Sample records for phenylpyruvicus primer caso

  1. Phonics Primer

    ERIC Educational Resources Information Center

    Elam, Sandra


    This primer lists the 44 sounds in the English language and then gives steps for teaching those 44 sounds and their most common spelling patterns. In addition to learning sounds and spellings, each day the student must read lists of phonetically related words and spell these words from dictation. Phonics instruction must be reinforced by having…

  2. Salinas primer.

    SciTech Connect

    Walsh, Timothy Francis; Reese, Garth M.; Bhardwaj, Manoj Kumar


    Salinas provides a massively parallel implementation of structural dynamics finite element analysis. This capability is required for high fidelity, validated models used in modal, vibration, static and shock analysis of weapons systems. General capabilities for modal, statics and transient dynamics are provided. Salinas is similar to commercial codes like Nastran or Abaqus. It has some nonlinear capability, but excels in linear computation. It is different than the above commercial codes in that it is designed to operate efficiently in a massively parallel environment. Even for an experienced analyst, running a new finite element package can be a challenge. This little primer is intended to make part of this task easier by presenting the basic steps in a simple way. The analyst is referred to the theory manual for details of the mathematics behind the work. The User's Notes should be used for more complex inputs, and will have more details about the process (as well as many more examples). More information can be found on our web pages, 3 or 4. Finite element analysis can be deceptive. Any software can give the wrong answers if used improperly, and occasionally even when used properly. Certainly a solid background in structural mechanics is necessary to build an adequate finite element model and interpret the results. This primer should provide a quick start in answering some of the more common questions that come up in using Salinas.

  3. Polyacid macromolecule primers


    Sugama, Toshifumi.


    Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

  4. Polyacid macromolecule primers


    Sugama, Toshifumi


    Hydrophylic polyacids, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests.

  5. Transmission Investment: A Primer

    SciTech Connect

    McGarvey, Joe


    This primer highlights recent trends in transmission investment, summarizes the division of jurisdictional authority over transmission, and presents four alternative models for transmission ownership. (author)

  6. Quick spacecraft charging primer

    SciTech Connect

    Larsen, Brian Arthur


    This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

  7. China Energy Primer

    SciTech Connect

    Ni, Chun Chun


    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  8. Systems Engineering Measurement Primer

    DTIC Science & Technology


    Systems Engineering Measurement Primer A Basic Introduction to Systems Engineering Measurement Concepts and Use Version 1.0 March 1998 This document...Federal Systems Garry Roedler Lockheed Martin Management & Data Systems Cathy Tilton The National Registry, Inc. E. Richard Widmann Raytheon Systems...IV 1. INTRODUCTION

  9. An SAT® Validity Primer

    ERIC Educational Resources Information Center

    Shaw, Emily J.


    This primer should provide the reader with a deeper understanding of the concept of test validity and will present the recent available validity evidence on the relationship between SAT® scores and important college outcomes. In addition, the content examined on the SAT will be discussed as well as the fundamental attention paid to the fairness of…

  10. Primer on Social Economics.

    ERIC Educational Resources Information Center

    Darcy, Robert L.

    An elaboration of the author's booklet entitled "First Steps Toward Economic Understanding," this primer is designed to help the reader develop a functional understanding of the economic process so that he can make wiser decisions on issues of social policy and on matters affecting his economic well-being. The document is not "economics in one…

  11. Primer on Water Quality


    ... fs-027-01.pdf--665KB A Primer on Water Quality What is in the water? Is it safe for drinking? Can fish and ... affect water quality. What do we mean by "water quality"? Water quality can be thought of as ...

  12. BatchPrimer3: A high throughput web application for PCR and sequencing primer design

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A new web primer design program, BatchPrimer3, is developed based on Primer3. BatchPrimer3 adopted the Primer3 core program as a major primer design engine to choose the best primer pairs. A new score-based primer picking module is incorporated into BatchPrimer3 and used to pick position-restricte...

  13. Primer on molecular genetics

    SciTech Connect

    Not Available


    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  14. Coal Bed Methane Primer

    SciTech Connect

    Dan Arthur; Bruce Langhus; Jon Seekins


    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  15. Crystalline Silica Primer

    USGS Publications Warehouse



    substance and will present a nontechnical overview of the techniques used to measure crystalline silica. Because this primer is meant to be a starting point for anyone interested in learning more about crystalline silica, a list of selected readings and other resources is included. The detailed glossary, which defines many terms that are beyond the scope of this publication, is designed to help the reader move from this presentation to a more technical one, the inevitable next step.

  16. Primer on Beam Optics

    DTIC Science & Technology


    Inc. San Diego, California Table of Contents Page 1 . Introduction 1 1.1 Organization of Primer 1 1.2 Introduction to Neutral Particle Beam...Optical Systems 3 2. Fundamentals of Charged Particle Optics 10 2.1 Introduction 1 ° 2.2 Phase Space and Nonlinear Motion 10 2.3 Linear Maps 22 2.4...102 Figures Figure Pag© 1 . Generic Neutral Particle Beam Device 4 2. An orthogonal three dimensional coordinate system 11 3. Trajectory of a

  17. Laser Doppler velocimetry primer

    NASA Technical Reports Server (NTRS)

    Bachalo, William D.


    Advanced research in experimental fluid dynamics required a familiarity with sophisticated measurement techniques. In some cases, the development and application of new techniques is required for difficult measurements. Optical methods and in particular, the laser Doppler velocimeter (LDV) are now recognized as the most reliable means for performing measurements in complex turbulent flows. And such, the experimental fluid dynamicist should be familiar with the principles of operation of the method and the details associated with its application. Thus, the goals of this primer are to efficiently transmit the basic concepts of the LDV method to potential users and to provide references that describe the specific areas in greater detail.

  18. Limited-life cartridge primers


    Makowiecki, Daniel M.; Rosen, Robert S.


    A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.

  19. Limited-life cartridge primers


    Makowiecki, D.M.; Rosen, R.S.


    A cartridge primer is described which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML`s would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers. 10 figs.

  20. Limited-life cartridge primers


    Makowiecki, Daniel M.; Rosen, Robert S.


    A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.

  1. Multiplexed Primer Prediction for PCR

    SciTech Connect


    MPP predicts sets of multiplex-compatible primers for Polymerase Chain Reaction (PCR), finding a near minimal set of primers such that at least one amplicon will be generated from every target sequence in the input file. The code finds highly conserved oligos that are suitable as primers, according to user-specified desired primer characteristics such as length, melting temperature, and amplicon length. The primers are predicted not to form unwanted dimer or hairpin structures. The target sequences used as input can be diverse, since no multiple sequence alighment is required. The code is scalable, taking up to tens of thousands of sequences as input, and works, for example, to find a "universal primer set" for all viral genomes provided as a single input file. The code generates a periodic check-point file, thus in the event of premature execution termination, the application can be restarted from the last check-point file.

  2. A primer on water

    USGS Publications Warehouse

    Leopold, Luna Bergere; Langbein, Walter Basil


    When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

  3. Metabolomics: A Primer.


    Liu, Xiaojing; Locasale, Jason W


    Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future.

  4. Neuraminidase subtyping of avian influenza viruses with PrimerHunter-designed primers and quadruplicate primer pools.


    Huang, Yanyan; Khan, Mazhar I; Khan, Mazhar; Măndoiu, Ion; Măndoiu, Ion I


    We have previously developed a software package called PrimerHunter to design primers for PCR-based virus subtyping. In this study, 9 pairs of primers were designed with PrimerHunter and successfully used to differentiate the 9 neuraminidase (NA) genes of avian influenza viruses (AIVs) in multiple PCR-based assays. Furthermore, primer pools were designed and successfully used to decrease the number of reactions needed for NA subtyping from 9 to 4. The quadruplicate primer-pool method is cost-saving, and was shown to be suitable for the NA subtyping of both cultured AIVs and uncultured AIV swab samples. The primers selected for this study showed excellent sensitivity and specificity in NA subtyping by RT-PCR, SYBR green-based Real-time PCR and Real-time RT-PCR methods. AIV RNA of 2 to 200 copies (varied by NA subtypes) could be detected by these reactions. No unspecific amplification was displayed when detecting RNAs of other avian infectious viruses such as Infectious bronchitis virus, Infectious bursal disease virus and Newcastle disease virus. In summary, this study introduced several sensitive and specific PCR-based assays for NA subtyping of AIVs and also validated again the effectiveness of the PrimerHunter tool for the design of subtyping primers.

  5. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2013 CFR


    ... 30 Mineral Resources 1 2013-07-01 2013-07-01 false Primer protection. 56.6304 Section 56.6304... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives... the primer except where the blasthole contains sufficient depth of water to protect the primer...

  6. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2014 CFR


    ... 30 Mineral Resources 1 2014-07-01 2014-07-01 false Primer protection. 56.6304 Section 56.6304... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives... the primer except where the blasthole contains sufficient depth of water to protect the primer...

  7. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2012 CFR


    ... 30 Mineral Resources 1 2012-07-01 2012-07-01 false Primer protection. 56.6304 Section 56.6304... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives... the primer except where the blasthole contains sufficient depth of water to protect the primer...

  8. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2011 CFR


    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Primer protection. 56.6304 Section 56.6304... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives... the primer except where the blasthole contains sufficient depth of water to protect the primer...

  9. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2010 CFR


    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives... the primer except where the blasthole contains sufficient depth of water to protect the primer...

  10. Charter School Primer. Peter Lang Primer. Volume 34

    ERIC Educational Resources Information Center

    Tryjankowski, Anne Marie


    The "Charter School Primer" presents an overview of public charter schools in the United States. The book discusses what charter schools are; the history of public charter school choice in the United States; the role of teachers, parents, boards, and unions in the charter school movement; and gives examples of innovations in education made…

  11. Vygotsky on Education Primer. Peter Lang Primer. Volume 30

    ERIC Educational Resources Information Center

    Lake, Robert


    The "Vygotsky on Education Primer" serves as an introduction to the life and work of the Russian psychologist Lev Vygotsky. Even though he died almost eighty years ago, his life's work remains both relevant and significant to the field of education today. This book examines Vygotsky's emphasis on the role of cultural and historical context in…

  12. A Primer on Multilevel Modeling

    ERIC Educational Resources Information Center

    Hayes, Andrew F.


    Multilevel modeling (MLM) is growing in use throughout the social sciences. Although daunting from a mathematical perspective, MLM is relatively easy to employ once some basic concepts are understood. In this article, I present a primer on MLM, describing some of these principles and applying them to the analysis of a multilevel data set on…

  13. A Hearing Aid Primer 1

    ERIC Educational Resources Information Center

    Yetter, Carol J.


    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  14. Primer vector theory and applications

    NASA Technical Reports Server (NTRS)

    Jezewski, D. J.


    A method developed to compute two-body, optimal, N-impulse trajectories was presented. The necessary conditions established define the gradient structure of the primer vector and its derivative for any set of boundary conditions and any number of impulses. Inequality constraints, a conjugate gradient iterator technique, and the use of a penalty function were also discussed.

  15. Postsecondary Data Connections: A Primer

    ERIC Educational Resources Information Center

    Data Quality Campaign, 2011


    There is an increasing focus at the state and federal levels on linking data across the P-20/Workforce spectrum to help inform policies and practices. This primer is intended to provide policymakers with: (1) An overview of the status of states vis-a-vis the linking of postsecondary data to K-12 and workforce data; (2) A subset of questions…

  16. Freshwater Wetlands: A Citizen's Primer.

    ERIC Educational Resources Information Center

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

  17. Straight Talk: A Communication Primer.

    ERIC Educational Resources Information Center

    Maidment, Robert

    Using typical statements made by teachers and school administrators as examples, this self-help primer offers tips for developing conversational patterns that promote interpersonal understanding. The tips are designed to help readers learn about 40 effective conversational habits, including being specific, talking sparingly, admitting mistakes,…

  18. Alternative Teacher Compensation: A Primer

    ERIC Educational Resources Information Center

    Koppich, Julia E.; Rigby, Jessica


    This policy primer is designed to provide base-line information about new forms of teacher pay that are emerging around the country, to support the local conversations and negotiations that will lead to the development of innovative compensation systems. It identifies reasons why teacher compensation is high on local, state, and federal policy…

  19. Status of NC Primer Demonstration & Transition

    DTIC Science & Technology


    Primer Demos: Gloss Paint Scheme 4 Demonstration COMPLETE BUNO Induction Date Non- Chrome Primer Date Delivery Date Carrier Deployments...Includes T-6, T-34, T-44, T-45* NC Primer Demos: Gloss Paint Scheme 6 P-3C Demonstration is on-going… • PPG-Deft 02-GN-084 demonstrated over CCC on OML...Only one P-3C demonstrating NC Primer, A/C # 510  Primed Sept. 15, 2011 NC Primer Demos: Gloss Paint Scheme 7 NC Primer Demos: Gloss Paint

  20. HIV lipodystrophy syndrome: a primer.


    Robinson, F Patrick


    Treatment with highly active antiretroviral therapy (HAART) has been implicated in the development of anthropomorphic and metabolic abnormalities termed HIV lipodystrophy syndrome (or LDS). This primer offers a comprehensive overview of LDS including epidemiology, hypothesized etiologies, and clinical consequences. The evidence-based literature is reviewed for current treatment strategies including discontinuation of specific antiretrovirals, pharmacological management of dyslipidemia and insulin resistance, exercise training, facial augmentation, liposuction, and hormonal therapy. Patient education, counseling, and adherence are discussed.

  1. Using Primers to Motivate Your Students

    ERIC Educational Resources Information Center

    Graff, Dan


    Primers are used to motivate and uplift your class. They come in many different styles and can be used in a variety of ways. Making primers relevant to students helps them to learn and makes them feel appreciated and knowledgeable when they participate. Using primers in the classroom to make students feel valued brings much success.

  2. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2013 CFR


    ... 30 Mineral Resources 1 2013-07-01 2013-07-01 false Primer protection. 57.6304 Section 57.6304... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives or blasting agents that are 4 inches (100 millimeters)...

  3. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2011 CFR


    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Primer protection. 57.6304 Section 57.6304... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives or blasting agents that are 4 inches (100 millimeters)...

  4. 30 CFR 75.1317 - Primer cartridges.

    Code of Federal Regulations, 2012 CFR


    ... 30 Mineral Resources 1 2012-07-01 2012-07-01 false Primer cartridges. 75.1317 Section 75.1317... MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Explosives and Blasting § 75.1317 Primer cartridges. (a) Primer cartridges shall be primed and loaded only by a qualified person or a person working in...

  5. 30 CFR 75.1317 - Primer cartridges.

    Code of Federal Regulations, 2014 CFR


    ... 30 Mineral Resources 1 2014-07-01 2014-07-01 false Primer cartridges. 75.1317 Section 75.1317... MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Explosives and Blasting § 75.1317 Primer cartridges. (a) Primer cartridges shall be primed and loaded only by a qualified person or a person working in...

  6. 30 CFR 75.1317 - Primer cartridges.

    Code of Federal Regulations, 2011 CFR


    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Primer cartridges. 75.1317 Section 75.1317... MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Explosives and Blasting § 75.1317 Primer cartridges. (a) Primer cartridges shall be primed and loaded only by a qualified person or a person working in...

  7. 30 CFR 75.1317 - Primer cartridges.

    Code of Federal Regulations, 2010 CFR


    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer cartridges. 75.1317 Section 75.1317... MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Explosives and Blasting § 75.1317 Primer cartridges. (a) Primer cartridges shall be primed and loaded only by a qualified person or a person working in...

  8. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2010 CFR


    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives or blasting agents that are 4 inches (100 millimeters)...

  9. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2012 CFR


    ... 30 Mineral Resources 1 2012-07-01 2012-07-01 false Primer protection. 57.6304 Section 57.6304... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives or blasting agents that are 4 inches (100 millimeters)...

  10. 30 CFR 75.1317 - Primer cartridges.

    Code of Federal Regulations, 2013 CFR


    ... 30 Mineral Resources 1 2013-07-01 2013-07-01 false Primer cartridges. 75.1317 Section 75.1317... MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Explosives and Blasting § 75.1317 Primer cartridges. (a) Primer cartridges shall be primed and loaded only by a qualified person or a person working in...

  11. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2014 CFR


    ... 30 Mineral Resources 1 2014-07-01 2014-07-01 false Primer protection. 57.6304 Section 57.6304... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives or blasting agents that are 4 inches (100 millimeters)...

  12. Environmental Acceptable Medium Caliber Ammunition Percussion Primers

    DTIC Science & Technology


    percussion primers typically consist of lead styphnate and antimony sulfide. Although highly effective, these heavy material compounds were identified under...Percussion primers, including those used in medium caliber ammunition, typically contain lead styphnate and antimony sulfide along with other constituents...Furthermore, current percussion primer compositions also contain barium nitrate. Although not negatively categorized by the Environmental Protection

  13. Water based adhesive primers on aluminum substrates

    SciTech Connect

    Wightman, J.P.; Mori, S.


    The number of aluminum alloy bonding applications has been increasing recently in the automobile industry. Primer coating of aluminum substrates is one of the main processes used to promote bond performance. Solvent based organic primers have been used for a long time but environmental regulations now require the substitution of volatile organic compounds (VOC) by alternate materials such as water based adhesive primers. However, the bond strengths obtained with many water based primers are generally lower than for solvent based ones. Water based primers which have some reactive functional groups have been proposed recently but such primers require special treatment. This paper describes a study conducted to optimize bond strength using a water based adhesive as a primer in the adhesive bonding of anodized aluminum.

  14. Output testing of small-arms primers

    NASA Technical Reports Server (NTRS)

    Bement, Laurence J.; Doris, Thomas A.; Schimmel, Morry L.


    The performance of two standard primers for initiating small-caliber ammunition are compared to that of a primer for initiating aircraft escape-system components. Three testing methods are employed including: (1) firing the primer to measure total energy delivered; (2) monitoring output in terms of gaseous product-mass flow rate and pressure as a function of time; and (3) firing the primer onto ignition material to study gas pressure produced during ignition and burning as a function of time. The results of the test demonstrate differences in the ignitability factors of the standard primers and time peak pressures of less than 100 microseconds. One unexpected result is that two percussion primers (the FA-41 and the M42C1) developed for different applications have the same ignitability. The ignitability test method is shown to yield the most useful data and can be used to specify percussion primers and optimize their performance.

  15. Sample Return Primer and Handbook

    NASA Technical Reports Server (NTRS)

    Barrow, Kirk; Cheuvront, Allan; Faris, Grant; Hirst, Edward; Mainland, Nora; McGee, Michael; Szalai, Christine; Vellinga, Joseph; Wahl, Thomas; Williams, Kenneth; Lee, Gentry; Duxbury, Thomas


    This three-part Sample Return Primer and Handbook provides a road map for conducting the terminal phase of a sample return mission. The main chapters describe element-by-element analyses and trade studies, as well as required operations plans, procedures, contingencies, interfaces, and corresponding documentation. Based on the experiences of the lead Stardust engineers, the topics include systems engineering (in particular range safety compliance), mission design and navigation, spacecraft hardware and entry, descent, and landing certification, flight and recovery operations, mission assurance and system safety, test and training, and the very important interactions with external support organizations (non-NASA tracking assets, landing site support, and science curation).

  16. PrimerZ: streamlined primer design for promoters, exons and human SNPs.


    Tsai, Ming-Fang; Lin, Yi-Jung; Cheng, Yu-Chang; Lee, Kuo-Hsi; Huang, Cheng-Chih; Chen, Yuan-Tsong; Yao, Adam


    PrimerZ ( is a web application dedicated primarily to primer design for genes and human SNPs. PrimerZ accepts genes by gene name or Ensembl accession code, and SNPs by dbSNP rs or AFFY_Probe IDs. The promoter and exon sequence information of all gene transcripts fetched from the Ensembl database ( are processed before being passed on to Primer3 ( for individual primer design. All results returned from Primer 3 are organized and integrated in a specially designed web page for easy browsing. Besides the web page presentation, csv text file export is also provided for enhanced user convenience. PrimerZ automates highly standard but tedious gene primer design to improve the success rate of PCR experiments. More than 2000 primers have been designed with PrimerZ at our institute since 2004 and the success rate is over 70%. The addition of several new features has made PrimerZ even more useful to the research community in facilitating primer design for promoters, exons and SNPs.

  17. Primer design for large scale sequencing.


    Haas, S; Vingron, M; Poustka, A; Wiemann, S


    We have developed PRIDE, a primer design program that automatically designs primers in single contigs or whole sequencing projects to extend the already known sequence and to double strand single-stranded regions. The program is fully integrated into the Staden package (GAP4) and accessible with a graphical user interface. PRIDE uses a fuzzy logic-based system to calculate primer qualities. The computational performance of PRIDE is enhanced by using suffix trees to store the huge amount of data being produced. A test set of 110 sequencing primers and 11 PCR primer pairs has been designed on genomic templates, cDNAs and sequences containing repetitive elements to analyze PRIDE's success rate. The high performance of PRIDE, combined with its minimal requirement of user interaction and its fast algorithm, make this program useful for the large scale design of primers, especially in large sequencing projects.

  18. Primer design for large scale sequencing.

    PubMed Central

    Haas, S; Vingron, M; Poustka, A; Wiemann, S


    We have developed PRIDE, a primer design program that automatically designs primers in single contigs or whole sequencing projects to extend the already known sequence and to double strand single-stranded regions. The program is fully integrated into the Staden package (GAP4) and accessible with a graphical user interface. PRIDE uses a fuzzy logic-based system to calculate primer qualities. The computational performance of PRIDE is enhanced by using suffix trees to store the huge amount of data being produced. A test set of 110 sequencing primers and 11 PCR primer pairs has been designed on genomic templates, cDNAs and sequences containing repetitive elements to analyze PRIDE's success rate. The high performance of PRIDE, combined with its minimal requirement of user interaction and its fast algorithm, make this program useful for the large scale design of primers, especially in large sequencing projects. PMID:9611248

  19. Nucleic acid amplification using modular branched primers


    Ulanovsky, Levy; Raja, Mugasimangalam C.


    Methods and compositions expand the options for making primers for use in amplifying nucleic acid segments. The invention eliminates the step of custom synthesis of primers for Polymerase Chain Reactions (PCR). Instead of being custom-synthesized, a primer is replaced by a combination of several oligonucleotide modules selected from a pre-synthesized library. A modular combination of just a few oligonucleotides essentially mimics the performance of a conventional, custom-made primer by matching the sequence of the priming site in the template. Each oligonucleotide module has a segment that matches one of the stretches within the priming site.

  20. A Primer on Observational Measurement.


    Girard, Jeffrey M; Cohn, Jeffrey F


    Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore.

  1. A Practical Primer on Geostatistics

    USGS Publications Warehouse

    Olea, Ricardo A.


    significant methodological implications. HISTORICAL REMARKS As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields. PIONEERS Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorology CALCULATIONS Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations. SOFTWARE For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics. ORGANIZATION OF THE PRIMER The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of th

  2. Linear elastic fracture mechanics primer

    NASA Technical Reports Server (NTRS)

    Wilson, Christopher D.


    This primer is intended to remove the blackbox perception of fracture mechanics computer software by structural engineers. The fundamental concepts of linear elastic fracture mechanics are presented with emphasis on the practical application of fracture mechanics to real problems. Numerous rules of thumb are provided. Recommended texts for additional reading, and a discussion of the significance of fracture mechanics in structural design are given. Griffith's criterion for crack extension, Irwin's elastic stress field near the crack tip, and the influence of small-scale plasticity are discussed. Common stress intensities factor solutions and methods for determining them are included. Fracture toughness and subcritical crack growth are discussed. The application of fracture mechanics to damage tolerance and fracture control is discussed. Several example problems and a practice set of problems are given.

  3. Primer: Shotgun Proteomics in Neuroscience

    PubMed Central

    Liao, Lujian; McClatchy, Daniel B.; Yates, John R.


    Mass spectrometry-based proteomics is increasingly used to address basic and clinical questions in biomedical research through studies of differential protein expression, protein-protein interactions, and post-translational modifications. The complex structural and functional organization of the human brain warrants the application of high-throughput, systematic approaches to understand the functional alterations under normal physiological conditions and the perturbations of neurological diseases. This primer focuses on shotgun proteomics based tandem mass spectrometry for the identification of proteins in a complex mixture. It describes the basic concepts of protein differential expression analysis and post-translational modification analysis and discusses several strategies to improve the coverage of the proteome. PMID:19607789

  4. PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection.


    O'Halloran, Damien M


    Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction.

  5. PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection

    PubMed Central

    O’Halloran, Damien M.


    Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558

  6. A Primer on Sampling for Statewide Assessment.

    ERIC Educational Resources Information Center

    Jaeger, Richard M.

    This paper is a primer on sampling procedures for statewide assessment. The careful reader should gain substantial knowledge about the promises and pitfalls of sampling for assessment. The primer has three basic objectives: (1) to define terms and concepts basic to sampling theory and its application, including population, sampling unit, sampling…

  7. Primer on Special Education in Charter Schools

    ERIC Educational Resources Information Center

    Luna, Tom


    This section of the Idaho Primer on Special Education in Charter Schools is divided into two parts: (1) a discussion of the legal status of charter schools and their linkage to other local education agencies (LEAs), and (2) a synopsis of federal laws that are most relevant to special education in charter schools. The Primer on Special Education in…

  8. SBE primer : multiplexing minisequencing-based genotyping

    SciTech Connect

    Kaderali, L.; Deshpande, A.; Uribe-Romeo, F. J.; Schliep, A.; Torney, D. C.


    Single-nucleotide polymorphism (SNP) analysis is a powerful tool for mapping and diagnosing disease-related alleles. Most of the known genetic diseases are caused by point mutations, and a growing number of SNPs will be routinely analyzed to diagnose genetic disorders. Mutation analysis by polymerase mediated single-base primer extension (minisequencing) can be massively parallelized using for example DNA microchips or flow cytometry with microspheres as solid support. By adding a unique oligonucleotide tag to the 5-inch end of the minisequencing primer and attaching the complementary anti-tag to the array or bead surface, the assay can be 'demultiplexed'. However, such high-throughput scoring of SNPs requires a high level of primer multiplexing in order to analyze multiple loci in one assay, thus enabling inexpensive and fast polymorphism scoring. Primers can be chosen from either the plus or the minus strand, and primers used in the same experiment must not bind to one another. To genotype a given number of polymorphic sites, the question is which primer to use for each SNP, and which primers to group into the same experiment. Furthermore, a crosshybridization-free tag/anti-tag code is required in order to sort the extended primers to the corresponding microspheres or chip spots. These problems pose challenging algorithmic questions. We present a computer program lo automate the design process for the assay. Oligonucleotide primers for the reaction are automatically selected by the software, a unique DNA tag/anti-tag system is generated, and the pairing of primers and DNA-Tags is automatically done in a way to avoid any crossreactivity. We report first results on a 45-plex genotyping assay, indicating that minisequencing can be adapted to be a powerful tool for high-throughput, massively parallel genotyping.

  9. Primer on spontaneous heating and pyrophoricity

    SciTech Connect

    Not Available


    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  10. Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.


    Yofe, Ido; Schuldiner, Maya


    The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at:

  11. Multiplexing Short Primers for Viral Family PCR

    SciTech Connect

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W


    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  12. Use of labeled primers for differential display

    SciTech Connect

    Paunesku, T.; Woloschak, G.E.


    Two artifacts introduced in using differential display technology are (1) random priming from dT present from affinity purification of PolyA+ RNA and (2) hybridization of the arbitrary primer to template target sequences on both cDNA strands. We have developed a method eliminating both problems. By separately using 5`-end-labeled (T){sub 12}XY and arbitrary primers to label bands and comparing two differential display patterns, we can detect only those products incorporating the (T){sub 12}XY primer on the 3` ends and the arbitrary primer on 5` ends. Those bands that are generated randomly in the PCR are readily detectable and can be ignored.

  13. Climate Ready Estuaries Rolling Easements Primer

    EPA Pesticide Factsheets

    Rolling easements enable wetlands and beaches to migrate inland and allow society to avoid the costs and hazards of protecting low lands from rising sea levels. This document provides a primer on more than a dozen rolling easement approaches.

  14. PCR hot-start using duplex primers.


    Kong, Deming; Shen, Hanxi; Huang, Yanping; Mi, Huaifeng


    A new technique of PCR hot-start using duplex primers has been developed which can decrease the undesirable products arising throughout PCR amplification thereby giving better results than a manual hot-start method.

  15. A Dozen Primers on Important Information Standards

    ERIC Educational Resources Information Center

    Dempsey, Kathy, Comp.


    This is a compilation of 12 primers on important information standards and protocols. These primers are: (1) Atom; (2) COinS; (3) MADS; (4) MARC 21/MARCXML; (5) MIX; (6) MXG; (7) OpenSearch; (8) PREMIS; (9) RESTful HTTP; (10) unAPI; (11) XMPP (aka Jabber); and (12) ZeeRex. The Atom Syndication Format defines a new XML-based syndication format for…

  16. Protective Coats For Zinc-Rich Primers

    NASA Technical Reports Server (NTRS)

    Macdowell, Louis G, III


    Report describes tests of topcoats for inorganic zinc-rich primers on carbon steel. Topcoats intended to provide additional protection against corrosion in acidic, salty seacoast-air/rocket-engine-exhaust environment of Space Shuttle launch site. Tests focused on polyurethane topcoats on epoxy tie coats on primers. Part of study involved comparison between "high-build" coating materials and thin-film coating materials.

  17. Are "universal" DNA primers really universal?


    Sharma, Pranay; Kobayashi, Tsuyoshi


    "Universal" DNA primers LCO 1490 and HCO 2198 were originally designed from three coding and six anticoding strands by comparing highly conserved regions of mitochondrial cytochrome c oxidase subunit I (COI) genes across 15 taxa. These primers have been successful in amplifying a 710-bp fragment of highly conserved regions of the COI gene for more than 80 invertebrate species from 11 phyla. In the present study, 130,843 variations were reviewed in the primer region of mitochondrial molecular markers by comparing 725 COI sequences from the kingdom Animalia. It was found that, for 177 invertebrate species, the forward primer (LCO 1490) showed only four conserved regions, compared to 12 in the original study. For ascidians, fungi and vertebrates, it showed approximately 50 % conserved regions, dropping to one conserved region for echinoderms. However, the reverse primer (HCO 2198) was highly conserved across 725 COI primer sequences. A similar pattern was observed in amino acid distributions. There was a significant difference in the means of base pair differences from the level of family, genus and species for LCO 1490 [analysis of variance (ANOVA), F 6,188 = 8.193, P < 0.001] and at the level of genus and species for HCO 2198 (ANOVA, F 6,77 = 2.538, P < 0.027). We conclude that, at different taxonomic levels, it is possible to design forward primers from reference sequences belonging to the level of order (maximum 5 bp differences), family (maximum 6 bp differences) or genus (maximum 1 bp difference). Reverse primers can be designed from the level of family (maximum 5 bp differences) or genus (maximum 2 bp differences).

  18. Use of labeled primers for differential display

    SciTech Connect

    Paunesku, T.; Woloschak, G.E.


    The differential display of eukaryotic cDNAs using PCR allows for determination of mRNA species differentially expressed when comparing two similar cell populations. This procedure uses a (T){sub 12}XY oligonucleotide as the 3 ft primer and an arbitrary 8-10-mer as the 5 ft primer. Labeling occurs by inclusion of {alpha}[{sup 33}P]-dATP in the PCR reaction. Two artifacts caused by this approach are (1) random printing from dT present from affinity purification of PolyA+RNA and (2) hybridization of the arbitrary primer to template target sequences on both cDNA strands. In this work, we have developed an approach for both eliminating smearing and identifying nonspecific bands on sequencing gels. By separately using 5 ft-end-labeled (T){sub 12}XY and arbitrary primers to label bands and comparing two differential display patterns rather than including labeled nucleotides in the PCR reaction itself, we can detect only those products incorporating the M{sub 12}XY primer on the 3 ft ends and the arbitrary primer on 5 ft ends. Those bands that are generated randomly in the PCR reaction are readily detectable and can be ignored. If on the other hand, one is interested only in a diagnostic banding pattern for differential display, benefit can be derived from the simplicity of the pattern obtained when labeled (T){sub 12}XY is used.

  19. PrimerDesign-M: A multiple-alignment based multiple-primer design tool for walking across variable genomes


    Yoon, Hyejin; Leitner, Thomas


    Analyses of entire viral genomes or mtDNA requires comprehensive design of many primers across their genomes. In addition, simultaneous optimization of several DNA primer design criteria may improve overall experimental efficiency and downstream bioinformatic processing. To achieve these goals, we developed PrimerDesign-M. It includes several options for multiple-primer design, allowing researchers to efficiently design walking primers that cover long DNA targets, such as entire HIV-1 genomes, and that optimizes primers simultaneously informed by genetic diversity in multiple alignments and experimental design constraints given by the user. PrimerDesign-M can also design primers that include DNA barcodes and minimize primer dimerization. PrimerDesign-Mmore » finds optimal primers for highly variable DNA targets and facilitates design flexibility by suggesting alternative designs to adapt to experimental conditions.« less

  20. PrimerDesign-M: A multiple-alignment based multiple-primer design tool for walking across variable genomes

    SciTech Connect

    Yoon, Hyejin; Leitner, Thomas


    Analyses of entire viral genomes or mtDNA requires comprehensive design of many primers across their genomes. In addition, simultaneous optimization of several DNA primer design criteria may improve overall experimental efficiency and downstream bioinformatic processing. To achieve these goals, we developed PrimerDesign-M. It includes several options for multiple-primer design, allowing researchers to efficiently design walking primers that cover long DNA targets, such as entire HIV-1 genomes, and that optimizes primers simultaneously informed by genetic diversity in multiple alignments and experimental design constraints given by the user. PrimerDesign-M can also design primers that include DNA barcodes and minimize primer dimerization. PrimerDesign-M finds optimal primers for highly variable DNA targets and facilitates design flexibility by suggesting alternative designs to adapt to experimental conditions.

  1. Beam shaping for laser initiated optical primers

    NASA Astrophysics Data System (ADS)

    Lizotte, Todd E.


    Remington was one of the first firearm manufacturing companies to file a patent for laser initiated firearms, in 1969. Nearly 40 years later, the development of laser initiated firearms has not become a mainstream technology in the civilian market. Requiring a battery is definitely a short coming, so it is easy to see how such a concept would be problematic. Having a firearm operate reliably and the delivery of laser energy in an efficient manner to ignite the shock-sensitive explosive primer mixtures is a tall task indeed. There has been considerable research on optical element based methods of transferring or compressing laser energy to ignite primer charges, including windows, laser chip primers and various lens shaped windows to focus the laser energy. The focusing of laser light needs to achieve igniting temperatures upwards of >400°C. Many of the patent filings covering this type of technology discuss simple approaches where a single point of light might be sufficient to perform this task. Alternatively a multi-point method might provide better performance, especially for mission critical applications, such as precision military firearms. This paper covers initial design and performance test of the laser beam shaping optics to create simultaneous multiple point ignition locations and a circumferential intense ring for igniting primer charge compounds. A simple initial test of the ring beam shaping technique was evaluated on a standard large caliber primer to determine its effectiveness on igniting the primer material. Several tests were conducted to gauge the feasibility of laser beam shaping, including optic fabrication and mounting on a cartridge, optic durability and functional ignition performance. Initial data will be presented, including testing of optically elements and empirical primer ignition / burn analysis.

  2. Primers on Special Education and Charter Schools: Compilation of Full Primer Set

    ERIC Educational Resources Information Center

    Ahearn, Eileen M.; Giovannetti, Elizabeth A.; Lange, Cheryl M.; Rhim, Lauren Morando; Warren, Sandra Hopfengardner


    This set of primers for charter school authorizers; charter school operators and state-level administrators has been developed to provide background information and resources for the "builders" of charter schools and policymakers to facilitate the successful inclusion of students with disabilities in charter schools. The primers open…

  3. Exquisite allele discrimination by toehold hairpin primers

    PubMed Central

    Byrom, Michelle; Bhadra, Sanchita; Jiang, Yu Sherry; Ellington, Andrew D.


    The ability to detect and monitor single nucleotide polymorphisms (SNPs) in biological samples is an enabling research and clinical tool. We have developed a surprising, inexpensive primer design method that provides exquisite discrimination between SNPs. The field of DNA computation is largely reliant on using so-called toeholds to initiate strand displacement reactions, leading to the execution of kinetically trapped circuits. We have now similarly found that the short toehold sequence to a target of interest can initiate both strand displacement within the hairpin and extension of the primer by a polymerase, both of which will further stabilize the primer:template complex. However, if the short toehold does not bind, neither of these events can readily occur and thus amplification should not occur. Toehold hairpin primers were used to detect drug resistance alleles in two genes, rpoB and katG, in the Mycobacterium tuberculosis genome, and ten alleles in the Escherichia coli genome. During real-time PCR, the primers discriminate between mismatched templates with Cq delays that are frequently so large that the presence or absence of mismatches is essentially a ‘yes/no’ answer. PMID:24990378

  4. Primer-design for multiplexed genotyping.


    Kaderali, Lars; Deshpande, Alina; Nolan, John P; White, P Scott


    Single-nucleotide polymorphism (SNP) analysis is a powerful tool for mapping and diagnosing disease-related alleles. Mutation analysis by polymerase-mediated single-base primer extension (minisequencing) can be massively parallelized using DNA microchips or flow cytometry with microspheres as solid support. By adding a unique oligonucleotide tag to the 5' end of the minisequencing primer and attaching the complementary antitag to the array or bead surface, the assay can be 'demultiplexed'. Such high-throughput scoring of SNPs requires a high level of primer multiplexing in order to analyze multiple loci in one assay, thus enabling inexpensive and fast polymorphism scoring. We present a computer program to automate the design process for the assay. Oligonucleotide primers for the reaction are automatically selected by the software, a unique DNA tag/antitag system is generated, and the pairing of primers and DNA tags is automatically done in a way to avoid any crossreactivity. We report results on a 45-plex genotyping assay, indicating that minisequencing can be adapted to be a powerful tool for high-throughput, massively parallel genotyping. The software is available to academic users on request.

  5. Climate Change, Health, and Communication: A Primer.


    Chadwick, Amy E


    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

  6. Development of Specific Primer for Tricholoma matsutake

    PubMed Central

    Kim, Jang-Han


    In this study, in an effort to develop a method for the molecular detection of Tricholoma matsutake in Korea from other closely related Tricholomataceae, a species-specific PCR primer pair, TmF and TmR, was designed using nuclear ribosomal intertranscribed spacer (ITS) sequences. The DTmF and DTmR sequences were 5'-CCTGACGCCAATCTTTTCA-3' and 5'-GGAGAGCAGACTTGTGAGCA-3', respectively. The PCR primers reliably amplified only the ITS sequences of T. matsutake, and not those of other species used in this study. PMID:23983557

  7. Forest Interpreter's Primer on Fire Management.

    ERIC Educational Resources Information Center

    Zelker, Thomas M.

    Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

  8. Microsatellite primers for red drum (Sciaenops ocellatus)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In this note, we document polymerase-chain-reaction (PCR) primer pairs for 101, nuclear-encoded microsatellites designed and developed from a red drum (Sciaenops ocellatus) genomic library. The 101 microsatellites (Genbank Accession Numbers EU015882-EU015982) were amplified successfully and used to...

  9. The FAS Child: A Primer for Teachers.

    ERIC Educational Resources Information Center

    Wentz, Thomas L.; Larson, Julie


    This primer on fetal alcohol syndrome (FAS) distinguishes between the syndrome and fetal alcohol effects (FAE), offers a history of FAS, outlines medical criteria for diagnosis, rates of incidence, factors influencing incidence and severity, developmental stages of children with FAS, clinical features, and educational implications and approaches.…

  10. Issues Primer. EEE708 Negotiated Study Program.

    ERIC Educational Resources Information Center

    Jennings, Leonie

    This issues primer is structured around a series of 20 contemporary concerns in the changing world of work and training in Australia in the early 1990s. It is part of the study materials for the one-semester distance education unit, Negotiated Study Program, in the Open Campus Program at Deakin University (Australia). Information on each issue is…

  11. School Safety & Youth Violence: A Legal Primer.

    ERIC Educational Resources Information Center

    Bailey, Kirk A.; Ross, Catherine J.

    This legal primer on violence in schools addresses the responsibility of school officials to respond to undisciplined youths whose behavior threatens the welfare and safety of other children in attendance. It is broken down into sections that provide a brief overview of the key rules and guidelines for school officials and teachers in each topic…

  12. Microsatellite primer resource for Populus developed from

    SciTech Connect

    Yin, Tongming; Yang, Xiaohan; Gunter, Lee E; Tuskan, Gerald A; Wullschleger, Stan D; Huang, Prof. Minren; Li, Shuxian; Zhang, Xinye


    In this study, 148 428 simple sequence repeat (SSR) primer pairs were designed from the unambiguously mapped sequence scaffolds of the Nisqually-1 genome. The physical position of the priming sites were identified along each of the 19 Populus chromosomes, and it was specified whether the priming sequences belong to intronic, intergenic, exonic or UTR regions. A subset of 150 SSR loci were amplified and a high amplification success rate (72%) was obtained in P. tremuloides, which belongs to a divergent subgenus of Populus relative to Nisqually-1. PCR reactions showed that the amplification success rate of exonic primer pairs was much higher than that of the intronic/intergenic primer pairs. Applying ANOVA and regression analyses to the flanking sequences of microsatellites, the repeat lengths, the GC contents of the repeats, the repeat motif numbers, the repeat motif length and the base composition of the repeat motif, it was determined that only the base composition of the repeat motif and the repeat motif length significantly affect the microsatellite variability in P. tremuloides samples. The SSR primer resource developed in this study provides a database for selecting highly transferable SSR markers with known physical position in the Populus genome and provides a comprehensive genetic tool to extend the genome sequence of Nisqually-1 to genetic studies in different Populus species.

  13. Exploratory Development of Corrosion Inhibiting Primers

    DTIC Science & Technology


    melamine , were selected for further evaluation in primer systems as examples of soluble and insoluble corrosion inhibitors. Other routes to potential...guanidine dichromate gave relatively poor performance. Melamine dich- romate pigment was more generally effective in preventing corrosion than the common...dihpneyl- guanidine ....... ..................... ... 66 Preparation Of Melamine Dichromate (Compound #25). 66 vii TABLE OF CONTENTS

  14. Apparatus For Tests Of Percussion Primers

    NASA Technical Reports Server (NTRS)

    Bement, Laurence J.; Bailey, James W.; Schimmel, Morry L.


    Test apparatus and method developed to measure ignition capability of percussion primers. Closely simulates actual conditions and interfaces encountered in such applications as in munitions and rocket motors. Ignitability-testing apparatus is small bomb instrumented with pressure transducers. Sizes, shapes, and positions of bomb components and materials under test selected to obtain quantitative data on ignition.

  15. A primer on effectiveness and efficacy trials.


    Singal, Amit G; Higgins, Peter D R; Waljee, Akbar K


    Although efficacy and effectiveness studies are both important when evaluating interventions, they serve distinct purposes and have different study designs. Unfortunately, the distinction between these two types of trials is often poorly understood. In this primer, we highlight several differences between these two types of trials including study design, patient populations, intervention design, data analysis, and result reporting.

  16. A Primer on Simulation and Gaming.

    ERIC Educational Resources Information Center

    Barton, Richard F.

    In a primer intended for the administrative professions, for the behavioral sciences, and for education, simulation and its various aspects are defined, illustrated, and explained. Man-model simulation, man-computer simulation, all-computer simulation, and analysis are discussed as techniques for studying object systems (parts of the "real…

  17. Environmentally Acceptable Medium Caliber Ammunition Percussion Primers

    DTIC Science & Technology


    typically contain lead styphnate and antimony sulfide along with other constituents. Although highly effective, these heavy metal compounds have been...contain barium nitrate. Although not negatively categorized by the EPA itself, barium compounds are generally regarded as toxic and likewise should...contains the lead styphnate based FA956 composition2 which is a typical formulation of conventional military ammunition percussion primers. The

  18. Rust transformation/rust compatible primers

    NASA Technical Reports Server (NTRS)

    Emeric, Dario A.; Miller, Christopher E.


    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  19. Deconstructing the polymerase chain reaction: understanding and correcting bias associated with primer degeneracies and primer-template mismatches.


    Green, Stefan J; Venkatramanan, Raghavee; Naqib, Ankur


    The polymerase chain reaction (PCR) is sensitive to mismatches between primer and template, and mismatches can lead to inefficient amplification of targeted regions of DNA template. In PCRs in which a degenerate primer pool is employed, each primer can behave differently. Therefore, inefficiencies due to different primer melting temperatures within a degenerate primer pool, in addition to mismatches between primer binding sites and primers, can lead to a distortion of the true relative abundance of targets in the original DNA pool. A theoretical analysis indicated that a combination of primer-template and primer-amplicon interactions during PCR cycles 3-12 is potentially responsible for this distortion. To test this hypothesis, we developed a novel amplification strategy, entitled "Polymerase-exonuclease (PEX) PCR", in which primer-template interactions and primer-amplicon interactions are separated. The PEX PCR method substantially and significantly improved the evenness of recovery of sequences from a mock community of known composition, and allowed for amplification of templates with introduced mismatches near the 3' end of the primer annealing sites. When the PEX PCR method was applied to genomic DNA extracted from complex environmental samples, a significant shift in the observed microbial community was detected. Furthermore, the PEX PCR method provides a mechanism to identify which primers in a primer pool are annealing to target gDNA. Primer utilization patterns revealed that at high annealing temperatures in the PEX PCR method, perfect match annealing predominates, while at lower annealing temperatures, primers with up to four mismatches with templates can contribute substantially to amplification. The PEX PCR method is simple to perform, is limited to PCR mixes and a single exonuclease step which can be performed without reaction cleanup, and is recommended for reactions in which degenerate primer pools are used or when mismatches between primers and

  20. New primers for adhesive bonding of aluminum alloys

    NASA Technical Reports Server (NTRS)

    Burrell, B. W.; Port, W. S.


    Synthetic polypeptide adhesive primers are effective, with high temperature epoxy resins, at temperatures from 100 deg to 300 deg C. Lap-shear failure loads and lap-shear strength of both primers are discussed.

  1. PrimerSuite: A High-Throughput Web-Based Primer Design Program for Multiplex Bisulfite PCR

    PubMed Central

    Lu, Jennifer; Johnston, Andrew; Berichon, Philippe; Ru, Ke-lin; Korbie, Darren; Trau, Matt


    The analysis of DNA methylation at CpG dinucleotides has become a major research focus due to its regulatory role in numerous biological processes, but the requisite need for assays which amplify bisulfite-converted DNA represents a major bottleneck due to the unique design constraints imposed on bisulfite-PCR primers. Moreover, a review of the literature indicated no available software solutions which accommodated both high-throughput primer design, support for multiplex amplification assays, and primer-dimer prediction. In response, the tri-modular software package PrimerSuite was developed to support bisulfite multiplex PCR applications. This software was constructed to (i) design bisulfite primers against multiple regions simultaneously (PrimerSuite), (ii) screen for primer-primer dimerizing artefacts (PrimerDimer), and (iii) support multiplex PCR assays (PrimerPlex). Moreover, a major focus in the development of this software package was the emphasis on extensive empirical validation, and over 1300 unique primer pairs have been successfully designed and screened, with over 94% of them producing amplicons of the expected size, and an average mapping efficiency of 93% when screened using bisulfite multiplex resequencing. The potential use of the software in other bisulfite-based applications such as methylation-specific PCR is under consideration for future updates. This resource is freely available for use at PrimerSuite website ( PMID:28117430

  2. PrimerSuite: A High-Throughput Web-Based Primer Design Program for Multiplex Bisulfite PCR.


    Lu, Jennifer; Johnston, Andrew; Berichon, Philippe; Ru, Ke-Lin; Korbie, Darren; Trau, Matt


    The analysis of DNA methylation at CpG dinucleotides has become a major research focus due to its regulatory role in numerous biological processes, but the requisite need for assays which amplify bisulfite-converted DNA represents a major bottleneck due to the unique design constraints imposed on bisulfite-PCR primers. Moreover, a review of the literature indicated no available software solutions which accommodated both high-throughput primer design, support for multiplex amplification assays, and primer-dimer prediction. In response, the tri-modular software package PrimerSuite was developed to support bisulfite multiplex PCR applications. This software was constructed to (i) design bisulfite primers against multiple regions simultaneously (PrimerSuite), (ii) screen for primer-primer dimerizing artefacts (PrimerDimer), and (iii) support multiplex PCR assays (PrimerPlex). Moreover, a major focus in the development of this software package was the emphasis on extensive empirical validation, and over 1300 unique primer pairs have been successfully designed and screened, with over 94% of them producing amplicons of the expected size, and an average mapping efficiency of 93% when screened using bisulfite multiplex resequencing. The potential use of the software in other bisulfite-based applications such as methylation-specific PCR is under consideration for future updates. This resource is freely available for use at PrimerSuite website (

  3. Electrocoat Process for Non-Chromate Primers in DOD Manufacturing

    DTIC Science & Technology


    2 with two levels of corrosion inhibitor – MIL-PRF-23377N Cr-free spray primer – MIL-PRF-23377C Solvent Cr spray primer – MIL-PRF-85582C Water...NC spray primer Residual coating Results summary- Galvanic assemblies Corrosion mechanism different between Electrocoat and spray primers...An application method which uses direct electrical current to deposit the coating ● Waterborne coating ● Chromium-free (no heavy metals

  4. Genetics and health communication: a primer.


    Greenberg, Marisa S


    The progress of genetic knowledge has been swift and steadfast. As we move forward in the genomic era, post Human Genome Project, and continue to explore how one's genes interact with one's environment, it becomes increasingly important for all audiences to have a firm grasp of the vocabulary used in this health context. This primer is intended to be used as a reference and to introduce and/or make more clear concepts related to genetics to increase understanding.

  5. A primer for criticality calculations with DANTSYS

    SciTech Connect

    Busch, R.D.


