Science.gov

Sample records for phosphatase alpha rptpalpha

  1. Expression of protein tyrosine phosphatase alpha (RPTPalpha) in human breast cancer correlates with low tumor grade, and inhibits tumor cell growth in vitro and in vivo.

    PubMed

    Ardini, E; Agresti, R; Tagliabue, E; Greco, M; Aiello, P; Yang, L T; Ménard, S; Sap, J

    2000-10-12

    Tyrosine phosphorylation is controlled by a balance of tyrosine kinases (PTKs) and protein tyrosine phosphatases (PTPs). Whereas the contribution of PTKs to breast tumorigenesis is the subject of intense scrutiny, the potential role of PTPs is poorly known. RPTPalpha is implicated in the activation of Src family kinases, and regulation of integrin signaling, cell adhesion, and growth factor responsiveness. To explore its potential contribution to human neoplasia, we surveyed RPTPalpha protein levels in primary human breast cancer. We found RPTPalpha levels to vary widely among tumors, with 29% of cases manifesting significant overexpression. High RPTPalpha protein levels correlated significantly with low tumor grade and positive estrogen receptor status. Expression of RPTPalpha in breast carcinoma cells led to growth inhibition, associated with increased accumulation in G0 and G1, and delayed tumor growth and metastasis. To our knowledge, this is the first example of a study correlating expression level of a specific bona fide PTP with neoplastic disease status in humans.

  2. Purification and characterization of a Bacillus licheniformis phosphatase specific for D-alpha-glycerophosphate.

    PubMed

    Skraly, F A; Cameron, D C

    1998-01-01

    Bacillus licheniformis ("Ford's type") was found to contain a novel enzyme, D-alpha-glycerophosphatase. The enzyme is highly specific for D-alpha-glycerophosphate, effecting little or no hydrolysis of L-alpha- or beta-glycerophosphate or other similar compounds. All other known alpha-glycerophosphatases preferentially hydrolyze the L isomer. The products of the D-alpha-glycerophosphatase reaction were identified as glycerol and inorganic phosphate. The enzyme is a monomer with an apparent molecular mass of approximately 25 kDa. As with most phosphatases, it requires divalent magnesium for activity, but unlike the nonspecific acid and alkaline phosphatases, its optimum pH is around neutral. Its K(m) for D-alpha-glycerophosphate in the presence of 1 mM Mg2+ was found to be 4.3 mM. D-alpha-glycerophosphatase was produced in B. licheniformis fermentations whether or not high levels of phosphate were present; the same was true of glycerol formation. D-alpha-glycerophosphatase is not strongly inhibited by inorganic phosphate and would therefore be capable of catalyzing the formation of glycerol in the presence of high levels of phosphate. The D-alpha-glycerophosphatase of B. licheniformis is similar in characteristics to L-alpha-glycerophosphatases known to synthesize glycerol in vivo, suggesting that D-alpha-glycerophosphatase may be the final enzyme in the fermentative glycerol formation pathway of B. licheniformis.

  3. Modulation of EGF receptor autophosphorylation by alpha-hemolysin of Staphylococcus aureus via protein tyrosine phosphatase.

    PubMed

    Vandana, Sharma; Navneet, Sangha; Surinder, Kaur; Krishnasastry, M V

    2003-01-30

    In the presence of assembled alpha-hemolysin (alpha-HL) of Staphylococcus aureus, the epidermal growth factor receptor (EGFr) is rapidly dephosphorylated. Several obvious possibilities that otherwise would have contributed to the dephosphorylation were ruled out. Instead, an elevation in the activity of a protein tyrosine phosphatase appears to be responsible for the observed loss of phosphorylation signal of EGFr. For this dephosphorylation, the assembly of alpha-HL is necessary while lytic pore formation is not required. In summary, the EGFr is unable to retain its phosphorylation signal in the presence of alpha-HL and the process is irreversible.

  4. Inhibition of purple acid phosphatase with alpha-alkoxynaphthylmethylphosphonic acids.

    PubMed

    McGeary, Ross P; Vella, Peter; Mak, Jeffrey Y W; Guddat, Luke W; Schenk, Gerhard

    2009-01-01

    Purple acid phosphatases (PAPs) are binuclear hydrolases that catalyse the hydrolysis of a range of phosphorylated substrates. Human PAP is a major histochemical marker for the diagnosis of osteoporosis. In patients suffering from this disorder, PAP activity contributes to increased bone resorption and, therefore, human PAP is a key target for the development of anti-osteoporotic drugs. This manuscript describes the design and synthesis of derivatives of 1-naphthylmethylphosphonic acids as inhibitors of PAP. The K(i) values of these compounds are as low as 4 microM, the lowest reported to date for a PAP inhibitor.

