruud A; van Wijk, Ringo; Munnik, Teun; Testerink, Christa; Kooijman, Edgar E

2016-11-01

Phosphatidic acid (PA) is a crucial membrane phospholipid involved in de novo lipid synthesis and numerous intracellular signaling cascades. The signaling function of PA is mediated by peripheral membrane proteins that specifically recognize PA. While numerous PA-binding proteins are known, much less is known about what drives specificity of PA-protein binding. Previously, we have described the ionization properties of PA, summarized in the electrostatic-hydrogen bond switch, as one aspect that drives the specific binding of PA by PA-binding proteins. Here we focus on membrane curvature stress induced by phosphatidylethanolamine and show that many PA-binding proteins display enhanced binding as a function of negative curvature stress. This result is corroborated by the observation that positive curvature stress, induced by lyso phosphatidylcholine, abolishes PA binding of target proteins. We show, for the first time, that a novel plant PA-binding protein, Arabidopsis Epsin-like Clathrin Adaptor 1 (ECA1) displays curvature-dependence in its binding to PA. Other established PA targets examined in this study include, the plant proteins TGD2, and PDK1, the yeast proteins Opi1 and Spo20, and, the mammalian protein Raf-1 kinase and the C2 domain of the mammalian phosphatidylserine binding protein Lact as control. Based on our observations, we propose that liposome binding assays are the preferred method to investigate lipid binding compared to the popular lipid overlay assays where membrane environment is lost. The use of complex lipid mixtures is important to elucidate further aspects of PA binding proteins. Copyright © 2016. Published by Elsevier B.V.

Identification of a factor in HeLa cells specific for an upstream transcriptional control sequence of an EIA-inducible adenovirus promoter and its relative abundance in infected and uninfected cells.

PubMed Central

SivaRaman, L; Subramanian, S; Thimmappaya, B

1986-01-01

Utilizing the gel electrophoresis/DNA binding assay, a factor specific for the upstream transcriptional control sequence of the EIA-inducible adenovirus EIIA-early promoter has been detected in HeLa cell nuclear extract. Analysis of linker-scanning mutants of the promoter by DNA binding assays and methylation-interference experiments show that the factor binds to the 17-nucleotide sequence 5' TGGAGATGACGTAGTTT 3' located between positions -66 and -82 upstream from the cap site. This sequence has been shown to be essential for transcription of this promoter. The EIIA-early-promoter specific factor was found to be present at comparable levels in uninfected HeLa cells and in cells infected with either wild-type adenovirus or the EIA-deletion mutant dl312 under conditions in which the EIA proteins are induced to high levels [7 or 20 hr after infection in the presence of arabinonucleoside (cytosine arabinoside)]. Based on the quantitation in DNA binding assays, it appears that the mechanism of EIA-activated transcription of the EIIA-early promoter does not involve a net change in the amounts of this factor. Images PMID:2942943

Expression and purification of RHC-EGFP fusion protein and its application in hyaluronic acid assay.

PubMed

Duan, Ningjun; Lv, Wansheng; Zhu, Lingli; Zheng, Weijuan; Hua, Zichun

2017-03-16

Hyaluronan is a widely distributed glycosaminoglycan which has multiple functions. Hyaluronic acid (HA) accumulation has been reported in many human diseases. Understanding the role of hyaluronan and its binding proteins in the pathobiology of disease will facilitate the development of novel therapeutics for many critical diseases. Current techniques described for the analysis of HA are mainly for HA quantification in solutions, not for the direct detection of HA in tissues or on cell surfaces. In our study, a fusion protein, named C-terminal domain of RHAMM-enhanced green fluorescence protein (RHC-EGFP), combined the HA-binding domain, C-terminal of receptor for hyaluronan-mediated motility, with EGFP, a widely used enhanced green fluorescence protein, was expressed and purified from Escherichia coli with high purity. Based on the sensitivity and convenience of fluorescence detection, methods for direct assay of HA in solutions, on cell surface or in tissues were established using RHC-EGFP. The binding specificity was also confirmed by competitive binding experiment and hyaluronidase degradation experiment. Our results provide an alternative choice for the specific and convenient assay of HA in various samples, and maybe helpful for further understanding of the fundamental and comprehensive functions of HA.

A novel multiplex poliovirus binding inhibition assay applicable for large serosurveillance and vaccine studies, without the use of live poliovirus.

PubMed

Schepp, Rutger M; Berbers, Guy A M; Ferreira, José A; Reimerink, Johan H; van der Klis, Fiona R

2017-03-01

Large-scale serosurveillance or vaccine studies for poliovirus using the "gold standard" WHO neutralisation test (NT) are very laborious and time consuming. With the polio eradication at hand and with the removal of live attenuated Sabin strains from the oral poliovirus vaccine (OPV), starting with type 2 (as of April 2016), laboratories will need to conform to much more stringent laboratory biosafety regulations when handling live poliovirus strains. In this study, a poliovirus binding inhibition multiplex immunoassay (polio MIA) using inactivated poliovirus vaccine (IPV-Salk) was developed for simultaneous quantification of serum antibodies directed to all three poliovirus types. Our assay shows a good correlation with the NT and an excellent correlation with the ELISA-based binding inhibition assay (POBI). The assay is highly type-specific and reproducible. Additionally, serum sample throughput increases about fivefold relative to NT and POBI and the amount of serum needed is reduced by more than 90%. In conclusion, the polio MIA can be used as a safe and high throughput application, especially for large-scale surveillance and vaccine studies, reducing laboratory time and serum amounts needed. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Determination of nuvenzepine in human plasma by a sensitive sup 3 Hpirenzepine radioreceptor binding assay

DOE Office of Scientific and Technical Information (OSTI.GOV)

Caselli, G.; Ferrari, M.P.; Tonon, G.

1991-02-01

A sensitive method for the quantitation of small amounts of nuvenzepine, a new M1-selective antimuscarinic drug, in plasma is described. The analytical method involves the use of a radioreceptor binding assay based on {sup 3}Hpirenzepine displacement in rat cerebral cortex homogenates; no previous extraction is required. The method is reliable, with an interassay CV ranging from 5 to 10%, and allows the analysis of greater than 100 samples/experiment. The limit of detection is {approximately} 0.1 ng/assay. Using this method we have determined the plasma levels of nuvenzepine in eight healthy volunteers treated PO with 15 or 25 mg of nuvenzepine.HCl.more » The pharmacokinetic parameters obtained were (for 15 and 25 mg): Cmax, 64 and 131 ng/mL; AUC0-infinity, 851 and 1379 ng.h/mL; t1/2, 8.6 and 7.2 h. These values are in good agreement with those obtained using an HPLC method. Therefore, this radioreceptor binding assay proved to be simple, rapid, and specific for the determination of low levels of nuvenzepine in human plasma.« less

Lactose-containing starburst dendrimers: influence of dendrimer generation and binding-site orientation of receptors (plant/animal lectins and immunoglobulins) on binding properties.