    With the closure of many experimental facilities, the nuclear safety analyst has to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. Although deterministic methods often do not provide exact models of a system, a substantial amount of reliable information on nuclear systems can be obtained using these methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico (UNM) in cooperation with the Radiation Transport Group at Los Alamos National Laboratory (LANL) has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. DANTSYS is the new name of the group of codes formerly known as: ONEDANT, TWODANT, TWOHEX, TWOGQ, and THREEDANT. The primer is designed to teach bu example, with each example illustrating two or three DANTSYS features useful in criticality analyses. Starting with a Quickstart chapter, the primer gives an overview of the basic requirements for DANTSYS input and allows the user to quickly run a simple criticality problem with DANTSYS. Each chapter has a list of basic objectives at the beginning identifying the goal of the chapter and the individual DANTSYS features covered in detail in the chapter example problems. On completion of the primer, it is expected that the user will be comfortable doing criticality calculations with DANTSYS and can handle 60--80% of the situations that normally arise in a facility. The primary provides a set of input files that can be selective modified by the user to fit each particular problem.

  6. Fractal antenna and fractal resonator primer

    NASA Astrophysics Data System (ADS)

    Cohen, Nathan


    Self-similarity and fractals have opened new and important avenues for antenna and electronic solutions over the last 25 years. This primer provides an introduction to the benefits provided by fractal geometry in antennas, resonators, and related structures. Such benefits include, among many, wider bandwidths, smaller sizes, part-less electronic components, and better performance. Fractals also provide a new generation of optimized design tools, first used successfully in antennas but applicable in a general fashion.

  7. Specific PCR product primer design using memetic algorithm.


    Yang, Cheng-Hong; Cheng, Yu-Huei; Chuang, Li-Yeh; Chang, Hsueh-Wei


    To provide feasible primer sets for performing a polymerase chain reaction (PCR) experiment, many primer design methods have been proposed. However, the majority of these methods require a relatively long time to obtain an optimal solution since large quantities of template DNA need to be analyzed. Furthermore, the designed primer sets usually do not provide a specific PCR product size. In recent years, evolutionary computation has been applied to PCR primer design and yielded promising results. In this article, a memetic algorithm (MA) is proposed to solve primer design problems associated with providing a specific product size for PCR experiments. The MA is compared with a genetic algorithm (GA) using an accuracy formula to estimate the quality of the primer design and test the running time. Overall, 50 accession nucleotide sequences were sampled for the comparison of the accuracy of the GA and MA for primer design. Five hundred runs of the GA and MA primer design were performed with PCR product lengths of 150-300 bps and 500-800 bps, and two different methods of calculating T(m) for each accession nucleotide sequence were tested. A comparison of the accuracy results for the GA and MA primer design showed that the MA primer design yielded better results than the GA primer design. The results further indicate that the proposed method finds optimal or near-optimal primer sets and effective PCR products in a dry dock experiment. Related materials are available online at

  8. Universal COI primers for DNA barcoding amphibians.


    Che, Jing; Chen, Hong-Man; Yang, Jun-Xiao; Jin, Jie-Qiong; Jiang, Ke; Yuan, Zhi-Yong; Murphy, Robert W; Zhang, Ya-Ping


    DNA barcoding is a proven tool for the rapid and unambiguous identification of species, which is essential for many activities including the vouchering tissue samples in the genome 10K initiative, genealogical reconstructions, forensics and biodiversity surveys, among many other applications. A large-scale effort is underway to barcode all amphibian species using the universally sequenced DNA region, a partial fragment of mitochondrial cytochrome oxidase subunit I COI. This fragment is desirable because it appears to be superior to 16S for barcoding, at least for some groups of salamanders. The barcoding of amphibians is essential in part because many species are now endangered. Unfortunately, existing primers for COI often fail to achieve this goal. Herein, we report two new pairs of primers (➀, ➁) that in combination serve to universally amplify and sequence all three orders of Chinese amphibians as represented by 36 genera. This taxonomic diversity, which includes caecilians, salamanders and frogs, suggests that the new primer pairs will universally amplify COI for the vast majority species of amphibians.

  9. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.


    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei


    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system.

  10. Hydrology of Central Florida Lakes - A Primer

    USGS Publications Warehouse

    Schiffer, Donna M.


    INTRODUCTION Lakes are among the most valued natural resources of central Florida. The landscape of central Florida is riddled with lakeswhen viewed from the air, it almost seems there is more water than land. Florida has more naturally formed lakes than other southeastern States, where many lakes are created by building dams across streams. The abundance of lakes on the Florida peninsula is a result of the geology and geologic history of the State. An estimated 7,800 lakes in Florida are greater than 1 acre in surface area. Of these, 35 percent are located in just four counties (fig. 1): Lake, Orange, Osceola, and Polk (Hughes, 1974b). Lakes add to the aesthetic and commercial value of the area and are used by many residents and visitors for fishing, boating, swimming, and other types of outdoor recreation. Lakes also are used for other purposes such as irrigation, flood control, water supply, and navigation. Residents and visitors commonly ask questions such as Whyare there so many lakes here?, Why is my lake drying up (or flooding)?, or Is my lake spring-fed? These questions indicate that the basic hydrology of lakes and the interaction of lakes with ground water and surface water are not well understood by the general population. Because of the importance of lakes to residents of central Florida and the many questions and misconceptions about lakes, this primer was prepared by the U.S. Geological Survey (USGS) in cooperation with the St. Johns River Water Management District and the South Florida Water Management District. The USGS has been collecting hydrologic data in central Florida since the 1920s, obtaining valuable information that has been used to better understand the hydrology of the water resources of central Florida, including lakes. In addition to data collection, as of 1994, the USGS had published 66 reports and maps on central Florida lakes (Garcia and Hoy, 1995). The main purpose of this primer is to describe the hydrology of lakes in central

  11. Spectrophotometric determination of tetrazene in primers and primer mixes by use of resorcinol.


    Norwitz, G; Keliher, P N


    A spectrophotometric method is proposed for the determination of tetrazene (tetracene) in primers and primer mixes that involves treatment of the tetrazene with resorcinol solution and measurement of the intensity of the yellow colour of the diazo-dye produced. In the application of the method, lead styphnate and barium nitrate are first removed by extraction with ammonium acetate solution and then nitrocellulose and PETN are removed by extraction with acetone. The insoluble matter containing the tetrazene is boiled with resorcinol reagent, the solution filtered, and the absorbance measured at 400 nm. Conditions for optimum colour development are studied and the nature of the reaction is considered.

  12. Hubble Space Telescope Primer for Cycle 21

    NASA Astrophysics Data System (ADS)

    Gonzaga, S.; et al.


    The Hubble Space Telescope Primer for Cycle 21 is a companion document to the HST Call for Proposals1. It provides an overview of the Hubble Space Telescope (HST), with basic information about telescope operations, instrument capabilities, and technical aspects of the proposal preparation process. A thorough understanding of the material in this document is essential for the preparation of a competitive proposal. This document is available as an online HTML document and a PDF file. The HTML version, optimized for online browsing, contains many links to additional information. The PDF version is optimized for printing, but online PDF readers have search capabilities for quick retrieval of specific information.

  13. A primer on clinical trial design.


    Ellimoottil, Chad; Vijan, Sandeep; Flanigan, Robert C


    A well-designed and executed clinical trial is the gold standard of evidence-based medicine. It is important for readers to understand the rationale for the study design, identify common pitfalls, and scrutinize limitations. Herein, we present a brief overview of types of designs used for clinical trials and discuss the use of appropriate end points, the selection of study participants, randomization, sample size calculation, blinding, and analysis of data. Finally, we emphasize the importance of accurate and transparent reporting. Our goal is to provide a primer for practicing urologists to enhance their understanding of the clinical trial literature.

  14. Global Health in Family Medicine Summer Primer

    PubMed Central

    Rouleau, Katherine; Janakiram, Praseedha; Nicolle, Eileen; Godoy-Ruiz, Paula; Pakes, Barry N.


    Abstract Problem addressed Despite the rapid emergence of global health training across North American universities, there remains a gap in educational programs focusing on the unique role of family medicine and primary care in global health. Objective of program The objective of the Global Health in Family Medicine Summer Primer, developed in 2013 by the Department of Family and Community Medicine at the University of Toronto in Ontario, is to strengthen global health competencies among family medicine residents and faculty. Program description The course covers the meaning of global health; global health ethics; the place of family medicine, primary care, and primary health care in the global health context; epidemiology; infectious diseases; the social determinants of health; and care of vulnerable populations locally and globally. The course is delivered in an intensive 5-day format with didactic lectures, group discussions, interactive workshops, and lived-experience panels. Conclusion The Global Health in Family Medicine Summer Primer has proven to be a successful educational initiative and provides valuable lessons learned for other academic science centres in developing global health training programs for family medicine residents and faculty. PMID:26380854

  15. Great Lakes rivermouths: a primer for managers

    USGS Publications Warehouse

    Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul


    Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described

  16. Oligonucleotide primers for PCR amplification of coelomate introns.


    Jarman, Simon N; Ward, Robert D; Elliott, Nicholas G


    Abstract Seven novel oligonucleotide primer pairs for polymerase chain reaction amplification of introns from nuclear genes in coelomates were designed and tested. Each pair bound to adjacent exons that are separated by a single intron in most coelomate species. The primer sets amplified introns in species as widely separated by the course of evolution as oysters (Mollusca: Protostoma) and salmon (Chordata: Deuterostoma). Each primer set was tested on a further 6 coelomate species and found to amplify introns in most cases. These primer sets may therefore be useful tools for developing nuclear DNA markers in diverse coelomate species for studies of population genetics, phylogenetics, or genome mapping.

  17. Brownfields Technology Primer: Selecting and Using Phytoremediation for Site Cleanup

    EPA Pesticide Factsheets

    This primer explains the phytoremediation process, discusses the potential advantages and considerations in selecting phytoremediation to clean up brownfields sites, and provides information on additional resources about phytoremediation.

  18. HST archive primer, version 4.1

    NASA Technical Reports Server (NTRS)

    Fruchter, A. (Editor); Baum, S. (Editor)


    This version of the HST Archive Primer provides the basic information a user needs to know to access the HST archive via StarView the new user interface to the archive. Using StarView, users can search for observations interest, find calibration reference files, and retrieve data from the archive. Both the terminal version of StarView and the X-windows version feature a name resolver which simplifies searches of the HST archive based on target name. In addition, the X-windows version of StarView allows preview of all public HST data; compressed versions of public images are displayed via SAOIMAGE, while spectra are plotted using the public plotting package, XMGR. Finally, the version of StarView described here features screens designed for observers preparing Cycle 5 HST proposals.

  19. Primer on tritium safe handling practices

    SciTech Connect

    Not Available


    This Primer is designed for use by operations and maintenance personnel to improve their knowledge of tritium safe handling practices. It is applicable to many job classifications and can be used as a reference for classroom work or for self-study. It is presented in general terms for use throughout the DOE Complex. After reading it, one should be able to: describe methods of measuring airborne tritium concentration; list types of protective clothing effective against tritium uptake from surface and airborne contamination; name two methods of reducing the body dose after a tritium uptake; describe the most common method for determining amount of tritium uptake in the body; describe steps to take following an accidental release of airborne tritium; describe the damage to metals that results from absorption of tritium; explain how washing hands or showering in cold water helps reduce tritium uptake; and describe how tritium exchanges with normal hydrogen in water and hydrocarbons.

  20. Formaldehyde as hypothetical primer of biohomochirality

    SciTech Connect

    Goldanskii, V.I.


    One of the most intriguing and crucial problems of the prebiotic evolution and the origin of life is the explanation of the origin of biohomochirality. A scheme of conversions originated by formaldehyde (FA) as hypothetical primer of biohomochirality is proposed. The merit of FA as executor of this function is based -inter alia - on the distinguished role of FA as one of the earliest and simplest molecules in both warm, terrestrial and cold, extraterrestrial scenarios of the origin of life. The confirmation of the role of FA as primer of biohomochirality would support the option of an RNA world as an alternative to the protein world. The suggested hypothesis puts forward for the first time a concrete sequence of chemical reactions which can lead to biohomochirality. The spontaneous breaking of the mirror symmetry is secured by the application of the well-known Frank scheme (combination of autocatalysis and {open_quote}{open_quote}annihilation{close_quote}{close_quote} of L and D enantiomers) to the series of interactions of FA {open_quote}{open_quote}trimers{close_quote}{close_quote} (i.e. C{sub 3}H{sub 6}O{sub 3} compounds) of (aaa), (apa) and (app) types, where the monomeric groups (a) means {open_quote}{open_quote}achirons{close_quote}{close_quote} (a=CH{sub n}, n{ge}2 and C=M, M=C,O) and (p) mean {open_quote}{open_quote}prochirons{close_quote}{close_quote} (p=HC{asterisk}OM, M=H,C). {copyright} {ital 1996 American Institute of Physics.}

  1. The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.

    ERIC Educational Resources Information Center

    Zellweger, Polle T.; Mackinlay, Jock D.

    A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

  2. A Primer for the NEWBASIC/CATALYST System.

    ERIC Educational Resources Information Center

    Dwyer, Thomas A.; And Others

    Assuming no previous experience with computers, this primer is designed to help students, teachers, scientists, and other scholars to learn how to use the NEWBASIC/CATALYST system (NBS). The primer contains nine sections: (1) instructions for establishing contact with the computer (logging on); (2) examples and problems to lead the student through…

  3. Uncoupling primer and releaser responses to pheromone in honey bees

    NASA Astrophysics Data System (ADS)

    Grozinger, Christina M.; Fischer, Patrick; Hampton, Jacob E.


    Pheromones produce dramatic behavioral and physiological responses in a wide variety of species. Releaser pheromones elicit rapid responses within seconds or minutes, while primer pheromones produce long-term changes which may take days to manifest. Honeybee queen mandibular pheromone (QMP) elicits multiple distinct behavioral and physiological responses in worker bees, as both a releaser and primer, and thus produces responses on vastly different time scales. In this study, we demonstrate that releaser and primer responses to QMP can be uncoupled. First, treatment with the juvenile hormone analog methoprene leaves a releaser response (attraction to QMP) intact, but modulates QMP’s primer effects on sucrose responsiveness. Secondly, two components of QMP (9-ODA and 9-HDA) do not elicit a releaser response (attraction) but are as effective as QMP at modulating a primer response, downregulation of foraging-related brain gene expression. These results suggest that different responses to a single pheromone may be produced via distinct pathways.

  4. Moisture insensitive primer: A myth or truth

    PubMed Central

    Shukla, Chandresh; Maurya, Rajkumar; Jain, Upendra; Gupta, Ankur; Garg, Jayshree


    Objectives: To compare the mean shear bond strength (SBS) of moisture insensitive primer (MIP) used for orthodontic bonding in the presence and absence of saliva. Materials and Methods: A total of 60 human noncarious maxillary premolars with sound buccal surfaces, recently extracted were collected in two groups of each 30. Maxillary premolar brackets were bonded to the teeth using light cure (Transbond XT, 3M Unitek, Monrovia, CA, USA) and MIP (Transbond MIP 3M Unitek, Monrovia, CA, USA,) in the presence and absence of saliva. Operators’ saliva was used during the bonding under moist condition. After debonding, all the specimens were examined under a stereomicroscope (×40 magnification) for adhesive remnant using adhesive remnant index (ARI). The SBS tests were done using Instron universal testing machine at cross-head speed of 1 mm/min, force passing parallel to the buccal surface using custom rod and registered in Newtons later converted into Megapascals. Results: Light cure and MIP (Transbond MIP and Transbond XT, 3M Unitek, Monrovia, CA, USA) in the absence of saliva showed higher mean SBS than the presence of saliva. Group I (light cure and MIP) in the absence of saliva showed mean SBS of 9.65 ± 0.90 Mpa. Group II (light cure and MIP) with the presence of saliva showed mean SBS of 9.03 ± 1.14 Mpa. The difference between both the groups was statistically significant, as confirmed by paired t-test (P < 0.05). In-Group I, ARI scores showed that more than half of the adhesive was left over the tooth surface, and Group II showed that there was no or insignificant amount of adhesive left over the tooth surface. Chi-square test revealed significant difference in debonding characteristics among the test groups of ARI (P < 0.05). Failure occurred mainly in resin– bracket base and resin – adhesive interfaces (χ² = 10.04, df = 3, P = 0.031). Conclusion: Moisture insensitive primer is effective in the presence/absence of moisture and has shown SBS value of more

  5. Primer on electricity futures and other derivatives

    SciTech Connect

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.


    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  6. Shear bond strength comparison of moisture-insensitive primer and self-etching primer

    PubMed Central

    Goswami, Arunima; Mitali, Borah; Roy, BK


    Context: The detrimental effect of moisture on orthodontic bonding has long been known. Hydrophilic bonding materials have been introduced suggesting the possibility of obtaining successful orthodontic bonding to a moisture contaminated enamel surface. Aims: This study has been performed with an aim to compare the in vitro shear bond strength (SBS) and debonding characteristic of moisture-insensitive primer (MIP) (Transbond MIP) (3M Unitek, South Peck Road, Monrovia, California, USA) and self-etching primer (SEP) (Transbond Plus SEP) (3M Unitek, South Peck Road, Monrovia, California, USA) in combination with a color changing adhesive system (Transbond Plus Color Change) (3M Unitek, South Peck Road, Monrovia, California, USA) under both dry and contaminated condition. Settings and Design: Randomized controlled clinical study. Subjects and Methods: One hundred and twenty freshly extracted teeth for the purpose of orthodontic treatment were collected. Teeth were randomly assigned into four groups, each consisting of 30 specimen and stainless steel brackets were bonded using each primer-adhesive combination under different enamel conditions, that is, dry and enamel contaminated with natural saliva. SBS and adhesive remnant index were calculated for each group. Results: Analysis of variance of SBS for both MIP and SEP under dry and contaminated condition showed no statistical significance (P = 0.5). Chi-square test showed significant difference in debonding characteristics among the test groups (P < 0.001). All the groups showed typical debonding characteristics of separation either at the bracket-adhesive interface or within the adhesive itself. Conclusions: Moisture contamination did not affect the SBS and adhesive remaining on tooth for both MIP and SEP. PMID:25143933

  7. Plastid primers for angiosperm phylogenetics and phylogeography1

    PubMed Central

    Prince, Linda M.


    Premise of the study: PCR primers are available for virtually every region of the plastid genome. Selection of which primer pairs to use is second only to selection of the genic region. This is particularly true for research at the species/population interface. Methods: Primer pairs for 130 regions of the chloroplast genome were evaluated in 12 species distributed across the angiosperms. Likelihood of amplification success was inferred based upon number and location of mismatches to target sequence. Intraspecific sequence variability was evaluated under three different criteria in four species. Results: Many published primer pairs should work across all taxa sampled, with the exception of failure due to genomic reorganization events. Universal barcoding primers were the least likely to work (65% success). The list of most variable regions for use within species has little in common with the lists identified in prior studies. Discussion: Published primer sequences should amplify a diversity of flowering plant DNAs, even those designed for specific taxonomic groups. “Universal” primers may have extremely limited utility. There was little consistency in likelihood of amplification success for any given publication across lineages or within lineage across publications. PMID:26082876

  8. PD5: A General Purpose Library for Primer Design Software

    PubMed Central

    Riley, Michael C.; Aubrey, Wayne; Young, Michael; Clare, Amanda


    Background Complex PCR applications for large genome-scale projects require fast, reliable and often highly sophisticated primer design software applications. Presently, such applications use pipelining methods to utilise many third party applications and this involves file parsing, interfacing and data conversion, which is slow and prone to error. A fully integrated suite of software tools for primer design would considerably improve the development time, the processing speed, and the reliability of bespoke primer design software applications. Results The PD5 software library is an open-source collection of classes and utilities, providing a complete collection of software building blocks for primer design and analysis. It is written in object-oriented C++ with an emphasis on classes suitable for efficient and rapid development of bespoke primer design programs. The modular design of the software library simplifies the development of specific applications and also integration with existing third party software where necessary. We demonstrate several applications created using this software library that have already proved to be effective, but we view the project as a dynamic environment for building primer design software and it is open for future development by the bioinformatics community. Therefore, the PD5 software library is published under the terms of the GNU General Public License, which guarantee access to source-code and allow redistribution and modification. Conclusions The PD5 software library is downloadable from Google Code and the accompanying Wiki includes instructions and examples: PMID:24278254

  9. A physicists guide to The Los Alamos Primer

    NASA Astrophysics Data System (ADS)

    Reed, B. Cameron


    In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer, which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons.

  10. PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets

    SciTech Connect

    Gardner, S. N.


    Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether there are also TaqMan/Luminex probe matches within predicted amplicons.

  11. Quantitative PCR measurements of the effects of introducing inosines into primers provides guidelines for improved degenerate primer design.


    Zheng, Linda; Gibbs, Mark J; Rodoni, Brendan C


    Polymerase chain reaction (PCR) is used to detect groups of viruses with the use of group-specific degenerate primers. Inosine residues are sometimes used in the primers to match variable positions within the complementary target sequences, but there is little data on their effects on cDNA synthesis and amplification. A quantitative reverse-transcription PCR was used to measure the rate of amplification with primers containing inosine residues substituted at different positions and in increasing numbers. Experiments were conducted using standard quantities of cloned DNA copied from Potato virus Y genomic RNA and RNA (cRNA) transcribed from the cloned DNA. Single inosine residues had no affect on the amplification rate in the forward primer, except at one position close to the 3' terminus. Conversely, single inosine residues significantly reduced the amplification rate when placed at three out of four positions in the reverse primer. Four or five inosine substitutions could be tolerated with some decline in rates, but amplification often failed from cRNA templates with primers containing larger numbers of inosines. Greater declines in the rate of amplification were observed with RNA templates, suggesting that reverse transcription suffers more than PCR amplification when inosine is included in the reverse primer.

  12. DPPrimer – A Degenerate PCR Primer Design Tool

    PubMed Central

    Gahoi, Shachi; Arya, L; Anil, Rai; Marla, ss


    Designed degenerate primers unlike conventional primers are superior in matching and amplification of large number of genes, from related gene families. DPPrimer tool was designed to predict primers for PCR amplification of homologous gene from related or diverse plant species. The key features of this tool include platform independence and user friendliness in primer design. Embedded features such as search for functional domains, similarity score selection and phylogebetic tree further enhance the user friendliness of DPPrimer tool. Performance of DPPrimer tool was evaluated by successful PCR amplification of ADP-glucose phosphorylase genes from wheat, barley and rice. Availability DPPrimer is freely accessible at PMID:24307773


    EPA Science Inventory

    This primer is designed for brownfields stakeholders concerned about vapor intrusion, including property owners, real estate developers, and contractors performing environmental site investigations. It provides an overview of the vapor intrusion issue and how it can impact the ap...

  14. Best Development Practices: A Primer for Smart Growth

    EPA Pesticide Factsheets

    Best Development Practices: A Primer for Smart Growth lists specific practices to achieve development principles that mix land uses, support transportation options, protect natural systems, and provide housing choices.

  15. 20. BUILDINGS 243247. PRIMER DRYHOUSES. HEATING LAYOUT. October 16, 1917 ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    20. BUILDINGS 243-247. PRIMER DRYHOUSES. HEATING LAYOUT. October 16, 1917 - Frankford Arsenal, Building Nos. 242-246A, South side Craig Road between Eakin & Walbach Streets, Philadelphia, Philadelphia County, PA


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    13. BUILDING 239. ARTILLERY PRIMER SHOP. ADDITIONS AND ALTERATIONS. FIRST FLOOR PLAN AND ELEVATIONS. May 12, 1920. - Frankford Arsenal, Building Nos. 239-239A, Southeast corner of Clay Street & Cray Road, Philadelphia, Philadelphia County, PA

  17. 19. BUILDINGS 243247. PRIMER DRYHOUSES. BUILDING LAYOUT. February 16, 1917 ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    19. BUILDINGS 243-247. PRIMER DRYHOUSES. BUILDING LAYOUT. February 16, 1917 - Frankford Arsenal, Building Nos. 242-246A, South side Craig Road between Eakin & Walbach Streets, Philadelphia, Philadelphia County, PA

  18. 18. BUILDING 243247. PRIMER DRYHOUSES. GENERAL LAYOUT. February 16, 1917 ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    18. BUILDING 243-247. PRIMER DRYHOUSES. GENERAL LAYOUT. February 16, 1917 - Frankford Arsenal, Building Nos. 242-246A, South side Craig Road between Eakin & Walbach Streets, Philadelphia, Philadelphia County, PA

  19. PCR Primers for identification of high sucrose Saccharum genotypes.


    Vinayak, Vandana; Dhawan, Ashok K; Gupta, V K


    The progeny of a cross between high sucrose sugarcane clone S. officinarum 'Gungera' and a low sucrose clone S. spontaneum 'SES 603' resulted in interspecific hybrids that were named as ISH-1 to ISH-29 and graded on the basis of sucrose content. Hybrids ISH-1, ISH-5, ISH-17 and ISH-23 were selected as very high sucrose (65 to 100 mg/g tissue) genotypes, whereas ISH-10, ISH-11, ISH-12 and ISH-25 were very low sucrose (2 to 25 mg/g tissue) genotypes. DNA from leaves of both the parent clones, as also the progeny hybrids, was amplified using selected primers, in order to identify markers for sucrose content. Ten specific primers were examined: primers 'A' and 'B' that detect polymorphism in promoter region of sucrose synthase-2 gene; primers AI, SS and SPS that were designed on the basis of nucleotide sequences of genes for acid invertase, sucrose synthase and sucrose phosphate synthase enzymes, respectively and primers MSSCIR43, MSSCIRI, SMC226CG, SMC1039CG and SCB07 selected for relation to sucrose accumulation process. DNA products specific to low or high sucrose clones were identified. Primer 'A' and AI amplified DNA products of size 230 and 500 bp, respectively only in high sucrose genotypes ('Gungera', ISH-1, ISH-5, ISH-17 and ISH-23), while primer SMC226CG generated a DNA product of size 920 bp only in low sucrose genotypes ('SES 603', ISH-10, ISH-11, ISH-12 and ISH-25). Ten random decamer primers were also examined, but their products did not show relationship to sucrose content of genotypes.

  20. PrecisePrimer: an easy-to-use web server for designing PCR primers for DNA library cloning and DNA shuffling.


    Pauthenier, Cyrille; Faulon, Jean-Loup


    PrecisePrimer is a web-based primer design software made to assist experimentalists in any repetitive primer design task such as preparing, cloning and shuffling DNA libraries. Unlike other popular primer design tools, it is conceived to generate primer libraries with popular PCR polymerase buffers proposed as pre-set options. PrecisePrimer is also meant to design primers in batches, such as for DNA libraries creation of DNA shuffling experiments and to have the simplest interface possible. It integrates the most up-to-date melting temperature algorithms validated with experimental data, and cross validated with other computational tools. We generated a library of primers for the extraction and cloning of 61 genes from yeast DNA genomic extract using default parameters. All primer pairs efficiently amplified their target without any optimization of the PCR conditions.

  1. Polymerization behavior of Klenow fragment and Taq DNA polymerase in short primer extension reactions.


    Zhao, Guojie; Guan, Yifu


    DNA polymerases amplify DNA fragments through primer extension reactions. However, polymerization behavior of short primers in the primer extension process has not been systematically explored. In this study, we examined the minimal primer length required for primer extension, and the effect of primer length, mismatches and other conditions on DNA polymerization using a non-radioactive method. Under the condition we conducted, the shortest primers polymerized by Klenow fragment (KF) and Taq DNA polymerase in our experiments were respectively heptamer and octamer. The extension efficiency was also affected by the up-stream overhanging structure of the primer-template complex. We hypothesized a simple model to interpret these observations based on the polymerase structures. Furthermore, it was found that the longer the primer, the more efficient is the primer extension. These polymerization behavior of short primers lay foundation about DNA polymerization mechanism and development of novel nucleic acid detection assays.

  2. TSUNAMI Primer: A Primer for Sensitivity/Uncertainty Calculations with SCALE

    SciTech Connect

    Rearden, Bradley T; Mueller, Don; Bowman, Stephen M; Busch, Robert D.; Emerson, Scott


    This primer presents examples in the application of the SCALE/TSUNAMI tools to generate k{sub eff} sensitivity data for one- and three-dimensional models using TSUNAMI-1D and -3D and to examine uncertainties in the computed k{sub eff} values due to uncertainties in the cross-section data used in their calculation. The proper use of unit cell data and need for confirming the appropriate selection of input parameters through direct perturbations are described. The uses of sensitivity and uncertainty data to identify and rank potential sources of computational bias in an application system and TSUNAMI tools for assessment of system similarity using sensitivity and uncertainty criteria are demonstrated. Uses of these criteria in trending analyses to assess computational biases, bias uncertainties, and gap analyses are also described. Additionally, an application of the data adjustment tool TSURFER is provided, including identification of specific details of sources of computational bias.

  3. Complex Adaptive System of Systems (CASoS) Engineering Applications. Version 1.0.

    SciTech Connect

    Linebarger, John Michael; Maffitt, S. Louise; Glass, Robert John, Jr.; Beyeler, Walter Eugene; Brown, Theresa Jean; Ames, Arlo Leroy


    Complex Adaptive Systems of Systems, or CASoS, are vastly complex eco-socio-economic-technical systems which we must understand to design a secure future for the nation and the world. Perturbations/disruptions in CASoS have the potential for far-reaching effects due to highly-saturated interdependencies and allied vulnerabilities to cascades in associated systems. The Phoenix initiative approaches this high-impact problem space as engineers, devising interventions (problem solutions) that influence CASoS to achieve specific aspirations. CASoS embody the world's biggest problems and greatest opportunities: applications to real world problems are the driving force of our effort. We are developing engineering theory and practice together to create a discipline that is grounded in reality, extends our understanding of how CASoS behave, and allows us to better control those behaviors. Through application to real-world problems, Phoenix is evolving CASoS Engineering principles while growing a community of practice and the CASoS engineers to populate it.

  4. Phoenix : Complex Adaptive System of Systems (CASoS) engineering version 1.0.

    SciTech Connect

    Moore, Thomas W.; Quach, Tu-Thach; Detry, Richard Joseph; Conrad, Stephen Hamilton; Kelic, Andjelka; Starks, Shirley J.; Beyeler, Walter Eugene; Brodsky, Nancy S.; Verzi, Stephen J.; Brown, Theresa Jean; Glass, Robert John, Jr.; Sunderland, Daniel J.; Mitchell, Michael David; Ames, Arlo Leroy; Maffitt, S. Louise; Finley, Patrick D.; Russell, Eric Dean; Zagonel, Aldo A.; Reedy, Geoffrey E.; Mitchell, Roger A.; Corbet, Thomas Frank, Jr.; Linebarger, John Michael


    Complex Adaptive Systems of Systems, or CASoS, are vastly complex ecological, sociological, economic and/or technical systems which we must understand to design a secure future for the nation and the world. Perturbations/disruptions in CASoS have the potential for far-reaching effects due to pervasive interdependencies and attendant vulnerabilities to cascades in associated systems. Phoenix was initiated to address this high-impact problem space as engineers. Our overarching goals are maximizing security, maximizing health, and minimizing risk. We design interventions, or problem solutions, that influence CASoS to achieve specific aspirations. Through application to real-world problems, Phoenix is evolving the principles and discipline of CASoS Engineering while growing a community of practice and the CASoS engineers to populate it. Both grounded in reality and working to extend our understanding and control of that reality, Phoenix is at the same time a solution within a CASoS and a CASoS itself.

  5. Complex Adaptive Systems of Systems (CASoS) engineering and foundations for global design.

    SciTech Connect

    Brodsky, Nancy S.; Finley, Patrick D.; Beyeler, Walter Eugene; Brown, Theresa Jean; Linebarger, John Michael; Moore, Thomas W.; Glass, Robert John, Jr.; Maffitt, S. Louise; Mitchell, Michael David; Ames, Arlo Leroy


    Complex Adaptive Systems of Systems, or CASoS, are vastly complex ecological, sociological, economic and/or technical systems which must be recognized and reckoned with to design a secure future for the nation and the world. Design within CASoS requires the fostering of a new discipline, CASoS Engineering, and the building of capability to support it. Towards this primary objective, we created the Phoenix Pilot as a crucible from which systemization of the new discipline could emerge. Using a wide range of applications, Phoenix has begun building both theoretical foundations and capability for: the integration of Applications to continuously build common understanding and capability; a Framework for defining problems, designing and testing solutions, and actualizing these solutions within the CASoS of interest; and an engineering Environment required for 'the doing' of CASoS Engineering. In a secondary objective, we applied CASoS Engineering principles to begin to build a foundation for design in context of Global CASoS

  6. PCR Primers for Metazoan Mitochondrial 12S Ribosomal DNA Sequences

    PubMed Central

    Machida, Ryuji J.; Kweskin, Matthew; Knowlton, Nancy


    Background Assessment of the biodiversity of communities of small organisms is most readily done using PCR-based analysis of environmental samples consisting of mixtures of individuals. Known as metagenetics, this approach has transformed understanding of microbial communities and is beginning to be applied to metazoans as well. Unlike microbial studies, where analysis of the 16S ribosomal DNA sequence is standard, the best gene for metazoan metagenetics is less clear. In this study we designed a set of PCR primers for the mitochondrial 12S ribosomal DNA sequence based on 64 complete mitochondrial genomes and then tested their efficacy. Methodology/Principal Findings A total of the 64 complete mitochondrial genome sequences representing all metazoan classes available in GenBank were downloaded using the NCBI Taxonomy Browser. Alignment of sequences was performed for the excised mitochondrial 12S ribosomal DNA sequences, and conserved regions were identified for all 64 mitochondrial genomes. These regions were used to design a primer pair that flanks a more variable region in the gene. Then all of the complete metazoan mitochondrial genomes available in NCBI's Organelle Genome Resources database were used to determine the percentage of taxa that would likely be amplified using these primers. Results suggest that these primers will amplify target sequences for many metazoans. Conclusions/Significance Newly designed 12S ribosomal DNA primers have considerable potential for metazoan metagenetic analysis because of their ability to amplify sequences from many metazoans. PMID:22536450

  7. Initialization of Formation Flying Using Primer Vector Theory

    NASA Technical Reports Server (NTRS)

    Mailhe, Laurie; Schiff, Conrad; Folta, David


    In this paper, we extend primer vector analysis to formation flying. Optimization of the classical rendezvous or free-time transfer problem between two orbits using primer vector theory has been extensively studied for one spacecraft. However, an increasing number of missions are now considering flying a set of spacecraft in close formation. Missions such as the Magnetospheric MultiScale (MMS) and Leonardo-BRDF (Bidirectional Reflectance Distribution Function) need to determine strategies to transfer each spacecraft from the common launch orbit to their respective operational orbit. In addition, all the spacecraft must synchronize their states so that they achieve the same desired formation geometry over each orbit. This periodicity requirement imposes constraints on the boundary conditions that can be used for the primer vector algorithm. In this work we explore the impact of the periodicity requirement in optimizing each spacecraft transfer trajectory using primer vector theory. We first present our adaptation of primer vector theory to formation flying. Using this method, we then compute the AV budget for each spacecraft subject to different formation endpoint constraints.

  8. Primer design for PCR reactions in forensic biology.


    Elkins, Kelly M


    The polymerase chain reaction (PCR) is a popular method to copy DNA in vitro. Its invention revolutionized fields ranging from clinical medicine to anthropology, molecular biology, and forensic biology. The method employs one of many available heat-stable DNA polymerases in a reaction that is repeated many times in situ. The DNA polymerase reads a template DNA strand and using the components of the reaction mix, catalyzes the addition of free 2'-deoxynucleotide triphosphate nitrogenous bases to short segment of DNA that forms a complement with the template via Watson-Crick base pairing. This short segment of DNA is referred to as a PCR primer and it is essential to the success of the reaction. The most widely used application of PCR in forensic labs is the amplification of short tandem repeat (STR) loci used in DNA typing. The STRs are routinely evaluated in concert with 16 or more reactions, a multiplex, run in one test tube simultaneously. In a multiplex, it is essential that the primers work specifically and accurately on the intended reactions without hindering the other reactions. The primers, which are very specific, also can be used to probe single nucleotide polymorphisms (SNPs) in a DNA sequence of interest by single base extension. Primers are often designed using one of many available automated software packages. Here the process of manually designing PCR primers for forensic biology using no-cost software is described.

  9. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    SciTech Connect

    Bowman, Stephen M


    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  10. ConservedPrimers 2.0: A high-throughput pipeline for comparative genome referenced intron-flanking PCR primer design and its application in wheat SNP discovery

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In some genomic applications it is necessary to design large numbers of PCR primers in exons flanking one or several introns on the basis of orthologous gene sequences in related species. The primer pairs designed by this target gene approach are called "intron-flanking primers" or because they ar...

  11. New cyt b gene universal primer set for forensic analysis.


    Lopez-Oceja, A; Gamarra, D; Borragan, S; Jiménez-Moreno, S; de Pancorbo, M M


    Analysis of mitochondrial DNA, and in particular the cytochrome b gene (cyt b), has become an essential tool for species identification in routine forensic practice. In cases of degraded samples, where the DNA is fractionated, universal primers that are highly efficient for the amplification of the target region are necessary. Therefore, in the present study a new universal cyt b primer set with high species identification capabilities, even in samples with highly degraded DNA, has been developed. In order to achieve this objective, the primers were designed following the alignment of complete sequences of the cyt b from 751 species from the Class of Mammalia listed in GenBank. A highly variable region of 148bp flanked by highly conserved sequences was chosen for placing the primers. The effectiveness of the new pair of primers was examined in 63 animal species belonging to 38 Families from 14 Orders and 5 Classes (Mammalia, Aves, Reptilia, Actinopterygii, and Malacostraca). Species determination was possible in all cases, which shows that the fragment analyzed provided a high capability for species identification. Furthermore, to ensure the efficiency of the 148bp fragment, the intraspecific variability was analyzed by calculating the concordance between individuals with the BLAST tool from the NCBI (National Center for Biotechnological Information). The intraspecific concordance levels were superior to 97% in all species. Likewise, the phylogenetic information from the selected fragment was confirmed by obtaining the phylogenetic tree from the sequences of the species analyzed. Evidence of the high power of phylogenetic discrimination of the analyzed fragment of the cyt b was obtained, as 93.75% of the species were grouped within their corresponding Orders. Finally, the analysis of 40 degraded samples with small-size DNA fragments showed that the new pair of primers permits identifying the species, even when the DNA is highly degraded as it is very common in

  12. A High Temperature Hermetic Primer and a Variable Spring Tester

    SciTech Connect

    Begeal, D.R.


    Percussion primers are used at Sandia to ignite energetic components such as pyrotechnic actuators and thermal batteries. This report describes a High Temperature Hermetic Primer (HTHP) that was developed to replace a previous G16 Percussion Primer Subassembly (Gl6PPS). The ignition mix in these primers is the same as in the discontinued Remington 44G16 (KC1O{sub 3}, SbS{sub 3}, and Ca{sub 2}Si). The HTHP has nearly the same sensitivity as the 44G16 and a significantly lower sensitivity than the G16PPS. In parallel with the HTHP development, we also designed a Variable Spring Tester (VST) to determine percussion primer ignition sensitivity with firing pins that have the same mass as those used in field applications. The tester is capable of accelerating firing pins over a velocity range of 100 to 600 inches per second for pins weighing up to 6 grams. The desired impulse can be preselected with an accuracy of better than {plus_minus}1%. The actual impulse is measured on every shot. The VST was characterized using the WW42Cl primer, as well as with the G16PPS and the HTHP. Compared to data from conventional ball drop testers, we found that ignition sensitivities were lower and there was less scatter in the sensitivity data. Our experiments indicate that ignition sensitivity is not strictly energy dependent, but also depends on the rate of deposition, or firing pin velocity in this case. Development results for the HTHP and Variable Spring Tester are discussed and design details are shown.

  13. Selective and universal primers for trematode barcoding in freshwater snails.


    Routtu, J; Grunberg, D; Izhar, R; Dagan, Y; Guttel, Y; Ucko, M; Ben-Ami, F


    Trematodes are significant pathogens of high medical, veterinary, and environmental importance. They are hard to isolate from their intermediate hosts, and their early life stages are difficult to identify morphologically. Therefore, primers were developed for trematodes to create a species barcoding system and allow selective PCR amplification in mixed samples. The specific oligonucleotide primer was universal for trematodes that infected several freshwater snail species in Israel. The diagnostic tool is based on the 18S rDNA gene. In contrast to morphological identification, trematode barcoding is rapid as it is based on a sequence of only 800 bp, and it classifies species accurately due to high polymorphism between conserved areas.

  14. Novel nuclear intron-spanning primers for Arecaceae evolutionary biology.


    Bacon, Christine D; Feltus, F Alex; Paterson, Andrew H; Bailey, C Donovan


    In this study, 96 nuclear 'conserved intron-scanning primers' were screened across subfamilies the Arecaceae (palms) for potential use in research focused on palm evolutionary biology. Primers were evaluated based on their ability to amplify single polymerase chain reaction products in Arecaceae, the clarity of sequencing reads, and the interspecific variability observed. Ultimately, the results suggest that: (i) seven of the loci are likely to be suitable when comparing non-Arecaceae outgroups and Arecaceae ingroups; (ii) seven loci may be of use when comparing subfamilies of Arecaceae; and (iii) four of the loci may be of use when comparing closely related genera.

  15. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    SciTech Connect

    Lucas, D.S.


    This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

  16. Changes in Rous Sarcoma Virus RNA Secondary Structure near the Primer Binding Site upon tRNATrp Primer Annealing

    PubMed Central

    Morris, Shannon; Leis, Jonathan


    Predicted secondary-structure elements encompassing the primer binding site in the 5′ untranslated region of Rous sarcoma virus (RSV) RNA play an integral role in multiple viral replications steps including reverse transcription, DNA integration, and RNA packaging (A. Aiyar, D. Cobrinik, Z. Ge, H. J. Kung, and J. Leis, J. Virol. 66:2464–2472, 1992; D. Cobrinik, A. Aiyar, Z. Ge, M. Katzman, H. Huang, and J. Leis, J. Virol. 65:3864–3872, 1991; J. T. Miller, Z. Ge, S. Morris, K. Das, and J. Leis, J. Virol. 71:7648–7656, 1997). These elements include the U5-Leader stem, U5-IR stem-loop, and U5-TΨC interaction region. Limited digestion of the 5′ untranslated region of wild-type and mutant RSV RNAs with structure- and/or sequence-specific RNases detects the presence of the U5-Leader stem and the U5-IR stem-loop. When a tRNATrp primer is annealed to wild-type RNAs in vitro, limited nuclease mapping indicates that the U5-IR stem becomes partially unwound. This is not observed when mutant RNAs with altered U5-IR stem-loop structures are substituted for wild-type RNAs. The U5-Leader stem also becomes destabilized when the tRNA primer is annealed to either wild-type or mutant RNA fragments. Nuclease mapping studies of tRNATrp, as well as the viral RNA, indicate that the U5-TΨC helix does form in vitro upon primer annealing. Collectively, these data suggest that the various structural elements near the RSV primer binding site undergo significant changes during the process of primer annealing. PMID:10400722

  17. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer.

    PubMed Central

    Lund, A H; Duch, M; Lovmand, J; Jørgensen, P; Pedersen, F S


    Reverse transcription of retroviral genomes is primed by a tRNA annealed to an 18-nucleotide primer binding site. Here, we present a primer complementation system to study molecular interaction of the replication machinery with the primer and primer binding site in vivo. Introduction of eight base substitutions into the primer binding site of a murine leukemia virus-based vector allowed efficient RNA encapsidation but resulted in severely reduced vector replication capacity. Replication was restored upon complementation with a synthetic gene designed to encode a complementary tRNA-like primer, but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology. PMID:8995641

  18. Blood Donation and Transfusion: A Primer for Health Educators.

    ERIC Educational Resources Information Center

    Felts, W. Michael; Glascoff, Mary A.


    Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)

  19. Factor Scores, Structure and Communality Coefficients: A Primer

    ERIC Educational Resources Information Center

    Odum, Mary


    (Purpose) The purpose of this paper is to present an easy-to-understand primer on three important concepts of factor analysis: Factor scores, structure coefficients, and communality coefficients. Given that statistical analyses are a part of a global general linear model (GLM), and utilize weights as an integral part of analyses (Thompson, 2006;…

  20. STITCHER 2.0: primer design for overlapping PCR applications.


    O'Halloran, Damien M; Uriagereka-Herburger, Isabel; Bode, Katrin


    Overlapping polymerase chain reaction (PCR) is a common technique used by researchers in very diverse fields that enables the user to 'stitch' individual pieces of DNA together. Previously, we have reported a web based tool called STITCHER that provides a platform for researchers to automate the design of primers for overlapping PCR applications. Here we present STITCHER 2.0, which represents a substantial update to STITCHER. STITCHER 2.0 is a newly designed web tool that automates the design of primers for overlapping PCR. Unlike STITCHER, STITCHER 2.0 considers diverse algorithmic parameters, and returns multiple result files that include a facility for the user to draw their own primers as well as comprehensive visual guides to the user's input, output, and designed primers. These result files provide greater control and insight during experimental design and troubleshooting. STITCHER 2.0 is freely available to all users without signup or login requirements and can be accessed at the following webpage:

  1. The development, characterization and testing of magnesium-rich primers

    NASA Astrophysics Data System (ADS)

    Battocchi, Dante

    Aluminum alloys are widely used in aircraft industry for their strength and light weight. Those alloys that are hardened by precipitation, especially the Copper-rich of the 2000 series, are prone to corrosion and are protected against it using chromate containing coatings. The primary component of these coating systems is Chromium 6+ (CrVI) that has been found to be very toxic in the environment and carcinogenic, toxic and mutagenic in humans. The Mg-rich primer development is the result of a successful multi-year project funded by the US Air-force with its objective the replacement of coatings based on CrVI with a class of coatings less toxic and with comparable protective performances. The Mg rich primer fulfilled the USAF requirements and it is currently undergoing commercial and military qualifications testing. The use of Mg as one of the active pigments in coatings allows the primer to protect the underlying Al sacrificially, not considered possible for this substrate until now. Mg is anodic to most of the other structural metals and when particulate Mg became available commercially, the concept of the primer was first developed by analogy to Zn-rich coatings for steel. When Mg and Al are in contact and immersed in a corrosive environment, magnesium corrodes preferentially and protects the aluminum.

  2. Deeper Learning: A Primer for State Legislators. ECS Education Trends

    ERIC Educational Resources Information Center

    Aragon, Stephanie


    A growing number of schools across the country are working hard to provide a "deeper" learning experience for their students, and state legislators are being asked to create policies that support wide-scale implementation of 21st century learning practices. This primer is created for state policymakers seeking to modify instruction and…

  3. Children on Medication: A Primer for School Personnel.

    ERIC Educational Resources Information Center

    Gadow, Kenneth D.

    Intended as a primer for school personnel, the book discusses children whose various disorders require them to be on medication, and describes the behavioral effects of these drugs along with their major side effects. Fundamental concepts in pharmacotherapy are reviewed, including dosage adjustment and side effects, and a brief introduction to the…

  4. Improved primer for bonding polyurethane adhesives to metals

    NASA Technical Reports Server (NTRS)

    Constanza, L. J.


    Primer ensures effective bonding integrity of polyurethane adhesives on metal surfaces at temperatures ranging from minus 423 degrees to plus 120 degrees F. It provides greater metal surface protection and bond strengths over this temperature range than could be attained with other adhesive systems.

  5. Wash Primer Replacement Based on the Superprimer Technology

    DTIC Science & Technology


    wash primer on  CRS  under military primers  and a CARC topcoat ( creep  in mm)   Table 19. SST and CCT test results for AU­23 and modified versions as a...wash primer on  CRS   under epoxy primers and a CARC topcoat ( creep  in mm)   Table 20. SST and CCT test results for EPZ­0 and EPZ­1 on  CRS  under epoxy... alloys , that is completely devoid of  Cr (VI), HAPs, phosphoric acid  and has low VOC, without sacrificing corrosion protection  performance under

  6. A Primer on Individualized Education Programs for Handicapped Children.

    ERIC Educational Resources Information Center

    Torres, Scottie, Ed.

    Intended to be a practical guide for administrators, teachers, and parents on how to meet the individualized education program (IEP) requirements of Public Law 94-142, the primer provides 10 author contributed chapters to aid the reader in developing, implementing, and monitoring an IEP for every handicapped child. Chapters have the following…

  7. Assessing the Nation's Literacy: A State Policy Primer.

    ERIC Educational Resources Information Center

    National Governors' Association, Washington, DC.

    This primer is designed to provide a step-by-step guide for state policymakers and state agency officials interested in assessing the literacy skills of the people of their state. Chapter 1 describes the importance of assessing the literacy skills in each state. Literacy is discussed as an economic necessity, a requirement for a healthy democracy,…

  8. STITCHER 2.0: primer design for overlapping PCR applications

    PubMed Central

    O’Halloran, Damien M.; Uriagereka-Herburger, Isabel; Bode, Katrin


    Overlapping polymerase chain reaction (PCR) is a common technique used by researchers in very diverse fields that enables the user to ‘stitch’ individual pieces of DNA together. Previously, we have reported a web based tool called STITCHER that provides a platform for researchers to automate the design of primers for overlapping PCR applications. Here we present STITCHER 2.0, which represents a substantial update to STITCHER. STITCHER 2.0 is a newly designed web tool that automates the design of primers for overlapping PCR. Unlike STITCHER, STITCHER 2.0 considers diverse algorithmic parameters, and returns multiple result files that include a facility for the user to draw their own primers as well as comprehensive visual guides to the user’s input, output, and designed primers. These result files provide greater control and insight during experimental design and troubleshooting. STITCHER 2.0 is freely available to all users without signup or login requirements and can be accessed at the following webpage: PMID:28358011


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey


  10. Exploding the Myths about DETC Accreditation: A Primer for Students

    ERIC Educational Resources Information Center

    Distance Education and Training Council, 2011


    Prospective distance education students are faced with a bewildering number of choices in selecting an institution that is best suited to achieving their educational goals. They also face a confusing forest of institutions' promotional claims of being the best or most respected school. This primer is intended to help the prospective student of an…

  11. Sights, Sounds, Senses in Step with Reading. Primer.

    ERIC Educational Resources Information Center

    Norris, Mildred W.; Messerli, John H.

