Science.gov

Sample records for phenylpyruvicus primer caso

  1. Phonics Primer

    ERIC Educational Resources Information Center

    Elam, Sandra

    2007-01-01

    This primer lists the 44 sounds in the English language and then gives steps for teaching those 44 sounds and their most common spelling patterns. In addition to learning sounds and spellings, each day the student must read lists of phonetically related words and spell these words from dictation. Phonics instruction must be reinforced by having…

  2. RATMAC PRIMER

    SciTech Connect

    Munn, R. J.; Stewart, J. M.; Norden, A. P.; Pagoaga, M. Katherine

    1980-10-01

    The language RATMAC is a direct descendant of one of the most successful structured FORTRAN languages, rational FORTRAN, RATFOR. RATMAC has all of the characteristics of RATFOR, but is augmented by a powerful recursive macro processor which is extremely useful in generating transportable FORTRAN programs. A macro is a collection of programming steps which are associated with a keyword. This keyword uniquely identifies the macro, and whenever it appears in a RATMAC program it is replaced by the collection of steps. This primer covers the language's control and decision structures, macros, file inclusion, symbolic constants, and error messages.

  3. Salinas primer.

    SciTech Connect

    Walsh, Timothy Francis; Reese, Garth M.; Bhardwaj, Manoj Kumar

    2004-08-01

    Salinas provides a massively parallel implementation of structural dynamics finite element analysis. This capability is required for high fidelity, validated models used in modal, vibration, static and shock analysis of weapons systems. General capabilities for modal, statics and transient dynamics are provided. Salinas is similar to commercial codes like Nastran or Abaqus. It has some nonlinear capability, but excels in linear computation. It is different than the above commercial codes in that it is designed to operate efficiently in a massively parallel environment. Even for an experienced analyst, running a new finite element package can be a challenge. This little primer is intended to make part of this task easier by presenting the basic steps in a simple way. The analyst is referred to the theory manual for details of the mathematics behind the work. The User's Notes should be used for more complex inputs, and will have more details about the process (as well as many more examples). More information can be found on our web pages, 3 or 4. Finite element analysis can be deceptive. Any software can give the wrong answers if used improperly, and occasionally even when used properly. Certainly a solid background in structural mechanics is necessary to build an adequate finite element model and interpret the results. This primer should provide a quick start in answering some of the more common questions that come up in using Salinas.

  4. Polyacid macromolecule primers

    DOEpatents

    Sugama, Toshifumi.

    1989-12-26

    Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

  5. Polyacid macromolecule primers

    DOEpatents

    Sugama, Toshifumi

    1989-01-01

    Hydrophylic polyacids, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests.

  6. Education Vouchers. A Primer.

    ERIC Educational Resources Information Center

    Richter, Philip C.; Hollender, Mary Jo

    This document is intended to serve both as a primer and as an annotated bibliography about educational vouchers. As a primer, it introduces the reader to the concept of vouchers and to the variety of issues--including political, economic, legal, and educational issues--associated with vouchers. As an annotated bibliography, it provides a summary…

  7. Quick spacecraft charging primer

    SciTech Connect

    Larsen, Brian Arthur

    2014-03-12

    This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

  8. Designing Polymerase Chain Reaction Primers Using Primer3Plus.

    PubMed

    Hung, Jui-Hung; Weng, Zhiping

    2016-01-01

    Designing oligonucleotide primers is a crucial step for successful molecular biology experiments that require the use of the polymerase chain reaction (PCR). PCR involves cycles of three steps: denaturation, annealing, and extension. During denaturation, double-stranded DNA (dsDNA) molecules (templates) are separated into single strands. During annealing, a pair of primers is annealed to the complementary regions of the single-stranded molecules. In the extension step, DNA polymerase extends the primers to produce DNA molecules that correspond to the region bracketed by the primers (the amplicons). All of these steps are temperature sensitive, and the common choice of temperatures is 94°C, 60°C, and 70°C, respectively. Poorly designed primers may lead to no amplification product or additional undesired amplified fragments. The goals of primer design include good primer specificity, high annealing efficiency, appropriate melting temperature, proper GC content, and the prevention of primer hairpins or primer dimers. PMID:27574202

  9. China Energy Primer

    SciTech Connect

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  10. Primer on Social Economics.

    ERIC Educational Resources Information Center

    Darcy, Robert L.

    An elaboration of the author's booklet entitled "First Steps Toward Economic Understanding," this primer is designed to help the reader develop a functional understanding of the economic process so that he can make wiser decisions on issues of social policy and on matters affecting his economic well-being. The document is not "economics in one…

  11. An SAT® Validity Primer

    ERIC Educational Resources Information Center

    Shaw, Emily J.

    2015-01-01

    This primer should provide the reader with a deeper understanding of the concept of test validity and will present the recent available validity evidence on the relationship between SAT® scores and important college outcomes. In addition, the content examined on the SAT will be discussed as well as the fundamental attention paid to the fairness of…

  12. Crystalline Silica Primer

    USGS Publications Warehouse

    ,

    1992-01-01

    substance and will present a nontechnical overview of the techniques used to measure crystalline silica. Because this primer is meant to be a starting point for anyone interested in learning more about crystalline silica, a list of selected readings and other resources is included. The detailed glossary, which defines many terms that are beyond the scope of this publication, is designed to help the reader move from this presentation to a more technical one, the inevitable next step.

  13. Coal Bed Methane Primer

    SciTech Connect

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  14. Primer on molecular genetics

    SciTech Connect

    Not Available

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  15. Laser Doppler velocimetry primer

    NASA Technical Reports Server (NTRS)

    Bachalo, William D.

    1985-01-01

    Advanced research in experimental fluid dynamics required a familiarity with sophisticated measurement techniques. In some cases, the development and application of new techniques is required for difficult measurements. Optical methods and in particular, the laser Doppler velocimeter (LDV) are now recognized as the most reliable means for performing measurements in complex turbulent flows. And such, the experimental fluid dynamicist should be familiar with the principles of operation of the method and the details associated with its application. Thus, the goals of this primer are to efficiently transmit the basic concepts of the LDV method to potential users and to provide references that describe the specific areas in greater detail.

  16. Multiplexed Primer Prediction for PCR

    SciTech Connect

    2007-07-23

    MPP predicts sets of multiplex-compatible primers for Polymerase Chain Reaction (PCR), finding a near minimal set of primers such that at least one amplicon will be generated from every target sequence in the input file. The code finds highly conserved oligos that are suitable as primers, according to user-specified desired primer characteristics such as length, melting temperature, and amplicon length. The primers are predicted not to form unwanted dimer or hairpin structures. The target sequences used as input can be diverse, since no multiple sequence alighment is required. The code is scalable, taking up to tens of thousands of sequences as input, and works, for example, to find a "universal primer set" for all viral genomes provided as a single input file. The code generates a periodic check-point file, thus in the event of premature execution termination, the application can be restarted from the last check-point file.

  17. Limited-life cartridge primers

    DOEpatents

    Makowiecki, Daniel M.; Rosen, Robert S.

    1998-01-01

    A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.

  18. Limited-life cartridge primers

    DOEpatents

    Makowiecki, Daniel M.; Rosen, Robert S.

    2005-04-19

    A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.

  19. Limited-life cartridge primers

    DOEpatents

    Makowiecki, D.M.; Rosen, R.S.

    1998-06-30

    A cartridge primer is described which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML`s would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers. 10 figs.

  20. Multiplexed Primer Prediction for PCR

    2007-07-23

    MPP predicts sets of multiplex-compatible primers for Polymerase Chain Reaction (PCR), finding a near minimal set of primers such that at least one amplicon will be generated from every target sequence in the input file. The code finds highly conserved oligos that are suitable as primers, according to user-specified desired primer characteristics such as length, melting temperature, and amplicon length. The primers are predicted not to form unwanted dimer or hairpin structures. The target sequencesmore » used as input can be diverse, since no multiple sequence alighment is required. The code is scalable, taking up to tens of thousands of sequences as input, and works, for example, to find a "universal primer set" for all viral genomes provided as a single input file. The code generates a periodic check-point file, thus in the event of premature execution termination, the application can be restarted from the last check-point file.« less

  1. STR primer concordance study.

    PubMed

    Budowle, B; Masibay, A; Anderson, S J; Barna, C; Biega, L; Brenneke, S; Brown, B L; Cramer, J; DeGroot, G A; Douglas, D; Duceman, B; Eastman, A; Giles, R; Hamill, J; Haase, D J; Janssen, D W; Kupferschmid, T D; Lawton, T; Lemire, C; Llewellyn, B; Moretti, T; Neves, J; Palaski, C; Schueler, S; Sgueglia, J; Sprecher, C; Tomsey, C; Yet, D

    2001-12-15

    Over 1500 population database samples comprising African Americans, Caucasians, Hispanics, Native Americans, Chamorros and Filipinos were typed using the PowerPlex 16 and the Profiler Plus/COfiler kits. Except for the D8S1179 locus in Chamorros and Filipinos from Guam, there were eight examples in which a typing difference due to allele dropout was observed. At the D8S1179 locus in the population samples from Guam, there were 13 examples of allele dropout observed when using the Profiler Plus kit. The data support that the primers used in the PowerPlex 16, Profiler Plus, and COfiler kits are reliable for typing reference samples that are for use in CODIS. In addition, allele frequency databases have been established for the STR loci Penta D and Penta E. Both loci are highly polymorphic. PMID:11741760

  2. Explanatory chapter: PCR primer design.

    PubMed

    Álvarez-Fernández, Rubén

    2013-01-01

    This chapter is intended as a guide on polymerase chain reaction (PCR) primer design (for information on PCR, see General PCR and Explanatory Chapter: Troubleshooting PCR). In the next section, general guidelines will be provided, followed by a discussion on primer design for specific applications. A list of recommended software tools is shown at the end.

  3. Hermetic G-16 percussion primer

    SciTech Connect

    Durand, N.A.; Weinmaster, R.R.; Massis, T.M.

    1988-01-01

    Studies were conducted to optimize a Hermetic percussion primer capable of surviving temperatures of 200/degree/C for up to 48 hours. These studies included work with typical brass percussion primers and the pyrotechnic composition designed G-16. The G-16 mixture is composed of antimony sulfide, calcium silicide, and potassium. The hermetically sealed assembly consists of a brass cup and anvil loaded with G-16 pyrotechnic mixture and assembly includes a steel disc which is laser welded over the sealing mechanisms cause negligible changes. This assembly can be used with other primers and is capable of enhanced output for specialized applications. 4 refs., 8 figs., 4 tabs.

  4. Selection of primers for polymerase chain reaction.

    PubMed

    Rychlik, W

    1995-04-01

    One of the most important factors affecting the quality of PCR is the choice of primers. In general, the longer the PCR product the more difficult it is to select efficient primers and set appropriate designing primers, and in general, the more DNA sequence information is available, the better the chance of finding an optimal primer pair. Efficient primers can be designed by avoiding the following flaws: primer-dimer formation, self-complementarity, too low Tm of the primers, and/or their incorrect internal stability profile. Tips on subcloning PCR products, calculating duplex stability (predicting dimer formation strength), and designing degenerate primers are given.

  5. BatchPrimer3: A high throughput web application for PCR and sequencing primer design

    PubMed Central

    You, Frank M; Huo, Naxin; Gu, Yong Qiang; Luo, Ming-cheng; Ma, Yaqin; Hane, Dave; Lazo, Gerard R; Dvorak, Jan; Anderson, Olin D

    2008-01-01

    Background Microsatellite (simple sequence repeat – SSR) and single nucleotide polymorphism (SNP) markers are two types of important genetic markers useful in genetic mapping and genotyping. Often, large-scale genomic research projects require high-throughput computer-assisted primer design. Numerous such web-based or standard-alone programs for PCR primer design are available but vary in quality and functionality. In particular, most programs lack batch primer design capability. Such a high-throughput software tool for designing SSR flanking primers and SNP genotyping primers is increasingly demanded. Results A new web primer design program, BatchPrimer3, is developed based on Primer3. BatchPrimer3 adopted the Primer3 core program as a major primer design engine to choose the best primer pairs. A new score-based primer picking module is incorporated into BatchPrimer3 and used to pick position-restricted primers. BatchPrimer3 v1.0 implements several types of primer designs including generic primers, SSR primers together with SSR detection, and SNP genotyping primers (including single-base extension primers, allele-specific primers, and tetra-primers for tetra-primer ARMS PCR), as well as DNA sequencing primers. DNA sequences in FASTA format can be batch read into the program. The basic information of input sequences, as a reference of parameter setting of primer design, can be obtained by pre-analysis of sequences. The input sequences can be pre-processed and masked to exclude and/or include specific regions, or set targets for different primer design purposes as in Primer3Web and primer3Plus. A tab-delimited or Excel-formatted primer output also greatly facilitates the subsequent primer-ordering process. Thousands of primers, including wheat conserved intron-flanking primers, wheat genome-specific SNP genotyping primers, and Brachypodium SSR flanking primers in several genome projects have been designed using the program and validated in several laboratories

  6. Charter School Primer. Peter Lang Primer. Volume 34

    ERIC Educational Resources Information Center

    Tryjankowski, Anne Marie

    2012-01-01

    The "Charter School Primer" presents an overview of public charter schools in the United States. The book discusses what charter schools are; the history of public charter school choice in the United States; the role of teachers, parents, boards, and unions in the charter school movement; and gives examples of innovations in education made…

  7. Vygotsky on Education Primer. Peter Lang Primer. Volume 30

    ERIC Educational Resources Information Center

    Lake, Robert

    2012-01-01

    The "Vygotsky on Education Primer" serves as an introduction to the life and work of the Russian psychologist Lev Vygotsky. Even though he died almost eighty years ago, his life's work remains both relevant and significant to the field of education today. This book examines Vygotsky's emphasis on the role of cultural and historical context in…

  8. Primer vector theory and applications

    NASA Technical Reports Server (NTRS)

    Jezewski, D. J.

    1975-01-01

    A method developed to compute two-body, optimal, N-impulse trajectories was presented. The necessary conditions established define the gradient structure of the primer vector and its derivative for any set of boundary conditions and any number of impulses. Inequality constraints, a conjugate gradient iterator technique, and the use of a penalty function were also discussed.

  9. A Hearing Aid Primer 1

    ERIC Educational Resources Information Center

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  10. Freshwater Wetlands: A Citizen's Primer.

    ERIC Educational Resources Information Center

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of wetland…

  11. Coal mining: A petex primer

    SciTech Connect

    Not Available

    1985-01-01

    This book is an introduction to the coal industry - from planning a mine to delivering coal to a power plant. The primer covers what coal is and how it is used, modern underground and surface mining practices, coal preparation and transport, and the relation between coal and the environment.

  12. Postsecondary Data Connections: A Primer

    ERIC Educational Resources Information Center

    Data Quality Campaign, 2011

    2011-01-01

    There is an increasing focus at the state and federal levels on linking data across the P-20/Workforce spectrum to help inform policies and practices. This primer is intended to provide policymakers with: (1) An overview of the status of states vis-a-vis the linking of postsecondary data to K-12 and workforce data; (2) A subset of questions…

  13. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 30 Mineral Resources 1 2012-07-01 2012-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of...

  14. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 30 Mineral Resources 1 2014-07-01 2014-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of...

  15. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 30 Mineral Resources 1 2013-07-01 2013-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of...

  16. 30 CFR 75.1317 - Primer cartridges.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer cartridges. 75.1317 Section 75.1317... MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Explosives and Blasting § 75.1317 Primer cartridges. (a) Primer cartridges shall be primed and loaded only by a qualified person or a person working in...

  17. 30 CFR 75.1317 - Primer cartridges.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Primer cartridges. 75.1317 Section 75.1317... MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Explosives and Blasting § 75.1317 Primer cartridges. (a) Primer cartridges shall be primed and loaded only by a qualified person or a person working in...

  18. Using Primers to Motivate Your Students

    ERIC Educational Resources Information Center

    Graff, Dan

    2002-01-01

    Primers are used to motivate and uplift your class. They come in many different styles and can be used in a variety of ways. Making primers relevant to students helps them to learn and makes them feel appreciated and knowledgeable when they participate. Using primers in the classroom to make students feel valued brings much success.

  19. Branched modular primers in DNA sequencing

    SciTech Connect

    Mugasimangalam, R.C.; Shmulevitz, M. |; Ramanathan, V.

    1997-08-01

    The need to synthesize new sequencing primers, such as in primer walking, can be eliminated by assembling modular primers from oligonucleotide modules selected from presynthesized libraries. Our earlier modular primers consisted of 5-mers, 6-mers or 7-mers, annealing to the template contiguously with each other. Here we introduce a novel {open_quotes}branched{close_quotes} type of modular primer with a distinctly different specificity mechanism. The concept of a {open_quotes}branched{close_quotes} primer involves modules that are physically linked by annealing to each other as well as to the target, forming a branched structure of the 3-way junction type. While contiguous modular primers are made specific by the preference of the polymerase for longer primer, branched primers, in contrast, owe their specificity to cooperative annealing of their modules to the intended site on the template. This cooperativity of annealing to the template is provided by mutually complementary segments in the two modules that bind each other. Thus the primer-template complex is no longer limited to linear sequences, but acquires another, second dimension giving the modular primer new functionality.

  20. Water based adhesive primers on aluminum substrates

    SciTech Connect

    Wightman, J.P.; Mori, S.

    1996-12-31

    The number of aluminum alloy bonding applications has been increasing recently in the automobile industry. Primer coating of aluminum substrates is one of the main processes used to promote bond performance. Solvent based organic primers have been used for a long time but environmental regulations now require the substitution of volatile organic compounds (VOC) by alternate materials such as water based adhesive primers. However, the bond strengths obtained with many water based primers are generally lower than for solvent based ones. Water based primers which have some reactive functional groups have been proposed recently but such primers require special treatment. This paper describes a study conducted to optimize bond strength using a water based adhesive as a primer in the adhesive bonding of anodized aluminum.

  1. Sample Return Primer and Handbook

    NASA Technical Reports Server (NTRS)

    Barrow, Kirk; Cheuvront, Allan; Faris, Grant; Hirst, Edward; Mainland, Nora; McGee, Michael; Szalai, Christine; Vellinga, Joseph; Wahl, Thomas; Williams, Kenneth; Lee, Gentry; Duxbury, Thomas

    2007-01-01

    This three-part Sample Return Primer and Handbook provides a road map for conducting the terminal phase of a sample return mission. The main chapters describe element-by-element analyses and trade studies, as well as required operations plans, procedures, contingencies, interfaces, and corresponding documentation. Based on the experiences of the lead Stardust engineers, the topics include systems engineering (in particular range safety compliance), mission design and navigation, spacecraft hardware and entry, descent, and landing certification, flight and recovery operations, mission assurance and system safety, test and training, and the very important interactions with external support organizations (non-NASA tracking assets, landing site support, and science curation).

  2. Effect of primers on bonding agent polymerization.

    PubMed

    Hotta, M; Kondoh, K; Kamemizu, H

    1998-10-01

    The aim of the present study was to evaluate the effect of primers on the polymerization of bonding agent. We measured the degree of conversion (radical production) and mechanical properties (surface hardness and direct tensile strength) of various adhesives/primers mixed at different ratios and the effect of varying the visible-light curing time. With and without primer treatment, the tensile bond strength of adhesive resin to micacious glass ceramic and human enamel was measured. After the tensile bond test, using the Image Capture System, the failure patterns of adhesive resin bonded to micacious glass-ceramic were analysed. The results show that the mixtures containing the higher amounts of primer yielded a lower degree of conversion and inferior mechanical properties when compared with the mixtures containing a lower proportion of primer, except in the experimental bonding system. The adhesive/primer mixtures inhibited free radical polymerization. The value for the Knoop hardness number and the direct tensile strength of the adhesive/primer mixtures were significantly decreased compared with those of the adhesive bonding agent alone with no primer added. The tensile bond strength of adhesive resin bonded to micacious glass-ceramic or human enamel without primer treatment was significantly greater than that of adhesive resin with primer treatment in certain cases. Most of the fractures of ceramic surfaces were cohesive (within resins) and/or interface (at the ceramic surface) failure.

  3. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    PubMed Central

    Batnyam, Nomin; Lee, Jimin; Lee, Jungnam; Hong, Seung Bok; Oh, Sejong; Han, Kyudong

    2012-01-01

    Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR) assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque) and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors. PMID:22693428

  4. Nucleic acid amplification using modular branched primers

    SciTech Connect

    Ulanovsky, Levy; Raja, Mugasimangalam C.

    2001-01-01

    Methods and compositions expand the options for making primers for use in amplifying nucleic acid segments. The invention eliminates the step of custom synthesis of primers for Polymerase Chain Reactions (PCR). Instead of being custom-synthesized, a primer is replaced by a combination of several oligonucleotide modules selected from a pre-synthesized library. A modular combination of just a few oligonucleotides essentially mimics the performance of a conventional, custom-made primer by matching the sequence of the priming site in the template. Each oligonucleotide module has a segment that matches one of the stretches within the priming site.

  5. Linear elastic fracture mechanics primer

    NASA Technical Reports Server (NTRS)

    Wilson, Christopher D.

    1992-01-01

    This primer is intended to remove the blackbox perception of fracture mechanics computer software by structural engineers. The fundamental concepts of linear elastic fracture mechanics are presented with emphasis on the practical application of fracture mechanics to real problems. Numerous rules of thumb are provided. Recommended texts for additional reading, and a discussion of the significance of fracture mechanics in structural design are given. Griffith's criterion for crack extension, Irwin's elastic stress field near the crack tip, and the influence of small-scale plasticity are discussed. Common stress intensities factor solutions and methods for determining them are included. Fracture toughness and subcritical crack growth are discussed. The application of fracture mechanics to damage tolerance and fracture control is discussed. Several example problems and a practice set of problems are given.

  6. A Practical Primer on Geostatistics

    USGS Publications Warehouse

    Olea, Ricardo A.

    2009-01-01

    significant methodological implications. HISTORICAL REMARKS As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields. PIONEERS Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorology CALCULATIONS Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations. SOFTWARE For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics. ORGANIZATION OF THE PRIMER The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of th

  7. URPD: a specific product primer design tool

    PubMed Central

    2012-01-01

    Background Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/. PMID:22713312

  8. PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection

    PubMed Central

    O’Halloran, Damien M.

    2016-01-01

    Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558

  9. PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection.

    PubMed

    O'Halloran, Damien M

    2016-01-01

    Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558

  10. PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection.

    PubMed

    O'Halloran, Damien M

    2016-01-01

    Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction.

  11. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 30 Mineral Resources 1 2012-07-01 2012-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on...

  12. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 30 Mineral Resources 1 2013-07-01 2013-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on...

  13. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 30 Mineral Resources 1 2014-07-01 2014-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on...

  14. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... SAFETY AND HEALTH SAFETY AND HEALTH STANDARDS-UNDERGROUND METAL AND NONMETAL MINES Explosives... primer. (b) Rigid cartridges of explosives or blasting agents that are 4 inches (100 millimeters) in... of water to protect the primer from impact. Slit packages of prill, water gel, or emulsions are...

  15. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... SAFETY AND HEALTH SAFETY AND HEALTH STANDARDS-SURFACE METAL AND NONMETAL MINES Explosives Use § 56.6304 Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives... impact. Slit packages of prill, water gel, or emulsions are not considered rigid cartridges and may...

  16. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... SAFETY AND HEALTH SAFETY AND HEALTH STANDARDS-SURFACE METAL AND NONMETAL MINES Explosives Use § 56.6304 Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives... impact. Slit packages of prill, water gel, or emulsions are not considered rigid cartridges and may...

  17. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... SAFETY AND HEALTH SAFETY AND HEALTH STANDARDS-UNDERGROUND METAL AND NONMETAL MINES Explosives... primer. (b) Rigid cartridges of explosives or blasting agents that are 4 inches (100 millimeters) in... of water to protect the primer from impact. Slit packages of prill, water gel, or emulsions are...

  18. [DNA amplification using PCR with abutting primers].

    PubMed

    Garafutdinov, R R; Galimova, A A; Sakhabutdinova, A R; Vakhitov, V A; Chemeris, A V

    2015-01-01

    DNA analysis of ñîmplex biological objects (wastewater, soil, archaeological and forensic samples, etc.) is currently of great interest. DNA of these objects is characterized by low suitability for research due to the violation of its integrity and chemical structure; thus, the detection of specific nucleic acid fragments can be achieved by PCR with contiguous primers. In this paper, we present the results that clarify the specific characteristics of PCR with abutting primers. The 3'-ends of these primers are annealed at adjacent nucleotides of complementary chains of DNA target. It has been shown that the proximity of primers enables the formation of specific reaction products with a higher sensitivity and less reaction time. Using artificially damaged DNA and DNA from the soil we demonstrated that the abutting primers provide assured detection of specific DNA fragments. The results of this work may be taken into account in PCR with degraded (fragmented) DNA.

  19. Electrostatic Discharge testing of propellants and primers

    SciTech Connect

    Berry, R.B.

    1994-02-01

    This report presents the results of testing of selected propellants and primers to Electrostatic Discharge (ESD) characteristic of the human body. It describes the tests and the fixturing built to accommodate loose material (propellants) and the packed energetic material of the primer. The results indicate that all powders passed and some primers, especially the electric primers, failed to pass established requirements which delineate insensitive energetic components. This report details the testing of components and materials to four ESD environments (Standard ESD, Severe ESD, Modified Standard ESD, and Modified Severe ESD). The purpose of this study was to collect data based on the customer requirements as defined in the Sandia Environmental Safety & Health (ES&H) Manual, Chapter 9, and to define static sensitive and insensitive propellants and primers.

  20. SBE primer : multiplexing minisequencing-based genotyping

    SciTech Connect

    Kaderali, L.; Deshpande, A.; Uribe-Romeo, F. J.; Schliep, A.; Torney, D. C.

    2002-01-01

    Single-nucleotide polymorphism (SNP) analysis is a powerful tool for mapping and diagnosing disease-related alleles. Most of the known genetic diseases are caused by point mutations, and a growing number of SNPs will be routinely analyzed to diagnose genetic disorders. Mutation analysis by polymerase mediated single-base primer extension (minisequencing) can be massively parallelized using for example DNA microchips or flow cytometry with microspheres as solid support. By adding a unique oligonucleotide tag to the 5-inch end of the minisequencing primer and attaching the complementary anti-tag to the array or bead surface, the assay can be 'demultiplexed'. However, such high-throughput scoring of SNPs requires a high level of primer multiplexing in order to analyze multiple loci in one assay, thus enabling inexpensive and fast polymorphism scoring. Primers can be chosen from either the plus or the minus strand, and primers used in the same experiment must not bind to one another. To genotype a given number of polymorphic sites, the question is which primer to use for each SNP, and which primers to group into the same experiment. Furthermore, a crosshybridization-free tag/anti-tag code is required in order to sort the extended primers to the corresponding microspheres or chip spots. These problems pose challenging algorithmic questions. We present a computer program lo automate the design process for the assay. Oligonucleotide primers for the reaction are automatically selected by the software, a unique DNA tag/anti-tag system is generated, and the pairing of primers and DNA-Tags is automatically done in a way to avoid any crossreactivity. We report first results on a 45-plex genotyping assay, indicating that minisequencing can be adapted to be a powerful tool for high-throughput, massively parallel genotyping.

  1. MRI Biosensors: A Short Primer

    PubMed Central

    Louie, Angelique

    2013-01-01

    Interest in Magnetic Resonance Imaging (MRI) contrast agents for molecular imaging of biological function experienced a surge of excitement approximately 20 years ago with the development of the first activatable contrast agents that could act as biosensors and turn “on” in response to a specific biological activity. This brief tutorial, based on a short course lecture from the 2011 ISMRM meeting, provides an overview of underlying principles governing the design of biosensing contrast agents. We describe mechanisms by which a magnetic resonance imaging (MRI) contrast agent can be made into a sensor for both T1 and T2 types contrast agents. Examples of biological activities that can interact with a contrast agent are discussed using specific examples from the recent literature to illustrate the primary mechanisms of action that have been utilized to achieve activation. MRI sensors for pH, ion binding, enzyme cleavage, and oxidation-reduction are presented. This article is not meant to be an exhaustive review, but an illustrative primer to explain how activation can be achieved for an MRI contrast agent. Chemical exchange saturation transfer (CEST) is not covered as these agents were covered in a separate lecture. PMID:23996662

  2. Climate change primer for respirologists.

    PubMed

    Takaro, Tim K; Henderson, Sarah B

    2015-01-01

    Climate change is already affecting the cardiorespiratory health of populations around the world, and these impacts are expected to increase. The present overview serves as a primer for respirologists who are concerned about how these profound environmental changes may affect their patients. The authors consider recent peer-reviewed literature with a focus on climate interactions with air pollution. They do not discuss in detail cardiorespiratory health effects for which the potential link to climate change is poorly understood. For example, pneumonia and influenza, which affect >500 million people per year, are not addressed, although clear seasonal variation suggests climate-related effects. Additionally, large global health impacts in low-resource countries, including migration precipitated by environmental change, are omitted. The major cardiorespiratory health impacts addressed are due to heat, air pollution and wildfires, shifts in allergens and infectious diseases along with respiratory impacts from flooding. Personal and societal choices about carbon use and fossil energy infrastructure should be informed by their impacts on health, and respirologists can play an important role in this discussion.

  3. Primer on spontaneous heating and pyrophoricity

    SciTech Connect

    Not Available

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  4. Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

    PubMed

    Yofe, Ido; Schuldiner, Maya

    2014-02-01

    The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast

  5. Multiplexing Short Primers for Viral Family PCR

    SciTech Connect

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  6. Use of labeled primers for differential display

    SciTech Connect

    Paunesku, T.; Woloschak, G.E.

    1995-01-01

    Two artifacts introduced in using differential display technology are (1) random priming from dT present from affinity purification of PolyA+ RNA and (2) hybridization of the arbitrary primer to template target sequences on both cDNA strands. We have developed a method eliminating both problems. By separately using 5`-end-labeled (T){sub 12}XY and arbitrary primers to label bands and comparing two differential display patterns, we can detect only those products incorporating the (T){sub 12}XY primer on the 3` ends and the arbitrary primer on 5` ends. Those bands that are generated randomly in the PCR are readily detectable and can be ignored.

  7. Protective Coats For Zinc-Rich Primers

    NASA Technical Reports Server (NTRS)

    Macdowell, Louis G, III

    1993-01-01

    Report describes tests of topcoats for inorganic zinc-rich primers on carbon steel. Topcoats intended to provide additional protection against corrosion in acidic, salty seacoast-air/rocket-engine-exhaust environment of Space Shuttle launch site. Tests focused on polyurethane topcoats on epoxy tie coats on primers. Part of study involved comparison between "high-build" coating materials and thin-film coating materials.

  8. A Dozen Primers on Important Information Standards

    ERIC Educational Resources Information Center

    Dempsey, Kathy, Comp.

    2007-01-01

    This is a compilation of 12 primers on important information standards and protocols. These primers are: (1) Atom; (2) COinS; (3) MADS; (4) MARC 21/MARCXML; (5) MIX; (6) MXG; (7) OpenSearch; (8) PREMIS; (9) RESTful HTTP; (10) unAPI; (11) XMPP (aka Jabber); and (12) ZeeRex. The Atom Syndication Format defines a new XML-based syndication format for…

  9. ANL supplement to the UNICOS primer

    SciTech Connect

    Wiley, M.S.; Karlovsky, S.R.

    1991-06-01

    The ANL Supplement to the UNICOS Primer (ANL/TM 460) introduces the Cray X-MP interactive and batch services available at Argonne National Laboratory. It serves as a companion to the UNICOS Primer (Cray publication SG-2010 6.0). Whereas the UNICOS Primer discusses standard Unix issues of Cray computing, this manual discusses those issues specific to Cray computing at ANL. If this is your first experience on a Unix-based system, we assume that you have read at least Chapters 1 through 3 of the UNICOS Primer. The Glossary at the back of the UNICOS Primer will also be useful to you. If you are already familiar with a Unix system, it should suffice to keep the UNICOS Primer handy as you use this document. To learn about Unix programming in greater detail, we recommend A Practical Guide to the Unix System, by Mark G. Sobell. This manual and all other sources referred to in this document are available for purchase at the Document Distribution Counter in Building 221, Room A-134. We assume that you have already read the Guide to Computing at ANL (ANL/TM 336) to get an overview of all the computing facilities and services available at Argonne National Laboratory. You should also refer to Recommended Documentation for Computer Users at ANL (ANL/TM 379) for additional guidance in selecting available documentation that will best fill your particular computing needs.

  10. Use of labeled primers for differential display

    SciTech Connect

    Paunesku, T.; Woloschak, G.E.

    1995-02-01

    The differential display of eukaryotic cDNAs using PCR allows for determination of mRNA species differentially expressed when comparing two similar cell populations. This procedure uses a (T){sub 12}XY oligonucleotide as the 3 ft primer and an arbitrary 8-10-mer as the 5 ft primer. Labeling occurs by inclusion of {alpha}[{sup 33}P]-dATP in the PCR reaction. Two artifacts caused by this approach are (1) random printing from dT present from affinity purification of PolyA+RNA and (2) hybridization of the arbitrary primer to template target sequences on both cDNA strands. In this work, we have developed an approach for both eliminating smearing and identifying nonspecific bands on sequencing gels. By separately using 5 ft-end-labeled (T){sub 12}XY and arbitrary primers to label bands and comparing two differential display patterns rather than including labeled nucleotides in the PCR reaction itself, we can detect only those products incorporating the M{sub 12}XY primer on the 3 ft ends and the arbitrary primer on 5 ft ends. Those bands that are generated randomly in the PCR reaction are readily detectable and can be ignored. If on the other hand, one is interested only in a diagnostic banding pattern for differential display, benefit can be derived from the simplicity of the pattern obtained when labeled (T){sub 12}XY is used.

  11. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design.

    PubMed

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads Tvillinggaard; Genee, Hans Jasper; Holm, Dorte Koefoed; Carlsen, Simon; Hansen, Bjarne Gram; Patil, Kiran Raosaheb; Mortensen, Uffe Hasbro; Wernersson, Rasmus

    2011-07-01

    Uracil-Specific Exision Reagent (USER) fusion is a recently developed technique that allows for assembly of multiple DNA fragments in a few simple steps. However, designing primers for USER fusion is both tedious and time consuming. Here, we present the Primer Help for USER (PHUSER) software, a novel tool for designing primers specifically for USER fusion and USER cloning applications. We also present proof-of-concept experimental validation of its functionality. PHUSER offers quick and easy design of PCR optimized primers ensuring directionally correct fusion of fragments into a plasmid containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (T(m)), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers are individually analysed in terms of GC content, presence of GC clamp at 3'-end, the risk of primer dimer formation, the risk of intra-primer complementarity (secondary structures) and the presence of polyN stretches. Furthermore, PHUSER offers the option to insert linkers between DNA fragments, as well as highly flexible cassette options. PHUSER is publicly available at http://www.cbs.dtu.dk/services/phuser/. PMID:21622660

  12. PrimerDesign-M: A multiple-alignment based multiple-primer design tool for walking across variable genomes

    SciTech Connect

    Yoon, Hyejin; Leitner, Thomas

    2014-12-17

    Analyses of entire viral genomes or mtDNA requires comprehensive design of many primers across their genomes. In addition, simultaneous optimization of several DNA primer design criteria may improve overall experimental efficiency and downstream bioinformatic processing. To achieve these goals, we developed PrimerDesign-M. It includes several options for multiple-primer design, allowing researchers to efficiently design walking primers that cover long DNA targets, such as entire HIV-1 genomes, and that optimizes primers simultaneously informed by genetic diversity in multiple alignments and experimental design constraints given by the user. PrimerDesign-M can also design primers that include DNA barcodes and minimize primer dimerization. PrimerDesign-M finds optimal primers for highly variable DNA targets and facilitates design flexibility by suggesting alternative designs to adapt to experimental conditions.

  13. PrimerDesign-M: A multiple-alignment based multiple-primer design tool for walking across variable genomes

    DOE PAGES

    Yoon, Hyejin; Leitner, Thomas

    2014-12-17

    Analyses of entire viral genomes or mtDNA requires comprehensive design of many primers across their genomes. In addition, simultaneous optimization of several DNA primer design criteria may improve overall experimental efficiency and downstream bioinformatic processing. To achieve these goals, we developed PrimerDesign-M. It includes several options for multiple-primer design, allowing researchers to efficiently design walking primers that cover long DNA targets, such as entire HIV-1 genomes, and that optimizes primers simultaneously informed by genetic diversity in multiple alignments and experimental design constraints given by the user. PrimerDesign-M can also design primers that include DNA barcodes and minimize primer dimerization. PrimerDesign-Mmore » finds optimal primers for highly variable DNA targets and facilitates design flexibility by suggesting alternative designs to adapt to experimental conditions.« less

  14. Beam shaping for laser initiated optical primers

    NASA Astrophysics Data System (ADS)

    Lizotte, Todd E.

    2008-08-01

    Remington was one of the first firearm manufacturing companies to file a patent for laser initiated firearms, in 1969. Nearly 40 years later, the development of laser initiated firearms has not become a mainstream technology in the civilian market. Requiring a battery is definitely a short coming, so it is easy to see how such a concept would be problematic. Having a firearm operate reliably and the delivery of laser energy in an efficient manner to ignite the shock-sensitive explosive primer mixtures is a tall task indeed. There has been considerable research on optical element based methods of transferring or compressing laser energy to ignite primer charges, including windows, laser chip primers and various lens shaped windows to focus the laser energy. The focusing of laser light needs to achieve igniting temperatures upwards of >400°C. Many of the patent filings covering this type of technology discuss simple approaches where a single point of light might be sufficient to perform this task. Alternatively a multi-point method might provide better performance, especially for mission critical applications, such as precision military firearms. This paper covers initial design and performance test of the laser beam shaping optics to create simultaneous multiple point ignition locations and a circumferential intense ring for igniting primer charge compounds. A simple initial test of the ring beam shaping technique was evaluated on a standard large caliber primer to determine its effectiveness on igniting the primer material. Several tests were conducted to gauge the feasibility of laser beam shaping, including optic fabrication and mounting on a cartridge, optic durability and functional ignition performance. Initial data will be presented, including testing of optically elements and empirical primer ignition / burn analysis.

  15. Primers on Special Education and Charter Schools: Compilation of Full Primer Set

    ERIC Educational Resources Information Center

    Ahearn, Eileen M.; Giovannetti, Elizabeth A.; Lange, Cheryl M.; Rhim, Lauren Morando; Warren, Sandra Hopfengardner

    2004-01-01

    This set of primers for charter school authorizers; charter school operators and state-level administrators has been developed to provide background information and resources for the "builders" of charter schools and policymakers to facilitate the successful inclusion of students with disabilities in charter schools. The primers open with a…

  16. Primerize: automated primer assembly for transcribing non-coding RNA domains

    PubMed Central

    Tian, Siqi; Yesselman, Joseph D.; Cordero, Pablo; Das, Rhiju

    2015-01-01

    Customized RNA synthesis is in demand for biological and biotechnological research. While chemical synthesis and gel or chromatographic purification of RNA is costly and difficult for sequences longer than tens of nucleotides, a pipeline of primer assembly of DNA templates, in vitro transcription by T7 RNA polymerase and kit-based purification provides a cost-effective and fast alternative for preparing RNA molecules. Nevertheless, designing template primers that optimize cost and avoid mispriming during polymerase chain reaction currently requires expert inspection, downloading specialized software or both. Online servers are currently not available or maintained for the task. We report here a server named Primerize that makes available an efficient algorithm for primer design developed and experimentally tested in our laboratory for RNA domains with lengths up to 300 nucleotides. Free access: http://primerize.stanford.edu. PMID:25999345

  17. Climate Change, Health, and Communication: A Primer.

    PubMed

    Chadwick, Amy E

    2016-01-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

  18. Climate Change, Health, and Communication: A Primer.

    PubMed

    Chadwick, Amy E

    2016-01-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects. PMID:26580230

  19. PrimerIdent: A web based tool for conserved primer design

    PubMed Central

    Pessoa, Alberto M; Pereira, Susana; Teixeira, Jorge

    2010-01-01

    Conserved primers across multiple species and simultaneously specific for a certain isozyme can be rare and difficult to find. PrimerIdent was developed aiming to automate this primer design and selection process in a given nucleotide sequence alignment, providing an intuitive, easy to interpret graphical result, which offers a list of all possible primers that meet the user criteria, with a colour-code identity to each sequence in the alignment. The software here presented is a simple and intuitive web based tool that is suitable for distinguishing very similar nucleotide sequences, such as isozymes­coding sequences, to enable the conserved primer design across multiple species, necessary for approaches that rely on knowing if a primer is suitable for a certain set of pre-aligned sequences, to design a specific primer to a certain sequence variation, or a combination thereof. This extremely useful software can, therefore, be used as a tool for the specific amplification of individual members of multigenic families across related species and also to evaluate the differential expression of isogenes for a given species. Availability http://primerident.up.pt PMID:21346862

  20. Internet Primer: Workshop Design and Objectives.

    ERIC Educational Resources Information Center

    Laverty, Corinne Y. C.

    1996-01-01

    Outlines the design, objectives, and evaluation of an introductory Internet workshop offered with library instruction classes in an electronic classroom at Queens University (Kingston, Ontario, Canada). Presents teaching tips and frequently-asked questions. The Internet primer handouts are appended. (AEF)

  1. Microsatellite primers for red drum (Sciaenops ocellatus)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In this note, we document polymerase-chain-reaction (PCR) primer pairs for 101, nuclear-encoded microsatellites designed and developed from a red drum (Sciaenops ocellatus) genomic library. The 101 microsatellites (Genbank Accession Numbers EU015882-EU015982) were amplified successfully and used to...

  2. Theme: A Primer for Agricultural Education.

    ERIC Educational Resources Information Center

    Vaughn, Paul, Ed.; And Others

    1998-01-01

    Includes "A Primer for Agricultural Education" (Vaughn); "What Are the Goals and Purposes of Ag Ed?" (Case, Whitaker); "Basics of Supervised Experience" (Lee); "The FFA [Future Farmers of America]: Why Do We Have It?" (Case, Whitaker); "The Council: Providing Visionary Leadership" (Daniel, Vaughn); "Ag Communications" (Lockaby, Vernon); and…

  3. Microsatellite primer resource for Populus developed from

    SciTech Connect

    Yin, Tongming; Yang, Xiaohan; Gunter, Lee E; Tuskan, Gerald A; Wullschleger, Stan D; Huang, Prof. Minren; Li, Shuxian; Zhang, Xinye

    2008-01-01

    In this study, 148 428 simple sequence repeat (SSR) primer pairs were designed from the unambiguously mapped sequence scaffolds of the Nisqually-1 genome. The physical position of the priming sites were identified along each of the 19 Populus chromosomes, and it was specified whether the priming sequences belong to intronic, intergenic, exonic or UTR regions. A subset of 150 SSR loci were amplified and a high amplification success rate (72%) was obtained in P. tremuloides, which belongs to a divergent subgenus of Populus relative to Nisqually-1. PCR reactions showed that the amplification success rate of exonic primer pairs was much higher than that of the intronic/intergenic primer pairs. Applying ANOVA and regression analyses to the flanking sequences of microsatellites, the repeat lengths, the GC contents of the repeats, the repeat motif numbers, the repeat motif length and the base composition of the repeat motif, it was determined that only the base composition of the repeat motif and the repeat motif length significantly affect the microsatellite variability in P. tremuloides samples. The SSR primer resource developed in this study provides a database for selecting highly transferable SSR markers with known physical position in the Populus genome and provides a comprehensive genetic tool to extend the genome sequence of Nisqually-1 to genetic studies in different Populus species.

  4. A Primer on Simulation and Gaming.

    ERIC Educational Resources Information Center

    Barton, Richard F.

    In a primer intended for the administrative professions, for the behavioral sciences, and for education, simulation and its various aspects are defined, illustrated, and explained. Man-model simulation, man-computer simulation, all-computer simulation, and analysis are discussed as techniques for studying object systems (parts of the "real…

  5. Forest Interpreter's Primer on Fire Management.

    ERIC Educational Resources Information Center

    Zelker, Thomas M.

    Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

  6. Issues Primer. EEE708 Negotiated Study Program.

    ERIC Educational Resources Information Center

    Jennings, Leonie

    This issues primer is structured around a series of 20 contemporary concerns in the changing world of work and training in Australia in the early 1990s. It is part of the study materials for the one-semester distance education unit, Negotiated Study Program, in the Open Campus Program at Deakin University (Australia). Information on each issue is…

  7. Evaluation of new primers for CSF1PO.

    PubMed

    Yoshida, K; Sekiguchi, K; Kasai, K; Sato, H; Seta, S; Sensabaugh, G F

    1997-01-01

    We describe new primers for the detection of the STR polymorphism at the CSF1PO locus. These primers have been designed to produce shorter amplicons (150-182 bp) than the primers in standard use (295-327 bp). The reliability of the new primers for CSF1PO typing has been demonstrated by testing on known samples and by sequence analysis. These primers are superior to the original primers with regard to electrophoretic resolution and utility for typing of severely degraded DNA.

  8. Rust transformation/rust compatible primers

    NASA Technical Reports Server (NTRS)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  9. New primers for adhesive bonding of aluminum alloys

    NASA Technical Reports Server (NTRS)

    Burrell, B. W.; Port, W. S.

    1971-01-01

    Synthetic polypeptide adhesive primers are effective, with high temperature epoxy resins, at temperatures from 100 deg to 300 deg C. Lap-shear failure loads and lap-shear strength of both primers are discussed.

  10. A primer for criticality calculations with DANTSYS

    SciTech Connect

    Busch, R.D.

    1997-08-01

    With the closure of many experimental facilities, the nuclear safety analyst has to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. Although deterministic methods often do not provide exact models of a system, a substantial amount of reliable information on nuclear systems can be obtained using these methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico (UNM) in cooperation with the Radiation Transport Group at Los Alamos National Laboratory (LANL) has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. DANTSYS is the new name of the group of codes formerly known as: ONEDANT, TWODANT, TWOHEX, TWOGQ, and THREEDANT. The primer is designed to teach bu example, with each example illustrating two or three DANTSYS features useful in criticality analyses. Starting with a Quickstart chapter, the primer gives an overview of the basic requirements for DANTSYS input and allows the user to quickly run a simple criticality problem with DANTSYS. Each chapter has a list of basic objectives at the beginning identifying the goal of the chapter and the individual DANTSYS features covered in detail in the chapter example problems. On completion of the primer, it is expected that the user will be comfortable doing criticality calculations with DANTSYS and can handle 60--80% of the situations that normally arise in a facility. The primary provides a set of input files that can be selective modified by the user to fit each particular problem.

  11. Universal COI primers for DNA barcoding amphibians.

    PubMed

    Che, Jing; Chen, Hong-Man; Yang, Jun-Xiao; Jin, Jie-Qiong; Jiang, Ke; Yuan, Zhi-Yong; Murphy, Robert W; Zhang, Ya-Ping

    2012-03-01

    DNA barcoding is a proven tool for the rapid and unambiguous identification of species, which is essential for many activities including the vouchering tissue samples in the genome 10K initiative, genealogical reconstructions, forensics and biodiversity surveys, among many other applications. A large-scale effort is underway to barcode all amphibian species using the universally sequenced DNA region, a partial fragment of mitochondrial cytochrome oxidase subunit I COI. This fragment is desirable because it appears to be superior to 16S for barcoding, at least for some groups of salamanders. The barcoding of amphibians is essential in part because many species are now endangered. Unfortunately, existing primers for COI often fail to achieve this goal. Herein, we report two new pairs of primers (➀, ➁) that in combination serve to universally amplify and sequence all three orders of Chinese amphibians as represented by 36 genera. This taxonomic diversity, which includes caecilians, salamanders and frogs, suggests that the new primer pairs will universally amplify COI for the vast majority species of amphibians.

  12. Universal COI primers for DNA barcoding amphibians.

    PubMed

    Che, Jing; Chen, Hong-Man; Yang, Jun-Xiao; Jin, Jie-Qiong; Jiang, Ke; Yuan, Zhi-Yong; Murphy, Robert W; Zhang, Ya-Ping

    2012-03-01

    DNA barcoding is a proven tool for the rapid and unambiguous identification of species, which is essential for many activities including the vouchering tissue samples in the genome 10K initiative, genealogical reconstructions, forensics and biodiversity surveys, among many other applications. A large-scale effort is underway to barcode all amphibian species using the universally sequenced DNA region, a partial fragment of mitochondrial cytochrome oxidase subunit I COI. This fragment is desirable because it appears to be superior to 16S for barcoding, at least for some groups of salamanders. The barcoding of amphibians is essential in part because many species are now endangered. Unfortunately, existing primers for COI often fail to achieve this goal. Herein, we report two new pairs of primers (➀, ➁) that in combination serve to universally amplify and sequence all three orders of Chinese amphibians as represented by 36 genera. This taxonomic diversity, which includes caecilians, salamanders and frogs, suggests that the new primer pairs will universally amplify COI for the vast majority species of amphibians. PMID:22145866

  13. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

    PubMed

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

    2015-07-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system.

  14. Optimization of turn-back primers in isothermal amplification.

    PubMed

    Kimura, Yasumasa; de Hoon, Michiel J L; Aoki, Shintaro; Ishizu, Yuri; Kawai, Yuki; Kogo, Yasushi; Daub, Carsten O; Lezhava, Alexander; Arner, Erik; Hayashizaki, Yoshihide

    2011-05-01

    The application of isothermal amplification technologies is rapidly expanding and currently covers different areas such as infectious disease, genetic disorder and drug dosage adjustment. Meanwhile, many of such technologies have complex reaction processes and often require a fine-tuned primer set where existing primer design tools are not sufficient. We have developed a primer selection system for one important primer, the turn-back primer (TP), which is commonly used in loop-mediated amplification (LAMP) and smart amplification process (SmartAmp). We chose 78 parameters related to the primer and target sequence, and explored their relationship to amplification speed using experimental data for 1344 primer combinations. We employed the least absolute shrinkage and selection operator (LASSO) method for parameter selection and estimation of their numerical coefficients. We subsequently evaluated our prediction model using additional independent experiments and compared to the LAMP primer design tool, Primer Explorer version4 (PE4). The evaluation showed that our approach yields a superior primer design in isothermal amplification and is robust against variations in the experimental setup. Our LASSO regression analysis revealed that availability of the 3'- and 5'-end of the primer are particularly important factors for efficient isothermal amplification. Our computer script is freely available at: http://gerg.gsc.riken.jp/TP_optimization/.

  15. Hydrology of Central Florida Lakes - A Primer

    USGS Publications Warehouse

    Schiffer, Donna M.

    1998-01-01

    INTRODUCTION Lakes are among the most valued natural resources of central Florida. The landscape of central Florida is riddled with lakeswhen viewed from the air, it almost seems there is more water than land. Florida has more naturally formed lakes than other southeastern States, where many lakes are created by building dams across streams. The abundance of lakes on the Florida peninsula is a result of the geology and geologic history of the State. An estimated 7,800 lakes in Florida are greater than 1 acre in surface area. Of these, 35 percent are located in just four counties (fig. 1): Lake, Orange, Osceola, and Polk (Hughes, 1974b). Lakes add to the aesthetic and commercial value of the area and are used by many residents and visitors for fishing, boating, swimming, and other types of outdoor recreation. Lakes also are used for other purposes such as irrigation, flood control, water supply, and navigation. Residents and visitors commonly ask questions such as Whyare there so many lakes here?, Why is my lake drying up (or flooding)?, or Is my lake spring-fed? These questions indicate that the basic hydrology of lakes and the interaction of lakes with ground water and surface water are not well understood by the general population. Because of the importance of lakes to residents of central Florida and the many questions and misconceptions about lakes, this primer was prepared by the U.S. Geological Survey (USGS) in cooperation with the St. Johns River Water Management District and the South Florida Water Management District. The USGS has been collecting hydrologic data in central Florida since the 1920s, obtaining valuable information that has been used to better understand the hydrology of the water resources of central Florida, including lakes. In addition to data collection, as of 1994, the USGS had published 66 reports and maps on central Florida lakes (Garcia and Hoy, 1995). The main purpose of this primer is to describe the hydrology of lakes in central

  16. Hubble Space Telescope Primer for Cycle 21

    NASA Astrophysics Data System (ADS)

    Gonzaga, S.; et al.

    2012-12-01

    The Hubble Space Telescope Primer for Cycle 21 is a companion document to the HST Call for Proposals1. It provides an overview of the Hubble Space Telescope (HST), with basic information about telescope operations, instrument capabilities, and technical aspects of the proposal preparation process. A thorough understanding of the material in this document is essential for the preparation of a competitive proposal. This document is available as an online HTML document and a PDF file. The HTML version, optimized for online browsing, contains many links to additional information. The PDF version is optimized for printing, but online PDF readers have search capabilities for quick retrieval of specific information.

  17. Protein sulfation analysis--A primer.

    PubMed

    Monigatti, Flavio; Hekking, Brian; Steen, Hanno

    2006-12-01

    The aim of this review is to present an overview of protein sulfation in the context of 'modificomics', i.e. post-translational modification-specific proteome research. In addition to a short introduction to the biology of protein sulfation (part 1), we will provide detailed discussion regarding (i) methods and tools for prediction of protein tyrosine sulfation sites (part 2), (ii) biochemical techniques used for protein sulfation analysis (part 3.1), and (iii) mass spectrometric strategies and methods applied to protein sulfation analysis (part 3.2). We will highlight strengths and limitations of different strategies and approaches (including references), providing a primer for newcomers to protein sulfation analysis.

  18. Global Health in Family Medicine Summer Primer

    PubMed Central

    Rouleau, Katherine; Janakiram, Praseedha; Nicolle, Eileen; Godoy-Ruiz, Paula; Pakes, Barry N.