PubMed

André, S; Ortega, P J; Perez, M A; Roy, R; Gabius, H J

1999-11-01

Starburst glycodendrimers offer the potential to serve as high-affinity ligands for clinically relevant sugar receptors. In order to define areas of application, their binding behavior towards sugar receptors with differential binding-site orientation but identical monosaccharide specificity must be evaluated. Using poly(amidoamine) starburst dendrimers of five generations, which contain the p-isothiocyanato derivative of p-aminophenyl-beta-D-lactoside as ligand group, four different types of galactoside-binding proteins were chosen for this purpose, i.e., the (AB)(2)-toxic agglutinin from mistletoe, a human immunoglobulin G fraction, the homodimeric galectin-1 with its two binding sites at opposite ends of the jelly-roll-motif-harboring protein and monomeric galectin-3. Direct solid-phase assays with surface-immobilized glycodendrimers resulted in obvious affinity enhancements by progressive core branching for the plant agglutinin and less pronounced for the antibody and galectin-1. High density of binding of galectin-3 with modest affinity increases only from the level of the 32-mer onwards points to favorable protein-protein interactions of the monomeric lectin and a spherical display of the end groups without a major share of backfolding. When the inhibitory potency of these probes was evaluated as competitor of receptor binding to an immobilized neoglycoprotein or to asialofetuin, a marked selectivity was detected. The 32- and 64-mers were second to none as inhibitors for the plant agglutinin against both ligand-exposing matrices and for galectin-1 on the matrix with a heterogeneous array of interglycoside distances even on the per-sugar basis. In contrast, a neoglycoprotein with the same end group was superior in the case of the antibody and, less pronounced, monomeric galectin-3. Intimate details of topological binding-site presentation and the ligand display on different generations of core assembly are major operative factors which determine the potential of dendrimers for applications as lectin-targeting device, as attested by these observations.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Acetylcholinesterase affinity-based screening assay on Lippia gracilis Schauer extracts.

PubMed

Vanzolini, K L; da F Sprenger, R; Leme, G M; de S Moraes, V R; Vilela, A F L; Cardoso, C L; Cass, Q B

2018-05-10

The use of affinity-based protein assay produced by covalently linking acetylcholinesterase to magnetic beads, followed by chemical characterization of the selective binders using Liquid Chromatography with tandem High-Resolution Mass Spectrometry (LC-HRMS) is herein described for profiling crude aqueous natural product extracts. The fishing assay was first modulated using galanthamine as a reference ligand and then, the assay condition was adjusted for the aqueous leaves extracts obtained from Lippia gracilis Schauer (genotype 201) that was used as the natural combinatory library. From the experiments, a selective binder has been undisclosed with an accurate mass of 449.1131 m/z and identified as eriodictyol 2'-O-glucoside or eriodictyol 3'-O-glucoside. The selectivity of the binding assay was demonstrated, as much as, that erydictiol 7-O-glucoside was not fished, although it was present in the crude aqueous extract. The binding assay platform exhibited high specificity and did not require any sample pretreatment, making it appropriate for profiling binders at natural libraries. Copyright © 2018 Elsevier B.V. All rights reserved.

Quantifying domain-ligand affinities and specificities by high-throughput holdup assay

PubMed Central

Vincentelli, Renaud; Luck, Katja; Poirson, Juline; Polanowska, Jolanta; Abdat, Julie; Blémont, Marilyne; Turchetto, Jeremy; Iv, François; Ricquier, Kevin; Straub, Marie-Laure; Forster, Anne; Cassonnet, Patricia; Borg, Jean-Paul; Jacob, Yves; Masson, Murielle; Nominé, Yves; Reboul, Jérôme; Wolff, Nicolas; Charbonnier, Sebastian; Travé, Gilles

2015-01-01

Many protein interactions are mediated by small linear motifs interacting specifically with defined families of globular domains. Quantifying the specificity of a motif requires measuring and comparing its binding affinities to all its putative target domains. To this aim, we developed the high-throughput holdup assay, a chromatographic approach that can measure up to a thousand domain-motif equilibrium binding affinities per day. Extracts of overexpressed domains are incubated with peptide-coated resins and subjected to filtration. Binding affinities are deduced from microfluidic capillary electrophoresis of flow-throughs. After benchmarking the approach on 210 PDZ-peptide pairs with known affinities, we determined the affinities of two viral PDZ-binding motifs derived from Human Papillomavirus E6 oncoproteins for 209 PDZ domains covering 79% of the human PDZome. We obtained exquisite sequence-dependent binding profiles, describing quantitatively the PDZome recognition specificity of each motif. This approach, applicable to many categories of domain-ligand interactions, has a wide potential for quantifying the specificities of interactomes. PMID:26053890

Galline Ex-FABP is an Antibacterial Siderocalin and a Lysophosphatidic Acid Sensor Functioning through Dual Ligand Specificities

PubMed Central

Correnti, Colin; Clifton, Matthew C.; Abergel, Rebecca J.; Allred, Ben; Hoette, Trisha M.; Ruiz, Mario; Cancedda, Ranieri; Raymond, Kenneth N.; Descalzi, Fiorella; Strong, Roland K.