    This Title III bibliography presents books, films, filmstrips, and records that correlate with stories from primers. The list of books is prepared from the suggested lists of the Ginn, Houghton Mifflin, Lippincott, and Scott, Foresman reading series. The bibliography includes sections about animals, birthdays, cowboys, fantasy, helpers, holidays,…

  12. A Primer on Fresh Water: The Environmental Citizenship Series.

    ERIC Educational Resources Information Center

    Environment Canada, Ottawa (Ontario).

    Water is the lifeblood of the environment as no organisms can survive without it. This reference booklet is designed to help people make environmentally responsible decisions. The primer is targeted at the general public (grade 8 to post-secondary) to be used by educators, communities and organizations as well as individuals, as part of a learning…

  13. Depth profiles and free volume in aircraft primer films

    NASA Astrophysics Data System (ADS)

    Van Horn, J. D.; Chen, H.; Jean, Y. C.; Zhang, W.; Jaworowski, M. R.


    Positron annihilation lifetime spectroscopy (PALS) and associated techniques provide non-destructive methods to study the free volume inside polymeric materials, and to study material characteristics over a depth profile. Cast free films of organic- or aqueous-based, non-chromated aerospace primers, when cured for about one week, had very different water vapour transport (through-plane) behaviour. In addition, both types of primer films showed strong anisotropic behaviour in in-plane versus through-plane water vapour transport rates. We report the differences between the organic- and aqueous-based aircraft primer films samples and their surface depth profiles. In bulk PALS measurements, an aged, organic-based film exhibited typical lifetimes and intensities for a particulate-containing polymer film on both faces. In contrast, aqueous-based films exhibited face oriented-dependent differences. In all aqueous- based samples, the I3 value of the back of the sample was smaller. The primer film samples were also evaluated with mono-energetic positron beam techniques to generate depth profile information. The heterogeneity in the samples was verified by Doppler broadening of energy spectroscopy (DBES). A model for the differences in the faces of the films, and their layered structure is discussed.

  14. Method to amplify variable sequences without imposing primer sequences


    Bradbury, Andrew M.; Zeytun, Ahmet


    The present invention provides methods of amplifying target sequences without including regions flanking the target sequence in the amplified product or imposing amplification primer sequences on the amplified product. Also provided are methods of preparing a library from such amplified target sequences.

  15. A Primer on Economics for Financial Aid Professionals.

    ERIC Educational Resources Information Center

    Baum, Sandy

    This primer is intended to provide college financial aid professionals with a background in fundamental areas of economics. Its goal is to provide a stronger understanding of the key principles that shape need analysis systems. Part 1 presents basic economic concepts and discusses their application to college enrollment and student aid. These…

  16. Comparison of three different primer sets for sexing birds.


    Çakmak, Emel; Akın Pekşen, Çiğdem; Bilgin, C Can


    Because many bird species are monomorphic or only sexually dimorphic in adult stages, it is difficult to determine their sexes, which may cause significant problems in population and conservation studies. DNA-based sexing relies on the chromodomain helicase DNA binding ( CHD) gene located on the W chromosome and its homolog on the Z chromosome, giving distinct banding patterns on agarose gel as a result of length differences in intronic regions within this gene. We used 3 specific primer sets, CHD1F/CHD1R, 2550F/2718R, and P2/P8, for sex determination of 230 samples from 77 avian species. We report here the records for 70 of those species analyzed using the CHD1F/CHD1R primer set, and 49 species using 2550F/2718R, and 46 species using P2/P8. CHD1F/CHD1R PCR products on agarose gel generally showed an apparent single band in males and 2 bands in females, but the products of 2550F/2718R (61%) and P2/P8 (42%) showed distinct banding patterns for separate bird orders. However, when PCR products of these last 2 primer pairs labeled with fluorescent dye were run in a capillary gel and detected using a DNA analyzer, P2/P8 gave 2 distinguishable peaks in females, whereas 2550F/2718R results remained the same. DNA sexing with any of those 3 primer sets can be used for all sexually monomorphic avian taxa although the primer sets should be compared before choosing the most efficient one for molecular sexing of the studied species.

  17. primers4clades: a web server that uses phylogenetic trees to design lineage-specific PCR primers for metagenomic and diversity studies.


    Contreras-Moreira, Bruno; Sachman-Ruiz, Bernardo; Figueroa-Palacios, Iraís; Vinuesa, Pablo


    Primers4clades is an easy-to-use web server that implements a fully automatic PCR primer design pipeline for cross-species amplification of novel sequences from metagenomic DNA, or from uncharacterized organisms, belonging to user-specified phylogenetic clades or taxa. The server takes a set of non-aligned protein coding genes, with or without introns, aligns them and computes a neighbor-joining tree, which is displayed on screen for easy selection of species or sequence clusters to design lineage-specific PCR primers. Primers4clades implements an extended CODEHOP primer design strategy based on both DNA and protein multiple sequence alignments. It evaluates several thermodynamic properties of the oligonucleotide pairs, and computes the phylogenetic information content of the predicted amplicon sets from Shimodaira-Hasegawa-like branch support values of maximum likelihood phylogenies. A non-redundant set of primer formulations is returned, ranked according to their thermodynamic properties. An amplicon distribution map provides a convenient overview of the coverage of the target locus. Altogether these features greatly help the user in making an informed choice between alternative primer pair formulations. Primers4clades is available at two mirror sites: Three demo data sets and a comprehensive documentation/tutorial page are provided for easy testing of the server's capabilities and interface.

  18. White primer permits a corrosion-resistant coating of minimum weight

    NASA Technical Reports Server (NTRS)

    Albrecht, R. H.; Jensen, D. P.; Schnake, P.


    White primer for coating 2219 aluminum alloy supplies a base for a top coating of enamel. A formulation of pigments and vehicle results in a primer with high corrosion resistance and minimum film thickness.

  19. Generation of polymerase chain reaction-specific probes for library screening using single degenerate primers.


    Hommes, N G; Arp, D J; Sayavedra-Soto, L A


    Degenerate oligonucleotide primers were made to peptide sequences from hydroxylamine oxidoreductase (HAO) from Nitrosomonas europaea. The primers were used singly in PCR reactions to amplify portions of the gene for HAO from genomic DNA. Southern hybridizations using fragments amplified with each primer showed that they labeled the same genomic DNA fragments. The PCR-amplified fragments were successfully used to screen a gene library for clones containing the HAO gene. The method of isolating genes by PCR with single primers has general utility.

  20. New primer strategy improves precision of differential display.


    Zhao, S; Ooi, S L; Pardee, A B


    To increase the reproducibility and to reduce the false positives in the initial mRNA differential display, modified long composite primers were developed based on both mRNA differential display and RNA arbitrarily primed PCR fingerprinting methods. Ten-base nucleotides were added at the 5' ends of the primers used in the initial mRNA differential display. These included a restriction site to aid cloning. PCR began with one low-stringency cycle (40 degrees C for annealing) followed by 35 high-stringency cycles (60 degrees C for annealing). The modified method significantly improved the reproducibility and sensitivity of the mRNA differential display while still keeping the characteristics of the original method.

  1. [Screening of peafowl microsatellite primers and analysis of genetic diversity].


    Bao, Wen-Bin; Chen, Guo-Hong; Shu, Jing-Ting; Xu, Qi; Li, Hui-Fang


    The applicability of chicken microsatellite primers to peafowl population was analyzed in the present paper, and the results showed 14 of 29 pairs of microsatellite primers from chicken could amplify peafowl DNA and produce specific allele patterns. A mean of 1.71 alleles was found for each locus. Seven pairs were highly polymorphic, and MCW0080 and MCW0098 were ideal markers for peafowl. Genetic diversity analysis within and between the green peafowl and the blue peafowl populations demonstrated that the expected heterozygosity of two peafowl populations were 0.2482 and 0.2744, respectively. The inbreeding index (FST), Reynolds' genetic distance and gene flow between the two populations were 0.078, 0.0603 and 3.896 respectively. These results indicate that the heterozygosity and the genetic diversity of these two peafowl populations were very low, and suggest a tendency towards intermixing.

  2. Recombination of polynucleotide sequences using random or defined primers


    Arnold, Frances H.; Shao, Zhixin; Affholter, Joseph A.; Zhao, Huimin; Giver, Lorraine J.


    A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.

  3. Recombination of polynucleotide sequences using random or defined primers


    Arnold, Frances H.; Shao, Zhixin; Affholter, Joseph A.; Zhao, Huimin H; Giver, Lorraine J.


    A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.

  4. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    SciTech Connect

    A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson


    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  5. Primer and interviews: molecular mechanisms of morphological evolution.


    Kiefer, Julie C


    The beauty of the developing embryo, and the awe that it inspires, lure many scientists into the field of developmental biology. What compels cells to divide, migrate, and morph into a being with a complex body plan? Evolutionary developmental biologists hold similar fascinations, with dynamics that take place on a grander timescale. How do phenotypic traits diverge over evolutionary time? This primer illustrates how a deep understanding of the basic principles that underlie developmental biology have changed how scientists think about the evolution of body form. The primer culminates in a conversation with David Stern, PhD, and Michael Shapiro, PhD, who discuss current topics in morphological evolution, why the field should be of interest to classic developmental biologists, and what lies ahead.

  6. Stability of the high-temperature G-16 primer composition

    SciTech Connect

    Durand, N.A.; Weinmaster, R.R.; Massis, T.A.; Fleming, W.


    The stability of the G-16 pyrotechnic primer mixture of antimony sulfide, calcium silicide, and potassium chlorate was studied at temperatures up to 200/sup 0/C in sealed and open environments. Data have shown that this mixture is stable in open environments at 200/sup 0/C for up to 48 hours. However, in sealed, limited volume environments, the mixture completely decomposes within 24 hours at 200/sup 0/C. In sealed environments, the mixture shows stability with copper present. Both functional testing and chemical analysis were used to evaluate the primer composition after temperature exposure. The degree of degradation of the mixture was determined from the concentration of final reaction products (sulfate and chloride ions), using ion chromatography. When copper was present, the intermediate reaction products were scavenged by the copper, and the degradation was reduced. The role of copper in the reaction was verified with differential scanning calorimetry and surface analysis. 3 refs., 9 figs., 2 tabs.

  7. Primer and interviews: Molecular mechanisms of morphological evolution

    PubMed Central

    Kiefer, Julie C


    The beauty of the developing embryo, and the awe that it inspires, lure many scientists into the field of developmental biology. What compels cells to divide, migrate, and morph into a being with a complex body plan? Evolutionary developmental biologists hold similar fascinations, with dynamics that take place on a grander timescale. How do phenotypic traits diverge over evolutionary time? This primer illustrates how a deep understanding of the basic principles that underlie developmental biology have changed how scientists think about the evolution of body form. The primer culminates in a conversation with David Stern, PhD, and Michael Shapiro, PhD, who discuss current topics in morphological evolution, why the field should be of interest to classic developmental biologists, and what lies ahead. Developmental Dynamics 239:3497–3505, 2010. © 2010 Wiley-Liss, Inc. PMID:21069831

  8. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    SciTech Connect

    Bilyard, Gordon R.; Word, Charlotte J.; Weber, James R.; Harding, Anna K.


    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  9. Microsatellite primers for the rare shrub Acacia adinophylla (Fabaceae)1

    PubMed Central

    Nevill, Paul G.; Wardell-Johnson, Grant


    Premise of the study: Microsatellite primers were developed for the rare shrub Acacia adinophylla (Fabaceae) to assess genetic diversity and its spatial structuring. Methods and Results: Shotgun sequencing on an Illumina MiSeq produced 6,372,575 reads. Using the QDD pipeline, we designed 60 primer pairs, which were screened using PCR. Seventeen loci were developed, of which 12 loci were identified that were polymorphic, amplified reliably, and could be consistently scored. These loci were then screened for variation in individuals from three populations. The number of alleles observed for these 12 loci ranged from three to 18 and expected heterozygosity ranged from 0.13 to 0.85. Conclusions: These markers will enable the quantification of genetic impact of proposed mining activities on the short-range endemic Acacia adinophylla. PMID:27843728

  10. Primer on molecular genetics. DOE Human Genome Program

    SciTech Connect

    Not Available


    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  11. Genotypic resistance testing in HIV by arrayed primer extension

    PubMed Central

    Bodem, Jochen; Gerhold-Ay, Aslihan; Jacob, Anette; Fellenberg, Kurt; Kräusslich, Hans-Georg; Hoheisel, Jörg D.


    The analysis of mutations that are associated with the occurrence of drug resistance is important for monitoring the antiretroviral therapy of patients infected with human immunodeficiency virus (HIV). Here, we describe the establishment and successful application of Arrayed Primer Extension (APEX) for genotypic resistance testing in HIV as a rapid and economical alternative to standard sequencing. The assay is based on an array of oligonucleotide primers that are immobilised via their 5′-ends. Upon hybridisation of template DNA, a primer extension reaction is performed in the presence of the four dideoxynucleotides, each labelled with a distinct fluorophore. The inserted label immediately indicates the sequence at the respective position. Any mutation changes the colour pattern. We designed a microarray for the analysis of 26 and 33 codons in the HIV protease and reverse transcriptase, respectively, which are of special interest with respect to drug resistance. The enormous genome variability of HIV represents a big challenge for genotypic resistance tests, which include a hybridisation step, both in terms of specificity and probe numbers. The use of degenerated oligonucleotides resulted in a significant reduction in the number of primers needed. For validation, DNA of 94 and 48 patients that exhibited resistance to inhibitors of HIV protease and reverse transcriptase, respectively, were analysed. The validation included HIV subtype B, prevalent in industrialised countries, as well as non-subtype B samples that are more common elsewhere. Electronic supplementary material The online version of this article (doi:10.1007/s00216-007-1775-0) contains supplementary material, which is available to authorized users. PMID:18202840

  12. A Strategic Planning Primer: Model, Methods, and Misunderstandings

    DTIC Science & Technology


    primer is published in an attempt to org-ani,e and codi fs the Institute’,, strateg ic plaunins, experience. aind to contribute to) the field of know ledge...intended purposes Performing resource analysis and integration. By institutionalizing a formal process such as the PPBES, the Army can ensure that...which locus on organizational strengths, weaknesses, opportunities, and threats. and is often summarized by the acronym SWOT . The thrust of this model is

  13. Ab Initio Atomistic Thermodynamics for Surfaces: A Primer

    DTIC Science & Technology


    Ab Initio Atomistic Thermodynamics for Surfaces: A Primer Jutta Rogal and Karsten Reuter Fritz - Haber -Institut der Max-Planck-Gesellschaft... Fritz - Haber -Institut der Max-Planck-Gesellschaft Faradayweg 4-6 D-14195 Berlin Germany 8. PERFORMING ORGANIZATION REPORT NUMBER 9. SPONSORING...of the Fritz - Haber -Institut, in particular Wei-Xue Li, Cathy Stampfl and Mira Todorova. Particular thanks go to Matthias Scheffler for his continued

  14. Primer on Molecular Genetics; DOE Human Genome Program

    DOE R&D Accomplishments Database


    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  15. Retention of Pre-Construction Primer in Tank Coating System

    DTIC Science & Technology


    topcoats were measured for DFT . 6.3 All topcoats were light colored in ballast tanks based on recommendations by certification/standards agencies...Control of Biofilm Formation in Marine Environment using Some N2O2 Donor Schiff Bases NACE Corrosion 97, Page No. 220 Mar-97 Guan, Shiwei, primer in ship’s ballast tanks. Based on the results of this study, secondary surface preparation should consist of abrasive blast cleaning

  16. Development of a Nonchromate Structural Adhesive Bond Primer

    DTIC Science & Technology


    Prevent corrosion of base metal • Applied to porous anodized surface • Overcoated with non-inhibited epoxy adhesive • High adhesive bond strength...primers •Long-running surveillance of chromate-free alternatives by UTC companies shows weak corrosion inhibition • (A) strontium chromate...solubility of multiple inhibitors 7705 Al / EcoTuff™ After corrosion test Bright deposits: 50 wt% W + Zn mixed oxide 3M Commercial EW5000AS(P) 3M Lab

  17. Small Commercial Building Re-tuning: A Primer

    SciTech Connect

    Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas


    To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

  18. The U.S. Militarys Force Structure: A Primer

    DTIC Science & Technology


    CONGRESS OF THE UNITED STATES CONGRESSIONAL BUDGET OFFICE CBO The U.S. Military’s Force Structure : A Primer JULY 2016 CBONotes Unless otherwise...Military’s Force Structure ? 1 What Does This Analysis Indicate About the Budgetary Effects of Altering the Force Structure ? 4 How Is This Report...Organized? 51 Introduction 7What Is Force Structure ? 8 BOX 1-1. DEFINING SUPPORT UNITS 10 How CBO Estimated the Costs of the Military’s Force Structure 10

  19. Sequence analysis reveals genomic factors affecting EST-SSR primer performance and polymorphism.


    Chen, Chunxian; Bock, Clive H; Beckman, Tom G


    This study was to explore genomic factors affecting the performance and polymorphism of 340 randomly selected EST-SSR (expressed sequence tag-simple sequence repeat) primers through BLAST of primer sequences to a reference genome. Genotyping showed 111 failed and 229 succeeded. The failed types included "no peaks" (NP, 69 primers), "weak peaks" (WP, 30), and "multiple peaks" (MP, 12). The successful types were divided into HM (homozygous between two selected parents, 78 primers) and HT (heterozygous at least in one parent, 151 primers). The BLAST revealed primer alignment status, genomic amplicon size (GAS), and genomic and expressed amplicon size difference (ASD). The alignment status was categorized as: "no hits found" (NHF); "multiple partial alignments" (MPA); "single partial alignment" (SPA); "multiple full alignments" (MFA); and "single full alignment" (SFA). NHF and partial alignment (PA) mainly resulted from discrepant nucleotides in contig-derived primers. The ASD separated 247 non-NHF primers into: "deletion", "same size", "insertion", "intron (GAS ≤500)", "intron (GAS >500)", and "error" categories. Most SFA primers were successful. About 88 % "error", 53 % NHF primers, and 47 % "intron (GAS >500)" failed. The "deletion" and "insertion" primers had the higher HT rates, and the "same size" had the highest HM rate. Optimized primer selection criteria are discussed.

  20. 40 CFR 63.745 - Standards: Primer and topcoat application operations.

    Code of Federal Regulations, 2011 CFR


    .../L (4.5 lb/gal) of primer (less water), as applied, for general aviation rework facilities; or 650 g/L (5.4 lb/gal) of exterior primer (less water), as applied, to large commercial aircraft components... produce fully assembled, large commercial aircraft; or 350 g/L (2.9 lb/gal) of primer (less water),...

  1. 40 CFR 63.745 - Standards: Primer and topcoat application operations.

    Code of Federal Regulations, 2013 CFR


    .../L (4.5 lb/gal) of primer (less water), as applied, for general aviation rework facilities; or 650 g/L (5.4 lb/gal) of exterior primer (less water), as applied, to large commercial aircraft components... produce fully assembled, large commercial aircraft; or 350 g/L (2.9 lb/gal) of primer (less water),...

  2. Design of primers and probes for quantitative real-time PCR methods.


    Rodríguez, Alicia; Rodríguez, Mar; Córdoba, Juan J; Andrade, María J


    Design of primers and probes is one of the most crucial factors affecting the success and quality of quantitative real-time PCR (qPCR) analyses, since an accurate and reliable quantification depends on using efficient primers and probes. Design of primers and probes should meet several criteria to find potential primers and probes for specific qPCR assays. The formation of primer-dimers and other non-specific products should be avoided or reduced. This factor is especially important when designing primers for SYBR(®) Green protocols but also in designing probes to ensure specificity of the developed qPCR protocol. To design primers and probes for qPCR, multiple software programs and websites are available being numerous of them free. These tools often consider the default requirements for primers and probes, although new research advances in primer and probe design should be progressively added to different algorithm programs. After a proper design, a precise validation of the primers and probes is necessary. Specific consideration should be taken into account when designing primers and probes for multiplex qPCR and reverse transcription qPCR (RT-qPCR). This chapter provides guidelines for the design of suitable primers and probes and their subsequent validation through the development of singlex qPCR, multiplex qPCR, and RT-qPCR protocols.

  3. Sensory reception of the primer pheromone ethyl oleate

    NASA Astrophysics Data System (ADS)

    Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang


    Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

  4. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    SciTech Connect

    D. S. Lucas


    A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at

  5. Complex Adaptive Systems of Systems (CASOS) engineering environment.

    SciTech Connect

    Detry, Richard Joseph; Linebarger, John Michael; Finley, Patrick D.; Maffitt, S. Louise; Glass, Robert John, Jr.; Beyeler, Walter Eugene; Ames, Arlo Leroy


    Complex Adaptive Systems of Systems, or CASoS, are vastly complex physical-socio-technical systems which we must understand to design a secure future for the nation. The Phoenix initiative implements CASoS Engineering principles combining the bottom up Complex Systems and Complex Adaptive Systems view with the top down Systems Engineering and System-of-Systems view. CASoS Engineering theory and practice must be conducted together to develop a discipline that is grounded in reality, extends our understanding of how CASoS behave and allows us to better control the outcomes. The pull of applications (real world problems) is critical to this effort, as is the articulation of a CASoS Engineering Framework that grounds an engineering approach in the theory of complex adaptive systems of systems. Successful application of the CASoS Engineering Framework requires modeling, simulation and analysis (MS and A) capabilities and the cultivation of a CASoS Engineering Community of Practice through knowledge sharing and facilitation. The CASoS Engineering Environment, itself a complex adaptive system of systems, constitutes the two platforms that provide these capabilities.

  6. Preliminary Evaluation of the Acute Toxicity of Desensitized Primer Compounds and Primer Waste Effluents to Representative Aquatic Organisims

    DTIC Science & Technology


    daphnids, with 48-hour LC50 values for these two materials being several orders of magnitude lower than those observed for lead styphnate , PETN and... styphnate (PoTNR), tetracene (= tetrazene), pentaerythritol tetranitrate (PETN), .and FA 956 priming mixture. The FA 956 mixture is composed of: 37...PbTNR, 4% tetracene, 5% PETN, 32% barium nitrate, 15% antimony sulfide and 7% aluminum (Small and Rosenblatt, 1974). Each of these primer components was

  7. Recovery of the mitochondrial COI barcode region in diverse Hexapoda through tRNA-based primers

    PubMed Central


    Background DNA barcoding uses a 650 bp segment of the mitochondrial cytochrome c oxidase I (COI) gene as the basis for an identification system for members of the animal kingdom and some other groups of eukaryotes. PCR amplification of the barcode region is a key step in the analytical chain, but it sometimes fails because of a lack of homology between the standard primer sets and target DNA. Results Two forward PCR primers were developed following analysis of all known arthropod mitochondrial genome arrangements and sequence alignment of the tRNA-W gene which was usually located within 200 bp upstream of the COI gene. These two primers were combined with a standard reverse primer (LepR1) to produce a cocktail which generated a barcode amplicon from 125 of 141 species that included representatives of 121 different families of Hexapoda. High quality sequences were recovered from 79% of the species including groups, such as scale insects, that invariably fail to amplify with standard primers. Conclusions A cocktail of two tRNA-W forward primers coupled with a standard reverse primer amplifies COI for most hexapods, allowing characterization of the standard barcode primer binding region in COI 5' as well as the barcode segment. The current results show that primers designed to bind to highly conserved gene regions upstream of COI will aid the amplification of this gene region in species where standard primers fail and provide valuable information to design a primer for problem groups. PMID:20615258

  8. Transferability of retrotransposon primers derived from Persimmon (Diospyros kaki Thunb.) across other plant species.


    Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R


    Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.

  9. Comparison and validation of some ITS primer pairs useful for fungal metabarcoding studies.


    Op De Beeck, Michiel; Lievens, Bart; Busschaert, Pieter; Declerck, Stéphan; Vangronsveld, Jaco; Colpaert, Jan V


    Current metabarcoding studies aiming to characterize microbial communities generally rely on the amplification and sequencing of relatively short DNA regions. For fungi, the internal transcribed spacer (ITS) region in the ribosomal RNA (rRNA) operon has been accepted as the formal fungal barcode. Despite an increasing number of fungal metabarcoding studies, the amplification efficiency of primers is generally not tested prior to their application in metabarcoding studies. Some of the challenges that metabarcoding primers should overcome efficiently are the amplification of target DNA strands in samples rich in non-target DNA and environmental pollutants, such as humic acids, that may have been co-extracted with DNA. In the current study, three selected primer pairs were tested for their suitability as fungal metabarcoding primers. The selected primer pairs include two primer pairs that have been frequently used in fungal metabarcoding studies (ITS1F/ITS2 and ITS3/ITS4) and a primer pair (ITS86F/ITS4) that has been shown to efficiently amplify the ITS2 region of a broad range of fungal taxa in environmental soil samples. The selected primer pairs were evaluated in a 454 amplicon pyrosequencing experiment, real-time PCR (qPCR) experiments and in silico analyses. Results indicate that experimental evaluation of primers provides valuable information that could aid in the selection of suitable primers for fungal metabarcoding studies. Furthermore, we show that the ITS86F/ITS4 primer pair outperforms other primer pairs tested in terms of in silico primer efficiency, PCR efficiency, coverage, number of reads and number of species-level operational taxonomic units (OTUs) obtained. These traits push the ITS86F/ITS4 primer pair forward as highly suitable for studying fungal diversity and community structures using DNA metabarcoding.

  10. Comparison and Validation of Some ITS Primer Pairs Useful for Fungal Metabarcoding Studies

    PubMed Central

    Op De Beeck, Michiel; Lievens, Bart; Busschaert, Pieter; Declerck, Stéphan; Vangronsveld, Jaco; Colpaert, Jan V.


    Current metabarcoding studies aiming to characterize microbial communities generally rely on the amplification and sequencing of relatively short DNA regions. For fungi, the internal transcribed spacer (ITS) region in the ribosomal RNA (rRNA) operon has been accepted as the formal fungal barcode. Despite an increasing number of fungal metabarcoding studies, the amplification efficiency of primers is generally not tested prior to their application in metabarcoding studies. Some of the challenges that metabarcoding primers should overcome efficiently are the amplification of target DNA strands in samples rich in non-target DNA and environmental pollutants, such as humic acids, that may have been co-extracted with DNA. In the current study, three selected primer pairs were tested for their suitability as fungal metabarcoding primers. The selected primer pairs include two primer pairs that have been frequently used in fungal metabarcoding studies (ITS1F/ITS2 and ITS3/ITS4) and a primer pair (ITS86F/ITS4) that has been shown to efficiently amplify the ITS2 region of a broad range of fungal taxa in environmental soil samples. The selected primer pairs were evaluated in a 454 amplicon pyrosequencing experiment, real-time PCR (qPCR) experiments and in silico analyses. Results indicate that experimental evaluation of primers provides valuable information that could aid in the selection of suitable primers for fungal metabarcoding studies. Furthermore, we show that the ITS86F/ITS4 primer pair outperforms other primer pairs tested in terms of in silico primer efficiency, PCR efficiency, coverage, number of reads and number of species-level operational taxonomic units (OTUs) obtained. These traits push the ITS86F/ITS4 primer pair forward as highly suitable for studying fungal diversity and community structures using DNA metabarcoding. PMID:24933453

  11. Studies on the minimal lengths required for DNA primers to be extended by the Tetrahymena telomerase: implications for primer positioning by the enzyme.


    Baran, Nava; Haviv, Yonit; Paul, Beena; Manor, Haim


    Telomerase is a specialized reverse transcriptase that contains an integral RNA subunit including a short template sequence. It extends telomeric 3' overhangs and chromosome breakpoints by catalyzing reiterative copying of this internal template into single-stranded telomeric DNA repeats. Here we report for the first time that in vitro the ciliate Tetrahymena telomerase can efficiently extend very short single-stranded DNA primers (<6 nt). These data indicate that interactions with nucleotides further upstream are not essential for elongation of longer primers. We also report that the minimal lengths required for primers to be extended by the telomerase depend on the positions along the template at which the primers are initially aligned. At a primer concentration of 2.5 micro M, primers aligned in the beginning, middle and next to the end of the template, respectively, must consist of at least 4, 5 and 6 nt to be extended by the telomerase. At a primer concentration of 50 micro M, the corresponding minimal lengths are 3, 4 and 5 nt. The systematic variation of the minimal required primer lengths supports the presence of a site within the telomerase ribonucleoprotein complex that mediates specific positioning of 3' termini of telomeric and non-telomeric DNA in the beginning of the template during telomere synthesis.

  12. Rapid identification of Zygosaccharomyces with genus-specific primers.


    Hulin, Michelle; Wheals, Alan


    There has been a recent and rapid increase in the number of species of the genus Zygosaccharomyces which now comprises Z. bailii, Z. bisporus, Z. gambellarensis, Z. kombuchaensis, Z. lentus, Z. machadoi, Z. mellis, Z. parabaillii, Z. pseudobailii, Z. pseudorouxii, Z. rouxii, Z. sapae, and Z. siamensis. Z. pseudorouxii is an unofficial name given to isolates closely related to the newly-described species Z. sapae. The Zygosaccharomyces genus contains species that are important as food and beverage spoilage organisms and others are associated with fermentations and sweet foodstuffs, such as honey. Their economic significance means that the ability to identify them rapidly is of significant importance. Although Z. rouxii and Z. bailii have been genome-sequenced the extent of sequence data for the others, especially the newly-discovered species, is sometimes extremely limited which makes identification slow. However, parts of the ITS1/5.8S/ITS2 rDNA region contain sequences of sufficient similarity within the genus and of sufficient difference with outgroups, to be potential regions for the design of genus-wide specific primers. We report here the development of genus-specific primers that can detect all the major Zygosaccharomyces species including all those associated with foods; the rare and localised species Z. machadoi and Z. gambellarensis are not detected. The size of the single amplicon produced varies between species and in some cases is sufficiently different to assign provisional species identification. Sequence data from rDNA regions are available for virtually all described yeast species in all genera, thus, prior to having sufficient sequence data from structural genes, rDNA regions may provide more generally suitable candidates for both genus-specific and species-specific primer design.

  13. Shining On: A primer on solar radiation data

    SciTech Connect

    Dunlap, M.A.; Cook, G.; Marion, B.; Riordan, C.; Renne, D.


    This document is a primer on solar radiation data. General uses of solar energy are presented. The manner in which solar radiation data is used to aid engineers in optimizing the use of solar thermal conversion and photovoltaic conversion is discussed. Methods for acquiring and assimilating the solar radiation data are illustrated. This would include the design and use of pyranometers and pyrheliometers. Seasonal and geographical variations in solar flux reaching the earth are evaluated. Other uses of compiled data include the determination of meteorological impacts of atmospheric disturbances such as volcano eruptions.

  14. Steel Primer Chamber Assemblies for Dual Initiated Pyrovalves

    NASA Technical Reports Server (NTRS)

    Guemsey, Carl S.; Mizukami, Masashi; Zenz, Zac; Pender, Adam A.


    A solution was developed to mitigate the potential risk of ignition failures and burn-through in aluminum primer chamber assemblies on pyrovalves. This was accomplished by changing the assembly material from aluminum to steel, and reconfiguration of flame channels to provide more direct paths from initiators to boosters. With the geometric configuration of the channels changed, energy is more efficiently transferred from the initiators to the boosters. With the alloy change to steel, the initiator flame channels do not erode upon firing, eliminating the possibility of burn-through. Flight qualification tests have been successfully passed.

  15. A NASTRAN primer for the analysis of rotating flexible blades

    NASA Technical Reports Server (NTRS)

    Lawrence, Charles; Aiello, Robert A.; Ernst, Michael A.; Mcgee, Oliver G.


    This primer provides documentation for using MSC NASTRAN in analyzing rotating flexible blades. The analysis of these blades includes geometrically nonlinear (large displacement) analysis under centrifugal loading, and frequency and mode shape (normal modes) determination. The geometrically nonlinear analysis using NASTRAN Solution sequence 64 is discussed along with the determination of frequencies and mode shapes using Solution Sequence 63. A sample problem with the complete NASTRAN input data is included. Items unique to rotating blade analyses, such as setting angle and centrifugal softening effects are emphasized.

  16. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    SciTech Connect

    Weber, James R.; Schell, Charlotte J.; Marino, T; Bilyard, Gordon R.


    This version of the communication primer comprises two interlocking parts: Pat 1, a practical section, intended to prepare you for public interactions, and Part 2, a theoretical section that provides social and technical bases for the practices recommended in Part 1. The mutual support of practice and theory is very familiar in science and clearly requires a willingness to observe and revise our prior assumptions--in this document, we invoke both. We hope that is offering will represent a step both towards improving practice and maturing the theory of practical science communication.

  17. Primer for evaluating ecological risk at petroleum release sites.


    Claff, R


    Increasingly, risk-based approaches are being used to guide decision making at sites such as service stations and petroleum product terminals, where petroleum products have been inadvertently released to the soil. For example, the API Decision Support System software, DSS, evaluates site human health risk along six different routes of exposure. The American Society for Testing and Materials' Risk-Based Corrective Action (RBCA) standard, ASTM 1739, establishes a tiered framework for evaluating petroleum release sites on the basis of human health risk. Though much of the risk assessment focus has been on human health risk, regulatory agencies recognize that protection of human health may not fully protect the environment; and EPA has developed guidance on identifying ecological resources to be protected through risk-based decision making. Not every service station or petroleum product terminal site warrants a detailed ecological risk assessment. In some cases, a simple preliminary assessment will provide sufficient information for decision making. Accordingly, the American Petroleum Institute (API) is developing a primer for site managers, to assist them in conducting this preliminary assessment, and in deciding whether more detailed ecological risk assessments are warranted. The primer assists the site manager in identifying relevant ecological receptors and habitats, in identifying chemicals and exposure pathways of concern, in developing a conceptual model of the site to guide subsequent actions, and in identifying conditions that may warrant immediate response.

  18. FullSSR: Microsatellite Finder and Primer Designer

    PubMed Central

    Metz, Sebastián; Cabrera, Juan Manuel; Rueda, Eva; Giri, Federico; Amavet, Patricia


    Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR) loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user. PMID:27366148

  19. Development of a unique polyurethane primer/topcoat

    NASA Technical Reports Server (NTRS)

    Novak, Howard L.; Klotz, James M.


    USBI Company, a Division of Pratt & Whitney Government Engines and Space Propulsion, is involved in corrosion and environmental research and development activities both at their headquarters in Huntsville, Alabama and their Florida Operations at Kennedy Space Center, Florida. The programs involve the development of environmentally compatible materials that improve the corrosion protection of expensive Solid Rocket Boosters (SRB) that are part of the Space Shuttle systems developed and managed by Marshall Space Flight Center in Huntsville, Alabama. Coatings For Industry, a paint manufacturer in Souderton, PA helped formulate and produce the first lot of BOOSTERCOAT paint. High strength aluminum aerospace flight hardware exposed to harsh seacoast environments and seawater immersion presently uses high volatile organic compound (VOC) chromated and lead bearing primers and epoxy topcoats for corrosion protection. Epoxy paint tends to be brittle and has relatively low ultraviolet (UV) exposure resistance. A unique, environmentally compatible, non-leaded/non-chromated, low VOC polyurethane single coat (primer/topcoat) trade named BOOSTERCOAT has been developed for excellent corrosion protection, flexibility, adhesion, chemical and solvent resistance properties. This report will discuss the development of BOOSTERCOAT and the potential opportunities for commercial use in the energy, transportation, chemical, maritime, structural fields.

  20. FullSSR: Microsatellite Finder and Primer Designer.


    Metz, Sebastián; Cabrera, Juan Manuel; Rueda, Eva; Giri, Federico; Amavet, Patricia


    Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR) loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.

  1. Microsatellite primer development for post oak, Quercus stellata (Fagaceae)1

    PubMed Central

    Chatwin, Warren B.; Carpenter, Kyrie K.; Jimenez, Felix R.; Elzinga, Dave B.; Johnson, Leigh A.; Maughan, Peter J.


    • Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata). This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. • Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. • Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants. PMID:25309841

  2. New Primers for Discovering Fungal Diversity Using Nuclear Large Ribosomal DNA

    PubMed Central

    Gloor, Gregory B.; Lindo, Zoë


    Metabarcoding has become an important tool in the discovery of biodiversity, including fungi, which are the second most speciose group of eukaryotes, with diverse and important ecological roles in terrestrial ecosystems. We have designed and tested new PCR primers that target the D1 variable region of nuclear large subunit (LSU) ribosomal DNA; one set that targets the phylum Ascomycota and another that recovers all other fungal phyla. The primers yield amplicons compatible with the Illumina MiSeq platform, which is cost-effective and has a lower error rate than other high throughput sequencing platforms. The new primer set LSU200A-F/LSU476A-R (Ascomycota) yielded 95–98% of reads of target taxa from environmental samples, and primers LSU200-F/LSU481-R (all other fungi) yielded 72–80% of target reads. Both primer sets have fairly low rates of data loss, and together they cover a wide variety of fungal taxa. We compared our results with these primers by amplifying and sequencing a subset of samples using the previously described ITS3_KYO2/ITS4_KYO3 primers, which amplify the internal transcribed spacer 2 (ITS2) of Ascomycota and Basidiomycota. With approximately equivalent read depth, our LSU primers recovered a greater number and phylogenetic diversity of sequences than the ITS2 primers. For instance, ITS3_KYO2/ITS4_KYO3 primers failed to pick up any members of Eurotiales, Mytilinidiales, Pezizales, Saccharomycetales, or Venturiales within Ascomycota, or members of Exobasidiomycetes, Microbotryomycetes, Pucciniomycetes, or Tremellomycetes within Basidiomycota, which were retrieved in good numbers from the same samples by our LSU primers. Among the OTUs recovered using the LSU primers were 127 genera and 28 species that were not obtained using the ITS2 primers, although the ITS2 primers recovered 10 unique genera and 16 species that were not obtained using either of the LSU primers These features identify the new primer sets developed in this study as useful

  3. A Tale of Tails: Dissecting the Enhancing Effect of Tailed Primers in Real-Time PCR

    PubMed Central

    Vandenbussche, Frank; Mathijs, Elisabeth; Lefebvre, David; De Clercq, Kris; Van Borm, Steven


    Non-specific tail sequences are often added to the 5’-terminus of primers to improve the robustness and overall performance of diagnostic assays. Despite the widespread use of tailed primers, the underlying working mechanism is not well understood. To address this problem, we conducted a detailed in vitro and in silico analysis of the enhancing effect of primer tailing on 2 well-established foot-and-mouth disease virus (FMDV) RT-qPCR assays using an FMDV reference panel. Tailing of the panFMDV-5UTR primers mainly affected the shape of the amplification curves. Modelling of the raw fluorescence data suggested a reduction of the amplification efficiency due to the accumulation of inhibitors. In depth analysis of PCR products indeed revealed the rapid accumulation of forward-primer derived artefacts. More importantly, tailing of the forward primer delayed artefacts formation and concomitantly restored the sigmoidal shape of the amplification curves. Our analysis also showed that primer tailing can alter utilisation patterns of degenerate primers and increase the number of primer variants that are able to participate in the reaction. The impact of tailed primers was less pronounced in the panFMDV-3D assay with only 5 out of 50 isolates showing a clear shift in Cq values. Sequence analysis of the target region of these 5 isolates revealed several mutations in the inter-primer region that extend an existing hairpin structure immediately downstream of the forward primer binding site. Stabilisation of the forward primer with either a tail sequence or cationic spermine units restored the sensitivity of the assay, which suggests that the enhancing effect in the panFMDV-3D assay is due to a more efficient extension of the forward primer. ur results show that primer tailing can alter amplification through various mechanisms that are determined by both the assay and target region. These findings expand our understanding of primer tailing and should enable a more targeted and

  4. A sputtered zirconia primer for improved thermal shock resistance of plasma-sprayed ceramic turbine seals

    NASA Technical Reports Server (NTRS)

    Bill, R. C.; Sovey, J.; Allen, G. P.


    It is shown that the application of sputtered Y2O3-stabilized ZrO2 (YSZ) primer in plasma-sprayed YSZ ceramic-coated turbine blades results in an improvement, by a factor of 5-6, in the thermal shock life of specimens with a sprayed, porous, Ni-Cr-Al-Y intermediate layer. Species with and without the primer were found to be able to survive 1000 cycles when the intermediate layer was used, but reduced laminar cracking was observed in the specimen with the primer. It is suggested that the sputtered YZS primer-induced properties are due to (1) more effective wetting and adherence of the plasma-sprayed YZS particles to the primer, and (2) the primer's retardation of impinging, molten plasma sprayed particles solidification rates, which result in a less detrimental residual stress distribution.

  5. Universal multiplexable matK primers for DNA barcoding of angiosperms1

    PubMed Central

    Heckenhauer, Jacqueline; Barfuss, Michael H. J.; Samuel, Rosabelle


    Premise of the study: PCR amplification of the matK barcoding region is often difficult when dealing with multiple angiosperm families. We developed a primer cocktail to amplify this region efficiently across angiosperm diversity. Methods and Results: We developed 14 matK primers (seven forward, seven reverse) for multiplex PCR, using sequences available in GenBank for 178 taxa belonging to 123 genera in 41 families and 18 orders. Universality of these new multiplexed primers was tested with 53 specimens from 44 representative angiosperm families in 23 different orders. Our primers showed high PCR amplification and sequencing success. Conclusions: These results show that our newly developed primers are highly effective for multiplex PCR and can be employed in future barcode projects involving taxonomically diverse samples across angiosperms. Using multiplex primers for barcoding will reduce the cost and time needed for PCR amplification. PMID:27347449

  6. Primer Output and Initial Projectile Motion for 5.56- and 7.62-mm Ammunition

    DTIC Science & Technology


    is presented. The impulse resulting from the primers’ (Nos. 41 and 34, respectively) output is measured and compared with the bullet momentum ...Rifled and Smoothbore Barrels 8 3.4 Primer Impulse and Bullet Momentum Measurements 9 3.5 Further Demonstrations of Primer Brisance 11 3.6 Variation in...Fig. 10 Impulse from the primer graphed vs. momentum imparted to the bullet for M855 and M80 bullets with 2 assumptions of propellant motion behavior

  7. A Primer on Vibrational Ball Bearing Feature Generation for Prognostics and Diagnostics Algorithms

    DTIC Science & Technology


    A Primer on Vibrational Ball Bearing Feature Generation for Prognostics and Diagnostics Algorithms by Kwok F Tom ARL-TR-7230 March 2015...TR-7230 March 2015 A Primer on Vibrational Ball Bearing Feature Generation for Prognostics and Diagnostics Algorithms Kwok F Tom...DATES COVERED (From - To) 10/2012–09/2013 4. TITLE AND SUBTITLE A Primer on Vibrational Ball Bearing Feature Generation for Prognostics and

  8. Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

    USGS Publications Warehouse

    Galkiewicz, J.P.; Kellogg, C.A.


    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

  9. A method for predicting service life of zinc rich primers on carbon steel

    NASA Technical Reports Server (NTRS)

    Hoppesch, C. W.


    The service life of zinc rich primers on carbon steel can be estimated by immersing a primer coated glass slide into an aqueous copper sulfate solution and measuring the amount of zinc that reacts with the copper in 15 minutes. This zinc availability test was used to evaluate eleven primers currently available for which marine beach exposure data was available from previous programs. Results were evaluated and a correlation between zinc availability and ASTM rust grade was shown.

  10. Quantitative experimental determination of primer-dimer formation risk by free-solution conjugate electrophoresis.


    Desmarais, Samantha M; Leitner, Thomas; Barron, Annelise E


    DNA barcodes are short, unique ssDNA primers that "mark" individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 base-pairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive base-pairs formed, yet non-consecutive base-pairs did not create stable dimers even when 20 out of 30 possible base-pairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation.

  11. The corrosion protection of 2219-T87 aluminum by organic and inorganic zinc-rich primers

    NASA Technical Reports Server (NTRS)

    Danford, M. D.; Mendrek, M. J.; Walsh, D. W.


    The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electro-chemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. the galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 micro A/cm(exp 2) and 23.7 micro A/cm(exp 2) for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

  12. Anti-biofilm dentin primer with quaternary ammonium and silver nanoparticles.


    Cheng, L; Zhang, K; Melo, M A S; Weir, M D; Zhou, X; Xu, H H K


    Antibacterial bonding agents could combat recurrent caries at the tooth-composite margins. The objectives of this study were to develop novel antibacterial dentin primers containing quaternary ammonium dimethacrylate (QADM) and nanoparticles of silver (NAg), and to investigate the effects on dentin bond strength and dental plaque microcosm biofilms for the first time. Scotchbond Multi-Purpose ("SBMP") bonding agent was used. QADM and NAg were incorporated into SBMP primer, yielding 4 primers: SBMP primer (control), control + 10% QADM (mass), control + 0.05% NAg, and control + 10% QADM + 0.05% NAg. Human saliva was collected to grow microcosm biofilms. The NAg particle size (mean ± SD; n = 100) was 2.7 ± 0.6 nm. Dentin shear bond strengths (n = 10) with human third molars were approximately 30 MPa for all groups (p > 0.1). QADM-NAg-containing primer increased the bacteria inhibition zone by 9-fold, compared with control primer (p < 0.05). QADM-NAg-containing primer reduced lactic acid production and colony-forming units of total micro-organisms, total streptococci, and mutans streptococci by an order of magnitude. In conclusion, novel QADM-NAg-containing primers were strongly antibacterial without compromising dentin bond strength, and hence are promising to inhibit biofilms and secondary caries. The processing method of incorporating QADM and NAg together into the same primer produced the strongest antibacterial effect, which could have a wide applicability to other bonding systems.

  13. Greene SCPrimer: a rapid comprehensive tool for designing degenerate primers from multiple sequence alignments

    PubMed Central

    Jabado, Omar J.; Palacios, Gustavo; Kapoor, Vishal; Hui, Jeffrey; Renwick, Neil; Zhai, Junhui; Briese, Thomas; Lipkin, W. Ian


    Polymerase chain reaction (PCR) is widely applied in clinical and environmental microbiology. Primer design is key to the development of successful assays and is often performed manually by using multiple nucleic acid alignments. Few public software tools exist that allow comprehensive design of degenerate primers for large groups of related targets based on complex multiple sequence alignments. Here we present a method for designing such primers based on tree building followed by application of a set covering algorithm, and demonstrate its utility in compiling Multiplex PCR primer panels for detection and differentiation of viral pathogens. PMID:17135211

  14. Express Primer Tool for high-throughput gene cloning and expression

    SciTech Connect


    A tool to assist in the design of primers for DNA amplification. The Express Primer web-based tool generates primer sequences specifically for the generation of expression clones for both lab scale and high-throughput projects. The application is designed not only to allow the user complete flexibility to specify primer design parameters but also to minimize the amount of manual intervention needed to generate a large number of primers for simultaneous amplification of multiple target genes. The Express Primer Tool enables the user to specify various experimental parameters (e.g. optimal Tm, Tm range, maximum Tm difference) for single or multiple candidate sequence(s) in FASTA format input as a flat text (ASCII) file. The application generates condidate primers, selects optimal primer pairs, and writes the forward and reverse primers pairs to an Excel file that is suitable for electronic submission to a synthesis facility. The program parameters emphasize high-throughput but allow for target atrition at various stages of the project.

  15. The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

    NASA Technical Reports Server (NTRS)

    Danford, M. D.; Mendrek, M. J.; Walsh, D. W.


    The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

  16. Plasmid ColE1 incompatibility determined by interaction of RNA I with primer transcript.

    PubMed Central

    Tomizawa, J; Itoh, T


    Mutants of plasmid pNT7 that can coexist with plasmid pMB9 in growing bacteria have been isolated. These mutants show altered incompatibility properties and increased copy numbers. Each mutant has a single base change at or near the center of one of the three palindromes in the region that specifies two RNA species: a larger one (primer transcripts) that provides a primer for DNA replication and a smaller one (RNA I) that is the incompatibility-specific inhibitor of primer formation. In vitro transcription studies show that the single base changes affect both the ability of RNA I to inhibit primer formation and the sensitivity of primer formation to inhibition by RNA I. RNA I hybridizes to the primer transcript, and the rate of hybridization is reduced by the single base changes. Based on analyses of inhibition of in vitro primer formation by RNA I and of in vivo properties of the mutant plasmids, we conclude that incompatibility between two plasmids can be attributed to inhibition of primer formation on one of the plasmids by the RNA I of the other. Inhibition of primer formation by RNA I appears to be the mechanism that determines the copy number of pNT7 and its derivatives. Images PMID:6171811

  17. A Primer to Single-Particle Cryo-Electron Microscopy

    PubMed Central

    Cheng, Yifan; Grigorieff, Nikolaus; Penczek, Pawel A.; Walz, Thomas


    Summary Cryo-electron microscopy (cryo-EM) of single-particle specimens is used to determine the structure of proteins and macromolecular complexes without the need for crystals. Recent advances in detector technology and software algorithms now allow images of unprecedented quality to be recorded and structures to be determined at near-atomic resolution. However, compared with X-ray crystallography, cryo-EM is a young technique with distinct challenges. This primer explains the different steps and considerations involved in structure determination by single-particle cryo-EM to provide an overview for scientists wishing to understand more about this technique and the interpretation of data obtained with it, as well as a starting guide for new practitioners. PMID:25910204

  18. Antibiotic resistance: a primer and call to action.


    Smith, Rachel A; M'ikanatha, Nkuchia M; Read, Andrew F


    During the past century, discoveries of microorganisms as causes of infections and antibiotics as effective therapeutic agents have contributed to significant gains in public health in many parts of the world. Health agencies worldwide are galvanizing attention toward antibiotic resistance, which is a major threat to public health (Centers for Disease Control and Prevention, 2013; World Health Organization, 2014). Some life scientists believe that we are approaching the post-antibiotic age (Davies & Davies, 2010). The growing threat of antimicrobial resistance is fueled by complex factors with biological, behavioral, and societal aspects. This primer provides an overview of antibiotic resistance and its growing burden on public health, the biological and behavioral mechanisms that increase antibiotic resistance, and examples of where health communication scholars can contribute to efforts to make our current antibiotic drugs last as long as possible. In addition, we identify compelling challenges for current communication theories and practices.