    2015-01-01

    Abstract Problem addressed Despite the rapid emergence of global health training across North American universities, there remains a gap in educational programs focusing on the unique role of family medicine and primary care in global health. Objective of program The objective of the Global Health in Family Medicine Summer Primer, developed in 2013 by the Department of Family and Community Medicine at the University of Toronto in Ontario, is to strengthen global health competencies among family medicine residents and faculty. Program description The course covers the meaning of global health; global health ethics; the place of family medicine, primary care, and primary health care in the global health context; epidemiology; infectious diseases; the social determinants of health; and care of vulnerable populations locally and globally. The course is delivered in an intensive 5-day format with didactic lectures, group discussions, interactive workshops, and lived-experience panels. Conclusion The Global Health in Family Medicine Summer Primer has proven to be a successful educational initiative and provides valuable lessons learned for other academic science centres in developing global health training programs for family medicine residents and faculty. PMID:26380854

  19. Alanylated lipoteichoic acid primer in Bacillus subtilis

    PubMed Central

    Luo, Yu

    2016-01-01

    Lipoteichoic acid is a major lipid-anchored polymer in Gram-positive bacteria such as Bacillus subtilis. This polymer typically consists of repeating phosphate-containing units and therefore has a predominant negative charge. The repeating units are attached to a glycolipid anchor which has a diacylglycerol (DAG) moiety attached to a dihexopyranose head group. D-alanylation is known as the major modification of type I and type IV lipoteichoic acids, which partially neutralizes the polymer and plays important roles in bacterial survival and resistance to the host immune system. The biosynthesis pathways of the glycolipid anchor and lipoteichoic acid have been fully characterized. However, the exact mechanism of D-alanyl transfer from the cytosol to cell surface lipoteichoic acid remains unclear. Here I report the use of mass spectrometry in the identification of possible intermediate species in the biosynthesis and D-alanylation of lipoteichoic acid: the glycolipid anchor, nascent lipoteichoic acid primer with one phosphoglycerol unit, as well as mono- and di-alanylated forms of the lipoteichoic acid primer. Monitoring these species as well as the recently reported D-alanyl-phosphatidyl glycerol should aid in shedding light on the mechanism of the D-alanylation pathway of lipoteichoic acid. PMID:27134729

  20. Great Lakes rivermouths: a primer for managers

    USGS Publications Warehouse

    Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul

    2013-01-01

    Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described

  1. Homolog-specific PCR primer design for profiling splice variants

    PubMed Central

    Srivastava, Gyan Prakash; Hanumappa, Mamatha; Kushwaha, Garima; Nguyen, Henry T.; Xu, Dong

    2011-01-01

    To study functional diversity of proteins encoded from a single gene, it is important to distinguish the expression levels among the alternatively spliced variants. A variant-specific primer pair is required to amplify each alternatively spliced variant individually. For this purpose, we developed a new feature, homolog-specific primer design (HSPD), in our high-throughput primer and probe design software tool, PRIMEGENS-v2. The algorithm uses a de novo approach to design primers without any prior information of splice variants or close homologs for an input query sequence. It not only designs primer pairs but also finds potential isoforms and homologs of the input sequence. Efficiency of this algorithm was tested for several gene families in soybean. A total of 187 primer pairs were tested under five different abiotic stress conditions with three replications at three time points. Results indicate a high success rate of primer design. Some primer pairs designed were able to amplify all splice variants of a gene. Furthermore, by utilizing combinations within the same multiplex pool, we were able to uniquely amplify a specific variant or duplicate gene. Our method can also be used to design PCR primers to specifically amplify homologs in the same gene family. PRIMEGENS-v2 is available at: http://primegens.org. PMID:21415011

  2. HST archive primer, version 4.1

    NASA Technical Reports Server (NTRS)

    Fruchter, A. (Editor); Baum, S. (Editor)

    1994-01-01

    This version of the HST Archive Primer provides the basic information a user needs to know to access the HST archive via StarView the new user interface to the archive. Using StarView, users can search for observations interest, find calibration reference files, and retrieve data from the archive. Both the terminal version of StarView and the X-windows version feature a name resolver which simplifies searches of the HST archive based on target name. In addition, the X-windows version of StarView allows preview of all public HST data; compressed versions of public images are displayed via SAOIMAGE, while spectra are plotted using the public plotting package, XMGR. Finally, the version of StarView described here features screens designed for observers preparing Cycle 5 HST proposals.

  3. Primer on tritium safe handling practices

    SciTech Connect

    Not Available

    1994-12-01

    This Primer is designed for use by operations and maintenance personnel to improve their knowledge of tritium safe handling practices. It is applicable to many job classifications and can be used as a reference for classroom work or for self-study. It is presented in general terms for use throughout the DOE Complex. After reading it, one should be able to: describe methods of measuring airborne tritium concentration; list types of protective clothing effective against tritium uptake from surface and airborne contamination; name two methods of reducing the body dose after a tritium uptake; describe the most common method for determining amount of tritium uptake in the body; describe steps to take following an accidental release of airborne tritium; describe the damage to metals that results from absorption of tritium; explain how washing hands or showering in cold water helps reduce tritium uptake; and describe how tritium exchanges with normal hydrogen in water and hydrocarbons.

  4. Formaldehyde as hypothetical primer of biohomochirality

    SciTech Connect

    Goldanskii, V.I.

    1996-07-01

    One of the most intriguing and crucial problems of the prebiotic evolution and the origin of life is the explanation of the origin of biohomochirality. A scheme of conversions originated by formaldehyde (FA) as hypothetical primer of biohomochirality is proposed. The merit of FA as executor of this function is based -inter alia - on the distinguished role of FA as one of the earliest and simplest molecules in both warm, terrestrial and cold, extraterrestrial scenarios of the origin of life. The confirmation of the role of FA as primer of biohomochirality would support the option of an RNA world as an alternative to the protein world. The suggested hypothesis puts forward for the first time a concrete sequence of chemical reactions which can lead to biohomochirality. The spontaneous breaking of the mirror symmetry is secured by the application of the well-known Frank scheme (combination of autocatalysis and {open_quote}{open_quote}annihilation{close_quote}{close_quote} of L and D enantiomers) to the series of interactions of FA {open_quote}{open_quote}trimers{close_quote}{close_quote} (i.e. C{sub 3}H{sub 6}O{sub 3} compounds) of (aaa), (apa) and (app) types, where the monomeric groups (a) means {open_quote}{open_quote}achirons{close_quote}{close_quote} (a=CH{sub n}, n{ge}2 and C=M, M=C,O) and (p) mean {open_quote}{open_quote}prochirons{close_quote}{close_quote} (p=HC{asterisk}OM, M=H,C). {copyright} {ital 1996 American Institute of Physics.}

  5. [Analysis of effectiveness of cDNA synthesis, induced using complementary primers and primers containing a noncomplementary base matrix].

    PubMed

    D'iachenko, L B; Chenchik, A A; Khaspekov, G L; Tatarenko, A O; Bibilashvili, R Sh

    1994-01-01

    We have studied the efficiency of DNA synthesis catalyzed by M-MLV reverse transcriptase or Thermus aquaticus DNA polymerase for primers (4-17 nucleotides long) either completely matched or possessing a single mismatched base pair at all possible positions in the primer. It has been shown that DNA synthesis efficiency depends not only on the position of mismatched base pair but on the length and primary structure of the primer. The enzyme, template, and primer concentrations determine the relative level of mismatched DNA synthesis.

  6. Kentucky State Primer. A Primer on Developing Kentucky's Landfill Gas-to-Energy Potential

    NASA Astrophysics Data System (ADS)

    2000-05-01

    Throughout the country, the number of landfill gas-to-energy (LFGTE) projects is growing. Recovering methane gas at solid waste landfills provides significant environmental and economic benefits by eliminating methane emissions while capturing the emissions energy value. The methane captured from landfills can be transformed into a cost-effective fuel source for generating electricity and heat, firing boilers, or even powering vehicles. Permits, incentive programs, and policies for LFGTE project development vary greatly from state to state. To guide LFGTE project developers through the state permitting process and to help them to take advantage of state incentive programs, the U.S. Environmental Protection Agencys (EPAs) Landfill Methane Outreach Program (LMOP) has worked with state agencies to develop individual primers for states participating in the State Ally Program. By presenting the latest information on federal and state regulations and incentives affecting LFGTE projects in this primer, the LMOP and Kentucky state officials hope to facilitate development of many of the landfills listed in Table A. To develop this primer, the Commonwealth of Kentucky identified all the permits and funding programs that could apply to LFGTE projects developed in Kentucky. It should be noted, however, that the regulations, agencies, and policies described are subject to change. Changes are likely to occur whenever a state legislature meets, or when the federal government imposes new directions on state and local governments. LFGTE project developers should verify and continuously monitor the status of laws and rules that might affect their plans or the operations of their projects.

  7. Uncoupling primer and releaser responses to pheromone in honey bees

    NASA Astrophysics Data System (ADS)

    Grozinger, Christina M.; Fischer, Patrick; Hampton, Jacob E.

    2007-05-01

    Pheromones produce dramatic behavioral and physiological responses in a wide variety of species. Releaser pheromones elicit rapid responses within seconds or minutes, while primer pheromones produce long-term changes which may take days to manifest. Honeybee queen mandibular pheromone (QMP) elicits multiple distinct behavioral and physiological responses in worker bees, as both a releaser and primer, and thus produces responses on vastly different time scales. In this study, we demonstrate that releaser and primer responses to QMP can be uncoupled. First, treatment with the juvenile hormone analog methoprene leaves a releaser response (attraction to QMP) intact, but modulates QMP’s primer effects on sucrose responsiveness. Secondly, two components of QMP (9-ODA and 9-HDA) do not elicit a releaser response (attraction) but are as effective as QMP at modulating a primer response, downregulation of foraging-related brain gene expression. These results suggest that different responses to a single pheromone may be produced via distinct pathways.

  8. DNA sequencing technology, walking with modular primers. Final report

    SciTech Connect

    Ulanovsky, L.

    1996-12-31

    The success of the Human Genome Project depends on the development of adequate technology for rapid and inexpensive DNA sequencing, which will also benefit biomedical research in general. The authors are working on DNA technologies that eliminate primer synthesis, the main bottleneck in sequencing by primer walking. They have developed modular primers that are assembled from three 5-mer, 6-mer or 7-mer modules selected from a presynthesized library of as few as 1,000 oligonucleotides ({double_bond}4, {double_bond}5, {double_bond}7). The three modules anneal contiguously at the selected template site and prime there uniquely, even though each is not unique for the most part when used alone. This technique is expected to speed up primer walking 30 to 50 fold, and reduce the sequencing cost by a factor of 5 to 15. Time and expensive will be saved on primer synthesis itself and even more so due to closed-loop automation of primer walking, made possible by the instant availability of primers. Apart from saving time and cost, closed-loop automation would also minimize the errors and complications associated with human intervention between the walks. The author has also developed two additional approaches to primer-library based sequencing. One involves a branched structure of modular primers which has a distinctly different mechanism of achieving priming specificity. The other introduces the concept of ``Differential Extension with Nucleotide Subsets`` as an approach increasing priming specificity, priming strength and allowing cycle sequencing. These approaches are expected to be more robust than the original version of the modular primer technique.

  9. Moisture insensitive primer: A myth or truth

    PubMed Central

    Shukla, Chandresh; Maurya, Rajkumar; Jain, Upendra; Gupta, Ankur; Garg, Jayshree

    2014-01-01

    Objectives: To compare the mean shear bond strength (SBS) of moisture insensitive primer (MIP) used for orthodontic bonding in the presence and absence of saliva. Materials and Methods: A total of 60 human noncarious maxillary premolars with sound buccal surfaces, recently extracted were collected in two groups of each 30. Maxillary premolar brackets were bonded to the teeth using light cure (Transbond XT, 3M Unitek, Monrovia, CA, USA) and MIP (Transbond MIP 3M Unitek, Monrovia, CA, USA,) in the presence and absence of saliva. Operators’ saliva was used during the bonding under moist condition. After debonding, all the specimens were examined under a stereomicroscope (×40 magnification) for adhesive remnant using adhesive remnant index (ARI). The SBS tests were done using Instron universal testing machine at cross-head speed of 1 mm/min, force passing parallel to the buccal surface using custom rod and registered in Newtons later converted into Megapascals. Results: Light cure and MIP (Transbond MIP and Transbond XT, 3M Unitek, Monrovia, CA, USA) in the absence of saliva showed higher mean SBS than the presence of saliva. Group I (light cure and MIP) in the absence of saliva showed mean SBS of 9.65 ± 0.90 Mpa. Group II (light cure and MIP) with the presence of saliva showed mean SBS of 9.03 ± 1.14 Mpa. The difference between both the groups was statistically significant, as confirmed by paired t-test (P < 0.05). In-Group I, ARI scores showed that more than half of the adhesive was left over the tooth surface, and Group II showed that there was no or insignificant amount of adhesive left over the tooth surface. Chi-square test revealed significant difference in debonding characteristics among the test groups of ARI (P < 0.05). Failure occurred mainly in resin– bracket base and resin – adhesive interfaces (χ² = 10.04, df = 3, P = 0.031). Conclusion: Moisture insensitive primer is effective in the presence/absence of moisture and has shown SBS value of more

  10. Complex Adaptive System of Systems (CASoS) Engineering Applications. Version 1.0.

    SciTech Connect

    Linebarger, John Michael; Maffitt, S. Louise; Glass, Robert John, Jr.; Beyeler, Walter Eugene; Brown, Theresa Jean; Ames, Arlo Leroy

    2011-10-01

    Complex Adaptive Systems of Systems, or CASoS, are vastly complex eco-socio-economic-technical systems which we must understand to design a secure future for the nation and the world. Perturbations/disruptions in CASoS have the potential for far-reaching effects due to highly-saturated interdependencies and allied vulnerabilities to cascades in associated systems. The Phoenix initiative approaches this high-impact problem space as engineers, devising interventions (problem solutions) that influence CASoS to achieve specific aspirations. CASoS embody the world's biggest problems and greatest opportunities: applications to real world problems are the driving force of our effort. We are developing engineering theory and practice together to create a discipline that is grounded in reality, extends our understanding of how CASoS behave, and allows us to better control those behaviors. Through application to real-world problems, Phoenix is evolving CASoS Engineering principles while growing a community of practice and the CASoS engineers to populate it.

  11. Phoenix : Complex Adaptive System of Systems (CASoS) engineering version 1.0.

    SciTech Connect

    Moore, Thomas W.; Quach, Tu-Thach; Detry, Richard Joseph; Conrad, Stephen Hamilton; Kelic, Andjelka; Starks, Shirley J.; Beyeler, Walter Eugene; Brodsky, Nancy S.; Verzi, Stephen J.; Brown, Theresa Jean; Glass, Robert John, Jr.; Sunderland, Daniel J.; Mitchell, Michael David; Ames, Arlo Leroy; Maffitt, S. Louise; Finley, Patrick D.; Russell, Eric Dean; Zagonel, Aldo A.; Reedy, Geoffrey E.; Mitchell, Roger A.; Corbet, Thomas Frank, Jr.; Linebarger, John Michael

    2011-08-01

    Complex Adaptive Systems of Systems, or CASoS, are vastly complex ecological, sociological, economic and/or technical systems which we must understand to design a secure future for the nation and the world. Perturbations/disruptions in CASoS have the potential for far-reaching effects due to pervasive interdependencies and attendant vulnerabilities to cascades in associated systems. Phoenix was initiated to address this high-impact problem space as engineers. Our overarching goals are maximizing security, maximizing health, and minimizing risk. We design interventions, or problem solutions, that influence CASoS to achieve specific aspirations. Through application to real-world problems, Phoenix is evolving the principles and discipline of CASoS Engineering while growing a community of practice and the CASoS engineers to populate it. Both grounded in reality and working to extend our understanding and control of that reality, Phoenix is at the same time a solution within a CASoS and a CASoS itself.

  12. Complex Adaptive Systems of Systems (CASoS) engineering and foundations for global design.

    SciTech Connect

    Brodsky, Nancy S.; Finley, Patrick D.; Beyeler, Walter Eugene; Brown, Theresa Jean; Linebarger, John Michael; Moore, Thomas W.; Glass, Robert John, Jr.; Maffitt, S. Louise; Mitchell, Michael David; Ames, Arlo Leroy

    2012-01-01

    Complex Adaptive Systems of Systems, or CASoS, are vastly complex ecological, sociological, economic and/or technical systems which must be recognized and reckoned with to design a secure future for the nation and the world. Design within CASoS requires the fostering of a new discipline, CASoS Engineering, and the building of capability to support it. Towards this primary objective, we created the Phoenix Pilot as a crucible from which systemization of the new discipline could emerge. Using a wide range of applications, Phoenix has begun building both theoretical foundations and capability for: the integration of Applications to continuously build common understanding and capability; a Framework for defining problems, designing and testing solutions, and actualizing these solutions within the CASoS of interest; and an engineering Environment required for 'the doing' of CASoS Engineering. In a secondary objective, we applied CASoS Engineering principles to begin to build a foundation for design in context of Global CASoS

  13. Primer on electricity futures and other derivatives

    SciTech Connect

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  14. PD5: A General Purpose Library for Primer Design Software

    PubMed Central

    Riley, Michael C.; Aubrey, Wayne; Young, Michael; Clare, Amanda

    2013-01-01

    Background Complex PCR applications for large genome-scale projects require fast, reliable and often highly sophisticated primer design software applications. Presently, such applications use pipelining methods to utilise many third party applications and this involves file parsing, interfacing and data conversion, which is slow and prone to error. A fully integrated suite of software tools for primer design would considerably improve the development time, the processing speed, and the reliability of bespoke primer design software applications. Results The PD5 software library is an open-source collection of classes and utilities, providing a complete collection of software building blocks for primer design and analysis. It is written in object-oriented C++ with an emphasis on classes suitable for efficient and rapid development of bespoke primer design programs. The modular design of the software library simplifies the development of specific applications and also integration with existing third party software where necessary. We demonstrate several applications created using this software library that have already proved to be effective, but we view the project as a dynamic environment for building primer design software and it is open for future development by the bioinformatics community. Therefore, the PD5 software library is published under the terms of the GNU General Public License, which guarantee access to source-code and allow redistribution and modification. Conclusions The PD5 software library is downloadable from Google Code and the accompanying Wiki includes instructions and examples: http://code.google.com/p/primer-design PMID:24278254

  15. On the mechanism of the modular primer effect.

    PubMed Central

    Beskin, A D; Zevin-Sonkin, D; Sobolev, I A; Ulanovsky, L E

    1995-01-01

    Modular primers are strings of three contiguously annealed unligated oligonucleotides (modules) as short as 5- or 6-mers, selected from a presynthesized library. It was previously found that such strings can prime DNA sequencing reactions specifically, thus eliminating the need for the primer synthesis step in DNA sequencing by primer walking. It has remained largely a mystery why modular primers prime uniquely, while a single module, used alone in the same conditions, often shows alternative priming of comparable strength. In a puzzling way, the single module, even in a large excess over the template, no longer primes at the alternative sites, when modules with which it can form a contiguous string are also present. Here we describe experiments indicating that this phenomenon cannot be explained by cooperative annealing of the modules to the template. Instead, the mechanism seems to involve competition between different primers for the available polymerase. In this competition, the polymerase is preferentially engaged by longer primers, whether modular or conventional, at the expense of shorter primers, even though the latter can otherwise prime with similar or occasionally higher efficiency. Images PMID:7659510

  16. A physicists guide to The Los Alamos Primer

    NASA Astrophysics Data System (ADS)

    Reed, B. Cameron

    2016-11-01

    In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer, which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons.

  17. PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets

    2013-08-08

    Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether theremore » are also TaqMan/Luminex probe matches within predicted amplicons.« less

  18. PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets

    SciTech Connect

    Gardner, S. N.

    2013-08-08

    Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether there are also TaqMan/Luminex probe matches within predicted amplicons.

  19. BTSC VAPOR INSTRUSION PRIMER "VAPOR INTRUSION CONSIDERATION FOR REDEVELOPMENT"

    EPA Science Inventory

    This primer is designed for brownfields stakeholders concerned about vapor intrusion, including property owners, real estate developers, and contractors performing environmental site investigations. It provides an overview of the vapor intrusion issue and how it can impact the ap...

  20. New primers for DNA barcoding of digeneans and cestodes (Platyhelminthes).

    PubMed

    Van Steenkiste, Niels; Locke, Sean A; Castelin, Magalie; Marcogliese, David J; Abbott, Cathryn L

    2015-07-01

    Digeneans and cestodes are species-rich taxa and can seriously impact human health, fisheries, aqua- and agriculture, and wildlife conservation and management. DNA barcoding using the COI Folmer region could be applied for species detection and identification, but both 'universal' and taxon-specific COI primers fail to amplify in many flatworm taxa. We found that high levels of nucleotide variation at priming sites made it unrealistic to design primers targeting all flatworms. We developed new degenerate primers that enabled acquisition of the COI barcode region from 100% of specimens tested (n = 46), representing 23 families of digeneans and 6 orders of cestodes. This high success rate represents an improvement over existing methods. Primers and methods provided here are critical pieces towards redressing the current paucity of COI barcodes for these taxa in public databases.

  1. PrecisePrimer: an easy-to-use web server for designing PCR primers for DNA library cloning and DNA shuffling.

    PubMed

    Pauthenier, Cyrille; Faulon, Jean-Loup

    2014-07-01

    PrecisePrimer is a web-based primer design software made to assist experimentalists in any repetitive primer design task such as preparing, cloning and shuffling DNA libraries. Unlike other popular primer design tools, it is conceived to generate primer libraries with popular PCR polymerase buffers proposed as pre-set options. PrecisePrimer is also meant to design primers in batches, such as for DNA libraries creation of DNA shuffling experiments and to have the simplest interface possible. It integrates the most up-to-date melting temperature algorithms validated with experimental data, and cross validated with other computational tools. We generated a library of primers for the extraction and cloning of 61 genes from yeast DNA genomic extract using default parameters. All primer pairs efficiently amplified their target without any optimization of the PCR conditions. PMID:24829457

  2. Universal primers that amplify RNA from all three flavivirus subgroups

    PubMed Central

    Maher-Sturgess, Sheryl L; Forrester, Naomi L; Wayper, Paul J; Gould, Ernest A; Hall, Roy A; Barnard, Ross T; Gibbs, Mark J

    2008-01-01

    Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5) coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers. PMID:18218114

  3. TSUNAMI Primer: A Primer for Sensitivity/Uncertainty Calculations with SCALE

    SciTech Connect

    Rearden, Bradley T; Mueller, Don; Bowman, Stephen M; Busch, Robert D.; Emerson, Scott

    2009-01-01

    This primer presents examples in the application of the SCALE/TSUNAMI tools to generate k{sub eff} sensitivity data for one- and three-dimensional models using TSUNAMI-1D and -3D and to examine uncertainties in the computed k{sub eff} values due to uncertainties in the cross-section data used in their calculation. The proper use of unit cell data and need for confirming the appropriate selection of input parameters through direct perturbations are described. The uses of sensitivity and uncertainty data to identify and rank potential sources of computational bias in an application system and TSUNAMI tools for assessment of system similarity using sensitivity and uncertainty criteria are demonstrated. Uses of these criteria in trending analyses to assess computational biases, bias uncertainties, and gap analyses are also described. Additionally, an application of the data adjustment tool TSURFER is provided, including identification of specific details of sources of computational bias.

  4. Initialization of Formation Flying Using Primer Vector Theory

    NASA Technical Reports Server (NTRS)

    Mailhe, Laurie; Schiff, Conrad; Folta, David

    2002-01-01

    In this paper, we extend primer vector analysis to formation flying. Optimization of the classical rendezvous or free-time transfer problem between two orbits using primer vector theory has been extensively studied for one spacecraft. However, an increasing number of missions are now considering flying a set of spacecraft in close formation. Missions such as the Magnetospheric MultiScale (MMS) and Leonardo-BRDF (Bidirectional Reflectance Distribution Function) need to determine strategies to transfer each spacecraft from the common launch orbit to their respective operational orbit. In addition, all the spacecraft must synchronize their states so that they achieve the same desired formation geometry over each orbit. This periodicity requirement imposes constraints on the boundary conditions that can be used for the primer vector algorithm. In this work we explore the impact of the periodicity requirement in optimizing each spacecraft transfer trajectory using primer vector theory. We first present our adaptation of primer vector theory to formation flying. Using this method, we then compute the AV budget for each spacecraft subject to different formation endpoint constraints.

  5. Primer design for PCR reactions in forensic biology.

    PubMed

    Elkins, Kelly M

    2015-01-01

    The polymerase chain reaction (PCR) is a popular method to copy DNA in vitro. Its invention revolutionized fields ranging from clinical medicine to anthropology, molecular biology, and forensic biology. The method employs one of many available heat-stable DNA polymerases in a reaction that is repeated many times in situ. The DNA polymerase reads a template DNA strand and using the components of the reaction mix, catalyzes the addition of free 2'-deoxynucleotide triphosphate nitrogenous bases to short segment of DNA that forms a complement with the template via Watson-Crick base pairing. This short segment of DNA is referred to as a PCR primer and it is essential to the success of the reaction. The most widely used application of PCR in forensic labs is the amplification of short tandem repeat (STR) loci used in DNA typing. The STRs are routinely evaluated in concert with 16 or more reactions, a multiplex, run in one test tube simultaneously. In a multiplex, it is essential that the primers work specifically and accurately on the intended reactions without hindering the other reactions. The primers, which are very specific, also can be used to probe single nucleotide polymorphisms (SNPs) in a DNA sequence of interest by single base extension. Primers are often designed using one of many available automated software packages. Here the process of manually designing PCR primers for forensic biology using no-cost software is described.

  6. PCR Primers for Metazoan Mitochondrial 12S Ribosomal DNA Sequences

    PubMed Central

    Machida, Ryuji J.; Kweskin, Matthew; Knowlton, Nancy

    2012-01-01

    Background Assessment of the biodiversity of communities of small organisms is most readily done using PCR-based analysis of environmental samples consisting of mixtures of individuals. Known as metagenetics, this approach has transformed understanding of microbial communities and is beginning to be applied to metazoans as well. Unlike microbial studies, where analysis of the 16S ribosomal DNA sequence is standard, the best gene for metazoan metagenetics is less clear. In this study we designed a set of PCR primers for the mitochondrial 12S ribosomal DNA sequence based on 64 complete mitochondrial genomes and then tested their efficacy. Methodology/Principal Findings A total of the 64 complete mitochondrial genome sequences representing all metazoan classes available in GenBank were downloaded using the NCBI Taxonomy Browser. Alignment of sequences was performed for the excised mitochondrial 12S ribosomal DNA sequences, and conserved regions were identified for all 64 mitochondrial genomes. These regions were used to design a primer pair that flanks a more variable region in the gene. Then all of the complete metazoan mitochondrial genomes available in NCBI's Organelle Genome Resources database were used to determine the percentage of taxa that would likely be amplified using these primers. Results suggest that these primers will amplify target sequences for many metazoans. Conclusions/Significance Newly designed 12S ribosomal DNA primers have considerable potential for metazoan metagenetic analysis because of their ability to amplify sequences from many metazoans. PMID:22536450

  7. Rapid and simple method of qPCR primer design.

    PubMed

    Thornton, Brenda; Basu, Chhandak

    2015-01-01

    Quantitative real-time polymerase chain reaction (qPCR) is a powerful tool for analysis and quantification of gene expression. It is advantageous compared to traditional gel-based method of PCR, as gene expression can be visualized "real-time" using a computer. In qPCR, a reporter dye system is used which intercalates with DNA's region of interest and detects DNA amplification. Some of the popular reporter systems used in qPCR are the following: Molecular Beacon(®), SYBR Green(®), and Taqman(®). However, success of qPCR depends on the optimal primers used. Some of the considerations for primer design are the following: GC content, primer self-dimer, or secondary structure formation. Freely available software could be used for ideal qPCR primer design. Here we have shown how to use some freely available web-based software programs (such as Primerquest(®), Unafold(®), and Beacon designer(®)) to design qPCR primers.

  8. ConservedPrimers 2.0: A high-throughput pipeline for comparative genome referenced intron-flanking PCR primer design and its application in wheat SNP discovery

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In some genomic applications it is necessary to design large numbers of PCR primers in exons flanking one or several introns on the basis of orthologous gene sequences in related species. The primer pairs designed by this target gene approach are called "intron-flanking primers" or because they ar...

  9. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    SciTech Connect

    Bowman, Stephen M

    2008-09-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  10. New cyt b gene universal primer set for forensic analysis.

    PubMed

    Lopez-Oceja, A; Gamarra, D; Borragan, S; Jiménez-Moreno, S; de Pancorbo, M M

    2016-07-01

    Analysis of mitochondrial DNA, and in particular the cytochrome b gene (cyt b), has become an essential tool for species identification in routine forensic practice. In cases of degraded samples, where the DNA is fractionated, universal primers that are highly efficient for the amplification of the target region are necessary. Therefore, in the present study a new universal cyt b primer set with high species identification capabilities, even in samples with highly degraded DNA, has been developed. In order to achieve this objective, the primers were designed following the alignment of complete sequences of the cyt b from 751 species from the Class of Mammalia listed in GenBank. A highly variable region of 148bp flanked by highly conserved sequences was chosen for placing the primers. The effectiveness of the new pair of primers was examined in 63 animal species belonging to 38 Families from 14 Orders and 5 Classes (Mammalia, Aves, Reptilia, Actinopterygii, and Malacostraca). Species determination was possible in all cases, which shows that the fragment analyzed provided a high capability for species identification. Furthermore, to ensure the efficiency of the 148bp fragment, the intraspecific variability was analyzed by calculating the concordance between individuals with the BLAST tool from the NCBI (National Center for Biotechnological Information). The intraspecific concordance levels were superior to 97% in all species. Likewise, the phylogenetic information from the selected fragment was confirmed by obtaining the phylogenetic tree from the sequences of the species analyzed. Evidence of the high power of phylogenetic discrimination of the analyzed fragment of the cyt b was obtained, as 93.75% of the species were grouped within their corresponding Orders. Finally, the analysis of 40 degraded samples with small-size DNA fragments showed that the new pair of primers permits identifying the species, even when the DNA is highly degraded as it is very common in

  11. A High Temperature Hermetic Primer and a Variable Spring Tester

    SciTech Connect

    Begeal, D.R.

    1994-05-01

    Percussion primers are used at Sandia to ignite energetic components such as pyrotechnic actuators and thermal batteries. This report describes a High Temperature Hermetic Primer (HTHP) that was developed to replace a previous G16 Percussion Primer Subassembly (Gl6PPS). The ignition mix in these primers is the same as in the discontinued Remington 44G16 (KC1O{sub 3}, SbS{sub 3}, and Ca{sub 2}Si). The HTHP has nearly the same sensitivity as the 44G16 and a significantly lower sensitivity than the G16PPS. In parallel with the HTHP development, we also designed a Variable Spring Tester (VST) to determine percussion primer ignition sensitivity with firing pins that have the same mass as those used in field applications. The tester is capable of accelerating firing pins over a velocity range of 100 to 600 inches per second for pins weighing up to 6 grams. The desired impulse can be preselected with an accuracy of better than {plus_minus}1%. The actual impulse is measured on every shot. The VST was characterized using the WW42Cl primer, as well as with the G16PPS and the HTHP. Compared to data from conventional ball drop testers, we found that ignition sensitivities were lower and there was less scatter in the sensitivity data. Our experiments indicate that ignition sensitivity is not strictly energy dependent, but also depends on the rate of deposition, or firing pin velocity in this case. Development results for the HTHP and Variable Spring Tester are discussed and design details are shown.

  12. New cyt b gene universal primer set for forensic analysis.

    PubMed

    Lopez-Oceja, A; Gamarra, D; Borragan, S; Jiménez-Moreno, S; de Pancorbo, M M

    2016-07-01

    Analysis of mitochondrial DNA, and in particular the cytochrome b gene (cyt b), has become an essential tool for species identification in routine forensic practice. In cases of degraded samples, where the DNA is fractionated, universal primers that are highly efficient for the amplification of the target region are necessary. Therefore, in the present study a new universal cyt b primer set with high species identification capabilities, even in samples with highly degraded DNA, has been developed. In order to achieve this objective, the primers were designed following the alignment of complete sequences of the cyt b from 751 species from the Class of Mammalia listed in GenBank. A highly variable region of 148bp flanked by highly conserved sequences was chosen for placing the primers. The effectiveness of the new pair of primers was examined in 63 animal species belonging to 38 Families from 14 Orders and 5 Classes (Mammalia, Aves, Reptilia, Actinopterygii, and Malacostraca). Species determination was possible in all cases, which shows that the fragment analyzed provided a high capability for species identification. Furthermore, to ensure the efficiency of the 148bp fragment, the intraspecific variability was analyzed by calculating the concordance between individuals with the BLAST tool from the NCBI (National Center for Biotechnological Information). The intraspecific concordance levels were superior to 97% in all species. Likewise, the phylogenetic information from the selected fragment was confirmed by obtaining the phylogenetic tree from the sequences of the species analyzed. Evidence of the high power of phylogenetic discrimination of the analyzed fragment of the cyt b was obtained, as 93.75% of the species were grouped within their corresponding Orders. Finally, the analysis of 40 degraded samples with small-size DNA fragments showed that the new pair of primers permits identifying the species, even when the DNA is highly degraded as it is very common in

  13. Complex Adaptive Systems of Systems (CASOS) engineering environment.

    SciTech Connect

    Detry, Richard Joseph; Linebarger, John Michael; Finley, Patrick D.; Maffitt, S. Louise; Glass, Robert John, Jr.; Beyeler, Walter Eugene; Ames, Arlo Leroy

    2012-02-01

    Complex Adaptive Systems of Systems, or CASoS, are vastly complex physical-socio-technical systems which we must understand to design a secure future for the nation. The Phoenix initiative implements CASoS Engineering principles combining the bottom up Complex Systems and Complex Adaptive Systems view with the top down Systems Engineering and System-of-Systems view. CASoS Engineering theory and practice must be conducted together to develop a discipline that is grounded in reality, extends our understanding of how CASoS behave and allows us to better control the outcomes. The pull of applications (real world problems) is critical to this effort, as is the articulation of a CASoS Engineering Framework that grounds an engineering approach in the theory of complex adaptive systems of systems. Successful application of the CASoS Engineering Framework requires modeling, simulation and analysis (MS and A) capabilities and the cultivation of a CASoS Engineering Community of Practice through knowledge sharing and facilitation. The CASoS Engineering Environment, itself a complex adaptive system of systems, constitutes the two platforms that provide these capabilities.

  14. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    SciTech Connect

    Lucas, D.S.

    2004-10-03

    This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

  15. Changes in Rous Sarcoma Virus RNA Secondary Structure near the Primer Binding Site upon tRNATrp Primer Annealing

    PubMed Central

    Morris, Shannon; Leis, Jonathan

    1999-01-01

    Predicted secondary-structure elements encompassing the primer binding site in the 5′ untranslated region of Rous sarcoma virus (RSV) RNA play an integral role in multiple viral replications steps including reverse transcription, DNA integration, and RNA packaging (A. Aiyar, D. Cobrinik, Z. Ge, H. J. Kung, and J. Leis, J. Virol. 66:2464–2472, 1992; D. Cobrinik, A. Aiyar, Z. Ge, M. Katzman, H. Huang, and J. Leis, J. Virol. 65:3864–3872, 1991; J. T. Miller, Z. Ge, S. Morris, K. Das, and J. Leis, J. Virol. 71:7648–7656, 1997). These elements include the U5-Leader stem, U5-IR stem-loop, and U5-TΨC interaction region. Limited digestion of the 5′ untranslated region of wild-type and mutant RSV RNAs with structure- and/or sequence-specific RNases detects the presence of the U5-Leader stem and the U5-IR stem-loop. When a tRNATrp primer is annealed to wild-type RNAs in vitro, limited nuclease mapping indicates that the U5-IR stem becomes partially unwound. This is not observed when mutant RNAs with altered U5-IR stem-loop structures are substituted for wild-type RNAs. The U5-Leader stem also becomes destabilized when the tRNA primer is annealed to either wild-type or mutant RNA fragments. Nuclease mapping studies of tRNATrp, as well as the viral RNA, indicate that the U5-TΨC helix does form in vitro upon primer annealing. Collectively, these data suggest that the various structural elements near the RSV primer binding site undergo significant changes during the process of primer annealing. PMID:10400722

  16. A Primer on Fresh Water: The Environmental Citizenship Series.

    ERIC Educational Resources Information Center

    Environment Canada, Ottawa (Ontario).

    Water is the lifeblood of the environment as no organisms can survive without it. This reference booklet is designed to help people make environmentally responsible decisions. The primer is targeted at the general public (grade 8 to post-secondary) to be used by educators, communities and organizations as well as individuals, as part of a learning…

  17. Depth profiles and free volume in aircraft primer films

    NASA Astrophysics Data System (ADS)

    Van Horn, J. D.; Chen, H.; Jean, Y. C.; Zhang, W.; Jaworowski, M. R.

    2015-06-01

    Positron annihilation lifetime spectroscopy (PALS) and associated techniques provide non-destructive methods to study the free volume inside polymeric materials, and to study material characteristics over a depth profile. Cast free films of organic- or aqueous-based, non-chromated aerospace primers, when cured for about one week, had very different water vapour transport (through-plane) behaviour. In addition, both types of primer films showed strong anisotropic behaviour in in-plane versus through-plane water vapour transport rates. We report the differences between the organic- and aqueous-based aircraft primer films samples and their surface depth profiles. In bulk PALS measurements, an aged, organic-based film exhibited typical lifetimes and intensities for a particulate-containing polymer film on both faces. In contrast, aqueous-based films exhibited face oriented-dependent differences. In all aqueous- based samples, the I3 value of the back of the sample was smaller. The primer film samples were also evaluated with mono-energetic positron beam techniques to generate depth profile information. The heterogeneity in the samples was verified by Doppler broadening of energy spectroscopy (DBES). A model for the differences in the faces of the films, and their layered structure is discussed.

  18. Children on Medication: A Primer for School Personnel.

    ERIC Educational Resources Information Center

    Gadow, Kenneth D.

    Intended as a primer for school personnel, the book discusses children whose various disorders require them to be on medication, and describes the behavioral effects of these drugs along with their major side effects. Fundamental concepts in pharmacotherapy are reviewed, including dosage adjustment and side effects, and a brief introduction to the…

  19. Exploding the Myths about DETC Accreditation: A Primer for Students

    ERIC Educational Resources Information Center

    Distance Education and Training Council, 2011

    2011-01-01

    Prospective distance education students are faced with a bewildering number of choices in selecting an institution that is best suited to achieving their educational goals. They also face a confusing forest of institutions' promotional claims of being the best or most respected school. This primer is intended to help the prospective student of an…

  20. Controlling Air Pollution; A Primer on Stationary Source Control Techniques.

    ERIC Educational Resources Information Center

    Corman, Rena

    This companion document to "Air Pollution Primer" is written for the nonexpert in air pollution; however, it does assume a familiarity with air pollution problems. This work is oriented toward providing the reader with knowledge about current and proposed air quality legislation and knowledge about available technology to meet these standards for…

  1. Zip Pak for Pre-Primer Reading Level (Teacher's Manual).

    ERIC Educational Resources Information Center

    Scott, Norval C., Comp.

    The Zip Pak for the pre-primer reading level was developed for use with migrant Mexican American children with reading deficiencies. Its goals are to: (1) increase and widen the child's ability to be selective in choosing his information and selecting information pertinent to a purpose; and (2) improve the child's ability to make decisions,…

  2. Zip Pak for Pre-Primer Reading Level.

    ERIC Educational Resources Information Center

    Scott, Norval C., Comp.

    The Zip Pak for the pre-primer reading level was developed for use with migrant Mexican American children who have reading deficiencies. The area of failure with these children has not been with the visual discrimination involved in decoding, but with the interpretation of the material to be decoded. Therefore, the 5 lessons in this student…

  3. Philosophical Foundations: A Primer for Adult Continuing Education.

    ERIC Educational Resources Information Center

    Rampp, Lary C., Ed.; Guffey, J. Stephen, Ed.

    This document, which is intended as a primer for adult continuing education, contains 11 chapters examining the philosophical foundations of adult and continuing education. The chapter titles and authors are as follows: "Progressivism and Adult Continuing Education" (Michael Day); "Progressivism: An Anthology" (Andrea Reeve); "Progressivism;…

  4. 5. LOOKING NORTH TOWARD BARRICADES AROUND BUILDING NO. 230, PRIMER ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    5. LOOKING NORTH TOWARD BARRICADES AROUND BUILDING NO. 230, PRIMER AND DETONATOR LOADING BUILDING. BARRICADES DIRECT FORCE OF BLAST UPWARD IN THE EVENT OF AN EXPLOSION. - Picatinny Arsenal, 200 Area, Shell Component Loading, State Route 15 near I-80, Dover, Morris County, NJ

  5. Computer Terminals and Terminology Made Easy! A Primer.

    ERIC Educational Resources Information Center

    Penny, Judith H.

    Designed to make computer users comfortable with both computers and user/reference manual instructions before they have hands-on training, this primer is an introduction to computer concepts, devices, and terms. Common questions related to learning about data processing are addressed, and the following topics are covered: captured data; reports;…

  6. Factor Scores, Structure and Communality Coefficients: A Primer

    ERIC Educational Resources Information Center

    Odum, Mary

    2011-01-01

    (Purpose) The purpose of this paper is to present an easy-to-understand primer on three important concepts of factor analysis: Factor scores, structure coefficients, and communality coefficients. Given that statistical analyses are a part of a global general linear model (GLM), and utilize weights as an integral part of analyses (Thompson, 2006;…

  7. Sequence-specific DNA primer effects on telomerase polymerization activity.

    PubMed Central

    Lee, M S; Blackburn, E H

    1993-01-01

    The ribonucleoprotein enzyme telomerase synthesizes one strand of telomeric DNA by copying a template sequence within the RNA moiety of the enzyme. Kinetic studies of this polymerization reaction were used to analyze the mechanism and properties of the telomerase from Tetrahymena thermophila. This enzyme synthesizes TTGGGG repeats, the telomeric DNA sequence of this species, by elongating a DNA primer whose 3' end base pairs with the template-forming domain of the RNA. The enzyme was found to act nonprocessively with short (10- to 12-nucleotide) primers but to become processive as TTGGGG repeats were added. Variation of the 5' sequences of short primers with a common 3' end identified sequence-specific effects which are distinct from those involving base pairing of the 3' end of the primer with the RNA template and which can markedly induce enzyme activity by increasing the catalytic rate of the telomerase polymerization reaction. These results identify an additional mechanistic basis for telomere and DNA end recognition by telomerase in vivo. Images PMID:8413255

  8. Improved primer for bonding polyurethane adhesives to metals

    NASA Technical Reports Server (NTRS)

    Constanza, L. J.

    1969-01-01

    Primer ensures effective bonding integrity of polyurethane adhesives on metal surfaces at temperatures ranging from minus 423 degrees to plus 120 degrees F. It provides greater metal surface protection and bond strengths over this temperature range than could be attained with other adhesive systems.

  9. Deeper Learning: A Primer for State Legislators. ECS Education Trends

    ERIC Educational Resources Information Center

    Aragon, Stephanie

    2015-01-01

    A growing number of schools across the country are working hard to provide a "deeper" learning experience for their students, and state legislators are being asked to create policies that support wide-scale implementation of 21st century learning practices. This primer is created for state policymakers seeking to modify instruction and…

  10. Barcoded primers used in multiplex amplicon pyrosequencing bias amplification.

    PubMed

    Berry, David; Ben Mahfoudh, Karim; Wagner, Michael; Loy, Alexander

    2011-11-01

    "Barcode-tagged" PCR primers used for multiplex amplicon sequencing generate a thus-far-overlooked amplification bias that produces variable terminal restriction fragment length polymorphism (T-RFLP) and pyrosequencing data from the same environmental DNA template. We propose a simple two-step PCR approach that increases reproducibility and consistently recovers higher genetic diversity in pyrosequencing libraries. PMID:21890669

  11. Blood Donation and Transfusion: A Primer for Health Educators.

    ERIC Educational Resources Information Center

    Felts, W. Michael; Glascoff, Mary A.

    1991-01-01

    Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)

  12. Method to amplify variable sequences without imposing primer sequences

    DOEpatents

    Bradbury, Andrew M.; Zeytun, Ahmet

    2006-11-14

    The present invention provides methods of amplifying target sequences without including regions flanking the target sequence in the amplified product or imposing amplification primer sequences on the amplified product. Also provided are methods of preparing a library from such amplified target sequences.

  13. primers4clades: a web server that uses phylogenetic trees to design lineage-specific PCR primers for metagenomic and diversity studies

    PubMed Central

    Contreras-Moreira, Bruno; Sachman-Ruiz, Bernardo; Figueroa-Palacios, Iraís; Vinuesa, Pablo

    2009-01-01

    Primers4clades is an easy-to-use web server that implements a fully automatic PCR primer design pipeline for cross-species amplification of novel sequences from metagenomic DNA, or from uncharacterized organisms, belonging to user-specified phylogenetic clades or taxa. The server takes a set of non-aligned protein coding genes, with or without introns, aligns them and computes a neighbor-joining tree, which is displayed on screen for easy selection of species or sequence clusters to design lineage-specific PCR primers. Primers4clades implements an extended CODEHOP primer design strategy based on both DNA and protein multiple sequence alignments. It evaluates several thermodynamic properties of the oligonucleotide pairs, and computes the phylogenetic information content of the predicted amplicon sets from Shimodaira–Hasegawa-like branch support values of maximum likelihood phylogenies. A non-redundant set of primer formulations is returned, ranked according to their thermodynamic properties. An amplicon distribution map provides a convenient overview of the coverage of the target locus. Altogether these features greatly help the user in making an informed choice between alternative primer pair formulations. Primers4clades is available at two mirror sites: http://maya.ccg.unam.mx/primers4clades/and http://floresta.eead.csic.es/primers4clades/. Three demo data sets and a comprehensive documentation/tutorial page are provided for easy testing of the server's capabilities and interface. PMID:19465390

  14. primers4clades: a web server that uses phylogenetic trees to design lineage-specific PCR primers for metagenomic and diversity studies.

    PubMed

    Contreras-Moreira, Bruno; Sachman-Ruiz, Bernardo; Figueroa-Palacios, Iraís; Vinuesa, Pablo

    2009-07-01

    Primers4clades is an easy-to-use web server that implements a fully automatic PCR primer design pipeline for cross-species amplification of novel sequences from metagenomic DNA, or from uncharacterized organisms, belonging to user-specified phylogenetic clades or taxa. The server takes a set of non-aligned protein coding genes, with or without introns, aligns them and computes a neighbor-joining tree, which is displayed on screen for easy selection of species or sequence clusters to design lineage-specific PCR primers. Primers4clades implements an extended CODEHOP primer design strategy based on both DNA and protein multiple sequence alignments. It evaluates several thermodynamic properties of the oligonucleotide pairs, and computes the phylogenetic information content of the predicted amplicon sets from Shimodaira-Hasegawa-like branch support values of maximum likelihood phylogenies. A non-redundant set of primer formulations is returned, ranked according to their thermodynamic properties. An amplicon distribution map provides a convenient overview of the coverage of the target locus. Altogether these features greatly help the user in making an informed choice between alternative primer pair formulations. Primers4clades is available at two mirror sites: http://maya.ccg.unam.mx/primers4clades/and http://floresta.eead.csic.es/primers4clades/. Three demo data sets and a comprehensive documentation/tutorial page are provided for easy testing of the server's capabilities and interface.

  15. White primer permits a corrosion-resistant coating of minimum weight

    NASA Technical Reports Server (NTRS)

    Albrecht, R. H.; Jensen, D. P.; Schnake, P.

    1966-01-01

    White primer for coating 2219 aluminum alloy supplies a base for a top coating of enamel. A formulation of pigments and vehicle results in a primer with high corrosion resistance and minimum film thickness.

  16. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    SciTech Connect

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-09-27

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  17. Recombination of polynucleotide sequences using random or defined primers

    DOEpatents

    Arnold, Frances H.; Shao, Zhixin; Affholter, Joseph A.; Zhao, Huimin H; Giver, Lorraine J.

    2000-01-01

    A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.

  18. Recombination of polynucleotide sequences using random or defined primers

    DOEpatents

    Arnold, Frances H.; Shao, Zhixin; Affholter, Joseph A.; Zhao, Huimin; Giver, Lorraine J.

    2001-01-01

    A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.

  19. [Screening of peafowl microsatellite primers and analysis of genetic diversity].

    PubMed

    Bao, Wen-Bin; Chen, Guo-Hong; Shu, Jing-Ting; Xu, Qi; Li, Hui-Fang

    2006-10-01

    The applicability of chicken microsatellite primers to peafowl population was analyzed in the present paper, and the results showed 14 of 29 pairs of microsatellite primers from chicken could amplify peafowl DNA and produce specific allele patterns. A mean of 1.71 alleles was found for each locus. Seven pairs were highly polymorphic, and MCW0080 and MCW0098 were ideal markers for peafowl. Genetic diversity analysis within and between the green peafowl and the blue peafowl populations demonstrated that the expected heterozygosity of two peafowl populations were 0.2482 and 0.2744, respectively. The inbreeding index (FST), Reynolds' genetic distance and gene flow between the two populations were 0.078, 0.0603 and 3.896 respectively. These results indicate that the heterozygosity and the genetic diversity of these two peafowl populations were very low, and suggest a tendency towards intermixing.

  20. Stability of the high-temperature G-16 primer composition

    SciTech Connect

    Durand, N.A.; Weinmaster, R.R.; Massis, T.A.; Fleming, W.

    1988-01-01

    The stability of the G-16 pyrotechnic primer mixture of antimony sulfide, calcium silicide, and potassium chlorate was studied at temperatures up to 200/sup 0/C in sealed and open environments. Data have shown that this mixture is stable in open environments at 200/sup 0/C for up to 48 hours. However, in sealed, limited volume environments, the mixture completely decomposes within 24 hours at 200/sup 0/C. In sealed environments, the mixture shows stability with copper present. Both functional testing and chemical analysis were used to evaluate the primer composition after temperature exposure. The degree of degradation of the mixture was determined from the concentration of final reaction products (sulfate and chloride ions), using ion chromatography. When copper was present, the intermediate reaction products were scavenged by the copper, and the degradation was reduced. The role of copper in the reaction was verified with differential scanning calorimetry and surface analysis. 3 refs., 9 figs., 2 tabs.

  1. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    SciTech Connect

    A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson

    1998-12-10

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  2. [Screening of peafowl microsatellite primers and analysis of genetic diversity].

    PubMed

    Bao, Wen-Bin; Chen, Guo-Hong; Shu, Jing-Ting; Xu, Qi; Li, Hui-Fang

    2006-10-01

    The applicability of chicken microsatellite primers to peafowl population was analyzed in the present paper, and the results showed 14 of 29 pairs of microsatellite primers from chicken could amplify peafowl DNA and produce specific allele patterns. A mean of 1.71 alleles was found for each locus. Seven pairs were highly polymorphic, and MCW0080 and MCW0098 were ideal markers for peafowl. Genetic diversity analysis within and between the green peafowl and the blue peafowl populations demonstrated that the expected heterozygosity of two peafowl populations were 0.2482 and 0.2744, respectively. The inbreeding index (FST), Reynolds' genetic distance and gene flow between the two populations were 0.078, 0.0603 and 3.896 respectively. These results indicate that the heterozygosity and the genetic diversity of these two peafowl populations were very low, and suggest a tendency towards intermixing. PMID:17035182

  3. Primer and interviews: Molecular mechanisms of morphological evolution

    PubMed Central

    Kiefer, Julie C

    2010-01-01

    The beauty of the developing embryo, and the awe that it inspires, lure many scientists into the field of developmental biology. What compels cells to divide, migrate, and morph into a being with a complex body plan? Evolutionary developmental biologists hold similar fascinations, with dynamics that take place on a grander timescale. How do phenotypic traits diverge over evolutionary time? This primer illustrates how a deep understanding of the basic principles that underlie developmental biology have changed how scientists think about the evolution of body form. The primer culminates in a conversation with David Stern, PhD, and Michael Shapiro, PhD, who discuss current topics in morphological evolution, why the field should be of interest to classic developmental biologists, and what lies ahead. Developmental Dynamics 239:3497–3505, 2010. © 2010 Wiley-Liss, Inc. PMID:21069831

  4. Small Commercial Building Re-tuning: A Primer

    SciTech Connect

    Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas

    2013-09-30

    To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

  5. Primer on Molecular Genetics; DOE Human Genome Program

    DOE R&D Accomplishments Database

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  6. Primer on molecular genetics. DOE Human Genome Program

    SciTech Connect

    Not Available

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  7. Primer initiation and extension by T7 DNA primase

    PubMed Central

    Qimron, Udi; Lee, Seung-Joo; Hamdan, Samir M; Richardson, Charles C

    2006-01-01

    T7 DNA primase is composed of a catalytic RNA polymerase domain (RPD) and a zinc-binding domain (ZBD) connected by an unstructured linker. The two domains are required to initiate the synthesis of the diribonucleotide pppAC and its extension into a functional primer pppACCC (de novo synthesis), as well as for the extension of exogenous AC diribonucleotides into an ACCC primer (extension synthesis). To explore the mechanism underlying the RPD and ZBD interactions, we have changed the length of the linker between them. Wild-type T7 DNA primase is 10-fold superior in de novo synthesis compared to T7 DNA primase having a shorter linker. However, the primase having the shorter linker exhibits a two-fold enhancement in its extension synthesis. T7 DNA primase does not catalyze extension synthesis by a ZBD of one subunit acting on a RPD of an adjacent subunit (trans mode), whereas de novo synthesis is feasible in this mode. We propose a mechanism for primer initiation and extension based on these findings. PMID:16642036

  8. Primer initiation and extension by T7 DNA primase.

    PubMed

    Qimron, Udi; Lee, Seung-Joo; Hamdan, Samir M; Richardson, Charles C

    2006-05-17

    T7 DNA primase is composed of a catalytic RNA polymerase domain (RPD) and a zinc-binding domain (ZBD) connected by an unstructured linker. The two domains are required to initiate the synthesis of the diribonucleotide pppAC and its extension into a functional primer pppACCC (de novo synthesis), as well as for the extension of exogenous AC diribonucleotides into an ACCC primer (extension synthesis). To explore the mechanism underlying the RPD and ZBD interactions, we have changed the length of the linker between them. Wild-type T7 DNA primase is 10-fold superior in de novo synthesis compared to T7 DNA primase having a shorter linker. However, the primase having the shorter linker exhibits a two-fold enhancement in its extension synthesis. T7 DNA primase does not catalyze extension synthesis by a ZBD of one subunit acting on a RPD of an adjacent subunit (trans mode), whereas de novo synthesis is feasible in this mode. We propose a mechanism for primer initiation and extension based on these findings.

  9. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    SciTech Connect

    D. S. Lucas

    2004-10-01

    A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com.

  10. Sensory reception of the primer pheromone ethyl oleate

    NASA Astrophysics Data System (ADS)

    Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

    2012-05-01

    Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

  11. Transferability of retrotransposon primers derived from Persimmon (Diospyros kaki Thunb.) across other plant species.