2011-01-01

SUMMARY Galline Ex-FABP was identified as another candidate antibacterial, catecholate siderophore binding lipocalin (siderocalin) based on structural parallels with the family archetype, mammalian Siderocalin. Binding assays show that Ex-FABP retains iron in a siderophore-dependent manner in both hypertrophic and dedifferentiated chondrocytes, where Ex-FABP expression is induced after treatment with proinflammatory agents, and specifically binds ferric complexes of enterobactin, parabactin, bacillibactin and, unexpectedly, monoglucosylated enterobactin, which does not bind to Siderocalin. Growth arrest assays functionally confirm the bacteriostatic effect of Ex-FABP in vitro under iron-limiting conditions. The 1.8Å crystal structure of Ex-FABP explains the expanded specificity, but also surprisingly reveals an extended, multi-chambered cavity extending through the protein and encompassing two separate ligand specificities, one for bacterial siderophores (as in Siderocalin) at one end and one specifically binding co-purified lysophosphatidic acid, a potent cell signaling molecule, at the other end, suggesting Ex-FABP employs dual functionalities to explain its diverse endogenous activities. PMID:22153502

Determining ERβ Binding Affinity to Singly Mutant ERE Using Dual Polarization Interferometry

NASA Astrophysics Data System (ADS)

Song, Hong Yan; Su, Xiaodi

In a classic mode of estrogen action, estrogen receptors (ERs) bind to estrogen responsive element (ERE) to activate gene transcription. A perfect ERE contains a 13-base pair sequence of a palindromic repeat separated by a three-base spacer, 5‧-GGTCAnnnTGACC-3‧. In addition to the consensus or wild-type ERE (wtERE), naturally occurring EREs often have one or two base pairs’ alternation. Based on the newly constructed Thermodynamic Modeling of ChIP-seq (TherMos) model, binding energy between ERβ and a series of 34-bp mutant EREs (mutERE) was simulated to predict the binding affinity between ERs and EREs with single base pair deviation at different sites of the 13-bp inverted sequence. Experimentally, dual polarization interferometry (DPI) method was developed to measure ERβ-mutEREs binding affinity. On a biotin-NeutrAvidin (NA)-biotin treated DPI chip, wtERE is immobilized. In a direct binding assay, ERβ-wtERE binding affinity is determined. In a competition assay, ERβ was preincubated with mutant EREs before being added for competitive binding to the immobilized wtERE. This competition strategy provided a successful platform to evaluate the binding affinity variation among large number of ERE with different base mutations. The experimental result correlates well with the mathematically predicted binding energy with a Spearman correlation coefficient of 0.97.

Exploring blocking assays using Octet, ProteOn, and Biacore biosensors.

PubMed

Abdiche, Yasmina N; Malashock, Dan S; Pinkerton, Alanna; Pons, Jaume

2009-03-15

We demonstrate the use of label-free real-time optical biosensors in competitive binding assays by epitope binning a panel of antibodies. We describe three assay orientations that we term in tandem, premix, and classical sandwich blocking, and we perform each of them on three platforms: ForteBio's Octet QK, Bio-Rad's ProteOn XPR36, and GE Healthcare's Biacore 3000. By testing whether antibodies block one another's binding to their antigen in a pairwise fashion, we establish a blocking profile for each antibody relative to the others in the panel. The blocking information is then used to create "bins" of antibodies with similar epitopes. The advantages and disadvantages of each biosensor, factors to consider when deciding on the most appropriate blocking assay orientation for a particular interaction system, and tips for dealing with ambiguous data are discussed. The data from our different assay orientations and biosensors agree very well, establishing these machines as valuable tools for characterizing antibody epitopes and multiprotein complexes of biological significance.

PSNCBAM-1, a novel allosteric antagonist at cannabinoid CB1 receptors with hypophagic effects in rats.

PubMed

Horswill, J G; Bali, U; Shaaban, S; Keily, J F; Jeevaratnam, P; Babbs, A J; Reynet, C; Wong Kai In, P

2007-11-01

Rimonabant (Acomplia, SR141716A), a cannabinoid CB1 receptor inverse agonist, has recently been approved for the treatment of obesity. There are, however, concerns regarding its side effect profile. Developing a CB1 antagonist with a different pharmacological mechanism may lead to a safer alternative. To this end we have screened a proprietary small molecule library and have discovered a novel class of allosteric antagonist at CB1 receptors. Herein, we have characterized an optimized prototypical molecule, PSNCBAM-1, and its hypophagic effects in vivo. A CB1 yeast reporter assay was used as a primary screen. PSNCBAM-1 was additionally characterized in [35S]-GTPgammaS, cAMP and radioligand binding assays. An acute rat feeding model was used to evaluate its effects on food intake and body weight in vivo. In CB1 receptor yeast reporter assays, PSNCBAM-1 blocked the effects induced by agonists such as CP55,940, WIN55212-2, anandamide (AEA) or 2-arachidonoyl glycerol (2-AG). The antagonist characteristics of PSNCBAM-1 were confirmed in [35S]-GTPgammaS binding and cAMP assays and was shown to be non-competitive by Schild analyses. PSNCBAM-1 did not affect CB2 receptors. In radioligand binding assays, PSNCBAM-1 increased the binding of [3H]CP55,940 despite its antagonist effects. In an acute rat feeding model, PSNCBAM-1 decreased food intake and body weight. PSNCBAM-1 exerted its effects through selective allosteric modulation of the CB1 receptor. The acute effects on food intake and body weight induced in rats provide a first report of in vivo activity for an allosteric CB1 receptor antagonist.

PSNCBAM-1, a novel allosteric antagonist at cannabinoid CB1 receptors with hypophagic effects in rats

PubMed Central

Horswill, J G; Bali, U; Shaaban, S; Keily, J F; Jeevaratnam, P; Babbs, A J; Reynet, C; Wong Kai In, P

2007-01-01

Background and purpose: Rimonabant (AcompliaTM, SR141716A), a cannabinoid CB1 receptor inverse agonist, has recently been approved for the treatment of obesity. There are, however, concerns regarding its side effect profile. Developing a CB1 antagonist with a different pharmacological mechanism may lead to a safer alternative. To this end we have screened a proprietary small molecule library and have discovered a novel class of allosteric antagonist at CB1 receptors. Herein, we have characterized an optimized prototypical molecule, PSNCBAM-1, and its hypophagic effects in vivo. Experimental approach: A CB1 yeast reporter assay was used as a primary screen. PSNCBAM-1 was additionally characterized in [35S]-GTPγS, cAMP and radioligand binding assays. An acute rat feeding model was used to evaluate its effects on food intake and body weight in vivo. Key results: In CB1 receptor yeast reporter assays, PSNCBAM-1 blocked the effects induced by agonists such as CP55,940, WIN55212-2, anandamide (AEA) or 2-arachidonoyl glycerol (2-AG). The antagonist characteristics of PSNCBAM-1 were confirmed in [35S]-GTPγS binding and cAMP assays and was shown to be non-competitive by Schild analyses. PSNCBAM-1 did not affect CB2 receptors. In radioligand binding assays, PSNCBAM-1 increased the binding of [3H]CP55,940 despite its antagonist effects. In an acute rat feeding model, PSNCBAM-1 decreased food intake and body weight. Conclusions and implications: PSNCBAM-1 exerted its effects through selective allosteric modulation of the CB1 receptor. The acute effects on food intake and body weight induced in rats provide a first report of in vivo activity for an allosteric CB1 receptor antagonist. PMID:17592509

Functional diagnostics for thyrotropin hormone receptor autoantibodies: bioassays prevail over binding assays.