  19. Primer Vector Optimization: Survey of Theory, new Analysis and Applications

    NASA Astrophysics Data System (ADS)


    This paper presents a preliminary study in developing a set of optimization tools for orbit rendezvous, transfer and station keeping. This work is part of a large scale effort undergoing at NASA Goddard Space Flight Center and a.i. solutions, Inc. to build generic methods, which will enable missions with tight fuel budgets. Since no single optimization technique can solve efficiently all existing problems, a library of tools where the user could pick the method most suited for the particular mission is envisioned. The first trajectory optimization technique explored is Lawden's primer vector theory [Ref. 1]. Primer vector theory can be considered as a byproduct of applying Calculus of Variations (COV) techniques to the problem of minimizing the fuel usage of impulsive trajectories. For an n-impulse trajectory, it involves the solution of n-1 two-point boundary value problems. In this paper, we look at some of the different formulations of the primer vector (dependent on the frame employed and on the force model). Also, the applicability of primer vector theory is examined in effort to understand when and why the theory can fail. Specifically, since COV is based on "small variations", singularities in the linearized (variational) equations of motion along the arcs must be taken into account. These singularities are a recurring problem in analyzes that employ "small variations" [Refs. 2, 3]. For example, singularities in the (2-body problem) variational equations along elliptic arcs occur when [Ref. 4], 1) the difference between the initial and final times is a multiple of the reference orbit period, 2) the difference between the initial and final true anomalies are given by k, for k= 0, 1, 2, 3,..., note that this cover the 3) the time of flight is a minimum for the given difference in true anomaly. For the N-body problem, the situation is more complex and is still under investigation. Several examples, such as the initialization of an orbit (ascent trajectory) and

  20. Evaluation of non toxic alkyd primers by electrochemical impedance spectroscopy

    SciTech Connect

    Hernandez, L.S.; Garcia, G. |; Lopez, C.


    The purpose of this work was to compare the protective capacity of several alkyd primers pigmented with 12.1 volume percent either of calcium phosphate or micronized zinc phosphate as anticorrosive pigments. A paint containing zinc chromate was used as reference. The performance of these paints on steel was assessed through Electrochemical Impedance Spectroscopy (EIS) using a 3% NaCl solution. After 576 hr immersion, the paint with calcium phosphate and specially that with micronized zinc phosphate, showed a better behavior than paint with zinc chromate. Paint rating, using impedance parameters (ionic resistance and capacitance of the paint film, and breakpoint frequency), was in agreement with the visible paint deterioration and corrosion, In addition, there was a good correlation between these parameter and the open circuit corrosion potential of the metallic substrate.

  1. Microsatellite primers for the rare sedge Lepidosperma bungalbin (Cyperaceae)1

    PubMed Central

    Nevill, Paul G.; Wardell-Johnson, Grant


    Premise of the study: Microsatellite markers were developed for the rare sedge Lepidosperma bungalbin (Cyperaceae) to assess genetic variation and its spatial structuring. Methods and Results: We conducted shotgun sequencing on an Illumina MiSeq and produced 6,215,872 sequence reads. The QDD pipeline was used to design 60 primer pairs that were screened using PCR. We developed 17 loci, of which 12 loci were identified that were polymorphic, amplified reliably, and could be consistently scored. We then screened these loci for variation in individuals from three populations. The number of alleles observed for these 12 loci across the three populations ranged from nine to 19 and expected heterozygosity ranged from 0.41 to 0.89. Conclusions: These markers will enable the quantification of the potential impact of mining on genetic variation within L. bungalbin and establish a baseline for future management of genetic variation of the rare sedge. PMID:27843727

  2. Prader-Willi syndrome: A primer for clinicians

    PubMed Central


    The advent of sensitive genetic testing modalities for the diagnosis of Prader-Willi syndrome has helped to define not only the phenotypic features of the syndrome associated with the various genotypes but also to anticipate clinical and psychological problems that occur at each stage during the life span. With advances in hormone replacement therapy, particularly growth hormone children born in circumstances where therapy is available are expected to have an improved quality of life as compared to those born prior to growth hormone. This manuscript was prepared as a primer for clinicians-to serve as a resource for those of you who care for children and adults with Prader-Willi syndrome on a daily basis in your practices. Appropriate and anticipatory interventions can make a difference. PMID:22008714

  3. ParaDiS-FEM dislocation dynamics simulation code primer

    SciTech Connect

    Tang, M; Hommes, G; Aubry, S; Arsenlis, A


    The ParaDiS code is developed to study bulk systems with periodic boundary conditions. When we try to perform discrete dislocation dynamics simulations for finite systems such as thin films or cylinders, the ParaDiS code must be extended. First, dislocations need to be contained inside the finite simulation box; Second, dislocations inside the finite box experience image stresses due to the free surfaces. We have developed in-house FEM subroutines to couple with the ParaDiS code to deal with free surface related issues in the dislocation dynamics simulations. This primer explains how the coupled code was developed, the main changes from the ParaDiS code, and the functions of the new FEM subroutines.

  4. Development of a Universal Intimin Antiserum and PCR Primers

    PubMed Central

    Batchelor, Miranda; Knutton, Stuart; Caprioli, Alfredo; Huter, Veronika; Zanial, Mazlina; Dougan, Gordon; Frankel, Gad


    Enteropathogenic Escherichia coli (EPEC) and enterohemorrhagic E. coli (EHEC) constitute a significant risk to human health worldwide. A hallmark of both pathogens is their ability to produce characteristic attaching-and-effacing (A/E) lesions in intestinal epithelial cells. Genes encoding A/E lesion formation map to a chromosomal pathogenicity island termed the locus of enterocyte effacement (LEE). Intimin, an LEE-encoded bacterial adhesion molecule, mediates the intimate bacterium-host cell interaction characteristic of A/E lesions. On the basis of characterization of the C-terminal 280-amino-acid cell binding domain of intimin (Int280661–939), four distinct Int280 types (types α, β, γ, and δ) have been identified. Importantly, Int280α and Int280β antisera specifically recognized their respective intimin types. Using a conserved region of the intimin molecule (Int388–667) and primers synthesized to generate the recombinant Int388–667, we have now generated universal intimin antiserum and PCR primers that are reactive with the different intimin types expressed by both human and animal A/E lesion-forming strains. Use of immunogold electron microscopy to visualize intimin on the surfaces of EPEC and EHEC strains revealed, in general, a uniform distribution on the bacterial cell surface. However, a filamentous staining pattern was observed with a few strains expressing intimin γ. Cloning of the intimin eae gene from one such strain (strain ICC57) into strain CVD206, an EPEC strain which harbors a null deletion in eae, produced a uniform intimin staining pattern indicating that, if the filamentous staining pattern defines a filamentous form of intimin γ, it is dependent upon the genetic background of the strain and is not a feature of the intimin molecule. PMID:10565891

  5. Variations in the sensitivity of different primers for detecting Wolbachia in Anastrepha (diptera: tephritidae)

    PubMed Central

    Marcon, Helena Sanches; Coscrato, Virgínia Elias; Selivon, Denise; Perondini, André Luiz Paranhos; Marino, Celso Luis


    Wolbachia are endosymbiont bacteria of the family Rickettsiacea that are widespread in invertebrates and occur between 20% and 60% of Neotropical insects. These bacteria are responsible for reproductive phenomena such as cytoplasmic incompatibility, male killing, feminization and parthenogenesis. Supergroups A and B of Wolbachia are common in insects and can be identified using primers for 16S rDNA, ftsZ and wsp; these primers vary in their ability to detect Wolbachia. The ftsZ primer was the first primer used to detect Wolbachia in Anastrepha fruit flies. The primers for 16S rDNA, ftsZ and wsp and the corresponding PCR conditions have been optimized to study the distribution of Wolbachia and their effect on the biology of Anastrepha in Brazil. In this work, we examined the ability of these primers to detect Wolbachia in Anastrepha populations from three regions in the State of São Paulo, southeastern Brazil. All of the samples were positive for Wolbachia supergroup A when screened with primers for 16S A rDNA and wsp A; the wsp B primer also gave a positive result, indicating cross-reactivity. The ftsZ primer showed a poor ability to detect Wolbachia in Anastrepha and generated false negatives in 44.9% of the samples. These findings indicate that reliable PCR detection of Wolbachia requires the use of primers for 16S rDNA and wsp to avoid cross-reactions and false negatives, and that the ftsZ primer needs to be redesigned to improve its selectivity. PMID:24031693

  6. Development of a ceramic primer with higher bond durability for resin cement.


    Li, Rui


    To increase the bond durability of resin to the CAD/CAM ceramic surface, two types of two-bottle type ceramic primers, consisting of Primer A1 or A2 and Primer B, were designed. Primer A1 was prepared by dissolving 25, 50, or 100 mg of gamma-methacryloxypropyltrimethoxysilane in 1 mL of ethanol. Primer A2 was prepared by dissolving 50 mg of mixed silanes, consisting of 1,2-bis(trimethoxysilyl)ethane to gamma-methacryloxypropyltrimethoxysilane, in 1 mL of ethanol. Mole fractions of 1,2-bis(trimethoxysilyl)ethane to gamma-methacryloxypropyltrimethoxysilane were 0, 10, 20, 30, 40 and 50 mol%. Primer B was prepared after dissolving 0.01, 0.05 or 0.1 mol L(-1) hydrochloric acid in ethanol by 50 vol%. Ceramic surface was silanated with a mixture of Primers A1 and B or Primers A2 and B for 1 min, and then air-dried. Commercial GC ceramic primer and Porcelain Liner M were utilized. Thereafter, dual-curing type resin cement was bonded to silanated ceramic surface through visible-light irradiation. Shear bond strength of resin to the ceramic surface was measured, before and after thermo-cycling. Addition of 0.01 or 0.05 mol L(-1) hydrochloric acid to the gamma-methacryloxypropyltrimethoxysilane allowed for significant increases in the bond strength. However, thermo-cycling resulted in significant decreases of approximately 5 MPa in the bond strength. Conversely, when the mixed silane, where 30 mol% of 1,2-bis(trimethoxysilyl)ethane dissolved in gamma-methacryloxypropyltrimethoxysilane, was utilized with 0.05 mol L(-1) hydrochloric acid, the reduction in the bond strength decreased to approximately 2 MPa. The designed ceramic primers exhibited higher ceramic bond durability than commercial ceramic primers.

  7. Effects of metal primers on bonding of adhesive resin cement to noble alloys for porcelain fusing.


    Okuya, Nobuhiro; Minami, Hiroyuki; Kurashige, Hisanori; Murahara, Sadaaki; Suzuki, Shiro; Tanaka, Takuo


    This study evaluated the effects of metal primers on the bonding of adhesive resin to four pure metals (Au, Pd, Ag, Cu) and two noble alloys for porcelain fusing (high-gold and high-palladium content alloys). Bonding surface was polished with 600-grit silicon carbide paper and primed with one of the three metal primers (V-Primer, Metaltite, and M.L. Primer). Bonded specimens were fabricated by applying adhesive resin (Super-Bond C&B) on the primed surface. Shear bond strength (SBS) was determined both before and after thermocycling (4-60 degrees C for 2,000 cycles). The highest SBS values to each pure metal after thermocycling were 33.5 MPa for Au by M.L. Primer, 35.0 MPa for Ag by V-Primer, and 34.4 MPa for Cu by Metaltite. SBS to high-gold content alloy after thermocycling was 33.3 MPa by M.L. Primer. None of the primers was effective for pure Pd and high-palladium content alloy after thermocycling.

  8. Design of a Percussion and Electric Primer Gun Firing Power Supply

    DTIC Science & Technology


    solenoid failure . As new instrumentation techniques such as high -speed video and laser interferometry have been introduced into our gun testing...Design of a Percussion and Electric Primer Gun Firing Power Supply by Peter T. Bartkowski ARL-TR-6987 July 2014...Percussion and Electric Primer Gun Firing Power Supply Peter T. Bartkowski Weapons and Materials Research Directorate, ARL

  9. Primer for identifying cold-water refuges to protect and restore thermal diversity in riverine landscapes

    EPA Science Inventory

    EPA recently released a primer that provides guidance to Region 10 Tribes, States, and local watershed community groups to support the identification, protection, and restoration of critical cold water refuges for the protection of salmonids. This primer will assist these entiti...

  10. Novel primers for detection of genetically diverse virulent Agrobacterium tumefaciens bv1 strains

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Novel primers were developed to amplify a 243 bp fragment of an intergenic region between gene5 and tms2 on the T-DNA of Agrobacterium tumefaciens. These primers exhibit 100% positive correlation with strain virulence, 100% negative correlation with avirulence and did not generate extraneous bands,...

  11. A new PCR method: one primer amplification of PCR-CTPP products.


    Yin, Guang; Mitsuda, Yoko; Ezaki, Takayuki; Hamajima, Nobuyuki


    Polymerase chain reaction with confronting two-pair primers (PCR-CTPP) is a convenient method for genotyping single nucleotide polymorphisms, saving time, and costs. It uses four primers for PCR; F1 and R1 for one allele, and F2 and R2 for the other allele, by which three different sizes of DNA are amplified; between F1 and R1, between F2 and R2, and between F1 and R2. To date, we have applied PCR-CTPP successfully for genotyping more than 60 polymorphisms. However, it is not rare that PCR does not produce balanced amplification of allele specific bands. Accordingly, the method was modified by attaching a common sequence at the 5' end of two-pair primers and adding another primer with the common sequence in PCR, in total five different primers in a tube for PCR. The modification allowed one primer amplification for the products of initial PCR with confronting two-pair primers, named as one primer amplification of PCR-CTPP products (OPA-CTPP). This article demonstrates an example for an A/G polymorphism of paraoxonase 1 (PON1) Gln192Arg (rs662). PCR-CTPP failed clear genotyping for the polymorphism, while OPA-CTPP successfully produced PCR products corresponding to the allele. The present example indicated that the OPA-CTPP would be useful in the case that PCR-CTPP failed to produce balanced PCR products specific to each allele.

  12. GSP: A web-based platform for designing genome-specific primers in polyploids

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The sequences among subgenomes in a polyploid species have high similarity. This makes difficult to design genome-specific primers for sequence analysis. We present a web-based platform named GSP for designing genome-specific primers to distinguish subgenome sequences in the polyploid genome backgr...

  13. Single primer-triggered isothermal amplification for double-stranded DNA detection.


    Ma, Cuiping; Han, Dianang; Deng, Meilian; Wang, Jingfei; Shi, Chao


    Here we have devised a new generation of isothermal double-stranded DNA (dsDNA) detection method, termed single primer-triggered isothermal amplification (SAMP). It is very simple only requiring one primer and a few copies of dsDNA in less than an hour are detectable with multiple signal amplification steps.

  14. Demystifying Special Education in Virtual Charter Schools. Special Report. Primers on Special Education in Charter Schools

    ERIC Educational Resources Information Center

    Rhim, Lauren Morando; Kowal, Julie


    This special report is a supplement to a series of special education primers created to inform state officials, authorizers and charter school operators about special education in the charter sector. The primer series also provides tools to help these stakeholders build charter school capacity to provide special education and related services. In…

  15. Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.


    Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong


    The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease.

  16. A Comprehensive Evaluation of PCR Primers to Amplify the nifH Gene of Nitrogenase

    PubMed Central

    Gaby, John Christian; Buckley, Daniel H.


    The nifH gene is the most widely sequenced marker gene used to identify nitrogen-fixing Bacteria and Archaea. Numerous PCR primers have been designed to amplify nifH, but a comprehensive evaluation of nifH PCR primers has not been performed. We performed an in silico analysis of the specificity and coverage of 51 universal and 35 group-specific nifH primers by using an aligned database of 23,847 nifH sequences. We found that there are 15 universal nifH primers that target 90% or more of nitrogen fixers, but that there are also 23 nifH primers that target less than 50% of nifH sequences. The nifH primers we evaluated vary in their phylogenetic bias and their ability to recover sequences from commonly sampled environments. In addition, many of these primers will amplify genes that do not mediate nitrogen fixation, and thus it would be advisable for researchers to screen their sequencing results for the presence of non-target genes before analysis. Universal primers that performed well in silico were tested empirically with soil samples and with genomic DNA from a phylogenetically diverse set of nitrogen-fixing strains. This analysis will be of great utility to those engaged in molecular analysis of nifH genes from isolates and environmental samples. PMID:22848735

  17. A Highly Reactive Imidazolium-Bridged Dinucleotide Intermediate in Nonenzymatic RNA Primer Extension.


    Walton, Travis; Szostak, Jack W


    Because of its importance for the origin of life, the nonenzymatic copying of RNA templates has been the subject of intense study for several decades. Previous characterizations of template-directed primer extension using 5'-phosphoryl-2-methylimidazole-activated nucleotides (2-MeImpNs) as substrates have assumed a classical in-line nucleophilic substitution mechanism, in which the 3'-hydroxyl of the primer attacks the phosphate of the incoming monomer, displacing the 2-methylimidazole leaving group. However, we have found that the initial rate of primer extension depends on the pH and concentration at which the activated monomer is maintained prior to the primer extension reaction. These and other results suggest an alternative mechanism, in which two monomers react with each other to form an imidazolium-bridged dinucleotide intermediate, which then binds to the template. Subsequent attack of the 3'-hydroxyl of the primer displaces an activated nucleotide as the leaving group and results in extension of the primer by one nucleotide. Analysis of monomer solutions by NMR indicates formation of the proposed imidazolium-bridged dinucleotide in the expected pH-dependent manner. We have used synthetic methods to prepare material that is enriched in this proposed intermediate and show that it is a highly reactive substrate for primer extension. The formation of an imidazolium-bridged dinucleotide intermediate provides a mechanistic interpretation of previously observed catalysis by an activated nucleotide located downstream from the site of primer extension.

  18. MFEprimer-2.0: a fast thermodynamics-based program for checking PCR primer specificity.


    Qu, Wubin; Zhou, Yang; Zhang, Yanchun; Lu, Yiming; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang


    Evaluating the specificity of polymerase chain reaction (PCR) primers is an essential step in PCR primer design. The MFEprimer-2.0 server allows users to check primer specificity against genomic DNA and messenger RNA/complementary DNA sequence databases quickly and easily. MFEprimer-2.0 uses a k-mer index algorithm to accelerate the search process for primer binding sites and uses thermodynamics to evaluate binding stability between each primer and its DNA template. Several important characteristics, such as the sequence, melting temperature and size of each amplicon, either specific or non-specific, are reported on the results page. Based on these characteristics and the user-friendly output, users can readily draw conclusions about the specificity of PCR primers. Analyses for degenerate primers and multiple PCR primers are also supported in MFEprimer-2.0. In addition, the databases supported by MFEprimer-2.0 are comprehensive, and custom databases can also be supported on request. The MFEprimer-2.0 server does not require a login and is freely available at More over, the MFEprimer-2.0 command-line version and local server version are open source and can be downloaded at

  19. Microarrays for high-throughput genotyping of MICA alleles using allele-specific primer extension.


    Baek, I C; Jang, J-P; Choi, H-B; Choi, E-J; Ko, W-Y; Kim, T-G


    The role of major histocompatibility complex (MHC) class I chain-related gene A (MICA), a ligand of NKG2D, has been defined in human diseases by its allele associations with various autoimmune diseases, hematopoietic stem cell transplantation (HSCT) and cancer. This study describes a practical system to develop MICA genotyping by allele-specific primer extension (ASPE) on microarrays. From the results of 20 control primers, strict and reliable cut-off values of more than 30,000 mean fluorescence intensity (MFI) as positive and less than 3000 MFI as negative, were applied to select high-quality specific extension primers. Among 55 allele-specific primers, 44 primers could be initially selected as optimal primer. Through adjusting the length, six primers were improved. The other failed five primers were corrected by refractory modification. MICA genotypes by ASPE on microarrays showed the same results as those by nucleotide sequencing. On the basis of these results, ASPE on microarrays may provide high-throughput genotyping for MICA alleles for population studies, disease-gene associations and HSCT.

  20. Novel computational methods for increasing PCR primer design effectiveness in directed sequencing

    PubMed Central

    Li, Kelvin; Brownley, Anushka; Stockwell, Timothy B; Beeson, Karen; McIntosh, Tina C; Busam, Dana; Ferriera, Steve; Murphy, Sean; Levy, Samuel


    Background Polymerase chain reaction (PCR) is used in directed sequencing for the discovery of novel polymorphisms. As the first step in PCR directed sequencing, effective PCR primer design is crucial for obtaining high-quality sequence data for target regions. Since current computational primer design tools are not fully tuned with stable underlying laboratory protocols, researchers may still be forced to iteratively optimize protocols for failed amplifications after the primers have been ordered. Furthermore, potentially identifiable factors which contribute to PCR failures have yet to be elucidated. This inefficient approach to primer design is further intensified in a high-throughput laboratory, where hundreds of genes may be targeted in one experiment. Results We have developed a fully integrated computational PCR primer design pipeline that plays a key role in our high-throughput directed sequencing pipeline. Investigators may specify target regions defined through a rich set of descriptors, such as Ensembl accessions and arbitrary genomic coordinates. Primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the specified target regions. As part of the tiling process, primer pairs are computationally screened to meet the criteria for success with one of two PCR amplification protocols. In the process of improving our sequencing success rate, which currently exceeds 95% for exons, we have discovered novel and accurate computational methods capable of identifying primers that may lead to PCR failures. We reveal the laboratory protocols and their associated, empirically determined computational parameters, as well as describe the novel computational methods which may benefit others in future primer design research. Conclusion The high-throughput PCR primer design pipeline has been very successful in providing the basis for high-quality directed sequencing results and for minimizing costs associated with labor and

  1. Multi-primer target PCR for rapid identification of bovine DRB3 alleles.


    Ledwidge, S A; Mallard, B A; Gibson, J P; Jansen, G B; Jiang, Z H


    Multi-primer target polymerase chain reaction (MPT-PCR) is a rapid method for the identification of specific BoLA-DRB3 alleles. In a single PCR reaction, the presence of two alleles associated with increased risk, DRB3.2*23 (DRB3*2701-2703, 2705-2707) and decreased risk, DRB3.2*16 (DRB3*1501, 1502), of mastitis in Canadian Holstein can be detected. Two outer primers amplify exon 2 of DRB3. Simultaneously, two inner, allele-specific primers amplify individual alleles. Initially, 40 cows previously typed by PCR-restriction fragment length polymorphism (PCR-RFLP) were genotyped using the multi-primer approach. An additional 30 cows were first genotyped by multi-primer target PCR, then by PCR-RFLP. All animals were correctly identified and there were no false positives. This technique can readily be modified to identify other BoLA alleles of interest.

  2. A novel technique for detecting single nucleotide polymorphisms by analyzing consumed allele-specific primers.


    Watanabe, G; Umetsu, K; Yuasa, I; Sato, M; Sakabe, M; Naito, E; Yamanouchi, H; Suzuki, T


    We present a simple and rapid polymerase chain reaction (PCR)-based technique, termed consumed allele-specific primer analysis (CASPA), as a new strategy for single nucleotide polymorphism (SNP) analysis. The method involves the use of labeled allele-specific primers, differing in length, with several noncomplementary nucleotides added in the 5'-terminal region. After PCR amplification, the amounts of the remaining primers not incorporated into the PCR products are determined. Thus, nucleotide substitutions are identified by measuring the consumption of primers. In this study, the CASPA method was successfully applied to ABO genotyping. In the present method, the allele-specific primer only anneals with the target polymorphic site on the DNA, so it is not necessary to analyze the PCR products. Therefore, this method is only little affected by modification of the PCR products. The CASPA method is expected to be a useful tool for typing of SNPs.

  3. Identification of putative sequence specific PCR primers for detection of the toxigenic fungal species Stachybotrys chartarum.


    Haugland, R A; Heckman, J L


    The nucleotide sequence of a c 936 bp segment of the nuclear rRNA gene operon was determined for the toxigenic fungal species Stachybotrys chartarum and for other species of Stachybotrys and the related genus Memnoniella. This information was used to infer the phylogenetic relationships of these organisms and to search for sequence specific polymerase chain reaction (PCR) primers for S. chartarum in the internal transcribed spacer (ITS) regions. Searches for candidate primers were performed both by computer using the commercially available Oligo(R) v5.0 primer analysis software package and by manual inspection of the aligned sequences. Primers identified in both types of searches were evaluated for their specificities using a priming efficiency analysis algorithm available in the Oligo(R) 5.0 software. The automated computer searches were unsuccessful in finding S. chartarum-specific primers but did identify a group-specific reverse primer (designated as StacR4) for a phylogenetically related cluster of species that included S. chartarum. Manual searches led to the identification of a reverse primer (designated as StacR3) that was predicted to be specific for only S. chartarum and one other species of Stachybotrys. Experimental PCR analyses using these primers in conjunction with a universal forward primer indicated that the computer-generated amplification efficiency predictions were correct in most instances. A notable exception was the finding that StacR3 was specific only for S. chartarum. The relative merits of different PCR strategies for the detection of S. chartarum employing either one or both of the primers identified in this study are discussed.

  4. 40 CFR 63.3092 - How must I control emissions from my electrodeposition primer system if I want to comply with the...

    Code of Federal Regulations, 2013 CFR


    ... electrodeposition primer system if I want to comply with the combined primer-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? 63.3092 Section 63.3092 Protection of... combined primer-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive...

  5. 40 CFR 63.3092 - How must I control emissions from my electrodeposition primer system if I want to comply with the...

    Code of Federal Regulations, 2014 CFR


    ... electrodeposition primer system if I want to comply with the combined primer-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? 63.3092 Section 63.3092 Protection of... combined primer-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive...

  6. 40 CFR 63.3092 - How must I control emissions from my electrodeposition primer system if I want to comply with the...

    Code of Federal Regulations, 2012 CFR


    ... electrodeposition primer system if I want to comply with the combined primer-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? 63.3092 Section 63.3092 Protection of... combined primer-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive...

  7. KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input

    SciTech Connect

    Busch, R.D.


    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a.

  8. Demystifying Kepler Data: A Primer for Systematic Artifact Mitigation

    NASA Technical Reports Server (NTRS)

    Kinemuchi, K.; Barclay, T.; Fanelli, M.; Pepper, J.; Still, M.; Howell, B.


    The Kepler spacecraft has collected data of high photometric precision and cadence almost continuously since operations began on 2009 May 2. Primarily designed to detect planetary transits and asteroseismological signals from solar-like stars, Kepler has provided high quality data for many areas of investigation. Unconditioned simple aperture time-series photometry are however affected by systematic structure. Examples of these systematics are differential velocity aberration, thermal gradients across the spacecraft, and pointing variations. While exhibiting some impact on Kepler's primary science, these systematics can critically handicap potentially ground-breaking scientific gains in other astrophysical areas, especially over long timescales greater than 10 days. As the data archive grows to provide light curves for 10(exp 5) stars of many years in length, Kepler will only fulfill its broad potential for stellar astrophysics if these systematics are understood and mitigated. Post-launch developments in the Kepler archive, data reduction pipeline and open source data analysis software have occurred to remove or reduce systematic artifacts. This paper provides a conceptual primer for users of the Kepler data archive to understand and recognize systematic artifacts within light curves and some methods for their removal. Specific examples of artifact mitigation are provided using data available within the archive. Through the methods defined here, the Kepler community will find a road map to maximizing the quality and employment of the Kepler legacy archive.

  9. Maximum Likelihood, Profile Likelihood, and Penalized Likelihood: A Primer

    PubMed Central

    Cole, Stephen R.; Chu, Haitao; Greenland, Sander


    The method of maximum likelihood is widely used in epidemiology, yet many epidemiologists receive little or no education in the conceptual underpinnings of the approach. Here we provide a primer on maximum likelihood and some important extensions which have proven useful in epidemiologic research, and which reveal connections between maximum likelihood and Bayesian methods. For a given data set and probability model, maximum likelihood finds values of the model parameters that give the observed data the highest probability. As with all inferential statistical methods, maximum likelihood is based on an assumed model and cannot account for bias sources that are not controlled by the model or the study design. Maximum likelihood is nonetheless popular, because it is computationally straightforward and intuitive and because maximum likelihood estimators have desirable large-sample properties in the (largely fictitious) case in which the model has been correctly specified. Here, we work through an example to illustrate the mechanics of maximum likelihood estimation and indicate how improvements can be made easily with commercial software. We then describe recent extensions and generalizations which are better suited to observational health research and which should arguably replace standard maximum likelihood as the default method. PMID:24173548

  10. A Transparent Window into Biology: A Primer on Caenorhabditis elegans.


    Corsi, Ann K; Wightman, Bruce; Chalfie, Martin


    A little over 50 years ago, Sydney Brenner had the foresight to develop the nematode (round worm) Caenorhabditis elegans as a genetic model for understanding questions of developmental biology and neurobiology. Over time, research on C. elegans has expanded to explore a wealth of diverse areas in modern biology including studies of the basic functions and interactions of eukaryotic cells, host-parasite interactions, and evolution. C. elegans has also become an important organism in which to study processes that go awry in human diseases. This primer introduces the organism and the many features that make it an outstanding experimental system, including its small size, rapid life cycle, transparency, and well-annotated genome. We survey the basic anatomical features, common technical approaches, and important discoveries in C. elegans research. Key to studying C. elegans has been the ability to address biological problems genetically, using both forward and reverse genetics, both at the level of the entire organism and at the level of the single, identified cell. These possibilities make C. elegans useful not only in research laboratories, but also in the classroom where it can be used to excite students who actually can see what is happening inside live cells and tissues.

  11. Complement: A primer for the coming therapeutic revolution.


    Barnum, Scott R


    The complement system is an important part of the innate and adaptive immune systems. Originally characterized as a single serum component contributing to the killing of bacteria, we now know that there are close to sixty complement proteins, multiple activation pathways and a wide range of effector functions mediated by complement. The system plays a critical role in host defense against bacteria, viruses, fungi and other pathogens. However, inappropriate complement activation contributes to the pathophysiology of autoimmune diseases and many inflammatory syndromes. Over the last several decades, therapeutic approaches to inhibit complement activation at various steps in the pathways have met with initial success, particularly at the level of the terminal pathway. This success, combined with insight from animal model studies, has lead to an unprecedented effort by biotech and pharmaceutical companies to begin developing complement inhibitors. As a result, complement has been brought for the first time to the attention of pharmacologists, toxicologists, project managers and others in the drug development industry, as well as those in the investment world. The purpose of this primer is to provide a broad overview of complement immunobiology to help those new to complement understand the rationale behind the current therapeutic directions and the investment potential of these new therapeutics.

  12. A primer to frequent itemset mining for bioinformatics

    PubMed Central

    Naulaerts, Stefan; Meysman, Pieter; Bittremieux, Wout; Vu, Trung Nghia; Vanden Berghe, Wim; Goethals, Bart


    Over the past two decades, pattern mining techniques have become an integral part of many bioinformatics solutions. Frequent itemset mining is a popular group of pattern mining techniques designed to identify elements that frequently co-occur. An archetypical example is the identification of products that often end up together in the same shopping basket in supermarket transactions. A number of algorithms have been developed to address variations of this computationally non-trivial problem. Frequent itemset mining techniques are able to efficiently capture the characteristics of (complex) data and succinctly summarize it. Owing to these and other interesting properties, these techniques have proven their value in biological data analysis. Nevertheless, information about the bioinformatics applications of these techniques remains scattered. In this primer, we introduce frequent itemset mining and their derived association rules for life scientists. We give an overview of various algorithms, and illustrate how they can be used in several real-life bioinformatics application domains. We end with a discussion of the future potential and open challenges for frequent itemset mining in the life sciences. PMID:24162173

  13. A primer to frequent itemset mining for bioinformatics.


    Naulaerts, Stefan; Meysman, Pieter; Bittremieux, Wout; Vu, Trung Nghia; Vanden Berghe, Wim; Goethals, Bart; Laukens, Kris


    Over the past two decades, pattern mining techniques have become an integral part of many bioinformatics solutions. Frequent itemset mining is a popular group of pattern mining techniques designed to identify elements that frequently co-occur. An archetypical example is the identification of products that often end up together in the same shopping basket in supermarket transactions. A number of algorithms have been developed to address variations of this computationally non-trivial problem. Frequent itemset mining techniques are able to efficiently capture the characteristics of (complex) data and succinctly summarize it. Owing to these and other interesting properties, these techniques have proven their value in biological data analysis. Nevertheless, information about the bioinformatics applications of these techniques remains scattered. In this primer, we introduce frequent itemset mining and their derived association rules for life scientists. We give an overview of various algorithms, and illustrate how they can be used in several real-life bioinformatics application domains. We end with a discussion of the future potential and open challenges for frequent itemset mining in the life sciences.

  14. Review of Attachment, play, and authenticity: A Winnicott primer.


    Penn, Linda S


    Reviews the book, Attachment, play, and authenticity: A Winnicott primer by Steven Tuber (see record 2008-04633-000). In this book, Tuber does not attempt to offer a comprehensive review of Winnicott's work. Rather, he focuses on what he sees as Winnicott's most central concepts, offering close examination of a few articles that he feels best represent each of these concepts, and frames each with the noting of a central dilemma or paradox. Tuber describes the book as an attempt to teach through "playing" with Winnicott (play being central to Winnicott's ideas) and engaging the reader to join in the play. The book is based on a series of lectures from a course on Winnicott he has given to his clinical psychology doctoral students at the City University of New York. The reviewer noted that the author omitted some information that she considered to be important. However, she concludes that this book is a compelling read that captures what she sees as the essence of Winnicott's work, and as Winnicott would have loved, presents it without jargon or pretense in the simple terms that best elucidate Winnicott's view of the human experience. (PsycINFO Database Record (c) 2010 APA, all rights reserved).

  15. The corrosion mechanisms for primer coated 2219-T87 aluminum

    NASA Technical Reports Server (NTRS)

    Danford, Merlin D.; Knockemus, Ward W.


    To investigate metal surface corrosion and the breakdown of metal protective coatings, the ac Impedance Method was applied to zinc chromate primer coated 2219-T87 aluminum. The EG&GPARC Model 368 ac Impedance Measurement System, along with dc measurements with the same system using the Polarization Resistance Method, was used to monitor changing properties of coated aluminum disks immersed in 3.5 percent NaCl solutions buffered at pH 5.5 and pH 8.2 over periods of 40 days each. The corrosion system can be represented by an electronic analog called an equivalent circuit consisting of resistors and capacitors in specific arrangements. This equivalent circuit parallels the impedance behavior of the corrosion system during a frequency scan. Values for resistances and capacitances, that can be assigned in the equivalent circuit following a least squares analysis of the data, describe changes occurring on the corroding metal surface and in the protective coatings. A suitable equivalent circuit has been determined which predicts the correct Bode phase and magnitude for the experimental sample. The dc corrosion current density data are related to equivalent circuit element parameters.

  16. A Transparent Window into Biology: A Primer on Caenorhabditis elegans

    PubMed Central

    Corsi, Ann K.; Wightman, Bruce; Chalfie, Martin


    A little over 50 years ago, Sydney Brenner had the foresight to develop the nematode (round worm) Caenorhabditis elegans as a genetic model for understanding questions of developmental biology and neurobiology. Over time, research on C. elegans has expanded to explore a wealth of diverse areas in modern biology including studies of the basic functions and interactions of eukaryotic cells, host–parasite interactions, and evolution. C. elegans has also become an important organism in which to study processes that go awry in human diseases. This primer introduces the organism and the many features that make it an outstanding experimental system, including its small size, rapid life cycle, transparency, and well-annotated genome. We survey the basic anatomical features, common technical approaches, and important discoveries in C. elegans research. Key to studying C. elegans has been the ability to address biological problems genetically, using both forward and reverse genetics, both at the level of the entire organism and at the level of the single, identified cell. These possibilities make C. elegans useful not only in research laboratories, but also in the classroom where it can be used to excite students who actually can see what is happening inside live cells and tissues. PMID:26088431

  17. Primer of statistics in dental research: Part II.


    Shintani, Ayumi


    The Part I of Primer of Statistics in Dental Research covered five topics that are often mentioned in statistical check list of many peer-review journals including (1) statistical graph, (2) how to deal with outliers, (3) p-value and confidence interval, (4) testing equivalence, and (5) multiplicity Adjustment. The Part II of the series covers another set of important topics in dental statistics including (1) selecting the proper statistical tests, (2) repeated measures analysis, (3) epidemiological consideration for causal association, and (4) analysis of agreement. First, a guide in selecting the proper statistical tests based on the research question will be laid out in text and with a table so that researchers choose the univariable statistical test by answering five simple questions. Second, the importance of utilizing repeated measures analysis will be illustrated. This is a key component of data analysis as in many dental studies, observations are considered repeated in a single patient (several teeth are measured in a single patient). Third, concepts of confounding and the use of regression analysis are explained by going over a famous observational cohort study. Lastly, the use of proper agreement analysis vs. correlation for study of agreement will be discussed to avoid a common pitfall in dental research.

  18. A Transparent window into biology: A primer on Caenorhabditis elegans.

    PubMed Central

    Corsi, Ann K; Wightman, Bruce; Chalfie, Martin


    A little over 50 years ago, Sydney Brenner had the foresight to develop the nematode (round worm) Caenorhabditis elegans as a genetic model for understanding questions of developmental biology and neurobiology. Over time, research on C. elegans has expanded to explore a wealth of diverse areas in modern biology including studies of the basic functions and interactions of eukaryotic cells, host-parasite interactions, and evolution. C. elegans has also become an important organism in which to study processes that go awry in human diseases. This primer introduces the organism and the many features that make it an outstanding experimental system, including its small size, rapid life cycle, transparency, and well-annotated genome. We survey the basic anatomical features, common technical approaches, and important discoveries in C. elegans research. Key to studying C. elegans has been the ability to address biological problems genetically, using both forward and reverse genetics, both at the level of the entire organism and at the level of the single, identified cell. These possibilities make C. elegans useful not only in research laboratories, but also in the classroom where it can be used to excite students who actually can see what is happening inside live cells and tissues. PMID:26087236

  19. Fungal-specific PCR primers developed for analysis of the ITS region of environmental DNA extracts

    PubMed Central

    Martin, Kendall J; Rygiewicz, Paul T


    Background The Internal Transcribed Spacer (ITS) regions of fungal ribosomal DNA (rDNA) are highly variable sequences of great importance in distinguishing fungal species by PCR analysis. Previously published PCR primers available for amplifying these sequences from environmental samples provide varying degrees of success at discriminating against plant DNA while maintaining a broad range of compatibility. Typically, it has been necessary to use multiple primer sets to accommodate the range of fungi under study, potentially creating artificial distinctions for fungal sequences that amplify with more than one primer set. Results Numerous sequences for PCR primers were tested to develop PCR assays with a wide range of fungal compatibility and high discrimination from plant DNA. A nested set of 4 primers was developed that reflected these criteria and performed well amplifying ITS regions of fungal rDNA. Primers in the 5.8S sequence were also developed that would permit separate amplifications of ITS1 and ITS2. A range of basidiomycete fruiting bodies and ascomycete cultures were analyzed with the nested set of primers and Restriction Fragment Length Polymorphism (RFLP) fingerprinting to demonstrate the specificity of the assay. Single ectomycorrhizal root tips were similarly analyzed. These primers have also been successfully applied to Quantitative PCR (QPCR), Length Heterogeneity PCR (LH-PCR) and Terminal Restriction Fragment Length Polymorphism (T-RFLP) analyses of fungi. A set of wide-range plant-specific primers were developed at positions corresponding to one pair of the fungal primers. These were used to verify that the host plant DNA was not being amplified with the fungal primers. Conclusion These plant primers have been successfully applied to PCR-RFLP analyses of forest plant tissues from above- and below-ground samples and work well at distinguishing a selection of plants to the species level. The complete set of primers was developed with an emphasis on

  20. Development of acceptance criteria for batches of silane primer for external tank thermal protection system bonding applications

    NASA Technical Reports Server (NTRS)

    Mikes, F.; Mowrey, C.; Reis, E.


    Results of lap shear tests of various silane primers are presented in graphs and tables. The OH-absorption of these primers (FTIR area values) are correlated with the lap shear tests of coated panels.

  1. In vitro short-term bonding performance of zirconia treated with hot acid etching and primer conditioning etching and primer conditioning.


    Xie, Haifeng; Chen, Chen; Dai, Wenyong; Chen, Gang; Zhang, Feimin


    This study aimed to investigate and compare the resin bond strengths of zirconia conditioned as follows: alumina sandblasting; alumina sandblasting+application of 10-MDP-containing primer; alumina sandblasting+application of Z-Prime Plus or Metal/Zirconia Primer (new zirconia primers); tribochemical silica coating+silanization; hot acid etching in three different combinations [H2SO4/(NH4)2SO4, HF/HNO3, H2SO4/HF/HNO3]+application of 10-MDP-containing primer. Shear bond strengths (SBS) after water storage for 24 h and 40 days were measured to assess resin bonding performance. Surface and chemical properties of conditioned zirconia surfaces and primers were characterized using scanning electron microscopy, energy dispersive X-ray spectrometry, Fourier transform infrared spectroscopy, and atomic force microscopy. Surface roughness ranked in descending order was: hot acid etching > tribochemical silica coating > alumina sandblasting. Combination of tribochemical silica coating and silanization showed the highest initial SBS (12.46±2.13 MPa) (P<0.01). Etching with H2SO4/(NH4)2SO4 (13.15±3.24 MPa) and HF/HNO3 (13.48±2.15 MPa) showed significantly better bond durability (P<0.01). Hot acid etching seemed to be a promising surface roughening treatment to improve resin-zirconia bonding.

  2. Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes


    Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.; ...


    Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus.more » Each group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less

  3. MRPrimerV: a database of PCR primers for RNA virus detection

    PubMed Central

    Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Kim, Doyun; Koo, JaeHyung; Kim, Min-Soo


    Many infectious diseases are caused by viral infections, and in particular by RNA viruses such as MERS, Ebola and Zika. To understand viral disease, detection and identification of these viruses are essential. Although PCR is widely used for rapid virus identification due to its low cost and high sensitivity and specificity, very few online database resources have compiled PCR primers for RNA viruses. To effectively detect viruses, the MRPrimerV database ( contains 152 380 247 PCR primer pairs for detection of 1818 viruses, covering 7144 coding sequences (CDSs), representing 100% of the RNA viruses in the most up-to-date NCBI RefSeq database. Due to rigorous similarity testing against all human and viral sequences, every primer in MRPrimerV is highly target-specific. Because MRPrimerV ranks CDSs by the penalty scores of their best primer, users need only use the first primer pair for a single-phase PCR or the first two primer pairs for two-phase PCR. Moreover, MRPrimerV provides the list of genome neighbors that can be detected using each primer pair, covering 22 192 variants of 532 RefSeq RNA viruses. We believe that the public availability of MRPrimerV will facilitate viral metagenomics studies aimed at evaluating the variability of viruses, as well as other scientific tasks. PMID:27899620

  4. RNA Primer Extension Hinders DNA Synthesis by Escherichia coli Mutagenic DNA Polymerase IV

    PubMed Central

    Tashjian, Tommy F.; Lin, Ida; Belt, Verena; Cafarelli, Tiziana M.; Godoy, Veronica G.


    In Escherichia coli the highly conserved DNA damage regulated dinB gene encodes DNA Polymerase IV (DinB), an error prone specialized DNA polymerase with a central role in stress-induced mutagenesis. Since DinB is the DNA polymerase with the highest intracellular concentrations upon induction of the SOS response, further regulation must exist to maintain genomic stability. Remarkably, we find that DinB DNA synthesis is inherently poor when using an RNA primer compared to a DNA primer, while high fidelity DNA polymerases are known to have no primer preference. Moreover, we show that the poor DNA synthesis from an RNA primer is conserved in DNA polymerase Kappa, the human DinB homolog. The activity of DinB is modulated by interactions with several other proteins, one of which is the equally evolutionarily conserved recombinase RecA. This interaction is known to positively affect DinB’s fidelity on damaged templates. We find that upon interaction with RecA, DinB shows a significant reduction in DNA synthesis when using an RNA primer. Furthermore, with DinB or DinB:RecA a robust pause, sequence and lesion independent, occurs only when RNA is used as a primer. The robust pause is likely to result in abortive DNA synthesis when RNA is the primer. These data suggest a novel mechanism to prevent DinB synthesis when it is not needed despite its high concentrations, thus protecting genome stability. PMID:28298904

  5. Construction of Specific Primers for Rapid Detection of South African Exportable Vegetable Macergens

    PubMed Central

    Aremu, Bukola Rhoda; Babalola, Olubukola Oluranti


    Macergens are bacteria causing great damages to the parenchymatous tissues of vegetable both on the field and in transit. To effectively and rapidly investigate the diversity and distribution of these macergens, four specific primers were designed by retrieving 16S rDNA sequences of pectolytic bacteria from GenBank through the National Center for Biotechnology Information (NCBI). These were aligned using ClusterW via BioEdit and primers were designed using Primer3Plus platform. The size and primer location of each species and PCR product size were accurately defined. For specificity enhancement, DNA template of known macergens (Pectobacterium chrysanthermi) and fresh healthy vegetable were used. These primers yielded expected size of approximately 1100 bp product only when tested with known macergens and no amplicon with fresh healthy vegetable was detected. Rapid detection of macergens in rotten vegetable samples was then carried out using these primers. Nucleotide sequences of macergens identified were deposited into the GenBank and were assigned accession numbers. Hence, with these specific primers, macergens can be identified with minimal quantities of the vegetable tissues using molecular techniques, for future use of the quarantine section of the Agricultural Department of the country for quick and rapid detection of macergens before exportation. PMID:26437427

  6. Universal Primers for Detection and Sequencing of Hepatitis B Virus Genomes across Genotypes A to G.


    Chook, Jack Bee; Teo, Woon Li; Ngeow, Yun Fong; Tee, Kok Keng; Ng, Kee Peng; Mohamed, Rosmawati


    Hepatitis B virus (HBV) has been divided into 10 genotypes, A to J, based on an 8% nucleotide sequence divergence between genotypes. The conventional practice of using a single set of primers to amplify a near-complete HBV genome is hampered by its low analytical sensitivity. The current practice of using overlapping conserved primer sets to amplify a complete HBV genome in a clinical sample is limited by the lack of pan-primers to detect all HBV genotypes. In this study, we designed six highly conserved, overlapping primer sets to cover the complete HBV genome. We based our design on the sequences of 5,154 HBV genomes of genotypes A to I downloaded from the GenBank nucleotide database. These primer sets were tested on 126 plasma samples from Malaysia, containing genotypes A to D and with viral loads ranging from 20 to >79,780,000 IU/ml. The overall success rates for PCR amplification and sequencing were >96% and >94%, respectively. Similarly, there was 100% amplification and sequencing success when the primer sets were tested on an HBV reference panel of genotypes A to G. Thus, we have established primer sets that gave a high analytical sensitivity for PCR-based detection of HBV and a high rate of sequencing success for HBV genomes in most of the viral genotypes, if not all, without prior known sequence data for the particular genotype/genome.

  7. Indexed PCR Primers Induce Template-Specific Bias in Large-Scale DNA Sequencing Studies.


    O'Donnell, James L; Kelly, Ryan P; Lowell, Natalie C; Port, Jesse A


    Massively parallel sequencing is rapidly emerging as an efficient way to quantify biodiversity at all levels, from genetic variation and expression to ecological community assemblage. However, the number of reads produced per sequencing run far exceeds the number required per sample for many applications, compelling researchers to sequence multiple samples per run in order to maximize efficiency. For studies that include a PCR step, this can be accomplished using primers that include an index sequence allowing sample origin to be determined after sequencing. The use of indexed primers assumes they behave no differently than standard primers; however, we found that indexed primers cause substantial template sequence-specific bias, resulting in radically different profiles of the same environmental sample. Likely the outcome of differential amplification efficiency due to primer-template mismatch, two indexed primer sets spuriously change the inferred sequence abundance from the same DNA extraction by up to 77.1%. We demonstrate that a double PCR approach alleviates these effects in applications where indexed primers are necessary.

  8. Human DNA polymerase α in binary complex with a DNA:DNA template-primer.


    Coloma, Javier; Johnson, Robert E; Prakash, Louise; Prakash, Satya; Aggarwal, Aneel K


    The Polα/primase complex assembles the short RNA-DNA fragments for priming of lagging and leading strand DNA replication in eukaryotes. As such, the Polα polymerase subunit encounters two types of substrates during primer synthesis: an RNA:DNA helix and a DNA:DNA helix. The engagement of the polymerase subunit with the DNA:DNA helix has been suggested as the of basis for primer termination in eukaryotes. However, there is no structural information on how the Polα polymerase subunit actually engages with a DNA:DNA helix during primer synthesis. We present here the first crystal structure of human Polα polymerase subunit in complex with a DNA:DNA helix. Unexpectedly, we find that portion of the DNA:DNA helix in contact with the polymerase is not in a B-form but in a hybrid A-B form. Almost all of the contacts observed previously with an RNA primer are preserved with a DNA primer--with the same set of polymerase residues tracking the sugar-phosphate backbone of the DNA or RNA primer. Thus, rather than loss of specific contacts, the free energy cost of distorting DNA from B- to hybrid A-B form may augur the termination of primer synthesis in eukaryotes.

  9. Guidelines for the tetra-primer ARMS-PCR technique development.


    Medrano, Ruan Felipe Vieira; de Oliveira, Camila Andréa


    The tetra-primer amplification refractory mutation system-polymerase chain (ARMS-PCR) reaction is a simple and economical method to genotype single-nucleotide polymorphisms (SNPs). It uses four primers in a single PCR and is followed just by gel electrophoresis. However, the optimization step can be very hardworking and time-consuming. Hence, we propose to demonstrate and discuss critical steps for its development, in a way to provide useful information. Two SNPs that provided different amplification conditions were selected. DNA extraction methods, annealing temperatures, PCR cycles protocols, reagents, and primers concentration were also analyzed. The use of tetra-primer ARMS-PCR could be impaired for SNPs in DNA regions rich in cytosine and guanine and for samples with DNA not purified. The melting temperature was considered the factor of greater interference. However, small changes in the reagents concentration significantly affect the PCR, especially MgCl2. Balancing the inner primers band is also a key step. So, in order to balance the inner primers band, intensity is important to observe which one has the weakest band and promote its band by increasing its concentration. The use of tetra-primer ARMS-PCR attends the expectations of modern genomic research and allows the study of SNPs in a fast, reliable, and low-cost way.