    PubMed

    Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R

    2013-06-06

    Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.

  12. Environmental DNA sequencing primers for eutardigrades and bdelloid rotifers

    PubMed Central

    2009-01-01

    Background The time it takes to isolate individuals from environmental samples and then extract DNA from each individual is one of the problems with generating molecular data from meiofauna such as eutardigrades and bdelloid rotifers. The lack of consistent morphological information and the extreme abundance of these classes makes morphological identification of rare, or even common cryptic taxa a large and unwieldy task. This limits the ability to perform large-scale surveys of the diversity of these organisms. Here we demonstrate a culture-independent molecular survey approach that enables the generation of large amounts of eutardigrade and bdelloid rotifer sequence data directly from soil. Our PCR primers, specific to the 18s small-subunit rRNA gene, were developed for both eutardigrades and bdelloid rotifers. Results The developed primers successfully amplified DNA of their target organism from various soil DNA extracts. This was confirmed by both the BLAST similarity searches and phylogenetic analyses. Tardigrades showed much better phylogenetic resolution than bdelloids. Both groups of organisms exhibited varying levels of endemism. Conclusion The development of clade-specific primers for characterizing eutardigrades and bdelloid rotifers from environmental samples should greatly increase our ability to characterize the composition of these taxa in environmental samples. Environmental sequencing as shown here differs from other molecular survey methods in that there is no need to pre-isolate the organisms of interest from soil in order to amplify their DNA. The DNA sequences obtained from methods that do not require culturing can be identified post-hoc and placed phylogenetically as additional closely related sequences are obtained from morphologically identified conspecifics. Our non-cultured environmental sequence based approach will be able to provide a rapid and large-scale screening of the presence, absence and diversity of Bdelloidea and Eutardigrada in

  13. Steel Primer Chamber Assemblies for Dual Initiated Pyrovalves

    NASA Technical Reports Server (NTRS)

    Guemsey, Carl S.; Mizukami, Masashi; Zenz, Zac; Pender, Adam A.

    2009-01-01

    A solution was developed to mitigate the potential risk of ignition failures and burn-through in aluminum primer chamber assemblies on pyrovalves. This was accomplished by changing the assembly material from aluminum to steel, and reconfiguration of flame channels to provide more direct paths from initiators to boosters. With the geometric configuration of the channels changed, energy is more efficiently transferred from the initiators to the boosters. With the alloy change to steel, the initiator flame channels do not erode upon firing, eliminating the possibility of burn-through. Flight qualification tests have been successfully passed.

  14. Adhesion of epoxy primer to hydrotalcite conversion coated AA2024

    NASA Astrophysics Data System (ADS)

    Leggat, Robert Benton, III

    Hydrotalcite-based (HT) conversion coatings are being developed as an environmentally benign alternative to chromate conversion coatings (CCC). Accelerated exposure tests were conducted on epoxy primed, HT-modified AA2024 to gauge service performance. HT-based conversion coatings did not perform as well as the CCC when used with an epoxy primer. The current HT chemistries are optimized for stand-alone corrosion protection, however additional research into the primer/HT interactions is necessary before they can be implemented within a coating scheme. The relative contribution of mechanical and physico-chemical interactions in controlling adhesion has been investigated in this study. Practical adhesion tests were used to assess the dry and wet bond strength of epoxy primer on HT coatings using the pull-off tensile strength (POTS) as the figure of merit. The practical adhesion of HT coated samples generally fell between that observed for the CCC and bare AA2024. Laboratory testing was done to assess the physical and chemical properties of HT coatings. Contact angle measurements were performed using powders representative of different HT chemistries to evaluate the dispersive and acid-base character of the surface. The wet POTS correlated with the electrodynamic (dipole + dispersive) parameter of the surface tension. The HT surfaces were found to be predominantly basic. Given the basicity of epoxy, these results indicate that increasing the acidic character of HT coatings may increase the adhesion performance. This was supported by electrokinetic measurements in which the dry POTS was found to increase with decreasing conversion coating iso-electric point. The correlations with the dry and wet state adhesion are interpreted as indicating that dry state adhesion is optimized by minimizing unfavorable polar interactions between the basic epoxy and HT interfaces. Wet state adhesion, where polar interactions are disrupted, is dictated by non-polar bonding. FTIR

  15. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    SciTech Connect

    Weber, James R.; Schell, Charlotte J.; Marino, T; Bilyard, Gordon R.

    2004-02-10

    This version of the communication primer comprises two interlocking parts: Pat 1, a practical section, intended to prepare you for public interactions, and Part 2, a theoretical section that provides social and technical bases for the practices recommended in Part 1. The mutual support of practice and theory is very familiar in science and clearly requires a willingness to observe and revise our prior assumptions--in this document, we invoke both. We hope that is offering will represent a step both towards improving practice and maturing the theory of practical science communication.

  16. A NASTRAN primer for the analysis of rotating flexible blades

    NASA Technical Reports Server (NTRS)

    Lawrence, Charles; Aiello, Robert A.; Ernst, Michael A.; Mcgee, Oliver G.

    1987-01-01

    This primer provides documentation for using MSC NASTRAN in analyzing rotating flexible blades. The analysis of these blades includes geometrically nonlinear (large displacement) analysis under centrifugal loading, and frequency and mode shape (normal modes) determination. The geometrically nonlinear analysis using NASTRAN Solution sequence 64 is discussed along with the determination of frequencies and mode shapes using Solution Sequence 63. A sample problem with the complete NASTRAN input data is included. Items unique to rotating blade analyses, such as setting angle and centrifugal softening effects are emphasized.

  17. Whole genome amplification using single-primer PCR.

    PubMed

    Lao, Kaiqin; Xu, Nan Lan; Straus, Neil A

    2008-03-01

    Comprehensive genomic molecular analyses require relatively large DNA amounts that are often not available from forensic, clinical and other crucial biological samples. Numerous methods to amplify the whole genome have been proposed for cancer, forensic and taxonomic research. Unfortunately, when using truly random primers for the initial priming step, all of these procedures suffer from high background problems for sub-nanogram quantities of input DNA. Here we report an approach to eliminate this problem for PCR-based methods even at levels of DNA approaching that of a single cell.

  18. Exciton Primer-mediated SNP detection in SmartAmp2 reactions.

    PubMed

    Lezhava, Alexander; Ishidao, Takefumi; Ishizu, Yuri; Naito, Kana; Hanami, Takeshi; Katayama, Atsuko; Kogo, Yasushi; Soma, Takahiro; Ikeda, Shuji; Murakami, Kayoko; Nogawa, Chihiro; Itoh, Masayoshi; Mitani, Yasumasa; Harbers, Matthias; Okamoto, Akimitsu; Hayashizaki, Yoshihide

    2010-02-01

    Most commonly used intercalating fluorescent dyes in DNA detection are lacking any sequence specificity, whereas so-called Exciton Primers can overcome this limitation by functioning as "sequence-specific dyes." After hybridization to complementary sequences, the fluorescence of Exciton Primers provides sequence-specific signals for real-time monitoring of amplification reactions. Applied to the SmartAmp2 mutation detection process, Exciton Primers show high signal strength with low background leading to a superior specificity and sensitivity compared to SYBR Green I. Signal strength can be further enhanced using multiple dyes within one Exciton Primer or use of multiple Exciton Primers in the same amplification reaction. Here we demonstrate the use of Exciton Primers for genotyping a single nucleotide polymorphism (SNP) in the VKORC1 locus (-1639G>A) relevant for Warfarin dosing as an example for Exciton Primers mediated genotyping by SmartAmp2. The genotyping assay can use only one labeled Exciton Primer for endpoint detection, or simultaneously by real-time monitoring detect wild-type and mutant alleles in a one-tube reaction using two Exciton Primers having different dyes. Working directly from blood samples, Exciton Primer mediated genotyping by SmartAmp2 offers superior solutions for rapid point-of-care testing.

  19. Development of a unique polyurethane primer/topcoat

    NASA Technical Reports Server (NTRS)

    Novak, Howard L.; Klotz, James M.

    1994-01-01

    USBI Company, a Division of Pratt & Whitney Government Engines and Space Propulsion, is involved in corrosion and environmental research and development activities both at their headquarters in Huntsville, Alabama and their Florida Operations at Kennedy Space Center, Florida. The programs involve the development of environmentally compatible materials that improve the corrosion protection of expensive Solid Rocket Boosters (SRB) that are part of the Space Shuttle systems developed and managed by Marshall Space Flight Center in Huntsville, Alabama. Coatings For Industry, a paint manufacturer in Souderton, PA helped formulate and produce the first lot of BOOSTERCOAT paint. High strength aluminum aerospace flight hardware exposed to harsh seacoast environments and seawater immersion presently uses high volatile organic compound (VOC) chromated and lead bearing primers and epoxy topcoats for corrosion protection. Epoxy paint tends to be brittle and has relatively low ultraviolet (UV) exposure resistance. A unique, environmentally compatible, non-leaded/non-chromated, low VOC polyurethane single coat (primer/topcoat) trade named BOOSTERCOAT has been developed for excellent corrosion protection, flexibility, adhesion, chemical and solvent resistance properties. This report will discuss the development of BOOSTERCOAT and the potential opportunities for commercial use in the energy, transportation, chemical, maritime, structural fields.

  20. FullSSR: Microsatellite Finder and Primer Designer

    PubMed Central

    Metz, Sebastián; Cabrera, Juan Manuel; Rueda, Eva; Giri, Federico; Amavet, Patricia

    2016-01-01

    Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR) loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user. PMID:27366148

  1. Primer for evaluating ecological risk at petroleum release sites.

    PubMed

    Claff, R

    1999-02-01

    Increasingly, risk-based approaches are being used to guide decision making at sites such as service stations and petroleum product terminals, where petroleum products have been inadvertently released to the soil. For example, the API Decision Support System software, DSS, evaluates site human health risk along six different routes of exposure. The American Society for Testing and Materials' Risk-Based Corrective Action (RBCA) standard, ASTM 1739, establishes a tiered framework for evaluating petroleum release sites on the basis of human health risk. Though much of the risk assessment focus has been on human health risk, regulatory agencies recognize that protection of human health may not fully protect the environment; and EPA has developed guidance on identifying ecological resources to be protected through risk-based decision making. Not every service station or petroleum product terminal site warrants a detailed ecological risk assessment. In some cases, a simple preliminary assessment will provide sufficient information for decision making. Accordingly, the American Petroleum Institute (API) is developing a primer for site managers, to assist them in conducting this preliminary assessment, and in deciding whether more detailed ecological risk assessments are warranted. The primer assists the site manager in identifying relevant ecological receptors and habitats, in identifying chemicals and exposure pathways of concern, in developing a conceptual model of the site to guide subsequent actions, and in identifying conditions that may warrant immediate response. PMID:10189585

  2. FullSSR: Microsatellite Finder and Primer Designer.

    PubMed

    Metz, Sebastián; Cabrera, Juan Manuel; Rueda, Eva; Giri, Federico; Amavet, Patricia

    2016-01-01

    Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR) loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.

  3. Primer for evaluating ecological risk at petroleum release sites.

    PubMed

    Claff, R

    1999-02-01

    Increasingly, risk-based approaches are being used to guide decision making at sites such as service stations and petroleum product terminals, where petroleum products have been inadvertently released to the soil. For example, the API Decision Support System software, DSS, evaluates site human health risk along six different routes of exposure. The American Society for Testing and Materials' Risk-Based Corrective Action (RBCA) standard, ASTM 1739, establishes a tiered framework for evaluating petroleum release sites on the basis of human health risk. Though much of the risk assessment focus has been on human health risk, regulatory agencies recognize that protection of human health may not fully protect the environment; and EPA has developed guidance on identifying ecological resources to be protected through risk-based decision making. Not every service station or petroleum product terminal site warrants a detailed ecological risk assessment. In some cases, a simple preliminary assessment will provide sufficient information for decision making. Accordingly, the American Petroleum Institute (API) is developing a primer for site managers, to assist them in conducting this preliminary assessment, and in deciding whether more detailed ecological risk assessments are warranted. The primer assists the site manager in identifying relevant ecological receptors and habitats, in identifying chemicals and exposure pathways of concern, in developing a conceptual model of the site to guide subsequent actions, and in identifying conditions that may warrant immediate response.

  4. FullSSR: Microsatellite Finder and Primer Designer.

    PubMed

    Metz, Sebastián; Cabrera, Juan Manuel; Rueda, Eva; Giri, Federico; Amavet, Patricia

    2016-01-01

    Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR) loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user. PMID:27366148

  5. New Primers for Discovering Fungal Diversity Using Nuclear Large Ribosomal DNA.

    PubMed

    Asemaninejad, Asma; Weerasuriya, Nimalka; Gloor, Gregory B; Lindo, Zoë; Thorn, R Greg

    2016-01-01

    Metabarcoding has become an important tool in the discovery of biodiversity, including fungi, which are the second most speciose group of eukaryotes, with diverse and important ecological roles in terrestrial ecosystems. We have designed and tested new PCR primers that target the D1 variable region of nuclear large subunit (LSU) ribosomal DNA; one set that targets the phylum Ascomycota and another that recovers all other fungal phyla. The primers yield amplicons compatible with the Illumina MiSeq platform, which is cost-effective and has a lower error rate than other high throughput sequencing platforms. The new primer set LSU200A-F/LSU476A-R (Ascomycota) yielded 95-98% of reads of target taxa from environmental samples, and primers LSU200-F/LSU481-R (all other fungi) yielded 72-80% of target reads. Both primer sets have fairly low rates of data loss, and together they cover a wide variety of fungal taxa. We compared our results with these primers by amplifying and sequencing a subset of samples using the previously described ITS3_KYO2/ITS4_KYO3 primers, which amplify the internal transcribed spacer 2 (ITS2) of Ascomycota and Basidiomycota. With approximately equivalent read depth, our LSU primers recovered a greater number and phylogenetic diversity of sequences than the ITS2 primers. For instance, ITS3_KYO2/ITS4_KYO3 primers failed to pick up any members of Eurotiales, Mytilinidiales, Pezizales, Saccharomycetales, or Venturiales within Ascomycota, or members of Exobasidiomycetes, Microbotryomycetes, Pucciniomycetes, or Tremellomycetes within Basidiomycota, which were retrieved in good numbers from the same samples by our LSU primers. Among the OTUs recovered using the LSU primers were 127 genera and 28 species that were not obtained using the ITS2 primers, although the ITS2 primers recovered 10 unique genera and 16 species that were not obtained using either of the LSU primers These features identify the new primer sets developed in this study as useful

  6. A Tale of Tails: Dissecting the Enhancing Effect of Tailed Primers in Real-Time PCR

    PubMed Central

    Vandenbussche, Frank; Mathijs, Elisabeth; Lefebvre, David; De Clercq, Kris; Van Borm, Steven

    2016-01-01

    Non-specific tail sequences are often added to the 5’-terminus of primers to improve the robustness and overall performance of diagnostic assays. Despite the widespread use of tailed primers, the underlying working mechanism is not well understood. To address this problem, we conducted a detailed in vitro and in silico analysis of the enhancing effect of primer tailing on 2 well-established foot-and-mouth disease virus (FMDV) RT-qPCR assays using an FMDV reference panel. Tailing of the panFMDV-5UTR primers mainly affected the shape of the amplification curves. Modelling of the raw fluorescence data suggested a reduction of the amplification efficiency due to the accumulation of inhibitors. In depth analysis of PCR products indeed revealed the rapid accumulation of forward-primer derived artefacts. More importantly, tailing of the forward primer delayed artefacts formation and concomitantly restored the sigmoidal shape of the amplification curves. Our analysis also showed that primer tailing can alter utilisation patterns of degenerate primers and increase the number of primer variants that are able to participate in the reaction. The impact of tailed primers was less pronounced in the panFMDV-3D assay with only 5 out of 50 isolates showing a clear shift in Cq values. Sequence analysis of the target region of these 5 isolates revealed several mutations in the inter-primer region that extend an existing hairpin structure immediately downstream of the forward primer binding site. Stabilisation of the forward primer with either a tail sequence or cationic spermine units restored the sensitivity of the assay, which suggests that the enhancing effect in the panFMDV-3D assay is due to a more efficient extension of the forward primer. ur results show that primer tailing can alter amplification through various mechanisms that are determined by both the assay and target region. These findings expand our understanding of primer tailing and should enable a more targeted and

  7. New Primers for Discovering Fungal Diversity Using Nuclear Large Ribosomal DNA

    PubMed Central

    Gloor, Gregory B.; Lindo, Zoë

    2016-01-01

    Metabarcoding has become an important tool in the discovery of biodiversity, including fungi, which are the second most speciose group of eukaryotes, with diverse and important ecological roles in terrestrial ecosystems. We have designed and tested new PCR primers that target the D1 variable region of nuclear large subunit (LSU) ribosomal DNA; one set that targets the phylum Ascomycota and another that recovers all other fungal phyla. The primers yield amplicons compatible with the Illumina MiSeq platform, which is cost-effective and has a lower error rate than other high throughput sequencing platforms. The new primer set LSU200A-F/LSU476A-R (Ascomycota) yielded 95–98% of reads of target taxa from environmental samples, and primers LSU200-F/LSU481-R (all other fungi) yielded 72–80% of target reads. Both primer sets have fairly low rates of data loss, and together they cover a wide variety of fungal taxa. We compared our results with these primers by amplifying and sequencing a subset of samples using the previously described ITS3_KYO2/ITS4_KYO3 primers, which amplify the internal transcribed spacer 2 (ITS2) of Ascomycota and Basidiomycota. With approximately equivalent read depth, our LSU primers recovered a greater number and phylogenetic diversity of sequences than the ITS2 primers. For instance, ITS3_KYO2/ITS4_KYO3 primers failed to pick up any members of Eurotiales, Mytilinidiales, Pezizales, Saccharomycetales, or Venturiales within Ascomycota, or members of Exobasidiomycetes, Microbotryomycetes, Pucciniomycetes, or Tremellomycetes within Basidiomycota, which were retrieved in good numbers from the same samples by our LSU primers. Among the OTUs recovered using the LSU primers were 127 genera and 28 species that were not obtained using the ITS2 primers, although the ITS2 primers recovered 10 unique genera and 16 species that were not obtained using either of the LSU primers These features identify the new primer sets developed in this study as useful

  8. Selection of functional tRNA primers and primer binding site sequences from a retroviral combinatorial library: identification of new functional tRNA primers in murine leukemia virus replication

    PubMed Central

    Lund, Anders H.; Duch, Mogens; Pedersen, Finn Skou

    2000-01-01

    Retroviral reverse transcription is initiated from a cellular tRNA molecule and all known exogenous isolates of murine leukemia virus utilise a tRNAPro molecule. While several studies suggest flexibility in murine leukemia virus primer utilisation, studies on human immunodeficiency virus and avian retroviruses have revealed evidence of molecular adaptation towards the specific tRNA isoacceptor used as replication primer. In this study, murine leukemia virus tRNA utilisation is investigated by in vivo screening of a retroviral vector combinatorial library with randomised primer binding sites. While most of the selected primer binding sites are complementary to the 3′-end of tRNAPro, we also retrieved PBS sequences matching four other tRNA molecules and demonstrate that Akv murine leukemia virus vectors may efficiently replicate using tRNAArg(CCU), tRNAPhe(GAA) and a hitherto unknown human tRNASer(CGA). PMID:10637332

  9. Universal multiplexable matK primers for DNA barcoding of angiosperms1

    PubMed Central

    Heckenhauer, Jacqueline; Barfuss, Michael H. J.; Samuel, Rosabelle

    2016-01-01

    Premise of the study: PCR amplification of the matK barcoding region is often difficult when dealing with multiple angiosperm families. We developed a primer cocktail to amplify this region efficiently across angiosperm diversity. Methods and Results: We developed 14 matK primers (seven forward, seven reverse) for multiplex PCR, using sequences available in GenBank for 178 taxa belonging to 123 genera in 41 families and 18 orders. Universality of these new multiplexed primers was tested with 53 specimens from 44 representative angiosperm families in 23 different orders. Our primers showed high PCR amplification and sequencing success. Conclusions: These results show that our newly developed primers are highly effective for multiplex PCR and can be employed in future barcode projects involving taxonomically diverse samples across angiosperms. Using multiplex primers for barcoding will reduce the cost and time needed for PCR amplification. PMID:27347449

  10. A sputtered zirconia primer for improved thermal shock resistance of plasma-sprayed ceramic turbine seals

    NASA Technical Reports Server (NTRS)

    Bill, R. C.; Sovey, J.; Allen, G. P.

    1981-01-01

    It is shown that the application of sputtered Y2O3-stabilized ZrO2 (YSZ) primer in plasma-sprayed YSZ ceramic-coated turbine blades results in an improvement, by a factor of 5-6, in the thermal shock life of specimens with a sprayed, porous, Ni-Cr-Al-Y intermediate layer. Species with and without the primer were found to be able to survive 1000 cycles when the intermediate layer was used, but reduced laminar cracking was observed in the specimen with the primer. It is suggested that the sputtered YZS primer-induced properties are due to (1) more effective wetting and adherence of the plasma-sprayed YZS particles to the primer, and (2) the primer's retardation of impinging, molten plasma sprayed particles solidification rates, which result in a less detrimental residual stress distribution.

  11. PCR primers for the amplification of four insect mitochondrial gene fragments.

    PubMed

    Kambhampati, S; Smith, P T

    1995-11-01

    Insect mitochondrial genome (mtDNA) analysis is a powerful tool for the study of population genetics and phylogenetics. In the past few years primer sequences for the PCR amplification of various insect mtDNA genes have been published. The objectives of this study were (1) present new primer sequences for six insect mitochondrial genes and (2) test primers designed in our laboratory and some previously published primers on a wide range of insects to determine if amplification of the target fragment could be obtained. The primers for the amplification of the two ribosomal RNA gene (16S and 12S rRNA) fragments are universal for insects and related groups; the primers for NADH5 and NADH4 dehydrogenase gene fragments and cytochrome c oxidase I gene fragment are applicable broadly.

  12. Inosine at Different Primer Positions to Study Structure and Diversity of Prokaryotic Populations.

    PubMed

    Ben-Dov, Eitan; Kushmaro, Ariel

    2015-01-01

    Culture-independent methods, employed to study the diversity and complexity of microbial communities that are based on amplification of rRNA genes with universal primers, include gradient gel electrophoresis (denaturing or temperature), single-strand-conformation polymorphism, restriction fragment length polymorphism, qPCR and high-throughput DNA sequencing. Substituting one or more base(s) within or at the 3'-termi of the universal primers by inosine can overcome some of their shortcomings improving amplification capacity. Universal primer sets do not usually amplify sequences with nucleotide mismatch to the templates, particularly in the last three bases, whereas inosine-modified primers anneal and amplify a variety of rRNA gene sequences. Inosine-containing primers are therefore might be useful to detect more species in diverse prokaryotic populations. The article summarizes the pros and cons of using inosine especially at the 3' termini of universal primers in nucleic acid amplification for the study of microbial diversity.

  13. Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

    USGS Publications Warehouse

    Galkiewicz, J.P.; Kellogg, C.A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

  14. A method for predicting service life of zinc rich primers on carbon steel

    NASA Technical Reports Server (NTRS)

    Hoppesch, C. W.

    1986-01-01

    The service life of zinc rich primers on carbon steel can be estimated by immersing a primer coated glass slide into an aqueous copper sulfate solution and measuring the amount of zinc that reacts with the copper in 15 minutes. This zinc availability test was used to evaluate eleven primers currently available for which marine beach exposure data was available from previous programs. Results were evaluated and a correlation between zinc availability and ASTM rust grade was shown.

  15. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    PubMed Central

    Spandidos, Athanasia; Wang, Xiaowei; Wang, Huajun; Dragnev, Stefan; Thurber, Tara; Seed, Brian

    2008-01-01

    Background Quantitative polymerase chain reaction (QPCR) is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays. PMID:19108745

  16. The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

    NASA Technical Reports Server (NTRS)

    Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

    1995-01-01

    The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

  17. The corrosion protection of 2219-T87 aluminum by organic and inorganic zinc-rich primers

    NASA Technical Reports Server (NTRS)

    Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

    1995-01-01

    The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electro-chemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. the galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 micro A/cm(exp 2) and 23.7 micro A/cm(exp 2) for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

  18. Express Primer Tool for high-throughput gene cloning and expression

    2002-12-01

    A tool to assist in the design of primers for DNA amplification. The Express Primer web-based tool generates primer sequences specifically for the generation of expression clones for both lab scale and high-throughput projects. The application is designed not only to allow the user complete flexibility to specify primer design parameters but also to minimize the amount of manual intervention needed to generate a large number of primers for simultaneous amplification of multiple target genes.more » The Express Primer Tool enables the user to specify various experimental parameters (e.g. optimal Tm, Tm range, maximum Tm difference) for single or multiple candidate sequence(s) in FASTA format input as a flat text (ASCII) file. The application generates condidate primers, selects optimal primer pairs, and writes the forward and reverse primers pairs to an Excel file that is suitable for electronic submission to a synthesis facility. The program parameters emphasize high-throughput but allow for target atrition at various stages of the project.« less

  19. ecoPrimers: inference of new DNA barcode markers from whole genome sequence analysis

    PubMed Central

    Riaz, Tiayyba; Shehzad, Wasim; Viari, Alain; Pompanon, François; Taberlet, Pierre; Coissac, Eric

    2011-01-01

    Using non-conventional markers, DNA metabarcoding allows biodiversity assessment from complex substrates. In this article, we present ecoPrimers, a software for identifying new barcode markers and their associated PCR primers. ecoPrimers scans whole genomes to find such markers without a priori knowledge. ecoPrimers optimizes two quality indices measuring taxonomical range and discrimination to select the most efficient markers from a set of reference sequences, according to specific experimental constraints such as marker length or specifically targeted taxa. The key step of the algorithm is the identification of conserved regions among reference sequences for anchoring primers. We propose an efficient algorithm based on data mining, that allows the analysis of huge sets of sequences. We evaluate the efficiency of ecoPrimers by running it on three different sequence sets: mitochondrial, chloroplast and bacterial genomes. Identified barcode markers correspond either to barcode regions already in use for plants or animals, or to new potential barcodes. Results from empirical experiments carried out on a promising new barcode for analyzing vertebrate diversity fully agree with expectations based on bioinformatics analysis. These tests demonstrate the efficiency of ecoPrimers for inferring new barcodes fitting with diverse experimental contexts. ecoPrimers is available as an open source project at: http://www.grenoble.prabi.fr/trac/ecoPrimers. PMID:21930509

  20. Recent developments in primer design for DNA polymorphism and mRNA profiling in higher plants

    PubMed Central

    Yang, Xiaohan; Scheffler, Brian E; Weston, Leslie A

    2006-01-01

    Primer design is a critical step in the application of PCR-based technologies in gene expression and genetic diversity analysis. As more plant genomes have been sequenced in recent years, the emphasis of primer design strategy has shifted to genome-wide and high-throughput direction. This paper summarizes recent advances in primer design for profiling of DNA polymorphism and mRNA in higher plants, as well as new primer systems developed for animals that can be adapted for plants. PMID:16509990

  1. Anti-biofilm dentin primer with quaternary ammonium and silver nanoparticles.

    PubMed

    Cheng, L; Zhang, K; Melo, M A S; Weir, M D; Zhou, X; Xu, H H K

    2012-06-01

    Antibacterial bonding agents could combat recurrent caries at the tooth-composite margins. The objectives of this study were to develop novel antibacterial dentin primers containing quaternary ammonium dimethacrylate (QADM) and nanoparticles of silver (NAg), and to investigate the effects on dentin bond strength and dental plaque microcosm biofilms for the first time. Scotchbond Multi-Purpose ("SBMP") bonding agent was used. QADM and NAg were incorporated into SBMP primer, yielding 4 primers: SBMP primer (control), control + 10% QADM (mass), control + 0.05% NAg, and control + 10% QADM + 0.05% NAg. Human saliva was collected to grow microcosm biofilms. The NAg particle size (mean ± SD; n = 100) was 2.7 ± 0.6 nm. Dentin shear bond strengths (n = 10) with human third molars were approximately 30 MPa for all groups (p > 0.1). QADM-NAg-containing primer increased the bacteria inhibition zone by 9-fold, compared with control primer (p < 0.05). QADM-NAg-containing primer reduced lactic acid production and colony-forming units of total micro-organisms, total streptococci, and mutans streptococci by an order of magnitude. In conclusion, novel QADM-NAg-containing primers were strongly antibacterial without compromising dentin bond strength, and hence are promising to inhibit biofilms and secondary caries. The processing method of incorporating QADM and NAg together into the same primer produced the strongest antibacterial effect, which could have a wide applicability to other bonding systems. PMID:22492276

  2. Shear bond strength between autopolymerizing acrylic resin and Co-Cr alloy using different primers.

    PubMed

    Sanohkan, Sasiwimol; Urapepon, Somchai; Harnirattisai, Choltacha; Sirisinha, Chakrit; Sunintaboon, Panya

    2012-01-01

    This study aimed to examine the shear bond strength between cobalt chromium alloy and autopolymerizing acrylic resin using experimental primers containing 5, 10, and 15 wt% of 4-methacryloxyethyl trimellitic anhydride or 1, 2, and 3 wt% of 3-methacryloxypropyl-trimethoxysilane comparison to 5 commercial primers (ML primers, Alloy primer, Metal/Zirconia primer, Monobond S, and Monobond plus). Sixty alloy specimens were sandblasted and treated with each primer before bonded with an acrylic resin. The control group was not primed. The shear bond strengths were tested and statistically compared. Specimens treated with commercial primers significantly increased the shear bond strength of acrylic resin to cobalt chromium alloy (p<0.05). The highest shear bond strength was found in the Alloy primer group. Among experimental group, using 10 wt% of 4-methacryloxyethyl trimellitic anhydride -or 2 wt% of 3-methacryloxypropyltrimethoxysilane enhanced highest shear bond strength. The experimental and commercial primers in this study all improved bonding of acrylic resin to cobalt chromium alloy.

  3. PCR hot start using primers with the structure of molecular beacons (hairpin-like structure).

    PubMed

    Kaboev, O K; Luchkina, L A; Tret'iakov, A N; Bahrmand, A R

    2000-11-01

    A new technique of PCR hot start using oligonucleotide primers with a stem-loop structure is developed here. The molecular beacon oligonucleotide structure without any chromophore addition to the ends was used. The 3'-end sequence of the primers was complementary to the target and five or six nucleotides complementary to the 3'-end were added to the 5'-end. During preparation of the reaction mixture and initial heating, the oligonucleotide has a stem-loop structure and cannot serve as an effective primer for DNA polymerase. After heating to the annealing temperature it acquires a linear structure and primer extension can begin.

  4. Antibiotic resistance: a primer and call to action.

    PubMed

    Smith, Rachel A; M'ikanatha, Nkuchia M; Read, Andrew F

    2015-01-01

    During the past century, discoveries of microorganisms as causes of infections and antibiotics as effective therapeutic agents have contributed to significant gains in public health in many parts of the world. Health agencies worldwide are galvanizing attention toward antibiotic resistance, which is a major threat to public health (Centers for Disease Control and Prevention, 2013; World Health Organization, 2014). Some life scientists believe that we are approaching the post-antibiotic age (Davies & Davies, 2010). The growing threat of antimicrobial resistance is fueled by complex factors with biological, behavioral, and societal aspects. This primer provides an overview of antibiotic resistance and its growing burden on public health, the biological and behavioral mechanisms that increase antibiotic resistance, and examples of where health communication scholars can contribute to efforts to make our current antibiotic drugs last as long as possible. In addition, we identify compelling challenges for current communication theories and practices.

  5. Primer Part 1-The building blocks of epilepsy genetics.

    PubMed

    Helbig, Ingo; Heinzen, Erin L; Mefford, Heather C

    2016-06-01

    This is the first of a two-part primer on the genetics of the epilepsies within the Genetic Literacy Series of the Genetics Commission of the International League Against Epilepsy. In Part 1, we cover the foundations of epilepsy genetics including genetic epidemiology and the range of genetic variants that can affect the risk for developing epilepsy. We discuss various epidemiologic study designs that have been applied to the genetics of the epilepsies including population studies, which provide compelling evidence for a strong genetic contribution in many epilepsies. We discuss genetic risk factors varying in size, frequency, inheritance pattern, effect size, and phenotypic specificity, and provide examples of how genetic risk factors within the various categories increase the risk for epilepsy. We end by highlighting trends in epilepsy genetics including the increasing use of massive parallel sequencing technologies. PMID:27226047

  6. Primer Part 1-The building blocks of epilepsy genetics.

    PubMed

    Helbig, Ingo; Heinzen, Erin L; Mefford, Heather C

    2016-06-01

    This is the first of a two-part primer on the genetics of the epilepsies within the Genetic Literacy Series of the Genetics Commission of the International League Against Epilepsy. In Part 1, we cover the foundations of epilepsy genetics including genetic epidemiology and the range of genetic variants that can affect the risk for developing epilepsy. We discuss various epidemiologic study designs that have been applied to the genetics of the epilepsies including population studies, which provide compelling evidence for a strong genetic contribution in many epilepsies. We discuss genetic risk factors varying in size, frequency, inheritance pattern, effect size, and phenotypic specificity, and provide examples of how genetic risk factors within the various categories increase the risk for epilepsy. We end by highlighting trends in epilepsy genetics including the increasing use of massive parallel sequencing technologies.

  7. [The pharmacology of humour -- a primer to quantum humourdynamics].

    PubMed

    Györfi, András

    2014-08-10

    A good word put in for someone during a medical consultation can alleviate the stress generated by the contact with the clinic. The superlative of "good word" in these situations could be a humorous phrase of the physician during the consultation, which can cause a cognitive shift in the patient's perception of her/his situation. This change of perspective will diminish the anxiety generated by the disease, can rebuild optimism and establish a good doctor-patient relationship, based on hope and collaboration. This paper analyzes the elements of humour and the neurological mechanisms involved in the emergence of mirth. The dosage of this genuine alternative medication is discussed based on a primer to quantum humor dynamics, observing the similarity between the behaviour of quantum mechanic's elementary particles with the quanta of humour called hilarion. Finally, laughter's psychological and physiological benefits are discussed, obtained through changes in circulation, respiration, muscular tonus and endorphin release.

  8. Magnetic resonance imaging methods in developmental science: a primer.

    PubMed

    Hunt, Ruskin H; Thomas, Kathleen M

    2008-01-01

    Structural and functional magnetic resonance imaging (MRI) are increasingly common research methods among investigators interested in typically and atypically developing populations. However, the effective use of these tools requires an understanding of the basis of the magnetic resonance signal, as well as some of the additional experimental complications that arise when collecting MRI data from developmental populations. This primer provides a foundation for investigators who wish to utilize MRI methods in their research and whose primary interest involves typically and atypically developing populations. The basic concepts of MRI physics are introduced, as well as the typical MRI scanner components and their role in MRI data acquisition. In addition, a variety of scan types (structural, functional, diffusion tensor) are discussed, along with a number of important experimental design factors that can impact the quality and utility of the data collected. Special consideration is given to working with pediatric and special populations.

  9. ParaDiS-FEM dislocation dynamics simulation code primer

    SciTech Connect

    Tang, M; Hommes, G; Aubry, S; Arsenlis, A

    2011-09-27

    The ParaDiS code is developed to study bulk systems with periodic boundary conditions. When we try to perform discrete dislocation dynamics simulations for finite systems such as thin films or cylinders, the ParaDiS code must be extended. First, dislocations need to be contained inside the finite simulation box; Second, dislocations inside the finite box experience image stresses due to the free surfaces. We have developed in-house FEM subroutines to couple with the ParaDiS code to deal with free surface related issues in the dislocation dynamics simulations. This primer explains how the coupled code was developed, the main changes from the ParaDiS code, and the functions of the new FEM subroutines.

  10. Evaluation of non toxic alkyd primers by electrochemical impedance spectroscopy

    SciTech Connect

    Hernandez, L.S.; Garcia, G. |; Lopez, C.

    1998-12-31

    The purpose of this work was to compare the protective capacity of several alkyd primers pigmented with 12.1 volume percent either of calcium phosphate or micronized zinc phosphate as anticorrosive pigments. A paint containing zinc chromate was used as reference. The performance of these paints on steel was assessed through Electrochemical Impedance Spectroscopy (EIS) using a 3% NaCl solution. After 576 hr immersion, the paint with calcium phosphate and specially that with micronized zinc phosphate, showed a better behavior than paint with zinc chromate. Paint rating, using impedance parameters (ionic resistance and capacitance of the paint film, and breakpoint frequency), was in agreement with the visible paint deterioration and corrosion, In addition, there was a good correlation between these parameter and the open circuit corrosion potential of the metallic substrate.

  11. MCNP{sup TM} criticality primer and training experiences

    SciTech Connect

    Briesmeister, J.; Forster, R.A.; Busch, R.

    1995-09-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (k{sub eff}). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple k{sub eff} calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP.

  12. Variations in the sensitivity of different primers for detecting Wolbachia in Anastrepha (diptera: tephritidae)

    PubMed Central

    Marcon, Helena Sanches; Coscrato, Virgínia Elias; Selivon, Denise; Perondini, André Luiz Paranhos; Marino, Celso Luis

    2011-01-01

    Wolbachia are endosymbiont bacteria of the family Rickettsiacea that are widespread in invertebrates and occur between 20% and 60% of Neotropical insects. These bacteria are responsible for reproductive phenomena such as cytoplasmic incompatibility, male killing, feminization and parthenogenesis. Supergroups A and B of Wolbachia are common in insects and can be identified using primers for 16S rDNA, ftsZ and wsp; these primers vary in their ability to detect Wolbachia. The ftsZ primer was the first primer used to detect Wolbachia in Anastrepha fruit flies. The primers for 16S rDNA, ftsZ and wsp and the corresponding PCR conditions have been optimized to study the distribution of Wolbachia and their effect on the biology of Anastrepha in Brazil. In this work, we examined the ability of these primers to detect Wolbachia in Anastrepha populations from three regions in the State of São Paulo, southeastern Brazil. All of the samples were positive for Wolbachia supergroup A when screened with primers for 16S A rDNA and wsp A; the wsp B primer also gave a positive result, indicating cross-reactivity. The ftsZ primer showed a poor ability to detect Wolbachia in Anastrepha and generated false negatives in 44.9% of the samples. These findings indicate that reliable PCR detection of Wolbachia requires the use of primers for 16S rDNA and wsp to avoid cross-reactions and false negatives, and that the ftsZ primer needs to be redesigned to improve its selectivity. PMID:24031693

  13. Primer for identifying cold-water refuges to protect and restore thermal diversity in riverine landscapes

    EPA Science Inventory

    EPA recently released a primer that provides guidance to Region 10 Tribes, States, and local watershed community groups to support the identification, protection, and restoration of critical cold water refuges for the protection of salmonids. This primer will assist these entiti...

  14. Community Structure Analysis of Methanogens Associated with Rumen Protozoa Reveals Bias in Universal Archaeal Primers

    PubMed Central

    McAllister, Tim A.

    2012-01-01

    The diversity of protozoan-associated methanogens in cattle was investigated using five universal archaeal small-subunit (SSU) rRNA gene primer sets. Methanobrevibacter spp. and rumen cluster C (distantly related to Thermoplasma spp.) were predominant. Significant differences in species composition among libraries indicate that some primers used previously to characterize rumen methanogens exhibit biased amplification. PMID:22447586

  15. Effects of metal primers on bonding of adhesive resin cement to noble alloys for porcelain fusing.

    PubMed

    Okuya, Nobuhiro; Minami, Hiroyuki; Kurashige, Hisanori; Murahara, Sadaaki; Suzuki, Shiro; Tanaka, Takuo

    2010-03-01

    This study evaluated the effects of metal primers on the bonding of adhesive resin to four pure metals (Au, Pd, Ag, Cu) and two noble alloys for porcelain fusing (high-gold and high-palladium content alloys). Bonding surface was polished with 600-grit silicon carbide paper and primed with one of the three metal primers (V-Primer, Metaltite, and M.L. Primer). Bonded specimens were fabricated by applying adhesive resin (Super-Bond C&B) on the primed surface. Shear bond strength (SBS) was determined both before and after thermocycling (4-60 degrees C for 2,000 cycles). The highest SBS values to each pure metal after thermocycling were 33.5 MPa for Au by M.L. Primer, 35.0 MPa for Ag by V-Primer, and 34.4 MPa for Cu by Metaltite. SBS to high-gold content alloy after thermocycling was 33.3 MPa by M.L. Primer. None of the primers was effective for pure Pd and high-palladium content alloy after thermocycling.

  16. Novel primers for detection of genetically diverse virulent Agrobacterium tumefaciens bv1 strains

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Novel primers were developed to amplify a 243 bp fragment of an intergenic region between gene5 and tms2 on the T-DNA of Agrobacterium tumefaciens. These primers exhibit 100% positive correlation with strain virulence, 100% negative correlation with avirulence and did not generate extraneous bands,...

  17. Microarrays for high-throughput genotyping of MICA alleles using allele-specific primer extension.

    PubMed

    Baek, I C; Jang, J-P; Choi, H-B; Choi, E-J; Ko, W-Y; Kim, T-G

    2013-10-01

    The role of major histocompatibility complex (MHC) class I chain-related gene A (MICA), a ligand of NKG2D, has been defined in human diseases by its allele associations with various autoimmune diseases, hematopoietic stem cell transplantation (HSCT) and cancer. This study describes a practical system to develop MICA genotyping by allele-specific primer extension (ASPE) on microarrays. From the results of 20 control primers, strict and reliable cut-off values of more than 30,000 mean fluorescence intensity (MFI) as positive and less than 3000 MFI as negative, were applied to select high-quality specific extension primers. Among 55 allele-specific primers, 44 primers could be initially selected as optimal primer. Through adjusting the length, six primers were improved. The other failed five primers were corrected by refractory modification. MICA genotypes by ASPE on microarrays showed the same results as those by nucleotide sequencing. On the basis of these results, ASPE on microarrays may provide high-throughput genotyping for MICA alleles for population studies, disease-gene associations and HSCT.

  18. A Primer on Brain Imaging in Developmental Psychopathology: What Is It Good For?

    ERIC Educational Resources Information Center

    Pine, Daniel S.

    2006-01-01

    This primer introduces a Special Section on brain imaging, which includes a commentary and 10 data papers presenting applications of brain imaging to questions on developmental psychopathology. This primer serves two purposes. First, the article summarizes the strength and weaknesses of various brain-imaging techniques typically employed in…

  19. A new PCR method: one primer amplification of PCR-CTPP products.

    PubMed

    Yin, Guang; Mitsuda, Yoko; Ezaki, Takayuki; Hamajima, Nobuyuki

    2012-10-01

    Polymerase chain reaction with confronting two-pair primers (PCR-CTPP) is a convenient method for genotyping single nucleotide polymorphisms, saving time, and costs. It uses four primers for PCR; F1 and R1 for one allele, and F2 and R2 for the other allele, by which three different sizes of DNA are amplified; between F1 and R1, between F2 and R2, and between F1 and R2. To date, we have applied PCR-CTPP successfully for genotyping more than 60 polymorphisms. However, it is not rare that PCR does not produce balanced amplification of allele specific bands. Accordingly, the method was modified by attaching a common sequence at the 5' end of two-pair primers and adding another primer with the common sequence in PCR, in total five different primers in a tube for PCR. The modification allowed one primer amplification for the products of initial PCR with confronting two-pair primers, named as one primer amplification of PCR-CTPP products (OPA-CTPP). This article demonstrates an example for an A/G polymorphism of paraoxonase 1 (PON1) Gln192Arg (rs662). PCR-CTPP failed clear genotyping for the polymorphism, while OPA-CTPP successfully produced PCR products corresponding to the allele. The present example indicated that the OPA-CTPP would be useful in the case that PCR-CTPP failed to produce balanced PCR products specific to each allele.

  20. GSP: A web-based platform for designing genome-specific primers in polyploids

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The sequences among subgenomes in a polyploid species have high similarity. This makes difficult to design genome-specific primers for sequence analysis. We present a web-based platform named GSP for designing genome-specific primers to distinguish subgenome sequences in the polyploid genome backgr...

  1. Demystifying Special Education in Virtual Charter Schools. Special Report. Primers on Special Education in Charter Schools

    ERIC Educational Resources Information Center

    Rhim, Lauren Morando; Kowal, Julie

    2008-01-01

    This special report is a supplement to a series of special education primers created to inform state officials, authorizers and charter school operators about special education in the charter sector. The primer series also provides tools to help these stakeholders build charter school capacity to provide special education and related services. In…

  2. MFEprimer-2.0: a fast thermodynamics-based program for checking PCR primer specificity.

    PubMed

    Qu, Wubin; Zhou, Yang; Zhang, Yanchun; Lu, Yiming; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

    2012-07-01

    Evaluating the specificity of polymerase chain reaction (PCR) primers is an essential step in PCR primer design. The MFEprimer-2.0 server allows users to check primer specificity against genomic DNA and messenger RNA/complementary DNA sequence databases quickly and easily. MFEprimer-2.0 uses a k-mer index algorithm to accelerate the search process for primer binding sites and uses thermodynamics to evaluate binding stability between each primer and its DNA template. Several important characteristics, such as the sequence, melting temperature and size of each amplicon, either specific or non-specific, are reported on the results page. Based on these characteristics and the user-friendly output, users can readily draw conclusions about the specificity of PCR primers. Analyses for degenerate primers and multiple PCR primers are also supported in MFEprimer-2.0. In addition, the databases supported by MFEprimer-2.0 are comprehensive, and custom databases can also be supported on request. The MFEprimer-2.0 server does not require a login and is freely available at http://biocompute.bmi.ac.cn/CZlab/MFEprimer-2.0. More over, the MFEprimer-2.0 command-line version and local server version are open source and can be downloaded at https://github.com/quwubin/MFEprimer/wiki/Manual/.

  3. Composing Effective and Efficient E-mails: A Primer for Pharmacy Practitioners.

    PubMed

    Summerfield, Marc R; Feemster, Agnes Ann

    2015-09-01

    This primer describes the purpose and importance of e-mail as a key communication medium in the workplace. It emphasizes clarity as a primary modality to enhance efficiency and effectiveness. Finally, the primer reviews elements of grammar, punctuation, and style that contribute to each e-mail's ability to meet language standards, enhance the writer's image, and successfully transmit information.

  4. A Comprehensive Evaluation of PCR Primers to Amplify the nifH Gene of Nitrogenase

    PubMed Central

    Gaby, John Christian; Buckley, Daniel H.

    2012-01-01

    The nifH gene is the most widely sequenced marker gene used to identify nitrogen-fixing Bacteria and Archaea. Numerous PCR primers have been designed to amplify nifH, but a comprehensive evaluation of nifH PCR primers has not been performed. We performed an in silico analysis of the specificity and coverage of 51 universal and 35 group-specific nifH primers by using an aligned database of 23,847 nifH sequences. We found that there are 15 universal nifH primers that target 90% or more of nitrogen fixers, but that there are also 23 nifH primers that target less than 50% of nifH sequences. The nifH primers we evaluated vary in their phylogenetic bias and their ability to recover sequences from commonly sampled environments. In addition, many of these primers will amplify genes that do not mediate nitrogen fixation, and thus it would be advisable for researchers to screen their sequencing results for the presence of non-target genes before analysis. Universal primers that performed well in silico were tested empirically with soil samples and with genomic DNA from a phylogenetically diverse set of nitrogen-fixing strains. This analysis will be of great utility to those engaged in molecular analysis of nifH genes from isolates and environmental samples. PMID:22848735

  5. Characterization of the 18S rRNA gene for designing universal eukaryote specific primers.

    PubMed

    Hadziavdic, Kenan; Lekang, Katrine; Lanzen, Anders; Jonassen, Inge; Thompson, Eric M; Troedsson, Christofer

    2014-01-01

    High throughput sequencing technology has great promise for biodiversity studies. However, an underlying assumption is that the primers used in these studies are universal for the prokaryotic or eukaryotic groups of interest. Full primer universality is difficult or impossible to achieve and studies using different primer sets make biodiversity comparisons problematic. The aim of this study was to design and optimize universal eukaryotic primers that could be used as a standard in future biodiversity studies. Using the alignment of all eukaryotic sequences from the publicly available SILVA database, we generated a full characterization of variable versus conserved regions in the 18S rRNA gene. All variable regions within this gene were analyzed and our results suggested that the V2, V4 and V9 regions were best suited for biodiversity assessments. Previously published universal eukaryotic primers as well as a number of self-designed primers were mapped to the alignment. Primer selection will depend on sequencing technology used, and this study focused on the 454 pyrosequencing GS FLX Titanium platform. The results generated a primer pair yielding theoretical matches to 80% of the eukaryotic and 0% of the prokaryotic sequences in the SILVA database. An empirical test of marine sediments using the AmpliconNoise pipeline for analysis of the high throughput sequencing data yielded amplification of sequences for 71% of all eukaryotic phyla with no isolation of prokaryotic sequences. To our knowledge this is the first characterization of the complete 18S rRNA gene using all eukaryotes present in the SILVA database, providing a robust test for universal eukaryotic primers. Since both in silico and empirical tests using high throughput sequencing retained high inclusion of eukaryotic phyla and exclusion of prokaryotes, we conclude that these primers are well suited for assessing eukaryote diversity, and can be used as a standard in biodiversity studies.

  6. Characterization of the 18S rRNA Gene for Designing Universal Eukaryote Specific Primers

    PubMed Central

    Hadziavdic, Kenan; Lekang, Katrine; Lanzen, Anders; Jonassen, Inge; Thompson, Eric M.; Troedsson, Christofer

    2014-01-01

    High throughput sequencing technology has great promise for biodiversity studies. However, an underlying assumption is that the primers used in these studies are universal for the prokaryotic or eukaryotic groups of interest. Full primer universality is difficult or impossible to achieve and studies using different primer sets make biodiversity comparisons problematic. The aim of this study was to design and optimize universal eukaryotic primers that could be used as a standard in future biodiversity studies. Using the alignment of all eukaryotic sequences from the publicly available SILVA database, we generated a full characterization of variable versus conserved regions in the 18S rRNA gene. All variable regions within this gene were analyzed and our results suggested that the V2, V4 and V9 regions were best suited for biodiversity assessments. Previously published universal eukaryotic primers as well as a number of self-designed primers were mapped to the alignment. Primer selection will depend on sequencing technology used, and this study focused on the 454 pyrosequencing GS FLX Titanium platform. The results generated a primer pair yielding theoretical matches to 80% of the eukaryotic and 0% of the prokaryotic sequences in the SILVA database. An empirical test of marine sediments using the AmpliconNoise pipeline for analysis of the high throughput sequencing data yielded amplification of sequences for 71% of all eukaryotic phyla with no isolation of prokaryotic sequences. To our knowledge this is the first characterization of the complete 18S rRNA gene using all eukaryotes present in the SILVA database, providing a robust test for universal eukaryotic primers. Since both in silico and empirical tests using high throughput sequencing retained high inclusion of eukaryotic phyla and exclusion of prokaryotes, we conclude that these primers are well suited for assessing eukaryote diversity, and can be used as a standard in biodiversity studies. PMID:24516555

  7. KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input

    SciTech Connect

    Busch, R.D.

    2003-01-17

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a.

  8. A Transparent Window into Biology: A Primer on Caenorhabditis elegans.

    PubMed

    Corsi, Ann K; Wightman, Bruce; Chalfie, Martin

    2015-06-01

    A little over 50 years ago, Sydney Brenner had the foresight to develop the nematode (round worm) Caenorhabditis elegans as a genetic model for understanding questions of developmental biology and neurobiology. Over time, research on C. elegans has expanded to explore a wealth of diverse areas in modern biology including studies of the basic functions and interactions of eukaryotic cells, host-parasite interactions, and evolution. C. elegans has also become an important organism in which to study processes that go awry in human diseases. This primer introduces the organism and the many features that make it an outstanding experimental system, including its small size, rapid life cycle, transparency, and well-annotated genome. We survey the basic anatomical features, common technical approaches, and important discoveries in C. elegans research. Key to studying C. elegans has been the ability to address biological problems genetically, using both forward and reverse genetics, both at the level of the entire organism and at the level of the single, identified cell. These possibilities make C. elegans useful not only in research laboratories, but also in the classroom where it can be used to excite students who actually can see what is happening inside live cells and tissues.

  9. Review of Attachment, play, and authenticity: A Winnicott primer.

    PubMed

    Penn, Linda S

    2009-12-01

    Reviews the book, Attachment, play, and authenticity: A Winnicott primer by Steven Tuber (see record 2008-04633-000). In this book, Tuber does not attempt to offer a comprehensive review of Winnicott's work. Rather, he focuses on what he sees as Winnicott's most central concepts, offering close examination of a few articles that he feels best represent each of these concepts, and frames each with the noting of a central dilemma or paradox. Tuber describes the book as an attempt to teach through "playing" with Winnicott (play being central to Winnicott's ideas) and engaging the reader to join in the play. The book is based on a series of lectures from a course on Winnicott he has given to his clinical psychology doctoral students at the City University of New York. The reviewer noted that the author omitted some information that she considered to be important. However, she concludes that this book is a compelling read that captures what she sees as the essence of Winnicott's work, and as Winnicott would have loved, presents it without jargon or pretense in the simple terms that best elucidate Winnicott's view of the human experience. (PsycINFO Database Record (c) 2010 APA, all rights reserved).

  10. The corrosion mechanisms for primer coated 2219-T87 aluminum

    NASA Technical Reports Server (NTRS)

    Danford, Merlin D.; Knockemus, Ward W.

    1987-01-01

    To investigate metal surface corrosion and the breakdown of metal protective coatings, the ac Impedance Method was applied to zinc chromate primer coated 2219-T87 aluminum. The EG&GPARC Model 368 ac Impedance Measurement System, along with dc measurements with the same system using the Polarization Resistance Method, was used to monitor changing properties of coated aluminum disks immersed in 3.5 percent NaCl solutions buffered at pH 5.5 and pH 8.2 over periods of 40 days each. The corrosion system can be represented by an electronic analog called an equivalent circuit consisting of resistors and capacitors in specific arrangements. This equivalent circuit parallels the impedance behavior of the corrosion system during a frequency scan. Values for resistances and capacitances, that can be assigned in the equivalent circuit following a least squares analysis of the data, describe changes occurring on the corroding metal surface and in the protective coatings. A suitable equivalent circuit has been determined which predicts the correct Bode phase and magnitude for the experimental sample. The dc corrosion current density data are related to equivalent circuit element parameters.