PubMed

Lytton, Simon David; Schluter, Anke; Banga, Paul J

2018-06-01

Autoantibodies to the thyrotropin hormone receptor (TSH-R) are directly responsible for the hyperthyroidism in Graves' disease and mediate orbital manifestations in Graves' orbitopathy (otherwise known as thyroid eye disease). These autoantibodies are heterogeneous in their function and collectively referred to as TRAbs. Measurement of TRAbs is clinically important for diagnosis of a variety of conditions and different commercial assays with high sensitivity and specificity are available for diagnostic purposes. This review provides overwhelming evidence that the TRAbs detected in binding assays by mainly the automated electrochemical luminescence immunoassays (ECLIA) do not distinguish TRAbs that stimulate the TSH-R (called TSIs or TSAbs) and TRAbs that just inhibit the binding of TSH without stimulating the TSH-R (called TBAbs). However, TSAbs and TBAbs have divergent pathogenic roles, and depending which fraction predominates cause different clinical symptoms and engender different therapeutic regimen. Therefore, diagnostic distinction of TSAbs and TBAbs is of paramount clinical importance. To date, only bioassays such as the Mc4 TSH-R bioassay (Thyretain TM , Quidel) and the Bridge assay (Immulite 2000, Siemens) can measure TSAbs, with only the former being able to distinguish between TSAbs and TBAbs. On this note, it is strongly recommended to only use the term TSI or TSAb when reporting the results of bioassays, whereas the results of automated TRAb binding assays should be reported as TRAbs (of undetermined functional significance). This review aims to present a technical and analytical account of leading commercial diagnostic methods of anti-TSH-R antibodies, a metaanalysis of their clinical performance and a perspective for the use of cell based TSH-R bioassays in the clinical diagnostics of Graves' disease.

Generation of cell lines for drug discovery through random activation of gene expression: application to the human histamine H3 receptor.

PubMed

Song, J; Doucette, C; Hanniford, D; Hunady, K; Wang, N; Sherf, B; Harrington, J J; Brunden, K R; Stricker-Krongrad, A

2005-06-01

Target-based high-throughput screening (HTS) plays an integral role in drug discovery. The implementation of HTS assays generally requires high expression levels of the target protein, and this is typically accomplished using recombinant cDNA methodologies. However, the isolated gene sequences to many drug targets have intellectual property claims that restrict the ability to implement drug discovery programs. The present study describes the pharmacological characterization of the human histamine H3 receptor that was expressed using random activation of gene expression (RAGE), a technology that over-expresses proteins by up-regulating endogenous genes rather than introducing cDNA expression vectors into the cell. Saturation binding analysis using [125I]iodoproxyfan and RAGE-H3 membranes revealed a single class of binding sites with a K(D) value of 0.77 nM and a B(max) equal to 756 fmol/mg of protein. Competition binding studies showed that the rank order of potency for H3 agonists was N(alpha)-methylhistamine approximately (R)-alpha- methylhistamine > histamine and that the rank order of potency for H3 antagonists was clobenpropit > iodophenpropit > thioperamide. The same rank order of potency for H3 agonists and antagonists was observed in the functional assays as in the binding assays. The Fluorometic Imaging Plate Reader assays in RAGE-H3 cells gave high Z' values for agonist and antagonist screening, respectively. These results reveal that the human H3 receptor expressed with the RAGE technology is pharmacologically comparable to that expressed through recombinant methods. Moreover, the level of expression of the H3 receptor in the RAGE-H3 cells is suitable for HTS and secondary assays.

Flavonoid Regulation of HCN2 Channels*

PubMed Central

Carlson, Anne E.; Rosenbaum, Joel C.; Brelidze, Tinatin I.; Klevit, Rachel E.; Zagotta, William N.

2013-01-01

The hyperpolarization-activated cyclic nucleotide-modulated (HCN) channels are pacemaker channels whose currents contribute to rhythmic activity in the heart and brain. HCN channels open in response to hyperpolarizing voltages, and the binding of cAMP to their cyclic nucleotide-binding domain (CNBD) facilitates channel opening. Here, we report that, like cAMP, the flavonoid fisetin potentiates HCN2 channel gating. Fisetin sped HCN2 activation and shifted the conductance-voltage relationship to more depolarizing potentials with a half-maximal effective concentration (EC50) of 1.8 μm. When applied together, fisetin and cAMP regulated HCN2 gating in a nonadditive fashion. Fisetin did not potentiate HCN2 channels lacking their CNBD, and two independent fluorescence-based binding assays reported that fisetin bound to the purified CNBD. These data suggest that the CNBD mediates the fisetin potentiation of HCN2 channels. Moreover, binding assays suggest that fisetin and cAMP partially compete for binding to the CNBD. NMR experiments demonstrated that fisetin binds within the cAMP-binding pocket, interacting with some of the same residues as cAMP. Together, these data indicate that fisetin is a partial agonist for HCN2 channels. PMID:24085296

The pig CYP2E1 promoter is activated by COUP-TF1 and HNF-1 and is inhibited by androstenone.

PubMed

Tambyrajah, Winston S; Doran, Elena; Wood, Jeffrey D; McGivan, John D

2004-11-15

Functional analysis of the pig cytochrome P4502E1 (CYP2E1) promoter identified two major activating elements. One corresponded to the hepatic nuclear factor 1 (HNF-1) consensus binding sequence at nucleotides -128/-98 and the other was located in the region -292/-266. The binding of proteins in pig liver nuclear extracts to a synthetic double-stranded oligonucleotide corresponding to this more distal activating sequence was studied by electrophoretic mobility shift assay. The minimum protein binding sequence was identified as TGTTCTGACCTCTGGG. Gel super-shift assays identified the protein binding to this site as chick ovalbumin upstream promoter transcription factor 1 (COUP-TF1). Androstenone inhibited promoter activity in transfection experiments only with constructs which included the COUP-TF1 binding site. Androstenone inhibited COUP-TF1 binding to synthetic oligonucleotides but did not affect HNF-1 binding. The results offer an explanation for the inhibition of CYP2E1 protein expression by androstenone in isolated pig hepatocytes and may be relevant to the low expression of hepatic CYP2E1 in those pigs which accumulate high levels of androstenone in vivo.