  10. Primer effect in the detection of mitochondrial DNA point heteroplasmy by automated sequencing.


    Calatayud, Marta; Ramos, Amanda; Santos, Cristina; Aluja, Maria Pilar


    The correct detection of mitochondrial DNA (mtDNA) heteroplasmy by automated sequencing presents methodological constraints. The main goals of this study are to investigate the effect of sense and distance of primers in heteroplasmy detection and to test if there are differences in the accurate determination of heteroplasmy involving transitions or transversions. A gradient of the heteroplasmy levels was generated for mtDNA positions 9477 (transition G/A) and 15,452 (transversion C/A). Amplification and subsequent sequencing with forward and reverse primers, situated at 550 and 150 bp from the heteroplasmic positions, were performed. Our data provide evidence that there is a significant difference between the use of forward and reverse primers. The forward primer is the primer that seems to give a better approximation to the real proportion of the variants. No significant differences were found concerning the distance at which the sequencing primers were placed neither between the analysis of transitions and transversions. The data collected in this study are a starting point that allows to glimpse the importance of the sequencing primers in the accurate detection of point heteroplasmy, providing additional insight into the overall automated sequencing strategy.

  11. RNA Primer Extension Hinders DNA Synthesis by Escherichia coli Mutagenic DNA Polymerase IV.


    Tashjian, Tommy F; Lin, Ida; Belt, Verena; Cafarelli, Tiziana M; Godoy, Veronica G


    In Escherichia coli the highly conserved DNA damage regulated dinB gene encodes DNA Polymerase IV (DinB), an error prone specialized DNA polymerase with a central role in stress-induced mutagenesis. Since DinB is the DNA polymerase with the highest intracellular concentrations upon induction of the SOS response, further regulation must exist to maintain genomic stability. Remarkably, we find that DinB DNA synthesis is inherently poor when using an RNA primer compared to a DNA primer, while high fidelity DNA polymerases are known to have no primer preference. Moreover, we show that the poor DNA synthesis from an RNA primer is conserved in DNA polymerase Kappa, the human DinB homolog. The activity of DinB is modulated by interactions with several other proteins, one of which is the equally evolutionarily conserved recombinase RecA. This interaction is known to positively affect DinB's fidelity on damaged templates. We find that upon interaction with RecA, DinB shows a significant reduction in DNA synthesis when using an RNA primer. Furthermore, with DinB or DinB:RecA a robust pause, sequence and lesion independent, occurs only when RNA is used as a primer. The robust pause is likely to result in abortive DNA synthesis when RNA is the primer. These data suggest a novel mechanism to prevent DinB synthesis when it is not needed despite its high concentrations, thus protecting genome stability.

  12. Shop primer as part of the corrosion protective coating for submerged steel structures

    SciTech Connect

    Bjordal, M.; Steinsmo, U.


    In Norwegian workshops the standard pre-treatment procedures for steel structures intended for sub-sea use, normally include removal of shop primer by blast cleaning to Sa 2 1/2 before application of corrosion protective coatings. This is also stated in the Norwegian offshore standard NORSOK. Omitting this stage in fabrication will represent large reductions in both time consumption and costs, and reduce the volume of waste from the blast cleaning. This report presents results from investigations of how a shop primer will influence on the coating properties. The aim of the investigation was to test whether the systems are good enough if the shop primer is left on the surface. Two different zinc silicate shop primers have been included in the investigation. As protective coatings the authors have used three different epoxy mastic systems with Al pigments. In addition to panels with original shop primer, they have also tested shop primed panels pre-treated in various ways, such as heated, corroded and blast cleaned to various degrees before coating. The coatings have been tested in the ASTM-G8 121 test and in a long term test in sea water polarized with a Zn anode. They have found that coatings including the zinc silicate shop primer are more susceptible to cathodic disbonding than the coating applied directly on blast cleaned steel. It is however possible to meet the NORSOK criteria with a zinc silicate shop primer as first coat.

  13. Noncontinuously binding loop-out primers for avoiding problematic DNA sequences in PCR and sanger sequencing.


    Sumner, Kelli; Swensen, Jeffrey J; Procter, Melinda; Jama, Mohamed; Wooderchak-Donahue, Whitney; Lewis, Tracey; Fong, Michael; Hubley, Lindsey; Schwarz, Monica; Ha, Youna; Paul, Eleri; Brulotte, Benjamin; Lyon, Elaine; Bayrak-Toydemir, Pinar; Mao, Rong; Pont-Kingdon, Genevieve; Best, D Hunter


    We present a method in which noncontinuously binding (loop-out) primers are used to exclude regions of DNA that typically interfere with PCR amplification and/or analysis by Sanger sequencing. Several scenarios were tested using this design principle, including M13-tagged PCR primers, non-M13-tagged PCR primers, and sequencing primers. With this technique, a single oligonucleotide is designed in two segments that flank, but do not include, a short region of problematic DNA sequence. During PCR amplification or sequencing, the problematic region is looped-out from the primer binding site, where it does not interfere with the reaction. Using this method, we successfully excluded regions of up to 46 nucleotides. Loop-out primers were longer than traditional primers (27 to 40 nucleotides) and had higher melting temperatures. This method allows the use of a standardized PCR protocol throughout an assay, keeps the number of PCRs to a minimum, reduces the chance for laboratory error, and, above all, does not interrupt the clinical laboratory workflow.

  14. Comprehensive Primer Design for Analysis of Population Genetics in Non-Sequenced Organisms

    PubMed Central

    Tezuka, Ayumi; Matsushima, Noe; Nemoto, Yoriko; Akashi, Hiroshi D.; Kawata, Masakado; Makino, Takashi


    Nuclear sequence markers are useful tool for the study of the history of populations and adaptation. However, it is not easy to obtain multiple nuclear primers for organisms with poor or no genomic sequence information. Here we used the genomes of organisms that have been fully sequenced to design comprehensive sets of primers to amplify polymorphic genomic fragments of multiple nuclear genes in non-sequenced organisms. First, we identified a large number of candidate polymorphic regions that were flanked on each side by conserved regions in the reference genomes. We then designed primers based on these conserved sequences and examined whether the primers could be used to amplify sequences in target species, montane brown frog (Rana ornativentris), anole lizard (Anolis sagrei), guppy (Poecilia reticulata), and fruit fly (Drosophila melanogaster), for population genetic analysis. We successfully obtained polymorphic markers for all target species studied. In addition, we found that sequence identities of the regions between the primer sites in the reference genomes affected the experimental success of DNA amplification and identification of polymorphic loci in the target genomes, and that exonic primers had a higher success rate than intronic primers in amplifying readable sequences. We conclude that this comparative genomic approach is a time- and cost-effective way to obtain polymorphic markers for non-sequenced organisms, and that it will contribute to the further development of evolutionary ecology and population genetics for non-sequenced organisms, aiding in the understanding of the genetic basis of adaptation. PMID:22393396

  15. PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences

    PubMed Central

    Machida, Ryuji J.; Knowlton, Nancy


    Background Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. Methodology/Principal Findings Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. Conclusions/Significance The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S) and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other marker regions as targets

  16. An Investigation to Improve Quality Evaluations of Primers and Propellant for 20mm Munitions

    NASA Technical Reports Server (NTRS)

    Bement, L. J.; Holmes, C.; McGrory, J.; Schimmel, M. L.


    To reduce the frequency of electrically initiated, 20mm munition hangfires (delayed ignitions), a joint Army/NASA investigation was conducted to recommend quality evaluation improvements for acceptance of both primers and gun propellant. This effort focused only on evaluating ignition and combustion performance as potential causes of hangfires: poor electrical initiation of the primer, low output performance of the primer, low ignition sensitivity of the gun propellant, and the effects of cold temperature. The goal was to determine the "best" of the Army and NASA test methods to assess the functional performance of primers and gun propellants. The approach was to evaluate the performance of both high-quality and deliberately defective primers to challenge the sensitivity of test methods. In addition, the ignition sensitivity of different manufacturing batches of gun propellants was evaluated. The results of the investigation revealed that improvements can be made in functional evaluations that can assist in identifying and reducing ignition and performance variations. The "best" functional evaluation of primers and propellant is achieved through a combination of both Army and NASA test methods. Incorporating the recommendations offered in this report may provide for considerable savings in reducing the number of cartridge firings, while significantly lowering the rejection rate of primer, propellant and cartridge lots. The most probable causes for ignition and combustion-related hangfires were the lack of calcium silicide in the primer mix, a low output performance of primers, and finally, poor ignition sensitivity of gun propellant. Cold temperatures further reduce propellant ignition sensitivity, as well as reducing burn rate and chamber pressures.

  17. Design and evaluation of primers targeting genes encoding NO-forming nitrite reductases: implications for ecological inference of denitrifying communities

    PubMed Central

    Bonilla-Rosso, Germán; Wittorf, Lea; Jones, Christopher M.; Hallin, Sara


    The detection of NO-forming nitrite reductase genes (nir) has become the standard when studying denitrifying communities in the environment, despite well-known amplification biases in available primers. We review the performance of 35 published and 121 newly designed primers targeting the nirS and nirK genes, against sequences from complete genomes and 47 metagenomes from three major habitats where denitrification is important. There were no optimal universal primer pairs for either gene, although published primers targeting nirS displayed up to 75% coverage. The alternative is clade-specific primers, which show a trade-off between coverage and specificity. The test against metagenomic datasets showed a distinct performance of primers across habitats. The implications of clade-specific nir primers choice and their performance for ecological inference when used for quantitative estimates and in sequenced-based community ecology studies are discussed and our phylogenomic primer evaluation can be used as a reference along with their environmental specificity as a guide for primer selection. Based on our results, we also propose a general framework for primer evaluation that emphasizes the testing of coverage and phylogenetic range using full-length sequences from complete genomes, as well as accounting for environmental range using metagenomes. This framework serves as a guideline to simplify primer performance comparisons while explicitly addressing the limitations and biases of the primers evaluated. PMID:27966627

  18. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.


    Cheng, Yu-Huei


    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  19. Estimation of teaching-learning-based optimization primer design using regression analysis for different melting temperature calculations.


    Cheng, Yu-Huei


    Primers plays important role in polymerase chain reaction (PCR) experiments, thus it is necessary to select characteristic primers. Unfortunately, manual primer design manners are time-consuming and easy to get human negligence because many PCR constraints must be considered simultaneously. Automatic programs for primer design were developed urgently. In this study, the teaching-learning-based optimization (TLBO), a robust and free of algorithm-specific parameters method, is applied to screen primers conformed primer constraints. The optimal primer frequency (OPF) based on three known melting temperature formulas is estimated by 500 runs for primer design in each different number of generations. We selected optimal primers from fifty random nucleotide sequences of Homo sapiens at NCBI. The results indicate that the SantaLucia's formula is better coupled with the method to get higher optimal primer frequency and shorter CPU-time than the Wallace's formula and the Bolton and McCarthy's formula. Through the regression analysis, we also find the generations are significantly associated with the optimal primer frequency. The results are helpful for developing the novel TLBO-based computational method to design feasible primers.

  20. Magnetic Helicity and Large Scale Magnetic Fields: A Primer

    NASA Astrophysics Data System (ADS)

    Blackman, Eric G.


    Magnetic fields of laboratory, planetary, stellar, and galactic plasmas commonly exhibit significant order on large temporal or spatial scales compared to the otherwise random motions within the hosting system. Such ordered fields can be measured in the case of planets, stars, and galaxies, or inferred indirectly by the action of their dynamical influence, such as jets. Whether large scale fields are amplified in situ or a remnant from previous stages of an object's history is often debated for objects without a definitive magnetic activity cycle. Magnetic helicity, a measure of twist and linkage of magnetic field lines, is a unifying tool for understanding large scale field evolution for both mechanisms of origin. Its importance stems from its two basic properties: (1) magnetic helicity is typically better conserved than magnetic energy; and (2) the magnetic energy associated with a fixed amount of magnetic helicity is minimized when the system relaxes this helical structure to the largest scale available. Here I discuss how magnetic helicity has come to help us understand the saturation of and sustenance of large scale dynamos, the need for either local or global helicity fluxes to avoid dynamo quenching, and the associated observational consequences. I also discuss how magnetic helicity acts as a hindrance to turbulent diffusion of large scale fields, and thus a helper for fossil remnant large scale field origin models in some contexts. I briefly discuss the connection between large scale fields and accretion disk theory as well. The goal here is to provide a conceptual primer to help the reader efficiently penetrate the literature.

  1. Binary electrokinetic separation of target DNA from background DNA primers.

    SciTech Connect

    James, Conrad D.; Derzon, Mark Steven


    This report contains the summary of LDRD project 91312, titled ''Binary Electrokinetic Separation of Target DNA from Background DNA Primers''. This work is the first product of a collaboration with Columbia University and the Northeast BioDefense Center of Excellence. In conjunction with Ian Lipkin's lab, we are developing a technique to reduce false positive events, due to the detection of unhybridized reporter molecules, in a sensitive and multiplexed detection scheme for nucleic acids developed by the Lipkin lab. This is the most significant problem in the operation of their capability. As they are developing the tools for rapidly detecting the entire panel of hemorrhagic fevers this technology will immediately serve an important national need. The goal of this work was to attempt to separate nucleic acid from a preprocessed sample. We demonstrated the preconcentration of kilobase-pair length double-stranded DNA targets, and observed little preconcentration of 60 base-pair length single-stranded DNA probes. These objectives were accomplished in microdevice formats that are compatible with larger detection systems for sample pre-processing. Combined with Columbia's expertise, this technology would enable a unique, fast, and potentially compact method for detecting/identifying genetically-modified organisms and multiplexed rapid nucleic acid identification. Another competing approach is the DARPA funded IRIS Pharmaceutical TIGER platform which requires many hours for operation, and an 800k$ piece of equipment that fills a room. The Columbia/SNL system could provide a result in 30 minutes, at the cost of a few thousand dollars for the platform, and would be the size of a shoebox or smaller.

  2. A primer on trace metal-sediment chemistry

    USGS Publications Warehouse

    Horowitz, Arthur J.


    In most aquatic systems, concentrations of trace metals in suspended sediment and the top few centimeters of bottom sediment are far greater than concentrations of trace metals dissolved in the water column. Consequently, the distribution, transport, and availability of these constituents can not be intelligently evaluated, nor can their environmental impact be determined or predicted solely through the sampling and analysis of dissolved phases. This Primer is designed to acquaint the reader with the basic principles that govern the concentration and distribution of trace metals associated with bottom and suspended sediments. The sampling and analysis of suspended and bottom sediments are very important for monitoring studies, not only because trace metal concentrations associated with them are orders of magnitude higher than in the dissolved phase, but also because of several other factors. Riverine transport of trace metals is dominated by sediment. In addition, bottom sediments serve as a source for suspended sediment and can provide a historical record of chemical conditions. This record will help establish area baseline metal levels against which existing conditions can be compared. Many physical and chemical factors affect a sediment's capacity to collect and concentrate trace metals. The physical factors include grain size, surface area, surface charge, cation exchange capacity, composition, and so forth. Increases in metal concentrations are strongly correlated with decreasing grain size and increasing surface area, surface charge, cation exchange capacity, and increasing concentrations of iron and manganese oxides, organic matter, and clay minerals. Chemical factors are equally important, especially for differentiating between samples having similar bulk chemistries and for inferring or predicting environmental availability. Chemical factors entail phase associations (with such sedimentary components as interstitial water, sulfides, carbonates, and organic

  3. A primer on incentive regulation for electric utilities

    SciTech Connect

    Hill, L.J.


    In contemplating a regulatory approach, the challenge for regulators is to develop a model that provides incentives for utilities to engage in socially desirable behavior. In this primer, we provide guidance on this process by discussing (1) various models of economic regulation, (2) problems implementing these models, and (3) the types of incentives that various models of regulation provide electric utilities. We address five regulatory models in depth. They include cost-of-service regulation in which prudently incurred costs are reflected dollar-for-dollar in rates and four performance-based models: (1) price-cap regulation, in which ceilings are placed on the average price that a utility can charge its customers; (2) revenue-cap regulation, in which a ceiling is placed on revenues; (3) rate-of-return bandwidth regulation, in which a utility`s rates are adjusted if earnings fall outside a {open_quotes}band{close_quotes} around equity returns; and (4) targeted incentives, in which a utility is given incentives to improve specific components of its operations. The primary difference between cost-of-service and performance-based approaches is the latter sever the tie between costs and prices. A sixth, {open_quotes}mixed approach{close_quotes} combines two or more of the five basic ones. In the recent past, a common mixed approach has been to combine targeted incentives with cost-of-service regulation. A common example is utilities that are subject to cost-of-service regulation are given added incentives to increase the efficiency of troubled electric-generating units.

  4. Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples1

    PubMed Central

    Zuntini, Alexandre R.; Fonseca, Luiz Henrique M.; Lohmann, Lúcia G.


    • Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae. PMID:25202586

  5. PCR primers for 30 novel gene regions in the nuclear genomes of Lepidoptera.


    Wahlberg, Niklas; Peña, Carlos; Ahola, Milla; Wheat, Christopher W; Rota, Jadranka


    We report primer pairs for 30 new gene regions in the nuclear genomes of Lepidoptera that can be amplified using a standard PCR protocol. The new primers were tested across diverse Lepidoptera, including nonditrysians and a wide selection of ditrysians. These new gene regions give a total of 11,043 bp of DNA sequence data and they show similar variability to traditionally used nuclear gene regions in studies of Lepidoptera. We feel that a PCR-based approach still has its place in molecular systematic studies of Lepidoptera, particularly at the intrafamilial level, and our new set of primers now provides a route to generating phylogenomic datasets using traditional methods.

  6. Improved COI barcoding primers for Southeast Asian perching birds (Aves: Passeriformes).


    Lohman, David J; Prawiradilaga, Dewi M; Meier, Rudolf


    The All Birds Barcoding Initiative aims to assemble a DNA barcode database for all bird species, but the 648-bp 'barcoding' region of cytochrome c oxidase subunit I (COI) can be difficult to amplify in Southeast Asian perching birds (Aves: Passeriformes). Using COI sequences from complete mitochondrial genomes, we designed a primer pair that more reliably amplifies and sequences the COI barcoding region of Southeast Asian passerine birds. The 655-bp region amplified with these primers overlaps the COI region amplified with other barcoding primer pairs, enabling direct comparison of sequences with previously published DNA barcodes.

  7. Microsatellite primers in the lichen symbiotic alga Trebouxia decolorans (Trebouxiophyceae)1

    PubMed Central

    Dal Grande, Francesco; Beck, Andreas; Singh, Garima; Schmitt, Imke


    • Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. • Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. • Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont. PMID:25202529

  8. A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

    SciTech Connect

    Warwick, William M.


    This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

  9. Chrome-Free Paint Primer for Zn/Ni Plated High-Strength Steel (Briefing Charts)

    DTIC Science & Technology


    Chrome-Free Paint Primer for Zn/Ni Plated High- Strength Steel 11-19-14 Presentation at ASETSDefense 2014 George Zafiris Team: Mark Jaworowski, Mike...AND SUBTITLE Chrome-Free Paint Primer for Zn/Ni Plated High-Strength Steel 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER ANSI Std Z39-18 Background High-Strength Steel (Substrate) LHE Cd layer Cr(VI) Primer CCC High-Strength Steel (Substrate) LHE Zn/Ni layer

  10. Express primer tool for high-throughput gene cloning and expression.

    SciTech Connect

    Yoon, J. R.; Laible, P. D.; Gu, M.; Scott, H. N.; Collart, F. R.; Biosciences Division


    High-throughput approaches for gene cloning and expression require the development of new nonstandard tools for molecular biologists and biochemists. We introduce a Web-based tool to design primers specifically for the generation of expression clones for both laboratory-scale and high-throughput projects. The application is designed not only to allow the user complete flexibility to specify primer design parameters but also to minimize the amount of manual intervention needed to generate a large number of primers for the simultaneous amplification of multiple target genes.

  11. Use of tannin anticorrosive reaction primer to improve traditional coating systems

    SciTech Connect

    Matamala, G.; Droguett, G. ); Smeltzer, W. . Inst. for Materials Research)


    Different anticorrosive schemes applied over plain or previously shot-blasted surfaces of AISI 1010 (UNS G10100) steel plates were compared. Plates were painted with alkydic, vinylic, and epoxy anticorrosive schemes over metal treated previously with pine tannin reaction primer and over its own schemes without previous primer treatment. Anticorrosive tests were conducted in a salt fog chamber according to ASTM B 117-73. Rusting, blistering, and adhesion were assessed over time. The survey was complemented with potentiodynamic scanning tests in sodium chloride (NaCl) solution with a concentration equivalent to seawater. Corrosion currents were determined using Tafel and polarization resistance techniques. Results showed the reaction primer inhibited corrosion by improving adherence. Advantages over traditional conversion primers formulated in a base of zinc chromate in phosphoric medium were evident.

  12. Abridged adapter primers increase the target scope of Hi-Plex.


    Nguyen-Dumont, Tú; Hammet, Fleur; Mahmoodi, Maryam; Pope, Bernard J; Giles, Graham G; Hopper, John L; Southey, Melissa C; Park, Daniel J


    Previously, we reported Hi-Plex, an amplicon-based method for targeted massively parallel sequencing capable of generating 60 amplicons simultaneously. In further experiments, however, we found our approach did not scale to higher amplicon numbers. Here, we report a modification to the original Hi-Plex protocol that includes the use of abridged adapter oligonucleotides as universal primers (bridge primers) in the initial PCR mixture. Full-length adapter primers (indexing primers) are included only during latter stages of thermal cycling with concomitant application of elevated annealing temperatures. Using this approach, we demonstrate the application of Hi-Plex across a broad range of amplicon numbers (16-plex, 62-plex, 250-plex, and 1003-plex) while preserving the low amount (25 ng) of input DNA required.

  13. Mechanism of Concerted RNA-DNA Primer Synthesis by the Human Primosome.


    Baranovskiy, Andrey G; Babayeva, Nigar D; Zhang, Yinbo; Gu, Jianyou; Suwa, Yoshiaki; Pavlov, Youri I; Tahirov, Tahir H


    The human primosome, a 340-kilodalton complex of primase and DNA polymerase α (Polα), synthesizes chimeric RNA-DNA primers to be extended by replicative DNA polymerases δ and ϵ. The intricate mechanism of concerted primer synthesis by two catalytic centers was an enigma for over three decades. Here we report the crystal structures of two key complexes, the human primosome and the C-terminal domain of the primase large subunit (p58C) with bound DNA/RNA duplex. These structures, along with analysis of primase/polymerase activities, provide a plausible mechanism for all transactions of the primosome including initiation, elongation, accurate counting of RNA primer length, primer transfer to Polα, and concerted autoregulation of alternate activation/inhibition of the catalytic centers. Our findings reveal a central role of p58C in the coordinated actions of two catalytic domains in the primosome and ultimately could impact the design of anticancer drugs.

  14. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico

    PubMed Central

    Ramírez-Hernández, Dolores G.; Lara-Padilla, Eleazar; Zárate-Segura, Paola


    Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing. PMID:27563666

  15. Design of primer pairs for species-specific diagnosis of Leishmania (Leishmania) infantum chagasi using PCR.


    da Silveira Neto, Osvaldo José; Duarte, Sabrina Castilho; da Costa, Hérika Xavier; Linhares, Guido Fontgalland Coelho


    The objective of this study was to design and evaluate new primers for species-specific detection of L. infantum chagasi using PCR. Two combinations of primer pairs were established with the aim of obtaining specific amplification products from the L. infantum chagasi 18S rRNA gene. The combinations of the primer pairs and the respective sizes of the PCR products, based on the U422465 GenBank reference sequence of L. infantum chagasi, were: LCS1/LCS3 (259 bp) and LCS2/LCS3 (820 bp). It was concluded that the new PCR assays optimized using the primer pairs LCS1/LCS3 and LCS2/LCS3 were effective for specific detection of L. infantum chagasi, with analytical sensitivity to detect 1 pg/µL of DNA.

  16. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico.


    Bastida-González, Fernando; Ramírez-Hernández, Dolores G; Chavira-Suárez, Erika; Lara-Padilla, Eleazar; Zárate-Segura, Paola


    Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing.

  17. A Telecommunications Primer for College Presidents. Part I. The Technologies Defined. Educational Technology Profile 25.

    ERIC Educational Resources Information Center

    Smith, Ralph Lee


    Intended for use by presidents, planners, and administrators to acquaint them with developments in electronic communications, this primer describes cable television, common carrier, videotape recorders and videodiscs, satellites, microwave, circuit integration, digital transmission, data packet switching, and fiber optics. (LBH)


    EPA Science Inventory

    Background The Internal Transcribed Spacer (ITS) regions of fungal ribosomal DNA (rDNA) are highly variable sequences of great importance in distinguishing fungal species by PCR analysis. Previously published PCR primers available for amplifying these sequences from environmenta...

  19. Mega primer-mediated molecular cloning strategy for chimaeragenesis and long DNA fragment insertion.


    Zhang, Hui; Liu, Chang-Jun; Jiang, Hui; Zhou, Lu; Li, Wen-Ying; Zhu, Ling-Yun; Wu, Lei; Meng, Er; Zhang, Dong-Yi


    Molecular cloning methods based on primer and overlap-extension PCR are widely used due to their simplicity, reliability, low cost and high efficiency. In this article, an efficient mega primer-mediated (MP) cloning strategy for chimaeragenesis and long DNA fragment insertion is presented. MP cloning is a seamless, restriction/ligation-independent method that requires only three steps: (i) the first PCR for mega primer generation; (ii) the second PCR for exponential amplification mediated by the mega primers and (iii) DpnI digestion and transformation. Most importantly, for chimaeragenesis, genes can be assembled and constructed into the plasmid vector in a single PCR step. By employing this strategy, we successfully inserted four DNA fragments (approximately 500 bp each) into the same vector simultaneously. In conclusion, the strategy proved to be a simple and efficient tool for seamless cloning.

  20. Microsatellite primers in the foundation tree species Pinus edulis and P. monophylla (Pinaceae)1

    PubMed Central

    Krohn, Andrew L.; Flores-Rentería, Lluvia; Gehring, Catherine A.


    • Premise of the study: Microsatellite primers were developed in the foundational tree species Pinus edulis to investigate population differentiation of P. edulis and hybridization among closely related species. • Methods and Results: Using a hybridization protocol, primer sets for 11 microsatellite loci were developed using megagametophyte tissue from P. edulis and scored for polymorphism in three populations of P. edulis and a single P. monophylla population. The primers amplified simple and compound di-, tri-, and pentanucleotide repeats with two to 18 alleles per locus. • Conclusions: These results demonstrate the utility of the described primers for studies of population differentiation within and among P. edulis populations as well as across putative hybrid zones where P. edulis may coexist with sister species. PMID:25202571

  1. Primer retention owing to the absence of RNase H1 is catastrophic for mitochondrial DNA replication.


    Holmes, J Bradley; Akman, Gokhan; Wood, Stuart R; Sakhuja, Kiran; Cerritelli, Susana M; Moss, Chloe; Bowmaker, Mark R; Jacobs, Howard T; Crouch, Robert J; Holt, Ian J


    Encoding ribonuclease H1 (RNase H1) degrades RNA hybridized to DNA, and its function is essential for mitochondrial DNA maintenance in the developing mouse. Here we define the role of RNase H1 in mitochondrial DNA replication. Analysis of replicating mitochondrial DNA in embryonic fibroblasts lacking RNase H1 reveals retention of three primers in the major noncoding region (NCR) and one at the prominent lagging-strand initiation site termed Ori-L. Primer retention does not lead immediately to depletion, as the persistent RNA is fully incorporated in mitochondrial DNA. However, the retained primers present an obstacle to the mitochondrial DNA polymerase γ in subsequent rounds of replication and lead to the catastrophic generation of a double-strand break at the origin when the resulting gapped molecules are copied. Hence, the essential role of RNase H1 in mitochondrial DNA replication is the removal of primers at the origin of replication.

  2. A new approach to primer selection in polymerase chain reaction experiments

    SciTech Connect

    Pearson, W.R.; Robins, G.; Wrege, D.E.; Zhang, Tongtong


    We address the problem of primer selection in polymerase chain reaction (PCR) experiments. We prove that the problem of minimizing the number of primers required to amplify a set of DNA sequences is NP-complete, and show that even approximating solutions to this problem to within a constant factor times optimal is intractable. On the practical side, we give a simple branch-and-bound algorithm that solves the primers minimization problem within reasonable time for typical instances. We present an efficient approximation scheme for this problem, and prove that our heuristic always produces solutions no worse than a logarithmic factor times the optimal, this being the best approximation possible within polynomial time. Finally, we analyze a weighted variant, where both the number of primers as well as the sum of their {open_quotes}costs{close_quotes} is optimized simultaneously. We conclude by presenting the empirical performance of our methods on biological data.

  3. Oligonucleotide primers, probes and molecular methods for the environmental monitoring of methanogenic archaea

    PubMed Central

    Narihiro, Takashi; Sekiguchi, Yuji


    Summary For the identification and quantification of methanogenic archaea (methanogens) in environmental samples, various oligonucleotide probes/primers targeting phylogenetic markers of methanogens, such as 16S rRNA, 16S rRNA gene and the gene for the α‐subunit of methyl coenzyme M reductase (mcrA), have been extensively developed and characterized experimentally. These oligonucleotides were designed to resolve different groups of methanogens at different taxonomic levels, and have been widely used as hybridization probes or polymerase chain reaction primers for membrane hybridization, fluorescence in situ hybridization, rRNA cleavage method, gene cloning, DNA microarray and quantitative polymerase chain reaction for studies in environmental and determinative microbiology. In this review, we present a comprehensive list of such oligonucleotide probes/primers, which enable us to determine methanogen populations in an environment quantitatively and hierarchically, with examples of the practical applications of the probes and primers. PMID:21375721

  4. Streamlining DNA Barcoding Protocols: Automated DNA Extraction and a New cox1 Primer in Arachnid Systematics

    PubMed Central

    Vidergar, Nina; Toplak, Nataša; Kuntner, Matjaž


    Background DNA barcoding is a popular tool in taxonomic and phylogenetic studies, but for most animal lineages protocols for obtaining the barcoding sequences—mitochondrial cytochrome C oxidase subunit I (cox1 AKA CO1)—are not standardized. Our aim was to explore an optimal strategy for arachnids, focusing on the species-richest lineage, spiders by (1) improving an automated DNA extraction protocol, (2) testing the performance of commonly used primer combinations, and (3) developing a new cox1 primer suitable for more efficient alignment and phylogenetic analyses. Methodology We used exemplars of 15 species from all major spider clades, processed a range of spider tissues of varying size and quality, optimized genomic DNA extraction using the MagMAX Express magnetic particle processor—an automated high throughput DNA extraction system—and tested cox1 amplification protocols emphasizing the standard barcoding region using ten routinely employed primer pairs. Results The best results were obtained with the commonly used Folmer primers (LCO1490/HCO2198) that capture the standard barcode region, and with the C1-J-2183/C1-N-2776 primer pair that amplifies its extension. However, C1-J-2183 is designed too close to HCO2198 for well-interpreted, continuous sequence data, and in practice the resulting sequences from the two primer pairs rarely overlap. We therefore designed a new forward primer C1-J-2123 60 base pairs upstream of the C1-J-2183 binding site. The success rate of this new primer (93%) matched that of C1-J-2183. Conclusions The use of C1-J-2123 allows full, indel-free overlap of sequences obtained with the standard Folmer primers and with C1-J-2123 primer pair. Our preliminary tests suggest that in addition to spiders, C1-J-2123 will also perform in other arachnids and several other invertebrates. We provide optimal PCR protocols for these primer sets, and recommend using them for systematic efforts beyond DNA barcoding. PMID:25415202

  5. Design of a Combined Ballistic Simulator and Primer Force Experimental Fixture

    DTIC Science & Technology


    innovative methods used to research propellant ignition during the gun cycle have been combined into a single experimental fixture. The first...technique uses a force gauge behind the breech to measure the force acting in the primer cup, which should approximate breech pressure in the gun . These...where the base of the bullet would be in a gun and allows force acting in the primer cup to be measured while using a transparent chamber to view flame

  6. Investigation of Metastable Interstitial Composite (MIC) Materials for Electrically Initiated Lead Free Primers

    DTIC Science & Technology


    metals such as lead ( Pb ). The U. S. Army accepted this challenge for small caliber ammunition several years ago and established the ‘Green Ammunition...Program. One of the elements of this effort was to eliminate the use of lead ( Pb ) in percussion primers for small caliber gun ammunition. The U...proposed to engage parallel problems associated with the use of lead ( Pb ) in electric primers for medium caliber gun ammunition. The various MIC

  7. Adhesive bonding and the use of corrosion resistant primers. [for metal surface preparation

    NASA Technical Reports Server (NTRS)

    Hockridge, R. R.; Thibault, H. G.


    The use of an anti-corrosive primer has been shown to be essential to assure survival of a bonded structure in a hostile environment, particularly if a stress is to be applied to the adhesively bonded joint during the environmental exposure. For example, the Lockheed L-1011 TriStar assembly, after exhaustive evaluation tests specifies use of chromate filled inhibitive polysulfide sealants, and use of corrosion inhibiting adhesive primers prior to structural bonding with film adhesive.

  8. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates.


    Folmer, O; Black, M; Hoeh, W; Lutz, R; Vrijenhoek, R


    We describe "universal" DNA primers for polymerase chain reaction (PCR) amplification of a 710-bp fragment of the mitochondrial cytochrome c oxidase subunit I gene (COI) from 11 invertebrate phyla: Echinodermata, Mollusca, Annelida, Pogonophora, Arthropoda, Nemertinea, Echiura, Sipuncula, Platyhelminthes, Tardigrada, and Coelenterata, as well as the putative phylum Vestimentifera. Preliminary comparisons revealed that these COI primers generate informative sequences for phylogenetic analyses at the species and higher taxonomic levels.

  9. Composing Effective and Efficient E-mails: A Primer for Pharmacy Practitioners

    PubMed Central

    Feemster, Agnes Ann


    This primer describes the purpose and importance of e-mail as a key communication medium in the workplace. It emphasizes clarity as a primary modality to enhance efficiency and effectiveness. Finally, the primer reviews elements of grammar, punctuation, and style that contribute to each e-mail’s ability to meet language standards, enhance the writer’s image, and successfully transmit information. PMID:26715801

  10. Resin bonding of metal brackets to glazed zirconia with a porcelain primer

    PubMed Central

    Lee, Jung-Hwan; Lee, Milim; Kim, Kyoung-Nam


    Objective The aims of this study were to compare the shear bond strength between orthodontic metal brackets and glazed zirconia using different types of primer before applying resin cement and to determine which primer was more effective. Methods Zirconia blocks were milled and embedded in acrylic resin and randomly assigned to one of four groups: nonglazed zirconia with sandblasting and zirconia primer (NZ); glazed zirconia with sandblasting, etching, and zirconia primer (GZ); glazed zirconia with sandblasting, etching, and porcelain primer (GP); and glazed zirconia with sandblasting, etching, zirconia primer, and porcelain primer (GZP). A stainless steel metal bracket was bonded to each target surface with resin cement, and all specimens underwent thermal cycling. The shear bond strength of the specimens was measured by a universal testing machine. A scanning electron microscope, three-dimensional optical surface-profiler, and stereoscopic microscope were used to image the zirconia surfaces. The data were analyzed with one-way analyses of variance and the Fisher exact test. Results Group GZ showed significantly lower shear bond strength than did the other groups. No statistically significant differences were found among groups NZ, GP, and GZP. All specimens in group GZ showed adhesive failure between the zirconia and resin cement. In groups NZ and GP, bonding failed at the interface between the resin cement and bracket base or showed complex adhesive and cohesive failure. Conclusions Porcelain primer is the more appropriate choice for bonding a metal bracket to the surface of a full-contour glazed zirconia crown with resin cement. PMID:26629476

  11. Prim-SNPing: a primer designer for cost-effective SNP genotyping.


    Chang, Hsueh-Wei; Chuang, Li-Yeh; Cheng, Yu-Huei; Hung, Yu-Chen; Wen, Cheng-Hao; Gu, De-Leung; Yang, Cheng-Hong


    Many kinds of primer design (PD) software tools have been developed, but most of them lack a single nucleotide polymorphism (SNP) genotyping service. Here, we introduce the web-based freeware "Prim-SNPing," which, in addition to general PD, provides three kinds of primer design functions for cost-effective SNP genotyping: natural PD, mutagenic PD, and confronting two-pair primers (CTPP) PD. The natural PD and mutagenic PD provide primers and restriction enzyme mining for polymerase chain reaction-restriction fragment of length polymorphism (PCR-RFLP), while CTPP PD provides primers for restriction enzyme-free SNP genotyping. The PCR specificity and efficiency of the designed primers are improved by BLAST searching and evaluating secondary structure (such as GC clamps, dimers, and hairpins), respectively. The length pattern of PCR-RFLP using natural PD is user-adjustable, and the restriction sites of the RFLP enzymes provided by Prim-SNPing are confirmed to be absent within the generated PCR product. In CTPP PD, the need for a separate digestion step in RFLP is eliminated, thus making it faster and cheaper. The output of Prim-SNPing includes the primer list, melting temperature (Tm) value, GC percentage, and amplicon size with enzyme digestion information. The reference SNP (refSNP, or rs) clusters from the Single Nucleotide Polymorphism database (dbSNP) at the National Center for Biotechnology Information (NCBI), and multiple other formats of human, mouse, and rat SNP sequences are acceptable input. In summary, Prim-SNPing provides interactive, user-friendly and cost-effective primer design for SNP genotyping. It is freely available at

  12. MIPE: A metagenome-based community structure explorer and SSU primer evaluation tool

    PubMed Central

    Zhou, Quan


    An understanding of microbial community structure is an important issue in the field of molecular ecology. The traditional molecular method involves amplification of small subunit ribosomal RNA (SSU rRNA) genes by polymerase chain reaction (PCR). However, PCR-based amplicon approaches are affected by primer bias and chimeras. With the development of high-throughput sequencing technology, unbiased SSU rRNA gene sequences can be mined from shotgun sequencing-based metagenomic or metatranscriptomic datasets to obtain a reflection of the microbial community structure in specific types of environment and to evaluate SSU primers. However, the use of short reads obtained through next-generation sequencing for primer evaluation has not been well resolved. The software MIPE (MIcrobiota metagenome Primer Explorer) was developed to adapt numerous short reads from metagenomes and metatranscriptomes. Using metagenomic or metatranscriptomic datasets as input, MIPE extracts and aligns rRNA to reveal detailed information on microbial composition and evaluate SSU rRNA primers. A mock dataset, a real Metagenomics Rapid Annotation using Subsystem Technology (MG-RAST) test dataset, two PrimerProspector test datasets and a real metatranscriptomic dataset were used to validate MIPE. The software calls Mothur (v1.33.3) and the SILVA database (v119) for the alignment and classification of rRNA genes from a metagenome or metatranscriptome. MIPE can effectively extract shotgun rRNA reads from a metagenome or metatranscriptome and is capable of classifying these sequences and exhibiting sensitivity to different SSU rRNA PCR primers. Therefore, MIPE can be used to guide primer design for specific environmental samples. PMID:28350876

  13. Comparison of shear bond strength of orthodontic brackets using various zirconia primers

    PubMed Central

    Lee, Ji-Yeon; Kim, Jin-Seok


    Objective The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. Methods We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm2. The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). Results The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Conclusions Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses. PMID:26258062

  14. Simple and efficient oligonucleotide-directed mutagenesis using one primer and circular plasmid DNA template.


    Marotti, K R; Tomich, C S


    A rapid and simple procedure for site-directed mutagenesis is described. This method uses only a single oligonucleotide primer with the double-stranded circular plasmid DNA as the template for mutagenesis. The phage T4 gene 32 product is included during primer extension in vitro to increase efficiency. Single and multiple changes as well as deletions have been obtained at an efficiency of 1-2%.

  15. Detection of summer truffle (Tuber aestivum Vittad.) in ectomycorrhizae and in soil using specific primers.


    Gryndler, Milan; Hršelová, Hana; Soukupová, Lucie; Streiblová, Eva; Valda, Slavomír; Borovička, Jan; Gryndlerová, Hana; Gažo, Ján; Miko, Marián


    Tuber aestivum is becoming an important commodity of great economical value in some European countries. At the same time, it is a highly protected organism in other countries, where it needs careful treatment. A reliable method of detection in roots and soil is thus needed for assessment of geographic distribution, ecological studies and inoculation efficiency testing in man-made experiments. A PCR-based method of detection of T. aestivum using specific primers was therefore developed. A pair of PCR primers Tu1sekvF/Tu2sekvR selective for T. aestivum and some genotypes of Tuber mesentericum was designed on the basis of the known internal transcribed spacer T. aestivum sequences. TaiI restriction cleavage was then used to distinguish the two species. The selectivity of the designed primer pair was evaluated using DNA extracted from specimens of a further 13 Tuber spp. Subsequently, the selectivity and robustness to false-positive results with nontarget DNA of the designed primers was compared with two other primer pairs (UncI/UncII and BTAE-F/BTAEMB-R). The occurrence of T. aestivum in soil and ectomycorrhizae collected in its native habitat has been successfully detected using the designed primers and nested PCR. The method is reliable and thus suitable for detection of T. aestivum in the field.

  16. Single-primer PCR correction: a strategy for false-positive exclusion.


    Ma, J; Wang, P W; Yao, D; Wang, Y P; Yan, W; Guan, S C


    Polymerase chain reaction (PCR) technology plays an important role in molecular biology research, but false-positive and nonspecific PCR amplification have plagued many researchers. Currently, research on the optimization of the PCR system focuses on double-primer-based PCR products. This research has shown that PCR amplification based on single-primer binding to the DNA template is an important contributing factor to obtaining false-positive results, fragment impurity, and nonspecific fragment amplification, when the PCR conditions are highly restricted during PCR-based target gene cloning, detection of transgenic plants, simple-sequence repeat marker-assisted selection, and mRNA differential display. Here, we compared single- and double-primer amplification and proposed "single-primer PCR correction"; improvements in PCR that eliminate interference caused by single-primer-based nonspecific PCR amplification were demonstrated and the precision and success rates of experiments were increased. Although for some kinds of experiments, the improvement effect of single-primer PCR correction was variable, the precision and success rate could be elevated at 12-50% in our experiment by this way.

  17. Primer and platform effects on 16S rRNA tag sequencing


    Tremblay, Julien; Singh, Kanwar; Fern, Alison; ...


    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

  18. Primer and platform effects on 16S rRNA tag sequencing

    SciTech Connect

    Tremblay, Julien; Singh, Kanwar; Fern, Alison; Kirton, Edward S.; He, Shaomei; Woyke, Tanja; Lee, Janey; Chen, Feng; Dangl, Jeffery L.; Tringe, Susannah G.


    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as well as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.

  19. PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.


    Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong


    Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.

  20. Effect of metal primers and tarnish treatment on bonding between dental alloys and veneer resin

    PubMed Central

    Choo, Seung-Sik; Huh, Yoon-Hyuk; Cho, Lee-Ra


    PURPOSE The aim of this study was to evaluate the effect of metal primers on the bonding of dental alloys and veneer resin. Polyvinylpyrrolidone solution's tarnish effect on bonding strength was also investigated. MATERIALS AND METHODS Disk-shape metal specimens (diameter 8 mm, thickness 1.5 mm) were made from 3 kinds of alloy (Co-Cr, Ti and Au-Ag-Pd alloy) and divided into 4 groups per each alloy. Half specimens (n=12 per group) in tarnished group were immersed into polyvinylpyrrolidone solution for 24 hours. In Co-Cr and Ti-alloy, Alloy Primer (MDP + VBATDT) and MAC-Bond II (MAC-10) were applied, while Alloy Primer and V-Primer (VBATDT) were applied to Au-Ag-Pd alloys. After surface treatment, veneering composite resin were applied and shear bond strength test were conducted. RESULTS Alloy Primer showed higher shear bond strength than MAC-Bond II in Co-Cr alloys and Au-Ag-Pd alloy (P<.05). However, in Ti alloy, there was no significant difference between Alloy Primer and MAC-Bond II. Tarnished Co-Cr and Au-Ag-Pd alloy surfaces presented significantly decreased shear bond strength. CONCLUSION Combined use of MDP and VBATDT were effective in bonding of the resin to Co-Cr and Au-Ag-Pd alloy. Tarnish using polyvinylpyrrolidone solution negatively affected on the bonding of veneer resin to Co-Cr and Au-Ag-Pd alloys. PMID:26576256

  1. PrimerSNP: a web tool for whole-genome selection of allele-specific and common primers of phylogenetically-related bacterial genomic sequences

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The increasing number of genomic sequences of bacteria makes it possible to select unique SNPs of a particular strain/species at the whole genome level and thus design specific primers based on the SNPs. The high similarity of genomic sequences among phylogenetically-related bacteria requires the id...

  2. Functional genes to assess nitrogen cycling and aromatic hydrocarbon degradation: primers and processing matter

    PubMed Central

    Penton, C. Ryan; Johnson, Timothy A.; Quensen, John F.; Iwai, Shoko; Cole, James R.; Tiedje, James M.


    Targeting sequencing to genes involved in key environmental processes, i.e., ecofunctional genes, provides an opportunity to sample nature's gene guilds to greater depth and help link community structure to process-level outcomes. Vastly different approaches have been implemented for sequence processing and, ultimately, for taxonomic placement of these gene reads. The overall quality of next generation sequence analysis of functional genes is dependent on multiple steps and assumptions of unknown diversity. To illustrate current issues surrounding amplicon read processing we provide examples for three ecofunctional gene groups. A combination of in silico, environmental and cultured strain sequences was used to test new primers targeting the dioxin and dibenzofuran degrading genes dxnA1, dbfA1, and carAa. The majority of obtained environmental sequences were classified into novel sequence clusters, illustrating the discovery value of the approach. For the nitrite reductase step in denitrification, the well-known nirK primers exhibited deficiencies in reference database coverage, illustrating the need to refine primer-binding sites and/or to design multiple primers, while nirS primers exhibited bias against five phyla. Amino acid-based OTU clustering of these two N-cycle genes from soil samples yielded only 114 unique nirK and 45 unique nirS genus-level groupings, likely a reflection of constricted primer coverage. Finally, supervised and non-supervised OTU analysis methods were compared using the nifH gene of nitrogen fixation, with generally similar outcomes, but the clustering (non-supervised) method yielded higher diversity estimates and stronger site-based differences. High throughput amplicon sequencing can provide inexpensive and rapid access to nature's related sequences by circumventing the culturing barrier, but each unique gene requires individual considerations in terms of primer design and sequence processing and classification. PMID:24062736

  3. A randomised trial comparing the antibacterial effects of dentine primers against bacteria in natural root caries.


    Rolland, S L; McCabe, J F; Imazato, S; Walls, A W G


    As people are living longer and retaining their teeth into old age, root caries is an increasingly significant problem. A minimally invasive treatment strategy, involving sealing the root caries lesion with an antibacterial resin sealant, could be highly beneficial. The aim of this study was to compare the antibacterial properties of the primers of two proprietary dentine bonding agents, Clearfil SE Bond (SE; Kuraray Medical, Japan) and Clearfil Protect Bond (PB; Kuraray Medical), which contains the antibacterial monomer methacryloyloxydodecylpyridinium bromide. Fifty-two root caries lesions were identified and randomly assigned to a primer. The lesion was cleaned, isolated, sampled with a sharp spoon excavator, a primer applied and a second sample taken. Samples were transported in fastidious anaerobe broth, vortex-dispersed and serial dilutions inoculated onto selective agars. Reduction in colony-forming units (CFU, %) after primer application was calculated for both primers for bacterial growth on each selective agar and compared to a hypothesised mean of 100% (one-sample t test, p < 0.05). No significant differences between primers were seen, indicating efficient bacterial elimination by both materials. Comparing percent reduction between SE and PB for each agar (Mann-Whitney test, p < 0.05), a significantly greater CFU reduction by PB was seen for streptococci but not other bacteria. More lesions exhibited bacterial growth and several lesions demonstrated marked bacterial growth after treatment with SE compared with PB. Therefore, PB appears to exhibit superior antimicrobial properties, particularly against streptococci. Both primers are highly antibacterial towards root caries bacteria and may therefore be suitable for minimally invasive treatment.

  4. Circulating primers enhance platelet function and induce resistance to antiplatelet therapy

    PubMed Central

    Blair, T A; Moore, S F; Hers, I


    Background Aspirin and P2Y12 antagonists are antiplatelet compounds that are used clinically in patients with thrombosis. However, some patients are ‘resistant’ to antiplatelet therapy, which increases their risk of developing acute coronary syndromes. These patients often present with an underlying condition that is associated with altered levels of circulating platelet primers and platelet hyperactivity. Platelet primers cannot stimulate platelet activation, but, in combination with physiologic stimuli, significantly enhance platelet function. Objectives To explore the role of platelet primers in resistance to antiplatelet therapy, and to evaluate whether phosphoinositide 3-kinase (PI3K) contributes to this process. Methods and Results We used platelet aggregation, thromboxane A2 production and ex vivo thrombus formation as functional readouts of platelet activity. Platelets were treated with the potent P2Y12 inhibitor AR-C66096, aspirin, or a combination of both, in the presence or absence of the platelet primers insulin-like growth factor-1 (IGF-1) and thrombopoietin (TPO), or the Gz-coupled receptor ligand epinephrine. We found that platelet primers largely overcame the inhibitory effects of antiplatelet compounds on platelet functional responses. IGF-1-mediated and TPO-mediated, but not epinephrine-mediated, enhancements in the presence of antiplatelet drugs were blocked by the PI3K inhibitors wortmannin and LY294002. Conclusions These results demonstrate that platelet primers can contribute to antiplatelet resistance. Furthermore, our data demonstrate that there are PI3K-dependent and PI3K-independent mechanisms driving primer-mediated resistance to antiplatelet therapy. PMID:26039631

  5. New primers for detecting and quantifying denitrifying anaerobic methane oxidation archaea in different ecological niches.