  11. A Transparent Window into Biology: A Primer on Caenorhabditis elegans

    PubMed Central

    Corsi, Ann K.; Wightman, Bruce; Chalfie, Martin

    2015-01-01

    A little over 50 years ago, Sydney Brenner had the foresight to develop the nematode (round worm) Caenorhabditis elegans as a genetic model for understanding questions of developmental biology and neurobiology. Over time, research on C. elegans has expanded to explore a wealth of diverse areas in modern biology including studies of the basic functions and interactions of eukaryotic cells, host–parasite interactions, and evolution. C. elegans has also become an important organism in which to study processes that go awry in human diseases. This primer introduces the organism and the many features that make it an outstanding experimental system, including its small size, rapid life cycle, transparency, and well-annotated genome. We survey the basic anatomical features, common technical approaches, and important discoveries in C. elegans research. Key to studying C. elegans has been the ability to address biological problems genetically, using both forward and reverse genetics, both at the level of the entire organism and at the level of the single, identified cell. These possibilities make C. elegans useful not only in research laboratories, but also in the classroom where it can be used to excite students who actually can see what is happening inside live cells and tissues. PMID:26088431

  12. Demystifying Kepler Data: A Primer for Systematic Artifact Mitigation

    NASA Technical Reports Server (NTRS)

    Kinemuchi, K.; Barclay, T.; Fanelli, M.; Pepper, J.; Still, M.; Howell, B.

    2012-01-01

    The Kepler spacecraft has collected data of high photometric precision and cadence almost continuously since operations began on 2009 May 2. Primarily designed to detect planetary transits and asteroseismological signals from solar-like stars, Kepler has provided high quality data for many areas of investigation. Unconditioned simple aperture time-series photometry are however affected by systematic structure. Examples of these systematics are differential velocity aberration, thermal gradients across the spacecraft, and pointing variations. While exhibiting some impact on Kepler's primary science, these systematics can critically handicap potentially ground-breaking scientific gains in other astrophysical areas, especially over long timescales greater than 10 days. As the data archive grows to provide light curves for 10(exp 5) stars of many years in length, Kepler will only fulfill its broad potential for stellar astrophysics if these systematics are understood and mitigated. Post-launch developments in the Kepler archive, data reduction pipeline and open source data analysis software have occurred to remove or reduce systematic artifacts. This paper provides a conceptual primer for users of the Kepler data archive to understand and recognize systematic artifacts within light curves and some methods for their removal. Specific examples of artifact mitigation are provided using data available within the archive. Through the methods defined here, the Kepler community will find a road map to maximizing the quality and employment of the Kepler legacy archive.

  13. Demystifying Kepler Data: A Primer for Systematic Artifact Mitigation

    NASA Astrophysics Data System (ADS)

    Kinemuchi, K.; Barclay, T.; Fanelli, M.; Pepper, J.; Still, M.; Howell, Steve B.

    2012-09-01

    The Kepler spacecraft has collected data of high photometric precision and cadence almost continuously since operations began on 2009 May 2. Primarily designed to detect planetary transits and asteroseismological signals from solar-like stars, Kepler has provided high-quality data for many areas of investigation. Unconditioned simple aperture time-series photometry is, however, affected by systematic structure. Examples of these systematics include differential velocity aberration, thermal gradients across the spacecraft, and pointing variations. While exhibiting some impact on Kepler's primary science, these systematics can critically handicap potentially ground-breaking scientific gains in other astrophysical areas, especially over long timescales greater than 10 days. As the data archive grows to provide light curves for 105 stars of many years in length, Kepler will only fulfill its broad potential for stellar astrophysics if these systematics are understood and mitigated. Post-launch developments in the Kepler archive, data reduction pipeline and open source data analysis software have helped to remove or reduce systematic artifacts. This paper provides a conceptual primer to help users of the Kepler data archive understand and recognize systematic artifacts within light curves and some methods for their removal. Specific examples of artifact mitigation are provided using data available within the archive. Through the methods defined here, the Kepler community will find a road map to maximizing the quality and employment of the Kepler legacy archive.

  14. Quantification of splice variants using molecular beacon or scorpion primers.

    PubMed

    Taveau, Mathieu; Stockholm, Daniel; Spencer, Melissa; Richard, Isabelle

    2002-06-15

    Uncovering the relationship between the generation of alternative transcripts and cellular processes is of crucial importance in the exploration of a gene's biology. The description and quantification of the spatiotemporal splicing pattern can be one method to select the most interesting transcripts for future studies. Fluorescence-based real-time quantitative RT-PCR has recently revolutionized the possibilities for transcriptional quantification studies. In this report, Molecular Beacon and Scorpion probes have been tested as new possibilities for determining the expression level of alternative transcripts. We validated these systems by analyzing alternative splicing of exons 6, 15, and 16 of the calpain 3 gene with tissues containing large variation in the ratio of the different transcripts. We determined conditions that demonstrated that boundary probes are useful tools and good alternatives to boundary primers, when developing a system to quantify specific transcripts. We suggest that the choice of a quantification system should depend in part on the structure and base composition of the gene and may have to be determined experimentally.

  15. Development of acceptance criteria for batches of silane primer for external tank thermal protection system bonding applications

    NASA Technical Reports Server (NTRS)

    Mikes, F.; Mowrey, C.; Reis, E.

    1985-01-01

    Results of lap shear tests of various silane primers are presented in graphs and tables. The OH-absorption of these primers (FTIR area values) are correlated with the lap shear tests of coated panels.

  16. Guidelines for the tetra-primer ARMS-PCR technique development.

    PubMed

    Medrano, Ruan Felipe Vieira; de Oliveira, Camila Andréa

    2014-07-01

    The tetra-primer amplification refractory mutation system-polymerase chain (ARMS-PCR) reaction is a simple and economical method to genotype single-nucleotide polymorphisms (SNPs). It uses four primers in a single PCR and is followed just by gel electrophoresis. However, the optimization step can be very hardworking and time-consuming. Hence, we propose to demonstrate and discuss critical steps for its development, in a way to provide useful information. Two SNPs that provided different amplification conditions were selected. DNA extraction methods, annealing temperatures, PCR cycles protocols, reagents, and primers concentration were also analyzed. The use of tetra-primer ARMS-PCR could be impaired for SNPs in DNA regions rich in cytosine and guanine and for samples with DNA not purified. The melting temperature was considered the factor of greater interference. However, small changes in the reagents concentration significantly affect the PCR, especially MgCl2. Balancing the inner primers band is also a key step. So, in order to balance the inner primers band, intensity is important to observe which one has the weakest band and promote its band by increasing its concentration. The use of tetra-primer ARMS-PCR attends the expectations of modern genomic research and allows the study of SNPs in a fast, reliable, and low-cost way. PMID:24519268

  17. Construction of Specific Primers for Rapid Detection of South African Exportable Vegetable Macergens.

    PubMed

    Aremu, Bukola Rhoda; Babalola, Olubukola Oluranti

    2015-10-01

    Macergens are bacteria causing great damages to the parenchymatous tissues of vegetable both on the field and in transit. To effectively and rapidly investigate the diversity and distribution of these macergens, four specific primers were designed by retrieving 16S rDNA sequences of pectolytic bacteria from GenBank through the National Center for Biotechnology Information (NCBI). These were aligned using ClusterW via BioEdit and primers were designed using Primer3Plus platform. The size and primer location of each species and PCR product size were accurately defined. For specificity enhancement, DNA template of known macergens (Pectobacterium chrysanthermi) and fresh healthy vegetable were used. These primers yielded expected size of approximately 1100 bp product only when tested with known macergens and no amplicon with fresh healthy vegetable was detected. Rapid detection of macergens in rotten vegetable samples was then carried out using these primers. Nucleotide sequences of macergens identified were deposited into the GenBank and were assigned accession numbers. Hence, with these specific primers, macergens can be identified with minimal quantities of the vegetable tissues using molecular techniques, for future use of the quarantine section of the Agricultural Department of the country for quick and rapid detection of macergens before exportation. PMID:26437427

  18. Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes

    DOE PAGES

    Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.; Peña, José; Hysom, David A.; Borucki, Monica K.

    2014-01-01

    Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus.more » Each group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less

  19. Construction of Specific Primers for Rapid Detection of South African Exportable Vegetable Macergens

    PubMed Central

    Aremu, Bukola Rhoda; Babalola, Olubukola Oluranti

    2015-01-01

    Macergens are bacteria causing great damages to the parenchymatous tissues of vegetable both on the field and in transit. To effectively and rapidly investigate the diversity and distribution of these macergens, four specific primers were designed by retrieving 16S rDNA sequences of pectolytic bacteria from GenBank through the National Center for Biotechnology Information (NCBI). These were aligned using ClusterW via BioEdit and primers were designed using Primer3Plus platform. The size and primer location of each species and PCR product size were accurately defined. For specificity enhancement, DNA template of known macergens (Pectobacterium chrysanthermi) and fresh healthy vegetable were used. These primers yielded expected size of approximately 1100 bp product only when tested with known macergens and no amplicon with fresh healthy vegetable was detected. Rapid detection of macergens in rotten vegetable samples was then carried out using these primers. Nucleotide sequences of macergens identified were deposited into the GenBank and were assigned accession numbers. Hence, with these specific primers, macergens can be identified with minimal quantities of the vegetable tissues using molecular techniques, for future use of the quarantine section of the Agricultural Department of the country for quick and rapid detection of macergens before exportation. PMID:26437427

  20. Insight into the Human DNA Primase Interaction with Template-Primer.

    PubMed

    Baranovskiy, Andrey G; Zhang, Yinbo; Suwa, Yoshiaki; Gu, Jianyou; Babayeva, Nigar D; Pavlov, Youri I; Tahirov, Tahir H

    2016-02-26

    DNA replication in almost all organisms depends on the activity of DNA primase, a DNA-dependent RNA polymerase that synthesizes short RNA primers of defined size for DNA polymerases. Eukaryotic and archaeal primases are heterodimers consisting of small catalytic and large accessory subunits, both of which are necessary for the activity. The mode of interaction of primase subunits with substrates during the various steps of primer synthesis that results in the counting of primer length is not clear. Here we show that the C-terminal domain of the large subunit (p58C) plays a major role in template-primer binding and also defines the elements of the DNA template and the RNA primer that interact with p58C. The specific mode of interaction with a template-primer involving the terminal 5'-triphosphate of RNA and the 3'-overhang of DNA results in a stable complex between p58C and the DNA/RNA duplex. Our results explain how p58C participates in RNA synthesis and primer length counting and also indicate that the binding site for initiating NTP is located on p58C. These findings provide notable insight into the mechanism of primase function and are applicable for DNA primases from other species.

  1. Comprehensive Primer Design for Analysis of Population Genetics in Non-Sequenced Organisms

    PubMed Central

    Tezuka, Ayumi; Matsushima, Noe; Nemoto, Yoriko; Akashi, Hiroshi D.; Kawata, Masakado; Makino, Takashi

    2012-01-01

    Nuclear sequence markers are useful tool for the study of the history of populations and adaptation. However, it is not easy to obtain multiple nuclear primers for organisms with poor or no genomic sequence information. Here we used the genomes of organisms that have been fully sequenced to design comprehensive sets of primers to amplify polymorphic genomic fragments of multiple nuclear genes in non-sequenced organisms. First, we identified a large number of candidate polymorphic regions that were flanked on each side by conserved regions in the reference genomes. We then designed primers based on these conserved sequences and examined whether the primers could be used to amplify sequences in target species, montane brown frog (Rana ornativentris), anole lizard (Anolis sagrei), guppy (Poecilia reticulata), and fruit fly (Drosophila melanogaster), for population genetic analysis. We successfully obtained polymorphic markers for all target species studied. In addition, we found that sequence identities of the regions between the primer sites in the reference genomes affected the experimental success of DNA amplification and identification of polymorphic loci in the target genomes, and that exonic primers had a higher success rate than intronic primers in amplifying readable sequences. We conclude that this comparative genomic approach is a time- and cost-effective way to obtain polymorphic markers for non-sequenced organisms, and that it will contribute to the further development of evolutionary ecology and population genetics for non-sequenced organisms, aiding in the understanding of the genetic basis of adaptation. PMID:22393396

  2. Indexed PCR Primers Induce Template-Specific Bias in Large-Scale DNA Sequencing Studies

    PubMed Central

    O’Donnell, James L.; Kelly, Ryan P.; Lowell, Natalie C.; Port, Jesse A.

    2016-01-01

    Massively parallel sequencing is rapidly emerging as an efficient way to quantify biodiversity at all levels, from genetic variation and expression to ecological community assemblage. However, the number of reads produced per sequencing run far exceeds the number required per sample for many applications, compelling researchers to sequence multiple samples per run in order to maximize efficiency. For studies that include a PCR step, this can be accomplished using primers that include an index sequence allowing sample origin to be determined after sequencing. The use of indexed primers assumes they behave no differently than standard primers; however, we found that indexed primers cause substantial template sequence-specific bias, resulting in radically different profiles of the same environmental sample. Likely the outcome of differential amplification efficiency due to primer-template mismatch, two indexed primer sets spuriously change the inferred sequence abundance from the same DNA extraction by up to 77.1%. We demonstrate that a double PCR approach alleviates these effects in applications where indexed primers are necessary. PMID:26950069

  3. Improved PCR primers for the detection and identification of arbuscular mycorrhizal fungi.

    PubMed

    Lee, Jaikoo; Lee, Sangsun; Young, J Peter W

    2008-08-01

    A set of PCR primers that should amplify all subgroups of arbuscular mycorrhizal fungi (AMF, Glomeromycota), but exclude sequences from other organisms, was designed to facilitate rapid detection and identification directly from field-grown plant roots. The small subunit rRNA gene was targeted for the new primers (AML1 and AML2) because phylogenetic relationships among the Glomeromycota are well understood for this gene. Sequence comparisons indicate that the new primers should amplify all published AMF sequences except those from Archaeospora trappei. The specificity of the new primers was tested using 23 different AMF spore morphotypes from trap cultures and Miscanthus sinensis, Glycine max and Panax ginseng roots sampled from the field. Non-AMF DNA of 14 plants, 14 Basidiomycota and 18 Ascomycota was also tested as negative controls. Sequences amplified from roots using the new primers were compared with those obtained using the established NS31 and AM1 primer combination. The new primers have much better specificity and coverage of all known AMF groups. PMID:18631176

  4. Shop primer as part of the corrosion protective coating for submerged steel structures

    SciTech Connect

    Bjordal, M.; Steinsmo, U.

    1998-12-31

    In Norwegian workshops the standard pre-treatment procedures for steel structures intended for sub-sea use, normally include removal of shop primer by blast cleaning to Sa 2 1/2 before application of corrosion protective coatings. This is also stated in the Norwegian offshore standard NORSOK. Omitting this stage in fabrication will represent large reductions in both time consumption and costs, and reduce the volume of waste from the blast cleaning. This report presents results from investigations of how a shop primer will influence on the coating properties. The aim of the investigation was to test whether the systems are good enough if the shop primer is left on the surface. Two different zinc silicate shop primers have been included in the investigation. As protective coatings the authors have used three different epoxy mastic systems with Al pigments. In addition to panels with original shop primer, they have also tested shop primed panels pre-treated in various ways, such as heated, corroded and blast cleaned to various degrees before coating. The coatings have been tested in the ASTM-G8 121 test and in a long term test in sea water polarized with a Zn anode. They have found that coatings including the zinc silicate shop primer are more susceptible to cathodic disbonding than the coating applied directly on blast cleaned steel. It is however possible to meet the NORSOK criteria with a zinc silicate shop primer as first coat.

  5. Primer effect in the detection of mitochondrial DNA point heteroplasmy by automated sequencing.

    PubMed

    Calatayud, Marta; Ramos, Amanda; Santos, Cristina; Aluja, Maria Pilar

    2013-06-01

    The correct detection of mitochondrial DNA (mtDNA) heteroplasmy by automated sequencing presents methodological constraints. The main goals of this study are to investigate the effect of sense and distance of primers in heteroplasmy detection and to test if there are differences in the accurate determination of heteroplasmy involving transitions or transversions. A gradient of the heteroplasmy levels was generated for mtDNA positions 9477 (transition G/A) and 15,452 (transversion C/A). Amplification and subsequent sequencing with forward and reverse primers, situated at 550 and 150 bp from the heteroplasmic positions, were performed. Our data provide evidence that there is a significant difference between the use of forward and reverse primers. The forward primer is the primer that seems to give a better approximation to the real proportion of the variants. No significant differences were found concerning the distance at which the sequencing primers were placed neither between the analysis of transitions and transversions. The data collected in this study are a starting point that allows to glimpse the importance of the sequencing primers in the accurate detection of point heteroplasmy, providing additional insight into the overall automated sequencing strategy.

  6. Optimization of primer design for the detection of variable genomic lesions in cancer.

    PubMed

    Bashir, Ali; Liu, Yu-Tsueng; Raphael, Benjamin J; Carson, Dennis; Bafna, Vineet

    2007-11-01

    Primer approximation multiplex PCR (PAMP) is a new experimental protocol for efficiently assaying structural variation in genomes. PAMP is particularly suited to cancer genomes where the precise breakpoints of alterations such as deletions or translocations vary between patients. The design of PCR primer sets for PAMP is challenging because a large number of primer pairs are required to detect alterations in the hundreds of kilobases range that can occur in cancer. These sets of primers must achieve high coverage of the region of interest, while avoiding primer dimers and satisfying the physico-chemical constraints of good PCR primers. We describe a natural formulation of these constraints as a combinatorial optimization problem. We show that the PAMP primer design problem is NP-hard, and design algorithms based on simulated annealing and integer programming, that provide good solutions to this problem in practice. The algorithms are applied to a test region around the known CDKN2A deletion, which show excellent results even in a 1:49 mixture of mutated:wild-type cells. We use these test results to help set design parameters for larger problems. We can achieve near-optimal designs for regions close to 1 Mb. PMID:17766270

  7. Human DNA polymerase α in binary complex with a DNA:DNA template-primer

    PubMed Central

    Coloma, Javier; Johnson, Robert E.; Prakash, Louise; Prakash, Satya; Aggarwal, Aneel K.

    2016-01-01

    The Polα/primase complex assembles the short RNA-DNA fragments for priming of lagging and leading strand DNA replication in eukaryotes. As such, the Polα polymerase subunit encounters two types of substrates during primer synthesis: an RNA:DNA helix and a DNA:DNA helix. The engagement of the polymerase subunit with the DNA:DNA helix has been suggested as the of basis for primer termination in eukaryotes. However, there is no structural information on how the Polα polymerase subunit actually engages with a DNA:DNA helix during primer synthesis. We present here the first crystal structure of human Polα polymerase subunit in complex with a DNA:DNA helix. Unexpectedly, we find that portion of the DNA:DNA helix in contact with the polymerase is not in a B-form but in a hybrid A-B form. Almost all of the contacts observed previously with an RNA primer are preserved with a DNA primer – with the same set of polymerase residues tracking the sugar-phosphate backbone of the DNA or RNA primer. Thus, rather than loss of specific contacts, the free energy cost of distorting DNA from B- to hybrid A-B form may augur the termination of primer synthesis in eukaryotes. PMID:27032819

  8. Construction of Specific Primers for Rapid Detection of South African Exportable Vegetable Macergens.

    PubMed

    Aremu, Bukola Rhoda; Babalola, Olubukola Oluranti

    2015-09-30

    Macergens are bacteria causing great damages to the parenchymatous tissues of vegetable both on the field and in transit. To effectively and rapidly investigate the diversity and distribution of these macergens, four specific primers were designed by retrieving 16S rDNA sequences of pectolytic bacteria from GenBank through the National Center for Biotechnology Information (NCBI). These were aligned using ClusterW via BioEdit and primers were designed using Primer3Plus platform. The size and primer location of each species and PCR product size were accurately defined. For specificity enhancement, DNA template of known macergens (Pectobacterium chrysanthermi) and fresh healthy vegetable were used. These primers yielded expected size of approximately 1100 bp product only when tested with known macergens and no amplicon with fresh healthy vegetable was detected. Rapid detection of macergens in rotten vegetable samples was then carried out using these primers. Nucleotide sequences of macergens identified were deposited into the GenBank and were assigned accession numbers. Hence, with these specific primers, macergens can be identified with minimal quantities of the vegetable tissues using molecular techniques, for future use of the quarantine section of the Agricultural Department of the country for quick and rapid detection of macergens before exportation.

  9. Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes

    PubMed Central

    Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.; Peña, José; Hysom, David A.; Borucki, Monica K.

    2014-01-01

    Background. Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results. A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Each group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions. This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family. PMID:25157264

  10. Biased Diversity Metrics Revealed by Bacterial 16S Pyrotags Derived from Different Primer Sets

    PubMed Central

    Cai, Lin; Ye, Lin; Tong, Amy Hin Yan; Lok, Si; Zhang, Tong

    2013-01-01

    In recent years, PCR-based pyrosequencing of 16S rRNA genes has continuously increased our understanding of complex microbial communities in various environments of the Earth. However, there is always concern on the potential biases of diversity determination using different 16S rRNA gene primer sets and covered regions. Here, we first report how bacterial 16S rRNA gene pyrotags derived from a series of different primer sets resulted in the biased diversity metrics. In total, 14 types of pyrotags were obtained from two-end pyrosequencing of 7 amplicon pools generated by 7 primer sets paired by 1 of 4 forward primers (V1F, V3F, V5F, and V7F) and 1 of 4 reverse primers (V2R, V4R, V6R, and V9R), respectively. The results revealed that: i) the activated sludge exhibited a large bacterial diversity that represented a broad range of bacterial populations and served as a good sample in this methodology research; ii) diversity metrics highly depended on the selected primer sets and covered regions; iii) paired pyrotags obtained from two-end pyrosequencing of each short amplicon displayed different diversity metrics; iv) relative abundance analysis indicated the sequencing depth affected the determination of rare bacteria but not abundant bacteria; v) the primer set of V1F and V2R significantly underestimated the diversity of activated sludge; and vi) the primer set of V3F and V4R was highly recommended for future studies due to its advantages over other primer sets. All of these findings highlight the significance of this methodology research and offer a valuable reference for peer researchers working on microbial diversity determination. PMID:23341963

  11. An Investigation to Improve Quality Evaluations of Primers and Propellant for 20mm Munitions

    NASA Technical Reports Server (NTRS)

    Bement, L. J.; Holmes, C.; McGrory, J.; Schimmel, M. L.

    1997-01-01

    To reduce the frequency of electrically initiated, 20mm munition hangfires (delayed ignitions), a joint Army/NASA investigation was conducted to recommend quality evaluation improvements for acceptance of both primers and gun propellant. This effort focused only on evaluating ignition and combustion performance as potential causes of hangfires: poor electrical initiation of the primer, low output performance of the primer, low ignition sensitivity of the gun propellant, and the effects of cold temperature. The goal was to determine the "best" of the Army and NASA test methods to assess the functional performance of primers and gun propellants. The approach was to evaluate the performance of both high-quality and deliberately defective primers to challenge the sensitivity of test methods. In addition, the ignition sensitivity of different manufacturing batches of gun propellants was evaluated. The results of the investigation revealed that improvements can be made in functional evaluations that can assist in identifying and reducing ignition and performance variations. The "best" functional evaluation of primers and propellant is achieved through a combination of both Army and NASA test methods. Incorporating the recommendations offered in this report may provide for considerable savings in reducing the number of cartridge firings, while significantly lowering the rejection rate of primer, propellant and cartridge lots. The most probable causes for ignition and combustion-related hangfires were the lack of calcium silicide in the primer mix, a low output performance of primers, and finally, poor ignition sensitivity of gun propellant. Cold temperatures further reduce propellant ignition sensitivity, as well as reducing burn rate and chamber pressures.

  12. PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences

    PubMed Central

    Machida, Ryuji J.; Knowlton, Nancy

    2012-01-01

    Background Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. Methodology/Principal Findings Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. Conclusions/Significance The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S) and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other marker regions as targets

  13. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    PubMed

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  14. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    PubMed

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method. PMID:25429503

  15. A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

    SciTech Connect

    Warwick, William M.

    2002-06-03

    This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

  16. Universal primers for amplification of the complete mitochondrial control region in marine fish species.

    PubMed

    Cheng, Y Z; Xu, T J; Jin, X X; Tang, D; Wei, T; Sun, Y Y; Meng, F Q; Shi, G; Wang, R X

    2012-01-01

    Through multiple alignment analysis of mitochondrial tRNA-Thr and tRNA-Phe sequences from 161 fishes, new universal primers specially targeting the entire mitochondrial control region were designed. This new primer set successfully amplified the expected PCR products from various kinds of marine fish species, belonging to various families, and the amplified segments were confirmed to be the control region by sequencing. These primers provide a useful tool to study the control region diversity in economically important fish species, the possible mechanism of control region evolution, and the functions of the conserved motifs in the control region.

  17. Binary electrokinetic separation of target DNA from background DNA primers.

    SciTech Connect

    James, Conrad D.; Derzon, Mark Steven

    2005-10-01

    This report contains the summary of LDRD project 91312, titled ''Binary Electrokinetic Separation of Target DNA from Background DNA Primers''. This work is the first product of a collaboration with Columbia University and the Northeast BioDefense Center of Excellence. In conjunction with Ian Lipkin's lab, we are developing a technique to reduce false positive events, due to the detection of unhybridized reporter molecules, in a sensitive and multiplexed detection scheme for nucleic acids developed by the Lipkin lab. This is the most significant problem in the operation of their capability. As they are developing the tools for rapidly detecting the entire panel of hemorrhagic fevers this technology will immediately serve an important national need. The goal of this work was to attempt to separate nucleic acid from a preprocessed sample. We demonstrated the preconcentration of kilobase-pair length double-stranded DNA targets, and observed little preconcentration of 60 base-pair length single-stranded DNA probes. These objectives were accomplished in microdevice formats that are compatible with larger detection systems for sample pre-processing. Combined with Columbia's expertise, this technology would enable a unique, fast, and potentially compact method for detecting/identifying genetically-modified organisms and multiplexed rapid nucleic acid identification. Another competing approach is the DARPA funded IRIS Pharmaceutical TIGER platform which requires many hours for operation, and an 800k$ piece of equipment that fills a room. The Columbia/SNL system could provide a result in 30 minutes, at the cost of a few thousand dollars for the platform, and would be the size of a shoebox or smaller.

  18. Magnetic Helicity and Large Scale Magnetic Fields: A Primer

    NASA Astrophysics Data System (ADS)

    Blackman, Eric G.

    2015-05-01

    Magnetic fields of laboratory, planetary, stellar, and galactic plasmas commonly exhibit significant order on large temporal or spatial scales compared to the otherwise random motions within the hosting system. Such ordered fields can be measured in the case of planets, stars, and galaxies, or inferred indirectly by the action of their dynamical influence, such as jets. Whether large scale fields are amplified in situ or a remnant from previous stages of an object's history is often debated for objects without a definitive magnetic activity cycle. Magnetic helicity, a measure of twist and linkage of magnetic field lines, is a unifying tool for understanding large scale field evolution for both mechanisms of origin. Its importance stems from its two basic properties: (1) magnetic helicity is typically better conserved than magnetic energy; and (2) the magnetic energy associated with a fixed amount of magnetic helicity is minimized when the system relaxes this helical structure to the largest scale available. Here I discuss how magnetic helicity has come to help us understand the saturation of and sustenance of large scale dynamos, the need for either local or global helicity fluxes to avoid dynamo quenching, and the associated observational consequences. I also discuss how magnetic helicity acts as a hindrance to turbulent diffusion of large scale fields, and thus a helper for fossil remnant large scale field origin models in some contexts. I briefly discuss the connection between large scale fields and accretion disk theory as well. The goal here is to provide a conceptual primer to help the reader efficiently penetrate the literature.

  19. A primer on trace metal-sediment chemistry

    USGS Publications Warehouse

    Horowitz, Arthur J.

    1985-01-01

    In most aquatic systems, concentrations of trace metals in suspended sediment and the top few centimeters of bottom sediment are far greater than concentrations of trace metals dissolved in the water column. Consequently, the distribution, transport, and availability of these constituents can not be intelligently evaluated, nor can their environmental impact be determined or predicted solely through the sampling and analysis of dissolved phases. This Primer is designed to acquaint the reader with the basic principles that govern the concentration and distribution of trace metals associated with bottom and suspended sediments. The sampling and analysis of suspended and bottom sediments are very important for monitoring studies, not only because trace metal concentrations associated with them are orders of magnitude higher than in the dissolved phase, but also because of several other factors. Riverine transport of trace metals is dominated by sediment. In addition, bottom sediments serve as a source for suspended sediment and can provide a historical record of chemical conditions. This record will help establish area baseline metal levels against which existing conditions can be compared. Many physical and chemical factors affect a sediment's capacity to collect and concentrate trace metals. The physical factors include grain size, surface area, surface charge, cation exchange capacity, composition, and so forth. Increases in metal concentrations are strongly correlated with decreasing grain size and increasing surface area, surface charge, cation exchange capacity, and increasing concentrations of iron and manganese oxides, organic matter, and clay minerals. Chemical factors are equally important, especially for differentiating between samples having similar bulk chemistries and for inferring or predicting environmental availability. Chemical factors entail phase associations (with such sedimentary components as interstitial water, sulfides, carbonates, and organic

  20. Abridged adapter primers increase the target scope of Hi-Plex.

    PubMed

    Nguyen-Dumont, Tú; Hammet, Fleur; Mahmoodi, Maryam; Pope, Bernard J; Giles, Graham G; Hopper, John L; Southey, Melissa C; Park, Daniel J

    2015-01-01

    Previously, we reported Hi-Plex, an amplicon-based method for targeted massively parallel sequencing capable of generating 60 amplicons simultaneously. In further experiments, however, we found our approach did not scale to higher amplicon numbers. Here, we report a modification to the original Hi-Plex protocol that includes the use of abridged adapter oligonucleotides as universal primers (bridge primers) in the initial PCR mixture. Full-length adapter primers (indexing primers) are included only during latter stages of thermal cycling with concomitant application of elevated annealing temperatures. Using this approach, we demonstrate the application of Hi-Plex across a broad range of amplicon numbers (16-plex, 62-plex, 250-plex, and 1003-plex) while preserving the low amount (25 ng) of input DNA required.

  1. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico.

    PubMed

    Bastida-González, Fernando; Ramírez-Hernández, Dolores G; Chavira-Suárez, Erika; Lara-Padilla, Eleazar; Zárate-Segura, Paola

    2016-01-01

    Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing.

  2. FUNGAL-SPECIFIC PCR PRIMERS DEVELOPED FOR ANALYSIS OF THE ITS REGION OF ENVIRONMENTAL DNA EXTRACTS

    EPA Science Inventory

    Background The Internal Transcribed Spacer (ITS) regions of fungal ribosomal DNA (rDNA) are highly variable sequences of great importance in distinguishing fungal species by PCR analysis. Previously published PCR primers available for amplifying these sequences from environmenta...

  3. A Telecommunications Primer for College Presidents. Part I. The Technologies Defined. Educational Technology Profile 25.

    ERIC Educational Resources Information Center

    Smith, Ralph Lee

    1978-01-01

    Intended for use by presidents, planners, and administrators to acquaint them with developments in electronic communications, this primer describes cable television, common carrier, videotape recorders and videodiscs, satellites, microwave, circuit integration, digital transmission, data packet switching, and fiber optics. (LBH)

  4. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico

    PubMed Central

    Ramírez-Hernández, Dolores G.; Lara-Padilla, Eleazar; Zárate-Segura, Paola

    2016-01-01

    Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing. PMID:27563666

  5. Rapid DNA extraction methods and new primers for randomly amplified polymorphic DNA analysis of Giardia duodenalis.

    PubMed

    Deng, M Q; Cliver, D O

    1999-08-01

    A randomly amplified polymorphic DNA (RAPD) procedure using simple genomic DNA preparation methods and newly designed primers was optimized for analyzing Giardia duodenalis strains. Genomic DNA was extracted from in vitro cultivated trophozoites by five freezing-thawing cycles or by sonic treatment. Compared to a conventional method involving proteinase K digestion and phenol extraction, both freezing-thawing and sonication were equally efficient, yet with the advantage of being much less time- and labor-intensive. Five of the 10 tested RAPD primers produced reproducible polymorphisms among five human origin G. duodenalis strains, and grouping of these strains based on RAPD profiles was in agreement among these primers. The consistent classification of two standard laboratory reference strains, Portland-1 and WB, in the same group confirmed previous results using other fingerprinting methods, indicating that the reported simple DNA extraction methods and the selected primers are useful in RAPD for molecular characterization of G. duodenalis strains.

  6. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico.

    PubMed

    Bastida-González, Fernando; Ramírez-Hernández, Dolores G; Chavira-Suárez, Erika; Lara-Padilla, Eleazar; Zárate-Segura, Paola

    2016-01-01

    Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing. PMID:27563666

  7. Oligonucleotide primers, probes and molecular methods for the environmental monitoring of methanogenic archaea

    PubMed Central

    Narihiro, Takashi; Sekiguchi, Yuji

    2011-01-01

    Summary For the identification and quantification of methanogenic archaea (methanogens) in environmental samples, various oligonucleotide probes/primers targeting phylogenetic markers of methanogens, such as 16S rRNA, 16S rRNA gene and the gene for the α‐subunit of methyl coenzyme M reductase (mcrA), have been extensively developed and characterized experimentally. These oligonucleotides were designed to resolve different groups of methanogens at different taxonomic levels, and have been widely used as hybridization probes or polymerase chain reaction primers for membrane hybridization, fluorescence in situ hybridization, rRNA cleavage method, gene cloning, DNA microarray and quantitative polymerase chain reaction for studies in environmental and determinative microbiology. In this review, we present a comprehensive list of such oligonucleotide probes/primers, which enable us to determine methanogen populations in an environment quantitatively and hierarchically, with examples of the practical applications of the probes and primers. PMID:21375721

  8. Streamlining DNA Barcoding Protocols: Automated DNA Extraction and a New cox1 Primer in Arachnid Systematics

    PubMed Central

    Vidergar, Nina; Toplak, Nataša; Kuntner, Matjaž

    2014-01-01

    Background DNA barcoding is a popular tool in taxonomic and phylogenetic studies, but for most animal lineages protocols for obtaining the barcoding sequences—mitochondrial cytochrome C oxidase subunit I (cox1 AKA CO1)—are not standardized. Our aim was to explore an optimal strategy for arachnids, focusing on the species-richest lineage, spiders by (1) improving an automated DNA extraction protocol, (2) testing the performance of commonly used primer combinations, and (3) developing a new cox1 primer suitable for more efficient alignment and phylogenetic analyses. Methodology We used exemplars of 15 species from all major spider clades, processed a range of spider tissues of varying size and quality, optimized genomic DNA extraction using the MagMAX Express magnetic particle processor—an automated high throughput DNA extraction system—and tested cox1 amplification protocols emphasizing the standard barcoding region using ten routinely employed primer pairs. Results The best results were obtained with the commonly used Folmer primers (LCO1490/HCO2198) that capture the standard barcode region, and with the C1-J-2183/C1-N-2776 primer pair that amplifies its extension. However, C1-J-2183 is designed too close to HCO2198 for well-interpreted, continuous sequence data, and in practice the resulting sequences from the two primer pairs rarely overlap. We therefore designed a new forward primer C1-J-2123 60 base pairs upstream of the C1-J-2183 binding site. The success rate of this new primer (93%) matched that of C1-J-2183. Conclusions The use of C1-J-2123 allows full, indel-free overlap of sequences obtained with the standard Folmer primers and with C1-J-2123 primer pair. Our preliminary tests suggest that in addition to spiders, C1-J-2123 will also perform in other arachnids and several other invertebrates. We provide optimal PCR protocols for these primer sets, and recommend using them for systematic efforts beyond DNA barcoding. PMID:25415202

  9. Challenges with using primer IDs to improve accuracy of next generation sequencing.

    PubMed

    Brodin, Johanna; Hedskog, Charlotte; Heddini, Alexander; Benard, Emmanuel; Neher, Richard A; Mild, Mattias; Albert, Jan

    2015-01-01

    Next generation sequencing technologies, like ultra-deep pyrosequencing (UDPS), allows detailed investigation of complex populations, like RNA viruses, but its utility is limited by errors introduced during sample preparation and sequencing. By tagging each individual cDNA molecule with barcodes, referred to as Primer IDs, before PCR and sequencing these errors could theoretically be removed. Here we evaluated the Primer ID methodology on 257,846 UDPS reads generated from a HIV-1 SG3Δenv plasmid clone and plasma samples from three HIV-infected patients. The Primer ID consisted of 11 randomized nucleotides, 4,194,304 combinations, in the primer for cDNA synthesis that introduced a unique sequence tag into each cDNA molecule. Consensus template sequences were constructed for reads with Primer IDs that were observed three or more times. Despite high numbers of input template molecules, the number of consensus template sequences was low. With 10,000 input molecules for the clone as few as 97 consensus template sequences were obtained due to highly skewed frequency of resampling. Furthermore, the number of sequenced templates was overestimated due to PCR errors in the Primer IDs. Finally, some consensus template sequences were erroneous due to hotspots for UDPS errors. The Primer ID methodology has the potential to provide highly accurate deep sequencing. However, it is important to be aware that there are remaining challenges with the methodology. In particular it is important to find ways to obtain a more even frequency of resampling of template molecules as well as to identify and remove artefactual consensus template sequences that have been generated by PCR errors in the Primer IDs.

  10. Resin bonding of metal brackets to glazed zirconia with a porcelain primer

    PubMed Central

    Lee, Jung-Hwan; Lee, Milim; Kim, Kyoung-Nam

    2015-01-01

    Objective The aims of this study were to compare the shear bond strength between orthodontic metal brackets and glazed zirconia using different types of primer before applying resin cement and to determine which primer was more effective. Methods Zirconia blocks were milled and embedded in acrylic resin and randomly assigned to one of four groups: nonglazed zirconia with sandblasting and zirconia primer (NZ); glazed zirconia with sandblasting, etching, and zirconia primer (GZ); glazed zirconia with sandblasting, etching, and porcelain primer (GP); and glazed zirconia with sandblasting, etching, zirconia primer, and porcelain primer (GZP). A stainless steel metal bracket was bonded to each target surface with resin cement, and all specimens underwent thermal cycling. The shear bond strength of the specimens was measured by a universal testing machine. A scanning electron microscope, three-dimensional optical surface-profiler, and stereoscopic microscope were used to image the zirconia surfaces. The data were analyzed with one-way analyses of variance and the Fisher exact test. Results Group GZ showed significantly lower shear bond strength than did the other groups. No statistically significant differences were found among groups NZ, GP, and GZP. All specimens in group GZ showed adhesive failure between the zirconia and resin cement. In groups NZ and GP, bonding failed at the interface between the resin cement and bracket base or showed complex adhesive and cohesive failure. Conclusions Porcelain primer is the more appropriate choice for bonding a metal bracket to the surface of a full-contour glazed zirconia crown with resin cement. PMID:26629476

  11. Adhesive bonding and the use of corrosion resistant primers. [for metal surface preparation

    NASA Technical Reports Server (NTRS)

    Hockridge, R. R.; Thibault, H. G.

    1972-01-01

    The use of an anti-corrosive primer has been shown to be essential to assure survival of a bonded structure in a hostile environment, particularly if a stress is to be applied to the adhesively bonded joint during the environmental exposure. For example, the Lockheed L-1011 TriStar assembly, after exhaustive evaluation tests specifies use of chromate filled inhibitive polysulfide sealants, and use of corrosion inhibiting adhesive primers prior to structural bonding with film adhesive.

  12. Composing Effective and Efficient E-mails: A Primer for Pharmacy Practitioners

    PubMed Central

    Feemster, Agnes Ann

    2015-01-01

    This primer describes the purpose and importance of e-mail as a key communication medium in the workplace. It emphasizes clarity as a primary modality to enhance efficiency and effectiveness. Finally, the primer reviews elements of grammar, punctuation, and style that contribute to each e-mail’s ability to meet language standards, enhance the writer’s image, and successfully transmit information. PMID:26715801

  13. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates.

    PubMed

    Folmer, O; Black, M; Hoeh, W; Lutz, R; Vrijenhoek, R

    1994-10-01

    We describe "universal" DNA primers for polymerase chain reaction (PCR) amplification of a 710-bp fragment of the mitochondrial cytochrome c oxidase subunit I gene (COI) from 11 invertebrate phyla: Echinodermata, Mollusca, Annelida, Pogonophora, Arthropoda, Nemertinea, Echiura, Sipuncula, Platyhelminthes, Tardigrada, and Coelenterata, as well as the putative phylum Vestimentifera. Preliminary comparisons revealed that these COI primers generate informative sequences for phylogenetic analyses at the species and higher taxonomic levels.

  14. Comparison of shear bond strength of orthodontic brackets using various zirconia primers

    PubMed Central

    Lee, Ji-Yeon; Kim, Jin-Seok

    2015-01-01

    Objective The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. Methods We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm2. The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). Results The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Conclusions Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses. PMID:26258062

  15. A Primer on Population Health Management and Its Perioperative Application.

    PubMed

    Boudreaux, Arthur M; Vetter, Thomas R

    2016-07-01

    The movement toward value-based payment models, driven by governmental policies, federal statutes, and market forces, is propelling the importance of effectively managing the health of populations to the forefront in the United States and other developed countries. However, for many anesthesiologists, population health management is a new or even foreign concept. A primer on population health management and its potential perioperative application is thus presented here. Although it certainly continues to evolve, population health management can be broadly defined as the specific policies, programs, and interventions directed at optimizing population health. The Population Health Alliance has created a particularly cogent conceptual framework and interconnected and very useful population health process model, which together identify the key components of population health and its management. Population health management provides a useful rationale for patients, providers, payers, and policymakers to move collectively away from the traditional system of individual, siloed providers to a more integrated, coordinated, team-based approach, thus creating a holistic view of the patient population. The goal of population health management is to keep the targeted patient population as healthy as possible, thus minimizing the need for costly interventions such as emergency department visits, acute hospitalizations, laboratory testing and imaging, and diagnostic and therapeutic procedures. Population health management strategies are increasingly more important to leaders of health care systems as the health of populations for which they care, especially in a strong cost risk-sharing environment, must be optimized. Most population health management efforts rely on a patient-centric team approach, coordination of care, effective communication, robust outcomes data analysis, and continuous quality improvement. Anesthesiologists have an opportunity to help lead these efforts in

  16. Primer and platform effects on 16S rRNA tag sequencing

    DOE PAGES

    Tremblay, Julien; Singh, Kanwar; Fern, Alison; Kirton, Edward S.; He, Shaomei; Woyke, Tanja; Lee, Janey; Chen, Feng; Dangl, Jeffery L.; Tringe, Susannah G.

    2015-08-04

    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

  17. PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.

    PubMed

    Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong

    2015-01-01

    Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.

  18. UniPrime2: a web service providing easier Universal Primer design

    PubMed Central

    Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C.

    2009-01-01

    The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence. PMID:19401435

  19. Morphological categorization of acid-base resistant zones with self-etching primer adhesive systems.

    PubMed

    Inoue, Go; Nikaido, Toru; Sadr, Alireza; Tagami, Junji

    2012-01-01

    This study investigated the influence of the composition of self-etching primer adhesive systems on the morphology of acid-base resistant zones (ABRZs). One-step self-etching primer systems (Clearfil Tri-S Bond, G-Bond, and One-Up Bond F Plus) and two-step self-etching primer systems (Clearfil SE Bond, Clearfil Protect Bond, UniFil Bond, and Mac Bond II) were used in this study. Each adhesive was applied on prepared dentin disk surfaces, and a resin composite was placed between two dentin disks. All resin-bonded specimens were subjected to acid-base challenge. Observation under a scanning electron microscope (SEM) revealed the creation of an ABRZ adjacent to the hybrid layer for all the self-etch primer adhesive systems, even when non-fluoride releasing adhesives were used. The presence of fluoride in two-step self-etching adhesive significantly increased the thickness of ABRZ created. Results suggested that an ABRZ was created with the use of self-etching primer adhesive systems, but its morphology differed between one-and two-step self-etching primer adhesive systems and was influenced by fluoride release activity.

  20. Primer and platform effects on 16S rRNA tag sequencing

    SciTech Connect

    Tremblay, Julien; Singh, Kanwar; Fern, Alison; Kirton, Edward S.; He, Shaomei; Woyke, Tanja; Lee, Janey; Chen, Feng; Dangl, Jeffery L.; Tringe, Susannah G.

    2015-08-04

    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as well as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.

  1. Effect of metal primers and tarnish treatment on bonding between dental alloys and veneer resin

    PubMed Central

    Choo, Seung-Sik; Huh, Yoon-Hyuk; Cho, Lee-Ra

    2015-01-01

    PURPOSE The aim of this study was to evaluate the effect of metal primers on the bonding of dental alloys and veneer resin. Polyvinylpyrrolidone solution's tarnish effect on bonding strength was also investigated. MATERIALS AND METHODS Disk-shape metal specimens (diameter 8 mm, thickness 1.5 mm) were made from 3 kinds of alloy (Co-Cr, Ti and Au-Ag-Pd alloy) and divided into 4 groups per each alloy. Half specimens (n=12 per group) in tarnished group were immersed into polyvinylpyrrolidone solution for 24 hours. In Co-Cr and Ti-alloy, Alloy Primer (MDP + VBATDT) and MAC-Bond II (MAC-10) were applied, while Alloy Primer and V-Primer (VBATDT) were applied to Au-Ag-Pd alloys. After surface treatment, veneering composite resin were applied and shear bond strength test were conducted. RESULTS Alloy Primer showed higher shear bond strength than MAC-Bond II in Co-Cr alloys and Au-Ag-Pd alloy (P<.05). However, in Ti alloy, there was no significant difference between Alloy Primer and MAC-Bond II. Tarnished Co-Cr and Au-Ag-Pd alloy surfaces presented significantly decreased shear bond strength. CONCLUSION Combined use of MDP and VBATDT were effective in bonding of the resin to Co-Cr and Au-Ag-Pd alloy. Tarnish using polyvinylpyrrolidone solution negatively affected on the bonding of veneer resin to Co-Cr and Au-Ag-Pd alloys. PMID:26576256

  2. Primer-Dependent and Primer-Independent Initiation of Double Stranded RNA Synthesis by Purified Arabidopsis RNA-Dependent RNA Polymerases RDR2 and RDR6

    PubMed Central

    Devert, Anthony; Fabre, Nicolas; Floris, Maïna; Canard, Bruno; Robaglia, Christophe; Crété, Patrice

    2015-01-01

    Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer-independent and primer-dependent RNA polymerase activities with different efficiencies. We further show that RDR2 and RDR6 can initiate dsRNA synthesis either by elongation of 21- to 24- nucleotides RNAs hybridized to complementary RNA template or by elongation of self-primed RNA template. These findings provide new insights into our understanding of the molecular mechanisms of RNA silencing in plants. PMID:25793874

  3. Primer-dependent and primer-independent initiation of double stranded RNA synthesis by purified Arabidopsis RNA-dependent RNA polymerases RDR2 and RDR6.

    PubMed

    Devert, Anthony; Fabre, Nicolas; Floris, Maïna; Canard, Bruno; Robaglia, Christophe; Crété, Patrice

    2015-01-01

    Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer-independent and primer-dependent RNA polymerase activities with different efficiencies. We further show that RDR2 and RDR6 can initiate dsRNA synthesis either by elongation of 21- to 24- nucleotides RNAs hybridized to complementary RNA template or by elongation of self-primed RNA template. These findings provide new insights into our understanding of the molecular mechanisms of RNA silencing in plants. PMID:25793874

  4. Influence of acid-etching and ceramic primers on the repair of a glass ceramic.

    PubMed

    Queiroz, J R C; Souza, Rodrigo O A; Nogueira Junior, L; Ozcan, M; Bottino, M A

    2012-01-01

    The objective of this study was to evaluate the influence of different primers on the microtensile bond strength (μTBS) between a feldspathic ceramic and two composites. Forty blocks (6.0 x 6.0 x 5.0 mm³) were prepared from Vita Mark II . After polishing, they were randomly divided into 10 groups according to the surface treatment: Group 1, hydrofluoric acid 10% (HF) + silane; Group 2, CoJet + silane; Group 3, HF + Metal/Zirconia Primer; Group 4, HF + Clearfil Primer; Group 5, HF + Alloy Primer; Group 6, HF + V-Primer; Group 7, Metal/Zirconia Primer; Group 8, Clearfil Primer; Group 9, Alloy Primer; Group 10, V-Primer. After each surface treatment, an adhesive was applied and one of two composite resins was incrementally built up. The sticks obtained from each block (bonded area: 1.0 mm² ± 0.2 mm) were stored in distilled water at 37 degrees C for 30 days and submitted to thermocycling (7,000 cycles; 5 degrees C/55 degrees C ± 1 degree C). The μTBS test was carried out using a universal testing machine (1.0 mm/min). Data were analyzed using ANOVA and a Tukey test (a = 0.05). The surface treatments significantly affected the results (P < 0.05); no difference was observed between the composites (P > 0.05). The bond strength means (MPa) were as follows: Group 1a = 29.6; Group 1b = 33.7; Group 2a = 28.9; Group 2b = 27.1; Group 3a = 13.8; Group 3b = 14.9; Group 4a = 18.6; Group 4b = 19.4; Group 5a = 15.3; Group 5b = 16.5; Group 6a = 11; Group 6b = 18; Groups 7a to 10b = 0. While the use of primers alone was not sufficient for adequate bond strengths to feldspathic ceramic, HF etching followed by any silane delivered higher bond strength. PMID:22414522

  5. Influence of acid-etching and ceramic primers on the repair of a glass ceramic.

    PubMed

    Queiroz, J R C; Souza, Rodrigo O A; Nogueira Junior, L; Ozcan, M; Bottino, M A

    2012-01-01

    The objective of this study was to evaluate the influence of different primers on the microtensile bond strength (μTBS) between a feldspathic ceramic and two composites. Forty blocks (6.0 x 6.0 x 5.0 mm³) were prepared from Vita Mark II . After polishing, they were randomly divided into 10 groups according to the surface treatment: Group 1, hydrofluoric acid 10% (HF) + silane; Group 2, CoJet + silane; Group 3, HF + Metal/Zirconia Primer; Group 4, HF + Clearfil Primer; Group 5, HF + Alloy Primer; Group 6, HF + V-Primer; Group 7, Metal/Zirconia Primer; Group 8, Clearfil Primer; Group 9, Alloy Primer; Group 10, V-Primer. After each surface treatment, an adhesive was applied and one of two composite resins was incrementally built up. The sticks obtained from each block (bonded area: 1.0 mm² ± 0.2 mm) were stored in distilled water at 37 degrees C for 30 days and submitted to thermocycling (7,000 cycles; 5 degrees C/55 degrees C ± 1 degree C). The μTBS test was carried out using a universal testing machine (1.0 mm/min). Data were analyzed using ANOVA and a Tukey test (a = 0.05). The surface treatments significantly affected the results (P < 0.05); no difference was observed between the composites (P > 0.05). The bond strength means (MPa) were as follows: Group 1a = 29.6; Group 1b = 33.7; Group 2a = 28.9; Group 2b = 27.1; Group 3a = 13.8; Group 3b = 14.9; Group 4a = 18.6; Group 4b = 19.4; Group 5a = 15.3; Group 5b = 16.5; Group 6a = 11; Group 6b = 18; Groups 7a to 10b = 0. While the use of primers alone was not sufficient for adequate bond strengths to feldspathic ceramic, HF etching followed by any silane delivered higher bond strength.

  6. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    NASA Astrophysics Data System (ADS)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  7. Functional genes to assess nitrogen cycling and aromatic hydrocarbon degradation: primers and processing matter

    PubMed Central

    Penton, C. Ryan; Johnson, Timothy A.; Quensen, John F.; Iwai, Shoko; Cole, James R.; Tiedje, James M.

    2013-01-01

    Targeting sequencing to genes involved in key environmental processes, i.e., ecofunctional genes, provides an opportunity to sample nature's gene guilds to greater depth and help link community structure to process-level outcomes. Vastly different approaches have been implemented for sequence processing and, ultimately, for taxonomic placement of these gene reads. The overall quality of next generation sequence analysis of functional genes is dependent on multiple steps and assumptions of unknown diversity. To illustrate current issues surrounding amplicon read processing we provide examples for three ecofunctional gene groups. A combination of in silico, environmental and cultured strain sequences was used to test new primers targeting the dioxin and dibenzofuran degrading genes dxnA1, dbfA1, and carAa. The majority of obtained environmental sequences were classified into novel sequence clusters, illustrating the discovery value of the approach. For the nitrite reductase step in denitrification, the well-known nirK primers exhibited deficiencies in reference database coverage, illustrating the need to refine primer-binding sites and/or to design multiple primers, while nirS primers exhibited bias against five phyla. Amino acid-based OTU clustering of these two N-cycle genes from soil samples yielded only 114 unique nirK and 45 unique nirS genus-level groupings, likely a reflection of constricted primer coverage. Finally, supervised and non-supervised OTU analysis methods were compared using the nifH gene of nitrogen fixation, with generally similar outcomes, but the clustering (non-supervised) method yielded higher diversity estimates and stronger site-based differences. High throughput amplicon sequencing can provide inexpensive and rapid access to nature's related sequences by circumventing the culturing barrier, but each unique gene requires individual considerations in terms of primer design and sequence processing and classification. PMID:24062736

  8. New primers for detecting and quantifying denitrifying anaerobic methane oxidation archaea in different ecological niches.

    PubMed

    Ding, Jing; Ding, Zhao-Wei; Fu, Liang; Lu, Yong-Ze; Cheng, Shuk H; Zeng, Raymond J

    2015-11-01

    The significance of ANME-2d in methane sink in the environment has been overlooked, and there was no any study evaluating the distribution of ANME-2d in the environment. New primers were thus needed to be designed for following research. In this paper, a pair of primers (DP397F and DP569R) was designed to quantify ANME-2d. The specificity and amplification efficiency of this primer pair were acceptable. PCR amplification of another pair of primers (DP142F and DP779R) generated a single, bright targeted band from the enrichment sample, but yielded faint, multiple bands from the environmental samples. Nested PCR was conducted using the primers DP142F/DP779R in the first round and DP142F/DP569R in the second round, which generated a bright targeted band. Further phylogenetic analysis showed that these targeted bands were ANME-2d-related sequences. Real-time PCR showed that the copies of the 16s ribosomal RNA gene of ANME-2d in these samples ranged from 3.72 × 10(4) to 2.30 × 10(5) copies μg(-1) DNA, indicating that the percentage of ANME-2d was greatest in a polluted river sample and least in a rice paddy sample. These results demonstrate that the newly developed real-time PCR primers could sufficiently quantify ANME-2d and that nested PCR with an appropriate combination of the new primers could successfully detect ANME-2d in environmental samples; the latter finding suggests that ANME-2d may spread in environments.