Computational Assay of H7N9 Influenza Neuraminidase Reveals R292K Mutation Reduces Drug Binding Affinity

NASA Astrophysics Data System (ADS)

Woods, Christopher J.; Malaisree, Maturos; Long, Ben; McIntosh-Smith, Simon; Mulholland, Adrian J.

2013-12-01

The emergence of a novel H7N9 avian influenza that infects humans is a serious cause for concern. Of the genome sequences of H7N9 neuraminidase available, one contains a substitution of arginine to lysine at position 292, suggesting a potential for reduced drug binding efficacy. We have performed molecular dynamics simulations of oseltamivir, zanamivir and peramivir bound to H7N9, H7N9-R292K, and a structurally related H11N9 neuraminidase. They show that H7N9 neuraminidase is structurally homologous to H11N9, binding the drugs in identical modes. The simulations reveal that the R292K mutation disrupts drug binding in H7N9 in a comparable manner to that observed experimentally for H11N9-R292K. Absolute binding free energy calculations with the WaterSwap method confirm a reduction in binding affinity. This indicates that the efficacy of antiviral drugs against H7N9-R292K will be reduced. Simulations can assist in predicting disruption of binding caused by mutations in neuraminidase, thereby providing a computational `assay.'

Spectroscopic and molecular modeling approaches to investigate the interaction of bisphenol A, bisphenol F and their diglycidyl ethers with PPARα.

PubMed

Zhang, Jie; Zhang, Tiehua; Guan, Tianzhu; Ruan, Ping; Ren, Dayong; Dai, Weichang; Yu, Hansong; Li, Tiezhu

2017-08-01

A fluorescence polarization (FP) assay for the simultaneous determination of bisphenol A (BPA), bisphenol F (BPF), bisphenol A diglycidyl ether (BADGE) and bisphenol F diglycidyl ether (BFDGE) was developed. The method was based on the competition between bisphenols (BPs) and fluorescein-labeled dexamethasone derivative (Dex-fl) for mouse peroxisome proliferator-activated receptor α ligand binding domain (mPPARα-LBD). A recombinant soluble protein derivative mPPARα-LBD* was prepared, then in vitro binding of 4 BPs to mPPARα-LBD* was investigated. Fluorescence polarization assay showed that these compounds exhibited different binding potencies with mPPARα-LBD*. Additionally, molecular dynamics simulations were performed to further understand the mechanism of BPs binding affinity for mPPARα-LBD*. Docking results elucidated that the driving forces for the binding of BPs to mPPARα-LBD* were predominantly dependent on hydrophobic and hydrogen-bonding interactions. Comparison of the calculated binding energies vs. experimental binding affinities yielded a good correlation (R 2  = 0.7258). The proposed method has potential for multi-residue detection of BPA, BPF, BADGE, and BFDGE. Copyright © 2017 Elsevier Ltd. All rights reserved.

Characterization of the receptor-binding domain of Ebola glycoprotein in viral entry.

PubMed

Wang, Jizhen; Manicassamy, Balaji; Caffrey, Michael; Rong, Lijun

2011-06-01

Ebola virus infection causes severe hemorrhagic fever in human and non-human primates with high mortality. Viral entry/infection is initiated by binding of glycoprotein GP protein on Ebola virion to host cells, followed by fusion of virus-cell membrane also mediated by GP. Using an human immunodeficiency virus (HIV)-based pseudotyping system, the roles of 41 Ebola GP1 residues in the receptor-binding domain in viral entry were studied by alanine scanning substitutions. We identified that four residues appear to be involved in protein folding/structure and four residues are important for viral entry. An improved entry interference assay was developed and used to study the role of these residues that are important for viral entry. It was found that R64 and K95 are involved in receptor binding. In contrast, some residues such as I170 are important for viral entry, but do not play a major role in receptor binding as indicated by entry interference assay and/or protein binding data, suggesting that these residues are involved in post-binding steps of viral entry. Furthermore, our results also suggested that Ebola and Marburg viruses share a common cellular molecule for entry.

Protein–ligand interactions investigated by thermal shift assays (TSA) and dual polarization interferometry (DPI)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Grøftehauge, Morten K., E-mail: m.k.groftehauge@durham.ac.uk; Hajizadeh, Nelly R.; Swann, Marcus J.

2015-01-01

The biophysical characterization of protein–ligand interactions in solution using techniques such as thermal shift assay, or on surfaces using, for example, dual polarization interferometry, plays an increasingly important role in complementing crystal structure determinations. Over the last decades, a wide range of biophysical techniques investigating protein–ligand interactions have become indispensable tools to complement high-resolution crystal structure determinations. Current approaches in solution range from high-throughput-capable methods such as thermal shift assays (TSA) to highly accurate techniques including microscale thermophoresis (MST) and isothermal titration calorimetry (ITC) that can provide a full thermodynamic description of binding events. Surface-based methods such as surface plasmonmore » resonance (SPR) and dual polarization interferometry (DPI) allow real-time measurements and can provide kinetic parameters as well as binding constants. DPI provides additional spatial information about the binding event. Here, an account is presented of new developments and recent applications of TSA and DPI connected to crystallography.« less

Functional assay for T4 lysozyme-engineered G protein-coupled receptors with an ion channel reporter.

PubMed

Niescierowicz, Katarzyna; Caro, Lydia; Cherezov, Vadim; Vivaudou, Michel; Moreau, Christophe J

2014-01-07

Structural studies of G protein-coupled receptors (GPCRs) extensively use the insertion of globular soluble protein domains to facilitate their crystallization. However, when inserted in the third intracellular loop (i3 loop), the soluble protein domain disrupts their coupling to G proteins and impedes the GPCRs functional characterization by standard G protein-based assays. Therefore, activity tests of crystallization-optimized GPCRs are essentially limited to their ligand binding properties using radioligand binding assays. Functional characterization of additional thermostabilizing mutations requires the insertion of similar mutations in the wild-type receptor to allow G protein-activation tests. We demonstrate that ion channel-coupled receptor technology is a complementary approach for a comprehensive functional characterization of crystallization-optimized GPCRs and potentially of any engineered GPCR. Ligand-induced conformational changes of the GPCRs are translated into electrical signal and detected by simple current recordings, even though binding of G proteins is sterically blocked by the added soluble protein domain. Copyright © 2014 Elsevier Ltd. All rights reserved.