    Ding, Jing; Ding, Zhao-Wei; Fu, Liang; Lu, Yong-Ze; Cheng, Shuk H; Zeng, Raymond J


    The significance of ANME-2d in methane sink in the environment has been overlooked, and there was no any study evaluating the distribution of ANME-2d in the environment. New primers were thus needed to be designed for following research. In this paper, a pair of primers (DP397F and DP569R) was designed to quantify ANME-2d. The specificity and amplification efficiency of this primer pair were acceptable. PCR amplification of another pair of primers (DP142F and DP779R) generated a single, bright targeted band from the enrichment sample, but yielded faint, multiple bands from the environmental samples. Nested PCR was conducted using the primers DP142F/DP779R in the first round and DP142F/DP569R in the second round, which generated a bright targeted band. Further phylogenetic analysis showed that these targeted bands were ANME-2d-related sequences. Real-time PCR showed that the copies of the 16s ribosomal RNA gene of ANME-2d in these samples ranged from 3.72 × 10(4) to 2.30 × 10(5) copies μg(-1) DNA, indicating that the percentage of ANME-2d was greatest in a polluted river sample and least in a rice paddy sample. These results demonstrate that the newly developed real-time PCR primers could sufficiently quantify ANME-2d and that nested PCR with an appropriate combination of the new primers could successfully detect ANME-2d in environmental samples; the latter finding suggests that ANME-2d may spread in environments.

  6. Specific primers for PCR amplification of the ITS1 (ribosomal DNA) of Trypanosoma lewisi.


    Desquesnes, Marc; Marc, Desquesnes; Kamyingkird, Ketsarin; Ketsarin, Kamyingkird; Yangtara, Sarawut; Sarawut, Yangtara; Milocco, Cristina; Cristina, Milocco; Ravel, Sophie; Sophie, Ravel; Wang, Ming-Hui; Ming-Hui, Wang; Lun, Zhao-Rong; Zhao-Rong, Lun; Morand, Serge; Serge, Morand; Jittapalapong, Sathaporn; Sathaporn, Jittapalapong


    Trypanosoma lewisi is a mild or non-pathogenic parasite of the sub-genus Herpetosoma transmitted by fleas to rats. In a previous study we described pan-trypanosome specific primers TRYP1 which amplify the ITS1 of ribosomal DNA by hybridizing in highly conserved regions of 18S and 5.8S genes. These primers proved to be useful for detecting T. lewisi DNA in laboratory rats, but a recent large scale survey in wild rodents demonstrated a lack of specificity. In the present study, we designed and evaluated mono-specific primers LEW1S and LEW1R, for the detection and identification of T. lewisi by a single-step PCR. These primers were designed inside the highly variable region of the ITS1 sequence of T. lewisi ribosomal DNA. The product size of 220 bp is specific to T. lewisi. The sensitivity limit was estimated between 0.055 and 0.55 pg of DNA per reaction, equivalent to 1-10 organisms per reaction. All the PCR products obtained from 6 different T. lewisi isolates were more than 98% similar with each other and similar to the sequences of T. lewisi already published in Genbank. All DNA of 7 T. lewisi stocks from China gave the specific 220 bp product. We showed that LEW1S and LEW1R primers enabled sensitive detection and identification of T. lewisi infection in laboratory and wild rats. This assay is recommended for monitoring T. lewisi infections in rat colonies or for studying infections in the wild fauna. An absence of cross reaction with human DNA means that these primers can be used to investigate atypical trypanosome infections in humans. Given the risk of T. lewisi infection in human, we believe that these primers will be beneficial for public health diagnosis and rodents investigation programmes.

  7. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    NASA Astrophysics Data System (ADS)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen


    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  8. Dental primer and adhesive containing a new antibacterial quaternary ammonium monomer dimethylaminododecyl methacrylate

    PubMed Central

    Cheng, Lei; Weir, Michael D.; Zhang, Ke; Arola, Dwayne D.; Zhou, Xuedong; Xu, Hockin H. K.


    Objectives The main reason for restoration failure is secondary caries caused by biofilm acids. Replacing the failed restorations accounts for 50–70% of all operative work. The objectives of this study were to incorporate a new quaternary ammonium monomer (dimethylaminododecyl methacrylate, DMADDM) and nanoparticles of silver (NAg) into a primer and an adhesive, and to investigate their effects on antibacterial and dentin bonding properties. Methods Scotchbond Multi-Purpose (SBMP) served as control. DMADDM was synthesized and incorporated with NAg into primer/adhesive. A dental plaque microcosm biofilm model with human saliva was used to investigate metabolic activity, colony-forming units (CFU), and lactic acid. Dentin shear bond strengths were measured. Results Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of the new DMADDM were orders of magnitude lower than those of a previous quaternary ammonium dimethacrylate (QADM). Uncured primer with DMADDM had much larger inhibition zones than QADM (p<0.05). Cured primer/adhesive with DMADDM-NAg greatly reduced biofilm metabolic activity (p<0.05). Combining DMADDM with NAg in primer/adhesive resulted in less CFU than DMADDM alone (p<0.05). Lactic acid production by biofilms was reduced by 20-fold via DMADDM-NAg, compared to control. Incorporation of DMADDM and NAg into primer/adhesive did not adversely affect dentin bond strength. Conclusions A new antibacterial monomer DMADDM was synthesized and incorporated into primer/adhesive for the first time. The bonding agents are promising to combat residual bacteria in tooth cavity and invading bacteria at tooth-restoration margins to inhibit caries. DMADDM and NAg are promising for use into a wide range of dental adhesive systems and restoratives. PMID:23353068

  9. Primer containing dimethylaminododecyl methacrylate kills bacteria impregnated in human dentin blocks

    PubMed Central

    Chen, Chen; Cheng, Lei; Weir, Michael D; Lin, Nancy J; Lin-Gibson, Sheng; Zhou, Xue-Dong; Xu, Hockin HK


    Antibacterial dimethylaminododecyl methacrylate (DMADDM) was recently synthesized. The objectives of this study were to: (1) investigate antibacterial activity of DMADDM-containing primer on Streptococcus mutans impregnated into dentin blocks for the first time, and (2) compare the antibacterial efficacy of DMADDM with a previous quaternary ammonium dimethacrylate (QADM). Scotchbond Multi-Purpose (SBMP) bonding agent was used. DMADDM and QADM were mixed into SBMP primer. Six primers were tested: SBMP control primer P, P+2.5% DMADDM, P+5% DMADDM, P+7.5% DMADDM, P+10% DMADDM, and P+10% QADM. S. mutans were impregnated into human dentin blocks, and each primer was applied to dentin to test its ability to kill bacteria in dentinal tubules. Bacteria in dentin were collected via a sonication method, and the colony-forming units (CFU) and inhibition zones were measured. The bacterial inhibition zone of P+10% DMADDM was 10 times that of control primer (P<0.05). CFU in dentin with P+10% DMADDM was reduced by three orders of magnitude, compared with control. DMADDM had a much stronger antibacterial effect than QADM, and antibacterial efficacy increased with increasing DMADDM concentration. Dentin shear bond strengths were similar among all groups (P>0.1). In conclusion, antibacterial DMADDM-containing primer was validated to kill bacteria inside dentin blocks, possessing a much stronger antibacterial potency than the previous QADM. DMADDM-containing bonding agent was effective in eradicating bacteria in dentin, and its efficacy was directly proportional to DMADDM mass fraction. Therefore, DMADDM may be promising for use in bonding agents as well as in other restorative and preventive materials to inhibit bacteria. PMID:27811846

  10. MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR.


    Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo


    Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR.

  11. Comparative assessment of 5' A/T-rich overhang sequences with optimal and sub-optimal primers to increase PCR yields and sensitivity.


    Arif, M; Ochoa-Corona, F M


    Efficient PCR amplifications require precisely designed and optimized oligonucleotide primers, components, and cycling conditions. Despite recent software development and reaction improvement, primer design can still be enhanced. The aims of this research are to understand (1) the effect on PCR efficiency and DNA yields of primer thermodynamics parameters, and (2) the incorporation of 5' A/T-rich overhanging sequences (flaps) during primer design. Two primer sets, one optimal (ΔG = 0) and one sub-optimal (ΔG = 0.9), were designed using web interface software Primer3, BLASTn, and mFold to target a movement protein gene of Tobacco mosaic virus. The optimal primer set amplifies a product of 195 bp and supports higher PCR sensitivity and yields compared to the sub-optimal primer set, which amplifies a product of 192 bp. Greater fluorescence was obtained using optimal primers compared to that with sub-optimal primers. Primers designed with sub-optimal thermodynamics can be substantially improved by adding 5' flaps. Results indicate that even if the performance of some primers can be improved substantially by 5' flap addition, not all primers will be similarly improved. Optimal 5' flap sequences are dependent on the primer sequences, and alter the primer's T m value. The manipulation of this feature may enhance primer's efficiency to increase the PCR sensitivity and DNA yield.

  12. Genus-Specific Primers for Study of Fusarium Communities in Field Samples.


    Karlsson, Ida; Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna


    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology.

  13. The effect of various primers on shear bond strength of zirconia ceramic and resin composite

    PubMed Central

    Sanohkan, Sasiwimol; Kukiattrakoon, Boonlert; Larpboonphol, Narongrit; Sae-Yib, Taewalit; Jampa, Thibet; Manoppan, Satawat


    Aims: To determine the in vitro shear bond strengths (SBS) of zirconia ceramic to resin composite after various primer treatments. Materials and Methods: Forty zirconia ceramic (Zeno, Wieland Dental) specimens (10 mm in diameter and 2 mm thick) were prepared, sandblasted with 50 μm alumina, and divided into four groups (n = 10). Three experimental groups were surface treated with three primers; CP (RelyX Ceramic Primer, 3M ESPE), AP (Alloy Primer, Kuraray Medical), and MP (Monobond Plus, Ivoclar Vivadent AG). One group was not treated and served as the control. All specimens were bonded to a resin composite (Filtek Supreme XT, 3M ESPE) cylinder with an adhesive system (Adper Scotchbond Multi-Purpose Plus Adhesive, 3M ESPE) and then stored in 100% humidity at 37°C for 24 h before SBS testing in a universal testing machine. Mean SBS (MPa) were analyzed with one-way analysis of variance (ANOVA) and the Tukey's Honestly Significant Difference (HSD) test (α = 0.05). Results: Group AP yielded the highest mean and standard deviation (SD) value of SBS (16.8 ± 2.5 MPa) and Group C presented the lowest mean and SD value (15.4 ± 1.6 MPa). The SBS did not differ significantly among the groups (P = 0.079). Conclusions: Within the limitations of this study, the SBS values between zirconia ceramic to resin composite using various primers and untreated surface were not significantly different. PMID:24347881

  14. Genus-Specific Primers for Study of Fusarium Communities in Field Samples

    PubMed Central

    Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna


    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

  15. Effect of 4-MET- and 10-MDP-based primers on resin bonding to titanium.


    Tsuchimoto, Youhei; Yoshida, Yasuhiro; Mine, Atsushi; Nakamura, Mariko; Nishiyama, Norihiro; Van Meerbeek, Bart; Suzuki, Kazuomi; Kuboki, Takuo


    The purpose of this study was to investigate the effect of a 4-MET- and 10-MDP-based primer on the bond strength of two resin cements (SuperBond C&B, Sun Medical; Panavia Fluoro Cement, Kuraray) to titanium (Ti). Ti plates were treated with six experimental primers consisting of, respectively, 10-MDP and 4-MET in concentrations of 0.1, 1 and 10wt%, or were kept untreated (control). The highest tensile bond strength of Panavia Fluoro Cement to Ti was obtained when the Ti surface was pre-treated with 10wt% 10-MDP and was significantly higher than that when a lower concentrated 10-MDP-based primer or any 4-MET-based primer was used. On the contrary, no significant difference in tensile bond strength of SuperBond C&B was found for the untreated and six pre-treated Ti surfaces, although pre-treatment with each 10-MDP-based primer resulted in a higher tensile bond strength as compared to any 4-MET pre-treatment. Altogether, the data obtained strongly suggest that 10-MDP is effective to improve the adhesive performance of resin to titanium.

  16. Synchrotron FTIR characterisation of automotive primer surfacer paint coatings for forensic purposes.


    Maric, Mark; van Bronswijk, Wilhelm; Lewis, Simon W; Pitts, Kari


    Synchrotron FTIR microspectroscopy was used to characterise and assess the chemical diversity of electrocoat primer, primer surfacer and basecoats of automotive paint samples from 75 vehicles representing a range of international car manufacturers. Significant diversity was found in the synchrotron FTIR data from the primer surfacer coats. Classification using principal component analysis revealed 14 discrete groups, which could be associated with the country of manufacture, the specific manufacturer and manufacturing plant, the year of manufacture of the vehicle and in some instances the number of layers in the paint system. The model generated from the primer surfacer was significantly more discriminating than a previous model generated from FTIR analysis of clear coats of the same vehicles. Analysis of the primer surfacer also avoids issues of possible environmental degradation and component migration seen with FTIR analysis of automotive clear coats. Providing such information concerning vehicle origin would aid in the development of investigative leads from the analysis of questioned automotive paint samples located at the scene of a crime or on the body/clothing of a hit and run victim.

  17. Enhanced primers for amplification of DNA barcodes from a broad range of marine metazoans

    PubMed Central


    Background Building reference libraries of DNA barcodes is relatively straightforward when specifically designed primers are available to amplify the COI-5P region from a relatively narrow taxonomic group (e.g. single class or single order). DNA barcoding marine communities have been comparatively harder to accomplish due to the broad taxonomic diversity and lack of consistently efficient primers. Although some of the so-called “universal” primers have been relatively successful, they still fail to amplify COI-5P of many marine animal groups, while displaying random success even among species within each group. Here we propose a new pair of primers designed to enhance amplification of the COI-5P region in a wide range of marine organisms. Results Amplification tests conducted on a wide range of marine animal taxa, rendered possible the first–time sequencing of DNA barcodes from eight separated phyla (Annelida, Arthropoda, Chordata, Cnidaria, Echinodermata, Mollusca, Nemertea and Platyhelminthes), comprising a total of 14 classes, 28 orders, 57 families, 68 genus and 76 species. Conclusions These primers demonstrated to be highly cost-effective, which is of key importance for DNA barcoding procedures, such as for building comprehensive DNA barcode libraries of marine communities, where the processing of a large numbers of specimens from a wide variety of marine taxa is compulsory. PMID:24020880

  18. Consensus-degenerate hybrid oligonucleotide primers for amplification of distantly related sequences.

    PubMed Central

    Rose, T M; Schultz, E R; Henikoff, J G; Pietrokovski, S; McCallum, C M; Henikoff, S


    We describe a new primer design strategy for PCR amplification of unknown targets that are related to multiply-aligned protein sequences. Each primer consists of a short 3' degenerate core region and a longer 5' consensus clamp region. Only 3-4 highly conserved amino acid residues are necessary for design of the core, which is stabilized by the clamp during annealing to template molecules. During later rounds of amplification, the non-degenerate clamp permits stable annealing to product molecules. We demonstrate the practical utility of this hybrid primer method by detection of diverse reverse transcriptase-like genes in a human genome, and by detection of C5DNA methyltransferase homologs in various plant DNAs. In each case, amplified products were sufficiently pure to be cloned without gel fractionation. This COnsensus-DEgenerate Hybrid Oligonucleotide Primer (CODEHOP) strategy has been implemented as a computer program that is accessible over the World Wide Web ( and is directly linked from the BlockMaker multiple sequence alignment site for hybrid primer prediction beginning with a set of related protein sequences. PMID:9512532

  19. Real-time PCR (qPCR) primer design using free online software.


    Thornton, Brenda; Basu, Chhandak


    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software.

  20. Multicolor-based discrimination of 21 short tandem repeats and amelogenin using four fluorescent universal primers.


    Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko


    The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis.

  1. Amplification of soil fungal community DNA using the ITS86F and ITS4 primers.


    Vancov, Tony; Keen, Brad


    Internal transcribed spacer (ITS) 86F and ITS4 and the ITS1-F and ITS86R primer pairs were tested to specifically amplify fungal community DNA extracted from soil. Libraries were constructed from PCR-amplified fragments, sequenced and compared against sequences deposited in GenBank. The results confirmed that the ITS86F and ITS4 primer pair was selectively specific for the Ascomycetes, Basidiomycetes and Zygomycetes fungal clades. Amplified products generated by the ITS1F and ITS86R primer pair also aligned with sequences from a range of species within the Ascomycete and Basidiomycete clades but not from the Zygomycete. Both primer sets demonstrated fungal specificity and appear to be well suited for rapid PCR-based (fingerprinting) analysis of environmental fungal community DNA. This is the first reported use and assessment of the ITS86F and ITS4 and the ITS1-F and ITS86R primer pairs in amplifying fungal community DNA from soil.

  2. Internal transcribed spacer primers and sequences for improved characterization of basidiomycetous orchid mycorrhizas.


    Taylor, D Lee; McCormick, Melissa K


    Despite advances owing to molecular approaches, several hurdles still obstruct the identification of fungi forming orchid mycorrhizas. The Tulasnellaceae exhibit accelerated evolution of the nuclear ribosomal operon, causing most standard primers to fail in polymerase chain reaction (PCR) trials. Insufficient sequences are available from well characterized isolates and fruitbodies. Lastly, taxon-specific PCR primers are needed in order to explore the ecology of the fungi outside of the orchid root. Here, progress in overcoming these hurdles is reported. Broad-spectrum basidiomycete internal transcribed spacer (ITS) primers that do not exclude most known Tulasnellaceae are presented. blast searches and empirical PCR tests support their wide utility within the Basidiomycota. Taxon-specific ITS primers are presented targeted to orchid-associated Tulasnella, and a core component of the Thelephora-Tomentella complex. The efficiency and selectivity of these primer sets are again supported by blast searches and empirical tests. Lastly, ITS DNA sequences are presented from several strains of Epulorhiza, Ceratorhiza, Ceratobasidium, Sistotrema, Thanatephorus and Tulasnella that were originally described in the landmark mycorrhizal studies of Currah and Warcup. Detailed phylogenetic analyses reveal some inconsistencies in species concepts in these taxonomically challenging resupinate basidiomycetes, but also help to place several sequences from environmental samples.

  3. Novel Primer Sets for Next Generation Sequencing-Based Analyses of Water Quality

    PubMed Central

    Lee, Elvina; Khurana, Maninder S.; Whiteley, Andrew S.; Monis, Paul T.; Bath, Andrew; Gordon, Cameron; Ryan, Una M.; Paparini, Andrea


    Next generation sequencing (NGS) has rapidly become an invaluable tool for the detection, identification and relative quantification of environmental microorganisms. Here, we demonstrate two new 16S rDNA primer sets, which are compatible with NGS approaches and are primarily for use in water quality studies. Compared to 16S rRNA gene based universal primers, in silico and experimental analyses demonstrated that the new primers showed increased specificity for the Cyanobacteria and Proteobacteria phyla, allowing increased sensitivity for the detection, identification and relative quantification of toxic bloom-forming microalgae, microbial water quality bioindicators and common pathogens. Significantly, Cyanobacterial and Proteobacterial sequences accounted for ca. 95% of all sequences obtained within NGS runs (when compared to ca. 50% with standard universal NGS primers), providing higher sensitivity and greater phylogenetic resolution of key water quality microbial groups. The increased selectivity of the new primers allow the parallel sequencing of more samples through reduced sequence retrieval levels required to detect target groups, potentially reducing NGS costs by 50% but still guaranteeing optimal coverage and species discrimination. PMID:28118368

  4. Multiplex PCR based on a universal biotinylated primer to generate templates for pyrosequencing.


    Chen, Zhiyao; Liu, Yunlong; Duan, Wenbang; Ye, Hui; Wu, Haiping; Li, Jinheng; Zhou, Guohua


    Pyrosequencing is a powerful tool widely used in genetic analysis, however template preparation prior to pyrosequencing is still costly and time-consuming. To achieve an inexpensive and labor-saving template preparation for pyrosequencing, we have successfully developed a single-tube multiplex PCR including a pre-amplification and a universal amplification. In the process of pre-amplification, a low concentration of target-specific primers tagged with universal ends introduced universal priming regions into amplicons. In the process of universal amplification, a high concentration of universal primers was used for yielding amplicons with various SNPs of interest. As only a universal biotinylated primer and one step of single-stranded DNA preparation were required for typing multiple SNPs located on different sequences, pyrosequencing-based genotyping became time-saving, labor-saving, sample-saving, and cost-saving. By a simple optimization of multiplex PCR condition, only a 4-plex and a 3-plex PCR were required for typing 7 SNPs related to tamoxifen metabolism. Further study showed that pyrosequencing coupled with an improved multiplex PCR protocol allowed around 30% decrease of either typing cost or typing labor. Considering the biotinylated primer and the optimized condition of the multiplex PCR are independent of SNP locus, it is easy to use the same condition and the identical biotinylated primer for typing other SNPs. The preliminary typing results of the 7 SNPs in 11 samples demonstrated that multiplex PCR-based pyrosequencing could be promising in personalized medicine at a low cost.

  5. Nano-magnetic primer based electrochemiluminescence-polymerase chain reaction (NMPE-PCR) assay.


    Zhu, Xiao; Zhou, Xiaoming; Xing, Da


    Here we have developed a novel nano-magnetic primer based electrochemiluminescence-polymerase chain reaction (NMPE-PCR) strategy for detection of genome. The key idea of this method is integrating the two in situ processes: PCR on the surface of magnetic nanoparticles (MNPs) and magnetic beads based ECL readout platform, to avoid some laborious manual operations and achieve rapid yet sensitive detection. At first, the approach employs a pair of functional primers for amplification: one is tris-(2,2'-bipyridyl) ruthenium (TBR) labeled primer; the other one is nano-magnetic primer which is prepared by attaching the primer to the surfaces of MNPs. With the presence of DNA analyte and PCR mixture, the TBR labeled products are directly loaded and enriched on the surface of MNPs during PCR cycling. Then the MNPs-TBR complexes can be analyzed by a magnetic ECL platform without any post-modification or post-incubation. Finally, we used Listeria monocytogenes as the target to examine these desirable properties of this assay, reaching a detection limit of 500 fg/μL for genome in 1 h. The proposed study has provided the evidence as a proof-of-concept, thus having potential for development of automatic mode for detection of specific gene.

  6. Development of SCAR Primers for PCR Assay to Detect Diplodia seriata

    PubMed Central

    Martín, M. T.; Cuesta, M. J.; Martín, L.


    The aim of this study was to develop primer pairs for Diplodia seriata identification, one of the most common fungal species associated with grapevine decline in Castilla y León (Spain). Genetic variability of selected isolates of D. seriata was estimated. A molecular marker was generated from a random amplified polymorphic DNA (RAPD) fragment. PCR products of around 1200 bp were obtained with OPE20 primer. The PCR products were cloned and sequenced. The sequences were compared and a fragment of 1207 bp was used to design primer pairs. Two primer pairs were selected (DS3.8 S3-DS3.8 R6 and DS3.8 S3-DS3.8 R4) that amplified a single DNA product of 634 bp and 233 bp, respectively, with D. seriata isolates. No amplification was obtained for any of the 57 isolates of other species. The designed SCAR primer pairs allowed a rapid detection of D. seriata, and were able to detect 0.1 pg of the target DNA. Detection was specific and sensitive for D. seriata. The established protocols detected these fungi in naturally infected grapevines after DNA purification. Diplodia seriata was detectable without DNA purification and isolation in 62.5% to 75% of reactions. The detection of this pathogen in wood samples has great potential for use in pathogen-free certification schemes. PMID:27437468

  7. Tests for the mechanism of starch biosynthesis: de novo synthesis or an amylogenin primer synthesis.


    Mukerjea, Rupendra; Robyt, John F


    Studies in 1940 on potato phosphorylase reaction with starch found that d-glucopyranose from α-d-glucopyranosyl-1-phosphate was added to the nonreducing-ends of starch chains. This led to the hypothesis that the biosynthesis of starch required a preformed primer. Later it was found that phosphorylase was exclusively a degradative enzyme in vivo and that starch-synthase was the enzyme that reacted with ADPGlc to biosynthesize starch. Amylogenin, a putative self-glycosylated protein, was postulated to be the primer, although it was never demonstrated or found. In the present study, three reactions were performed in sequence with a highly purified potato starch-synthase to determine whether an amylogenin primer was present and required or whether the biosynthesis was de novo. Reaction 1 was performed by adding 2.0mM ADPGlc to synthesize the putative primer to a possible amylogenin in the preparation; in Reaction 2, 10mM ADP-[(14)C]Glc was added; and in Reaction 3, 10mM nonlabeled ADPGlc was added. After the isolation, reduction, and acid hydrolysis of the products of Reactions 2 and 3, (14)C-d-glucitol was obtained from Reaction 2 and was decreased by Reaction 3. The formation of (14)C-d-glucitol and its decrease showed that an amylogenin, protein primer was not involved in starch biosynthesis and the synthesis is de novo by the addition of d-glucose to the reducing-ends of growing starch chains.

  8. An Alternative Suite of Universal Primers for Genotyping in Multiplex PCR

    PubMed Central

    Ge, Cheng; Cui, Yu-Nan; Jing, Peng-Yu; Hong, Xiao-Yue


    The universal primer three-primer approach can dramatically reduce the cost when genotyping the microsatellites. One former research reported four universal primers that can be used in singleplex and multiplex genotyping. In this study, we proposed an alternative suite of universal primers with four dyes for genotyping 8–12 loci in one single run. This multiplex method was tested on Tetranychus truncatus. Published microsatellite loci of T. kanzawai, Frankliniella occidentalis and Nilaparvata lugens were modified as needed and also tested. The robustness of the method was confirmed by comparing with singleplex using multiple fluorophores and genotyping two populations of T. truncatus. This method showed lower signal strength than the singleplex three-primer system, but it was still sufficient to determine the fragment length. The cost of such a project can be reduced dramatically when many loci of different species are involved. In this way, laboratories performing population genetic analyses or studying several different species may benefit from the use of this cost-effective protocol. PMID:24658225

  9. A simple ABO genotyping by PCR using sequence-specific primers with mismatched nucleotides.


    Taki, Takashi; Kibayashi, Kazuhiko


    In forensics, the specific ABO blood group is often determined by analyzing the ABO gene. Among various methods used, PCR employing sequence-specific primers (PCR-SSP) is simpler than other methods for ABO typing. When performing the PCR-SSP, the pseudo-positive signals often lead to errors in ABO typing. We introduced mismatched nucleotides at the second and the third positions from the 3'-end of the primers for the PCR-SSP method and examined whether reliable typing could be achieved by suppressing pseudo-positive signals. Genomic DNA was extracted from nail clippings of 27 volunteers, and the ABO gene was examined with PCR-SSP employing primers with and without mismatched nucleotides. The ABO blood group of the nail clippings was also analyzed serologically, and these results were compared with those obtained using PCR-SSP. When mismatched primers were employed for amplification, the results of the ABO typing matched with those obtained by the serological method. When primers without mismatched nucleotides were used for PCR-SSP, pseudo-positive signals were observed. Thus our method may be used for achieving more reliable ABO typing.

  10. Cloning flanking sequence by single-primer PCR in transgenic plants.


    Ma, J; Wang, Y P; Ren, S; Zhang, Z; Lu, S; Wang, P W


    The insertion position of exogenous genes in plant genomes is usually identified by adapter ligation-mediated polymerase chain reaction (PCR), thermal asymmetric interlaced PCR, and restriction site extension PCR in transgenic plant research. However, these methods have various limitations, such as the complexity of designing primers and time-consuming and multiple-step procedures. The goal of this study was to establish an easier, more rapid, and more accurate method to clone flanking sequence using single-primer PCR in transgenic plants. Unknown flanking genome sequences in transgenic plants, including those in tobacco, soybean, rice, and maize, were cloned using the single-primer PCR method established in this study, with the Bar gene as the anchor gene. The primer 1 (P1), P2, and P3 PCRs obtained 4 sequences, and the completely correct flanking sequence of 508 bp that was obtained in the P3 PCR was verified by sequencing analysis. The single-primer PCR is more rapid and accurate than conventional methods, justifying its application widely in cloning flanking sequences in transgenic plants.

  11. SP-Designer: a user-friendly program for designing species-specific primer pairs from DNA sequence alignments.


    Villard, Pierre; Malausa, Thibaut


    SP-Designer is an open-source program providing a user-friendly tool for the design of specific PCR primer pairs from a DNA sequence alignment containing sequences from various taxa. SP-Designer selects PCR primer pairs for the amplification of DNA from a target species on the basis of several criteria: (i) primer specificity, as assessed by interspecific sequence polymorphism in the annealing regions, (ii) the biochemical characteristics of the primers and (iii) the intended PCR conditions. SP-Designer generates tables, detailing the primer pair and PCR characteristics, and a FASTA file locating the primer sequences in the original sequence alignment. SP-Designer is Windows-compatible and freely available from

  12. Effect of primer composition on cathodic disbonding resistance and adhesion durability of three layer polyethylene coated steel pipe

    SciTech Connect

    Tsuri, S.; Takao, K.; Mochizuki, K.


    The cathodic disbonding resistance and adhesion durability of three layer polyethylene coated steel pipe were studied from the viewpoint of water permeability and the water uptake of dicyandiamide-imidazole cured epoxy primer. The reaction between the epoxy resin and dicyandiamide generates hydroxyl groups. Therefore, as the content of dicyandiamide increased, the water uptake of the primer increased and the water diffusion rate of the primer decreased because of the strong interaction between hydroxyl reaction product and water molecules. Excellent cathodic disbonding resistance and adhesion durability were observed when the primer had the lowest water permeability which was expressed as the product of the water uptake and water diffusion rate. On the other hand, the addition of a corrosion protective pigment to the primer improved cathodic disbonding resistance and adhesion durability when the primer had high water uptake, which secured the sufficient solubility of the pigment. Polyethylene coated steel pipes are often used as pipelines for oil and natural gas.

  13. Influence of Berdan and Boxer Primer Spit-Hole Diameter on 7.62-mm Cartridge Performance

    DTIC Science & Technology


    Influence of Berdan and Boxer Primer Spit-Hole Diameter on 7.62-mm Cartridge Performance by John J. Ritter ARL-TR-6968 June 2014...Influence of Berdan and Boxer Primer Spit-Hole Diameter on 7.62-mm Cartridge Performance John J. Ritter Weapons and Materials Research Directorate...2013–January 2014 4. TITLE AND SUBTITLE Influence of Berdan and Boxer Primer Spit-Hole Diameter on 7.62-mm Cartridge Performance 5a. CONTRACT

  14. Detection of flaviviruses by reverse transcriptase-polymerase chain reaction with the universal primer set.


    Meiyu, F; Huosheng, C; Cuihua, C; Xiaodong, T; Lianhua, J; Yifei, P; Weijun, C; Huiyu, G


    Using a universal primer set designed to match the sequence of the NS1 gene of flaviviruses, the virus RNA of dengue (DEN), Japanese encephalitis (JEV), powassan and langat of Flaviviridae were successfully amplified by polymerase chain reaction (PCR) via cDNA; and with different internal primers, the serotypes of the dengue viruses were identified. Of the 78 clinically diagnosed dengue fever patients, 18 patients were positive for DEN 1, 48 patients for DEN 2 and 8 patients concurrently infected with DEN 4. Of the 52 patients admitted with Japanese encephalitis (JE), 45 were determined to be JEV infections. By nested PCR, we completed the identification of flaviviruses within 2 days. The results show that seven primers have a potential value for rapid clinical diagnosis of flavivirus infections.

  15. 5'-degenerate 3'-dideoxy-terminated competitors of PCR primers increase specificity of amplification.


    Atamas, S P; Luzina, I G; Handwerger, B S; White, B


    Amplification of a product in PCR with specific primers may be viewed as an artificial Darwinian-type "selection of the fittest". In other selective systems, such as general evolution, immune system and probably brain cortex, the stringency of selection is not absolute but rather degenerate, with selection of many highly fit units, not limited, however, to only the fittest. In PCR also, annealing of the primers is not absolutely specific. The subsequent amplification frequently leads to amplification of not only the desired product but also to less-specific sequences. Using theoretical analysis of the degenerate mode of selection, we predict theoretically and prove experimentally that 5'-degenerate, 3'-dideoxy-terminated competitors of PCR primers can be used to dramatically improve the specificity of PCR amplification without affecting the quantitation of the final specific product.

  16. PCR primers for 30 novel gene regions in the nuclear genomes of Lepidoptera

    PubMed Central

    Wahlberg, Niklas; Peña, Carlos; Ahola, Milla; Wheat, Christopher W.; Rota, Jadranka


    Abstract We report primer pairs for 30 new gene regions in the nuclear genomes of Lepidoptera that can be amplified using a standard PCR protocol. The new primers were tested across diverse Lepidoptera, including nonditrysians and a wide selection of ditrysians. These new gene regions give a total of 11,043 bp of DNA sequence data and they show similar variability to traditionally used nuclear gene regions in studies of Lepidoptera. We feel that a PCR-based approach still has its place in molecular systematic studies of Lepidoptera, particularly at the intrafamilial level, and our new set of primers now provides a route to generating phylogenomic datasets using traditional methods. PMID:27408580

  17. Novel Primers From Informative Nuclear Loci for Louse Molecular Phylogenetics (Insecta: Phthiraptera).


    Sweet, Andrew D; Allen, Julie M; Johnson, Kevin P


    While parasitic lice (Insecta: Phthiraptera) have historically been an important model taxon for understanding host-parasite coevolution, very few molecular markers have been developed for phylogenetic analysis. The current markers are insufficient to resolve many of the deeper nodes in this group; therefore, sequences from additional genetic loci are necessary. Here, we design primers targeting several nuclear protein coding genes based on a complete genome and transcriptome of Pediculus humanus L. plus transcriptomes and modest coverage genomic data from five genera of avian feather lice. These primers were tested on 32 genera of avian feather lice (Ischnocera), including multiple species within some genera. All of the new primer combinations produced sequences for the majority of the genera and had similar or higher divergences than the most widely used nuclear protein-coding gene in lice, EF-1α. These results indicate that these new loci will be useful in resolving phylogenetic relationships among parasitic lice.

  18. Comprehensive detection of phototrophic sulfur bacteria using PCR primers that target reverse dissimilatory sulfite reductase gene.


    Mori, Yumi; Purdy, Kevin J; Oakley, Brian B; Kondo, Ryuji


    A new set of primers for the detection of phototrophic sulfur bacteria in natural environments is described. The primers target the α-subunit of the reverse dissimilatory sulfite reductase gene (dsrA). PCR-amplification resulted in products of the expected size from all the phototrophic strains tested, including purple sulfur and green sulfur bacteria. Seventy-nine clones obtained from environmental DNA using the primers were sequenced and all found to be closely related to the dsrA of purple sulfur bacteria and green sulfur bacteria. This newly developed PCR assay targeting dsrA is rapid and simple for the detection of phototrophic sulfur bacteria in situ and superior to the use of culture-dependent techniques.

  19. A primer set to determine sex in the small Indian mongoose, Herpestes auropunctatus.


    Murata, C; Ogura, G; Kuroiwa, A


    To enable the accurate sexing of individuals of introduced populations of the small Indian mongoose, Herpestes auropunctatus, we designed a primer set for the amplification of the sex-specific fragments EIF2S3Y and EIF2S3X. Using this primer set, the expected amplification products were obtained for all samples of genomic DNA tested: males yielded two bands and females a single band. Sequencing of each PCR product confirmed that the 769-bp fragment amplified from DNA samples of both sexes was derived from EIF2S3X, whereas the 546-bp fragment amplified only from male DNA samples was derived from EIF2S3Y. The results indicated that this primer set is useful for sex identification in this species.

  20. Searching for Beta-Haemolysin hlb Gene in Staphylococcus pseudintermedius with Species-Specific Primers.


    Kmieciak, Wioletta; Szewczyk, Eligia M; Ciszewski, Marcin


    The paper presents an analysis of 51 Staphylococcus pseudintermedius clinically isolated strains from humans and from animals. Staphylococcus pseudintermedius strains' ability to produce β-haemolysin was evaluated with phenotypic methods (hot-cold effect, reverse CAMP test). In order to determine the hlb gene presence (coding for β-haemolysin) in a genomic DNA, PCR reactions were conducted with two different pairs of primers: one described in the literature for Staphylococcus aureus and recommended for analysing SIG group staphylococci and newly designed one in CLC Main Workbench software. Only reactions with newly designed primers resulted in product amplification, the presence of which was fully compatible with the results of phenotypic β-haemolysin test. Negative results for S. aureus and S. intermedius reference ATCC strains suggest that after further analysis the fragment of hlb gene amplified with primers described in this study might be included in the process of S. pseudintermedius strains identification.

  1. Single primer-mediated circular polymerase chain reaction for hairpin DNA cloning and plasmid editing.


    Huang, Jiansheng; Khan, Inamullah; Liu, Rui; Yang, Yan; Zhu, Naishuo


    We developed and validated a universal polymerase chain reaction (PCR) method, single primer circular (SPC)-PCR, using single primer to simultaneously insert and amplify a short hairpin sequence into a vector with a high success rate. In this method, the hairpin structure is divided into two parts and fused into a vector by PCR. Then, a single primer is used to cyclize the chimera into a mature short hairpin RNA (shRNA) expression vector. It is not biased by loop length or palindromic structures. Six hairpin DNAs with short 4-nucleotide loops were successfully cloned. Moreover, SPC-PCR was also applied to plasmid editing within 3 h with a success rate higher than 95%.

  2. Detection of gunshot primer residue on bone in an experimental setting-an unexpected finding.


    Berryman, Hugh E; Kutyla, Alicja K; Russell Davis, J


    Pork ribs with intact muscle tissue were used in an experimental attempt to identify bullet wipe on bone at distances from 1 to 6 feet with 0.45 caliber, full metal jacket ammunition. This resulted in the unexpected finding of primer-derived gunshot residue (GSR) deep within the wound tract. Of significance is the fact that the GSR was deposited on the bone, under the periosteum, after the bullet passed through a Ziploc bag and c. 1 inch of muscle tissue. It is also important to note that the GSR persisted on the bone after the periosteum was forcibly removed. The presence of primer-derived GSR on bone provides the potential to differentiate gunshot trauma from blunt trauma when the bone presents an atypical gunshot wound. In this study, the presence of gunshot primer residue at a distance of 6 feet demonstrates the potential for establishing maximum gun-to-target distance for remote shootings.

  3. Development and characterization of microsatellite primers in the endangered Mediterranean shrub Ziziphus lotus (Rhamnaceae)1

    PubMed Central

    González-Robles, Ana; Manzaneda, Antonio J.; Bastida, Jesús M.; Harvey, Nick; Jaime, Rafael; Salido, Teresa; Martínez, Luisa M.; Fernández-Ocaña, Ana; Alcántara, Julio M.; Rey, Pedro J.


    Premise of the study: Microsatellite primers were developed to characterize and evaluate patterns of genetic diversity and structure in the endangered Mediterranean shrub Ziziphus lotus (Rhamnaceae). Methods and Results: Twenty microsatellite primers were developed for Z. lotus, of which 14 were polymorphic. We evaluated microsatellite polymorphism in 97 specimens from 18 Spanish and seven Moroccan populations. Between two and eight alleles were found per locus, and the average number of alleles was 5.54. Observed heterozygosity and expected heterozygosity ranged from 0.08 to 0.90 and from 0.08 to 0.82, respectively. Nine of these primers also amplified microsatellite loci in Z. jujuba. Conclusions: The microsatellite markers described here will be useful in studies on genetic variation, population genetic structure, and gene flow in the fragmented habitat of this species. These markers are a valuable resource for designing appropriate conservation measures for the species in the Mediterranean range. PMID:28101436

  4. Highly effective sequencing whole chloroplast genomes of angiosperms by nine novel universal primer pairs.


    Yang, Jun-Bo; Li, De-Zhu; Li, Hong-Tao


    Chloroplast genomes supply indispensable information that helps improve the phylogenetic resolution and even as organelle-scale barcodes. Next-generation sequencing technologies have helped promote sequencing of complete chloroplast genomes, but compared with the number of angiosperms, relatively few chloroplast genomes have been sequenced. There are two major reasons for the paucity of completely sequenced chloroplast genomes: (i) massive amounts of fresh leaves are needed for chloroplast sequencing and (ii) there are considerable gaps in the sequenced chloroplast genomes of many plants because of the difficulty of isolating high-quality chloroplast DNA, preventing complete chloroplast genomes from being assembled. To overcome these obstacles, all known angiosperm chloroplast genomes available to date were analysed, and then we designed nine universal primer pairs corresponding to the highly conserved regions. Using these primers, angiosperm whole chloroplast genomes can be amplified using long-range PCR and sequenced using next-generation sequencing methods. The primers showed high universality, which was tested using 24 species representing major clades of angiosperms. To validate the functionality of the primers, eight species representing major groups of angiosperms, that is, early-diverging angiosperms, magnoliids, monocots, Saxifragales, fabids, malvids and asterids, were sequenced and assembled their complete chloroplast genomes. In our trials, only 100 mg of fresh leaves was used. The results show that the universal primer set provided an easy, effective and feasible approach for sequencing whole chloroplast genomes in angiosperms. The designed universal primer pairs provide a possibility to accelerate genome-scale data acquisition and will therefore magnify the phylogenetic resolution and species identification in angiosperms.

  5. Impact of primer choice on characterization of orchid mycorrhizal communities using 454 pyrosequencing.


    Waud, Michael; Busschaert, Pieter; Ruyters, Stefan; Jacquemyn, Hans; Lievens, Bart


    Although the number of studies investigating mycorrhizal associations in orchids has increased in recent years, the fungal communities associating with orchids and how they differ between species and sites remain unclear. Recent research has indicated that individual orchid plants may associate with several fungi concurrently, implying that to study mycorrhizal associations in orchids the fungal community should be assessed, rather than the presence of individual dominant fungal species or strains. High-throughput sequencing methods, such as 454 pyrosequencing, are increasingly used as the primary tool for such analyses. However, many studies combine universal primers from previous phylogenetic or ecological studies to generate amplicons suitable for 454 pyrosequencing without first critically evaluating their performance, potentially resulting in biased fungal community descriptions. Here, following in silico primer analysis we evaluated the performance of different combinations of existing PCR primers to characterize orchid mycorrhizal communities using 454 pyrosequencing by analysis of both an artificially assembled community of mycorrhizal fungi isolated from diverse orchid species and root samples from three different orchid species (Anacamptis morio, Ophrys tenthredinifera and Serapias lingua). Our results indicate that primer pairs ITS3/ITS4OF and ITS86F/ITS4, targeting the internal transcribed spacer-2 (ITS-2) region, outperformed other tested primer pairs in terms of number of reads, number of operational taxonomic units recovered from the artificial community and number of different orchid mycorrhizal associating families detected in the orchid samples. Additionally, we show the complementary specificity of both primer pairs, making them highly suitable for tandem use when studying the diversity of orchid mycorrhizal communities.

  6. The roles of tryptophans in primer synthesis by the DNA primase of bacteriophage T7.


    Zhang, Huidong; Lee, Seung-Joo; Richardson, Charles C


    DNA primases catalyze the synthesis of oligoribonucleotides required for the initiation of lagging strand DNA synthesis. Prokaryotic primases consist of a zinc-binding domain (ZBD) necessary for recognition of a specific template sequence and a catalytic RNA polymerase domain. Interactions of both domains with the DNA template and ribonucleotides are required for primer synthesis. Five tryptophan residues are dispersed in the primase of bacteriophage T7: Trp-42 in the ZBD and Trp-69, -97, -147, and -255 in the RNA polymerase domain. Previous studies showed that replacement of Trp-42 with alanine in the ZBD decreases primer synthesis, whereas substitution of non-aromatic residues for Trp-69 impairs both primer synthesis and delivery. However, the roles of tryptophan at position 97, 147, or 255 remain elusive. To investigate the essential roles of these residues, we replaced each tryptophan with the structurally similar tyrosine and examined the effect of this subtle alteration on primer synthesis. The substitution at position 42, 97, or 147 reduced primer synthesis, whereas substitution at position 69 or 255 did not. The functions of the tryptophans were further examined at each step of primer synthesis. Alteration of residue 42 disturbed the conformation of the ZBD and resulted in partial loss of the zinc ion, impairing binding to the ssDNA template. Replacement of Trp-97 with tyrosine reduced the binding affinity to NTP and the catalysis step. The replacement of Trp-147 with tyrosine also impaired the catalytic step. Therefore, Trp-42 is important in maintaining the conformation of the ZBD for template binding; Trp-97 contributes to NTP binding and the catalysis step; and Trp-147 maintains the catalysis step.

  7. Development of primer pairs from diverse chloroplast genomes for use in plant phylogenetic research.


    Yang, Y C; Kung, T L; Hu, C Y; Lin, S F


    Variation in the chloroplast DNA sequence is useful for plant phylogenetic studies. However, the number of variable sequences provided by chloroplast DNA for suggested genes or genomic regions in plant phylogenetic analyses is often inadequate. To identify conserved regions that can be used to design primers and amplify variable sequences for use in plant phylogenetic studies, the complete chloroplast genomic sequences of six plant species (including Oryza sativa, Arabidopsis thaliana, Glycine max, Lotus japonicus, Medicago truncatula, and Phaseolus vulgaris), searched from the taxonomy database of NCBI were investigated. A total of 93 conserved regions, 32 in large single copy and 61 in inverted repeat regions, were identified. A set of five primer pairs were designed according to the conserved sequences located in the psbA~trnK, psbB~psbH, rpl23~trnI, trnR~trnN, and trnY~trnD regions to amplify variable DNA fragments. An additional 18 plant accessions from 14 species were used to validate their utility. Each of the tested species could be distinguished by length polymorphisms of fragments amplified with the five primer pairs. trnR~trnN and rpl23~trnI amplified fragments specific to monocot and legume species, respectively. Three primer pairs located in the psbA~trnK, psbB~psbH, and trnR~trnN regions were applied to amplify variable DNA sequences for phylogenetic analysis using the maximum parsimony method. The consistent result between taxonomy and phylogenetic analysis on the variable sequences amplified with these three primer pairs was revealed. The five newly developed primer pairs are recommended as tools for use in the identification of plant species and in phylogenetic studies.

  8. Establishment of quantitative analysis method for genetically modified maize using a reference plasmid and novel primers.


    Moon, Gi-Seong; Shin, Weon-Sun


    For the quantitative analysis of genetically modified (GM) maize in processed foods, primer sets and probes based on the 35S promoter (p35S), nopaline synthase terminator (tNOS), p35S-hsp70 intron, and zSSIIb gene encoding starch synthase II for intrinsic control were designed. Polymerase chain reaction (PCR) products (80~101 bp) were specifically amplified and the primer sets targeting the smaller regions (80 or 81 bp) were more sensitive than those targeting the larger regions (94 or 101 bp). Particularly, the primer set 35F1-R1 for p35S targeting 81 bp of sequence was even more sensitive than that targeting 101 bp of sequence by a 3-log scale. The target DNA fragments were also specifically amplified from all GM labeled food samples except for one item we tested when 35F1-R1 primer set was applied. A reference plasmid pGMmaize (3 kb) including the smaller PCR products for p35S, tNOS, p35S-hsp70 intron, and the zSSIIb gene was constructed for real-time PCR (RT-PCR). The linearity of standard curves was confirmed by using diluents ranging from 2×10(1)~10(5) copies of pGMmaize and the R(2) values ranged from 0.999~1.000. In the RT-PCR, the detection limit using the novel primer/probe sets was 5 pg of genomic DNA from MON810 line indicating that the primer sets targeting the smaller regions (80 or 81 bp) could be used for highly sensitive detection of foreign DNA fragments from GM maize in processed foods.

  9. Design and Implementation of Degenerate Microsatellite Primers for the Mammalian Clade

    PubMed Central

    Buschiazzo, Emmanuel; Beck, Josephine S.; Gemmell, Neil J.


    Microsatellites are popular genetic markers in molecular ecology, genetic mapping and forensics. Unfortunately, despite recent advances, the isolation of de novo polymorphic microsatellite loci often requires expensive and intensive groundwork. Primers developed for a focal species are commonly tested in a related, non-focal species of interest for the amplification of orthologous polymorphic loci; when successful, this approach significantly reduces cost and time of microsatellite development. However, transferability of polymorphic microsatellite loci decreases rapidly with increasing evolutionary distance, and this approach has shown its limits. Whole genome sequences represent an under-exploited resource to develop cross-species primers for microsatellites. Here we describe a three-step method that combines a novel in silico pipeline that we use to (1) identify conserved microsatellite loci from a multiple genome alignments, (2) design degenerate primer pairs, with (3) a simple PCR protocol used to implement these primers across species. Using this approach we developed a set of primers for the mammalian clade. We found 126,306 human microsatellites conserved in mammalian aligned sequences, and isolated 5,596 loci using criteria based on wide conservation. From a random subset of ∼1000 dinucleotide repeats, we designed degenerate primer pairs for 19 loci, of which five produced polymorphic fragments in up to 18 mammalian species, including the distinctly related marsupials and monotremes, groups that diverged from other mammals 120–160 million years ago. Using our method, many more cross-clade microsatellite loci can be harvested from the currently available genomic data, and this ability is set to improve exponentially as further genomes are sequenced. PMID:22216321

  10. Bonding of Resin Cement to Zirconia with High Pressure Primer Coating

    PubMed Central

    Wang, Ying-jie; Jiao, Kai; Liu, Yan; Zhou, Wei; Shen, Li-juan; Fang, Ming; Li, Meng; Zhang, Xiang; Tay, Franklin R.; Chen, Ji-hua


    Objectives To investigate the effect of air-drying pressure during ceramic primer coating on zirconia/resin bonding and the surface characteristics of the primed zirconia. Methods Two ceramic primers (Clearfil Ceramic Primer, CCP, Kuraray Medical Inc. and Z-Prime Plus, ZPP, Bisco Inc.) were applied on the surface of air-abraded zirconia (Katana zirconia, Noritake) and dried at 4 different air pressures (0.1–0.4 MPa). The primed zirconia ceramic specimens were bonded with a resin-based luting agent (SA Luting Cement, Kuraray). Micro-shear bond strengths of the bonded specimens were tested after 3 days of water storage or 5,000× thermocycling (n = 12). Failure modes of the fractured specimens were examined with scanning electron miscopy. The effects of air pressure on the thickness of the primer layers and the surface roughness (Sa) of primed zirconia were evaluated using spectroscopic ellipsometry (n = 6), optical profilometry and environmental scanning electron microscopy (ESEM) (n = 6), respectively. Results Clearfil Ceramic Primer air-dried at 0.3 and 0.4 MPa, yielding significantly higher µSBS than gentle air-drying subgroups (p<0.05). Compared to vigorous drying conditions, Z-Prime Plus air-dried at 0.2 MPa exhibited significantly higher µSBS (p<0.05). Increasing air-drying pressure reduced the film thickness for both primers. Profilometry measurements and ESEM showed rougher surfaces in the high pressure subgroups of CCP and intermediate pressure subgroup of ZPP. Conclusion Air-drying pressure influences resin/zirconia bond strength and durability significantly. Higher air-drying pressure (0.3-0.4 MPa) for CCP and intermediate pressure (0.2 MPa) for ZPP are recommended to produce strong, durable bonds between resin cement and zirconia ceramics. PMID:24992678

  11. The corrosion protection of AISI(TM) 1010 steel by organic and inorganic zinc-rich primers

    NASA Technical Reports Server (NTRS)

    Danford, M. D.; Mendrek, M. J.