  9. Circulating primers enhance platelet function and induce resistance to antiplatelet therapy

    PubMed Central

    Blair, T A; Moore, S F; Hers, I

    2015-01-01

    Background Aspirin and P2Y12 antagonists are antiplatelet compounds that are used clinically in patients with thrombosis. However, some patients are ‘resistant’ to antiplatelet therapy, which increases their risk of developing acute coronary syndromes. These patients often present with an underlying condition that is associated with altered levels of circulating platelet primers and platelet hyperactivity. Platelet primers cannot stimulate platelet activation, but, in combination with physiologic stimuli, significantly enhance platelet function. Objectives To explore the role of platelet primers in resistance to antiplatelet therapy, and to evaluate whether phosphoinositide 3-kinase (PI3K) contributes to this process. Methods and Results We used platelet aggregation, thromboxane A2 production and ex vivo thrombus formation as functional readouts of platelet activity. Platelets were treated with the potent P2Y12 inhibitor AR-C66096, aspirin, or a combination of both, in the presence or absence of the platelet primers insulin-like growth factor-1 (IGF-1) and thrombopoietin (TPO), or the Gz-coupled receptor ligand epinephrine. We found that platelet primers largely overcame the inhibitory effects of antiplatelet compounds on platelet functional responses. IGF-1-mediated and TPO-mediated, but not epinephrine-mediated, enhancements in the presence of antiplatelet drugs were blocked by the PI3K inhibitors wortmannin and LY294002. Conclusions These results demonstrate that platelet primers can contribute to antiplatelet resistance. Furthermore, our data demonstrate that there are PI3K-dependent and PI3K-independent mechanisms driving primer-mediated resistance to antiplatelet therapy. PMID:26039631

  10. Dental primer and adhesive containing a new antibacterial quaternary ammonium monomer dimethylaminododecyl methacrylate

    PubMed Central

    Cheng, Lei; Weir, Michael D.; Zhang, Ke; Arola, Dwayne D.; Zhou, Xuedong; Xu, Hockin H. K.

    2013-01-01

    Objectives The main reason for restoration failure is secondary caries caused by biofilm acids. Replacing the failed restorations accounts for 50–70% of all operative work. The objectives of this study were to incorporate a new quaternary ammonium monomer (dimethylaminododecyl methacrylate, DMADDM) and nanoparticles of silver (NAg) into a primer and an adhesive, and to investigate their effects on antibacterial and dentin bonding properties. Methods Scotchbond Multi-Purpose (SBMP) served as control. DMADDM was synthesized and incorporated with NAg into primer/adhesive. A dental plaque microcosm biofilm model with human saliva was used to investigate metabolic activity, colony-forming units (CFU), and lactic acid. Dentin shear bond strengths were measured. Results Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of the new DMADDM were orders of magnitude lower than those of a previous quaternary ammonium dimethacrylate (QADM). Uncured primer with DMADDM had much larger inhibition zones than QADM (p<0.05). Cured primer/adhesive with DMADDM-NAg greatly reduced biofilm metabolic activity (p<0.05). Combining DMADDM with NAg in primer/adhesive resulted in less CFU than DMADDM alone (p<0.05). Lactic acid production by biofilms was reduced by 20-fold via DMADDM-NAg, compared to control. Incorporation of DMADDM and NAg into primer/adhesive did not adversely affect dentin bond strength. Conclusions A new antibacterial monomer DMADDM was synthesized and incorporated into primer/adhesive for the first time. The bonding agents are promising to combat residual bacteria in tooth cavity and invading bacteria at tooth-restoration margins to inhibit caries. DMADDM and NAg are promising for use into a wide range of dental adhesive systems and restoratives. PMID:23353068

  11. Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

    PubMed

    Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

    2014-08-01

    Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics. PMID:25229098

  12. MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR

    PubMed Central

    Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo

    2015-01-01

    Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. PMID:26109350

  13. Evaluating Primers for Profiling Anaerobic Ammonia Oxidizing Bacteria within Freshwater Environments

    PubMed Central

    Sonthiphand, Puntipar; Neufeld, Josh D.

    2013-01-01

    Anaerobic ammonia oxidizing (anammox) bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE) fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r) for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r) was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library analysis, A438f/A684r

  14. Evaluating primers for profiling anaerobic ammonia oxidizing bacteria within freshwater environments.

    PubMed

    Sonthiphand, Puntipar; Neufeld, Josh D

    2013-01-01

    Anaerobic ammonia oxidizing (anammox) bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE) fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r) for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r) was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library analysis, A438f/A684r

  15. Ceramic primer heat-treatment effect on resin cement/Y-TZP bond strength.

    PubMed

    Silva, L H; Costa, A K F; Queiroz, J R C; Bottino, M A; Valandro, L F

    2012-01-01

    The purpose of this study was to evaluate the effect of different heat-treatment strategies for a ceramic primer on the shear bond strength of a 10-methacryloyloxydecyl-dihydrogen-phosphate (MDP)-based resin cement to a yttrium-stabilized tetragonal zirconia polycrystal (Y-TZP) ceramic. Specimens measuring 4.5 × 3.5 × 4.5 mm(3) were produced from Y-TZP presintered cubes and embedded in polymethyl methacrylate (PMMA). Following finishing, the specimens were cleaned using an ultrasound device and distilled water and randomly divided into 10 experimental groups (n=14) according to the heat treatment of the ceramic primer and aging condition. The strategies used for the experimental groups were: GC (control), without primer; G20, primer application at ambient temperature (20°C); G45, primer application + heat treatment at 45°C; G79, primer application + heat treatment at 79°C; and G100, primer application + heat treatment at 100°C. The specimens from the aging groups were submitted to thermal cycling (6000 cycles, 5°C/55°C, 30 seconds per bath) after 24 hours. A cylinder of MDP-based resin cement (2.4 mm in diameter) was constructed on the ceramic surface of the specimens of each experimental group and stored for 24 hours at 37°C. The specimens were submitted to a shear bond strength test (n=14). Thermal gravimetric analysis was performed on the ceramic primer. The data obtained were statistically analyzed by two-way analysis of variance and the Tukey test (α=0.05). The experimental group G79 without aging (7.23 ± 2.87 MPa) presented a significantly higher mean than the other experimental groups without aging (GC: 2.81 ± 1.5 MPa; G20: 3.38 ± 2.21 MPa; G100: 3.96 ± 1.57 MPa), showing no difference from G45 only (G45: 6 ± 3.63 MPa). All specimens of the aging groups debonded during thermocycling and were considered to present zero bond strength for the statistical analyses. In conclusion, heat treatment of the metal/zirconia primer improved bond strength

  16. Enhanced primers for amplification of DNA barcodes from a broad range of marine metazoans

    PubMed Central

    2013-01-01

    Background Building reference libraries of DNA barcodes is relatively straightforward when specifically designed primers are available to amplify the COI-5P region from a relatively narrow taxonomic group (e.g. single class or single order). DNA barcoding marine communities have been comparatively harder to accomplish due to the broad taxonomic diversity and lack of consistently efficient primers. Although some of the so-called “universal” primers have been relatively successful, they still fail to amplify COI-5P of many marine animal groups, while displaying random success even among species within each group. Here we propose a new pair of primers designed to enhance amplification of the COI-5P region in a wide range of marine organisms. Results Amplification tests conducted on a wide range of marine animal taxa, rendered possible the first–time sequencing of DNA barcodes from eight separated phyla (Annelida, Arthropoda, Chordata, Cnidaria, Echinodermata, Mollusca, Nemertea and Platyhelminthes), comprising a total of 14 classes, 28 orders, 57 families, 68 genus and 76 species. Conclusions These primers demonstrated to be highly cost-effective, which is of key importance for DNA barcoding procedures, such as for building comprehensive DNA barcode libraries of marine communities, where the processing of a large numbers of specimens from a wide variety of marine taxa is compulsory. PMID:24020880

  17. Comparison of primer sets for T-cell clonality testing in canine intestinal lymphoma.

    PubMed

    Takanosu, Masamine; Kagawa, Yumiko

    2015-09-01

    Clonality testing based on polymerase chain reaction is an important tool for diagnosis of lymphoproliferative diseases. Many primers have been designed and used for canine clonality testing. Canine intestinal lymphoma is usually diagnosed pathologically by examination of excised intestinal or endoscopic biopsy tissues, and clonality testing is sometimes used to support the pathological diagnosis if this examination is inconclusive. In the present study, the sensitivity of each previously published primer set for clonality testing was examined by using formalin-fixed, paraffin-embedded sections from 39 cases pathologically diagnosed as canine intestinal lymphoma (large-cell type). All 39 cases were immunohistochemically positive for cluster of differentiation (CD)3. Thirty-two out of the 39 cases showed clonality in the T-cell receptor gamma (TRG) with at least 1 of the tested primers. The primer set with the highest sensitivity detected all 32 cases with TRG clonality, with a sensitivity of 82.1%. These results provide useful evidence for the selection of primer sets for clonality testing of canine intestinal lymphoma.

  18. Multicolor-based discrimination of 21 short tandem repeats and amelogenin using four fluorescent universal primers.

    PubMed

    Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko

    2016-02-01

    The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. PMID:26505528

  19. The effect of various primers on shear bond strength of zirconia ceramic and resin composite

    PubMed Central

    Sanohkan, Sasiwimol; Kukiattrakoon, Boonlert; Larpboonphol, Narongrit; Sae-Yib, Taewalit; Jampa, Thibet; Manoppan, Satawat

    2013-01-01

    Aims: To determine the in vitro shear bond strengths (SBS) of zirconia ceramic to resin composite after various primer treatments. Materials and Methods: Forty zirconia ceramic (Zeno, Wieland Dental) specimens (10 mm in diameter and 2 mm thick) were prepared, sandblasted with 50 μm alumina, and divided into four groups (n = 10). Three experimental groups were surface treated with three primers; CP (RelyX Ceramic Primer, 3M ESPE), AP (Alloy Primer, Kuraray Medical), and MP (Monobond Plus, Ivoclar Vivadent AG). One group was not treated and served as the control. All specimens were bonded to a resin composite (Filtek Supreme XT, 3M ESPE) cylinder with an adhesive system (Adper Scotchbond Multi-Purpose Plus Adhesive, 3M ESPE) and then stored in 100% humidity at 37°C for 24 h before SBS testing in a universal testing machine. Mean SBS (MPa) were analyzed with one-way analysis of variance (ANOVA) and the Tukey's Honestly Significant Difference (HSD) test (α = 0.05). Results: Group AP yielded the highest mean and standard deviation (SD) value of SBS (16.8 ± 2.5 MPa) and Group C presented the lowest mean and SD value (15.4 ± 1.6 MPa). The SBS did not differ significantly among the groups (P = 0.079). Conclusions: Within the limitations of this study, the SBS values between zirconia ceramic to resin composite using various primers and untreated surface were not significantly different. PMID:24347881

  20. Development of SCAR Primers for PCR Assay to Detect Diplodia seriata

    PubMed Central

    Martín, M. T.; Cuesta, M. J.; Martín, L.

    2014-01-01

    The aim of this study was to develop primer pairs for Diplodia seriata identification, one of the most common fungal species associated with grapevine decline in Castilla y León (Spain). Genetic variability of selected isolates of D. seriata was estimated. A molecular marker was generated from a random amplified polymorphic DNA (RAPD) fragment. PCR products of around 1200 bp were obtained with OPE20 primer. The PCR products were cloned and sequenced. The sequences were compared and a fragment of 1207 bp was used to design primer pairs. Two primer pairs were selected (DS3.8 S3-DS3.8 R6 and DS3.8 S3-DS3.8 R4) that amplified a single DNA product of 634 bp and 233 bp, respectively, with D. seriata isolates. No amplification was obtained for any of the 57 isolates of other species. The designed SCAR primer pairs allowed a rapid detection of D. seriata, and were able to detect 0.1 pg of the target DNA. Detection was specific and sensitive for D. seriata. The established protocols detected these fungi in naturally infected grapevines after DNA purification. Diplodia seriata was detectable without DNA purification and isolation in 62.5% to 75% of reactions. The detection of this pathogen in wood samples has great potential for use in pathogen-free certification schemes. PMID:27437468

  1. Genus-Specific Primers for Study of Fusarium Communities in Field Samples.

    PubMed

    Karlsson, Ida; Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

    2015-10-30

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology.

  2. Development of SCAR Primers for PCR Assay to Detect Diplodia seriata.

    PubMed

    Martín, M T; Cuesta, M J; Martín, L

    2014-01-01

    The aim of this study was to develop primer pairs for Diplodia seriata identification, one of the most common fungal species associated with grapevine decline in Castilla y León (Spain). Genetic variability of selected isolates of D. seriata was estimated. A molecular marker was generated from a random amplified polymorphic DNA (RAPD) fragment. PCR products of around 1200 bp were obtained with OPE20 primer. The PCR products were cloned and sequenced. The sequences were compared and a fragment of 1207 bp was used to design primer pairs. Two primer pairs were selected (DS3.8 S3-DS3.8 R6 and DS3.8 S3-DS3.8 R4) that amplified a single DNA product of 634 bp and 233 bp, respectively, with D. seriata isolates. No amplification was obtained for any of the 57 isolates of other species. The designed SCAR primer pairs allowed a rapid detection of D. seriata, and were able to detect 0.1 pg of the target DNA. Detection was specific and sensitive for D. seriata. The established protocols detected these fungi in naturally infected grapevines after DNA purification. Diplodia seriata was detectable without DNA purification and isolation in 62.5% to 75% of reactions. The detection of this pathogen in wood samples has great potential for use in pathogen-free certification schemes.

  3. Multiplex PCR based on a universal biotinylated primer to generate templates for pyrosequencing.

    PubMed

    Chen, Zhiyao; Liu, Yunlong; Duan, Wenbang; Ye, Hui; Wu, Haiping; Li, Jinheng; Zhou, Guohua

    2014-06-01

    Pyrosequencing is a powerful tool widely used in genetic analysis, however template preparation prior to pyrosequencing is still costly and time-consuming. To achieve an inexpensive and labor-saving template preparation for pyrosequencing, we have successfully developed a single-tube multiplex PCR including a pre-amplification and a universal amplification. In the process of pre-amplification, a low concentration of target-specific primers tagged with universal ends introduced universal priming regions into amplicons. In the process of universal amplification, a high concentration of universal primers was used for yielding amplicons with various SNPs of interest. As only a universal biotinylated primer and one step of single-stranded DNA preparation were required for typing multiple SNPs located on different sequences, pyrosequencing-based genotyping became time-saving, labor-saving, sample-saving, and cost-saving. By a simple optimization of multiplex PCR condition, only a 4-plex and a 3-plex PCR were required for typing 7 SNPs related to tamoxifen metabolism. Further study showed that pyrosequencing coupled with an improved multiplex PCR protocol allowed around 30% decrease of either typing cost or typing labor. Considering the biotinylated primer and the optimized condition of the multiplex PCR are independent of SNP locus, it is easy to use the same condition and the identical biotinylated primer for typing other SNPs. The preliminary typing results of the 7 SNPs in 11 samples demonstrated that multiplex PCR-based pyrosequencing could be promising in personalized medicine at a low cost.

  4. A new tetra-primer ARMS-PCR for genotyping bovine kappa-casein polymorphisms.

    PubMed

    Fonseca, P A S; Rosse, I C; Demiranda, M; Machado, M A; Verneque, R S; Peixoto, M G C D; Carvalho, M R S

    2013-12-11

    Kappa-casein (κ-casein) is one of the most abundant milk proteins. Its main function is to avoid the aggregation of casein micelles, keeping them, and therefore calcium phosphate, in pockets in solution. In bovines, a κ-casein functional polymorphism has been associated with fat, calcium, and protein milk contents and faster curd contraction in cheese production. Quicker curd contraction reduces the loss of milk solids, enhancing cheese yield. This polymorphism induces a double amino acid substitution (Thr136Ile and Ala148Asp). The polymorphism is normally detected by PCR-RFLP, which is a laborious method. An interesting methodological alternative is the tetra-primer amplification refractory mutation system PCR (tetra-primer ARMS-PCR). A tetra-primer ARMS-PCR for the detection of this κ-casein polymorphism has been described. However, specificity was not achieved, probably due to problems with primer design. We developed a new tetra-primer ARMS-PCR for the detection of the κ-casein polymorphism. This new method was validated in a double-blind test, by comparison with the results obtained for 50 Guzerá bulls formerly genotyped by PCR-RFLP. This new method achieved 100% sensitivity and specificity. We conclude that this method is a useful, cost-efficient alternative for the detection of functional κ-casein polymorphisms.

  5. Cloning flanking sequence by single-primer PCR in transgenic plants.

    PubMed

    Ma, J; Wang, Y P; Ren, S; Zhang, Z; Lu, S; Wang, P W

    2014-10-20

    The insertion position of exogenous genes in plant genomes is usually identified by adapter ligation-mediated polymerase chain reaction (PCR), thermal asymmetric interlaced PCR, and restriction site extension PCR in transgenic plant research. However, these methods have various limitations, such as the complexity of designing primers and time-consuming and multiple-step procedures. The goal of this study was to establish an easier, more rapid, and more accurate method to clone flanking sequence using single-primer PCR in transgenic plants. Unknown flanking genome sequences in transgenic plants, including those in tobacco, soybean, rice, and maize, were cloned using the single-primer PCR method established in this study, with the Bar gene as the anchor gene. The primer 1 (P1), P2, and P3 PCRs obtained 4 sequences, and the completely correct flanking sequence of 508 bp that was obtained in the P3 PCR was verified by sequencing analysis. The single-primer PCR is more rapid and accurate than conventional methods, justifying its application widely in cloning flanking sequences in transgenic plants.

  6. Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

    PubMed

    Françoso, E; Arias, M C

    2013-09-01

    Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode.

  7. Synchrotron FTIR characterisation of automotive primer surfacer paint coatings for forensic purposes.

    PubMed

    Maric, Mark; van Bronswijk, Wilhelm; Lewis, Simon W; Pitts, Kari

    2014-01-01

    Synchrotron FTIR microspectroscopy was used to characterise and assess the chemical diversity of electrocoat primer, primer surfacer and basecoats of automotive paint samples from 75 vehicles representing a range of international car manufacturers. Significant diversity was found in the synchrotron FTIR data from the primer surfacer coats. Classification using principal component analysis revealed 14 discrete groups, which could be associated with the country of manufacture, the specific manufacturer and manufacturing plant, the year of manufacture of the vehicle and in some instances the number of layers in the paint system. The model generated from the primer surfacer was significantly more discriminating than a previous model generated from FTIR analysis of clear coats of the same vehicles. Analysis of the primer surfacer also avoids issues of possible environmental degradation and component migration seen with FTIR analysis of automotive clear coats. Providing such information concerning vehicle origin would aid in the development of investigative leads from the analysis of questioned automotive paint samples located at the scene of a crime or on the body/clothing of a hit and run victim.

  8. Real-time PCR (qPCR) primer design using free online software.

    PubMed

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software.

  9. Genus-Specific Primers for Study of Fusarium Communities in Field Samples

    PubMed Central

    Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

    2015-01-01

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

  10. The use of a fluoropolymer containing primer to enhance adhesion of rotolined fluoropolymer coatings

    SciTech Connect

    Lech, L.M.

    1999-11-01

    Fluoropolymers such as PFA and ETFE are often used in rotolining applications. A common source of failure for rotolined coatings is delamination from the metal substrate. Extensive thermal cycling of the coated part, permeation of the contained liquid to the substrate, or a combination of both thermal cycling and permeation causes this. Rotolined coatings are typically applied directly to the metal part. It has been found that applying an aqueous fluoropolymer based primer to the metal substrate prior to applying the rotolined resin increases the time before delamination is observed. The primer is applied by conventional spray techniques and can either be force dried at low temperature or air-dried under ambient conditions. The primer consists primarily of a fluoropolymer such as ETFE or PFA and a bonding agent such as polyamide-imide, polyphenylene sulfide, or polyether sulfone. After the primer is applied to the metal part, the fluoropolymer in the primer melt blends with the fluoropolymer rotolining resin during the rotolining process. The bonding agent enhances the adhesion of the entire coating system to the metal part. This extends the lifetime of the rotolined coatings.

  11. Consensus-degenerate hybrid oligonucleotide primers for amplification of distantly related sequences.

    PubMed

    Rose, T M; Schultz, E R; Henikoff, J G; Pietrokovski, S; McCallum, C M; Henikoff, S

    1998-04-01

    We describe a new primer design strategy for PCR amplification of unknown targets that are related to multiply-aligned protein sequences. Each primer consists of a short 3' degenerate core region and a longer 5' consensus clamp region. Only 3-4 highly conserved amino acid residues are necessary for design of the core, which is stabilized by the clamp during annealing to template molecules. During later rounds of amplification, the non-degenerate clamp permits stable annealing to product molecules. We demonstrate the practical utility of this hybrid primer method by detection of diverse reverse transcriptase-like genes in a human genome, and by detection of C5DNA methyltransferase homologs in various plant DNAs. In each case, amplified products were sufficiently pure to be cloned without gel fractionation. This COnsensus-DEgenerate Hybrid Oligonucleotide Primer (CODEHOP) strategy has been implemented as a computer program that is accessible over the World Wide Web (http://blocks.fhcrc.org/codehop.html) and is directly linked from the BlockMaker multiple sequence alignment site for hybrid primer prediction beginning with a set of related protein sequences.

  12. A novel universal primer-multiplex-PCR method with sequencing gel electrophoresis analysis.

    PubMed

    Xu, Wentao; Zhai, Zhifang; Huang, Kunlun; Zhang, Nan; Yuan, Yanfang; Shang, Ying; Luo, Yunbo

    2012-01-01

    In this study, a novel universal primer-multiplex-PCR (UP-M-PCR) method adding a universal primer (UP) in the multiplex PCR reaction system was described. A universal adapter was designed in the 5'-end of each specific primer pairs which matched with the specific DNA sequences for each template and also used as the universal primer (UP). PCR products were analyzed on sequencing gel electrophoresis (SGE) which had the advantage of exhibiting extraordinary resolution. This method overcame the disadvantages rooted deeply in conventional multiplex PCR such as complex manipulation, lower sensitivity, self-inhibition and amplification disparity resulting from different primers, and it got a high specificity and had a low detection limit of 0.1 ng for single kind of crops when screening the presence of genetically modified (GM) crops in mixture samples. The novel developed multiplex PCR assay with sequencing gel electrophoresis analysis will be useful in many fields, such as verifying the GM status of a sample irrespective of the crop and GM trait and so on.

  13. SP-Designer: a user-friendly program for designing species-specific primer pairs from DNA sequence alignments.

    PubMed

    Villard, Pierre; Malausa, Thibaut

    2013-07-01

    SP-Designer is an open-source program providing a user-friendly tool for the design of specific PCR primer pairs from a DNA sequence alignment containing sequences from various taxa. SP-Designer selects PCR primer pairs for the amplification of DNA from a target species on the basis of several criteria: (i) primer specificity, as assessed by interspecific sequence polymorphism in the annealing regions, (ii) the biochemical characteristics of the primers and (iii) the intended PCR conditions. SP-Designer generates tables, detailing the primer pair and PCR characteristics, and a FASTA file locating the primer sequences in the original sequence alignment. SP-Designer is Windows-compatible and freely available from http://www2.sophia.inra.fr/urih/sophia_mart/sp_designer/info_sp_designer.php.

  14. Kisspeptin: a new neuronal target of primer pheromones in the control of reproductive function in mammals.

    PubMed

    Jouhanneau, Mélanie; Szymanski, Laura; Martini, Mariangela; Ella, Arsène; Keller, Matthieu

    2013-07-01

    Pheromones are known to trigger either short-term behavioral responses, usually referred to as "releaser effects", or more long-term physiological changes, known as "primer effects", which especially affect reproductive function at the level of the gonadotrope axis. The precise mechanisms through which pheromones interact with the gonadotrope axis in the hypothalamus is not fully known. We propose that the neuropeptide Kisspeptin, could be a specific target of primer pheromones, allowing these pheromones to modulate the gonadotrope axis and GnRH activity. This emerging hypothesis is discussed in the context of puberty acceleration in female mice and the male effect in female ungulates (sheep or goat). These examples have been chosen to illustrate the diversity of the reproductive contexts in mammals and potential mechanisms affected by primer effects at the level of the gonadotrope axis.

  15. Searching for Beta-Haemolysin hlb Gene in Staphylococcus pseudintermedius with Species-Specific Primers.

    PubMed

    Kmieciak, Wioletta; Szewczyk, Eligia M; Ciszewski, Marcin

    2016-07-01

    The paper presents an analysis of 51 Staphylococcus pseudintermedius clinically isolated strains from humans and from animals. Staphylococcus pseudintermedius strains' ability to produce β-haemolysin was evaluated with phenotypic methods (hot-cold effect, reverse CAMP test). In order to determine the hlb gene presence (coding for β-haemolysin) in a genomic DNA, PCR reactions were conducted with two different pairs of primers: one described in the literature for Staphylococcus aureus and recommended for analysing SIG group staphylococci and newly designed one in CLC Main Workbench software. Only reactions with newly designed primers resulted in product amplification, the presence of which was fully compatible with the results of phenotypic β-haemolysin test. Negative results for S. aureus and S. intermedius reference ATCC strains suggest that after further analysis the fragment of hlb gene amplified with primers described in this study might be included in the process of S. pseudintermedius strains identification.

  16. Novel Primers From Informative Nuclear Loci for Louse Molecular Phylogenetics (Insecta: Phthiraptera).

    PubMed

    Sweet, Andrew D; Allen, Julie M; Johnson, Kevin P

    2014-11-01

    While parasitic lice (Insecta: Phthiraptera) have historically been an important model taxon for understanding host-parasite coevolution, very few molecular markers have been developed for phylogenetic analysis. The current markers are insufficient to resolve many of the deeper nodes in this group; therefore, sequences from additional genetic loci are necessary. Here, we design primers targeting several nuclear protein coding genes based on a complete genome and transcriptome of Pediculus humanus L. plus transcriptomes and modest coverage genomic data from five genera of avian feather lice. These primers were tested on 32 genera of avian feather lice (Ischnocera), including multiple species within some genera. All of the new primer combinations produced sequences for the majority of the genera and had similar or higher divergences than the most widely used nuclear protein-coding gene in lice, EF-1α. These results indicate that these new loci will be useful in resolving phylogenetic relationships among parasitic lice. PMID:26309297

  17. Single primer-mediated circular polymerase chain reaction for hairpin DNA cloning and plasmid editing.

    PubMed

    Huang, Jiansheng; Khan, Inamullah; Liu, Rui; Yang, Yan; Zhu, Naishuo

    2016-05-01

    We developed and validated a universal polymerase chain reaction (PCR) method, single primer circular (SPC)-PCR, using single primer to simultaneously insert and amplify a short hairpin sequence into a vector with a high success rate. In this method, the hairpin structure is divided into two parts and fused into a vector by PCR. Then, a single primer is used to cyclize the chimera into a mature short hairpin RNA (shRNA) expression vector. It is not biased by loop length or palindromic structures. Six hairpin DNAs with short 4-nucleotide loops were successfully cloned. Moreover, SPC-PCR was also applied to plasmid editing within 3 h with a success rate higher than 95%.

  18. PCR primers for 30 novel gene regions in the nuclear genomes of Lepidoptera

    PubMed Central

    Wahlberg, Niklas; Peña, Carlos; Ahola, Milla; Wheat, Christopher W.; Rota, Jadranka

    2016-01-01

    Abstract We report primer pairs for 30 new gene regions in the nuclear genomes of Lepidoptera that can be amplified using a standard PCR protocol. The new primers were tested across diverse Lepidoptera, including nonditrysians and a wide selection of ditrysians. These new gene regions give a total of 11,043 bp of DNA sequence data and they show similar variability to traditionally used nuclear gene regions in studies of Lepidoptera. We feel that a PCR-based approach still has its place in molecular systematic studies of Lepidoptera, particularly at the intrafamilial level, and our new set of primers now provides a route to generating phylogenomic datasets using traditional methods. PMID:27408580

  19. Single primer-mediated circular polymerase chain reaction for hairpin DNA cloning and plasmid editing.

    PubMed

    Huang, Jiansheng; Khan, Inamullah; Liu, Rui; Yang, Yan; Zhu, Naishuo

    2016-05-01

    We developed and validated a universal polymerase chain reaction (PCR) method, single primer circular (SPC)-PCR, using single primer to simultaneously insert and amplify a short hairpin sequence into a vector with a high success rate. In this method, the hairpin structure is divided into two parts and fused into a vector by PCR. Then, a single primer is used to cyclize the chimera into a mature short hairpin RNA (shRNA) expression vector. It is not biased by loop length or palindromic structures. Six hairpin DNAs with short 4-nucleotide loops were successfully cloned. Moreover, SPC-PCR was also applied to plasmid editing within 3 h with a success rate higher than 95%. PMID:26792375

  20. Efficient newly designed primers for the amplification and sequencing of bird mitochondrial genomes.

    PubMed

    Amer, Sayed A M; Ahmed, Mohamed Mohamed; Shobrak, Mohammed

    2013-01-01

    In the present study, 27 mitochondrial genomes of diverse avian supra-orders were collected from the Genbank database and their genes were aligned separately. From the alignments, the conserved sequences were selected to design novel conserved primers for amplification and sequencing of the different mitochondrial genes. The reproducibility of these primers was tested in the amplification and sequencing of diverse avian supra-order mitochondrial genomes and was confirmed. This method helped in designing a new set of primers to accelerate both the amplification and the sequencing of bird mitogenomes. It also aids in building mitogenome markers in studying the genetic framework of endemic birds as a preliminary strategy for conservation management of them.

  1. Searching for Beta-Haemolysin hlb Gene in Staphylococcus pseudintermedius with Species-Specific Primers.

    PubMed

    Kmieciak, Wioletta; Szewczyk, Eligia M; Ciszewski, Marcin

    2016-07-01

    The paper presents an analysis of 51 Staphylococcus pseudintermedius clinically isolated strains from humans and from animals. Staphylococcus pseudintermedius strains' ability to produce β-haemolysin was evaluated with phenotypic methods (hot-cold effect, reverse CAMP test). In order to determine the hlb gene presence (coding for β-haemolysin) in a genomic DNA, PCR reactions were conducted with two different pairs of primers: one described in the literature for Staphylococcus aureus and recommended for analysing SIG group staphylococci and newly designed one in CLC Main Workbench software. Only reactions with newly designed primers resulted in product amplification, the presence of which was fully compatible with the results of phenotypic β-haemolysin test. Negative results for S. aureus and S. intermedius reference ATCC strains suggest that after further analysis the fragment of hlb gene amplified with primers described in this study might be included in the process of S. pseudintermedius strains identification. PMID:27086303

  2. Tail variation of the folding primer affects the SmartAmp2 process differently.

    PubMed

    Kimura, Yasumasa; Oguchi-Katayama, Atsuko; Kawai, Yuki; Naito, Kana; Mitani, Yasumasa; Morlighem, Jean-Etienne; Hayashizaki, Yoshihide; Lezhava, Alexander

    2009-06-12

    Folding primer (FP), together with turn-back primer (TP) and boost primer (BP), is one of the major components of SmartAmp2, a rapid amplification-based method for SNP detection. FP has a unique design where the annealing region is combined with a tail that can fold back. FP tails can be classified as either "strong" or "weak", depending on the melting temperature and free energy of the hairpin structure. We report that FP tails affect the amplification process differently; by changing the FP concentration, we can increase the amplification reaction speed with "strong tails". Unlike "strong tails", concentration change of FP with "weak tails" did not show significant impact on the amplification speed. The comparative analyses using gel electrophoresis demonstrate that the FP type and FP ratio in the reaction change the amplification pattern. The above observations can be used to optimize the reaction and manipulate the reaction speed of SmartAmp2.

  3. Detection of flaviviruses by reverse transcriptase-polymerase chain reaction with the universal primer set.

    PubMed

    Meiyu, F; Huosheng, C; Cuihua, C; Xiaodong, T; Lianhua, J; Yifei, P; Weijun, C; Huiyu, G

    1997-01-01

    Using a universal primer set designed to match the sequence of the NS1 gene of flaviviruses, the virus RNA of dengue (DEN), Japanese encephalitis (JEV), powassan and langat of Flaviviridae were successfully amplified by polymerase chain reaction (PCR) via cDNA; and with different internal primers, the serotypes of the dengue viruses were identified. Of the 78 clinically diagnosed dengue fever patients, 18 patients were positive for DEN 1, 48 patients for DEN 2 and 8 patients concurrently infected with DEN 4. Of the 52 patients admitted with Japanese encephalitis (JE), 45 were determined to be JEV infections. By nested PCR, we completed the identification of flaviviruses within 2 days. The results show that seven primers have a potential value for rapid clinical diagnosis of flavivirus infections.

  4. Primers for low-copy nuclear genes in the Melastomataceae1

    PubMed Central

    Reginato, Marcelo; Michelangeli, Fabián A.

    2016-01-01

    Premise of the study: Low-copy nuclear gene primers were developed for phylogenetic studies across the Melastomataceae. Methods and Results: Total genomic libraries from eight species in the Melastomataceae along with one transcriptome were used for marker identification and primer design. Eight exon-primed intron-crossing markers were amplified with success in taxa of nine tribes in the Melastomataceae. The new markers were directly sequenced for eight samples of closely related species of Miconia (Chaenanthera clade) in the tribe Miconieae. The DNA sequences for the eight loci ranged from 660 to 818 aligned base pairs. Compared with four commonly used markers in other studies, the loci developed here had a higher number of variable sites than plastid spacers (7–16 vs. 26–45) and comparable variation to the ribosomal spacers (28–39). Conclusions: The novel primer pairs should be useful for a broad range of studies of systematics and evolution in the diverse Melastomataceae. PMID:26819862

  5. COMplementary Primer ASymmetric PCR (COMPAS-PCR) Applied to the Identification of Salmo salar, Salmo trutta and Their Hybrids

    PubMed Central

    2016-01-01

    Avoiding complementarity between primers when designing a PCR assay constitutes a central rule strongly anchored in the mind of the molecular scientist. 3’-complementarity will extend the primers during PCR elongation using one another as template, consequently disabling further possible involvement in traditional target amplification. However, a 5’-complementarity will leave the primers unchanged during PCR cycles, albeit sequestered to one another, therefore also suppressing target amplification. We show that 5’-complementarity between primers may be exploited in a new PCR method called COMplementary-Primer-Asymmetric (COMPAS)-PCR, using asymmetric primer concentrations to achieve target PCR amplification. Moreover, such a design may paradoxically reduce spurious non-target amplification by actively sequestering the limiting primer. The general principles were demonstrated using 5S rDNA direct repeats as target sequences to design a species-specific assay for identifying Salmo salar and Salmo trutta using almost fully complementary primers overlapping the same target sequence. Specificity was enhanced by using 3’-penultimate point mutations and the assay was further developed to enable identification of S. salar x S. trutta hybrids by High Resolution Melt analysis in a 35 min one-tube assay. This small paradigm shift, using highly complementary primers for PCR, should help develop robust assays that previously would not be considered. PMID:27783658

  6. The corrosion protection of AISI(TM) 1010 steel by organic and inorganic zinc-rich primers

    NASA Technical Reports Server (NTRS)

    Danford, M. D.; Mendrek, M. J.

    1995-01-01

    The behavior of zinc-rich primer-coated AISI 1010 steel in 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR), were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electromechanical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 1010 steel cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high current between the steel cathode and both zinc-rich primer anodes (38.8 and 135.2 microns A/sq cm for the organic and inorganic primers, respectively). The results of corrosion rate determinations demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. EIS equivalent circuit parameters confirmed this conclusion. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application on solid rocket booster steel hardware.

  7. Bonding of Resin Cement to Zirconia with High Pressure Primer Coating

    PubMed Central

    Wang, Ying-jie; Jiao, Kai; Liu, Yan; Zhou, Wei; Shen, Li-juan; Fang, Ming; Li, Meng; Zhang, Xiang; Tay, Franklin R.; Chen, Ji-hua

    2014-01-01

    Objectives To investigate the effect of air-drying pressure during ceramic primer coating on zirconia/resin bonding and the surface characteristics of the primed zirconia. Methods Two ceramic primers (Clearfil Ceramic Primer, CCP, Kuraray Medical Inc. and Z-Prime Plus, ZPP, Bisco Inc.) were applied on the surface of air-abraded zirconia (Katana zirconia, Noritake) and dried at 4 different air pressures (0.1–0.4 MPa). The primed zirconia ceramic specimens were bonded with a resin-based luting agent (SA Luting Cement, Kuraray). Micro-shear bond strengths of the bonded specimens were tested after 3 days of water storage or 5,000× thermocycling (n = 12). Failure modes of the fractured specimens were examined with scanning electron miscopy. The effects of air pressure on the thickness of the primer layers and the surface roughness (Sa) of primed zirconia were evaluated using spectroscopic ellipsometry (n = 6), optical profilometry and environmental scanning electron microscopy (ESEM) (n = 6), respectively. Results Clearfil Ceramic Primer air-dried at 0.3 and 0.4 MPa, yielding significantly higher µSBS than gentle air-drying subgroups (p<0.05). Compared to vigorous drying conditions, Z-Prime Plus air-dried at 0.2 MPa exhibited significantly higher µSBS (p<0.05). Increasing air-drying pressure reduced the film thickness for both primers. Profilometry measurements and ESEM showed rougher surfaces in the high pressure subgroups of CCP and intermediate pressure subgroup of ZPP. Conclusion Air-drying pressure influences resin/zirconia bond strength and durability significantly. Higher air-drying pressure (0.3-0.4 MPa) for CCP and intermediate pressure (0.2 MPa) for ZPP are recommended to produce strong, durable bonds between resin cement and zirconia ceramics. PMID:24992678

  8. Highly effective sequencing whole chloroplast genomes of angiosperms by nine novel universal primer pairs.

    PubMed

    Yang, Jun-Bo; Li, De-Zhu; Li, Hong-Tao

    2014-09-01

    Chloroplast genomes supply indispensable information that helps improve the phylogenetic resolution and even as organelle-scale barcodes. Next-generation sequencing technologies have helped promote sequencing of complete chloroplast genomes, but compared with the number of angiosperms, relatively few chloroplast genomes have been sequenced. There are two major reasons for the paucity of completely sequenced chloroplast genomes: (i) massive amounts of fresh leaves are needed for chloroplast sequencing and (ii) there are considerable gaps in the sequenced chloroplast genomes of many plants because of the difficulty of isolating high-quality chloroplast DNA, preventing complete chloroplast genomes from being assembled. To overcome these obstacles, all known angiosperm chloroplast genomes available to date were analysed, and then we designed nine universal primer pairs corresponding to the highly conserved regions. Using these primers, angiosperm whole chloroplast genomes can be amplified using long-range PCR and sequenced using next-generation sequencing methods. The primers showed high universality, which was tested using 24 species representing major clades of angiosperms. To validate the functionality of the primers, eight species representing major groups of angiosperms, that is, early-diverging angiosperms, magnoliids, monocots, Saxifragales, fabids, malvids and asterids, were sequenced and assembled their complete chloroplast genomes. In our trials, only 100 mg of fresh leaves was used. The results show that the universal primer set provided an easy, effective and feasible approach for sequencing whole chloroplast genomes in angiosperms. The designed universal primer pairs provide a possibility to accelerate genome-scale data acquisition and will therefore magnify the phylogenetic resolution and species identification in angiosperms.

  9. The Roles of Tryptophans in Primer Synthesis by the DNA Primase of Bacteriophage T7*

    PubMed Central

    Zhang, Huidong; Lee, Seung-Joo; Richardson, Charles C.

    2012-01-01

    DNA primases catalyze the synthesis of oligoribonucleotides required for the initiation of lagging strand DNA synthesis. Prokaryotic primases consist of a zinc-binding domain (ZBD) necessary for recognition of a specific template sequence and a catalytic RNA polymerase domain. Interactions of both domains with the DNA template and ribonucleotides are required for primer synthesis. Five tryptophan residues are dispersed in the primase of bacteriophage T7: Trp-42 in the ZBD and Trp-69, -97, -147, and -255 in the RNA polymerase domain. Previous studies showed that replacement of Trp-42 with alanine in the ZBD decreases primer synthesis, whereas substitution of non-aromatic residues for Trp-69 impairs both primer synthesis and delivery. However, the roles of tryptophan at position 97, 147, or 255 remain elusive. To investigate the essential roles of these residues, we replaced each tryptophan with the structurally similar tyrosine and examined the effect of this subtle alteration on primer synthesis. The substitution at position 42, 97, or 147 reduced primer synthesis, whereas substitution at position 69 or 255 did not. The functions of the tryptophans were further examined at each step of primer synthesis. Alteration of residue 42 disturbed the conformation of the ZBD and resulted in partial loss of the zinc ion, impairing binding to the ssDNA template. Replacement of Trp-97 with tyrosine reduced the binding affinity to NTP and the catalysis step. The replacement of Trp-147 with tyrosine also impaired the catalytic step. Therefore, Trp-42 is important in maintaining the conformation of the ZBD for template binding; Trp-97 contributes to NTP binding and the catalysis step; and Trp-147 maintains the catalysis step. PMID:22605336

  10. Design and Implementation of Degenerate Microsatellite Primers for the Mammalian Clade

    PubMed Central

    Buschiazzo, Emmanuel; Beck, Josephine S.; Gemmell, Neil J.

    2011-01-01

    Microsatellites are popular genetic markers in molecular ecology, genetic mapping and forensics. Unfortunately, despite recent advances, the isolation of de novo polymorphic microsatellite loci often requires expensive and intensive groundwork. Primers developed for a focal species are commonly tested in a related, non-focal species of interest for the amplification of orthologous polymorphic loci; when successful, this approach significantly reduces cost and time of microsatellite development. However, transferability of polymorphic microsatellite loci decreases rapidly with increasing evolutionary distance, and this approach has shown its limits. Whole genome sequences represent an under-exploited resource to develop cross-species primers for microsatellites. Here we describe a three-step method that combines a novel in silico pipeline that we use to (1) identify conserved microsatellite loci from a multiple genome alignments, (2) design degenerate primer pairs, with (3) a simple PCR protocol used to implement these primers across species. Using this approach we developed a set of primers for the mammalian clade. We found 126,306 human microsatellites conserved in mammalian aligned sequences, and isolated 5,596 loci using criteria based on wide conservation. From a random subset of ∼1000 dinucleotide repeats, we designed degenerate primer pairs for 19 loci, of which five produced polymorphic fragments in up to 18 mammalian species, including the distinctly related marsupials and monotremes, groups that diverged from other mammals 120–160 million years ago. Using our method, many more cross-clade microsatellite loci can be harvested from the currently available genomic data, and this ability is set to improve exponentially as further genomes are sequenced. PMID:22216321

  11. Impact of primer choice on characterization of orchid mycorrhizal communities using 454 pyrosequencing.

    PubMed

    Waud, Michael; Busschaert, Pieter; Ruyters, Stefan; Jacquemyn, Hans; Lievens, Bart

    2014-07-01

    Although the number of studies investigating mycorrhizal associations in orchids has increased in recent years, the fungal communities associating with orchids and how they differ between species and sites remain unclear. Recent research has indicated that individual orchid plants may associate with several fungi concurrently, implying that to study mycorrhizal associations in orchids the fungal community should be assessed, rather than the presence of individual dominant fungal species or strains. High-throughput sequencing methods, such as 454 pyrosequencing, are increasingly used as the primary tool for such analyses. However, many studies combine universal primers from previous phylogenetic or ecological studies to generate amplicons suitable for 454 pyrosequencing without first critically evaluating their performance, potentially resulting in biased fungal community descriptions. Here, following in silico primer analysis we evaluated the performance of different combinations of existing PCR primers to characterize orchid mycorrhizal communities using 454 pyrosequencing by analysis of both an artificially assembled community of mycorrhizal fungi isolated from diverse orchid species and root samples from three different orchid species (Anacamptis morio, Ophrys tenthredinifera and Serapias lingua). Our results indicate that primer pairs ITS3/ITS4OF and ITS86F/ITS4, targeting the internal transcribed spacer-2 (ITS-2) region, outperformed other tested primer pairs in terms of number of reads, number of operational taxonomic units recovered from the artificial community and number of different orchid mycorrhizal associating families detected in the orchid samples. Additionally, we show the complementary specificity of both primer pairs, making them highly suitable for tandem use when studying the diversity of orchid mycorrhizal communities.

  12. Establishment of Quantitative Analysis Method for Genetically Modified Maize Using a Reference Plasmid and Novel Primers

    PubMed Central

    Moon, Gi-Seong; Shin, Weon-Sun

    2012-01-01

    For the quantitative analysis of genetically modified (GM) maize in processed foods, primer sets and probes based on the 35S promoter (p35S), nopaline synthase terminator (tNOS), p35S-hsp70 intron, and zSSIIb gene encoding starch synthase II for intrinsic control were designed. Polymerase chain reaction (PCR) products (80~101 bp) were specifically amplified and the primer sets targeting the smaller regions (80 or 81 bp) were more sensitive than those targeting the larger regions (94 or 101 bp). Particularly, the primer set 35F1-R1 for p35S targeting 81 bp of sequence was even more sensitive than that targeting 101 bp of sequence by a 3-log scale. The target DNA fragments were also specifically amplified from all GM labeled food samples except for one item we tested when 35F1-R1 primer set was applied. A reference plasmid pGMmaize (3 kb) including the smaller PCR products for p35S, tNOS, p35S-hsp70 intron, and the zSSIIb gene was constructed for real-time PCR (RT-PCR). The linearity of standard curves was confirmed by using diluents ranging from 2×101~105 copies of pGMmaize and the R2 values ranged from 0.999~1.000. In the RT-PCR, the detection limit using the novel primer/probe sets was 5 pg of genomic DNA from MON810 line indicating that the primer sets targeting the smaller regions (80 or 81 bp) could be used for highly sensitive detection of foreign DNA fragments from GM maize in processed foods. PMID:24471096

  13. Establishment of quantitative analysis method for genetically modified maize using a reference plasmid and novel primers.

    PubMed

    Moon, Gi-Seong; Shin, Weon-Sun

    2012-12-01

    For the quantitative analysis of genetically modified (GM) maize in processed foods, primer sets and probes based on the 35S promoter (p35S), nopaline synthase terminator (tNOS), p35S-hsp70 intron, and zSSIIb gene encoding starch synthase II for intrinsic control were designed. Polymerase chain reaction (PCR) products (80~101 bp) were specifically amplified and the primer sets targeting the smaller regions (80 or 81 bp) were more sensitive than those targeting the larger regions (94 or 101 bp). Particularly, the primer set 35F1-R1 for p35S targeting 81 bp of sequence was even more sensitive than that targeting 101 bp of sequence by a 3-log scale. The target DNA fragments were also specifically amplified from all GM labeled food samples except for one item we tested when 35F1-R1 primer set was applied. A reference plasmid pGMmaize (3 kb) including the smaller PCR products for p35S, tNOS, p35S-hsp70 intron, and the zSSIIb gene was constructed for real-time PCR (RT-PCR). The linearity of standard curves was confirmed by using diluents ranging from 2×10(1)~10(5) copies of pGMmaize and the R(2) values ranged from 0.999~1.000. In the RT-PCR, the detection limit using the novel primer/probe sets was 5 pg of genomic DNA from MON810 line indicating that the primer sets targeting the smaller regions (80 or 81 bp) could be used for highly sensitive detection of foreign DNA fragments from GM maize in processed foods.

  14. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

    PubMed

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

    2015-12-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail

  15. Lead-free precussion primer mixes based on metastable interstitial composite (MIC) technology

    DOEpatents

    Dixon, George P.; Martin, Joe A.; Thompson, Don

    1998-01-01

    A lead-free percussion primer composition and a percussion cup containing e composition. The lead-free percussion primer composition is comprised of a mixture of about 45 wt % aluminum powder having an outer coating of aluminum oxide and molybdenum trioxide powder or a mixture of about 50 wt % aluminum powder having an outer coating of aluminum oxide and polytetrafluoroethylene powder. The aluminum powder, molybdenum trioxide powder and polytetrafluoroethylene powder has a particle size of 0.1 .mu.m or less, more preferably a particle size of from about 200-500 angstroms.

  16. Thermally stimulated luminescence studies of undoped, Cu- and Mn-doped CaSO4 compounds

    NASA Astrophysics Data System (ADS)

    Manam, J.; Das, S.

    Thermally stimulated luminescence (TSL) of undoped and doped CaSO4 with activators such as Cu and Mn has been investigated. The polycrystalline samples of undoped and doped CaSO4 are prepared by the melting method. The formation of CaSO4 compound is confirmed by X-ray diffraction and Fourier transform infrared studies. Scanning electron microscopic studies of CaSO4 are also carried out. The TSL glow curves of undoped CaSO4, Cu- and Mn-doped CaSO4 are studied. Comparison of the thermoluminescence (TL) intensity of the most intensive glow peak of Cu-doped CaSO4 compound with that of undoped CaSO4 shows that addition of Cu impurity in CaSO4 compound enhances the TL intensity by about four times. However, the addition of Mn impurity to undoped CaSO4 increases the TL intensity by about three times when compared with that of undoped CaSO4. The TL-dose dependence of all three samples was studied and was observed to be almost linear in the studied range of irradiation time. Among the samples studied, namely undoped CaSO4 and Cu- and Mn-doped CaSO4, Cu-doped CaSO4 is found to be the most sensitive. The trap parameters, namely order of kinetics (b), activation energy (E) and frequency factor (s) associated with the most intensive glow peaks of CaSO4:Mn, CaSO4:Cu and CaSO4 phosphors were determined using the glow curve shape (Chen's) method.

  17. The Astrobiology Primer - an Early Career Scientist Education, Outreach and Professional Development Project

    NASA Astrophysics Data System (ADS)

    Wright, K. E.; Domagal-Goldman, S. D.

    2011-12-01

    We are early-career scientists jointly leading a project to write 'The Astrobiology Primer', a brief but comprehensive introduction to astrobiology, and we are using the process of producing the document as an innovative way of strengthening the international community of early-career astrobiologists. Astrobiology is the study of the origin, evolution, distribution and future of life in our universe. It includes not just study of life on Earth, but also the potential for life to exist beyond Earth, and the development of techniques to search for such life. It therefore incorporates geological and earth sciences, life sciences, chemistry, astronomy and planetary sciences. This requires astrobiologists to integrate these different disciplines in order to address questions such as 'How did Earth and its biosphere originate?', 'How do life and the physical, chemical and geological cycles on Earth interact, and affect each other?' and so 'What does life on Earth tell us about the habitability of environments outside Earth?'. The primer will provide a brief but comprehensive introduction to the field; it will be significantly more comprehensive than a normal review paper but much shorter than a textbook. This project is an initiative run entirely by early-career scientists, for the benefit of other early-career scientists and others. All the writers and editors of the primer are graduate/post-graduate students or post-doctoral fellows, and our primary target group for the primer is other early-career scientists, although we hope and expect that the primer will also be useful far more broadly in education and outreach work. An Astrobiology Primer was first published in 2006(Ref1), written and edited by a small group of early-career astrobiologists to provide an introduction to astrobiology for other early-career scientists new to the field. It has been used not only by the target group for private study, but in formal education and outreach settings at universities and

  18. Selection of more appropriate PCR primer pairs for improved efficiency in detecting Norwalk-like virus (NLV) RNA.

    PubMed

    Naitou, Hirotaka; Morita, Tamotsu

    2001-10-01

    A pair of primers, NV35 and NV36, and another pair of primers, NV81 and NV82/SM82, are commonly used for polymerase chain reaction (PCR) detection of Norwalk-like virus (NLV) genome RNA sequences in authorized test laboratories in Japan. However, the efficiency of NLV genome RNA detection with these primer pairs has been less than satisfactory. In the present study, we attempted to establish more appropriately matched primer pairs for improved detection of NLV genome RNA sequences using a combination of primers including NV35, NV36, NV81, NV82/SM82, SR33, and SRs (a mixture of 4 primers SR46, SR48, SR50, and SR52). We also evaluated appropriate primers for improved reverse transcription of NLV genome RNA. Stool samples used for detection of NLV included 18 samples collected from NLV-infected patients who ingested oysters (group 1) and 13 samples collected from those who did not ingest oysters (group 2). Reverse transcription of RNA genome with primer NV35 was less efficient compared with that with primer SR33 or NV81. When PCR products obtained with NV35 and NV36 as a pair of primers were subjected to gel electrophoresis, a strong extra band was detected compared with those obtained with other primer pairs. Since this extra band may represent heterodimeric or homodimeric hybrids, or intramolecular hybrids derived from these primers, this template-independent hybridization could lower the efficiency of primer-dependent polymerase reaction. Of 18 primer pairs, a pair of NV81 and SRs provided the best detection of PCR products following reverse transcription of NLV RNA with SR33 or NV81. The detection rate was 61% for both reverse transcription with SR33 and that with NV81. After reverse transcription using SR33 as a primer, nested PCR using a pair of NV81 and SRs following primary PCR using a pair of NV81 and NV82/SM82 increased the detection rate to 89% in group 1 and 100% in group 2.

  19. Novel primers and PCR protocols for the specific detection and quantification of Sphingobium suberifaciens in situ

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The pathogen causing corky root on lettuce, Sphingobium suberifaciens, is recalcitrant to standard epidemiological methods. Primers were selected from 16S rDNA sequences useful for the specific detection and quantification of S. suberifaciens. Conventional (PCR) and quantitative (qPCR) PCR protocols...