Acyl guanidine inhibitors of β-secretase (BACE-1): optimization of a micromolar hit to a nanomolar lead via iterative solid- and solution-phase library synthesis.

PubMed

Gerritz, Samuel W; Zhai, Weixu; Shi, Shuhao; Zhu, Shirong; Toyn, Jeremy H; Meredith, Jere E; Iben, Lawrence G; Burton, Catherine R; Albright, Charles F; Good, Andrew C; Tebben, Andrew J; Muckelbauer, Jodi K; Camac, Daniel M; Metzler, William; Cook, Lynda S; Padmanabha, Ramesh; Lentz, Kimberley A; Sofia, Michael J; Poss, Michael A; Macor, John E; Thompson, Lorin A

2012-11-08

This report describes the discovery and optimization of a BACE-1 inhibitor series containing an unusual acyl guanidine chemotype that was originally synthesized as part of a 6041-membered solid-phase library. The synthesis of multiple follow-up solid- and solution-phase libraries facilitated the optimization of the original micromolar hit into a single-digit nanomolar BACE-1 inhibitor in both radioligand binding and cell-based functional assay formats. The X-ray structure of representative inhibitors bound to BACE-1 revealed a number of key ligand:protein interactions, including a hydrogen bond between the side chain amide of flap residue Gln73 and the acyl guanidine carbonyl group, and a cation-π interaction between Arg235 and the isothiazole 4-methoxyphenyl substituent. Following subcutaneous administration in rats, an acyl guanidine inhibitor with single-digit nanomolar activity in cells afforded good plasma exposures and a dose-dependent reduction in plasma Aβ levels, but poor brain exposure was observed (likely due to Pgp-mediated efflux), and significant reductions in brain Aβ levels were not obtained.

Human sex hormone-binding globulin binding affinities of 125 structurally diverse chemicals and comparison with their binding to androgen receptor, estrogen receptor, and α-fetoprotein.

PubMed

Hong, Huixiao; Branham, William S; Ng, Hui Wen; Moland, Carrie L; Dial, Stacey L; Fang, Hong; Perkins, Roger; Sheehan, Daniel; Tong, Weida

2015-02-01

One endocrine disruption mechanism is through binding to nuclear receptors such as the androgen receptor (AR) and estrogen receptor (ER) in target cells. The concentration of a chemical in serum is important for its entry into the target cells to bind the receptors, which is regulated by the serum proteins. Human sex hormone-binding globulin (SHBG) is the major transport protein in serum that can bind androgens and estrogens and thus change a chemical's availability to enter the target cells. Sequestration of an androgen or estrogen in the serum can alter the chemical elicited AR- and ER-mediated responses. To better understand the chemical-induced endocrine activity, we developed a competitive binding assay using human pregnancy plasma and measured the binding to the human SHBG for 125 structurally diverse chemicals, most of which were known to bind AR and ER. Eighty seven chemicals were able to bind the human SHBG in the assay, whereas 38 chemicals were nonbinders. Binding data for human SHBG are compared with that for rat α-fetoprotein, ER and AR. Knowing the binding profiles between serum and nuclear receptors will improve assessment of a chemical's potential for endocrine disruption. The SHBG binding data reported here represent the largest data set of structurally diverse chemicals tested for human SHBG binding. Utilization of the SHBG binding data with AR and ER binding data could enable better evaluation of endocrine disrupting potential of chemicals through AR- and ER-mediated responses since sequestration in serum could be considered. Published by Oxford University Press on behalf of the Society of Toxicology 2014. This work is written by US Government employees and is in the public domain in the US.

Isolation of serotype-specific antibodies against dengue virus non-structural protein 1 using phage display and application in a multiplexed serotyping assay.

PubMed

Lebani, Kebaneilwe; Jones, Martina L; Watterson, Daniel; Ranzoni, Andrea; Traves, Renee J; Young, Paul R; Mahler, Stephen M

2017-01-01

The multidimensional nature of dengue virus (DENV) infections, which can be caused by four distinct serotypes of the virus, complicates the sensitivity of assays designed for the diagnosis of infection. Different viral markers can be optimally detected at different stages of infection. Of particular clinical importance is the early identification of infection, which is pivotal for disease management and the development of blood screening assays. Non-structural protein 1 (NS1) is an early surrogate marker of infection and its detection in serum coincides with detectable viraemia. The aim of this work was to isolate and characterise serotype-specific monoclonal antibodies that bind to NS1 for each of the four DENV serotypes. This was achieved using phage display and a subtractive biopanning strategy to direct the antibody selection towards serotype-specific epitopes. This antibody isolation strategy has advantages over immunisation techniques where it is difficult to avoid antibody responses to cross-reactive, immunodominant epitopes. Serotype specificity to recombinant antigen for each of the antibodies was confirmed by Enzyme Linked Immunosorbent Assay (ELISA) and Surface Plasmon Resonance. Confirmation of binding to native DENV NS1 was achieved using ELISA and immunofluorescence assay on DENV infected Vero cells. No cross-reactivity with Zika or Kunjin viruses was observed. A previously isolated pan-reactive antibody that binds to an immunodominant epitope was able to pair with each of the serotype-specific antibodies in a sandwich ELISA, indicating that the serotype specific antibodies bind to epitopes which are all spatially distinct from the immunodominant epitope. These antibodies were suitable for use in a multiplexed assay for simultaneous detection and serotyping of DENV NS1 in human serum. This work demonstrates that phage display coupled with novel biopanning strategies is a valuable in vitro methodology for isolation of binders that can discern amongst antigens with high homology for diagnostic applicability.

Molecular interactions between general anesthetics and the 5HT2B receptor.

PubMed

Matsunaga, Felipe; Gao, Lu; Huang, Xi-Ping; Saven, Jeffery G; Roth, Bryan L; Liu, Renyu

2015-01-01

Serotonin modulates many processes through a family of seven serotonin receptors. However, no studies have screened for interactions between general anesthetics currently in clinical use and serotonergic G-protein-coupled receptors (GPCRs). Given that both intravenous and inhalational anesthetics have been shown to target other classes of GPCRs, we hypothesized that general anesthetics might interact directly with some serotonin receptors and thus modify their function. Radioligand binding assays were performed to screen serotonin receptors for interactions with propofol and isoflurane as well as for affinity determinations. Docking calculations using the crystal structure of 5-HT2B were performed to computationally confirm the binding assay results and locate anesthetic binding sites. The 5-HT2B class of receptors interacted significantly with both propofol and isoflurane in the primary screen. The affinities for isoflurane and propofol were determined to be 7.78 and .95 μM, respectively, which were at or below the clinical concentrations for both anesthetics. The estimated free energy derived from docking calculations for propofol (-6.70 kcal/mol) and isoflurane (-5.10 kcal/mol) correlated with affinities from the binding assay. The anesthetics were predicted to dock at a pharmacologically relevant binding site of 5HT2B. The molecular interactions between propofol and isoflurane with the 5-HT2B class of receptors were discovered and characterized. This finding implicates the serotonergic GPCRs as potential anesthetic targets.