    The behavior of zinc-rich primer-coated AISI 1010 steel in 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR), were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electromechanical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 1010 steel cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high current between the steel cathode and both zinc-rich primer anodes (38.8 and 135.2 microns A/sq cm for the organic and inorganic primers, respectively). The results of corrosion rate determinations demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. EIS equivalent circuit parameters confirmed this conclusion. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application on solid rocket booster steel hardware.

  12. COMplementary Primer ASymmetric PCR (COMPAS-PCR) Applied to the Identification of Salmo salar, Salmo trutta and Their Hybrids

    PubMed Central


    Avoiding complementarity between primers when designing a PCR assay constitutes a central rule strongly anchored in the mind of the molecular scientist. 3’-complementarity will extend the primers during PCR elongation using one another as template, consequently disabling further possible involvement in traditional target amplification. However, a 5’-complementarity will leave the primers unchanged during PCR cycles, albeit sequestered to one another, therefore also suppressing target amplification. We show that 5’-complementarity between primers may be exploited in a new PCR method called COMplementary-Primer-Asymmetric (COMPAS)-PCR, using asymmetric primer concentrations to achieve target PCR amplification. Moreover, such a design may paradoxically reduce spurious non-target amplification by actively sequestering the limiting primer. The general principles were demonstrated using 5S rDNA direct repeats as target sequences to design a species-specific assay for identifying Salmo salar and Salmo trutta using almost fully complementary primers overlapping the same target sequence. Specificity was enhanced by using 3’-penultimate point mutations and the assay was further developed to enable identification of S. salar x S. trutta hybrids by High Resolution Melt analysis in a 35 min one-tube assay. This small paradigm shift, using highly complementary primers for PCR, should help develop robust assays that previously would not be considered. PMID:27783658

  13. Phosphatizing of Mg particles to improve the protective performance of Mg-rich primer on A2024 Al alloy

    NASA Astrophysics Data System (ADS)

    Wang, Jianguo; Zuo, Yu; Tang, Yuming; Lu, Xiangyu


    Mg-rich primer as a new type protective coating provides cathodic protection for Al alloy. In this paper, a kind of phosphatizing surface treatment on Mg particles was studied in order to improve the protective performance of Mg-rich primer. After treated with phosphoric acid, a protective magnesium phosphate layer was formed on the surface of Mg particles, which had no negative influence on the cathodic protection of the Mg-rich primer for Al alloy. The coating resistance of the treated Mg-rich primer was bigger than that of untreated primer, meanwhile the coating capacitance of the treated Mg-rich primer was smaller than that of untreated primer, suggesting that the barrier effect of the primer was improved and the lifetime was extended. The magnesium phosphate layer could reduce the consumption rate of Mg particles. Meanwhile, the phosphate radicals transported to Al alloy substrate to form a product layer composed of magnesium phosphate and aluminum phosphate on the substrate surface, which decreased the corrosion rate of Al alloy and improved the protective performance of the primer.

  14. COMplementary Primer ASymmetric PCR (COMPAS-PCR) Applied to the Identification of Salmo salar, Salmo trutta and Their Hybrids.


    Anglès d'Auriac, Marc B


    Avoiding complementarity between primers when designing a PCR assay constitutes a central rule strongly anchored in the mind of the molecular scientist. 3'-complementarity will extend the primers during PCR elongation using one another as template, consequently disabling further possible involvement in traditional target amplification. However, a 5'-complementarity will leave the primers unchanged during PCR cycles, albeit sequestered to one another, therefore also suppressing target amplification. We show that 5'-complementarity between primers may be exploited in a new PCR method called COMplementary-Primer-Asymmetric (COMPAS)-PCR, using asymmetric primer concentrations to achieve target PCR amplification. Moreover, such a design may paradoxically reduce spurious non-target amplification by actively sequestering the limiting primer. The general principles were demonstrated using 5S rDNA direct repeats as target sequences to design a species-specific assay for identifying Salmo salar and Salmo trutta using almost fully complementary primers overlapping the same target sequence. Specificity was enhanced by using 3'-penultimate point mutations and the assay was further developed to enable identification of S. salar x S. trutta hybrids by High Resolution Melt analysis in a 35 min one-tube assay. This small paradigm shift, using highly complementary primers for PCR, should help develop robust assays that previously would not be considered.

  15. Design of allele-specific primers and detection of the human ABO genotyping to avoid the pseudopositive problem.


    Yaku, Hidenobu; Yukimasa, Tetsuo; Nakano, Shu-ichi; Sugimoto, Naoki; Oka, Hiroaki


    PCR experiments using DNA primers forming mismatch pairing with template lambda DNA at the 3' end were carried out in order to develop allele-specific primers capable of detecting SNP in genomes without generating pseudopositive amplification products, and thus avoiding the so-called pseudopositive problem. Detectable amounts of PCR products were obtained when primers forming a single or two mismatch pairings at the 3' end were used. In particular, 3' terminal A/C or T/C (primer/template) mismatches tended to allow PCR amplification to proceed, resulting in pseudopositive results in many cases. While less PCR product was observed for primers forming three terminal mismatch pairings, target DNA sequences were efficiently amplified by primers forming two mismatch pairings next to the terminal G/C base pairing. These results indicate that selecting a primer having a 3' terminal nucleotide that recognizes the SNP nucleotide and the next two nucleotides that form mismatch pairings with the template sequence can be used as an allele-specific primer that eliminates the pseudopositive problem. Trials with the human ABO genes demonstrated that this primer design is also useful for detecting a single base pair difference in gene sequences with a signal-to-noise ratio of at least 45.

  16. Vectorette PCR isolation of microsatellite repeat sequences using anchored dinucleotide repeat primers.

    PubMed Central

    Lench, N J; Norris, A; Bailey, A; Booth, A; Markham, A F


    We have developed a vectorette PCR approach to provide an improved method for isolation of microsatellite repeats. The modified procedure relies on PCR amplification using a vectorette-specific primer in combination with one of a panel of anchored dinucleotide repeat primers. The target DNA to be screened for microsatellite sequences can be from YAC, P1, cosmid, bacteriophage or plasmid clones. We have used this technique to isolate novel, polymorphic microsatellite repeats from clones containing the amelogenin gene (AMGX) located on human chromosome Xp22.3. PMID:8668553

  17. cry1 genes from Bacillus thuringiensis: specificity determination and implications for primer design.


    Davolos, Camila C; Guidelli-Thuler, Ana M; de Abreu, Irlan L; Sena, Janete A D; Lemos, Manoel V F


    Some pest management programs employ PCR to identify cry1 genes from Bacillus thuringiensis to predict bacterial toxicity towards different insect pests. However, due to changes on the mode of action of the Cry proteins, new primers had to be designed to detect the new genes. Therefore, an 'in-silico' study of genetic sequences from five cry1 subclasses was carried out and characterized by molecular tools. The design of new primers allows for more precise selection of B. thuringiensis isolates, helping to better direct the programs employing biological control.

  18. Lead-free precussion primer mixes based on metastable interstitial composite (MIC) technology


    Dixon, George P.; Martin, Joe A.; Thompson, Don


    A lead-free percussion primer composition and a percussion cup containing e composition. The lead-free percussion primer composition is comprised of a mixture of about 45 wt % aluminum powder having an outer coating of aluminum oxide and molybdenum trioxide powder or a mixture of about 50 wt % aluminum powder having an outer coating of aluminum oxide and polytetrafluoroethylene powder. The aluminum powder, molybdenum trioxide powder and polytetrafluoroethylene powder has a particle size of 0.1 .mu.m or less, more preferably a particle size of from about 200-500 angstroms.

  19. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.


    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V


    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.

  20. Efficacy of a self-etching dentin primer composed of TEGMA and phenyl-P.


    Yoshimoto, Shinichiro; Itoh, Kazuo; Manabe, Atsufumi; Inoue, Mitsuko; Hisamitsu, Hisashi; Sasa, Ryuuji


    The purpose of the present study was to evaluate the efficacy of an experimental self-etching dentin primer composed of TEGMA and phenyl-P using primary and young permanent teeth. The efficacy of the self-etching dentin primer was evaluated by measuring the wall-to-wall polymerization contraction gap width and the shear bond strength to the flat dentin surface. The contraction gap formation was prevented completely in the specimens primed with the 35 vol% TEGMA and 20% phenyl-P for 30 sec.

  1. The Astrobiology Primer - an Early Career Scientist Education, Outreach and Professional Development Project

    NASA Astrophysics Data System (ADS)

    Wright, K. E.; Domagal-Goldman, S. D.


    We are early-career scientists jointly leading a project to write 'The Astrobiology Primer', a brief but comprehensive introduction to astrobiology, and we are using the process of producing the document as an innovative way of strengthening the international community of early-career astrobiologists. Astrobiology is the study of the origin, evolution, distribution and future of life in our universe. It includes not just study of life on Earth, but also the potential for life to exist beyond Earth, and the development of techniques to search for such life. It therefore incorporates geological and earth sciences, life sciences, chemistry, astronomy and planetary sciences. This requires astrobiologists to integrate these different disciplines in order to address questions such as 'How did Earth and its biosphere originate?', 'How do life and the physical, chemical and geological cycles on Earth interact, and affect each other?' and so 'What does life on Earth tell us about the habitability of environments outside Earth?'. The primer will provide a brief but comprehensive introduction to the field; it will be significantly more comprehensive than a normal review paper but much shorter than a textbook. This project is an initiative run entirely by early-career scientists, for the benefit of other early-career scientists and others. All the writers and editors of the primer are graduate/post-graduate students or post-doctoral fellows, and our primary target group for the primer is other early-career scientists, although we hope and expect that the primer will also be useful far more broadly in education and outreach work. An Astrobiology Primer was first published in 2006(Ref1), written and edited by a small group of early-career astrobiologists to provide an introduction to astrobiology for other early-career scientists new to the field. It has been used not only by the target group for private study, but in formal education and outreach settings at universities and

  2. Novel primers and PCR protocols for the specific detection and quantification of Sphingobium suberifaciens in situ

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The pathogen causing corky root on lettuce, Sphingobium suberifaciens, is recalcitrant to standard epidemiological methods. Primers were selected from 16S rDNA sequences useful for the specific detection and quantification of S. suberifaciens. Conventional (PCR) and quantitative (qPCR) PCR protocols...

  3. A Policymaker's Primer on Education Research: How to Understand, Evaluate and Use It

    ERIC Educational Resources Information Center

    Lauer, Patricia A.


    The goal of this primer is to help policymakers and other interested individuals answer three big questions: (1) What does the research say? (2) Is the research trustworthy? (3) How can the research be used to guide policy? Answering these questions will help policymakers: (1) make evidenced-based decisions about education policies; (2) gain a…

  4. A sputtered zirconia primer for improved thermal shock resistance of plasma sprayed ceramic turbine seals

    NASA Technical Reports Server (NTRS)

    Bill, R. C.; Sovey, J.; Allen, G. P.


    The development of plasma-sprayed yttria stabilized zirconia (YSZ) ceramic turbine blade tip seal components is discussed. The YSZ layers are quite thick (0.040 to 0.090 in.). The service potential of seal components with such thick ceramic layers is cyclic thermal shock limited. The most usual failure mode is ceramic layer delamination at or very near the interface between the plasma sprayed YSZ layer and the NiCrAlY bondcoat. Deposition of a thin RF sputtered YSZ primer to the bondcoat prior to deposition of the thick plasma sprayed YSZ layer was found to reduce laminar cracking in cyclic thermal shock testing. The cyclic thermal shock life of one ceramic seal design was increased by a factor of 5 to 6 when the sputtered YSZ primer was incorporated. A model based on thermal response of plasma sprayed YSZ particles impinging on the bondcoat surface with and without the sputtered YSZ primer provides a basis for understanding the function of the primer.

  5. What Are the Odds of that? A Primer on Understanding Logistic Regression

    ERIC Educational Resources Information Center

    Huang, Francis L.; Moon, Tonya R.


    The purpose of this Methodological Brief is to present a brief primer on logistic regression, a commonly used technique when modeling dichotomous outcomes. Using data from the National Education Longitudinal Study of 1988 (NELS:88), logistic regression techniques were used to investigate student-level variables in eighth grade (i.e., enrolled in a…


    ERIC Educational Resources Information Center



  7. With Heat You Never Have to Ask Directions. An Energy Primer for Minnesota Teachers.

    ERIC Educational Resources Information Center

    Minnesota State Dept. of Natural Resources, St. Paul. Environmental Education Board.

    This four-part primer is designed to: (1) help Minnesota teachers acquire some familiarity with basic energy structure and language; (2) provide a capsule summary of Minnesota's energy picture; and (3) demonstrate that it is relatively easy to participate in energy education. Part 1 discusses: the fossil fuel age; kinds and forms of energy; energy…

  8. A specific oligonucleotide primer for the rapid detection of Lactobacillus lindneri by polymerase chain reaction.


    Yasui, T; Okamoto, T; Taguchi, H


    A polymerase chain reaction (PCR) method was developed for the rapid detection of the beer-spoilage heterofermentative lactic acid bacterium Lactobacillus lindneri. Three strains, the Chinese brewery isolate DA1, the Japanese commercial beer isolate BG2, and the Japanese brewery isolate SE3, which were serologically classified as belonging to L. lindneri, were used in this study. After sequencing the 16S rDNA of the isolates DA1 and BG2 and the typical beer-spoilage heterofermentative Lactobacillus brevis L63, these sequences were compared with published data. A L. lindneri specific PCR primer, DA-40, was then constructed based on the V1 variable region of 16S rDNA. The specificity of PCR using the L. lindneri specific primer DA-40 and the universal primer 907r was examined using five L. lidneri strains: the three isolates described above and two strains from culture collection, DSM 20690 and DSM 20692. A variety of beer-spoilage lactic acid bacteria, including 71 Lactobacillus strains and 13 Pediococcus strains, were also included in this examination. No PCR product was obtained from any DNA with the exception of the five L. lindneri strains, indicating that the L. lindneri specific primer DA-40 was highly specific. The detection limit for L. lindneri in beer was 63 CFU/100 mL of beer.

  9. A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys


    Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.


    The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable regionmore » of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.« less

  10. A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys

    SciTech Connect

    Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.


    The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable region of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.

  11. Sequence analysis reveals genomic factors affecting EST-SSR primer performance and polymorphism

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Search for simple sequence repeat (SSR) motifs and design of flanking primers in expressed sequence tag (EST) sequences can be easily done at a large scale using bioinformatics programs. However, failed amplification and/or detection, along with lack of polymorphism, is often seen among randomly sel...

  12. TM7 detection in human microbiome: are PCR primers and FISH probes specific enough?

    PubMed Central

    Sizova, Maria V.; Doerfert, Sebastian N.; Gavrish, Ekaterina; Epstein, Slava S.


    TM7 appears important and omnipresent because it is repeatedly detected by molecular techniques in diverse environments. Here we report that most of primers and FISH probes thought to be TM7-specific do hybridize with multiple species from oral and vaginal cavity. This calls for re-examination of TM7 distribution and abundance. PMID:25957511

  13. The astrobiology primer: an outline of general knowledge--version 1, 2006.


    Billings, L; Cameron, V; Claire, M; Dick, G J; Domagal-Goldman, S D; Javaux, E J; Johnson, O J; Laws, C; Race, M S; Rask, J; Rummel, J D; Schelble, R T; Vance, S


    The Astrobiology Primer has been created as a reference tool for those who are interested in the interdisciplinary field of astrobiology. The field incorporates many diverse research endeavors, but it is our hope that this slim volume will present the reader with all he or she needs to know to become involved and to understand, at least at a fundamental level, the state of the art. Each section includes a brief overview of a topic and a short list of readable and important literature for those interested in deeper knowledge. Because of the great diversity of material, each section was written by a different author with a different expertise. Contributors, authors, and editors are listed at the beginning, along with a list of those chapters and sections for which they were responsible. We are deeply indebted to the NASA Astrobiology Institute (NAI), in particular to Estelle Dodson, David Morrison, Ed Goolish, Krisstina Wilmoth, and Rose Grymes for their continued enthusiasm and support. The Primer came about in large part because of NAI support for graduate student research, collaboration, and inclusion as well as direct funding. We have entitled the Primer version 1 in hope that it will be only the first in a series, whose future volumes will be produced every 3-5 years. This way we can insure that the Primer keeps up with the current state of research. We hope that it will be a great resource for anyone trying to stay abreast of an ever-changing field.

  14. GSP: a web-based platform for designing genome-specific primers in polyploids

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The primary goal of this research was to develop a web-based platform named GSP for designing genome-specific primers to distinguish subgenome sequences in the polyploid genome background. GSP uses BLAST to extract homeologous sequences of the subgenomes in the existing databases, performed a multip...


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey


  16. Fuel alcohol on the farm: a primer on production and use

    SciTech Connect

    Not Available


    The primer outlines for farmers the major factors to be considered before undertaking the production of ethanol on a small-scale basis - feedstocks, financing, safety, vehicle conversion and permit requirements. It illustrates and describes four small-scale stills that are currently operating.

  17. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    ERIC Educational Resources Information Center

    Elkins, Kelly M.


    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  18. A Web-Based Adaptive Tutor to Teach PCR Primer Design

    ERIC Educational Resources Information Center

    van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.


    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…

  19. Lives Intertwined: A Primer on the History and Emergence of Minority Serving Institutions

    ERIC Educational Resources Information Center

    Gasman, Marybeth; Nguyen, Thai-Huy; Conrad, Clifton F.


    In this article, we provide an overview--a primer--of the rise of Minority Serving Institutions (MSIs) as context for understanding the contemporary place of these institutions in our broader system of higher education. We also demonstrate how the emergence and the evolution of MSIs stem from our nation's struggle to provide equal educational…

  20. The Child, the Text and the Teacher: Reading Primers and Reading Instruction

    ERIC Educational Resources Information Center

    Patterson, Annette Joyce; Cormack, Phillip Anton; Green, William Charles


    From the late sixteenth century, in response to the problem of how best to teach children to read, a variety of texts, such as primers, spellers and readers were produced in England for vernacular instruction. This paper describes how these materials were used by teachers to develop, first, a specific religious understanding according to the…

  1. Sequence alignment status and amplicon size difference affecting EST-SSR primer performance and polymorphism

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Little attention has been given to failed, poorly-performing, and non-polymorphic expressed sequence tag (EST) simple sequence repeat (SSR) primers. This is due in part to a lack of interest and value in reporting them but also because of the difficulty in addressing the causes of failure on a prime...

  2. Sequence context effect on strand slippage in natural DNA primer-templates.


    Chi, Lai Man; Lam, Sik Lok


    Strand slippage has been found to occur in primer-templates containing a templating thymine, cytosine, and guanine, leading to the formation of misaligned structures with a single-nucleotide bulge. If remained in the active site of low-fidelity polymerases during DNA replication, these misaligned structures can ultimately bring about deletion mutations. In this study, we performed NMR investigations on primer-template models containing a templating adenine. Similar to our previous results on guanine, adenine templates are also less prone to strand slippage than pyrimidine templates. Misalignment occurs only in primer-templates that form a terminal C·G or G·C base pair. Together with our previous findings on thymine, cytosine, and guanine templates, the present study reveals strand slippage can occur in any kind of natural templating bases during DNA replication, providing insights into the origin of mutation hotspots in natural DNA sequences. In addition to the type of incoming base upon misincorporation, the propensity of strand slippage in primer-templates depends also on the type of templating base, its upstream and downstream bases.

  3. Massachusetts Primer on Special Education and Charter Schools. Section II: Information for State Officials and Others

    ERIC Educational Resources Information Center

    Massachusetts Department of Elementary and Secondary Education, 2009


    This paper presents the second part of "Massachusetts Primer on Special Education and Charter Schools." This section is an introduction for new staff members of state agencies and others who need an overview of topics related to Massachusetts students with disabilities enrolled in Massachusetts charter schools. The information focuses on…

  4. Detection of G-quadruplex DNA using primer extension as a tool.


    Kumari, Rupa; Nambiar, Mridula; Shanbagh, Shaika; Raghavan, Sathees C


    DNA sequence and structure play a key role in imparting fragility to different regions of the genome. Recent studies have shown that non-B DNA structures play a key role in causing genomic instability, apart from their physiological roles at telomeres and promoters. Structures such as G-quadruplexes, cruciforms, and triplexes have been implicated in making DNA susceptible to breakage, resulting in genomic rearrangements. Hence, techniques that aid in the easy identification of such non-B DNA motifs will prove to be very useful in determining factors responsible for genomic instability. In this study, we provide evidence for the use of primer extension as a sensitive and specific tool to detect such altered DNA structures. We have used the G-quadruplex motif, recently characterized at the BCL2 major breakpoint region as a proof of principle to demonstrate the advantages of the technique. Our results show that pause sites corresponding to the non-B DNA are specific, since they are absent when the G-quadruplex motif is mutated and their positions change in tandem with that of the primers. The efficiency of primer extension pause sites varied according to the concentration of monovalant cations tested, which support G-quadruplex formation. Overall, our results demonstrate that primer extension is a strong in vitro tool to detect non-B DNA structures such as G-quadruplex on a plasmid DNA, which can be further adapted to identify non-B DNA structures, even at the genomic level.

  5. Triplex PCR using new primers for the detection of Toxoplasma gondii.


    Rahumatullah, Anizah; Khoo, Boon Yin; Noordin, Rahmah


    Molecular methods are used increasingly for the detection of Toxoplasma gondii infection. This study developed a rapid, sensitive, and specific conventional triplex PCR for the detection of the B1 gene and ITS1 region of T. gondii using newly designed primers and an internal control based on the Vibrio cholerae HemM gene. The annealing temperature and concentrations of the primers, MgCl(2), and dNTPs were optimized. Two sets of primers (set 1 and 2) were tested, which contained different segments of the T. gondii B1 gene, 529 repeat region and ITS1 region. A series of sensitivity tests were performed using parasite DNA, whole parasites, and spiked human body fluids. Specificity tests were performed using DNA from common protozoa and bacteria. The newly developed assay based on set 2 primers was found to be specific and sensitive. The test was capable of detecting as little as 10 pg T. gondii DNA, 10(4) tachyzoites in spiked body fluids, and T. gondii DNA in the organ tissues of experimentally infected mice. The assay developed in this study will be useful for the laboratory detection of T. gondii infection.

  6. Facebook targeted advertisement for research recruitment: A primer for nurse researchers.


    Carter-Harris, Lisa


    Recruiting participants for research studies can be challenging and costly. Innovative recruitment methods are needed. Facebook targeted advertisement offers a low-cost alternative to traditional methods that has been successfully used in research study recruitment. This primer offers nurse researchers a method utilizing social media as a recruitment tool and details Facebook targeted advertisement for research recruitment.

  7. Multiply-primed rolling circle amplification of human papillomavirus using sequence-specific primers.


    Marincevic-Zuniga, Yanara; Gustavsson, Inger; Gyllensten, Ulf


    Multiply-primed rolling circle amplification (RCA) is a suitable technique for amplification of circular templates and has been used to identify novel human papillomaviruses (HPV). In this study we develop an efficient RCA for whole genome amplification of HPV using HPV-specific primers in clinical samples and establish a protocol for whole genome sequencing using the Sanger method. Amplification of cloned HPV-genomes by RCA was compared using specific primers against random hexamers. Using HPV-specific primers increased the effectiveness on average 15.2 times and the enrichment of HPV relative to human gDNA on average 62.2 times, as compared to using random hexamer. RCA products were sequenced without need for cloning, even when using low-input amounts. The technique was successfully used on 4 patient samples from FTA cards, to generate whole HPV-genome sequences. Degenerated HPV-specific primers for RCA produce DNA of sufficient quality and quantity suitable for sequencing and other potential downstream analyses.

  8. PCR Conditions for 16S Primers for Analysis of Microbes in the Colon of Rats

    PubMed Central

    Camacho, H.; Tuero, A. D.; Bacardí, D.; Palenzuela, D. O.; Aguilera, A.; Silva, J. A.; Estrada, R.; Gell, O.; Suárez, J.; Ancizar, J.; Brown, E.; Colarte, A. B.; Castro, J.; Novoa, L. I.


    The study of the composition of the intestinal flora is important to the health of the host, playing a key role in maintaining intestinal homeostasis and the evolution of the immune system. For these studies, various universal primers of the 16S rDNA gene are used in microbial taxonomy. Here, we report an evaluation of 5 universal primers to explore the presence of microbial DNA in colon biopsies preserved in RNAlater solution. The DNA extracted was used for the amplification of PCR products containing the variable (V) regions of the microbial 16S rDNA gene. The PCR products were studied by restriction fragment length polymorphism (RFLP) analysis and DNA sequence, whose percent of homology with microbial sequences reported in GenBank was verified using bioinformatics tools. The presence of microbes in the colon of rats was quantified by the quantitative PCR (qPCR) technique. We obtained microbial DNA from rat, useful for PCR analysis with the universal primers for the bacteria 16S rDNA. The sequences of PCR products obtained from a colon biopsy of the animal showed homology with the classes bacilli (Lactobacillus spp) and proteobacteria, normally represented in the colon of rats. The proposed methodology allowed the attainment of DNA of bacteria with the quality and integrity for use in qPCR, sequencing, and PCR-RFLP analysis. The selected universal primers provided knowledge of the abundance of microorganisms and the formation of a preliminary test of bacterial diversity in rat colon biopsies. PMID:27382362

  9. Species-specific PCR primers for the rapid identification of yeasts of the genus Zygosaccharomyces.


    Harrison, Elizabeth; Muir, Alastair; Stratford, Malcolm; Wheals, Alan


    Species-specific primer pairs that produce a single band of known product size have been developed for members of the Zygosaccharomyces clade including Zygosaccharomyces bailii, Zygosaccharomyces bisporus, Zygosaccharomyces kombuchaensis, Zygosaccharomyces lentus, Zygosaccharomyces machadoi, Zygosaccharomyces mellis and Zygosaccharomyces rouxii. An existing primer pair for the provisional new species Zygosaccharomyces pseudorouxii has been confirmed as specific. The HIS3 gene, encoding imidazole-glycerolphosphate dehydratase, was used as the target gene. This housekeeping gene evolves slowly and is thus well conserved among different isolates, but shows a significant number of base pair changes between even closely related species, sufficient for species-specific primer design. The primers were tested on type and wild strains of the genus Zygosaccharomyces and on members of the Saccharomycetaceae. Sequencing of the D1/D2 region of rDNA was used to confirm the identification of all nonculture collection isolates. This approach used extracted genomic DNA, but in practice, it can be used efficiently with a rapid colony PCR protocol. The method also successfully detected known and new hybrid strains of Z. rouxii and Z. pseudorouxii. The method is rapid, robust and inexpensive. It requires little expertise by the user and is thus useful for preliminary, large-scale screens.

  10. CCI Primer: Key Facts about Early Care and Education in New York City. 2008

    ERIC Educational Resources Information Center

    Kolben, Nancy; Holcomb, Betty


    This primer provides a comprehensive look at the early care and education services throughout New York City. The analysis, which includes data on access, funding, and services, helps members of the field, advocates and policy makers identify current challenges and opportunities. Data is presented on: (1) Demographics: New York City's Children and…

  11. El Primer Congreso Mexicanista de 1911: A Precursor to Contemporary Chicanismo

    ERIC Educational Resources Information Center

    Limon, Jose E.


    The article argues that many of the major themes which define the "supposedly new" ideology of Chicanismo were anticipated by El Primer Congreso Mexicanista, a political conference held in Laredo, Texas on September 14-22, 1911. Five of the discussions presented at the conference are appended. (NQ)

  12. Primer for Mississippi School Librarians. State Bulletin No. 134A. Re-issued in 1984.

    ERIC Educational Resources Information Center

    Mississippi State Dept. of Education, Jackson.

    This primer for Mississippi school librarians is designed for use as a planning guide by teachers, librarians, administrators, and supervisors involved in developing school library programs. The ten chapters of the bulletin cover: philosophy of the school library; standards; school library facilities; library collection development, including…

  13. Metastable Intermolecular Composites (MIC) Primers for Small Caliber Cartridges and Cartridge Actuated Devices

    DTIC Science & Technology


    formulations, which contain lead styphnate , barium nitrate, and antimony sulfide. The MIC mixture is an environmentally friendly, lead-free composition, so...compositions. Replacement of the lead styphnate only would have the disadvantage of retaining the antimony sulfide and barium nitrate pollutants in the...single batch of 500 MIC primers. ......... 23 Table 14. Direct process annual cost for lead styphnate

  14. Experimental Studies of the Number 41 Primer and Ignition 5.56-mm Ammunition

    DTIC Science & Technology


    caliber primers are lead styphnate , barium nitrate, and antimony sulfide, Sb2S3. Lesser amounts of aluminum powder, tetracene, and...this particle, which apparently did not melt, consists primarily of Barium . ...........................................................14 Figure 17...15 Figure 21. Reference spectrum of barium nitrate (top) compared to a spectrum representative (**splat) of many residual particles from

  15. A Public Policy Primer: How to Get off the Sidelines and into the Game

    ERIC Educational Resources Information Center

    Hollister, David C.


    This Primer is intended to help individual citizens and community leaders and organizers (1) better understand the complex nature of decision making in democracy and (2) identify strategies for having a larger voice and impact. This publication is predicated and draws upon the author's 40 years of extensive and hands-on experiences in varied…

  16. The Household Detective Primer: Protecting Your Children from Toxins in the Home. CHEC's Guide to Environmental Childproofing.

    ERIC Educational Resources Information Center

    Schubert, Sandra; Zelinsky, Benjamin

    Designed for parents, this primer presents information on threats to children's health that can be found in every American home, including disinfectants, art supplies, pesticides, and toxins in food and drinking water. The primer also provides practical information on safe and environmentally friendly household cleaners and disinfectants, outlines…

  17. Comparison of primers for RAPD-PCR from environmental isolates of Cryptococcus neoformans, Cryptococcus albidus and Cryptococcus laurentii complex.


    Dos Santos Pedroso, Reginaldo; Ferreira, Joseane Cristina; da Costa, Karen Regina Carim; Candido, Regina Celia


    Various organisms have been characterized by molecular methods, including fungi of the genus Cryptococcus. The purposes of this study were: to determine the discriminatory potential of the RAPD (Random Amplified Polymorphic DNA) primers, the pattern of similarity of the Cryptococcus species, and discuss their useful application in epidemiological studies. We analyzed 10 isolates of each specie/group: C. albidus, C. laurentii complex, C. neoformans var. grubii, all from environmental source, and two ATCC strains, C. neoformans var. grubii ATCC 90112, and C. neoformans var. neoformans ATCC 28957 by RAPD-PCR using the primers CAV1, CAV2, ZAP19, ZAP20, OPB11 and SEQ6. The primers showed a good discriminatory power, revealing important differences between them and between species; the SEQ6 primer discriminated a larger number of isolates of three species. Isolates of C. laurentii showed greater genetic diversity than other species revealed by all six primers. Isolates of C. neoformans were more homogeneous. Only the primer CAV2 showed no amplification of DNA bands for C. albidus. It was concluded that the use of limited number of carefully selected primers allowed the discrimination of different isolates, and some primers (e.g., CAV2 for C. albidus) may not to be applied to some species.

  18. Development of genus-specific primers for better understanding the diversity and population structure of Sphingomonas in soils.


    Zhou, Lisha; Li, Hui; Zhang, Ying; Han, Siqin; Xu, Hui


    Genus Sphingomonas has received increasing attentions due to its somewhat unique metabolic versatilities in the contaminated environment. However, due to the lack of genus-specific primers, the ecological significance of Sphingomonas in polluted soils has been rarely documented by 16S rDNA finger-printing methods. In this study, three genus-specific primer sets targeted at the 16S rRNA gene of Sphingomonas were developed and their specificities were tested with four contaminated soils from Shenfu petroleum-wastewater irrigation zone by constructing clone libraries, amplified ribosomal DNA restriction analysis (ARDRA) and sequencing the represented ARDRA patterns. Meanwhile, the newly designed primer sets and a previously reported primer set were compared, and the results showed that the newly developed primer set SA/429f-933r could detect a larger spectrum (90%) of Sphingomonas strains with higher specificity. Despite the superiority of primer set SA/429f-933r in specifically detecting Sphingomonas from contaminated soils, we cannot blink the fact that different primer sets preferentially amplified different dominant species. Therefore, two or more primer sets are recommended for evaluating the diversity and population structure of genus Sphingomonas. Additionally, a proportion (9.7%) of the cloned sequences discovered in this study were different from known Sphingomonas sequences, suggesting that new Sphingomonas sequences might present in soils from Shenfu irrigation zone.

  19. Comparison of primers for RAPD-PCR from environmental isolates of Cryptococcus neoformans, Cryptococcus albidus and Cryptococcus laurentii complex

    PubMed Central

    dos Santos Pedroso, Reginaldo; Ferreira, Joseane Cristina; da Costa, Karen Regina Carim; Candido, Regina Celia


    Various organisms have been characterized by molecular methods, including fungi of the genus Cryptococcus. The purposes of this study were: to determine the discriminatory potential of the RAPD (Random Amplified Polymorphic DNA) primers, the pattern of similarity of the Cryptococcus species, and discuss their useful application in epidemiological studies. We analyzed 10 isolates of each specie/group: C. albidus, C. laurentii complex, C. neoformans var. grubii, all from environmental source, and two ATCC strains, C. neoformans var. grubii ATCC 90112, and C. neoformans var. neoformans ATCC 28957 by RAPD-PCR using the primers CAV1, CAV2, ZAP19, ZAP20, OPB11 and SEQ6. The primers showed a good discriminatory power, revealing important differences between them and between species; the SEQ6 primer discriminated a larger number of isolates of three species. Isolates of C. laurentii showed greater genetic diversity than other species revealed by all six primers. Isolates of C. neoformans were more homogeneous. Only the primer CAV2 showed no amplification of DNA bands for C. albidus. It was concluded that the use of limited number of carefully selected primers allowed the discrimination of different isolates, and some primers (e.g., CAV2 for C. albidus) may not to be applied to some species. PMID:24031912

  20. Evaluation of 16S rRNA Gene Primer Pairs for Monitoring Microbial Community Structures Showed High Reproducibility within and Low Comparability between Datasets Generated with Multiple Archaeal and Bacterial Primer Pairs

    PubMed Central

    Fischer, Martin A.; Güllert, Simon; Neulinger, Sven C.; Streit, Wolfgang R.; Schmitz, Ruth A.


    The application of next-generation sequencing technology in microbial community analysis increased our knowledge and understanding of the complexity and diversity of a variety of ecosystems. In contrast to Bacteria, the archaeal domain was often not particularly addressed in the analysis of microbial communities. Consequently, established primers specifically amplifying the archaeal 16S ribosomal gene region are scarce compared to the variety of primers targeting bacterial sequences. In this study, we aimed to validate archaeal primers suitable for high throughput next generation sequencing. Three archaeal 16S primer pairs as well as two bacterial and one general microbial 16S primer pairs were comprehensively tested by in-silico evaluation and performing an experimental analysis of a complex microbial community of a biogas reactor. The results obtained clearly demonstrate that comparability of community profiles established using different primer pairs is difficult. 16S rRNA gene data derived from a shotgun metagenome of the same reactor sample added an additional perspective on the community structure. Furthermore, in-silico evaluation of primers, especially those for amplification of archaeal 16S rRNA gene regions, does not necessarily reflect the results obtained in experimental approaches. In the latter, archaeal primer pair ArchV34 showed the highest similarity to the archaeal community structure compared to observed by the metagenomic approach and thus appears to be the appropriate for analyzing archaeal communities in biogas reactors. However, a disadvantage of this primer pair was its low specificity for the archaeal domain in the experimental application leading to high amounts of bacterial sequences within the dataset. Overall our results indicate a rather limited comparability between community structures investigated and determined using different primer pairs as well as between metagenome and 16S rRNA gene amplicon based community structure analysis

  1. A degenerate pair of primers for simultaneous detection of four alpha- and betanecroviruses.


    Varanda, C M R; Cardoso, J M S; Oliveira, M D M; Oliveira, S; Clara, M I E; Félix, M R F


    The high infection levels due to Olive latent virus 1 (OLV-1), Olive mild mosaic virus (OMMV) (alphanecrovirus) and Tobacco necrosis virus D (TNV-D) (betanecrovirus) in Portuguese olive orchards prompted us to develop a rapid PCR-based assay for the simultaneous detection of these viruses aimed at the sanitary selection and marketing of plant material in compliance with European Union regulations. A pair of degenerate oligonucleotide primers, parRdRp5' and parCoat3' was designed based on conserved regions located in the RNA-dependent RNA polymerase (RdRp) and coat protein (CP) genes of these viruses and one other alphanecrovirus, Tobacco necrosis virus A. Its use in RT-PCR assays generated a product of ca. 2000 bp for the 4 viral species tested. These primers were compared with virus specific primers in multiplex RT-PCR, and identical results were obtained. Its application to dsRNA extracted from 54 olive field growing trees originated the expected ca. 2000 bp amplicon in 17 trees. The virus identity was determined by sequencing the cloned RT-PCR products. No TNV-A was found. The RT-PCR assay using the degenerate primers described in this study were shown to be reliable in detecting any of the above-mentioned alpha- and betanecroviruses, and it is as sensitive as that which uses virus specific primers in multiplex assays. Therefore, this assay is well suited for the rapid screen of virus-free plant material in selection and improvement crop programmes. Additionally, it has the potential to reveal virus diversity and the presence of new viruses, provided the RT-PCR generated amplicon is further sequenced.

  2. Comparison of the shear bond strength of 2 self-etch primer/adhesive systems.


    Bishara, Samir E; Oonsombat, Charuphan; Ajlouni, Raed; Laffoon, John F


    Conventional adhesive systems use 3 different agents-an enamel conditioner, a primer solution, and an adhesive resin for bonding orthodontic brackets to enamel. A unique characteristic of some new bonding systems in operative dentistry is that they combine the conditioning and priming agents into a single application. Combining conditioning and priming saves time and should be more cost-effective to the clinician and indirectly to the patient. The purpose of this study was to assess and compare the effects of mix and no-mix self-etch primers/bonding systems on the shear bond strengths of orthodontic brackets. The brackets were bonded to extracted human molars according to the following protocols. In group I, a self-etch acidic primer/adhesive system, Transbond Plus (3M Unitek, Monrovia, Calif), was applied on the enamel surface as suggested by the manufacturer; it has 2 components that must be mixed before use. The brackets were then bonded with Transbond XT and light-cured for 20 seconds. In group II, a no-mix self-etch bracket adhesive system, Ideal 1 (GAG International, Islandia, NY), was applied to the teeth as suggested by the manufacturer. The self-etch primer has 1 component that does not need to be mixed before use. The brackets were then bonded with the adhesive and light-cured for 20 seconds. The in vitro findings indicated that the shear bond strength comparisons (t = 0.681) of the 2 adhesive systems were not significantly different (P =.501). The mean shear bond strength of the 2-component acid etch primer was 5.9 +/- 2.7 MPa, and the mean for the 1-component system was 6.6 +/- 3.2 MPa. The clinician should consider the bond strength and the ease of application of the various components of the bracket bonding systems available on the market.

  3. Comparison of shear bond strength of two self-etch primer/adhesive systems.


    Bishara, Samir E; Ajlouni, Raed; Laffoon, John F; Warren, John J


    Orthodontic brackets adhesive systems use three different agents, an enamel conditioner, a primer solution, and an adhesive resin. A unique characteristic of some new bonding systems is that they combine the conditioning, priming, and adhesive agents into a single application. The purpose of this study was to assess and compare the effects of using one-step and two-step self-etch primer/adhesive systems on the shear bond strength of orthodontic brackets. The brackets were bonded to extracted human molars according to one of two protocols. Group I (control): a two-step self-etch acidic primer/adhesive system was used, Transbond Plus was applied to the enamel surface as suggested by the manufacturer. The brackets were bonded with Transbond XT and light cured for 20 seconds. Group II: a one-step self-etch, self-adhesive resin cement system, Maxcem, was applied directly to the bracket. The self-etch primer/adhesive is made of two components that mix automatically during application. The brackets were then light cured for 20 seconds. The mean shear bond strength of the two-step acid-etch primer/adhesive was 5.9 +/- 2.7 Mpa and the mean for the one-step system was 3.1 +/- 1.7 MPa. The in vitro findings of this study indicated that the shear bond strengths (t = 3.79) of the two adhesive systems were significantly different (P = .001). One-step adhesive systems could potentially be advantageous for orthodontic purposes if their bond strength can be improved.

  4. Advances in multiplex PCR: balancing primer efficiencies and improving detection success

    PubMed Central

    Sint, Daniela; Raso, Lorna; Traugott, Michael


    1. Multiplex PCR is a valuable tool in many biological studies but it is a multifaceted procedure that has to be planned and optimised thoroughly to achieve robust and meaningful results. In particular, primer concentrations have to be adjusted to assure an even amplification of all targeted DNA fragments. Until now, total DNA extracts were used for balancing primer efficiencies; however, the applicability for comparisons between taxa or different multiple-copy genes was limited owing to the unknown number of template molecules present per total DNA. 2. Based on a multiplex system developed to track trophic interactions in high Alpine arthropods, we demonstrate a fast and easy way of generating standardised DNA templates. These were then used to balance the amplification success for the different targets and to subsequently determine the sensitivity of each primer pair in the multiplex PCR. 3. In the current multiplex assay, this approach led to an even amplification success for all seven targeted DNA fragments. Using this balanced multiplex PCR, methodological bias owing to variation in primer efficiency will be avoided when analysing field-derived samples. 4. The approach outlined here allows comparing multiplex PCR sensitivity, independent of the investigated species, genome size or the targeted genes. The application of standardised DNA templates not only makes it possible to optimise primer efficiency within a given multiplex PCR, but it also offers to adjust and/or to compare the sensitivity between different assays. Along with other factors that influence the success of multiplex reactions, and which we discuss here in relation to the presented detection system, the adoption of this approach will allow for direct comparison of multiplex PCR data between systems and studies, enhancing the utility of this assay type. PMID:23549328

  5. A method for automatically extracting infectious disease-related primers and probes from the literature

    PubMed Central


    Background Primer and probe sequences are the main components of nucleic acid-based detection systems. Biologists use primers and probes for different tasks, some related to the diagnosis and prescription of infectious diseases. The biological literature is the main information source for empirically validated primer and probe sequences. Therefore, it is becoming increasingly important for researchers to navigate this important information. In this paper, we present a four-phase method for extracting and annotating primer/probe sequences from the literature. These phases are: (1) convert each document into a tree of paper sections, (2) detect the candidate sequences using a set of finite state machine-based recognizers, (3) refine problem sequences using a rule-based expert system, and (4) annotate the extracted sequences with their related organism/gene information. Results We tested our approach using a test set composed of 297 manuscripts. The extracted sequences and their organism/gene annotations were manually evaluated by a panel of molecular biologists. The results of the evaluation show that our approach is suitable for automatically extracting DNA sequences, achieving precision/recall rates of 97.98% and 95.77%, respectively. In addition, 76.66% of the detected sequences were correctly annotated with their organism name. The system also provided correct gene-related information for 46.18% of the sequences assigned a correct organism name. Conclusions We believe that the proposed method can facilitate routine tasks for biomedical researchers using molecular methods to diagnose and prescribe different infectious diseases. In addition, the proposed method can be expanded to detect and extract other biological sequences from the literature. The extracted information can also be used to readily update available primer/probe databases or to create new databases from scratch. PMID:20682041

  6. Retrieval of glycoside hydrolase family 9 cellulase genes from environmental DNA by metagenomic gene specific multi-primer PCR.


    Xiong, Xiaolong; Yin, Xiaopu; Pei, Xiaolin; Jin, Peng; Zhang, Ao; Li, Yan; Gong, Weibo; Wang, Qiuyan


    A new method, termed metagenomic gene specific multi-primer PCR (MGSM-PCR), is presented that uses multiple gene specific primers derived from an isolated gene from a constructed metagenomic library rather than degenerate primers designed based on a known enzyme family. The utility of MGSM-PCR was shown by applying it to search for homologues of the glycoside hydrolase family 9 cellulase in metagenomic DNA. The success of the multiplex PCR was verified by visualizing products on an agarose gel following gel electrophoresis. A total of 127 homologous genes were amplified with combinatorial multi-primer reactions from 34 soil DNA samples. Multiple alignments revealed extensive sequence diversity among these captured sequences with sequence identity varying from 26 to 99.7%. These results indicated that significantly diverse homologous genes were indeed readily accessible when using multiple metagenomic gene specific primers.

  7. Biofunctionalization of Polyoxometalates with DNA Primers, Their Use in the Polymerase Chain Reaction (PCR) and Electrochemical Detection of PCR Products.


    Debela, Ahmed M; Ortiz, Mayreli; Beni, Valerio; Thorimbert, Serge; Lesage, Denis; Cole, Richard B; O'Sullivan, Ciara K; Hasenknopf, Bernold


    The bioconjugation of polyoxometalates (POMs), which are inorganic metal oxido clusters, to DNA strands to obtain functional labeled DNA primers and their potential use in electrochemical detection have been investigated. Activated monooxoacylated polyoxotungstates [SiW11 O39 {Sn(CH2 )2 CO}](8-) and [P2 W17 O61 {Sn(CH2 )2 CO}](6-) have been used to link to a 5'-NH2 terminated 21-mer DNA forward primer through amide coupling. The functionalized primer was characterized by using a battery of techniques, including electrophoresis, mass spectrometry, as well as IR and Raman spectroscopy. The functionality of the POM-labeled primers was demonstrated through hybridization with a surface-immobilized probe. Finally, the labeled primers were successfully used in the polymerase chain reaction (PCR) and the PCR products were characterized by using electrophoresis.

  8. Design and evaluation of PCR primers for denaturing gradient gel electrophoresis analysis of plant parasitic and fungivorous nematode communities.


    Kushida, Atsuhiko


    A PCR-DGGE primer pair, Tyl2F-Tyl4R, specific to plant parasitic and fungivorous nematodes was designed based on the 18S rRNA gene. The results of community analysis using the primers showed that they are specific to the order Tylenchida. This primer pair detected species belonging to Tylenchida with high sensitivity and high resolution. The number of detected species of plant parasitic and fungivorous nematodes and their band intensity were much improved compared with PCR-DGGE analysis using the SSU18A-SSU9R primer, which is commonly used for nematode community analysis. It was confirmed that using a group-specific primer was effective for nematode community analysis with PCR-DGGE.

  9. Evaluation of single liquid primers with organic sulfur compound for bonding between indirect composite material and silver-palladium-copper-gold alloy.


    Shimoe, Saiji; Tanoue, Naomi; Satoda, Takahiro; Murayama, Takeshi; Nikawa, Hiroki; Matsumura, Hideo


    The purpose of this study was to evaluate the effect of primers on bonding between a silver-palladium-copper-gold alloy and an indirect composite material. Cast disks were air-abraded with alumina, conditioned with one of five primers (Alloy Primer, Luna-Wing Primer, Metal Primer II, Metaltite, M.L. Primer), and bonded with a light-activated indirect composite. Shear bond strengths were determined after 20,000 times of thermocycling. The results showed that four of the primers, except the Luna-Wing Primer, were effective in enhancing the bond strength as compared with the unprimed control group. Of these four primers, Alloy Primer, Metal Primer II, and M.L. Primer exhibited significantly greater bond strengths. It can be concluded that the effectiveness of primers varies considerably according to the organic sulfur compounds added to the solvent, and that care must be taken in selecting priming agents for bonding the composite material and the silver-palladium-copper-gold alloy.

  10. In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River

    PubMed Central

    Cannon, M. V.; Hester, J.; Shalkhauser, A.; Chan, E. R.; Logue, K.; Small, S. T.; Serre, D.


    Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity. PMID:26965911

  11. In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River

    NASA Astrophysics Data System (ADS)

    Cannon, M. V.; Hester, J.; Shalkhauser, A.; Chan, E. R.; Logue, K.; Small, S. T.; Serre, D.


    Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity.

  12. Single nucleotide polymorphism genotyping by mini-primer allele-specific amplification with universal reporter primers for identification of degraded DNA.


    Asari, Masaru; Watanabe, Satoshi; Matsubara, Kazuo; Shiono, Hiroshi; Shimizu, Keiko


    Single nucleotide polymorphism (SNP) is informative for human identification, and much shorter regions are targeted in analysis of biallelic SNP compared with highly polymorphic short tandem repeat (STR). Therefore, SNP genotyping is expected to be more sensitive than STR genotyping of degraded human DNA. To achieve simple, economical, and sensitive SNP genotyping for identification of degraded human DNA, we developed 18 loci for a SNP genotyping technique based on the mini-primer allele-specific amplification (ASA) combined with universal reporter primers (URP). The URP/ASA-based genotyping consisted of two amplifications followed by detection using capillary electrophoresis. The sizes of the target genome fragments ranged from 40 to 67bp in length. In the Japanese population, the frequencies of minor alleles of 18 SNPs ranged from 0.36 to 0.50, and these SNPs are informative for identification. The success rate of SNP genotyping was much higher than that of STR genotyping of artificially degraded DNA. Moreover, we applied this genotyping method to case samples and showed successful SNP genotyping of severely degraded DNA from a 4-year buffered formalin-fixed tissue sample for human identification.

  13. In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River.


    Cannon, M V; Hester, J; Shalkhauser, A; Chan, E R; Logue, K; Small, S T; Serre, D


    Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity.

  14. 40 CFR 63.3092 - How must I control emissions from my electrodeposition primer system if I want to comply with the...