  20. A Web-Based Adaptive Tutor to Teach PCR Primer Design

    ERIC Educational Resources Information Center

    van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…

  1. The astrobiology primer: an outline of general knowledge--version 1, 2006.

    PubMed

    Billings, L; Cameron, V; Claire, M; Dick, G J; Domagal-Goldman, S D; Javaux, E J; Johnson, O J; Laws, C; Race, M S; Rask, J; Rummel, J D; Schelble, R T; Vance, S

    2006-10-01

    The Astrobiology Primer has been created as a reference tool for those who are interested in the interdisciplinary field of astrobiology. The field incorporates many diverse research endeavors, but it is our hope that this slim volume will present the reader with all he or she needs to know to become involved and to understand, at least at a fundamental level, the state of the art. Each section includes a brief overview of a topic and a short list of readable and important literature for those interested in deeper knowledge. Because of the great diversity of material, each section was written by a different author with a different expertise. Contributors, authors, and editors are listed at the beginning, along with a list of those chapters and sections for which they were responsible. We are deeply indebted to the NASA Astrobiology Institute (NAI), in particular to Estelle Dodson, David Morrison, Ed Goolish, Krisstina Wilmoth, and Rose Grymes for their continued enthusiasm and support. The Primer came about in large part because of NAI support for graduate student research, collaboration, and inclusion as well as direct funding. We have entitled the Primer version 1 in hope that it will be only the first in a series, whose future volumes will be produced every 3-5 years. This way we can insure that the Primer keeps up with the current state of research. We hope that it will be a great resource for anyone trying to stay abreast of an ever-changing field.

  2. Sequence alignment status and amplicon size difference affecting EST-SSR primer performance and polymorphism

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Little attention has been given to failed, poorly-performing, and non-polymorphic expressed sequence tag (EST) simple sequence repeat (SSR) primers. This is due in part to a lack of interest and value in reporting them but also because of the difficulty in addressing the causes of failure on a prime...

  3. Stress and Burnout: A Primer for Special Education and Special Services Personnel.

    ERIC Educational Resources Information Center

    Shaw, Stan F.; And Others

    The primer is designed to help promote mental, physical, and emotional health in school personnel and to prevent job burnout, with primary focus on interventions that special education and special services personnel, administrators, and teacher trainers can implement to manage stress and prevent burnout. Nine chapters address the following topics:…

  4. Review of "A School Privatization Primer for Michigan School Officials, Media and Residents"

    ERIC Educational Resources Information Center

    Belfield, Clive

    2008-01-01

    Issued by the Mackinac Center for Public Policy, "A School Privatization Primer for Michigan School Officials, Media and Residents" examines the "contracting out" of public school support services--specifically food, transportation, and custodial services. The report describes the prevalence of contracting out and sets forth the practical steps in…

  5. The Interaction between tRNALys3 and the Primer Activation Signal Deciphered by NMR Spectroscopy

    PubMed Central

    Brachet, Franck; Tisne, Carine

    2013-01-01

    The initiation of reverse transcription of the human immunodeficiency virus type 1 (HIV-1) requires the opening of the three-dimensional structure of the primer tRNALys3 for its annealing to the viral RNA at the primer binding site (PBS). Despite the fact that the result of this rearrangement is thermodynamically more stable, there is a high-energy barrier that requires the chaperoning activity of the viral nucleocapsid protein. In addition to the nucleotide complementarity to the PBS, several regions of tRNALys3 have been described as interacting with the viral genomic RNA. Among these sequences, a sequence of the viral genome called PAS for “primer activation signal” was proposed to interact with the T-arm of tRNALys3, this interaction stimulating the initiation of reverse transcription. In this report, we investigate the formation of this additional interaction with NMR spectroscopy, using a simple system composed of the primer tRNALys3, the 18 nucleotides of the PBS, the PAS (8 nucleotides) encompassed or not in a hairpin structure, and the nucleocapsid protein. Our NMR study provides molecular evidence of the existence of this interaction and highlights the role of the nucleocapsid protein in promoting this additional RNA-RNA annealing. This study presents the first direct observation at a single base-pair resolution of the PAS/anti-PAS association, which has been proposed to be involved in the chronological regulation of the reverse transcription. PMID:23762248

  6. A Public Education Primer: Basic (and Sometimes Surprising) Facts about the U.S. Education System

    ERIC Educational Resources Information Center

    Kober, Nancy; Rentner, Diane Stark; Jennings, Jack

    2006-01-01

    Public education matters, whether one is a student, parent, teacher, volunteer, employer, employee, or taxpayer. Although an individual undoubtedly knows something about public education, he may be unaware of important facts about the U.S. education system or may be surprised to learn how things have changed in recent years. In this primer on…

  7. GSP: a web-based platform for designing genome-specific primers in polyploids

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The primary goal of this research was to develop a web-based platform named GSP for designing genome-specific primers to distinguish subgenome sequences in the polyploid genome background. GSP uses BLAST to extract homeologous sequences of the subgenomes in the existing databases, performed a multip...

  8. Seven Principles of Success: A Primer for Business-Led Coalitions.

    ERIC Educational Resources Information Center

    Theis, Audrey; Creticos, Peter; McMahon, Amanda

    Intended to help business-led coalitions master the seven principles of success in education and workforce development, this primer begins with a discussion of the problems stemming from the structural transition underway in the U.S. economy, an overview of the 21st century workforce system, and the potential role of business-led coalitions in…

  9. Sequence analysis reveals genomic factors affecting EST-SSR primer performance and polymorphism

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Search for simple sequence repeat (SSR) motifs and design of flanking primers in expressed sequence tag (EST) sequences can be easily done at a large scale using bioinformatics programs. However, failed amplification and/or detection, along with lack of polymorphism, is often seen among randomly sel...

  10. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    ERIC Educational Resources Information Center

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  11. Development of Species-specific Primers for Rapid Detection of Phellinus linteus and P. baumii

    PubMed Central

    Kim, Mun-Ok; Kim, Gi-Young; Nam, Byung-Hyouk; Jin, Cheng-Yun; Lee, Ki-Won; Park, Jae-Min; Lee, Sang-Joon

    2005-01-01

    Genus Phellinus taxonomically belongs to Aphyllophorales and some species of this genus have been used as a medicinal ingredients and Indian folk medicines. Especially, P. linteus and morphological-related species are well-known medicinal fungi that have various biological activities such as humoral and cell-mediated, anti-mutagenic, and anti-cancer activities. However, little is known about the rapid detection for complex Phellinus species. Therefore, this study was carried out to develop specific primers for the rapid detection of P. linteus and other related species. Designing the species-specific primers was done based on internal transcribed spacer sequence data. Each primer set detected specifically P. linteus (PL2/PL5R) and P. baumii (PB1/PB4R). These primer sets could be useful for the rapid detection of specific-species among unidentified Phellinus species. Moreover, restriction fragment length polymorphism analysis of the ITS region with HaeIII was also useful for clarifying the relationship between each 5 Phellinus species. PMID:24049482

  12. Primers to amplify SNP markers in Epichloë canadensis (Clavicipitaceae)1

    PubMed Central

    Sullivan, Terrence J.; Bultman, Thomas L.; Schoolcraft, Jennifer

    2016-01-01

    Premise of the study: Primers were designed to produce short amplicons containing single-nucleotide polymorphisms (SNPs) in β-tubulin (tubB) and translation elongation factor 1-α (tefA) in Epichloë canadensis (Clavicipitaceae), an endophytic fungus of Elymus canadensis (Poaceae). Methods and Results: Primers to amplify regions of tubB and tefA containing suspected SNPs were designed and tested on individuals from six populations. Two tubB alleles were identified that differed by a single SNP, and three tefA alleles were identified that differed by a combination of two SNPs. All six populations tested were polymorphic for the tefA marker, and three of the populations were also polymorphic for the tubB marker. These primers are also predicted to amplify these regions in 11 additional epichloid species. Conclusions: Primers for short amplicons within tubB and tefA genes can be used to successfully genotype E. canadensis, making them useful markers for population genetic or landscape genomic studies. PMID:27011893

  13. With Heat You Never Have to Ask Directions. An Energy Primer for Minnesota Teachers.

    ERIC Educational Resources Information Center

    Minnesota State Dept. of Natural Resources, St. Paul. Environmental Education Board.

    This four-part primer is designed to: (1) help Minnesota teachers acquire some familiarity with basic energy structure and language; (2) provide a capsule summary of Minnesota's energy picture; and (3) demonstrate that it is relatively easy to participate in energy education. Part 1 discusses: the fossil fuel age; kinds and forms of energy; energy…

  14. Single-primer PCR amplification of segments of the main noncoding region of human mitochondrial DNA

    SciTech Connect

    Derenko, M.V.; Malyarchuk, B.A.

    1994-11-01

    A method for amplifying segments of the main noncoding region of human mitochondrial DNA using a single-primer PCR is proposed. The method employs oligonucleotides that are homologous to this region of the human mitochondrial genome. Possible reaction mechanisms and the prospects for using the method in evolutionary and population genetic studies are discussed. 15 refs., 1 fig.

  15. A Public Policy Primer: How to Get off the Sidelines and into the Game

    ERIC Educational Resources Information Center

    Hollister, David C.

    2007-01-01

    This Primer is intended to help individual citizens and community leaders and organizers (1) better understand the complex nature of decision making in democracy and (2) identify strategies for having a larger voice and impact. This publication is predicated and draws upon the author's 40 years of extensive and hands-on experiences in varied…

  16. A sputtered zirconia primer for improved thermal shock resistance of plasma sprayed ceramic turbine seals

    NASA Technical Reports Server (NTRS)

    Bill, R. C.; Sovey, J.; Allen, G. P.

    1981-01-01

    The development of plasma-sprayed yttria stabilized zirconia (YSZ) ceramic turbine blade tip seal components is discussed. The YSZ layers are quite thick (0.040 to 0.090 in.). The service potential of seal components with such thick ceramic layers is cyclic thermal shock limited. The most usual failure mode is ceramic layer delamination at or very near the interface between the plasma sprayed YSZ layer and the NiCrAlY bondcoat. Deposition of a thin RF sputtered YSZ primer to the bondcoat prior to deposition of the thick plasma sprayed YSZ layer was found to reduce laminar cracking in cyclic thermal shock testing. The cyclic thermal shock life of one ceramic seal design was increased by a factor of 5 to 6 when the sputtered YSZ primer was incorporated. A model based on thermal response of plasma sprayed YSZ particles impinging on the bondcoat surface with and without the sputtered YSZ primer provides a basis for understanding the function of the primer.

  17. The O*Net Jobs Classification System: A Primer for Family Researchers

    ERIC Educational Resources Information Center

    Crouter, Ann C.; Lanza, Stephanie T.; Pirretti, Amy; Goodman, W. Benjamin; Neebe, Eloise

    2006-01-01

    We introduce family researchers to the Occupational Information Network, or O*Net, an electronic database on the work characteristics of over 950 occupations. The paper here is a practical primer that covers data collection, selecting occupational characteristics, coding occupations, scale creation, and construct validity, with empirical…

  18. 26. BUILDING NO. 271I, LEAD AZIDE PRIMER BUILDING, WESTERN CORNER ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    26. BUILDING NO. 271-I, LEAD AZIDE PRIMER BUILDING, WESTERN CORNER OF BUILDING SHOWING DOORS TO MIXING ROOM NO. 4. HAND CRANK VISIBLE AT RIGHT ROTATED SMALL POTS (CONTAINING LEAD AZIDE) IN MIXING ROOMS. - Picatinny Arsenal, 200 Area, Shell Component Loading, State Route 15 near I-80, Dover, Morris County, NJ

  19. Comparison of nine PCR primer sets designed to detect Pantoea stewartii subsp. stewartii in maize

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Pantoea stewartii subsp. stewartii, the causal agent of Stewart's bacterial wilt of maize, is a major quarantine pest in maize seed. Verifying freedom from P. stewartii remains a significant hurdle in exporting corn seed from the U.S. Several PCR primer sets have been developed and suggested as bein...

  20. Blocking primers reduce co-amplification of plant DNA when studying bacterial endophyte communities.

    PubMed

    Arenz, Brett E; Schlatter, Dan C; Bradeen, James M; Kinkel, Linda L

    2015-10-01

    A blocking primer set based on the technique described by Vestheim and Jarman (2008) was developed to reduce amplification of non-target plant DNA when conducting metagenomic studies on bacterial endophyte communities. Bacterial amplification efficiency was increased 300-fold compared to standard PCR in an Illumina-based study of Sorghastrum nutans leaves.

  1. Lives Intertwined: A Primer on the History and Emergence of Minority Serving Institutions

    ERIC Educational Resources Information Center

    Gasman, Marybeth; Nguyen, Thai-Huy; Conrad, Clifton F.

    2015-01-01

    In this article, we provide an overview--a primer--of the rise of Minority Serving Institutions (MSIs) as context for understanding the contemporary place of these institutions in our broader system of higher education. We also demonstrate how the emergence and the evolution of MSIs stem from our nation's struggle to provide equal educational…

  2. CCI Primer: Key Facts about Early Care and Education in New York City. 2008

    ERIC Educational Resources Information Center

    Kolben, Nancy; Holcomb, Betty

    2009-01-01

    This primer provides a comprehensive look at the early care and education services throughout New York City. The analysis, which includes data on access, funding, and services, helps members of the field, advocates and policy makers identify current challenges and opportunities. Data is presented on: (1) Demographics: New York City's Children and…

  3. Getting Started in Global Education: A Primer for Principals and Teachers.

    ERIC Educational Resources Information Center

    Taylor, Howard E., Ed.

    This primer is intended for teachers and principals to help integrate global education into the school curriculum. The articles offer suggestions and rationale for inclusion of a global approach to the classroom. The table of contents offers: (1) "Introduction" (Ernest L. Boyer); (2) What is Global Education?" (M. Eugene Gilliom); (3) "Position…

  4. A PROGRAMED PRIMER ON PROGRAMING. VOLUME II, PRACTICAL PROBLEMS. SECOND EDITION.

    ERIC Educational Resources Information Center

    MARKLE, SUSAN MEYER

    KEY CONCEPTS, TERMS, AND TECHNIQUES IN PROGRAMED INSTRUCTION ARE PRESENTED IN THIS PROGRAMED PRIMER, WHICH BEGINS BY DEMONSTRATING THE USE OF FORMAL AND THEMATIC PROMPTS IN THE UTILIZATION OF A STUDENT'S REPERTOIRE. NEW RESPONSES ARE INTRODUCED INTO THIS REPERTOIRE BY THE USE OF COPYING FRAMES, EMPHASIS PROMPTS, AND PANELS. THE DESIGN OF SEQUENCES…

  5. The Primer for Institutional Research. Resources for Institutional Research, Number Seven.

    ERIC Educational Resources Information Center

    Whiteley, Meredith A., Ed.; And Others

    This book presents 11 papers which consider the central issues, methods, and resources for work in institutional research in higher education. The primer uses the idea of a "cookbook" or "manual" for its conceptualization, organization, and format. The chapter topics focus on what are expected to be the key issues facing institutional researchers…

  6. PCR Conditions for 16S Primers for Analysis of Microbes in the Colon of Rats.

    PubMed

    Guillen, I A; Camacho, H; Tuero, A D; Bacardí, D; Palenzuela, D O; Aguilera, A; Silva, J A; Estrada, R; Gell, O; Suárez, J; Ancizar, J; Brown, E; Colarte, A B; Castro, J; Novoa, L I

    2016-09-01

    The study of the composition of the intestinal flora is important to the health of the host, playing a key role in maintaining intestinal homeostasis and the evolution of the immune system. For these studies, various universal primers of the 16S rDNA gene are used in microbial taxonomy. Here, we report an evaluation of 5 universal primers to explore the presence of microbial DNA in colon biopsies preserved in RNAlater solution. The DNA extracted was used for the amplification of PCR products containing the variable (V) regions of the microbial 16S rDNA gene. The PCR products were studied by restriction fragment length polymorphism (RFLP) analysis and DNA sequence, whose percent of homology with microbial sequences reported in GenBank was verified using bioinformatics tools. The presence of microbes in the colon of rats was quantified by the quantitative PCR (qPCR) technique. We obtained microbial DNA from rat, useful for PCR analysis with the universal primers for the bacteria 16S rDNA. The sequences of PCR products obtained from a colon biopsy of the animal showed homology with the classes bacilli (Lactobacillus spp) and proteobacteria, normally represented in the colon of rats. The proposed methodology allowed the attainment of DNA of bacteria with the quality and integrity for use in qPCR, sequencing, and PCR-RFLP analysis. The selected universal primers provided knowledge of the abundance of microorganisms and the formation of a preliminary test of bacterial diversity in rat colon biopsies. PMID:27382362

  7. PCR Conditions for 16S Primers for Analysis of Microbes in the Colon of Rats.

    PubMed

    Guillen, I A; Camacho, H; Tuero, A D; Bacardí, D; Palenzuela, D O; Aguilera, A; Silva, J A; Estrada, R; Gell, O; Suárez, J; Ancizar, J; Brown, E; Colarte, A B; Castro, J; Novoa, L I

    2016-09-01

    The study of the composition of the intestinal flora is important to the health of the host, playing a key role in maintaining intestinal homeostasis and the evolution of the immune system. For these studies, various universal primers of the 16S rDNA gene are used in microbial taxonomy. Here, we report an evaluation of 5 universal primers to explore the presence of microbial DNA in colon biopsies preserved in RNAlater solution. The DNA extracted was used for the amplification of PCR products containing the variable (V) regions of the microbial 16S rDNA gene. The PCR products were studied by restriction fragment length polymorphism (RFLP) analysis and DNA sequence, whose percent of homology with microbial sequences reported in GenBank was verified using bioinformatics tools. The presence of microbes in the colon of rats was quantified by the quantitative PCR (qPCR) technique. We obtained microbial DNA from rat, useful for PCR analysis with the universal primers for the bacteria 16S rDNA. The sequences of PCR products obtained from a colon biopsy of the animal showed homology with the classes bacilli (Lactobacillus spp) and proteobacteria, normally represented in the colon of rats. The proposed methodology allowed the attainment of DNA of bacteria with the quality and integrity for use in qPCR, sequencing, and PCR-RFLP analysis. The selected universal primers provided knowledge of the abundance of microorganisms and the formation of a preliminary test of bacterial diversity in rat colon biopsies.

  8. PCR Conditions for 16S Primers for Analysis of Microbes in the Colon of Rats

    PubMed Central

    Camacho, H.; Tuero, A. D.; Bacardí, D.; Palenzuela, D. O.; Aguilera, A.; Silva, J. A.; Estrada, R.; Gell, O.; Suárez, J.; Ancizar, J.; Brown, E.; Colarte, A. B.; Castro, J.; Novoa, L. I.

    2016-01-01

    The study of the composition of the intestinal flora is important to the health of the host, playing a key role in maintaining intestinal homeostasis and the evolution of the immune system. For these studies, various universal primers of the 16S rDNA gene are used in microbial taxonomy. Here, we report an evaluation of 5 universal primers to explore the presence of microbial DNA in colon biopsies preserved in RNAlater solution. The DNA extracted was used for the amplification of PCR products containing the variable (V) regions of the microbial 16S rDNA gene. The PCR products were studied by restriction fragment length polymorphism (RFLP) analysis and DNA sequence, whose percent of homology with microbial sequences reported in GenBank was verified using bioinformatics tools. The presence of microbes in the colon of rats was quantified by the quantitative PCR (qPCR) technique. We obtained microbial DNA from rat, useful for PCR analysis with the universal primers for the bacteria 16S rDNA. The sequences of PCR products obtained from a colon biopsy of the animal showed homology with the classes bacilli (Lactobacillus spp) and proteobacteria, normally represented in the colon of rats. The proposed methodology allowed the attainment of DNA of bacteria with the quality and integrity for use in qPCR, sequencing, and PCR-RFLP analysis. The selected universal primers provided knowledge of the abundance of microorganisms and the formation of a preliminary test of bacterial diversity in rat colon biopsies. PMID:27382362

  9. Pyrosequencing protocol using a universal biotinylated primer for mutation detection and SNP genotyping.

    PubMed

    Royo, Jose Luis; Hidalgo, Manuel; Ruiz, Agustin

    2007-01-01

    DNA sequencing has markedly changed the nature of biomedical research, identifying millions of polymorphisms along the human genome that now require further analysis to study the genetic basis of human diseases. Among the DNA-sequencing platforms available, Pyrosequencing has become a useful tool for medium-throughput single nucleotide polymorphism (SNP) genotyping, mutation detection, copy-number studies and DNA methylation analysis. Its 96-well genotyping format allows reliable results to be obtained at reasonable costs in a few minutes. However, a specific biotinylated primer is usually required for each SNP under study to allow the capture of single-stranded DNA template for the Pyrosequencing assay. Here, we present an alternative to the standard labeling of PCR products for analysis by Pyrosequencing that circumvents the requirement of specific biotinylated primers for each SNP of interest. This protocol uses a single biotinylated primer that is simultaneously incorporated into all M13-tagged PCR products during the amplification reaction. The protocol covers all steps from the PCR amplification and capture of single-stranded template, its preparation, and the Pyrosequencing assay itself. Once the correct primer stoichiometry has been determined, the assay takes around 2 h for PCR amplification, followed by 15-20 min (per plate) to obtain the genotypes.

  10. Detection of polyhydroxyalkanoate-accumulating bacteria from domestic wastewater treatment plant using highly sensitive PCR primers.

    PubMed

    Huang, Yu-Tzu; Chen, Pi-Ling; Semblante, Galilee Uy; You, Sheng-Jie

    2012-08-01

    Polyhydroxyalkanoate (PHA) is a class of biodegradable plastics that have great potential applications in the near future. In this study, the micro-biodiversity and productivity of PHA-accumulating bacteria in activated sludge from a domestic wastewater treatment plant were investigated. A previously reported primer set and a selfdesigned primer set (phaCF1BO/phaCR2BO) were both used to amplify the PHA synthase (phaC) gene of isolated colonies. The new primers demonstrated higher sensitivity for phaC, and combining the PCR results of the two primer sets was able to widen the range of detected genera and raise the sensitivity to nearly 90%. Results showed that 85.3% of the identified bacteria were Gram-negative, with Ralstonia as the dominant genus, and 14.7% were Gram-positive. In addition, Zoogloea and Rhizobium contained the highest amounts of intracellular PHA. It is apparent that glucose was a better carbon source than pentone or tryptone for promoting PHA production in Micrococcus. Two different classes, class I and class II, of phaC were detected from alphaproteobacteria, betaproteobacteria, and gammaproteobacteria, indicating the wide diversity of PHA-accumulating bacteria in this particular sampling site. Simultaneous wastewater treatment and PHA production is promising by adopting the high PHAaccumulating bacteria isolated from activated sludge.

  11. Student Development in the First College Year: A Primer for College Educators

    ERIC Educational Resources Information Center

    Skipper, Tracy L.

    2005-01-01

    Student Development in the First College Year provides a detailed overview of some of the most commonly referenced theories of learning and development in the college years. What sets this primer apart from other treatments of student development theory is its careful attention to the first college year and the wide range of educational…

  12. Helicobacter pylori in dental plaque: a comparison of different PCR primer sets.

    PubMed

    Song, Q; Haller, B; Schmid, R M; Adler, G; Bode, G

    1999-03-01

    This study was designed to compare different primer sets for PCR analysis of H. pylori in the same series of 40 dental plaque samples. Three pairs of primers, HPU1/HPU2, HP1/HP2, and EHC-U/EHC-L, directed to the urease A gene, 16S rRNA gene, or 860-bp DNA of H. pylori, respectively, were used. Our results demonstrate that EHC-L/EHC-U were more specific and sensitive for H. pylori added to saliva or dental plaque than HPU1/HPU2 and HP1/HP2. The detection rates for H. pylori DNA in dental plaque samples from randomly selected adult patients from the Dental Clinic of the University of Ulm were 26.5% (9/34) for HPU1/HPU2, 78.9% (30/38) for HP1/HP2, and 100% (40/40) for EHC-U/EHC-L (P < 0.001). Nested PCR using primers directed to the 860-bp DNA of H. pylori further confirmed the presence of H. pylori DNA (40/40) in all these samples. Our results indicate that primers EHC-U/EHC-L are to be recommended for PCR detection of H. pylori in the oral cavity.

  13. A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys

    DOE PAGES

    Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.

    2015-12-09

    The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable regionmore » of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.« less

  14. A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys

    SciTech Connect

    Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.

    2015-12-09

    The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable region of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.

  15. What Are the Odds of that? A Primer on Understanding Logistic Regression

    ERIC Educational Resources Information Center

    Huang, Francis L.; Moon, Tonya R.

    2013-01-01

    The purpose of this Methodological Brief is to present a brief primer on logistic regression, a commonly used technique when modeling dichotomous outcomes. Using data from the National Education Longitudinal Study of 1988 (NELS:88), logistic regression techniques were used to investigate student-level variables in eighth grade (i.e., enrolled in a…

  16. The Child, the Text and the Teacher: Reading Primers and Reading Instruction

    ERIC Educational Resources Information Center

    Patterson, Annette Joyce; Cormack, Phillip Anton; Green, William Charles

    2012-01-01

    From the late sixteenth century, in response to the problem of how best to teach children to read, a variety of texts, such as primers, spellers and readers were produced in England for vernacular instruction. This paper describes how these materials were used by teachers to develop, first, a specific religious understanding according to the…

  17. Novel oligonucleotide primers reveal a high diversity of microbes which drive phosphorous turnover in soil.

    PubMed

    Bergkemper, Fabian; Kublik, Susanne; Lang, Friederike; Krüger, Jaane; Vestergaard, Gisle; Schloter, Michael; Schulz, Stefanie

    2016-06-01

    Phosphorus (P) is of central importance for cellular life but likewise a limiting macronutrient in numerous environments. Certainly microorganisms have proven their ability to increase the phosphorus bioavailability by mineralization of organic-P and solubilization of inorganic-P. On the other hand they efficiently take up P and compete with other biota for phosphorus. However the actual microbial community that is associated to the turnover of this crucial macronutrient in different ecosystems remains largely anonymous especially taking effects of seasonality and spatial heterogeneity into account. In this study seven oligonucleotide primers are presented which target genes coding for microbial acid and alkaline phosphatases (phoN, phoD), phytases (appA), phosphonatases (phnX) as well as the quinoprotein glucose dehydrogenase (gcd) and different P transporters (pitA, pstS). Illumina amplicon sequencing of soil genomic DNA underlined the high rate of primer specificity towards the respective target gene which usually ranged between 98% and 100% (phoN: 87%). As expected the primers amplified genes from a broad diversity of distinct microorganisms. Using DNA from a beech dominated forest soil, the highest microbial diversity was detected for the alkaline phosphatase (phoD) gene which was amplified from 15 distinct phyla respectively 81 families. Noteworthy the primers also allowed amplification of phoD from 6 fungal orders. The genes coding for acid phosphatase (phoN) and the quinoprotein glucose dehydrogenase (gcd) were amplified from 20 respectively 17 different microbial orders. In comparison the phytase and phosphonatase (appA, phnX) primers covered 13 bacterial orders from 2 different phyla respectively. Although the amplified microbial diversity was apparently limited both primers reliably detected all orders that contributed to the P turnover in the investigated soil as revealed by a previous metagenomic approach. Genes that code for microbial P transporter

  18. Novel oligonucleotide primers reveal a high diversity of microbes which drive phosphorous turnover in soil.

    PubMed

    Bergkemper, Fabian; Kublik, Susanne; Lang, Friederike; Krüger, Jaane; Vestergaard, Gisle; Schloter, Michael; Schulz, Stefanie

    2016-06-01

    Phosphorus (P) is of central importance for cellular life but likewise a limiting macronutrient in numerous environments. Certainly microorganisms have proven their ability to increase the phosphorus bioavailability by mineralization of organic-P and solubilization of inorganic-P. On the other hand they efficiently take up P and compete with other biota for phosphorus. However the actual microbial community that is associated to the turnover of this crucial macronutrient in different ecosystems remains largely anonymous especially taking effects of seasonality and spatial heterogeneity into account. In this study seven oligonucleotide primers are presented which target genes coding for microbial acid and alkaline phosphatases (phoN, phoD), phytases (appA), phosphonatases (phnX) as well as the quinoprotein glucose dehydrogenase (gcd) and different P transporters (pitA, pstS). Illumina amplicon sequencing of soil genomic DNA underlined the high rate of primer specificity towards the respective target gene which usually ranged between 98% and 100% (phoN: 87%). As expected the primers amplified genes from a broad diversity of distinct microorganisms. Using DNA from a beech dominated forest soil, the highest microbial diversity was detected for the alkaline phosphatase (phoD) gene which was amplified from 15 distinct phyla respectively 81 families. Noteworthy the primers also allowed amplification of phoD from 6 fungal orders. The genes coding for acid phosphatase (phoN) and the quinoprotein glucose dehydrogenase (gcd) were amplified from 20 respectively 17 different microbial orders. In comparison the phytase and phosphonatase (appA, phnX) primers covered 13 bacterial orders from 2 different phyla respectively. Although the amplified microbial diversity was apparently limited both primers reliably detected all orders that contributed to the P turnover in the investigated soil as revealed by a previous metagenomic approach. Genes that code for microbial P transporter

  19. In silico vs in vitro analysis of primer specificity for the detection of Gardnerella vaginalis, Atopobium vaginae and Lactobacillus spp.

    PubMed Central

    2012-01-01

    Background Bacterial vaginosis (BV) is a common pathology of women in reproductive age that can lead to serious health complications, and is associated with shifts in the normal microflora from predominance of Lactobacillus spp. to a proliferation of other anaerobes such as G. vaginalis and A vaginae, which can be detected by PCR. The optimal PCR pathogen detection assay relies mainly on the specificity and sensitivity of the primers used. Findings Here we demonstrate that in silico analytical testing of primer specificity is not a synonym to in vitro analytical specificity by testing a range of published and newly designed primers with both techniques for the detection of BV-associated microorganisms. Conclusions By testing primer in vitro specificity with a sufficient range of bacterial strains, we were able to design primers with higher specificity and sensitivity. Also by comparing the results obtained for the newly designed primers with other previously published primers, we confirmed that in silico analysis is not sufficient to predict in vitro specificity. As such care must be taken when choosing the primers for a detection assay. PMID:23153093

  20. A Child Care Primer, 2000: Key Facts about Child Care and Early Education Services in New York City.

    ERIC Educational Resources Information Center

    Letts, Kenea; Simpson, Kristen; Torres, Marlyn; Kolben, Nancy

    This Child Care Primer provides a detailed overview of child care funding, supply, and demand in New York City. The Primer utilizes data available from public agencies to create a picture of the availability of child care and early education services. The statistical portrait covers New York City demographics, enrollment in regulated child care…

  1. ABCs: A Basic Guide to Early Care and Education in New York City. Child Care Primer Series, 2002.

    ERIC Educational Resources Information Center

    Child Care, Inc., New York, NY.

    This primer presents key facts about child care and early education in New York City and delineates issues related to the current status of child care and early education. Specifically, the primer provides information on the number of children served by child care programs, Head Start, the Universal Prekindergarten program, preschool special…

  2. Improved Selection of Internal Transcribed Spacer-Specific Primers Enables Quantitative, Ultra-High-Throughput Profiling of Fungal Communities

    PubMed Central

    Bokulich, Nicholas A.

    2013-01-01

    Ultra-high-throughput sequencing (HTS) of fungal communities has been restricted by short read lengths and primer amplification bias, slowing the adoption of newer sequencing technologies to fungal community profiling. To address these issues, we evaluated the performance of several common internal transcribed spacer (ITS) primers and designed a novel primer set and work flow for simultaneous quantification and species-level interrogation of fungal consortia. Primer comparison and validation were predicted in silico and by sequencing a “mock community” of mixed yeast species to explore the challenges of amplicon length and amplification bias for reconstructing defined yeast community structures. The amplicon size and distribution of this primer set are smaller than for all preexisting ITS primer sets, maximizing sequencing coverage of hypervariable ITS domains by very-short-amplicon, high-throughput sequencing platforms. This feature also enables the optional integration of quantitative PCR (qPCR) directly into the HTS preparatory work flow by substituting qPCR with these primers for standard PCR, yielding quantification of individual community members. The complete work flow described here, utilizing any of the qualified primer sets evaluated, can rapidly profile mixed fungal communities and capably reconstructed well-characterized beer and wine fermentation fungal communities. PMID:23377949

  3. The Household Detective Primer: Protecting Your Children from Toxins in the Home. CHEC's Guide to Environmental Childproofing.

    ERIC Educational Resources Information Center

    Schubert, Sandra; Zelinsky, Benjamin

    Designed for parents, this primer presents information on threats to children's health that can be found in every American home, including disinfectants, art supplies, pesticides, and toxins in food and drinking water. The primer also provides practical information on safe and environmentally friendly household cleaners and disinfectants, outlines…

  4. Design of phylum-specific hybrid primers for DNA barcoding: addressing the need for efficient COI amplification in the Echinodermata.

    PubMed

    Hoareau, T B; Boissin, E

    2010-11-01

    Recent research has shown the usefulness of the Folmer region of the cytochrome oxidase I (COI) as a genetic barcode to assist in species delimitation of echinoderms. However, amplification of COI is often challenging in echinoderms (low success or pseudogenes). We present a method that allows the design of phylum-specific hybrid primers, and use this to develop COI primers for the Echinodermata. We aligned COI sequences from 310 echinoderm species and designed all possible primers along the consensus sequence with two methods (standard degenerate and hybrid). We found much lower degeneracy for hybrid primers (4-fold degeneracy) than for standard degenerate primers (≥48-fold degeneracy). We then designed the most conserved hybrid primers to amplify a >500-bp region within COI. These primers successfully amplified this gene region in all tested taxa (123 species across all echinoderm classes). Sequencing of 30 species among these confirmed both the quality of the sequences (>500 bp, no pseudogenes) and their utility as a DNA barcode. This method should be useful for developing primers for other mitochondrial genes and other phyla. The method will also be of interest for the development of future projects involving both community-based genetic assessments on macroorganisms and biodiversity assessment of environmental samples using high-throughput sequencing.

  5. Evaluation of 16S rRNA Gene Primer Pairs for Monitoring Microbial Community Structures Showed High Reproducibility within and Low Comparability between Datasets Generated with Multiple Archaeal and Bacterial Primer Pairs

    PubMed Central

    Fischer, Martin A.; Güllert, Simon; Neulinger, Sven C.; Streit, Wolfgang R.; Schmitz, Ruth A.

    2016-01-01

    The application of next-generation sequencing technology in microbial community analysis increased our knowledge and understanding of the complexity and diversity of a variety of ecosystems. In contrast to Bacteria, the archaeal domain was often not particularly addressed in the analysis of microbial communities. Consequently, established primers specifically amplifying the archaeal 16S ribosomal gene region are scarce compared to the variety of primers targeting bacterial sequences. In this study, we aimed to validate archaeal primers suitable for high throughput next generation sequencing. Three archaeal 16S primer pairs as well as two bacterial and one general microbial 16S primer pairs were comprehensively tested by in-silico evaluation and performing an experimental analysis of a complex microbial community of a biogas reactor. The results obtained clearly demonstrate that comparability of community profiles established using different primer pairs is difficult. 16S rRNA gene data derived from a shotgun metagenome of the same reactor sample added an additional perspective on the community structure. Furthermore, in-silico evaluation of primers, especially those for amplification of archaeal 16S rRNA gene regions, does not necessarily reflect the results obtained in experimental approaches. In the latter, archaeal primer pair ArchV34 showed the highest similarity to the archaeal community structure compared to observed by the metagenomic approach and thus appears to be the appropriate for analyzing archaeal communities in biogas reactors. However, a disadvantage of this primer pair was its low specificity for the archaeal domain in the experimental application leading to high amounts of bacterial sequences within the dataset. Overall our results indicate a rather limited comparability between community structures investigated and determined using different primer pairs as well as between metagenome and 16S rRNA gene amplicon based community structure analysis

  6. Evaluation of 16S rRNA Gene Primer Pairs for Monitoring Microbial Community Structures Showed High Reproducibility within and Low Comparability between Datasets Generated with Multiple Archaeal and Bacterial Primer Pairs.

    PubMed

    Fischer, Martin A; Güllert, Simon; Neulinger, Sven C; Streit, Wolfgang R; Schmitz, Ruth A

    2016-01-01

    The application of next-generation sequencing technology in microbial community analysis increased our knowledge and understanding of the complexity and diversity of a variety of ecosystems. In contrast to Bacteria, the archaeal domain was often not particularly addressed in the analysis of microbial communities. Consequently, established primers specifically amplifying the archaeal 16S ribosomal gene region are scarce compared to the variety of primers targeting bacterial sequences. In this study, we aimed to validate archaeal primers suitable for high throughput next generation sequencing. Three archaeal 16S primer pairs as well as two bacterial and one general microbial 16S primer pairs were comprehensively tested by in-silico evaluation and performing an experimental analysis of a complex microbial community of a biogas reactor. The results obtained clearly demonstrate that comparability of community profiles established using different primer pairs is difficult. 16S rRNA gene data derived from a shotgun metagenome of the same reactor sample added an additional perspective on the community structure. Furthermore, in-silico evaluation of primers, especially those for amplification of archaeal 16S rRNA gene regions, does not necessarily reflect the results obtained in experimental approaches. In the latter, archaeal primer pair ArchV34 showed the highest similarity to the archaeal community structure compared to observed by the metagenomic approach and thus appears to be the appropriate for analyzing archaeal communities in biogas reactors. However, a disadvantage of this primer pair was its low specificity for the archaeal domain in the experimental application leading to high amounts of bacterial sequences within the dataset. Overall our results indicate a rather limited comparability between community structures investigated and determined using different primer pairs as well as between metagenome and 16S rRNA gene amplicon based community structure analysis

  7. Evaluation of 16S rRNA Gene Primer Pairs for Monitoring Microbial Community Structures Showed High Reproducibility within and Low Comparability between Datasets Generated with Multiple Archaeal and Bacterial Primer Pairs

    PubMed Central

    Fischer, Martin A.; Güllert, Simon; Neulinger, Sven C.; Streit, Wolfgang R.; Schmitz, Ruth A.

    2016-01-01

    The application of next-generation sequencing technology in microbial community analysis increased our knowledge and understanding of the complexity and diversity of a variety of ecosystems. In contrast to Bacteria, the archaeal domain was often not particularly addressed in the analysis of microbial communities. Consequently, established primers specifically amplifying the archaeal 16S ribosomal gene region are scarce compared to the variety of primers targeting bacterial sequences. In this study, we aimed to validate archaeal primers suitable for high throughput next generation sequencing. Three archaeal 16S primer pairs as well as two bacterial and one general microbial 16S primer pairs were comprehensively tested by in-silico evaluation and performing an experimental analysis of a complex microbial community of a biogas reactor. The results obtained clearly demonstrate that comparability of community profiles established using different primer pairs is difficult. 16S rRNA gene data derived from a shotgun metagenome of the same reactor sample added an additional perspective on the community structure. Furthermore, in-silico evaluation of primers, especially those for amplification of archaeal 16S rRNA gene regions, does not necessarily reflect the results obtained in experimental approaches. In the latter, archaeal primer pair ArchV34 showed the highest similarity to the archaeal community structure compared to observed by the metagenomic approach and thus appears to be the appropriate for analyzing archaeal communities in biogas reactors. However, a disadvantage of this primer pair was its low specificity for the archaeal domain in the experimental application leading to high amounts of bacterial sequences within the dataset. Overall our results indicate a rather limited comparability between community structures investigated and determined using different primer pairs as well as between metagenome and 16S rRNA gene amplicon based community structure analysis

  8. Evaluation of 16S rRNA Gene Primer Pairs for Monitoring Microbial Community Structures Showed High Reproducibility within and Low Comparability between Datasets Generated with Multiple Archaeal and Bacterial Primer Pairs.

    PubMed

    Fischer, Martin A; Güllert, Simon; Neulinger, Sven C; Streit, Wolfgang R; Schmitz, Ruth A

    2016-01-01

    The application of next-generation sequencing technology in microbial community analysis increased our knowledge and understanding of the complexity and diversity of a variety of ecosystems. In contrast to Bacteria, the archaeal domain was often not particularly addressed in the analysis of microbial communities. Consequently, established primers specifically amplifying the archaeal 16S ribosomal gene region are scarce compared to the variety of primers targeting bacterial sequences. In this study, we aimed to validate archaeal primers suitable for high throughput next generation sequencing. Three archaeal 16S primer pairs as well as two bacterial and one general microbial 16S primer pairs were comprehensively tested by in-silico evaluation and performing an experimental analysis of a complex microbial community of a biogas reactor. The results obtained clearly demonstrate that comparability of community profiles established using different primer pairs is difficult. 16S rRNA gene data derived from a shotgun metagenome of the same reactor sample added an additional perspective on the community structure. Furthermore, in-silico evaluation of primers, especially those for amplification of archaeal 16S rRNA gene regions, does not necessarily reflect the results obtained in experimental approaches. In the latter, archaeal primer pair ArchV34 showed the highest similarity to the archaeal community structure compared to observed by the metagenomic approach and thus appears to be the appropriate for analyzing archaeal communities in biogas reactors. However, a disadvantage of this primer pair was its low specificity for the archaeal domain in the experimental application leading to high amounts of bacterial sequences within the dataset. Overall our results indicate a rather limited comparability between community structures investigated and determined using different primer pairs as well as between metagenome and 16S rRNA gene amplicon based community structure analysis

  9. A method for automatically extracting infectious disease-related primers and probes from the literature

    PubMed Central

    2010-01-01

    Background Primer and probe sequences are the main components of nucleic acid-based detection systems. Biologists use primers and probes for different tasks, some related to the diagnosis and prescription of infectious diseases. The biological literature is the main information source for empirically validated primer and probe sequences. Therefore, it is becoming increasingly important for researchers to navigate this important information. In this paper, we present a four-phase method for extracting and annotating primer/probe sequences from the literature. These phases are: (1) convert each document into a tree of paper sections, (2) detect the candidate sequences using a set of finite state machine-based recognizers, (3) refine problem sequences using a rule-based expert system, and (4) annotate the extracted sequences with their related organism/gene information. Results We tested our approach using a test set composed of 297 manuscripts. The extracted sequences and their organism/gene annotations were manually evaluated by a panel of molecular biologists. The results of the evaluation show that our approach is suitable for automatically extracting DNA sequences, achieving precision/recall rates of 97.98% and 95.77%, respectively. In addition, 76.66% of the detected sequences were correctly annotated with their organism name. The system also provided correct gene-related information for 46.18% of the sequences assigned a correct organism name. Conclusions We believe that the proposed method can facilitate routine tasks for biomedical researchers using molecular methods to diagnose and prescribe different infectious diseases. In addition, the proposed method can be expanded to detect and extract other biological sequences from the literature. The extracted information can also be used to readily update available primer/probe databases or to create new databases from scratch. PMID:20682041

  10. Advances in multiplex PCR: balancing primer efficiencies and improving detection success

    PubMed Central

    Sint, Daniela; Raso, Lorna; Traugott, Michael

    2012-01-01

    1. Multiplex PCR is a valuable tool in many biological studies but it is a multifaceted procedure that has to be planned and optimised thoroughly to achieve robust and meaningful results. In particular, primer concentrations have to be adjusted to assure an even amplification of all targeted DNA fragments. Until now, total DNA extracts were used for balancing primer efficiencies; however, the applicability for comparisons between taxa or different multiple-copy genes was limited owing to the unknown number of template molecules present per total DNA. 2. Based on a multiplex system developed to track trophic interactions in high Alpine arthropods, we demonstrate a fast and easy way of generating standardised DNA templates. These were then used to balance the amplification success for the different targets and to subsequently determine the sensitivity of each primer pair in the multiplex PCR. 3. In the current multiplex assay, this approach led to an even amplification success for all seven targeted DNA fragments. Using this balanced multiplex PCR, methodological bias owing to variation in primer efficiency will be avoided when analysing field-derived samples. 4. The approach outlined here allows comparing multiplex PCR sensitivity, independent of the investigated species, genome size or the targeted genes. The application of standardised DNA templates not only makes it possible to optimise primer efficiency within a given multiplex PCR, but it also offers to adjust and/or to compare the sensitivity between different assays. Along with other factors that influence the success of multiplex reactions, and which we discuss here in relation to the presented detection system, the adoption of this approach will allow for direct comparison of multiplex PCR data between systems and studies, enhancing the utility of this assay type. PMID:23549328

  11. Biofunctionalization of Polyoxometalates with DNA Primers, Their Use in the Polymerase Chain Reaction (PCR) and Electrochemical Detection of PCR Products.

    PubMed

    Debela, Ahmed M; Ortiz, Mayreli; Beni, Valerio; Thorimbert, Serge; Lesage, Denis; Cole, Richard B; O'Sullivan, Ciara K; Hasenknopf, Bernold

    2015-12-01

    The bioconjugation of polyoxometalates (POMs), which are inorganic metal oxido clusters, to DNA strands to obtain functional labeled DNA primers and their potential use in electrochemical detection have been investigated. Activated monooxoacylated polyoxotungstates [SiW11 O39 {Sn(CH2 )2 CO}](8-) and [P2 W17 O61 {Sn(CH2 )2 CO}](6-) have been used to link to a 5'-NH2 terminated 21-mer DNA forward primer through amide coupling. The functionalized primer was characterized by using a battery of techniques, including electrophoresis, mass spectrometry, as well as IR and Raman spectroscopy. The functionality of the POM-labeled primers was demonstrated through hybridization with a surface-immobilized probe. Finally, the labeled primers were successfully used in the polymerase chain reaction (PCR) and the PCR products were characterized by using electrophoresis.

  12. Bonding of a cobalt-chromium alloy with acidic primers and tri-n-butylborane-initiated luting agents.

    PubMed

    Matsumura, H; Tanaka, T; Taira, Y; Atsuta, M

    1996-08-01

    Limited information is available about chemical bonding of cobalt-chromium alloys for resin-retained fixed partial dentures. This study evaluated the effect of acidic primers on the bonding of luting agents joined to a cobalt-chromium alloy. Disk alloy specimens were bonded with eight combinations of five primers and two luting agents. Shear bond strengths were determined before and after thermocycling. The effect of priming on bond strength varied among the combinations of primer and luting agent. In particular, after thermocycling three groups demonstrated greater bond strengths than the other groups did. These were (1) specimens treated with a phosphate-methacrylate primer (Cesead Opaque Primer), (2) specimens bonded with an adhesive resin (Super-Bond Opaque), or (3) a combination of both.

  13. Evaluation of single liquid primers with organic sulfur compound for bonding between indirect composite material and silver-palladium-copper-gold alloy.

    PubMed

    Shimoe, Saiji; Tanoue, Naomi; Satoda, Takahiro; Murayama, Takeshi; Nikawa, Hiroki; Matsumura, Hideo

    2010-01-01

    The purpose of this study was to evaluate the effect of primers on bonding between a silver-palladium-copper-gold alloy and an indirect composite material. Cast disks were air-abraded with alumina, conditioned with one of five primers (Alloy Primer, Luna-Wing Primer, Metal Primer II, Metaltite, M.L. Primer), and bonded with a light-activated indirect composite. Shear bond strengths were determined after 20,000 times of thermocycling. The results showed that four of the primers, except the Luna-Wing Primer, were effective in enhancing the bond strength as compared with the unprimed control group. Of these four primers, Alloy Primer, Metal Primer II, and M.L. Primer exhibited significantly greater bond strengths. It can be concluded that the effectiveness of primers varies considerably according to the organic sulfur compounds added to the solvent, and that care must be taken in selecting priming agents for bonding the composite material and the silver-palladium-copper-gold alloy.

  14. In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River

    NASA Astrophysics Data System (ADS)

    Cannon, M. V.; Hester, J.; Shalkhauser, A.; Chan, E. R.; Logue, K.; Small, S. T.; Serre, D.

    2016-03-01

    Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity.

  15. In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River

    PubMed Central

    Cannon, M. V.; Hester, J.; Shalkhauser, A.; Chan, E. R.; Logue, K.; Small, S. T.; Serre, D.

    2016-01-01

    Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity. PMID:26965911

  16. In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River.

    PubMed

    Cannon, M V; Hester, J; Shalkhauser, A; Chan, E R; Logue, K; Small, S T; Serre, D

    2016-03-11

    Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity.

  17. In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River.

    PubMed

    Cannon, M V; Hester, J; Shalkhauser, A; Chan, E R; Logue, K; Small, S T; Serre, D

    2016-01-01

    Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity. PMID:26965911

  18. Marker production by PCR amplification with primer pairs from conserved sequences of WRKY genes in chili pepper.

    PubMed

    Kim, Hyoun-Joung; Lee, Heung-Ryul; Han, Jung-Heon; Yeom, Seon-In; Harn, Chee-Hark; Kim, Byung-Dong

    2008-04-30

    Despite increasing awareness of the importance of WRKY genes in plant defense signaling, the locations of these genes in the Capsicum genome have not been established. To develop WRKY-based markers, primer sequences were deduced from the conserved sequences of the DNA binding motif within the WRKY domains of tomato and pepper genes. These primers were derived from upstream and downstream parts of the conserved sequences of the three WRKY groups. Six primer combinations of each WRKY group were tested for polymorphisms between the mapping parents, C. annuum 'CM334' and C. annuum 'Chilsungcho'. DNA fragments amplified by primer pairs deduced from WRKY Group II genes revealed high levels of polymorphism. Using 32 primer pairs to amplify upstream and downstream parts of the WRKY domain of WRKY group II genes, 60 polymorphic bands were detected. Polymorphisms were not detected with primer pairs from downstream parts of WRKY group II genes. Half of these primers were subjected to F2 genotyping to construct a linkage map. Thirty of 41 markers were located evenly spaced on 20 of the 28 linkage groups, without clustering. This linkage map also consisted of 199 AFLP and 26 SSR markers. This WRKY-based marker system is a rapid and simple method for generating sequence-specific markers for plant gene families.

  19. Sensitive RNA detection by combining three-way junction formation and primer generation-rolling circle amplification.

    PubMed

    Murakami, Taku; Sumaoka, Jun; Komiyama, Makoto

    2012-02-01

    Recently, we developed a simple isothermal nucleic acid amplification reaction, primer generation-rolling circle amplification (PG-RCA), to detect specific DNA sequences with great sensitivity and large dynamic range. In this paper, we combined PG-RCA with a three-way junction (3WJ) formation, and detected specific RNA molecules with high sensitivity and specificity in a one-step and isothermal reaction format. In the presence of target RNA, 3WJ probes (primer and template) are designed to form a 3WJ structure, from which multiple signal primers for the following PG-RCA can be generated by repeating primer extension, nicking and signal primer dissociation. Although this signal primer generation is a linear amplification process, the PG-RCA exponentially can amplify these signal primers and thus even a very small amount of RNA specimen can be detected. After optimizing the structures of 3WJ probes, the detection limit of this assay was 15.9 zmol (9.55 × 10(3) molecules) of synthetic RNA or 143 zmol (8.6 × 10(4) molecules) of in vitro transcribed human CD4 mRNA. Further, the applicability of this assay to detect CD4 mRNA in a human mRNA sample was demonstrated.

  20. Specific amplification of bacterial DNA by optimized so-called universal bacterial primers in samples rich of plant DNA.

    PubMed

    Dorn-In, Samart; Bassitta, Rupert; Schwaiger, Karin; Bauer, Johann; Hölzel, Christina S

    2015-06-01

    Universal primers targeting the bacterial 16S-rRNA-gene allow quantification of the total bacterial load in variable sample types by qPCR. However, many universal primer pairs also amplify DNA of plants or even of archaea and other eukaryotic cells. By using these primers, the total bacterial load might be misevaluated, whenever samples contain high amounts of non-target DNA. Thus, this study aimed to provide primer pairs which are suitable for quantification and identification of bacterial DNA in samples such as feed, spices and sample material from digesters. For 42 primers, mismatches to the sequence of chloroplasts and mitochondria of plants were evaluated. Six primer pairs were further analyzed with regard to the question whether they anneal to DNA of archaea, animal tissue and fungi. Subsequently they were tested with sample matrix such as plants, feed, feces, soil and environmental samples. To this purpose, the target DNA in the samples was quantified by qPCR. The PCR products of plant and feed samples were further processed for the Single Strand Conformation Polymorphism method followed by sequence analysis. The sequencing results revealed that primer pair 335F/769R amplified only bacterial DNA in samples such as plants and animal feed, in which the DNA of plants prevailed.

  1. Detection of Xanthomonas arboricola pv. pruni by PCR using primers based on DNA sequences related to the hrp genes.

    PubMed

    Park, So Yeon; Lee, Young Sun; Koh, Young Jin; Hur, Jae-Sun; Jung, Jae Sung

    2010-10-01

    Efficient control of Xanthomonas arboricola pv. pruni, the causal agent of bacterial spot on stone fruit, requires a sensitive and reliable diagnostic tool. A PCR detection method that utilizes primers to target the hrp gene cluster region was developed in this study. The nucleotide sequence of the PCR product amplified with primers specific for the hrp region of the xanthomonads and genomic DNA of X. arboricola pv. pruni was determined, and the sequence was aligned with that of X. campestris pv. campestris, which was obtained from the GenBank database. On the basis of the sequence of the amplified hrp region, a PCR primer set of XapF/R specific to X. arboricola pv. pruni was designed. This primer set yielded a 243-bp product from the genomic DNA of X. aboricola pv. pruni strains, but no products from other 21 strains of Xanthomonas or from two epiphytic bacterial species. Southern blot hybridization with the probe derived from the PCR product with the primer set and X. aboricola pv. pruni DNA confirmed the PCR results. The Xap primer system was successfully applied to detect the pathogen from infected peach fruits. When it was applied in field samples, the primer set was proved as a reliable diagnostic tool for specific detection of X. aboricola pv. pruni from peach orchards. PMID:21046331

  2. Evaluation of revised polymerase chain reaction primers for more inclusive quantification of ammonia-oxidizing archaea and bacteria.

    PubMed

    Meinhardt, Kelley A; Bertagnolli, Anthony; Pannu, Manmeet W; Strand, Stuart E; Brown, Sally L; Stahl, David A

    2015-04-01

    Ammonia-oxidizing archaea (AOA) and bacteria (AOB) fill key roles in the nitrogen cycle. Thus, well-vetted methods for characterizing their distribution are essential for framing studies of their significance in natural and managed systems. Quantification of the gene coding for one subunit of the ammonia monooxygenase (amoA) by polymerase chain reaction is frequently employed to enumerate the two groups. However, variable amplification of sequence variants comprising this conserved genetic marker for ammonia oxidizers potentially compromises within- and between-system comparisons. We compared the performance of newly designed non-degenerate quantitative polymerase chain reaction primer sets to existing primer sets commonly used to quantify the amoA of AOA and AOB using a collection of plasmids and soil DNA samples. The new AOA primer set provided improved quantification of model mixtures of different amoA sequence variants and increased detection of amoA in DNA recovered from soils. Although both primer sets for the AOB provided similar results for many comparisons, the new primers demonstrated increased detection in environmental application. Thus, the new primer sets should provide a useful complement to primers now commonly used to characterize the environmental distribution of AOA and AOB.