A rapid method for selecting suitable animal species for studying pathogen interactions with plasma protein ligands in vivo.

PubMed

Naudin, Clément; Schumski, Ariane; Salo-Ahen, Outi M H; Herwald, Heiko; Smeds, Emanuel

2017-05-01

Species tropism constitutes a serious problem for developing relevant animal models of infection. Human pathogens can express virulence factors that show specific selectivity to human proteins, while their affinity for orthologs from other species can vary significantly. Suitable animal species must be used to analyse whether virulence factors are potential targets for drug development. We developed an assay that rapidly predicts applicable animal species for studying virulence factors binding plasma proteins. We used two well-characterized Staphylococcus aureus proteins, SSL7 and Efb, to develop an ELISA-based inhibition assay using plasma from different animal species. The interaction between SSL7 and human C5 and the binding of Efb to human fibrinogen and human C3 was studied. Affinity experiments and Western blot analyses were used to validate the assay. Human, monkey and cat plasma interfered with binding of SSL7 to human C5. Binding of Efb to human fibrinogen was blocked in human, monkey, gerbil and pig plasma, while human, monkey, gerbil, rabbit, cat and guinea pig plasma inhibited the binding of Efb to human C3. These results emphasize the importance of choosing correct animal models, and thus, our approach is a rapid and cost-effective method that can be used to prevent unnecessary animal experiments. © 2017 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

dsRNA binding characterization of full length recombinant wild type and mutants Zaire ebolavirus VP35.

PubMed

Zinzula, Luca; Esposito, Francesca; Pala, Daniela; Tramontano, Enzo

2012-03-01

The Ebola viruses (EBOVs) VP35 protein is a multifunctional major virulence factor involved in EBOVs replication and evasion of the host immune system. EBOV VP35 is an essential component of the viral RNA polymerase, it is a key participant of the nucleocapsid assembly and it inhibits the innate immune response by antagonizing RIG-I like receptors through its dsRNA binding function and, hence, by suppressing the host type I interferon (IFN) production. Insights into the VP35 dsRNA recognition have been recently revealed by structural and functional analysis performed on its C-terminus protein. We report the biochemical characterization of the Zaire ebolavirus (ZEBOV) full-length recombinant VP35 (rVP35)-dsRNA binding function. We established a novel in vitro magnetic dsRNA binding pull down assay, determined the rVP35 optimal dsRNA binding parameters, measured the rVP35 equilibrium dissociation constant for heterologous in vitro transcribed dsRNA of different length and short synthetic dsRNA of 8bp, and validated the assay for compound screening by assessing the inhibitory ability of auryntricarboxylic acid (IC(50) value of 50μg/mL). Furthermore, we compared the dsRNA binding properties of full length wt rVP35 with those of R305A, K309A and R312A rVP35 mutants, which were previously reported to be defective in dsRNA binding-mediated IFN inhibition, showing that the latter have measurably increased K(d) values for dsRNA binding and modified migration patterns in mobility shift assays with respect to wt rVP35. Overall, these results provide the first characterization of the full-length wt and mutants VP35-dsRNA binding functions. Copyright © 2012 Elsevier B.V. All rights reserved.

A simple method for determining polymeric IgA-containing immune complexes.

PubMed

Sancho, J; Egido, J; González, E

1983-06-10

A simplified assay to measure polymeric IgA-immune complexes in biological fluids is described. The assay is based upon the specific binding of a secretory component for polymeric IgA. In the first step, multimeric IgA (monomeric and polymeric) immune complexes are determined by the standard Raji cell assay. Secondly, labeled secretory component added to the assay is bound to polymeric IgA-immune complexes previously fixed to Raji cells, but not to monomeric IgA immune complexes. To avoid false positives due to possible complement-fixing IgM immune complexes, prior IgM immunoadsorption is performed. Using anti-IgM antiserum coupled to CNBr-activated Sepharose 4B this step is not time-consuming. Polymeric IgA has a low affinity constant and binds weakly to Raji cells, as Scatchard analysis of the data shows. Thus, polymeric IgA immune complexes do not bind to Raji cells directly through Fc receptors, but through complement breakdown products, as with IgG-immune complexes. Using this method, we have been successful in detecting specific polymeric-IgA immune complexes in patients with IgA nephropathy (Berger's disease) and alcoholic liver disease, as well as in normal subjects after meals of high protein content. This new, simple, rapid and reproducible assay might help to study the physiopathological role of polymeric IgA immune complexes in humans and animals.

Identifying Metabolically Active Chemicals Using a Consensus ...

EPA Pesticide Factsheets

Endocrine disrupting chemicals (EDCs) are abundant throughout the environment and can alter neurodevelopment, behavior, and reproductive success of humans and other species by perturbing signaling pathways related to the estrogen receptor (ER). A recent study compared results across 18 ER-related assays in the ToxCast™ in vitro screening program to predict the likelihood of a chemical exhibiting in vivo estrogenic activity, with the purpose of eliminating chemicals that may produce a false signal by interfering with the technological attributes of an individual assay. However, flaws in in vitro assay design can also prevent induction of signal activity by EDCs. Another reason for not observing activity for some EDCs in in vitro assays is that metabolic activation is required to perturb ER-related pathways. In the current study, 1,024 chemicals were identified as lacking ER activity after establishing a consensus across each of the 18 ER-related in vitro assays, and nearly 2,000 primary and 3,700 secondary unique metabolites were predicted for these chemicals. The ER binding activity for each metabolite was then predicted using an existing ER activity quantitative structure activity relationship (QSAR) consensus model. Binding activity was predicted for 2-3% of the metabolites within each generation. Of the inactive parent compounds generating at least one metabolite predicted to have ER-binding activity, nearly 30% were found to have metabolites from both gene

The hURAT1 rs559946 polymorphism and the incidence of gout in Han Chinese men.