    Code of Federal Regulations, 2011 CFR


    ... bonding primer, and glass bonding adhesive emission limit? 63.3092 Section 63.3092 Protection of...-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? If...

  15. 40 CFR 63.3092 - How must I control emissions from my electrodeposition primer system if I want to comply with the...

    Code of Federal Regulations, 2010 CFR


    ... bonding primer, and glass bonding adhesive emission limit? 63.3092 Section 63.3092 Protection of...-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? If...

  16. Infrared spectroscopic method for analysis of Mg 2Ca(SO 4) 3 in mixtures with MgSO 4 and/or CaSO 4

    NASA Astrophysics Data System (ADS)

    Smith, Duane H.; Seshadri, Kal S.


    Mg 2Ca(SO 4) 3 is prepared from, and may be found in, mixtures with MgSO 4 and CaSO 4. Such mixtures frequently occur in the ash produced by various types of coal combustion, especially in filter cakes from pressurized fluidized bed combustion with dolomite as a SO x sorbent. Previously, qualitative analyses could be performed for Mg 2Ca(SO 4) 3 in these mixtures, but no quantitative analytical method was available. An infrared spectroscopic method has been developed that provides reasonably quantitative results for Mg 2Ca(SO 4) 3, MgSO 4,and CaSO 4 in their mixtures.

  17. Detection of Xanthomonas arboricola pv. pruni by PCR using primers based on DNA sequences related to the hrp genes.


    Park, So Yeon; Lee, Young Sun; Koh, Young Jin; Hur, Jae-Sun; Jung, Jae Sung


    Efficient control of Xanthomonas arboricola pv. pruni, the causal agent of bacterial spot on stone fruit, requires a sensitive and reliable diagnostic tool. A PCR detection method that utilizes primers to target the hrp gene cluster region was developed in this study. The nucleotide sequence of the PCR product amplified with primers specific for the hrp region of the xanthomonads and genomic DNA of X. arboricola pv. pruni was determined, and the sequence was aligned with that of X. campestris pv. campestris, which was obtained from the GenBank database. On the basis of the sequence of the amplified hrp region, a PCR primer set of XapF/R specific to X. arboricola pv. pruni was designed. This primer set yielded a 243-bp product from the genomic DNA of X. aboricola pv. pruni strains, but no products from other 21 strains of Xanthomonas or from two epiphytic bacterial species. Southern blot hybridization with the probe derived from the PCR product with the primer set and X. aboricola pv. pruni DNA confirmed the PCR results. The Xap primer system was successfully applied to detect the pathogen from infected peach fruits. When it was applied in field samples, the primer set was proved as a reliable diagnostic tool for specific detection of X. aboricola pv. pruni from peach orchards.

  18. Significance of stereochemistry of 3'-terminal phosphorothioate-modified primer in DNA polymerase-mediated chain extension.


    Nawrot, Barbara; Paul, Natasha; Rebowska, Beata; Stec, Wojciech J


    Influence of stereochemistry of the 3'-terminal phosphorothioate (PS)-modified primers was studied in a single base extension (SBE) assay to evaluate any improvements in specificity. SBE reactions were catalyzed by members of the high fidelity Pfu family of DNA polymerases with (exo+) or without (exo-) 3' --> 5' exonucleolytic activity. The diastereomerically pure PS-labeled primers used in these studies were obtained either by the stereospecific chemical synthesis invented in our laboratory or by the more conventional ion-exchange chromatographic method for separation of a mixture of diastereomers (R(P) and S(P)). When the SBE reaction was performed in the presence of mispaired 2'-deoxyribonucleoside triphosphates (dNTPs), the "racemic" 3'-phosphorothioate primer mixture resulted in a lower level of 3' --> 5' exonuclease-mediated cleavage products in comparison to the SBE reactions carried out with the corresponding unmodified primer. When the diastereomerically pure RP 3'-phosphorothioate primer was examined, the results were largely the same as for the racemic 3'-phosphorothioate primer mixture. In contrast, a 3'-PS primer of S(P) configuration displayed significantly improved performance in the SBE reaction. This included the lack of 3' --> 5' proofreading products, less mispriming, and improved yield of incorporation of the correct nucleotide.

  19. Primer release is the rate-limiting event in lagging-strand synthesis mediated by the T7 replisome

    PubMed Central

    Hernandez, Alfredo J.; Lee, Seung-Joo; Richardson, Charles C.


    DNA replication occurs semidiscontinuously due to the antiparallel DNA strands and polarity of enzymatic DNA synthesis. Although the leading strand is synthesized continuously, the lagging strand is synthesized in small segments designated Okazaki fragments. Lagging-strand synthesis is a complex event requiring repeated cycles of RNA primer synthesis, transfer to the lagging-strand polymerase, and extension effected by cooperation between DNA primase and the lagging-strand polymerase. We examined events controlling Okazaki fragment initiation using the bacteriophage T7 replication system. Primer utilization by T7 DNA polymerase is slower than primer formation. Slow primer release from DNA primase allows the polymerase to engage the complex and is followed by a slow primer handoff step. The T7 single-stranded DNA binding protein increases primer formation and extension efficiency but promotes limited rounds of primer extension. We present a model describing Okazaki fragment initiation, the regulation of fragment length, and their implications for coordinated leading- and lagging-strand DNA synthesis. PMID:27162371

  20. RNase H-dependent PCR (rhPCR): improved specificity and single nucleotide polymorphism detection using blocked cleavable primers

    PubMed Central


    Background The polymerase chain reaction (PCR) is commonly used to detect the presence of nucleic acid sequences both in research and diagnostic settings. While high specificity is often achieved, biological requirements sometimes necessitate that primers are placed in suboptimal locations which lead to problems with the formation of primer dimers and/or misamplification of homologous sequences. Results Pyrococcus abyssi (P.a.) RNase H2 was used to enable PCR to be performed using blocked primers containing a single ribonucleotide residue which are activated via cleavage by the enzyme (rhPCR). Cleavage occurs 5'-to the RNA base following primer hybridization to the target DNA. The requirement of the primer to first hybridize with the target sequence to gain activity eliminates the formation of primer-dimers and greatly reduces misamplification of closely related sequences. Mismatches near the scissile linkage decrease the efficiency of cleavage by RNase H2, further increasing the specificity of the assay. When applied to the detection of single nucleotide polymorphisms (SNPs), rhPCR was found to be far more sensitive than standard allele-specific PCR. In general, the best discrimination occurs when the mismatch is placed at the RNA:DNA base pair. Conclusion rhPCR eliminates the formation of primer dimers and markedly improves the specificity of PCR with respect to off-target amplification. These advantages of the assay should find utility in challenging qPCR applications such as genotyping, high level multiplex assays and rare allele detection. PMID:21831278

  1. Comparative Evaluation of Four Bacteria-Specific Primer Pairs for 16S rRNA Gene Surveys

    PubMed Central

    Thijs, Sofie; Op De Beeck, Michiel; Beckers, Bram; Truyens, Sascha; Stevens, Vincent; Van Hamme, Jonathan D.; Weyens, Nele; Vangronsveld, Jaco


    Bacterial taxonomic community analyses using PCR-amplification of the 16S rRNA gene and high-throughput sequencing has become a cornerstone in microbiology research. To reliably detect the members, or operational taxonomic units (OTUs), that make up bacterial communities, taxonomic surveys rely on the use of the most informative PCR primers to amplify the broad range of phylotypes present in up-to-date reference databases. However, primers specific for the domain Bacteria were often developed some time ago against database versions that are now out of date. Here we evaluated the performance of four bacterial primers for characterizing complex microbial communities in explosives contaminated and non-contaminated forest soil and by in silico evaluation against the current SILVA123 database. Primer pair 341f/785r produced the highest number of bacterial OTUs, phylogenetic richness, Shannon diversity, low non-specificity and most reproducible results, followed by 967f/1391r and 799f/1193r. Primer pair 68f/518r showed overall low coverage and a bias toward Alphaproteobacteria. In silico, primer pair 341f/785r showed the highest coverage of the domain Bacteria (96.1%) with no obvious bias toward the majority of bacterial species. This suggests the high utility of primer pair 341f/785r for soil and plant-associated bacterial microbiome studies.

  2. Specific amplification of bacterial DNA by optimized so-called universal bacterial primers in samples rich of plant DNA.


    Dorn-In, Samart; Bassitta, Rupert; Schwaiger, Karin; Bauer, Johann; Hölzel, Christina S


    Universal primers targeting the bacterial 16S-rRNA-gene allow quantification of the total bacterial load in variable sample types by qPCR. However, many universal primer pairs also amplify DNA of plants or even of archaea and other eukaryotic cells. By using these primers, the total bacterial load might be misevaluated, whenever samples contain high amounts of non-target DNA. Thus, this study aimed to provide primer pairs which are suitable for quantification and identification of bacterial DNA in samples such as feed, spices and sample material from digesters. For 42 primers, mismatches to the sequence of chloroplasts and mitochondria of plants were evaluated. Six primer pairs were further analyzed with regard to the question whether they anneal to DNA of archaea, animal tissue and fungi. Subsequently they were tested with sample matrix such as plants, feed, feces, soil and environmental samples. To this purpose, the target DNA in the samples was quantified by qPCR. The PCR products of plant and feed samples were further processed for the Single Strand Conformation Polymorphism method followed by sequence analysis. The sequencing results revealed that primer pair 335F/769R amplified only bacterial DNA in samples such as plants and animal feed, in which the DNA of plants prevailed.

  3. Improved efficiency and robustness in qPCR and multiplex end-point PCR by twisted intercalating nucleic acid modified primers.


    Schneider, Uffe Vest; Mikkelsen, Nikolaj Dam; Lindqvist, Anja; Okkels, Limei Meng; Jøhnk, Nina; Lisby, Gorm


    We introduce quantitative polymerase chain reaction (qPCR) primers and multiplex end-point PCR primers modified by the addition of a single ortho-Twisted Intercalating Nucleic Acid (o-TINA) molecule at the 5'-end. In qPCR, the 5'-o-TINA modified primers allow for a qPCR efficiency of 100% at significantly stressed reaction conditions, increasing the robustness of qPCR assays compared to unmodified primers. In samples spiked with genomic DNA, 5'-o-TINA modified primers improve the robustness by increased sensitivity and specificity compared to unmodified DNA primers. In unspiked samples, replacement of unmodified DNA primers with 5'-o-TINA modified primers permits an increased qPCR stringency. Compared to unmodified DNA primers, this allows for a qPCR efficiency of 100% at lowered primer concentrations and at increased annealing temperatures with unaltered cross-reactivity for primers with single nucleobase mismatches. In a previously published octaplex end-point PCR targeting diarrheagenic Escherichia coli, application of 5'-o-TINA modified primers allows for a further reduction (>45% or approximately one hour) in overall PCR program length, while sustaining the amplification and analytical sensitivity for all targets in crude bacterial lysates. For all crude bacterial lysates, 5'-o-TINA modified primers permit a substantial increase in PCR stringency in terms of lower primer concentrations and higher annealing temperatures for all eight targets. Additionally, crude bacterial lysates spiked with human genomic DNA show lesser formation of non-target amplicons implying increased robustness. Thus, 5'-o-TINA modified primers are advantageous in PCR assays, where one or more primer pairs are required to perform at stressed reaction conditions.

  4. A primer on brain imaging in developmental psychopathology: what is it good for?


    Pine, Daniel S


    This primer introduces a Special Section on brain imaging, which includes a commentary and 10 data papers presenting applications of brain imaging to questions on developmental psychopathology. This primer serves two purposes. First, the article summarizes the strength and weaknesses of various brain-imaging techniques typically employed in research on developmental psychopathology. Second, the article places research on brain imaging in a broader context by discussing particular limitations and utilities of imaging. Specifically, while brain imaging is currently of limited clinical utility, work in this area is beginning to shape clinical thinking. Brain-imaging research offers a unique opportunity to constrain theories of pathophysiology based on understandings of brain function. This effect promises to open avenues for novel treatments.

  5. Anticorrosion characteristics of a Zn-primer coating in a ballast tank under various chloride concentrations

    NASA Astrophysics Data System (ADS)

    Kim, Seong-Jong; Lee, Seung-Jun


    At an open-circuit potential, the anodic polarization curves had very similar values, and no significant differences were observed among the conditions. In the cathodic polarization curves, total residual chloride (TRC) reacted with the Zn-primer coating and created a film that had anticorrosion properties. Therefore, the anticorrosion property improved. With an increase in applied potential in the potentiostatic experiment, the observed surface corrosion occurred due to the dissolution reaction. From Tafel analysis, the corrosion current density had the highest value in natural seawater and the lowest value in the 2 ppm solution. Generally, metals corrode faster with increasing TRC concentration, but with the formation of Zn(OH)2, which has anticorrosion properties, the corrosion resistance of a Zn-primer-coated specimen in seawater can be improved.

  6. Construction of a Transcription Map for Papillomaviruses using RACE, RNase Protection, and Primer Extension Assays.


    Wang, Xiaohong; Zheng, Zhi-Ming


    Papillomaviruses are a family of small, non-enveloped DNA tumor viruses. Knowing a complete transcription map of each papillomavirus genome can provide guidance for various papillomavirus studies. This unit provides detailed protocols to construct a transcription map of human papillomavirus type 18. The same approach can be easily adapted to other transcription map studies of any other papillomavirus genotype due to the high degree of conservation in genome structure, organization, and gene expression among papillomaviruses. The focused methods are 5'- and 3'-rapid amplification of cDNA ends (RACE), which are techniques commonly used in molecular biology to obtain full-length RNA transcript or to map a transcription start site (TSS) or an RNA polyadenylation (pA) cleavage site. Primer walking RT-PCR is a method for studying the splicing junction of RACE products. In addition, RNase protection assay and primer extension are also introduced as alternative methods in the mapping analysis.

  7. Isolation of Fungal Pathogens to an Edible Mushroom, Pleurotus eryngii, and Development of Specific ITS Primers.


    Kim, Sang-Woo; Kim, Sinil; Lee, Hyun-Jun; Park, Ju-Wan; Ro, Hyeon-Su


    Fungal pathogens have caused severe damage to the commercial production of Pleurotus eryngii, the king oyster mushroom, by reducing production yield, causing deterioration of commercial value, and shortening shelf-life. Four strains of pathogenic fungi, including Trichoderma koningiopsis DC3, Phomopsis sp. MP4, Mucor circinelloides MP5, and Cladosporium bruhnei MP6, were isolated from the bottle culture of diseased P. eryngii. A species-specific primer set was designed for each fungus from the ITS1-5.8S rDNA-ITS2 sequences. PCR using the ITS primer set yielded a unique DNA band for each fungus without any cross-reaction, proving the validity of our method in detection of mushroom fungal pathogens.

  8. Human DNA polymerase θ grasps the primer terminus to mediate DNA repair

    PubMed Central

    Zahn, Karl E.; Averill, April M.; Aller, Pierre; Wood, Richard D.; Doublié, Sylvie


    DNA polymerase θ protects against genomic instability via an alternative end-joining repair pathway for DNA double-strand breaks. Breast, lung and oral cancers over-express polymerase θ, and reduction of its activity in mammalian cells increases sensitivity to double-strand break inducing agents, including ionizing radiation. Reported here are crystal structures of the C-terminal polymerase domain from human polymerase θ, illustrating two potential modes of dimerization. One structure depicts insertion of ddATP opposite an abasic site analog during translesion DNA synthesis. The second structure describes a cognate ddGTP complex. Polymerase θ employs a specialized thumb subdomain to establish unique upstream contacts to the primer DNA strand, including an interaction to the 3’-terminal phosphate from one of five distinctive insertion loops. These observations demonstrate how polymerase θ grasps the primer to bypass DNA lesions, or extend poorly annealed DNA termini to mediate end-joining. PMID:25775267

  9. Microsatellite primers for Camissoniopsis cheiranthifolia (Onagraceae) and cross-amplification in related species1

    PubMed Central

    López-Villalobos, Adriana; Samis, Karen E.; Eckert, Christopher G.


    • Premise of the study: We developed 24 nuclear microsatellite primers from an enriched genomic library for the Pacific coastal dune endemic Camissoniopsis cheiranthifolia to study the consequences of mating system differentiation, the genetics of species’ range limits, and hybridization with its closest sister taxon, C. bistorta. • Methods and Results: Twenty-four primer pairs were developed and characterized in four populations of C. cheiranthifolia and one population of C. bistorta. We also tested eight additional taxa for cross-amplification. The average number of alleles per locus per species was 4.3 and 6.0, respectively. The number of loci that amplified and were variable within the eight related taxa ranged from six to 17. • Conclusions: These markers will be useful in studying mating system evolution, the genetic structure of species’ ranges, hybridization, and the provenance of material used for habitat restoration in C. cheiranthifolia, C. bistorta, and related species. PMID:25309839

  10. STITCHER: A web resource for high-throughput design of primers for overlapping PCR applications.


    O'Halloran, Damien M


    Overlapping PCR is routinely used in a wide number of molecular applications. These include stitching PCR fragments together, generating fluorescent transcriptional and translational fusions, inserting mutations, making deletions, and PCR cloning. Overlapping PCR is also used for genotyping by traditional PCR techniques and in detection experiments using techniques such as loop-mediated isothermal amplification (LAMP). STITCHER is a web tool providing a central resource for researchers conducting all types of overlapping PCR experiments with an intuitive interface for automated primer design that's fast, easy to use, and freely available online ( STITCHER can handle both single sequence and multi-sequence input, and specific features facilitate numerous other PCR applications, including assembly PCR, adapter PCR, and primer walking. Field PCR, and in particular, LAMP, offers promise as an on site tool for pathogen detection in underdeveloped areas, and STITCHER includes off-target detection features for pathogens commonly targeted using LAMP technology.

  11. Construction of a Transcription Map for Papillomaviruses using RACE, RNAse Protection and Primer Extension Assays

    PubMed Central

    Wang, Xiaohong; Zheng, Zhi-Ming


    Papillomaviruses are a family of small, non-enveloped DNA tumor viruses. Knowing a complete transcription map from each papillomavirus genome can provide guidance for various papillomavirus studies. This unit provides detailed protocols to construct a transcription map of human papillomavirus type 18. The same approach can be easily adapted to other transcription map studies of any other papillomavirus genotype due to the high degree of conservation in the genome structure, organization and gene expression among papillomaviruses. The focused methods are 5’- and 3’- rapid amplification of cDNA ends (RACE), which are the techniques commonly used in molecular biology to obtain the full length RNA transcript or to map a transcription start site (TSS) or an RNA polyadenylation (pA) cleavage site. Primer walking RT-PCR is a method for studying splicing junction of RACE products. In addition, RNase protection assay and primer extension are also introduced as alternative methods in the mapping analysis. PMID:26855281

  12. Oligonucleotides complementary to the Oxytricha nova telomerase RNA delineate the template domain and uncover a novel mode of primer utilization.

    PubMed Central

    Melek, M; Davis, B T; Shippen, D E


    The telomerase reverse transcriptase uses an essential RNA subunit as a template to direct telomeric DNA synthesis. The 190-nucleotide Oxytricha nova telomerase RNA was identified by using an oligonucleotide probe complementary to the predicted CCCCAAAA template. This RNA displays extensive sequence similarity to the Euplotes crassus telomerase RNA and carries the same 5' CAAAACCCCAAAACC 3' telomeric domain. Antisense oligonucleotides were used to map the boundaries of the functional template and to investigate the mechanism of primer recognition and elongation. On the basis of their ability to inhibit or to prime telomerase, oligonucleotides were classified into three categories. Category 1 oligonucleotides, which extended 5' of residue 42 in the RNA, abolished elongation of (T4G4)3 and (G4T4)3 primers in vitro. In contrast, oligonucleotides terminating between residues 42 and 50 (categories 2 and 3), served as efficient telomerase primers. We conclude that the O. nova template comprises residues 42 to 50 in the 190-nucleotide RNA, a different set of nucleotides than are used by the E. crassus enzyme. Category 2 primer reactions amassed short products, and their abundance could be decreased by altering the 5' sequence of the primer, consistent with the two-primer-binding-site model for telomerase. Category 3 primers generated a bimodal distribution of short and long products, each having a unique elongation profile. The long-product profile is inconsistent with sequence-specific primer alignment. Rather, each primer was extended by the same register of TTTTGGGG repeats, suggesting shuttling to a default position within the template. The parallels between telomerase and RNA polymerase elongation mechanisms are discussed. Images PMID:7969123

  13. Barcoding the kingdom Plantae: new PCR primers for ITS regions of plants with improved universality and specificity.


    Cheng, Tao; Xu, Chao; Lei, Li; Li, Changhao; Zhang, Yu; Zhou, Shiliang


    The internal transcribed spacer (ITS) of nuclear ribosomal DNA is one of the most commonly used DNA markers in plant phylogenetic and DNA barcoding analyses, and it has been recommended as a core plant DNA barcode. Despite this popularity, the universality and specificity of PCR primers for the ITS region are not satisfactory, resulting in amplification and sequencing difficulties. By thoroughly surveying and analysing the 18S, 5.8S and 26S sequences of Plantae and Fungi from GenBank, we designed new universal and plant-specific PCR primers for amplifying the whole ITS region and a part of it (ITS1 or ITS2) of plants. In silico analyses of the new and the existing ITS primers based on these highly representative data sets indicated that (i) the newly designed universal primers are suitable for over 95% of plants in most groups; and (ii) the plant-specific primers are suitable for over 85% of plants in most groups without amplification of fungi. A total of 335 samples from 219 angiosperm families, 11 gymnosperm families, 24 fern and lycophyte families, 16 moss families and 17 fungus families were used to test the performances of these primers. In vitro PCR produced similar results to those from the in silico analyses. Our new primer pairs gave PCR improvements up to 30% compared with common-used ones. The new universal ITS primers will find wide application in both plant and fungal biology, and the new plant-specific ITS primers will, by eliminating PCR amplification of nonplant templates, significantly improve the quality of ITS sequence information collections in plant molecular systematics and DNA barcoding.

  14. Use of single-primer DNA amplifications in genetic studies of peanut (Arachis hypogaea L.).


    Halward, T; Stalker, T; LaRue, E; Kochert, G


    A recent approach to detecting genetic polymorphism involves the amplification of genomic DNA using single primers of arbitrary sequence. When separated electrophoretically in agarose gels, the amplification products give banding patterns that can be scored for genetic variation. The objective of this research was to apply these techniques to cultivated peanut (Arachis hypogaea L.) and related wild species to determine whether such an approach would be feasible for the construction of a genetic linkage map in peanut or for systematic studies of the genus. Two peanut cultivars, 25 unadapted germplasm lines of A. hypogaea, the wild allotetraploid progenitor of cultivated peanut (A. monticola), A. glabrata (a tetraploid species from section Rhizomatosae), and 29 diploid wild species of Arachis were evaluated for variability using primers of arbitrary sequence to amplify segments of genomic DNA. No variation in banding pattern was observed among the cultivars and germplasm lines of A. hypogaea, whereas the wild Arachis species were uniquely identified with most primers tested. Bands were scored (+/-) in the wild species and the PAUP computer program for phylogenetic analysis and the HyperRFLP program for genetic distance analysis were used to generate dendrograms showing genetic relationships among the diploid Arachis species evaluated. The two analyses produced nearly identical dendrograms of species relationships. In addition, approximately 100 F2 progeny from each of two interspecific crosses were evaluated for segregation of banding patterns. Although normal segregation was observed among the F2 progeny from both crosses, banding patterns were quite complex and undesirable for use in genetic mapping. The dominant behavior of the markers prevented the differentiation of heterozygotes from homozygotes with certainty, limiting the usefulness of arbitrary primer amplification products as markers in the construction of a genetic linkage map in peanut.

  15. Evaluation of Zn-rich Primers and Rust Converters for Corrosion Protection of Steel

    DTIC Science & Technology


    phosphoric acid at ~15-33% wt., phosphoric and tannic acids , optimum conversion takes place from 3 to 12 months, thickness of oxide layer and its...barrier characteristics. 1.Gempler’s (water-based, tannic acid ) 2.Loctite rust treatment (polymeric-based, barium sulfate) 3.Total Solutions (water...based, tannic acid ) 4.Phoscote (phosphoric acid – current USMC product) 5.VpCI CorrVerter (combined rust converter and primer) 6.Corroseal (water-based

  16. OrigenArp Primer: How to Perform Isotopic Depletion and Decay Calculations with SCALE/ORIGEN

    SciTech Connect

    Bowman, Stephen M; Gauld, Ian C


    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for nuclear analyses. ORIGEN-ARP is a SCALE isotopic depletion and decay analysis sequence used to perform point-depletion calculations with the well-known ORIGEN-S code using problem-dependent cross sections. Problem-dependent cross-section libraries are generated using the ARP (Automatic Rapid Processing) module using an interpolation algorithm that operates on pre-generated libraries created for a range of fuel properties and operating conditions. Methods are provided in SCALE to generate these libraries using one-, two-, and three-dimensional transport codes. The interpolation of cross sections for uranium-based fuels may be performed for the variables burnup, enrichment, and water density. An option is also available to interpolate cross sections for mixed-oxide (MOX) fuels using the variables burnup, plutonium content, plutonium isotopic vector, and water moderator density. This primer is designed to help a new user understand and use ORIGEN-ARP with the OrigenArp Windows graphical user interface in SCALE. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with nuclear depletion codes in general or with SCALE/ORIGEN-ARP in particular. The primer is based on SCALE 6 but should be applicable to earlier or later versions of SCALE. Information is included to help new users, along with several sample problems that walk the user through the different input forms and menus and illustrate the basic features. References to related documentation are provided. The primer provides a starting point for the nuclear analyst who uses SCALE/ORIGEN-ARP. Complete descriptions are provided in the SCALE documentation. Although the primer is self-contained, it is intended as a companion volume to the SCALE documentation. The SCALE Manual is

  17. Novel primers for complete mitochondrial cytochrome b gene sequencing in mammals.


    Naidu, Ashwin; Fitak, Robert R; Munguia-Vega, Adrian; Culver, Melanie


    Sequence-based species identification relies on the extent and integrity of sequence data available in online databases such as GenBank. When identifying species from a sample of unknown origin, partial DNA sequences obtained from the sample are aligned against existing sequences in databases. When the sequence from the matching species is not present in the database, high-scoring alignments with closely related sequences might produce unreliable results on species identity. For species identification in mammals, the cytochrome b (cyt b) gene has been identified to be highly informative; thus, large amounts of reference sequence data from the cyt b gene are much needed. To enhance availability of cyt b gene sequence data on a large number of mammalian species in GenBank and other such publicly accessible online databases, we identified a primer pair for complete cyt b gene sequencing in mammals. Using this primer pair, we successfully PCR amplified and sequenced the complete cyt b gene from 40 of 44 mammalian species representing 10 orders of mammals. We submitted 40 complete, correctly annotated, cyt b protein coding sequences to GenBank. To our knowledge, this is the first single primer pair to amplify the complete cyt b gene in a broad range of mammalian species. This primer pair can be used for the addition of new cyt b gene sequences and to enhance data available on species represented in GenBank. The availability of novel and complete gene sequences as high-quality reference data can improve the reliability of sequence-based species identification.

  18. An anti-steroidogenic inhibitory primer pheromone in male sea lamprey (Petromyzon marinus).


    Chung-Davidson, Yu-Wen; Wang, Huiyong; Bryan, Mara B; Wu, Hong; Johnson, Nicholas S; Li, Weiming


    Reproductive functions can be modulated by both stimulatory and inhibitory primer pheromones released by conspecifics. Many stimulatory primer pheromones have been documented, but relatively few inhibitory primer pheromones have been reported in vertebrates. The sea lamprey male sex pheromone system presents an advantageous model to explore the stimulatory and inhibitory primer pheromone functions in vertebrates since several pheromone components have been identified. We hypothesized that a candidate sex pheromone component, 7α, 12α-dihydroxy-5α-cholan-3-one-24-oic acid (3 keto-allocholic acid or 3kACA), exerts priming effects through the hypothalamic-pituitary-gonadal (HPG) axis. To test this hypothesis, we measured the peptide concentrations and gene expressions of lamprey gonadotropin releasing hormones (lGnRH) and the HPG output in immature male sea lamprey exposed to waterborne 3kACA. Exposure to waterborne 3kACA altered neuronal activation markers such as jun and jun N-terminal kinase (JNK), and lGnRH mRNA levels in the brain. Waterborne 3kACA also increased lGnRH-III, but not lGnRH-I or -II, in the forebrain. In the plasma, 3kACA exposure decreased all three lGnRH peptide concentrations after 1h exposure. After 2h exposure, 3kACA increased lGnRH-I and -III, but decreased lGnRH-II peptide concentrations in the plasma. Plasma lGnRH peptide concentrations showed differential phasic patterns. Group housing condition appeared to increase the averaged plasma lGnRH levels in male sea lamprey compared to isolated males. Interestingly, 15α-hydroxyprogesterone (15α-P) concentrations decreased after prolonged 3kACA exposure (at least 24h). To our knowledge, this is the only known synthetic vertebrate pheromone component that inhibits steroidogenesis in males.

  19. A primer for doing talk-in-interaction research in Augmentative and Alternative Communication.


    Higginbotham, David Jeffery; Engelke, Christopher R


    The study of talk-in-interaction is focused on how people conduct social interactions in real world situations, in real-time. The purpose of this article is to provide a primer for understanding talk-in-interaction research, conversation analysis and microanalysis in the AAC field. An overview of talk-in-interaction research and a discussion of important issues in the field will be presented, followed by a tutorial on conducting microanalytic investigations in AAC.

  20. Applied Ecosystem Analysis - - a Primer : EDT the Ecosystem Diagnosis and Treatment Method.

    SciTech Connect

    Lestelle, Lawrence C.; Mobrand, Lars E.


    The aim of this document is to inform and instruct the reader about an approach to ecosystem management that is based upon salmon as an indicator species. It is intended to provide natural resource management professionals with the background information needed to answer questions about why and how to apply the approach. The methods and tools the authors describe are continually updated and refined, so this primer should be treated as a first iteration of a sequentially revised manual.

  1. Magnesium Rich Primer for Chrome Free Protection of Aluminum Alloys (Preprint)

    DTIC Science & Technology


    the solubility of aluminum oxide and its hydrates (FIGURE 4), one can’t help but wonder if the ability to maintain a local pH near neutrality is an...FIGURE 4 – Solubility of aluminum oxide and its hydrates as a function of pH.8 7 QUALIFICATION AND TRANSITION PLAN The preliminary results...AFRL-RX-WP-TP-2008-4012 MAGNESIUM RICH PRIMER FOR CHROME FREE PROTECTION OF ALUMINUM ALLOYS (Preprint) Joel A. Johnson Nonstructural

  2. Development of primers to amplify mitochondrial DNA control region of Old World porcupines (subgenus Hystrix).


    Trucchi, E; Gentile, G; Sbordoni, V


    Eight primers were developed for the amplification of mitochondrial DNA control region of Old world porcupines (subgenus Hystrix). Successful amplifications of low-quality DNA extracted from old (12 years old) and recent quills were performed, thus facilitating field sampling. Successful cross-species amplifications were obtained for Hystrix africaeaustralis, H. cristata and H. indica. Length and structure of mitochondrial DNA control region were analysed and its usefulness as genetic marker for interspecific and population investigation was discussed.

  3. Comprehensive Evaluation and Transition of Non-Chromate Primers within DoD

    DTIC Science & Technology


    Materials Engineering Division ASETS Defense 2012 NAVAIR Distribution Statement – Distribution A Report Documentation Page Form...Primers : Akzo Nobel MgO 2111 PPG CA 7236 PPG CA 7211 PPG CA 7222 PPG CA 7233 Topcoat Deft ELT Corrosion tests: ASTM B117 (x2) ASTM...control. • Compare & correlate NAVAIR and AFRL galvanic panel test methods 10 NAVAIR/USAF Statement of Need 0 . 5 1.5 3 0 .5 1

  4. An anti-steroidogenic inhibitory primer pheromone in male sea lamprey (Petromyzon marinus)

    USGS Publications Warehouse

    Chung-Davidson, Yu-Wen; Wang, Huiyong; Bryan, Mara B.; Wu, Hong; Johnson, Nicholas S.; Li, Weiming


    Reproductive functions can be modulated by both stimulatory and inhibitory primer pheromones released by conspecifics. Many stimulatory primer pheromones have been documented, but relatively few inhibitory primer pheromones have been reported in vertebrates. The sea lamprey male sex pheromone system presents an advantageous model to explore the stimulatory and inhibitory primer pheromone functions in vertebrates since several pheromone components have been identified. We hypothesized that a candidate sex pheromone component, 7α, 12α-dihydroxy-5α-cholan-3-one-24-oic acid (3 keto-allocholic acid or 3kACA), exerts priming effects through the hypothalamic-pituitary-gonadal (HPG) axis. To test this hypothesis, we measured the peptide concentrations and gene expressions of lamprey gonadotropin releasing hormones (lGnRH) and the HPG output in immature male sea lamprey exposed to waterborne 3kACA. Exposure to waterborne 3kACA altered neuronal activation markers such as jun and jun N-terminal kinase (JNK), and lGnRH mRNA levels in the brain. Waterborne 3kACA also increased lGnRH-III, but not lGnRH-I or -II, in the forebrain. In the plasma, 3kACA exposure decreased all three lGnRH peptide concentrations after 1 h exposure. After 2 h exposure, 3kACA increased lGnRHI and -III, but decreased lGnRH-II peptide concentrations in the plasma. Plasma lGnRH peptide concentrations showed differential phasic patterns. Group housing condition appeared to increase the averaged plasma lGnRH levels in male sea lamprey compared to isolated males. Interestingly, 15α-hydroxyprogesterone (15α-P) concentrations decreased after prolonged 3kACA exposure (at least 24 h). To our knowledge, this is the only known synthetic vertebrate pheromone component that inhibits steroidogenesis in males.

  5. Demonstration of Metastable Intermolecular Composites (MIC) on Small Caliber Cartridges and CAD/PAD Percussion Primers

    DTIC Science & Technology


    Tetracene 4.0 Barium Nitrate 32.0 Antimony Sulfide 15.0 Aluminum Powder 7.0 PETN 5.0 Ingredient Weight % Normal Lead Styphnate 26.0 Barium Nitrate...Current Process Application Current Specification Affected Programs Candidate Parts/Substrate Lead Styphnate , Barium Nitrate, & Antimony...FA-956 and 5086 primer formulations which are based on lead styphnate , barium nitrate and antimony sulfide. The MIC mixture is an environmentally

  6. A Unique Primer with an Inosine Chain at the 5'-Terminus Improves the Reliability of SNP Analysis Using the PCR-Amplified Product Length Polymorphism Method.


    Shojo, Hideki; Tanaka, Mayumi; Takahashi, Ryohei; Kakuda, Tsuneo; Adachi, Noboru


    Polymerase chain reaction-amplified product length polymorphism (PCR-APLP) is one of the most convenient and reliable methods for single nucleotide polymorphism (SNP) analysis. This method is based on PCR, but uses allele-specific primers containing SNP sites at the 3'-terminus of each primer. To use this method at least two allele-specific primers and one "counter-primer", which serves as a common forward or reverse primer of the allele-specific primers, are required. The allele-specific primers have SNP sites at the 3'-terminus, and another primer should have a few non-complementary flaps at the 5'-terminus to detect SNPs by determining the difference of amplicon length by PCR and subsequent electrophoresis. A major disadvantage of the addition of a non-complementary flap is the non-specific annealing of the primer with non-complementary flaps. However, a design principle for avoiding this undesired annealing has not been fully established, therefore, it is often difficult to design effective APLP primers. Here, we report allele-specific primers with an inosine chain at the 5'-terminus for PCR-APLP analysis. This unique design improves the competitiveness of allele-specific primers and the reliability of SNP analysis when using the PCR-APLP method.

  7. Automation of a primer design and evaluation pipeline for subsequent sequencing of the coding regions of all human Refseq genes

    PubMed Central

    Lai, Daniel; Love, Donald R


    Screening for mutations in human disease-causing genes in a molecular diagnostic environment demands simplicity with a view to allowing high throughput approaches. In order to advance these requirements, we have developed and applied a primer design program, termed BatchPD, to achieve the PCR amplification of coding exons of all known human Refseq genes. Primer design, in silico PCR checks and formatted primer information for subsequent web-based interrogation are queried from existing online tools. BatchPD acts as an intermediate to automate queries and results processing and provides exon-specific information that is summarised in a spreadsheet format. PMID:22570517

  8. Development of acceptance criteria for batches of silane primer for external tank thermal protection system bonding applications

    NASA Technical Reports Server (NTRS)

    Mikes, F.


    Fourier transform infrared spectroscopy is currently the best technique for observing hydrolytic changes in DC 1200 silane the primers caused by moisture in the atmosphere. To further prove that FTIR can be used as a criterion test for acceptance of silane primer lots, intensities of the FTIR OH- band are being compared with primer adhesive bond strength using a mechanical test suggested by NASA. Results of tests for shear strength and Oh-absorption are tabulated and compared with FTIR absorption intensities in the OH-region.

  9. Group-specific primers for DNA-based detection of springtails (Hexapoda: Collembola) within predator gut contents.


    Kuusk, A K; Agustí, N


    Group-specific, degenerate polymerase chain reaction primers for DNA-based detection of springtails (Hexapoda: Collembola) within predator gut contents have been developed for the first time. Primers were designed from 18S rDNA and amplified fragments of 272 bp and 177 bp from 17 springtail species collected in agricultural habitats. Specificity tests against 41 nontarget species revealed no cross-reactivity. Group-specific polymerase chain reaction is advantageous when working in species-rich habitats and these primers could facilitate studies of trophic links between springtails and generalist arthropod predators worldwide.

  10. Systemic Identification of Hevea brasiliensis EST-SSR Markers and Primer Screening

    PubMed Central

    Hou, Benjun


    This research aimed to systematically identify and preliminarily validate the Hevea brasiliensis expressed sequence tag (EST) information using Simple Sequence Repeat (SSR) and provide evidence for further development of SSR molecular marker. The definition of general SSR features of Hevea EST splicing sequences and development of SSR primers founded the basis of diversity analysis and variety identification for Hevea tree resource. 1134 SSR loci were identified in the EST splicing sequence and distributed in 840 Unigene. The occurrence rate of SSR loci was 23.9%, and the average distribution distance of EST-SSR was 2.59 kb. The major repeat type was mononucleotide repeat motif, which accounted for 38.89%, while the corresponding value was 36.95% for dinucleotide repeat motif and 18.17% for trinucleotide repeat motif; the proportion of other motifs was only 5.99%. The superior repeat motifs for mononucleotide, dinucleotide, and trinucleotide were A/T, AG/CT, and AAG/CTT, respectively. 739 pair of primers were designed for 1134 SSR loci. PCR amplification was performed on Hevea Reyan5-11, Reyan87-6-47, and PR107, and 180 pairs of primers were selected which were able to amplify polymorphism bands. PMID:28232872

  11. Plasma polymerized primer for rubber-to-metal bonding: Adhesion measurement and interphase characterization

    SciTech Connect

    Tsai, Y.M.; Boerio, F.J.; Kim, D.K.


    Adhesion of rubber to steel is of considerable practical importance in many areas of technology. However, direct adhesion of natural rubber to most metals is very poor. As a result, metals are frequently plated with brass, to which rubber adheres very strongly, or else the metals are coated with proprietary primers and adhesives in order to obtain adhesion of rubber. Plasma processing has been attracting attention in many areas due to some of its unique features. During the process, the synthesis and deposition of plasma polymers can be accomplished at the same time, making plasma processing a very efficient method for polymer coating. Plasma processing also allows flexible combinations of reactor parameters which would provide a great deal of process control and versatility. Moreover, in plasma processing, there are no solvents involved and there are no solvent-disposal problems. The purpose of this paper is to describe results the authors have obtained in developing plasma polymerized primer films to enhance rubber-to-steel bonding. Preliminary durability test results are reported. Results obtained using a model rubber system to simulate reactions in the rubber/primer {open_quotes}interphase{close_quotes} are also described.

  12. Edesign: Primer and Enhanced Internal Probe Design Tool for Quantitative PCR Experiments and Genotyping Assays.


    Kimura, Yasumasa; Soma, Takahiro; Kasahara, Naoko; Delobel, Diane; Hanami, Takeshi; Tanaka, Yuki; de Hoon, Michiel J L; Hayashizaki, Yoshihide; Usui, Kengo; Harbers, Matthias


    Analytical PCR experiments preferably use internal probes for monitoring the amplification reaction and specific detection of the amplicon. Such internal probes have to be designed in close context with the amplification primers, and may require additional considerations for the detection of genetic variations. Here we describe Edesign, a new online and stand-alone tool for designing sets of PCR primers together with an internal probe for conducting quantitative real-time PCR (qPCR) and genotypic experiments. Edesign can be used for selecting standard DNA oligonucleotides like for instance TaqMan probes, but has been further extended with new functions and enhanced design features for Eprobes. Eprobes, with their single thiazole orange-labelled nucleotide, allow for highly sensitive genotypic assays because of their higher DNA binding affinity as compared to standard DNA oligonucleotides. Using new thermodynamic parameters, Edesign considers unique features of Eprobes during primer and probe design for establishing qPCR experiments and genotyping by melting curve analysis. Additional functions in Edesign allow probe design for effective discrimination between wild-type sequences and genetic variations either using standard DNA oligonucleotides or Eprobes. Edesign can be freely accessed online at, and the source code is available for download.

  13. Conserved primers for DNA barcoding historical and modern samples from New Zealand and Antarctic birds.


    Patel, Selina; Waugh, John; Millar, Craig D; Lambert, David M


    Our ability to DNA barcode the birds of the world is based on the effective amplification and sequencing of a 648 base pair (bp) region of the mitochondrial cytochrome c oxidase (COI or cox1) gene. For many geographic regions the large numbers of vouchered specimens necessary for the construction of a DNA barcoding database have already been collected and are available in museums and other institutions. However, many of these specimens are old (>20 years) and are stored as either fixed study skins or dried skeletons. DNA extracted from such historical samples is typically degraded and, generally, only short DNA fragments can be recovered from such specimens making the recovery of the barcoding region as a single fragment difficult. We report two sets of conserved primers that allow the amplification of the entire DNA barcoding region in either three or five overlapping fragments. These primer sets allow the recovery of DNA barcodes from valuable historical specimens that in many cases are unique in that they are unable or unlikely to be collected again. We also report three new primers that in combination allow the effective amplification from modern samples of the entire DNA barcoding region as a single DNA fragment for 17 orders of Southern Hemisphere birds.

  14. ThermoAlign: a genome-aware primer design tool for tiled amplicon resequencing

    PubMed Central

    Francis, Felix; Dumas, Michael D.; Wisser, Randall J.


    Isolating and sequencing specific regions in a genome is a cornerstone of molecular biology. This has been facilitated by computationally encoding the thermodynamics of DNA hybridization for automated design of hybridization and priming oligonucleotides. However, the repetitive composition of genomes challenges the identification of target-specific oligonucleotides, which limits genetics and genomics research on many species. Here, a tool called ThermoAlign was developed that ensures the design of target-specific primer pairs for DNA amplification. This is achieved by evaluating the thermodynamics of hybridization for full-length oligonucleotide-template alignments — thermoalignments — across the genome to identify primers predicted to bind specifically to the target site. For amplification-based resequencing of regions that cannot be amplified by a single primer pair, a directed graph analysis method is used to identify minimum amplicon tiling paths. Laboratory validation by standard and long-range polymerase chain reaction and amplicon resequencing with maize, one of the most repetitive genomes sequenced to date (≈85% repeat content), demonstrated the specificity-by-design functionality of ThermoAlign. ThermoAlign is released under an open source license and bundled in a dependency-free container for wide distribution. It is anticipated that this tool will facilitate multiple applications in genetics and genomics and be useful in the workflow of high-throughput targeted resequencing studies. PMID:28300202

  15. Crystal Structure of Complete Rhinovirus RNA Polymerase Suggests Front Loading of Protein Primer

    PubMed Central

    Appleby, Todd C.; Luecke, Hartmut; Shim, Jae Hoon; Wu, Jim Z.; Cheney, I. Wayne; Zhong, Weidong; Vogeley, Lutz; Hong, Zhi; Yao, Nanhua


    Picornaviruses utilize virally encoded RNA polymerase and a uridylylated protein primer to ensure replication of the entire viral genome. The molecular details of this mechanism are not well understood due to the lack of structural information. We report the crystal structure of human rhinovirus 16 3D RNA-dependent RNA polymerase (HRV16 3Dpol) at a 2.4-Å resolution, representing the first complete polymerase structure from the Picornaviridae family. HRV16 3Dpol shares the canonical features of other known polymerase structures and contains an N-terminal region that tethers the fingers and thumb subdomains, forming a completely encircled active site cavity which is accessible through a small tunnel on the backside of the molecule. The small thumb subdomain contributes to the formation of a large cleft on the front face of the polymerase which also leads to the active site. The cleft appears large enough to accommodate a template:primer duplex during RNA elongation or a protein primer during the uridylylation stage of replication initiation. Based on the structural features of HRV16 3Dpo1 and the catalytic mechanism known for all polymerases, a front-loading model for uridylylation is proposed. PMID:15596823

  16. Analysis of telomerase activity based on a spired DNA tetrahedron TS primer.


    Li, Yan; Wen, Yanli; Wang, Lele; Liang, Wen; Xu, Li; Ren, Shuzhen; Zou, Ziying; Zuo, Xiaolei; Fan, Chunhai; Huang, Qing; Liu, Gang; Jia, Nengqin


    The development of sensitive telomerase biosensors is hindered by the restricted accessibility of telomere strand (TS) primer and the limited enzyme reaction space, which is mainly confined by the vertical distance. In this work, we designed an electrochemical telomerase biosensor based on a spired DNA tetrahedron TS primer (STTS). By adding a rigid dsDNA spire onto the top of the DNA tetrahedron, we successfully regulated the distance between the TS primer and the surface, and thus greatly facilitated the telomerase elongation on surface. The signal-to-noise ratio was 2 times higher than TSP without the spire structure. The limit of detection was calculated to be lower than 10 HeLa cells, which is at least 2 magnitudes lower than other surface extension-based electrochemical telomerase sensors without amplification. The practicability of STTS sensor was also demonstrated by analysing various other cell lines including cancer cells, stem cells of high telomerase activity and somatic cells of low telomerase activity.

  17. Degenerate PCR primer design for the specific identification of rhinovirus C.


    Nam, Young Ran; Lee, Uk; Choi, Han Seok; Lee, Kyoung Jin; Kim, Nari; Jang, Yong Ju; Joo, Chul Hyun


    Human rhinovirus (HRV)-A and -B is a common cause of upper respiratory tract infections. Recently, a third species, HRV-C, was categorized based on molecular typing studies. The results showed that the HRV-C genome had diverged from that of HRV-A and -B. Despite its late identification, increasing evidence suggests that HRV-C causes more severe pathogenic infections than HRV-A or -B; however, a large amount of epidemiological data is required to confirm this association in different clinical settings. Consequently, a simple and rapid method for identifying HRV-C is required to expedite such epidemiological studies. Here, two degenerate primer sets (HEV and HRVC) were designed based on bioinformatic analyses. The HEV set targeting the fifth IRES domain sequence within the 5'-UTR, which is highly conserved among enteroviruses, was designed to detect all enteroviruses, whereas the HRVC set, which targeted the VP2 coding region, was designed to detect HRV-C alone. Both primer sets were tested against a panel of standard enteroviruses and clinical lavage samples. HEV detected all enteroviruses tested whereas HRVC was specific for HRV-C. Although the primer design strategy was confirmed with a limited number of samples, extensive tests are required to be applied in clinical settings.

  18. New primers for sex identification in the Chinese egret and other ardeid species.


    Wang, Zeng; Zhou, Xiaoping; Lin, Qingxian; Fang, Wenzhen; Chen, Xiaolin


    Using the universal P2/P8 primers, we were able to obtain the gene segments of chromo-helicase-DNA binding protein (CHD)-Z and CHD-W from ten species of ardeid birds including Chinese egret (Egretta eulophotes), little egret (E. garzetta), eastern reef egret (E. sacra), great egret (Ardea alba), grey heron (A. cinerea), Chinese pond-heron (Ardeola bacchus), cattle egret (Bubulcus ibis), black-crowned night-heron (Nycticorax nycticorax), cinnamon bittern (Ixobrychus cinnamomeus) and yellow bittern (I. sinensis). Based on conserved regions inside the P2/P8-derived sequences, we designed new PCR primers for sex identification in these ardeid species. Using agarose gel electrophoresis, the PCR products showed two bands for females (140 bp derived from CHD-W and the other 250 bp from CHD-ZW), whereas the males showed only the 250 bp band. The results indicated that our new primers could be used for accurate and convenient sex identification in ardeid species.

  19. New universal primers for genotyping and resistance detection of low HBV DNA levels.


    Tong, Yongqing; Liu, Bei; Liu, Hui; Zheng, Hongyun; Gu, Jian; Liu, Hang; Lin, Min; Ding, Yali; Song, Chunhua; Li, Yan


    HBV (hepatitis B virus) genotyping is important in determining the clinical manifestation of disease and treatment response, particularly, in patients with low viral loads. Also, sensitive detection of HBV antiviral drug resistance mutations is essential for monitoring therapy response.Asensitive direct sequencing method for genotyping and the drug resistance mutation detection of low levels of HBV DNA in patients' plasma is developed by PCR amplification of the DNA with novel universal primers.The novel, common, and universal primers were identified by alignment of RT region of all the HBV DNA sequences in databases. These primers could efficiently amplify the RT region of HBV virus at low DNA levels by directly sequencing the resulting PCR products, and mapping with the reference sequence made it possible to clearly obtain the HBV subtypes and identify the resistance mutations in the samples with HBV DNA level as low as 20 IU/mL. We examined the reliability of the method in clinical samples, and found it could detect the HBV subtypes and drug resistance mutations in 80 clinical HBV samples with low HBV DNA levels ranging from 20 to 200 IU/mL.This method is a sensitive and reliable direct sequencing method for HBV genotyping and antiviral drug resistance mutation detection, and is helpful for efficiently monitoring the response to therapy in HBV patients.

  20. Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA

    SciTech Connect

    Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J.


    The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.