  3. Primers for low-copy nuclear genes in Metrosideros and cross-amplification in Myrtaceae1

    PubMed Central

    Pillon, Yohan; Johansen, Jennifer; Sakishima, Tomoko; Chamala, Srikar; Barbazuk, W. Brad; Stacy, Elizabeth A.

    2014-01-01

    • Premise of the study: Primers were developed to amplify low-copy nuclear genes in Hawaiian Metrosideros (Myrtaceae). • Methods and Results: Data from a pooled 454 Titanium run of the partial transcriptomes of four Metrosideros taxa were used to identify the loci of interest. Ten exon-primed intron-crossing (EPIC) markers were amplified and sequenced directly with success in Metrosideros, as well as in a representative selection of Myrtaceae, including Syzygium, Psidium, and Melaleuca for most of the markers. The loci amplified ranged between 500 and 1100 bp, and up to 117 polymorphic sites were observed within an individual gene alignment. Two introns contained microsatellites in some of the species. • Conclusions: These novel primer pairs should be useful for phylogenetic analysis and population genetics of a broad range of Myrtaceae, particularly the diverse fleshy-fruited tribes Syzygieae and Myrteae. PMID:25309837

  4. STITCHER: A web resource for high-throughput design of primers for overlapping PCR applications.

    PubMed

    O'Halloran, Damien M

    2015-06-01

    Overlapping PCR is routinely used in a wide number of molecular applications. These include stitching PCR fragments together, generating fluorescent transcriptional and translational fusions, inserting mutations, making deletions, and PCR cloning. Overlapping PCR is also used for genotyping by traditional PCR techniques and in detection experiments using techniques such as loop-mediated isothermal amplification (LAMP). STITCHER is a web tool providing a central resource for researchers conducting all types of overlapping PCR experiments with an intuitive interface for automated primer design that's fast, easy to use, and freely available online (http://ohalloranlab.net/STITCHER.html). STITCHER can handle both single sequence and multi-sequence input, and specific features facilitate numerous other PCR applications, including assembly PCR, adapter PCR, and primer walking. Field PCR, and in particular, LAMP, offers promise as an on site tool for pathogen detection in underdeveloped areas, and STITCHER includes off-target detection features for pathogens commonly targeted using LAMP technology.

  5. Isolation of Fungal Pathogens to an Edible Mushroom, Pleurotus eryngii, and Development of Specific ITS Primers.

    PubMed

    Kim, Sang-Woo; Kim, Sinil; Lee, Hyun-Jun; Park, Ju-Wan; Ro, Hyeon-Su

    2013-12-01

    Fungal pathogens have caused severe damage to the commercial production of Pleurotus eryngii, the king oyster mushroom, by reducing production yield, causing deterioration of commercial value, and shortening shelf-life. Four strains of pathogenic fungi, including Trichoderma koningiopsis DC3, Phomopsis sp. MP4, Mucor circinelloides MP5, and Cladosporium bruhnei MP6, were isolated from the bottle culture of diseased P. eryngii. A species-specific primer set was designed for each fungus from the ITS1-5.8S rDNA-ITS2 sequences. PCR using the ITS primer set yielded a unique DNA band for each fungus without any cross-reaction, proving the validity of our method in detection of mushroom fungal pathogens. PMID:24493949

  6. RNA as an RNA Polymerase: Net Elongation of an RNA Primer Catalyzed by the Tetrahymena Ribozyme

    NASA Astrophysics Data System (ADS)

    Been, Michael D.; Cech, Thomas R.

    1988-03-01

    A catalytic RNA (ribozyme) derived from an intervening sequence (IVS) RNA of Tetrahymena thermophila will catalyze an RNA polymerization reaction in which pentacytidylic acid (C5) is extended by the successive addition of mononucleotides derived from a guanylyl-(3', 5')-nucleotide (GpN). Cytidines or uridines are added to C5 to generate chain lengths of 10 to 11 nucleotides, with longer products being generated at greatly reduced efficiency. The reaction is analogous to that catalyzed by a replicase with C5 acting as the primer, GpNs as the nucleoside triphosphates, and a sequence in the ribozyme providing a template. The demonstration that an RNA enzyme can catalyze net elongation of an RNA primer supports theories of prebiotic RNA self-replication.

  7. Construction of a Transcription Map for Papillomaviruses using RACE, RNase Protection, and Primer Extension Assays.

    PubMed

    Wang, Xiaohong; Zheng, Zhi-Ming

    2016-01-01

    Papillomaviruses are a family of small, non-enveloped DNA tumor viruses. Knowing a complete transcription map of each papillomavirus genome can provide guidance for various papillomavirus studies. This unit provides detailed protocols to construct a transcription map of human papillomavirus type 18. The same approach can be easily adapted to other transcription map studies of any other papillomavirus genotype due to the high degree of conservation in genome structure, organization, and gene expression among papillomaviruses. The focused methods are 5'- and 3'-rapid amplification of cDNA ends (RACE), which are techniques commonly used in molecular biology to obtain full-length RNA transcript or to map a transcription start site (TSS) or an RNA polyadenylation (pA) cleavage site. Primer walking RT-PCR is a method for studying the splicing junction of RACE products. In addition, RNase protection assay and primer extension are also introduced as alternative methods in the mapping analysis. PMID:26855281

  8. Development and characterization of 11 microsatellite primers for the sedge Trichophorum planifolium (Cyperaceae)1

    PubMed Central

    Nowell, Victoria J.; Wang, Song; Smith, Tyler W.

    2015-01-01

    Premise of the study: Microsatellite loci were developed for Trichophorum planifolium (Cyperaceae), an endangered woodland sedge protected under federal and provincial legislation in Canada, to explore patterns of population genetic diversity and differentiation in the species. Methods and Results: Sixty-three primer pairs were evaluated for amplification consistency and screened for polymorphisms in 96 samples collected from 12 populations of T. planifolium distributed through the range of the species. Of these, 11 loci were shown to be polymorphic, displaying two to six alleles. Mean observed heterozygosity across loci ranged from 0.00 to 0.06 among populations tested. Conclusions: The results suggest that the 11 primer pairs developed in this study will be useful for future studies of broad-scale genetic variation in T. planifolium and in guiding management protocols for the species in Canada. PMID:26421254

  9. Specificity of Methylation Assays in Cancer Research: A Guideline for Designing Primers and Probes

    PubMed Central

    Barekati, Zeinab; Radpour, Ramin; Kohler, Corina; Zhong, Xiao Yan

    2010-01-01

    DNA methylation is an epigenetic regulation mechanism of genomic function, and aberrant methylation pattern has been found to be a common event in many diseases and human cancers. A large number of cancer studies have been focused on identification of methylation changes as biomarkers (i.e., breast cancer). However, still clinical use of them is very limited because of lack of specificity and sensitivity for diagnostic test. This highlights the critical need for specific primer and probe design to avoid false-positive detection of methylation profiling. The guideline and online web tools that are introduced in this paper might help to perform a successful experiment and to develop specific diagnosis biomarkers by designing right primer pair and probe prior to experimental step. PMID:20798774

  10. Differentiation of five tuna species by a multiplex primer-extension assay.

    PubMed

    Bottero, Maria Teresa; Dalmasso, Alessandra; Cappelletti, Marco; Secchi, Camillo; Civera, Tiziana

    2007-05-01

    A novel methodology based on analysis of mtDNA-cytb diagnostic sites was performed to discriminate four closely related species of Thunnus (Thunnus alalunga, Thunnus albacares, Thunnus obesus and Thunnus thynnus) and one species of Euthynnus (Katsuwonus pelamis) genus in raw and canned tuna. The primers used in the preliminary PCR designed in well conserved region upstream and downstream of the diagnosis sites successfully amplified a 132bp region from the cytb gene of all the species taken into consideration. The sites of diagnosis have been interrogate simultaneously using a multiplex primer-extension assay (PER) and the results were confirmed by fragment sequencing. The applicability of the multiplex PER assay to commercial canned tuna samples was also demonstrated. The proposed test could be useful for detection of fraud and for seafood traceability. PMID:17353060

  11. Specific Polymerase Chain Reaction Primers for the Detection of Plasmodiophora brassicae in Soil and Water.

    PubMed

    Faggian, R; Bulman, S R; Lawrie, A C; Porter, I J

    1999-05-01

    ABSTRACT The development of specific oligonucleotide primers for Plasmodiophora brassicae has led to a nested polymerase chain reaction (PCR) detection method for P. brassicae in soil and water. Initially, the PCR was used to amplify a section of the rDNA repeat. The PCR products were sequenced and the data used to design primers that were directed at the ribosomal RNA genes and internal transcribed spacer regions. Specificity was tested against more than 40 common soil organisms, host plants, and spore suspension contaminants, as well as P. brassicae isolates from around Australia and the world. Sensitivity was determined to be 0.1 fentograms (fg; 10(-15) g) for pure template and as low as 1,000 spores per g of potting mix. In soil, P. brassicae was detected in all soils where the inoculum was sufficient to result in clubroot symptoms. Also outlined is a simple method of DNA extraction from soil. PMID:18944752

  12. Specific oligonucleotide primers for detection of lecithinase-positive Bacillus spp. by PCR.

    PubMed Central

    Schraft, H; Griffiths, M W

    1995-01-01

    An assay based on the PCR has been developed to facilitate detection and identification of Bacillus cereus in foods. Three primers for the PCR have been designed within the sequence for cereolysin AB, a cytolytic determinant that encodes lecithin-hydrolyzing and hemolytic activities of B. cereus. With the PCR and hybridization, the specificity of the primers was tested with 39 isolates of the B. cereus group, with 17 other Bacillus spp., and with 21 non-Bacillus strains. Results demonstrate a high specificity of the three oligonucleotides for isolates of the B. cereus group. With a combined PCR-hybridization assay, the detection limit for B. cereus in artificially contaminated milk was 1 CFU/ml of milk. PMID:7887632

  13. The National Cancer Institute's Dietary Assessment Primer: A Resource for Diet Research.

    PubMed

    Thompson, Frances E; Kirkpatrick, Sharon I; Subar, Amy F; Reedy, Jill; Schap, TusaRebecca E; Wilson, Magdalena M; Krebs-Smith, Susan M

    2015-12-01

    This monograph describes the National Cancer Institute's Dietary Assessment Primer, a web resource developed to help researchers choose the best available dietary assessment approach to achieve their research objective. All self-report instruments have error, but understanding the nature of that error can lead to better assessment, analysis, and interpretation of results. The Primer includes profiles of the major self-report dietary assessment instruments, including guidance on the best uses of each instrument; discussion of validation and measurement error generally and with respect to each instrument; guidance for choosing a dietary assessment approach for different research questions; and additional resources, such as a glossary, references, and overviews of specific/important issues in the field. This monograph also describes some future research needs in the field of dietary assessment.

  14. Construction of a Transcription Map for Papillomaviruses using RACE, RNase Protection, and Primer Extension Assays.

    PubMed

    Wang, Xiaohong; Zheng, Zhi-Ming

    2016-02-08

    Papillomaviruses are a family of small, non-enveloped DNA tumor viruses. Knowing a complete transcription map of each papillomavirus genome can provide guidance for various papillomavirus studies. This unit provides detailed protocols to construct a transcription map of human papillomavirus type 18. The same approach can be easily adapted to other transcription map studies of any other papillomavirus genotype due to the high degree of conservation in genome structure, organization, and gene expression among papillomaviruses. The focused methods are 5'- and 3'-rapid amplification of cDNA ends (RACE), which are techniques commonly used in molecular biology to obtain full-length RNA transcript or to map a transcription start site (TSS) or an RNA polyadenylation (pA) cleavage site. Primer walking RT-PCR is a method for studying the splicing junction of RACE products. In addition, RNase protection assay and primer extension are also introduced as alternative methods in the mapping analysis.

  15. 40 CFR 63.3092 - How must I control emissions from my electrodeposition primer system if I want to comply with the...

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ...)-defined carcinogen as specified in 29 CFR 1910.1200(d)(4). (b) Emissions from all bake ovens used to cure... electrodeposition primer system if I want to comply with the combined primer-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? 63.3092 Section 63.3092 Protection...

  16. 40 CFR 63.3092 - How must I control emissions from my electrodeposition primer system if I want to comply with the...

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... carcinogen as specified in 29 CFR 1910.1200(d)(4). (b) Emissions from all bake ovens used to cure... electrodeposition primer system if I want to comply with the combined primer-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? 63.3092 Section 63.3092 Protection...

  17. 40 CFR 63.3092 - How must I control emissions from my electrodeposition primer system if I want to comply with the...

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... carcinogen as specified in 29 CFR 1910.1200(d)(4). (b) Emissions from all bake ovens used to cure... electrodeposition primer system if I want to comply with the combined primer-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? 63.3092 Section 63.3092 Protection...

  18. 40 CFR 63.3092 - How must I control emissions from my electrodeposition primer system if I want to comply with the...

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ...)-defined carcinogen as specified in 29 CFR 1910.1200(d)(4). (b) Emissions from all bake ovens used to cure... electrodeposition primer system if I want to comply with the combined primer-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? 63.3092 Section 63.3092 Protection...

  19. 40 CFR 63.3092 - How must I control emissions from my electrodeposition primer system if I want to comply with the...

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ...)-defined carcinogen as specified in 29 CFR 1910.1200(d)(4). (b) Emissions from all bake ovens used to cure... electrodeposition primer system if I want to comply with the combined primer-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? 63.3092 Section 63.3092 Protection...

  20. PIPEMicroDB: microsatellite database and primer generation tool for pigeonpea genome.

    PubMed

    Sarika; Arora, Vasu; Iquebal, M A; Rai, Anil; Kumar, Dinesh

    2013-01-01

    Molecular markers play a significant role for crop improvement in desirable characteristics, such as high yield, resistance to disease and others that will benefit the crop in long term. Pigeonpea (Cajanus cajan L.) is the recently sequenced legume by global consortium led by ICRISAT (Hyderabad, India) and been analysed for gene prediction, synteny maps, markers, etc. We present PIgeonPEa Microsatellite DataBase (PIPEMicroDB) with an automated primer designing tool for pigeonpea genome, based on chromosome wise as well as location wise search of primers. Total of 123 387 Short Tandem Repeats (STRs) were extracted from pigeonpea genome, available in public domain using MIcroSAtellite tool (MISA). The database is an online relational database based on 'three-tier architecture' that catalogues information of microsatellites in MySQL and user-friendly interface is developed using PHP. Search for STRs may be customized by limiting their location on chromosome as well as number of markers in that range. This is a novel approach and is not been implemented in any of the existing marker database. This database has been further appended with Primer3 for primer designing of selected markers with left and right flankings of size up to 500 bp. This will enable researchers to select markers of choice at desired interval over the chromosome. Furthermore, one can use individual STRs of a targeted region over chromosome to narrow down location of gene of interest or linked Quantitative Trait Loci (QTLs). Although it is an in silico approach, markers' search based on characteristics and location of STRs is expected to be beneficial for researchers. Database URL: http://cabindb.iasri.res.in/pigeonpea/ PMID:23396298

  1. An anti-steroidogenic inhibitory primer pheromone in male sea lamprey (Petromyzon marinus)

    USGS Publications Warehouse

    Chung-Davidson, Yu-Wen; Wang, Huiyong; Bryan, Mara B.; Wu, Hong; Johnson, Nicholas S.; Li, Weiming

    2013-01-01

    Reproductive functions can be modulated by both stimulatory and inhibitory primer pheromones released by conspecifics. Many stimulatory primer pheromones have been documented, but relatively few inhibitory primer pheromones have been reported in vertebrates. The sea lamprey male sex pheromone system presents an advantageous model to explore the stimulatory and inhibitory primer pheromone functions in vertebrates since several pheromone components have been identified. We hypothesized that a candidate sex pheromone component, 7α, 12α-dihydroxy-5α-cholan-3-one-24-oic acid (3 keto-allocholic acid or 3kACA), exerts priming effects through the hypothalamic-pituitary-gonadal (HPG) axis. To test this hypothesis, we measured the peptide concentrations and gene expressions of lamprey gonadotropin releasing hormones (lGnRH) and the HPG output in immature male sea lamprey exposed to waterborne 3kACA. Exposure to waterborne 3kACA altered neuronal activation markers such as jun and jun N-terminal kinase (JNK), and lGnRH mRNA levels in the brain. Waterborne 3kACA also increased lGnRH-III, but not lGnRH-I or -II, in the forebrain. In the plasma, 3kACA exposure decreased all three lGnRH peptide concentrations after 1 h exposure. After 2 h exposure, 3kACA increased lGnRHI and -III, but decreased lGnRH-II peptide concentrations in the plasma. Plasma lGnRH peptide concentrations showed differential phasic patterns. Group housing condition appeared to increase the averaged plasma lGnRH levels in male sea lamprey compared to isolated males. Interestingly, 15α-hydroxyprogesterone (15α-P) concentrations decreased after prolonged 3kACA exposure (at least 24 h). To our knowledge, this is the only known synthetic vertebrate pheromone component that inhibits steroidogenesis in males.

  2. The Astrobiology Primer: An Outline of General Knowledge-Version 1, 2006

    NASA Astrophysics Data System (ADS)

    Billings, L.; Cameron, V.; Claire, M.; Dick, G. J.; Domagal-Goldman, S. D.; Javaux, E. J.; Johnson, O. J.; Laws, C.; Race, M. S.; Rask, J.; Rummel, J. D.; Schelble, R. T.; Vance, S.

    2006-10-01

    The Astrobiology Primer has been created as a reference tool for those who are interested in the interdisciplinary field of astrobiology. The field incorporates many diverse research endeavors, but it is our hope that this slim volume will present the reader with all he or she needs to know to become involved and to understand, at least at a fundamental level, the state of the art. Each section includes a brief overview of a topic and a short list of readable and important literature for those interested in deeper knowledge. Because of the great diversity of material, each section was written by a different author with a different expertise. Contributors, authors, and editors are listed at the beginning, along with a list of those chapters and sections for which they were responsible. We are deeply indebted to the NASA Astrobiology Institute (NAI), in particular to Estelle Dodson, David Morrison, Ed Goolish, Krisstina Wilmoth, and Rose Grymes for their continued enthusiasm and support. The Primer came about in large part because of NAI support for graduate student research, collaboration, and inclusion as well as direct funding. We have entitled the Primer version 1 in hope that it will be only the first in a series, whose future volumes will be produced every 3-5 years. This way we can insure that the Primer keeps up with the current state of research. We hope that it will be a great resource for anyone trying to stay abreast of an ever-changing field. If you have noticed any errors of fact or wish to be involved in future incarnations of the project, please contact Lucas Mix (e-mail: lucas@flirble.org).

  3. An anti-steroidogenic inhibitory primer pheromone in male sea lamprey (Petromyzon marinus).

    PubMed

    Chung-Davidson, Yu-Wen; Wang, Huiyong; Bryan, Mara B; Wu, Hong; Johnson, Nicholas S; Li, Weiming

    2013-08-01

    Reproductive functions can be modulated by both stimulatory and inhibitory primer pheromones released by conspecifics. Many stimulatory primer pheromones have been documented, but relatively few inhibitory primer pheromones have been reported in vertebrates. The sea lamprey male sex pheromone system presents an advantageous model to explore the stimulatory and inhibitory primer pheromone functions in vertebrates since several pheromone components have been identified. We hypothesized that a candidate sex pheromone component, 7α, 12α-dihydroxy-5α-cholan-3-one-24-oic acid (3 keto-allocholic acid or 3kACA), exerts priming effects through the hypothalamic-pituitary-gonadal (HPG) axis. To test this hypothesis, we measured the peptide concentrations and gene expressions of lamprey gonadotropin releasing hormones (lGnRH) and the HPG output in immature male sea lamprey exposed to waterborne 3kACA. Exposure to waterborne 3kACA altered neuronal activation markers such as jun and jun N-terminal kinase (JNK), and lGnRH mRNA levels in the brain. Waterborne 3kACA also increased lGnRH-III, but not lGnRH-I or -II, in the forebrain. In the plasma, 3kACA exposure decreased all three lGnRH peptide concentrations after 1h exposure. After 2h exposure, 3kACA increased lGnRH-I and -III, but decreased lGnRH-II peptide concentrations in the plasma. Plasma lGnRH peptide concentrations showed differential phasic patterns. Group housing condition appeared to increase the averaged plasma lGnRH levels in male sea lamprey compared to isolated males. Interestingly, 15α-hydroxyprogesterone (15α-P) concentrations decreased after prolonged 3kACA exposure (at least 24h). To our knowledge, this is the only known synthetic vertebrate pheromone component that inhibits steroidogenesis in males.

  4. Development of primers to amplify mitochondrial DNA control region of Old World porcupines (subgenus Hystrix).

    PubMed

    Trucchi, E; Gentile, G; Sbordoni, V

    2008-09-01

    Eight primers were developed for the amplification of mitochondrial DNA control region of Old world porcupines (subgenus Hystrix). Successful amplifications of low-quality DNA extracted from old (12 years old) and recent quills were performed, thus facilitating field sampling. Successful cross-species amplifications were obtained for Hystrix africaeaustralis, H. cristata and H. indica. Length and structure of mitochondrial DNA control region were analysed and its usefulness as genetic marker for interspecific and population investigation was discussed.

  5. OrigenArp Primer: How to Perform Isotopic Depletion and Decay Calculations with SCALE/ORIGEN

    SciTech Connect

    Bowman, Stephen M; Gauld, Ian C

    2010-08-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for nuclear analyses. ORIGEN-ARP is a SCALE isotopic depletion and decay analysis sequence used to perform point-depletion calculations with the well-known ORIGEN-S code using problem-dependent cross sections. Problem-dependent cross-section libraries are generated using the ARP (Automatic Rapid Processing) module using an interpolation algorithm that operates on pre-generated libraries created for a range of fuel properties and operating conditions. Methods are provided in SCALE to generate these libraries using one-, two-, and three-dimensional transport codes. The interpolation of cross sections for uranium-based fuels may be performed for the variables burnup, enrichment, and water density. An option is also available to interpolate cross sections for mixed-oxide (MOX) fuels using the variables burnup, plutonium content, plutonium isotopic vector, and water moderator density. This primer is designed to help a new user understand and use ORIGEN-ARP with the OrigenArp Windows graphical user interface in SCALE. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with nuclear depletion codes in general or with SCALE/ORIGEN-ARP in particular. The primer is based on SCALE 6 but should be applicable to earlier or later versions of SCALE. Information is included to help new users, along with several sample problems that walk the user through the different input forms and menus and illustrate the basic features. References to related documentation are provided. The primer provides a starting point for the nuclear analyst who uses SCALE/ORIGEN-ARP. Complete descriptions are provided in the SCALE documentation. Although the primer is self-contained, it is intended as a companion volume to the SCALE documentation. The SCALE Manual is

  6. Applied Ecosystem Analysis - - a Primer : EDT the Ecosystem Diagnosis and Treatment Method.

    SciTech Connect

    Lestelle, Lawrence C.; Mobrand, Lars E.

    1996-05-01

    The aim of this document is to inform and instruct the reader about an approach to ecosystem management that is based upon salmon as an indicator species. It is intended to provide natural resource management professionals with the background information needed to answer questions about why and how to apply the approach. The methods and tools the authors describe are continually updated and refined, so this primer should be treated as a first iteration of a sequentially revised manual.

  7. Development of primers to amplify mitochondrial DNA control region of Old World porcupines (subgenus Hystrix).

    PubMed

    Trucchi, E; Gentile, G; Sbordoni, V

    2008-09-01

    Eight primers were developed for the amplification of mitochondrial DNA control region of Old world porcupines (subgenus Hystrix). Successful amplifications of low-quality DNA extracted from old (12 years old) and recent quills were performed, thus facilitating field sampling. Successful cross-species amplifications were obtained for Hystrix africaeaustralis, H. cristata and H. indica. Length and structure of mitochondrial DNA control region were analysed and its usefulness as genetic marker for interspecific and population investigation was discussed. PMID:21585995

  8. Development of acceptance criteria for batches of silane primer for external tank thermal protection system bonding applications

    NASA Technical Reports Server (NTRS)

    Mikes, F.

    1985-01-01

    Fourier transform infrared spectroscopy is currently the best technique for observing hydrolytic changes in DC 1200 silane the primers caused by moisture in the atmosphere. To further prove that FTIR can be used as a criterion test for acceptance of silane primer lots, intensities of the FTIR OH- band are being compared with primer adhesive bond strength using a mechanical test suggested by NASA. Results of tests for shear strength and Oh-absorption are tabulated and compared with FTIR absorption intensities in the OH-region.

  9. Construction of "small-intelligent" focused mutagenesis libraries using well-designed combinatorial degenerate primers.

    PubMed

    Tang, Lixia; Gao, Hui; Zhu, Xuechen; Wang, Xiong; Zhou, Ming; Jiang, Rongxiang

    2012-03-01

    Site-saturation mutagenesis is a powerful tool for protein optimization due to its efficiency and simplicity. A degenerate codon NNN or NNS (K) is often used to encode the 20 standard amino acids, but this will produce redundant codons and cause uneven distribution of amino acids in the constructed library. Here we present a novel "small-intelligent" strategy to construct mutagenesis libraries that have a minimal gene library size without inherent amino acid biases, stop codons, or rare codons of Escherichia coli by coupling well-designed combinatorial degenerate primers with suitable PCR-based mutagenesis methods. The designed primer mixture contains exactly one codon per amino acid and thus allows the construction of small-intelligent mutagenesis libraries with one gene per protein. In addition, the software tool DC-Analyzer was developed to assist in primer design according to the user-defined randomization scheme for library construction. This small-intelligent strategy was successfully applied to the randomization of halohydrin dehalogenases with one or two randomized sites. With the help of DC-Analyzer, the strategy was proven to be as simple as NNS randomization and could serve as a general tool to efficiently randomize target genes at positions of interest.

  10. New universal primers for genotyping and resistance detection of low HBV DNA levels.

    PubMed

    Tong, Yongqing; Liu, Bei; Liu, Hui; Zheng, Hongyun; Gu, Jian; Liu, Hang; Lin, Min; Ding, Yali; Song, Chunhua; Li, Yan

    2016-08-01

    HBV (hepatitis B virus) genotyping is important in determining the clinical manifestation of disease and treatment response, particularly, in patients with low viral loads. Also, sensitive detection of HBV antiviral drug resistance mutations is essential for monitoring therapy response.Asensitive direct sequencing method for genotyping and the drug resistance mutation detection of low levels of HBV DNA in patients' plasma is developed by PCR amplification of the DNA with novel universal primers.The novel, common, and universal primers were identified by alignment of RT region of all the HBV DNA sequences in databases. These primers could efficiently amplify the RT region of HBV virus at low DNA levels by directly sequencing the resulting PCR products, and mapping with the reference sequence made it possible to clearly obtain the HBV subtypes and identify the resistance mutations in the samples with HBV DNA level as low as 20 IU/mL. We examined the reliability of the method in clinical samples, and found it could detect the HBV subtypes and drug resistance mutations in 80 clinical HBV samples with low HBV DNA levels ranging from 20 to 200 IU/mL.This method is a sensitive and reliable direct sequencing method for HBV genotyping and antiviral drug resistance mutation detection, and is helpful for efficiently monitoring the response to therapy in HBV patients. PMID:27537600

  11. Analysis of telomerase activity based on a spired DNA tetrahedron TS primer.

    PubMed

    Li, Yan; Wen, Yanli; Wang, Lele; Liang, Wen; Xu, Li; Ren, Shuzhen; Zou, Ziying; Zuo, Xiaolei; Fan, Chunhai; Huang, Qing; Liu, Gang; Jia, Nengqin

    2015-05-15

    The development of sensitive telomerase biosensors is hindered by the restricted accessibility of telomere strand (TS) primer and the limited enzyme reaction space, which is mainly confined by the vertical distance. In this work, we designed an electrochemical telomerase biosensor based on a spired DNA tetrahedron TS primer (STTS). By adding a rigid dsDNA spire onto the top of the DNA tetrahedron, we successfully regulated the distance between the TS primer and the surface, and thus greatly facilitated the telomerase elongation on surface. The signal-to-noise ratio was 2 times higher than TSP without the spire structure. The limit of detection was calculated to be lower than 10 HeLa cells, which is at least 2 magnitudes lower than other surface extension-based electrochemical telomerase sensors without amplification. The practicability of STTS sensor was also demonstrated by analysing various other cell lines including cancer cells, stem cells of high telomerase activity and somatic cells of low telomerase activity.

  12. Transferability of microsatellite primers developed for stingless bees to four other species of the genus Melipona.

    PubMed

    Viana, M V C; Miranda, E A; de Francisco, A K; Carvalho, C A L; Waldschmidt, A M

    2011-11-22

    Microsatellite markers are a useful tool for ecological monitoring of natural and managed populations. A technical limitation is the necessity for investment in the development of primers. Heterologous primers can provide an alternative to searching for new loci. In bees, these markers have been used in populational and intracolonial genetic analyses. The genus Melipona has the largest number of species among bee genera, about 70, occurring throughout the Neotropical region. However, only five species of the genus Melipona have specific microsatellite markers. Given the great diversity of this genus, this number is not representative. We analyzed the transferability of 49 microsatellite loci to four other species of the genus Melipona (M. scutellaris, M. mondury, M. mandacaia, and M. quadrifasciata). Four individuals of each species, from different localities, were used in amplification tests. Primer pairs described for five Melipona species and for Trigona carbonaria were tested. Among the 49 loci, 22 gave amplification products for all four species, while three gave nonspecific bands and five showed no amplification products. The remaining loci varied in the pattern of amplification, according to the species examined. The number of alleles ranged from 1 to 6. The results demonstrate the possibility of using these heterologous markers in other Melipona species, increasing the number of loci that can be analyzed and contributing to further genetic analyses of intra- and intercolonial structure, which is required for conservation measure planning, genetic improvement and resolution of taxonomic problems.

  13. Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA

    SciTech Connect

    Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J.

    2012-08-01

    The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.

  14. Cell-free cloning using multiply-primed rolling circle amplification with modified RNA primers.

    PubMed

    Takahashi, Hirokazu; Yamamoto, Kimiko; Ohtani, Toshio; Sugiyama, Shigeru

    2009-07-01

    The predominant method for DNA cloning is by propagation in biological hosts, but this method has limitations because certain sequences are difficult to clone using any combination of available hosts or vectors. Recently, multiply-primed rolling circle amplification (MPRCA) has been applied to overcome the problems of the DNA cloning via host cells. However, when MPRCA is used to amplify from minute quantities of DNA template, the products are mostly by-product DNA molecules generated by false priming and primer dimer formation. This study demonstrates that MPRCA using random RNA primers[#x02014]instead of DNA primers[#x02014]blocked the synthesis of by-products and succeeded in amplifying one copy of a circular DNA molecule more than 1012-fold to give microgram quantities of amplification product without using submicroliter reaction volumes. Furthermore, a ligation strategy was elaborated to circularize only the desired DNA sequence and eliminate undesired ligation-products. A combination of these methods was able to amplify and ligate a large construct without undesired DNA sequences and at microgram quantities within one day. Therefore, these methods have the possibility to improve DNA cloning techniques that have been restricted by the limitations of PCR methods or by the host cell.

  15. Secondary structure of the HIV-2 leader RNA comprising the tRNA-primer binding site.

    PubMed Central

    Berkhout, B; Schoneveld, I

    1993-01-01

    The initiation of reverse transcription of a retroviral RNA genome occurs by a tRNA primer bound near the 5' end of the genomic RNA at a position called the primer-binding site (PBS). To understand the molecular basis for this RNA-RNA interaction, the secondary structure of the leader RNA of the human immunodeficiency virus type 2 (HIV-2) RNA was analyzed. In vitro synthesized HIV-2 RNA was probed with various structure-specific enzymes and chemicals. A computer program was then used to predict the secondary structure consistent with these data. In addition, the nucleotide sequences of different HIV-2 isolates were used to screen for the occurrence of covariation among putative base pairs. The primary sequences have diverged rapidly in some HIV-2 isolates, however, some strikingly conserved secondary structure elements were identified. Most nucleotides in the leader region are involved in base pairing. An exception is the PBS sequence, of which 15 out of 18 nucleotides are exposed in an internal loop. These findings suggest that the overall structure of the HIV-2 genome has evolved to facilitate an optimal interaction with its tRNA primer. Images PMID:8464701

  16. Development of species-specific primers for rapid identification of Debaryomyces hansenii.

    PubMed

    Wrent, Petra; Rivas, Eva-María; Gil de Prado, Elena; Peinado, José M; de Silóniz, María-Isabel

    2015-01-16

    In this work, we developed a specific PCR assay for Debaryomyces hansenii strains that uses a putative homologous PAD1 region (729 bp) present in this yeast species as a target. The amplification of this sequence with the D. hansenii specific primer pair (DhPADF/DhPADR) was found to be a rapid, specific and an affordable method enabling identification of D. hansenii from other yeast strains. Primers were tested in almost 100 strains, 49 strains from Type Culture Collection belonging to the genus Debaryomyces and to other yeast species commonly found in foods or related genera. These primers were able to discriminate between closely related species of Debaryomyces, such as Debaryomyces fabryi and Debaryomyces subglobosus, with a 100% detection rate for D. hansenii. Also, the method was tested in 45 strains from different foods. Results confirmed the specificity of the PCR method and detected two earlier misidentifications of D. hansenii strains obtained by RFLP analysis of the 5.8S ITS rDNA region. Subsequently we confirmed by sequencing the D1/D2 domain of 26S rDNA that these strains belonged to D. fabryi. We call attention in this work to the fact that the RFLPs of the 5.8S ITS rDNA profiles of D. hansenii, D. fabryi and D. subglobosus are the same and this technique will thus lead to incorrect identifications. PMID:25462930

  17. Tea stains-inspired initiator primer for surface grafting of antifouling and antimicrobial polymer brush coatings.

    PubMed

    Pranantyo, Dicky; Xu, Li Qun; Neoh, Koon-Gee; Kang, En-Tang; Ng, Ying Xian; Teo, Serena Lay-Ming

    2015-03-01

    Inspired by tea stains, plant polyphenolic tannic acid (TA) was beneficially employed as the primer anchor for functional polymer brushes. The brominated TA (TABr) initiator primer was synthesized by partial modification of TA with alkyl bromide functionalities. TABr with trihydroxyphenyl moieties can readily anchor on a wide range of substrates, including metal, metal oxide, polymer, glass, and silicon. Concomitantly, the alkyl bromide terminals serve as initiation sites for atom transfer radical polymerization (ATRP). Cationic [2-(methacryloyloxy)ethyl]trimethylammonium chloride (META) and zwitterionic 2-methacryloyloxyethyl phosphorylcholine (MPC) and N-(3-sulfopropyl)-N-(methacryloxyethyl)-N,N-dimethylammonium betaine (SBMA) were graft-polymerized from the TABr-anchored stainless steel (SS) surface. The cationic polymer brushes on the modified surfaces are bactericidal, while the zwitterionic coatings exhibit resistance against bacterial adhesion. In addition, microalgal attachment (microfouling) and barnacle cyprid settlement (macrofouling) on the functional polymer-grafted surfaces were significantly reduced, in comparison to the pristine SS surface. Thus, the bifunctional TABr initiator primer provides a unique surface anchor for the preparation of functional polymer brushes for inhibiting both microfouling and macrofouling. PMID:25650890

  18. Genetic linkage analysis using pooled DNA and infrared detection of tailed STRP primer patterns

    NASA Astrophysics Data System (ADS)

    Oetting, William S.; Wildenberg, Scott C.; King, Richard A.

    1996-04-01

    The mapping of a disease locus to a specific chromosomal region is an important step in the eventual isolation and analysis of a disease causing gene. Conventional mapping methods analyze large multiplex families and/or smaller nuclear families to find linkage between the disease and a chromosome marker that maps to a known chromosomal region. This analysis is time consuming and tedious, typically requiring the determination of 30,000 genotypes or more. For appropriate populations, we have instead utilized pooled DNA samples for gene mapping which greatly reduces the amount of time necessary for an initial chromosomal screen. This technique assumes a common founder for the disease locus of interest and searches for a region of a chromosome shared between affected individuals. Our analysis involves the PCR amplification of short tandem repeat polymorphisms (STRP) to detect these shared regions. In order to reduce the cost of genotyping, we have designed unlabeled tailed PCR primers which, when combined with a labeled universal primer, provides for an alternative to synthesizing custom labeled primers. The STRP pattern is visualized with an infrared fluorescence based automated DNA sequencer and the patterns quantitated by densitometric analysis of the allele pattern. Differences in the distribution of alleles between pools of affected and unaffected individuals, including a reduction in the number of alleles in the affected pool, indicate the sharing of a region of a chromosome. We have found this method effective for markers 10 - 15 cM away from the disease locus for a recessive genetic disease.

  19. Mechanism of RNA primer removal by the RNase H activity of avian myeloblastosis virus reverse transcriptase.

    PubMed Central

    Champoux, J J; Gilboa, E; Baltimore, D

    1984-01-01

    The single-stranded DNA containing the Moloney murine leukemia virus origin for plus-strand synthesis was cloned in M13mp2 and used as a template for avian myeloblastosis virus reverse transcriptase in the presence of Moloney RNA which had been treated with pancreatic RNase A. The RNA pieces containing the polypurine stretch near the plus-strand origin were processed, presumably by RNase H, to generate primers for DNA synthesis which initiated both at the correct origin site and at one nucleotide downstream from the correct site. Approximately 50% of the labeled DNA fragments synthesized under these conditions retained the priming RNA on their 5' ends. When the isolated fragments were hybridized back to the template DNA and again treated with the reverse transcriptase, all of the RNA was removed from the labeled DNA. By using 5'-end-labeled pancreatic RNase A-resistant fragments, it was possible to show that the RNA primers were removed intact. It appears from these results that the RNase H activity associated with the enzyme shows a preference for cutting at the junction between the RNA and DNA moieties of such complexes and therefore is ideally suited for removing RNA primers. Images PMID:6199510

  20. Plasma polymerized primer for rubber-to-metal bonding: Adhesion measurement and interphase characterization

    SciTech Connect

    Tsai, Y.M.; Boerio, F.J.; Kim, D.K.

    1996-12-31

    Adhesion of rubber to steel is of considerable practical importance in many areas of technology. However, direct adhesion of natural rubber to most metals is very poor. As a result, metals are frequently plated with brass, to which rubber adheres very strongly, or else the metals are coated with proprietary primers and adhesives in order to obtain adhesion of rubber. Plasma processing has been attracting attention in many areas due to some of its unique features. During the process, the synthesis and deposition of plasma polymers can be accomplished at the same time, making plasma processing a very efficient method for polymer coating. Plasma processing also allows flexible combinations of reactor parameters which would provide a great deal of process control and versatility. Moreover, in plasma processing, there are no solvents involved and there are no solvent-disposal problems. The purpose of this paper is to describe results the authors have obtained in developing plasma polymerized primer films to enhance rubber-to-steel bonding. Preliminary durability test results are reported. Results obtained using a model rubber system to simulate reactions in the rubber/primer {open_quotes}interphase{close_quotes} are also described.

  1. Edesign: Primer and Enhanced Internal Probe Design Tool for Quantitative PCR Experiments and Genotyping Assays

    PubMed Central

    Kasahara, Naoko; Delobel, Diane; Hanami, Takeshi; Tanaka, Yuki; de Hoon, Michiel J. L.; Hayashizaki, Yoshihide; Usui, Kengo; Harbers, Matthias

    2016-01-01

    Analytical PCR experiments preferably use internal probes for monitoring the amplification reaction and specific detection of the amplicon. Such internal probes have to be designed in close context with the amplification primers, and may require additional considerations for the detection of genetic variations. Here we describe Edesign, a new online and stand-alone tool for designing sets of PCR primers together with an internal probe for conducting quantitative real-time PCR (qPCR) and genotypic experiments. Edesign can be used for selecting standard DNA oligonucleotides like for instance TaqMan probes, but has been further extended with new functions and enhanced design features for Eprobes. Eprobes, with their single thiazole orange-labelled nucleotide, allow for highly sensitive genotypic assays because of their higher DNA binding affinity as compared to standard DNA oligonucleotides. Using new thermodynamic parameters, Edesign considers unique features of Eprobes during primer and probe design for establishing qPCR experiments and genotyping by melting curve analysis. Additional functions in Edesign allow probe design for effective discrimination between wild-type sequences and genetic variations either using standard DNA oligonucleotides or Eprobes. Edesign can be freely accessed online at http://www.dnaform.com/edesign2/, and the source code is available for download. PMID:26863543

  2. New universal primers for genotyping and resistance detection of low HBV DNA levels.

    PubMed

    Tong, Yongqing; Liu, Bei; Liu, Hui; Zheng, Hongyun; Gu, Jian; Liu, Hang; Lin, Min; Ding, Yali; Song, Chunhua; Li, Yan

    2016-08-01

    HBV (hepatitis B virus) genotyping is important in determining the clinical manifestation of disease and treatment response, particularly, in patients with low viral loads. Also, sensitive detection of HBV antiviral drug resistance mutations is essential for monitoring therapy response.Asensitive direct sequencing method for genotyping and the drug resistance mutation detection of low levels of HBV DNA in patients' plasma is developed by PCR amplification of the DNA with novel universal primers.The novel, common, and universal primers were identified by alignment of RT region of all the HBV DNA sequences in databases. These primers could efficiently amplify the RT region of HBV virus at low DNA levels by directly sequencing the resulting PCR products, and mapping with the reference sequence made it possible to clearly obtain the HBV subtypes and identify the resistance mutations in the samples with HBV DNA level as low as 20 IU/mL. We examined the reliability of the method in clinical samples, and found it could detect the HBV subtypes and drug resistance mutations in 80 clinical HBV samples with low HBV DNA levels ranging from 20 to 200 IU/mL.This method is a sensitive and reliable direct sequencing method for HBV genotyping and antiviral drug resistance mutation detection, and is helpful for efficiently monitoring the response to therapy in HBV patients.

  3. Conserved primers for DNA barcoding historical and modern samples from New Zealand and Antarctic birds.

    PubMed

    Patel, Selina; Waugh, John; Millar, Craig D; Lambert, David M

    2010-05-01

    Our ability to DNA barcode the birds of the world is based on the effective amplification and sequencing of a 648 base pair (bp) region of the mitochondrial cytochrome c oxidase (COI or cox1) gene. For many geographic regions the large numbers of vouchered specimens necessary for the construction of a DNA barcoding database have already been collected and are available in museums and other institutions. However, many of these specimens are old (>20 years) and are stored as either fixed study skins or dried skeletons. DNA extracted from such historical samples is typically degraded and, generally, only short DNA fragments can be recovered from such specimens making the recovery of the barcoding region as a single fragment difficult. We report two sets of conserved primers that allow the amplification of the entire DNA barcoding region in either three or five overlapping fragments. These primer sets allow the recovery of DNA barcodes from valuable historical specimens that in many cases are unique in that they are unable or unlikely to be collected again. We also report three new primers that in combination allow the effective amplification from modern samples of the entire DNA barcoding region as a single DNA fragment for 17 orders of Southern Hemisphere birds.

  4. Modulation of non-templated nucleotide addition by Taq DNA polymerase: primer modifications that facilitate genotyping.

    PubMed

    Brownstein, M J; Carpten, J D; Smith, J R

    1996-06-01

    Taq DNA polymerase can catalyze non-templated addition of a nucleotide (principally adenosine) to the 3' end of PCR-amplified products. Recently, we showed that this activity, which is primer-specific, presents a potential source of error in genotyping studies based on the use of short tandem repeat (STR) markers. Furthermore, in reviewing our data, we found that non-templated nucleotide addition adjacent to a 3' terminal C is favored and that addition adjacent to a 3' terminal A is not. It was clear, however, that features of the template in addition to the 3' terminal base also affect the fraction of product adenylated. To define consensus sequences that promote or inhibit product adenylation, we transplanted sequences between the 5' ends of the reverse primers of markers that are adenylated and those of markers that are not adenylated. It proved difficult to identify a single sequence capable of protecting the products of all markers from non-templated addition of nucleotide. On the other hand, placing the sequence GTTTCTT on the 5' end of reverse primers resulted in nearly 100% adenylation of the 3' end of the forward strand. This modification or related ones (called "PIG-tailing") should facilitate accurate genotyping and efficient T/A cloning.

  5. Single universal primer multiplex ligation-dependent probe amplification with sequencing gel electrophoresis analysis.

    PubMed

    Shang, Ying; Zhu, Pengyu; Xu, Wentao; Guo, Tianxiao; Tian, Wenying; Luo, Yunbo; Huang, Kunlun

    2013-12-15

    In this study, a novel single universal primer multiplex ligation-dependent probe amplification (SUP-MLPA) technique that uses only one universal primer to perform multiplex polymerase chain reaction (PCR) was developed. Two reversely complementary common sequences were designed on the 5' or 3' end of the ligation probes (LPs), which allowed the ligation products to be amplified through only a single universal primer (SUP). SUP-MLPA products were analyzed on sequencing gel electrophoresis with extraordinary resolution. This method avoided the high expenses associated with capillary electrophoresis, which was the commonly used detection instrument. In comparison with conventional multiplex PCR, which suffers from low sensitivity, nonspecificity, and amplification disparity, SUP-MLPA had higher specificity and sensitivity and a low detection limit of 0.1 ng for detecting single crop species when screening the presence of genetically modified crops. We also studied the effect of different lengths of stuffer sequences on the probes for the first time. Through comparing the results of quantitative PCR, the LPs with different stuffer sequences did not affect the ligation efficiency, which further increased the multiplicity of this assay. The improved SUP-MLPA and sequencing gel electrophoresis method will be useful for food and animal feed identification, bacterial detection, and verification of genetic modification status of crops.

  6. ROTONET Primer

    NASA Technical Reports Server (NTRS)

    Prichard, Devon S.

    1996-01-01

    This document provides a brief overview of use of the ROTONET rotorcraft system noise prediction capability within the Aircraft Noise Program (ANOPP). Reviews are given on rotorcraft noise, the state-of-the-art of system noise prediction, and methods for using the various ROTONET prediction modules.

  7. Negotiations Primer.

    ERIC Educational Resources Information Center

    New Jersey Principals and Supervisors Association, Trenton.

    This booklet provides step-by-step advice for New Jersey school administrators on the organization of bargaining units and on negotiation. The section covering organizing reviews briefly the rights of school employee associations to negotiate, the values of collective negotiation, and the specific requirements and procedures involved in…

  8. NAEP Primer.

    ERIC Educational Resources Information Center

    Beaton, Albert E.; Gonzalez, Eugenio

    This guide to the National Assessment of Educational Progress (NAEP) is designed to help the secondary data analyst use the NAEP and to introduce some of the sophisticated technology used by the NAEP. The NAEP has been gathering information on American students since 1969. It samples populations that consist of all students in U.S. schools, both…

  9. Diskette Primer.

    ERIC Educational Resources Information Center

    Chien, Philip

    1986-01-01

    This detailed look into proper diskette maintenance presents general precautions on temperature, humidity, lifespan, labeling, storage, and disk drive maintenance. The Apple UniDisk 3.5 disk drive is described, tips on purchasing diskettes are presented, and information on specific data retrieval and backup software and diskettes is included. (MBR)

  10. Development of universal primers for detection of potato carlaviruses by RT-PCR.

    PubMed

    Nie, Xianzhou; Bai, Yanju; Molen, Teresa A; Desjardins, David C

    2008-05-01

    To facilitate efficient and accurate detection of potato-infecting carlaviruses, degenerated universal primers were designed based on conserved amino acid and nucleotide sequences. Two sense primers, Car-F1 and Car-F2, were based on the amino acid sequences "SNNMA" and "GLGVPTE", respectively, in the coat protein. The reverse primer, Car-R, which was located at the border of the nucleic acid binding protein gene and the 3' untranslated region, and dT-B, which was derived from the oligo-dT targeting the poly(A) tail, were selected. Successful application of fragments within the predicted size range of carlaviruses was obtained using Car-F1 paired with either Car-R or dT-B from tested carlaviruses (Potato virus S, M and latent) by RT-PCR. The Car-F2 failed to yield clear-cut fragments within the predicted size range when paired with either Car-R or dT-B in RT-PCR. However, a less degenerated version of the primer, Car-F2b, resulted in amplicons within the predicted size range when paired with either Car-R or dT-B. Sequencing of the tentative carlavirus-fragments resulting from Car-F1/Car-R and Car-F2b/dT-B proved their carlavirus-origin, thus indicating the high specificity of these primers. The sensitivity of Car-F1/Car-R or Car-F2b/Car-R mediated RT-PCR for the detection of carlavirus-infected potato tubers were assessed using composite samples containing one carlavirus-infected-potato-tuber RNA sample with up to 49 virus-free-potato-tuber RNA samples under the optimal annealing temperature. The target carlaviruses were detected readily from all composites, demonstrating a high sensitivity. The method was further evaluated using presumed virus-free or carlavirus-infected potatoes of several cultivars, and reliable results were obtained. PMID:18353450

  11. Application of microsatellite primers developed for Polistes in the independent-founding wasp Polists satan Bequaert (Hymenoptera: Vespidae).

    PubMed

    Komatsu, K; Mateus, S; Zucchi, R; Nascimento, F; Kudô, K

    2012-06-01

    Microsatellite primers developed for a given species are sometimes useful for another in the same genus and in other genera within the same family, making possible to search for pre-existing suitable primers in the databanks such as GenBank. We examined whether existing primers developed for Polistes could be used for Polistes satan Bequaert. We tested 50 microsatellite primers from three Polistes species and found that six microsatellite loci show polymorphism in size in P. satan. These six loci were highly polymorphic, having four to 15 alleles in P. satan with an expected heterozygosity of 0.525-0.832. These loci can be used to study parameters concerning genetic relatedness such as social interactions in colonies and genetic conflicts of interest among nestmate individuals.

  12. Tetra Primer ARMS PCR Optimization to Detect Single Nucleotide Polymorphisms of the CYP2E1 Gene.

    PubMed

    Suhda, Saihas; Paramita, Dewi Kartikawati; Fachiroh, Jajah

    2016-01-01

    Single nucleotide polymorphism (SNP) detection has been used extensively for genetic association studies of diseases including cancer. For mass, yet accurate and more economic SNP detection we have optimized tetra primer amplification refractory mutation system polymerase chain reaction (ARMS PCR) to detect three SNPs in the cytochrome P450 2E1 (CYP2E1) gene locus; i.e. rs3813865, rs2070672 and rs3813867. The optimization system strategies used were (1) designing inner and outer primers; (2) determining of their optimum primer concentration ratios; and (3) determining of the optimum PCR annealing temperature. The tetra primer ARMS PCR result could be directly observed using agarose gel electrophoresis. The method succesfully determined three SNPs in CYP2E1 locus, the results being consistent with validation using DNA sequencing and restriction fragment length polymorphisms (RFLP). PMID:27509930

  13. Tetra Primer ARMS PCR Optimization to Detect Single Nucleotide Polymorphisms of the CYP2E1 Gene.

    PubMed

    Suhda, Saihas; Paramita, Dewi Kartikawati; Fachiroh, Jajah

    2016-01-01

    Single nucleotide polymorphism (SNP) detection has been used extensively for genetic association studies of diseases including cancer. For mass, yet accurate and more economic SNP detection we have optimized tetra primer amplification refractory mutation system polymerase chain reaction (ARMS PCR) to detect three SNPs in the cytochrome P450 2E1 (CYP2E1) gene locus; i.e. rs3813865, rs2070672 and rs3813867. The optimization system strategies used were (1) designing inner and outer primers; (2) determining of their optimum primer concentration ratios; and (3) determining of the optimum PCR annealing temperature. The tetra primer ARMS PCR result could be directly observed using agarose gel electrophoresis. The method succesfully determined three SNPs in CYP2E1 locus, the results being consistent with validation using DNA sequencing and restriction fragment length polymorphisms (RFLP).

  14. Application of microsatellite primers developed for Polistes in the independent-founding wasp Polists satan Bequaert (Hymenoptera: Vespidae).

    PubMed

    Komatsu, K; Mateus, S; Zucchi, R; Nascimento, F; Kudô, K

    2012-06-01

    Microsatellite primers developed for a given species are sometimes useful for another in the same genus and in other genera within the same family, making possible to search for pre-existing suitable primers in the databanks such as GenBank. We examined whether existing primers developed for Polistes could be used for Polistes satan Bequaert. We tested 50 microsatellite primers from three Polistes species and found that six microsatellite loci show polymorphism in size in P. satan. These six loci were highly polymorphic, having four to 15 alleles in P. satan with an expected heterozygosity of 0.525-0.832. These loci can be used to study parameters concerning genetic relatedness such as social interactions in colonies and genetic conflicts of interest among nestmate individuals. PMID:23950044

  15. PLASMA POLYMER FILMS AS ADHESION PROMOTING PRIMERS FOR ALUMINUM. PART II: STRENGTH AND DURABILITY OF LAP JOINTS

    EPA Science Inventory

    Plasma polymerized hexamethyldisiloxane (HMDSO) films (~800 A in thickness) were deposited onto 6111-T4 aluminum substrates in radio frequency and microwave powered reactors and used as primers for structural adhesive bonding. Processing variables such as substrate pre-treatment,...

  16. tRNATrp (bovine) binding to the reverse transcriptase of avian myeloblastosis virus and function as a heterologous primer.

    PubMed Central

    Baroudy, B M; Fournier, M; Labouesse, J; Papas, T S; Chirikjian, J G

    1977-01-01

    The primary structures for tTNATrp (bovine) and primer tRNATrp (avian) show only minor differences in nucleotide sequence. The heterologous tRNATrp (bovine) appears to have properties similar to the tRNATrp (avian) in its ability to bind the alphabeta from of RNA-dependent DNA nucleotidyltransferase of avian myeloblastosis virus. A stable enzyme-tRNA complex has been isolated by gel filtration. In addition, tRNATrp (bovine) can hydridize to the avian viral 35S RNA and act as a primer for transcription of the RNA. tRNATrp (bovine) can be obtained in larger amounts than the avian primer and can be used to study the interactions between the primer and the viral enzyme. PMID:68471

  17. Amplification with molecular beacon primers and reverse line blotting for the detection and typing of human papillomaviruses.