PubMed

Li, C; Yu, Q; Han, L; Wang, C; Chu, N; Liu, S

2014-01-01

Our previous study identified rs559946, a human urate transporter 1 (hURAT1) single nucleotide polymorphism (SNP), as being significantly associated with risk of primary hyperuricaemia (HUA) in a Han Chinese population. In the current study we aimed to identify the genetic effects of rs559946 on gout susceptibility in Han Chinese men. A total of 335 patients with gout and 376 healthy controls were recruited for a case-control association study. To examine the functional effect of rs559946, we performed luciferase reporter assays and an electrophoretic mobility shift assay (EMSA). rs559946 was found to be significantly associated with gout susceptibility (p = 0.004), with T-allele carriers showing a decreased risk of gout [odds ratio (OR) 0.70, 95% confidence interval (CI) 0.55-0.89]. Multiple linear regression analysis identified a significant association between rs559946 genotypes and tophi. Luciferase reporter assays show increased transcriptional activity of the hURAT1 promoter with the C allele of rs559946. EMSA detected binding of nuclear proteins to both the T and C alleles, although increased binding was observed with the T allele. Cold competition assays suggest that rs559946 may bind within a glucocorticoid receptor (GR) binding motif. Our study suggests that the rs559946 polymorphism is associated with increased HUA risk and may also contribute to gout development in Han Chinese men. The T to C substitution within rs559946 increased the transcriptional activity, and potentially increases gout susceptibility.

Dopaminergic receptor-ligand binding assays based on molecularly imprinted polymers on quartz crystal microbalance sensors.

PubMed

Naklua, Wanpen; Suedee, Roongnapa; Lieberzeit, Peter A

2016-07-15

Molecularly imprinted polymers (MIPs) have been successfully applied as selective materials for assessing the binding activity of agonist and antagonist of dopamine D1 receptor (D1R) by using quartz crystal microbalance (QCM). In this study, D1R derived from rat hypothalamus was used as a template and thus self-organized on stamps. Those were pressed into an oligomer film consisting of acrylic acid: N-vinylpyrrolidone: N,N'-(1,2-dihydroxyethylene) bis-acrylamide in a ratio of 2:3:12 spin coated onto a dual electrode QCM. Such we obtained one D1R-MIP-QCM electrode, whereas the other electrode carried the non-imprinted control polymer (NIP) that had remained untreated. Successful imprinting of D1R was confirmed by AFM. The polymer can re-incorporate D1R leading to frequency responses of 100-1200Hz in a concentration range of 5.9-47.2µM. In a further step such frequency changes proved inherently useful for examining the binding properties of test ligands to D1R. The resulting mass-sensitive measurements revealed Kd of dopamine∙HCl, haloperidol, and (+)-SCH23390 at 0.874, 25.6, and 0.004nM, respectively. These results correlate well with the values determined in radio ligand binding assays. Our experiments revealed that D1R-MIP sensors are useful for estimating the strength of ligand binding to the active single site. Therefore, we have developed a biomimetic surface imprinting strategy for QCM studies of D1R-ligand binding and presented a new method to ligand binding assay for D1R. Copyright © 2016 Elsevier B.V. All rights reserved.

Isolation and characterization of target sequences of the chicken CdxA homeobox gene.

PubMed Central

Margalit, Y; Yarus, S; Shapira, E; Gruenbaum, Y; Fainsod, A

1993-01-01

The DNA binding specificity of the chicken homeodomain protein CDXA was studied. Using a CDXA-glutathione-S-transferase fusion protein, DNA fragments containing the binding site for this protein were isolated. The sources of DNA were oligonucleotides with random sequence and chicken genomic DNA. The DNA fragments isolated were sequenced and tested in DNA binding assays. Sequencing revealed that most DNA fragments are AT rich which is a common feature of homeodomain binding sites. By electrophoretic mobility shift assays it was shown that the different target sequences isolated bind to the CDXA protein with different affinities. The specific sequences bound by the CDXA protein in the genomic fragments isolated, were determined by DNase I footprinting. From the footprinted sequences, the CDXA consensus binding site was determined. The CDXA protein binds the consensus sequence A, A/T, T, A/T, A, T, A/G. The CAUDAL binding site in the ftz promoter is also included in this consensus sequence. When tested, some of the genomic target sequences were capable of enhancing the transcriptional activity of reporter plasmids when introduced into CDXA expressing cells. This study determined the DNA sequence specificity of the CDXA protein and it also shows that this protein can further activate transcription in cells in culture. Images PMID:7909943

Evaluation of the In Vivo and Ex Vivo Binding of Novel BC1 Cannabinoid Receptor Radiotracers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miller, A.; Gatley, J.; Gifford, A.

The primary active ingredient of marijuana, 9-tetrahydrocannabinol, exerts its psychoactive effects by binding to cannabinoid CB1 receptors. These receptors are found throughout the brain with high concentrations in the hippocampus and cerebellum. The current study was conducted to evaluate the binding of a newly developed putative cannabinoid antagonist, AM630, and a classical cannabinoid 8-tetrahydrocannabinol as potential PET and/or SPECT imaging agents for brain CB1 receptors. For both of these ligands in vivo and ex vivo studies in mice were conducted. AM630 showed good overall brain uptake (as measure by %IA/g) and a moderately rapid clearance from the brain with amore » half-clearance time of approximately 30 minutes. However, AM630 did not show selective binding to CB1 cannabinoid receptors. Ex vivo autoradiography supported the lack of selective binding seen in the in vivo study. Similar to AM630, 8-tetrahydrocanibol also failed to show selective binding to CB1 receptor rich brain areas. The 8-tetrahydrocanibol showed moderate overall brain uptake and relatively slow brain clearance as compared to AM630. Further studies were done with AM2233, a cannabinoid ligand with a similar structure as AM630. These studies were done to develop an ex vivo binding assay to quantify the displacement of [131I]AM2233 binding by other ligands in Swiss-Webster and CB1 receptor knockout mice. By developing this assay we hoped to determine the identity of an unknown binding site for AM2233 present in the hippocampus of CB1 knockout mice. Using an approach based on incubation of brain slices prepared from mice given intravenous [131I]AM2233 in either the presence or absence of AM2233 (unlabelled) it was possible to demonstrate a significant AM2233-displacable binding in the Swiss-Webster mice. Future studies will determine if this assay is appropriate for identifying the unknown binding site for AM2233 in the CB1 knockout mice.« less