    PubMed

    Jordens, J Z; Lanham, S; Pickett, M A; Amarasekara, S; Abeywickrema, I; Watt, P J

    2000-09-01

    A novel method for the detection and typing of human papillomavirus (HPV) was developed using molecular beacon primers. The method is based on the use of HPV-specific primers containing a hairpin loop structure in which fluorescent donor and quencher groups are held in close proximity such that fluorescence is quenched. Amplification of the target sequence results in the opening of the loop and the resulting fluorescence can be detected on a sequence detector system (SDS) 7700 (Applied Biosystems), as used for TaqMan assays. Fluorescent amplicons were identified on the SDS 7700 and then typed by a single hybridisation with specific probes immobilised in lines on a nylon membrane and detected on a fluorescent scanner. This novel beacon primer method compared well with conventional PCR for cervical scrape specimens. The combination of the beacon primer method and reverse line blotting should enable large-scale population studies of HPV infection.

  18. The novel primers for sex identification in the brown eared-pheasant and their application to other species.

    PubMed

    Wang, N; Zhang, Z-W

    2009-01-01

    We designed a pair of primers for sex identification in the brown eared-pheasant (Crossoptilon mantchuricum) based on the mechanism of PCR amplification of CHD fragments, and identified the number of products. The new primers were considered to have more sensitivity than P2/P8, and cross-species application indicated that they can also be used for sex identification in other species of Phasianidae and Passeriformes.

  19. Detection of the glmM Gene in Helicobacter pylori Isolates with a Novel Primer by PCR▿

    PubMed Central

    Córdova Espinoza, Maria Guadalupe; González Vazquez, Rosa; Morales Mendez, Iyari; Ruelas Vargas, Consuelo; Giono Cerezo, Silvia

    2011-01-01

    A novel reverse primer (GLM MR1) was designed for detection of the glmM gene in Helicobacter pylori by PCR. The percentage of amplification in clinical isolates using GLM MR1 was 100% for detection of the glmM gene and 86.36% for the ureA gene. The primer designed is useful for the identification of H. pylori. PMID:21289140

  20. Development of a Prokaryotic Universal Primer for Simultaneous Analysis of Bacteria and Archaea Using Next-Generation Sequencing

    PubMed Central

    Takahashi, Shunsuke; Tomita, Junko; Nishioka, Kaori; Hisada, Takayoshi; Nishijima, Miyuki

    2014-01-01

    For the analysis of microbial community structure based on 16S rDNA sequence diversity, sensitive and robust PCR amplification of 16S rDNA is a critical step. To obtain accurate microbial composition data, PCR amplification must be free of bias; however, amplifying all 16S rDNA species with equal efficiency from a sample containing a large variety of microorganisms remains challenging. Here, we designed a universal primer based on the V3-V4 hypervariable region of prokaryotic 16S rDNA for the simultaneous detection of Bacteria and Archaea in fecal samples from crossbred pigs (Landrace×Large white×Duroc) using an Illumina MiSeq next-generation sequencer. In-silico analysis showed that the newly designed universal prokaryotic primers matched approximately 98.0% of Bacteria and 94.6% of Archaea rRNA gene sequences in the Ribosomal Database Project database. For each sequencing reaction performed with the prokaryotic universal primer, an average of 69,330 (±20,482) reads were obtained, of which archaeal rRNA genes comprised approximately 1.2% to 3.2% of all prokaryotic reads. In addition, the detection frequency of Bacteria belonging to the phylum Verrucomicrobia, including members of the classes Verrucomicrobiae and Opitutae, was higher in the NGS analysis using the prokaryotic universal primer than that performed with the bacterial universal primer. Importantly, this new prokaryotic universal primer set had markedly lower bias than that of most previously designed universal primers. Our findings demonstrate that the prokaryotic universal primer set designed in the present study will permit the simultaneous detection of Bacteria and Archaea, and will therefore allow for a more comprehensive understanding of microbial community structures in environmental samples. PMID:25144201

  1. Improved Bacterial 16S rRNA Gene (V4 and V4-5) and Fungal Internal Transcribed Spacer Marker Gene Primers for Microbial Community Surveys

    SciTech Connect

    Walters , William; Hyde, Embriette R.; Berg-Lyons, Donna; Ackermann, Gail; Humphrey, Greg; Parada , Alma; Gilbert, Jack A.; Jansson, Janet K.; Caporaso, Greg; Fuhrman, Jed A.; Apprill, Amy; Knight, Rob

    2015-12-22

    Designing primers for PCR-based taxonomic surveys that amplify a broad range of phylotypes in varied community samples is a difficult challenge, and the comparability of datasets amplified with varied primers requires attention. Here we examine the performance of modified 16S rRNA gene and ITS primers for archaea/bacteria and fungi, respectively, with non-aquatic samples. We moved primer barcodes to the 5’-end, allowing for a range of different 3’ primer pairings, such as the 515f/926r primer pair, which amplifies variable regions 4-5 of the 16S rRNA gene. We additionally demonstrate that modifications to the 515f/806r (variable region 4) 16S primer pair, which improves detection of Thaumarchaeota and SAR11 in marine samples, do not degrade performance on taxa already amplified effectively by the original primer set. Alterations to the fungal ITS primers did result in differential but overall improved performance compared to the original primers. In both cases, the improved primers should be widely adopted for amplicon studies.

  2. Comparative in silico analysis of PCR primers suited for diagnostics and cloning of ammonia monooxygenase genes from ammonia-oxidizing bacteria.

    PubMed

    Junier, Pilar; Kim, Ok-Sun; Molina, Verónica; Limburg, Petra; Junier, Thomas; Imhoff, Johannes F; Witzel, Karl-Paul

    2008-04-01

    Over recent years, several PCR primers have been described to amplify genes encoding the structural subunits of ammonia monooxygenase (AMO) from ammonia-oxidizing bacteria (AOB). Most of them target amoA, while amoB and amoC have been neglected so far. This study compared the nucleotide sequence of 33 primers that have been used to amplify different regions of the amoCAB operon with alignments of all available sequences in public databases. The advantages and disadvantages of these primers are discussed based on the original description and the spectrum of matching sequences obtained. Additionally, new primers to amplify the almost complete amoCAB operon of AOB belonging to Betaproteobacteria (betaproteobacterial AOB), a primer pair for DGGE analysis of amoA and specific primers for gammaproteobacterial AOB, are also described. The specificity of these new primers was also evaluated using the databases of the sequences created during this study. PMID:18248438

  3. Problems with and a system to eliminate single-primer PCR product contamination in simple sequence repeat molecular marker-assisted selection in soybean.

    PubMed

    Ma, J; Guan, S C; Yao, D; Wei, Y F; Wang, P W

    2011-01-01

    Polymerase chain reaction (PCR) provides a foundation for simple sequence repeat molecular marker-assisted selection (SSR MAS) in soybean. This PCR system and its various conditions have been optimized by many researchers. However, current research on the optimization of the PCR system focuses on double-primer PCR products. We compared single- and double-SSR primer PCR products from 50 soybean samples and found that the use of single-PCR primers in the reaction system can lead to amplified fragments of portions of the SSR primers in the PCR process, resulting in both false-positives and fragment impurity of double-primer PCR amplification, inconvenient for subsequent analysis. We used "single-primer PCR correction" to eliminate interference caused by single-primer nonspecific PCR amplification and improve PCR quality. Using this method, the precision and success rates of SSR MAS in soybean can be increased.

  4. DegePrime, a Program for Degenerate Primer Design for Broad-Taxonomic-Range PCR in Microbial Ecology Studies

    PubMed Central

    Hugerth, Luisa W.; Wefer, Hugo A.; Lundin, Sverker; Jakobsson, Hedvig E.; Lindberg, Mathilda; Rodin, Sandra; Engstrand, Lars

    2014-01-01

    The taxonomic composition of a microbial community can be deduced by analyzing its rRNA gene content by, e.g., high-throughput DNA sequencing or DNA chips. Such methods typically are based on PCR amplification of rRNA gene sequences using broad-taxonomic-range PCR primers. In these analyses, the use of optimal primers is crucial for achieving an unbiased representation of community composition. Here, we present the computer program DegePrime that, for each position of a multiple sequence alignment, finds a degenerate oligomer of as high coverage as possible and outputs its coverage among taxonomic divisions. We show that our novel heuristic, which we call weighted randomized combination, performs better than previously described algorithms for solving the maximum coverage degenerate primer design problem. We previously used DegePrime to design a broad-taxonomic-range primer pair that targets the bacterial V3-V4 region (341F-805R) (D. P. Herlemann, M. Labrenz, K. Jurgens, S. Bertilsson, J. J. Waniek, and A. F. Andersson, ISME J. 5:1571–1579, 2011, http://dx.doi.org/10.1038/ismej.2011.41), and here we use the program to significantly increase the coverage of a primer pair (515F-806R) widely used for Illumina-based surveys of bacterial and archaeal diversity. By comparison with shotgun metagenomics, we show that the primers give an accurate representation of microbial diversity in natural samples. PMID:24928874

  5. Genome-Wide Characterization of Simple Sequence Repeat (SSR) Loci in Chinese Jujube and Jujube SSR Primer Transferability

    PubMed Central

    Xiao, Jing; Zhao, Jin; Liu, Mengjun; Liu, Ping; Dai, Li; Zhao, Zhihui

    2015-01-01

    Chinese jujube (Ziziphus jujuba), an economically important species in the Rhamnaceae family, is a popular fruit tree in Asia. Here, we surveyed and characterized simple sequence repeats (SSRs) in the jujube genome. A total of 436,676 SSR loci were identified, with an average distance of 0.93 Kb between the loci. A large proportion of the SSRs included mononucleotide, dinucleotide and trinucleotide repeat motifs, which accounted for 64.87%, 24.40%, and 8.74% of all repeats, respectively. Among the mononucleotide repeats, A/T was the most common, whereas AT/TA was the most common dinucleotide repeat. A total of 30,565 primer pairs were successfully designed and screened using a series of criteria. Moreover, 725 of 1,000 randomly selected primer pairs were effective among 6 cultivars, and 511 of these primer pairs were polymorphic. Sequencing the amplicons of two SSRs across three jujube cultivars revealed variations in the repeats. The transferability of jujube SSR primers proved that 35/64 SSRs could be transferred across family boundary. Using jujube SSR primers, clustering analysis results from 15 species were highly consistent with the Angiosperm Phylogeny Group (APGIII) System. The genome-wide characterization of SSRs in Chinese jujube is very valuable for whole-genome characterization and marker-assisted selection in jujube breeding. In addition, the transferability of jujube SSR primers could provide a solid foundation for their further utilization. PMID:26000739

  6. [Development, optimization and application of the expression analysis platform based on multiplex quantitative RT-PCR using fluorescent universal primers].

    PubMed

    Wang, Qin-Xi; Li, Kai; Zhou, Yu-Xun; Xiao, Jun-Hua

    2009-05-01

    A multiplex quantitative RT-PCR technology with a universal fluorescent primer was established. This technology employs a chimeric-primer-induced-universal-primer amplification method that ensures target genes amplified in a constant ratio. This technique was cost-effective, moderate-throughput, and reliable in quantification of gene expression. It is complementary to cDNA chip, which has low quantitative accuracy , and Real-time quantitative PCR with low throughput, through improving the entire process of expression profiling analysis. Eleven genes within a QTL segment regulating mouse puberty onset on chromosome X were investigated to construct and optimize the method. The sensitivity of detection (102 copies) was determined, the concentration ratio of universal primer and chimeric forward primers (1:1) was optimized, and the accuracy and repeatability were validated. The method of Touchdown PCR with addition of universal primers significantly improved amplification of genes expressed in low abundance. After testing the expression profile of 11 genes in hypothalamus and testis in two mouse strains C3H/HeJ and C57BL/6J at the age of 15 d, one gene named PHF6 was found differentially expressed for further function analysis.

  7. An RT-PCR primer pair for the detection of Pospiviroid and its application in surveying ornamental plants for viroids.

    PubMed

    Bostan, Hidayet; Nie, Xianzhou; Singh, Rudra P

    2004-03-15

    A primer pair for reverse transcription-polymerase chain reaction (RT-PCR), based on the conserved sequences of the members of genus Pospiviroid was designed to yield a fragment of about 200 base pairs (bp). Since pospiviroids infect a large number of plants species and a few members of the genus Pospiviroid have been already detected in some ornamental plants, the primer pair was evaluated for its efficacy using ornamental plants. The method of return-polyacrylamide gel electrophoresis (R-PAGE) was used to determine the general presence of viroids in the test samples. Efficacy of the primer pair for members of genus Pospiviroid was demonstrated by the detection of Potato spindle tuber viroid (PSTVd) and Tomato chlorotic dwarf viroid (TCDVd) in potato, Chrysanthemum stunt viroid and Iresine viroid in Verbena and Vinca species, and Citrus exocortis viroid in Impatiens species. Specificity of the primer pair became evident, where additional viroids were detected by R-PAGE in Coleus and Magilla species, but they were not amplified by the Pospiviroid primer. This primer pair would be of benefit in indexing ornamental plants in quarantine samples or in viroid-free certification schemes, irrespective of their actual identity.

  8. Systematic design of 18S rRNA gene primers for determining eukaryotic diversity in microbial consortia.

    PubMed

    Hugerth, Luisa W; Muller, Emilie E L; Hu, Yue O O; Lebrun, Laura A M; Roume, Hugo; Lundin, Daniel; Wilmes, Paul; Andersson, Anders F

    2014-01-01

    High-throughput sequencing of ribosomal RNA gene (rDNA) amplicons has opened up the door to large-scale comparative studies of microbial community structures. The short reads currently produced by massively parallel sequencing technologies make the choice of sequencing region crucial for accurate phylogenetic assignments. While for 16S rDNA, relevant regions have been well described, no truly systematic design of 18S rDNA primers aimed at resolving eukaryotic diversity has yet been reported. Here we used 31,862 18S rDNA sequences to design a set of broad-taxonomic range degenerate PCR primers. We simulated the phylogenetic information that each candidate primer pair would retrieve using paired- or single-end reads of various lengths, representing different sequencing technologies. Primer pairs targeting the V4 region performed best, allowing discrimination with paired-end reads as short as 150 bp (with 75% accuracy at genus level). The conditions for PCR amplification were optimised for one of these primer pairs and this was used to amplify 18S rDNA sequences from isolates as well as from a range of environmental samples which were then Illumina sequenced and analysed, revealing good concordance between expected and observed results. In summary, the reported primer sets will allow minimally biased assessment of eukaryotic diversity in different microbial ecosystems.

  9. Assessment of primer/template mismatch effects on real-time PCR amplification of target taxa for GMO quantification.

    PubMed

    Ghedira, Rim; Papazova, Nina; Vuylsteke, Marnik; Ruttink, Tom; Taverniers, Isabel; De Loose, Marc

    2009-10-28

    GMO quantification, based on real-time PCR, relies on the amplification of an event-specific transgene assay and a species-specific reference assay. The uniformity of the nucleotide sequences targeted by both assays across various transgenic varieties is an important prerequisite for correct quantification. Single nucleotide polymorphisms (SNPs) frequently occur in the maize genome and might lead to nucleotide variation in regions used to design primers and probes for reference assays. Further, they may affect the annealing of the primer to the template and reduce the efficiency of DNA amplification. We assessed the effect of a minor DNA template modification, such as a single base pair mismatch in the primer attachment site, on real-time PCR quantification. A model system was used based on the introduction of artificial mismatches between the forward primer and the DNA template in the reference assay targeting the maize starch synthase (SSIIb) gene. The results show that the presence of a mismatch between the primer and the DNA template causes partial to complete failure of the amplification of the initial DNA template depending on the type and location of the nucleotide mismatch. With this study, we show that the presence of a primer/template mismatch affects the estimated total DNA quantity to a varying degree.

  10. Genome-Wide Characterization of Simple Sequence Repeat (SSR) Loci in Chinese Jujube and Jujube SSR Primer Transferability.

    PubMed

    Xiao, Jing; Zhao, Jin; Liu, Mengjun; Liu, Ping; Dai, Li; Zhao, Zhihui

    2015-01-01

    Chinese jujube (Ziziphus jujuba), an economically important species in the Rhamnaceae family, is a popular fruit tree in Asia. Here, we surveyed and characterized simple sequence repeats (SSRs) in the jujube genome. A total of 436,676 SSR loci were identified, with an average distance of 0.93 Kb between the loci. A large proportion of the SSRs included mononucleotide, dinucleotide and trinucleotide repeat motifs, which accounted for 64.87%, 24.40%, and 8.74% of all repeats, respectively. Among the mononucleotide repeats, A/T was the most common, whereas AT/TA was the most common dinucleotide repeat. A total of 30,565 primer pairs were successfully designed and screened using a series of criteria. Moreover, 725 of 1,000 randomly selected primer pairs were effective among 6 cultivars, and 511 of these primer pairs were polymorphic. Sequencing the amplicons of two SSRs across three jujube cultivars revealed variations in the repeats. The transferability of jujube SSR primers proved that 35/64 SSRs could be transferred across family boundary. Using jujube SSR primers, clustering analysis results from 15 species were highly consistent with the Angiosperm Phylogeny Group (APGIII) System. The genome-wide characterization of SSRs in Chinese jujube is very valuable for whole-genome characterization and marker-assisted selection in jujube breeding. In addition, the transferability of jujube SSR primers could provide a solid foundation for their further utilization.

  11. Assessment of primer/template mismatch effects on real-time PCR amplification of target taxa for GMO quantification.

    PubMed

    Ghedira, Rim; Papazova, Nina; Vuylsteke, Marnik; Ruttink, Tom; Taverniers, Isabel; De Loose, Marc

    2009-10-28

    GMO quantification, based on real-time PCR, relies on the amplification of an event-specific transgene assay and a species-specific reference assay. The uniformity of the nucleotide sequences targeted by both assays across various transgenic varieties is an important prerequisite for correct quantification. Single nucleotide polymorphisms (SNPs) frequently occur in the maize genome and might lead to nucleotide variation in regions used to design primers and probes for reference assays. Further, they may affect the annealing of the primer to the template and reduce the efficiency of DNA amplification. We assessed the effect of a minor DNA template modification, such as a single base pair mismatch in the primer attachment site, on real-time PCR quantification. A model system was used based on the introduction of artificial mismatches between the forward primer and the DNA template in the reference assay targeting the maize starch synthase (SSIIb) gene. The results show that the presence of a mismatch between the primer and the DNA template causes partial to complete failure of the amplification of the initial DNA template depending on the type and location of the nucleotide mismatch. With this study, we show that the presence of a primer/template mismatch affects the estimated total DNA quantity to a varying degree. PMID:19778057

  12. An RT-PCR primer pair for the detection of Pospiviroid and its application in surveying ornamental plants for viroids.

    PubMed

    Bostan, Hidayet; Nie, Xianzhou; Singh, Rudra P

    2004-03-15

    A primer pair for reverse transcription-polymerase chain reaction (RT-PCR), based on the conserved sequences of the members of genus Pospiviroid was designed to yield a fragment of about 200 base pairs (bp). Since pospiviroids infect a large number of plants species and a few members of the genus Pospiviroid have been already detected in some ornamental plants, the primer pair was evaluated for its efficacy using ornamental plants. The method of return-polyacrylamide gel electrophoresis (R-PAGE) was used to determine the general presence of viroids in the test samples. Efficacy of the primer pair for members of genus Pospiviroid was demonstrated by the detection of Potato spindle tuber viroid (PSTVd) and Tomato chlorotic dwarf viroid (TCDVd) in potato, Chrysanthemum stunt viroid and Iresine viroid in Verbena and Vinca species, and Citrus exocortis viroid in Impatiens species. Specificity of the primer pair became evident, where additional viroids were detected by R-PAGE in Coleus and Magilla species, but they were not amplified by the Pospiviroid primer. This primer pair would be of benefit in indexing ornamental plants in quarantine samples or in viroid-free certification schemes, irrespective of their actual identity. PMID:14738987

  13. On the luminescence properties of CaSO4:Ce.

    PubMed

    Lapraz, D; Prevost, H; Iacconi, P; Guigues, C; Benabdesselam, M; Briand, D

    2002-01-01

    The luminescent properties of cerium doped calcium sulphate are studied: fluorescence and excitation spectra, optical absorption and thermoluminescence (TSL). It is known that, in rare earth doped CaSO4, only cerium induces a strong 400 degrees C TSL peak. In CaSO4:0.2%Ce samples synthesised under oxidising conditions, the recovery step of Ce3+ fluorescence is correlated with the 400 degrees C TSL peak readout, as mentioned by Nair er al. Our results indicate that an oxidation of Ce3+ ion does occur under X-irradiation (Ce3+ --> Ce4+), followed by a complete return to the trivalent state after thermal annealing at about 500 degrees C; our results confirm the hypothesis of Nair et al that Ce3+ ions are oxidised by ionising irradiation. So, a pure redox reaction seems the most probable for the 400 degrees C TSL peak of CaSO4:Ce. Moreover, the use of the 400 degrees C TSL peak for high temperature dosimetry applications is discussed.

  14. A method for genotype validation and primer assessment in heterozygote-deficient species, as demonstrated in the prosobranch mollusc Hydrobia ulvae

    PubMed Central

    Brownlow, Robert J; Dawson, Deborah A; Horsburgh, Gavin J; Bell, James J; Fish, John D

    2008-01-01

    Background In studies where microsatellite markers are employed, it is essential that the primers designed will reliably and consistently amplify target loci. In populations conforming to Hardy-Weinberg equilibrium (HWE), screening for unreliable markers often relies on the identification of heterozygote deficiencies and subsequent departures from HWE. However, since many populations naturally deviate from HWE, such as many marine invertebrates, it can be difficult to distinguish heterozygote deficiencies resulting from unreliable markers from natural processes. Thus, studies of populations that are suspected to deviate from HWE naturally would benefit from a method to validate genotype data-sets and test the reliability of the designed primers. Levels of heterozygosity are reported for the prosobranch mollusc Hydrobia ulvae (Pennant) together with a method of genotype validation and primer assessment that utilises two primer sets for each locus. Microsatellite loci presented are the first described for the species Hydrobia ulvae; the five loci presented will be of value in further study of populations of H. ulvae. Results We have developed a novel method of testing primer reliability in naturally heterozygote deficient populations. After the design of an initial primer set, genotyping in 48 Hydrobia ulvae specimens using a single primer set (Primer set_A) revealed heterozygote deficiency in six of the seven loci examined. Redesign of six of the primer pairs (Primer set_B), re-genotyping of the successful individuals from Primer set_A using Primer set_B, and comparison of genotypes between the two primer sets, enabled the identification of two loci (Hulv-06 & Hulv-07) that showed a high degree of discrepancy between primer sets A and B (0% & only 25% alleles matching, respectively), suggesting unreliability in these primers. The discrepancies included changes from heterozygotes to homozygotes or vice versa, and some individuals who also displayed new alleles of

  15. Recombination luminescence of CaSO4:Tb3+ and CaSO4:Gd3+phosphors

    NASA Astrophysics Data System (ADS)

    Kudryavtseva, Irina; Lushchik, Aleksandr; Maaroos, Aarne; Azmaganbetova, Zhannur; Nurakhmetov, Turlybek; Salikhoja, Zhussupbek

    2012-08-01

    A comparative study of the excitation of luminescence by VUV radiation as well as of thermally and photostimulated luminescence has been carried out for CaSO4:Tb3+ and CaSO4:Gd3+ phosphors, where Na+ or F- ions are used for charge compensation. The distinction in hole processes for the phosphors with Na+ or F- compensators is determined by the differing thermal stability of the holes localized at/near Tb3+Na+ and Gd3+Na+ (up to 100-160 K) or at/near Tb3+F- V Ca and Gd3+F- V Ca centers involving also a cation vacancy (up to 400-550 K). Tunnel luminescence in the pairs of localized electrons and holes nearby Tb3+ or Gd3+ has been detected. The mechanisms of electron-hole, hole-electron and tunnel recombination luminescence as well as a subsequent released energy transfer to RE3+ ions are considered.

  16. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    SciTech Connect

    Jothikumar, N. Hill, Vincent R.

    2013-06-28

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  17. POLRMT regulates the switch between replication primer formation and gene expression of mammalian mtDNA

    PubMed Central

    Kühl, Inge; Miranda, Maria; Posse, Viktor; Milenkovic, Dusanka; Mourier, Arnaud; Siira, Stefan J.; Bonekamp, Nina A.; Neumann, Ulla; Filipovska, Aleksandra; Polosa, Paola Loguercio; Gustafsson, Claes M.; Larsson, Nils-Göran

    2016-01-01

    Mitochondria are vital in providing cellular energy via their oxidative phosphorylation system, which requires the coordinated expression of genes encoded by both the nuclear and mitochondrial genomes (mtDNA). Transcription of the circular mammalian mtDNA depends on a single mitochondrial RNA polymerase (POLRMT). Although the transcription initiation process is well understood, it is debated whether POLRMT also serves as the primase for the initiation of mtDNA replication. In the nucleus, the RNA polymerases needed for gene expression have no such role. Conditional knockout of Polrmt in the heart results in severe mitochondrial dysfunction causing dilated cardiomyopathy in young mice. We further studied the molecular consequences of different expression levels of POLRMT and found that POLRMT is essential for primer synthesis to initiate mtDNA replication in vivo. Furthermore, transcription initiation for primer formation has priority over gene expression. Surprisingly, mitochondrial transcription factor A (TFAM) exists in an mtDNA-free pool in the Polrmt knockout mice. TFAM levels remain unchanged despite strong mtDNA depletion, and TFAM is thus protected from degradation of the AAA+ Lon protease in the absence of POLRMT. Last, we report that mitochondrial transcription elongation factor may compensate for a partial depletion of POLRMT in heterozygous Polrmt knockout mice, indicating a direct regulatory role of this factor in transcription. In conclusion, we present in vivo evidence that POLRMT has a key regulatory role in the replication of mammalian mtDNA and is part of a transcriptional mechanism that provides a switch between primer formation for mtDNA replication and mitochondrial gene expression. PMID:27532055

  18. POLRMT regulates the switch between replication primer formation and gene expression of mammalian mtDNA.

    PubMed

    Kühl, Inge; Miranda, Maria; Posse, Viktor; Milenkovic, Dusanka; Mourier, Arnaud; Siira, Stefan J; Bonekamp, Nina A; Neumann, Ulla; Filipovska, Aleksandra; Polosa, Paola Loguercio; Gustafsson, Claes M; Larsson, Nils-Göran

    2016-08-01

    Mitochondria are vital in providing cellular energy via their oxidative phosphorylation system, which requires the coordinated expression of genes encoded by both the nuclear and mitochondrial genomes (mtDNA). Transcription of the circular mammalian mtDNA depends on a single mitochondrial RNA polymerase (POLRMT). Although the transcription initiation process is well understood, it is debated whether POLRMT also serves as the primase for the initiation of mtDNA replication. In the nucleus, the RNA polymerases needed for gene expression have no such role. Conditional knockout of Polrmt in the heart results in severe mitochondrial dysfunction causing dilated cardiomyopathy in young mice. We further studied the molecular consequences of different expression levels of POLRMT and found that POLRMT is essential for primer synthesis to initiate mtDNA replication in vivo. Furthermore, transcription initiation for primer formation has priority over gene expression. Surprisingly, mitochondrial transcription factor A (TFAM) exists in an mtDNA-free pool in the Polrmt knockout mice. TFAM levels remain unchanged despite strong mtDNA depletion, and TFAM is thus protected from degradation of the AAA(+) Lon protease in the absence of POLRMT. Last, we report that mitochondrial transcription elongation factor may compensate for a partial depletion of POLRMT in heterozygous Polrmt knockout mice, indicating a direct regulatory role of this factor in transcription. In conclusion, we present in vivo evidence that POLRMT has a key regulatory role in the replication of mammalian mtDNA and is part of a transcriptional mechanism that provides a switch between primer formation for mtDNA replication and mitochondrial gene expression. PMID:27532055

  19. Streptococcus salivarius ATCC 25975 possesses at least two genes coding for primer-independent glucosyltransferases.

    PubMed Central

    Simpson, C L; Giffard, P M; Jacques, N A

    1995-01-01

    Fractionation of the culture medium showed that Streptococcus salivarius ATCC 25975 secreted a glucosyltransferase (Gtf) that was primer independent. On the basis of this observation, a gene library of S. salivarius chromosomal DNA cloned into lambda L47.1 was screened for a gene(s) coding for such an activity. As a result of this screening process, two new gtf genes, gtfL and gtfM, both of which coded for primer-independent Gtf activities, were isolated. GtfL produced an insoluble glucan that was refractory to digestion by the endo-(1-->6)-alpha-D-glucanase. of Chaetonium gracile, while GtfM produced a soluble glucan that was readily degraded by the glucanase. Comparison of the deduced amino acid sequences of gtfL and gtfM with 10 other available Gtf sequences allowed the relatedness of the conserved catalytic regions to be assessed. This analysis showed that the 12 enzymes did not form clusters based on their primer dependencies or on their product solubilities. Further analysis of the YG repeats in the C-terminal glucan-binding domains of GtfJ, GtfK, GtfL, and GtfM from S. salivarius showed that there was strong homology between a block of contiguous triplet YG repeats present in the four alleles. These blocks of YG repeats were coded for by a region of each gene that appeared to have arisen as a result of a recent duplication event(s). PMID:7822030

  20. Partial molecular cloning of the JHK retrovirus using gammaretrovirus consensus PCR primers

    PubMed Central

    Halligan, Brian D; Sun, Hai-Yuan; Kushnaryov, Vladimir M; Grossberg, Sidney E

    2013-01-01

    The JHK virus (JHKV) was previously described as a type C retrovirus that has some distinctive ultrastructural features and replicates constitutively in a human B-lymphoblastoid cell line, JHK-3. In order to facilitate the cloning of sequences from JHKV, a series of partially degenerate consensus retroviral PCR primers were created by a data-driven design approach based on an alignment of 14 diverse gammaretroviral genomes. These primers were used in the PCR amplification of purified JHK virion cDNA, and ana lysis of the resulting amplified sequence indicates that the JHKV is in the murine leukemia virus (MLV) family. The JHK sequence is nearly identical to the corresponding region of the Bxv-1 endogenous mouse retrovirus (GenBank accession AC115959) and distinct from XMRV. JHKV gag-specific amplification was demonstrated with nucleic acids from uncultivated, frozen, peripheral blood mononuclear cells (PBMCs) of the index patient, but not in PBMCs from nine healthy blood donors. Unlike earlier reports, in which MLV-like sequences were identified in human source material, which may have been due to murine contamination, budding retrovirions were demonstrated repeatedly by electron microscopy in uncultivated lymphocytes of the index patient that were morphologically identical in their development to the virions in the JHK-3 cells, and immunological evidence was obtained that the index patient produced IgG antibodies that bound to the budding viral particles in patient PBMCs and in the JHK-3 cells. These data indicate that the patient had been infected by JHKV, lending significance to the demonstration of JHKV amplicons in nucleic acids of the patient’s PBMCs. In future studies, the PCR primer sets described herein may expand the detection of an amplifiable subset of viruses related to MLV. PMID:24159361

  1. Preparation of ferrocene-functionalized gold nanoparticles by primer extension reaction on the particle surface.

    PubMed

    Takada, Tadao; Tochi, Takaaki; Nakamura, Mitsunobu; Yamana, Kazushige

    2014-06-15

    DNA molecules possessing multiple ferrocene (Fc) molecules as a redox active probe were prepared by the primer extension (PEX) reaction using a 2'-deoxyuridine-5'-triphosphate derivative in which Fc was connected to the C5-position of the uridine by a diethylene glycol linker. Gold nanoparticles (AuNP) covered with DNA possessing the Fc molecules were prepared by the PEX reaction on the surface. The AuNP-FcDNA conjugates exhibit a detectable electrochemical signal due to the Fc molecules. Possible application of the PEX reaction on AuNP is demonstrated for the detection of a single nucleotide mutation in the target DNA.

  2. PERMANENT GENETIC RESOURCES: Consensus primers of cyp73 genes discriminate willow species and hybrids (Salix, Salicaceae).

    PubMed

    Trung, Le Quang; VAN Puyvelde, Karolien; Triest, Ludwig

    2008-03-01

    Consensus primers, based on exon sequences of the cyp73 gene family coding for cinnamate 4-hydroxylase (C4H) of the lignin biosynthesis pathway, were designed for the tetraploid willow species Salix alba and Salix fragilis. Diagnostic alleles at species level were observed among introns of three cyp73 genes and allowed unambiguous detection of the first generation and introgressed hybrids in populations. Progeny analysis of a female S. alba with a male introgressed hybrid confirmed the codominant inheritance of each intron. Sequences of the diagnostic alleles of both species were similar to those found in the hybrids.

  3. Constructing the ecstasy of MDMA from its component mental organs: Proposing the primer/probe method.

    PubMed

    Ray, Thomas S

    2016-02-01

    The drug MDMA, commonly known as ecstasy, produces a specific and distinct open hearted mental state, which led to the creation of a new pharmacological class, "entactogens". Extensive literature on its mechanisms of action has come to characterize MDMA as a "messy" drug with multiple mechanisms, but the consensus is that the distinctive entactogenic effects arise from the release of neurotransmitters, primarily serotonin. I propose an alternative hypothesis: The entactogenic mental state is due to the simultaneous direct activation of imidazoline-1 (I1) and serotonin-2 (5-HT2) receptors by MDMA. This hypothesis emerges from "mental organ" theory, which embodies many hypotheses, the most relevant of which are: "Mental organs" are populations of neurons that all express their defining metabotropic receptor, and each mental organ plays a distinct role in the mind, a role shaped by evolution as mental organs evolve by duplication and divergence. Mental organs are the mechanism by which evolution sculpts the mind. Mental organs can be in or out of consciousness. In order for a mental organ to enter consciousness, three things must happen: The mental organ must be activated directly at its defining receptor. 5-HT2 must be simultaneously activated. One of the functions of activated 5-HT2 is to load other simultaneously activated mental organs fully into consciousness. In some cases THC must be introduced to remove long-term blocks mediated by the cannabinoid system. I propose the "primer/probe" method to test these hypotheses. A "primer" is a drug that selectively activates 5-HT2 (e.g. DOB or MEM) or serotonin-1 (5-HT1) and 5-HT2 (e.g. DOET or 2C-B-fly). A "probe" is a drug that activates a receptor whose corresponding mental organ we wish to load into consciousness in order to understand its role in the mind. The mental organ is loaded into consciousness when the primer and probe are taken together, but not when taken separately. For example, the blood pressure

  4. Constructing the ecstasy of MDMA from its component mental organs: Proposing the primer/probe method.

    PubMed

    Ray, Thomas S

    2016-02-01

    The drug MDMA, commonly known as ecstasy, produces a specific and distinct open hearted mental state, which led to the creation of a new pharmacological class, "entactogens". Extensive literature on its mechanisms of action has come to characterize MDMA as a "messy" drug with multiple mechanisms, but the consensus is that the distinctive entactogenic effects arise from the release of neurotransmitters, primarily serotonin. I propose an alternative hypothesis: The entactogenic mental state is due to the simultaneous direct activation of imidazoline-1 (I1) and serotonin-2 (5-HT2) receptors by MDMA. This hypothesis emerges from "mental organ" theory, which embodies many hypotheses, the most relevant of which are: "Mental organs" are populations of neurons that all express their defining metabotropic receptor, and each mental organ plays a distinct role in the mind, a role shaped by evolution as mental organs evolve by duplication and divergence. Mental organs are the mechanism by which evolution sculpts the mind. Mental organs can be in or out of consciousness. In order for a mental organ to enter consciousness, three things must happen: The mental organ must be activated directly at its defining receptor. 5-HT2 must be simultaneously activated. One of the functions of activated 5-HT2 is to load other simultaneously activated mental organs fully into consciousness. In some cases THC must be introduced to remove long-term blocks mediated by the cannabinoid system. I propose the "primer/probe" method to test these hypotheses. A "primer" is a drug that selectively activates 5-HT2 (e.g. DOB or MEM) or serotonin-1 (5-HT1) and 5-HT2 (e.g. DOET or 2C-B-fly). A "probe" is a drug that activates a receptor whose corresponding mental organ we wish to load into consciousness in order to understand its role in the mind. The mental organ is loaded into consciousness when the primer and probe are taken together, but not when taken separately. For example, the blood pressure

  5. Rational primer design greatly improves differential display-PCR (DD-PCR).

    PubMed Central

    Graf, D; Fisher, A G; Merkenschlager, M

    1997-01-01

    Since its conception in 1992, differential display PCR (DD-PCR) has attracted widespread interest. Theoretically an attractive cloning approach, it combines the comparative analysis of several samples with the sensitivity of PCR. Although a large number of studies embracing this technology have been initiated, few novel genes of interest have been identified, suggesting that the method has not realised its potential. The present report shows that by modifying primer design, sampling of differentially expressed genes can be greatly enhanced and relevant genes can be isolated. Using our modified conditions DD-PCR efficiently screens a wide range of gene expression levels, in which differences are represented on a linear scale. PMID:9153330

  6. State Bioenergy Primer: Information and Resources for States on Issues, Opportunities, and Options for Advancing Bioenergy

    SciTech Connect

    Byrnett, D. S.; Mulholland, D.; Zinsmeister, E.; Doris, E.; Milbrandt, A.; Robichaud. R.; Stanley, R.; Vimmerstedt, L.

    2009-09-01

    One renewable energy option that states frequently consider to meet their clean energy goals is the use of biomass resources to develop bioenergy. Bioenergy includes bioheat, biopower, biofuels, and bioproducts. This document provides an overview of biomass feedstocks, basic information about biomass conversion technologies, and a discussion of benefits and challenges of bioenergy options. The Primer includes a step-wise framework, resources, and tools for determining the availability of feedstocks, assessing potential markets for biomass, and identifying opportunities for action at the state level. Each chapter contains a list of selected resources and tools that states can use to explore topics in further detail.

  7. Effects of the turn-back primer on intermediate product generation in isothermal DNA amplification.

    PubMed

    Tanaka, Yuki; Kimura, Yasumasa; Mitani, Yasumasa; Kawai, Yuki; Lezhava, Alexander; Noma, Shohei; Tagami, Michihira; Kawai, Jun; Hayashizaki, Yoshihide; Usui, Kengo

    2010-12-01

    In DNA amplification, the initial step of copying a target sequence from the template DNA--the so-called intermediate product generation step--is very important. In examining the turn-back primer (TP)-dependent isothermal DNA amplification (TIA) method, we determined the actual time point of intermediate product generation by extrapolating dsDNA amplification curves. Our results indicate that intermediate product creation is the rate-limiting step in TIA, and good TP design is advantageous for improving the intermediate production process.

  8. Amplification of GB virus-C/hepatitis G virus RNA with primers from different regions of the viral genome.

    PubMed

    Kao, J H; Chen, P J; Chen, W; Hsiang, S C; Lai, M Y; Chen, D S

    1997-04-01

    GB virus-C/hepatitis G virus (GBV-C/HGV) is a newly identified RNA virus. The aim of the study was to compare three primer pairs from the 5' untranslated region (5'UTR), envelope region 2 (E 2) and nonstructural region 3 (NS 3) of GBV-C/HGV genome for their ability to detect GBV-C/HGV RNA by polymerase chain reaction (PCR) assays. By using PCR with primers from different regions of the viral genome, serum GBV-C/HGV RNA was assayed in 200 at-risk individuals. The sensitivity of this assay was assessed by a titration experiment, and nucleotide sequences of the amplified products were determined directly. Of 200 serum samples, 43 (21.5%) were positive for GBV-C/HGV RNA with at least one of the primer pairs. The positive rates by 5'UTR, NS 3, and E 2 primers were 100%, 98%, and 84%, respectively, and the sensitivity of PCR assays using 5'UTR primers was 10 to 100 times more likely to detect GBV-C/HGV RNA than that of NS 3 and E 2 primers. The average homology of amplified targets to the prototype HGV genome was 89%, 80%, and 85% and the similarity between each amplified target was up to 100%, 90%, and 92% in the 5'UTR, E 2, and NS 3 regions, respectively. Therefore, the 5'UTR of GBV-C/HGV genome is highly conserved and primers deduced from this region can provideva sensitive and specific PCR assay for GBV-C/HGV RNA.

  9. Mining of novel species-specific primers for PCR detection of Listeria monocytogenes based on genomic approach.

    PubMed

    Tao, Tingting; Chen, Qiming; Bie, Xiaomei; Lu, Fengxia; Lu, Zhaoxin

    2015-12-01

    Listeria monocytogenes in contaminated food is considered as a serious health threat for consumers due to its high mortality rate. The objective of this study was to obtain novel species-specific target-genes and primers for the molecular detection of L. monocytogenes using a comparative genomic approach. By comparative analysis of L. monocytogenes and non-L. monocytogenes genome sequences in the GenBank database with BLAST program, 26 specific target sequences were used as candidates and the primers were designed for L. monocytogenes species-specificity verification by using PCR assay. Finally, the three genes LMOf2365_0970, LMOf2365_2721 and mpl were identified to have L. monocytogenes species-specificity and be unique as detection targets for diagnostic application. The species-specific primer Lm8 of gene LMOf2365_0970, Lm13 of gene LMOf2365_2721 and Lm20 of gene mpl showed better specificity and sensitivity than the primers described previously. The PCR detection limits of the three specific primer sets were 430, 43, 4.3 fg/μL for genomic DNA, and 5 × 10(3), 50, 5 cfu/mL for pure culture of L. monocytogenes. There was no interference in specificity of detecting L. monocytogenes by co-culture with other foodborne pathogens in high concentration. Moreover, after 6-8 h of enrichment, L. monocytogenes in the artificially contaminated milk samples at an inoculum dose of 38 cfu/10 mL milk could be detected successfully with the studied three primers. Therefore, the three specific genes and primers can be applied to establish a novel rapid and accurate method for detecting L. monocytogenes in food materials. PMID:26354019

  10. Effects of dual antibacterial agents MDPB and nano-silver in primer on microcosm biofilm, cytotoxicity and dentin bond properties

    PubMed Central

    Zhang, Ke; Cheng, Lei; Imazato, Satoshi; Antonucci, Joseph M.; Lin, Nancy J.; Lin-Gibson, Sheng; Bai, Yuxing; Xu, Hockin H. K.

    2013-01-01

    Objectives The objective of this study was to investigate the effects of dentin primer containing dual antibacterial agents, namely, 12-methacryloyloxydodecylpyridinium bromide (MDPB) and nanoparticles of silver (NAg), on dentin bond strength, dental plaque microcosm biofilm response, and fibroblast cytotoxicity for the first time. Methods Scotchbond Multi-Purpose (SBMP) was used as the parent bonding agent. Four primers were tested: SBMP primer control (referred to as “P”), P+5%MDPB, P+0.05%NAg, and P+5%MDPB+0.05%NAg. Dentin shear bond strengths were measured using extracted human teeth. Biofilms from the mixed saliva of 10 donors were cultured to investigate metabolic activity, colony-forming units (CFU), and lactic acid production. Human fibroblast cytotoxicity of the four primers was tested in vitro. Results Incorporating MDPB and NAg into primer did not reduce dentin bond strength compared to control (p>0.1). SEM revealed well-bonded adhesive-dentin interfaces with numerous resin tags. MDPB or NAg each greatly reduced biofilm viability and acid production, compared to control. Dual agents MDPB+NAg had a much stronger effect than either agent alone (p<0.05), increasing inhibition zone size and reducing metabolic activity, CFU and lactic acid by an order of magnitude, compared to control. There was no difference in cytotoxicity between commercial control and antibacterial primers (p>0.1). Conclusions The method of using dual agents MDPB+NAg in the primer yielded potent antibacterial properties. Hence, this method may be promising to combat residual bacteria in tooth cavity and invading bacteria at the margins. The dual agents MDPB+NAg may have wide applicability to other adhesives, composites, sealants and cements to inhibit biofilms and caries. PMID:23402889

  11. Effect of three adhesive primers on the bond strengths of four light-activated opaque resins to noble alloy.

    PubMed

    Yoshida, K; Kamada, K; Taira, Y; Atsuta, M

    2001-02-01

    The effect of commercial adhesive primers for noble metals on the bond strength of light-activated opaque resin has not been determined. This study evaluated the effect of three adhesive primers on the shear bond strengths of each of the four light-activated opaque resins to silver--palladium--copper--gold (Ag--Pd--Cu--Au) alloy. The adhesive primers Alloy Primer (AP), Metal Primer II (MPII) and Metaltite(MT) were used. Four commercial light-activated opaque resins (Axis (AX), Cesead II (CEII), Dentacolor(DE) and Solidex (SO) were used to bond a light-activated resin-veneered composite to Ag--Pd--Cu--Au alloy. The specimens were stored in water at 37 degrees C for 24 h and then immersed alternatively in water baths at 4 and 60 degrees C for 1 min each for up to 20,000 thermal cycles before shear mode testing at a cross-head speed of 0.5 mm min(-1). All the primers examined improved the shear bond strength between opaque resin and Ag--Pd--Cu--Au alloy compared with non-primed specimens prior to thermal cycling. After 20,000 thermal cycles, the bond strengths of combined use of AP and DE and that of MT and each of AX, CE or DE were significantly greater than any other groups. Significant difference was observed between the bond strengths at thermal cycles 0 and 20,000, with the combined use of MT and DE. With the combination of appropriate adhesive metal primers and light-activated opaque resins, complicated surface preparations of metal frameworks of resin-veneered prostheses that are composed of casting Ag-Pd-Cu-Au alloy may be negligible.

  12. MRPrimerW: a tool for rapid design of valid high-quality primers for multiple target qPCR experiments.

    PubMed

    Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo

    2016-07-01

    Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. PMID:27154272

  13. Design and Validation of Four New Primers for Next-Generation Sequencing To Target the 18S rRNA Genes of Gastrointestinal Ciliate Protozoa

    PubMed Central

    Wright, André-Denis G.

    2014-01-01

    Four new primers and one published primer were used to PCR amplify hypervariable regions within the protozoal 18S rRNA gene to determine which primer pair provided the best identification and statistical analysis. PCR amplicons of 394 to 498 bases were generated from three primer sets, sequenced using Roche 454 pyrosequencing with Titanium, and analyzed using the BLAST database (NCBI) and MOTHUR version 1.29. The protozoal diversity of rumen contents from moose in Alaska was assessed. In the present study, primer set 1, P-SSU-316F and GIC758R (amplicon of 482 bases), gave the best representation of diversity using BLAST classification, and the set amplified Entodinium simplex and Ostracodinium spp., which were not amplified by the other two primer sets. Primer set 2, GIC1080F and GIC1578R (amplicon of 498 bases), had similar BLAST results and a slightly higher percentage of sequences that were identified with a higher sequence identity. Primer sets 1 and 2 are recommended for use in ruminants. However, primer set 1 may be inadequate to determine protozoal diversity in nonruminants. The amplicons created by primer set 1 were indistinguishable for certain species within the genera Bandia, Blepharocorys, Polycosta, and Tetratoxum and between Hemiprorodon gymnoprosthium and Prorodonopsis coli, none of which are normally found in the rumen. PMID:24973070

  14. Evaluation of PCR primer selectivity and phylogenetic specificity by using amplification of 16S rRNA genes from betaproteobacterial ammonia-oxidizing bacteria in environmental samples.

    PubMed

    Junier, Pilar; Kim, Ok-Sun; Hadas, Ora; Imhoff, Johannes F; Witzel, Karl-Paul

    2008-08-01

    The effect of primer specificity for studying the diversity of ammonia-oxidizing betaproteobacteria (betaAOB) was evaluated. betaAOB represent a group of phylogenetically related organisms for which the 16S rRNA gene approach is especially suitable. We used experimental comparisons of primer performance with water samples, together with an in silico analysis of published sequences and a literature review of clone libraries made with four specific PCR primers for the betaAOB 16S rRNA gene. With four aquatic samples, the primers NitA/NitB produced the highest frequency of ammonia-oxidizing-bacterium-like sequences compared to clone libraries with products amplified with the primer combinations betaAMOf/betaAMOr, betaAMOf/Nso1255g, and NitA/Nso1225g. Both the experimental examination of ammonia-oxidizing-bacterium-specific 16S rRNA gene primers and the literature search showed that neither specificity nor sensitivity of primer combinations can be evaluated reliably only by sequence comparison. Apparently, the combination of sequence comparison and experimental data is the best approach to detect possible biases of PCR primers. Although this study focused on betaAOB, the results presented here more generally exemplify the importance of primer selection and potential primer bias when analyzing microbial communities in environmental samples.

  15. Design and validation of four new primers for next-generation sequencing to target the 18S rRNA genes of gastrointestinal ciliate protozoa.

    PubMed

    Ishaq, Suzanne L; Wright, André-Denis G

    2014-09-01

    Four new primers and one published primer were used to PCR amplify hypervariable regions within the protozoal 18S rRNA gene to determine which primer pair provided the best identification and statistical analysis. PCR amplicons of 394 to 498 bases were generated from three primer sets, sequenced using Roche 454 pyrosequencing with Titanium, and analyzed using the BLAST database (NCBI) and MOTHUR version 1.29. The protozoal diversity of rumen contents from moose in Alaska was assessed. In the present study, primer set 1, P-SSU-316F and GIC758R (amplicon of 482 bases), gave the best representation of diversity using BLAST classification, and the set amplified Entodinium simplex and Ostracodinium spp., which were not amplified by the other two primer sets. Primer set 2, GIC1080F and GIC1578R (amplicon of 498 bases), had similar BLAST results and a slightly higher percentage of sequences that were identified with a higher sequence identity. Primer sets 1 and 2 are recommended for use in ruminants. However, primer set 1 may be inadequate to determine protozoal diversity in nonruminants. The amplicons created by primer set 1 were indistinguishable for certain species within the genera Bandia, Blepharocorys, Polycosta, and Tetratoxum and between Hemiprorodon gymnoprosthium and Prorodonopsis coli, none of which are normally found in the rumen.

  16. MRPrimerW: a tool for rapid design of valid high-quality primers for multiple target qPCR experiments

    PubMed Central

    Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo

    2016-01-01

    Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. PMID:27154272

  17. Adventitious match probability for autosomal profiles when primer binding site mutation is possible.

    PubMed

    Pope, Susan; Evett, Ian; Puch-Solis, Roberto

    2016-09-01

    This paper considers the situation where two DNA systems with differing primers have been used to produce DNA profiles for loading and searching of a DNA Database. With any profiling system there exists the possibility of a "primer binding site mutation" (PBSM). When such a mutation occurs at one of the loci in a profile, it has the effect that the associated allele is not visible in the profile. In the case where a person has two different alleles at a given locus (heterozygous) the effect of a PBSM would be that the profile would appear to be that of an individual with only one allele at that locus (homozygous). The paper investigates the potential for an adventitious match as a result of a PBSM when, for example, a crime profile and person profile that have originated from two different individuals are found to be the same as a result of a PBSM in one of the profiles. It is demonstrated, both by theory and using simulations, that the effect of PBSMs is to slightly decrease the adventitious match probability from what it would had the same DNA system been used. PMID:27420391

  18. The insect cytochrome oxidase I gene: evolutionary patterns and conserved primers for phylogenetic studies.

    PubMed

    Lunt, D H; Zhang, D X; Szymura, J M; Hewitt, G M

    1996-08-01

    Insect mitochondrial cytochrome oxidase I (COI) genes are used as a model to examine the within-gene heterogeneity of evolutionary rate and its implications for evolutionary analyses. The complete sequence (1537 bp) of the meadow grasshopper (Chorthippus parallelus) COI gene has been determined, and compared with eight other insect COI genes at both the DNA and amino acid sequence levels. This reveals that different regions evolve at different rates, and the patterns of sequence variability seems associated with functional constraints on the protein. The COOH-terminal was found to be significantly more variable than internal loops (I), external loops (E), transmembrane helices (M) or the NH2 terminal. The central region of COI (M5-M8) has lower levels of sequence variability, which is related to several important functional domains in this region. Highly conserved primers which amplify regions of different variabilities have been designed to cover the entire insect COI gene. These primers have been shown to amplify COI in a wide range of species, representing all the major insect groups; some even in an arachnid. Implications of the observed evolutionary pattern for phylogenetic analysis are discussed, with particular regard to the choice of regions of suitable variability for specific phylogenetic projects.

  19. A Comprehensive Analysis of Primer IDs to Study Heterogeneous HIV-1 Populations.

    PubMed

    Seifert, David; Di Giallonardo, Francesca; Töpfer, Armin; Singer, Jochen; Schmutz, Stefan; Günthard, Huldrych F; Beerenwinkel, Niko; Metzner, Karin J

    2016-01-16

    Determining the composition of viral populations is becoming increasingly important in the field of medical virology. While recently developed computational tools for viral haplotype analysis allow for correcting sequencing errors, they do not always allow for the removal of errors occurring in the upstream experimental protocol, such as PCR errors. Primer IDs (pIDs) are one method to address this problem by harnessing redundant template resampling for error correction. By using a reference mixture of five HIV-1 strains, we show how pIDs can be useful for estimating key experimental parameters, such as the substitution rate of the PCR process and the reverse transcription (RT) error rate. In addition, we introduce a hidden Markov model for determining the recombination rate of the RT PCR process. We found no strong sequence-specific bias in pID abundances (the same RT efficiencies as compared to commonly used short, specific RT primers) and no effects of pIDs on the estimated distribution of the references viruses.

  20. A primer for studying cell cycle dynamics of the human hair follicle.

    PubMed

    Purba, Talveen S; Brunken, Lars; Hawkshaw, Nathan J; Peake, Michael; Hardman, Jonathan; Paus, Ralf

    2016-09-01

    The cell cycle is of major importance to human hair follicle (HF) biology. Not only is continuously active cell cycling required to facilitate healthy hair growth in anagen VI HFs, but perturbations in the cell cycle are likely to be of significance in HF pathology (i.e. in scarring, non-scarring, chemotherapy-induced and androgenic alopecias). However, cell cycle dynamics of the human hair follicle (HF) are poorly understood in contrast to what is known in mouse. The current Methods Review aims at helping to close this gap by presenting a primer that introduces immunohistological/immunofluorescent techniques to study the cell cycle in the human HF. Moreover, this primer encourages the exploitation of the human HF as a powerful and clinically relevant tool to investigate mammalian cell cycle biology in situ. To achieve this, we describe methods to study markers of general 'proliferation' (nuclei count, Ki-67 expression), apoptosis (terminal deoxynucleotidyl transferase dUTP nick-end labelling, cleaved caspase 3), mitosis (phospho-histone H3, 'pS780'), DNA synthesis (5-ethynyl-2'-deoxyuridine) and cell cycle regulation (cyclins) in the human HF. In addition, we provide specific examples of dual immunolabelling for instructive cell cycle analyses and for investigating the cell cycle behaviour of specific HF keratinocyte subpopulations, such as keratin 15+ stem/progenitor cells.