  5. Cell cycle regulation and p53 activation by protein phosphatase 2C alpha.

    PubMed

    Ofek, Paula; Ben-Meir, Daniella; Kariv-Inbal, Zehavit; Oren, Moshe; Lavi, Sara

    2003-04-18

    Protein phosphatase 2C (PP2C) dephosphorylates a broad range of substrates, regulating stress response and growth-related pathways in both prokaryotes and eukaryotes. We now demonstrate that PP2C alpha, a major mammalian isoform, inhibits cell growth and activates the p53 pathway. In 293 cell clones, in which PP2C alpha expression is regulated by a tetracycline-inducible promoter, PP2C alpha overexpression led to G(2)/M cell cycle arrest and apoptosis. Furthermore, PP2C alpha induced the expression of endogenous p53 and the p53-responsive gene p21. Activation of the p53 pathway by PP2C alpha took place both in cells harboring endogenous p53, as well as in p53-null cells transfected with exogenous p53. Induction of PP2C alpha resulted in an increase in the overall levels of p53 protein as well as an augmentation of p53 transcription activity. The dephosphorylation activity of PP2C alpha is essential to the described phenomena, as none of these effects was detected when an enzymatically inactive PP2C alpha mutant was overexpressed. p53 plays an important role in PP2C alpha-directed cell cycle arrest and apoptosis because perturbation of p53 expression in human 293 cells by human papillomavirus E6 led to a significant increase in cell survival. The role of PP2C alpha in p53 activation is discussed.

  6. Stimulation of tumor necrosis factor alpha production in human monocytes by inhibitors of protein phosphatase 1 and 2A

    PubMed Central

    1992-01-01

    The protein phosphatase 1 and 2A inhibitor, okadaic acid, has been shown to stimulate many cellular functions by increasing the phosphorylation state of phosphoproteins. In human monocytes, okadaic acid by itself stimulates tumor necrosis factor alpha (TNF-alpha) mRNA accumulation and TNF-alpha synthesis. Calyculin A, a more potent inhibitor of phosphatase 1, has similar effects. TNF-alpha mRNA accumulation in okadaic acid-treated monocytes is due to increased TNF- alpha mRNA stability and transcription rate. The increase in TNF-alpha mRNA stability is more remarkable in okadaic acid-treated monocytes than the mRNA stability of other cytokines, such as interleukin 1 alpha (IL-1 alpha), IL-1 beta, and IL-6. Gel retardation studies show the stimulation of AP-1, AP-2, and NF-kappa B binding activities in okadaic acid-stimulated monocytes. This increase may correlate with the increase in TNF-alpha mRNA transcription rate. In addition to the stimulation of TNF-alpha secretion by monocytes, okadaic acid appears to modulate TNF-alpha precursor processing, as indicated by a marked increase in the cell-associated 26-kD precursor. These results suggest that active basal phosphorylation/dephosphorylation occurs in monocytes, and that protein phosphatase 1 or 2A is important in regulating TNF-alpha gene transcription, translation, and posttranslational modification. PMID:1324971

  7. [Effect of dental alloys on salivary alkaline and acid phosphatase, alpha amylase K+, Na+, and Cl-].

    PubMed

    Todorov, I; Saprjanova, M

    1977-04-01

    Comparative studied were performed in healthy subjects without metals in their oral cavities and in individuals having different metal alloys (gold, steel, amalgam) in their mouths and presenting with various complaints such as xerostomia, burning mucosa, etc. It was found that the contents of alkaline and acid phosphatases, alpha-amylase, K+, Na+ and Cl- in saliva increased significantly with the increase in total corrosion potential when non-precious metal alloys, especially different types of alloys, were present. Parallel to this, the frequency and the intensity of the complaints increased.

  8. Protein phosphatase 2A B56alpha during development in the spontaneously hypertensive rat.

    PubMed

    Yang, Zhiwei; Yu, Peiying; Asico, Laureano D; Felder, Robin A; Jose, Pedro A

    2004-04-01

    Mistargeting of the regulatory subunit of protein phosphatase 2A (PP2A), B56alpha is involved in the hyperphosphorylation and desensitization of the D1 dopamine receptor in renal proximal tubules of spontaneously hypertensive rats (SHRs). However, the renal expression of B56alpha before hypertension develops is not known. Therefore, we studied the expression of B56alpha and PP2A activity in the kidney during development in the SHR and its normotensive control, the Wistar-Kyoto (WKY) rat. PP2A B56alpha was expressed in proximal and distal tubules with no differences in the pattern of expression in WKY and SHRs at any age. In brush border membranes of renal proximal tubules, PP2A B56alpha protein was greatest in the immature rats and decreased with development. However, PP2A activity did not change with age. PP2A B56alpha protein and PP2A activity were similar in WKY and SHRs except at 2 weeks when both PP2A B56alpha protein and PP2A activity were higher in SHRs than in WKY rats. The PP2A catalytic subunit co-immunoprecipitated with the D1 receptor in renal proximal tubule cells. It is possible that the increased expression of PP2A B56alpha and increased basal PP2A activity in the young, especially in the SHRs, may serve as a compensatory mechanism in the increased phosphorylation and decreased renal D1 receptor function, including D1-receptor mediated stimulation in renal proximal tubules of SHRs.

  9. Differential localization of protein phosphatase-1alpha, beta and gamma1 isoforms in primate prefrontal cortex.

    PubMed

    Bordelon, Jill R; Smith, Yoland; Nairn, Angus C; Colbran, Roger J; Greengard, Paul; Muly, E Chris

    2005-12-01

    Prefrontal cortical functioning depends on D1 family receptors and their complex signal transduction cascade, including protein phosphatase-1 (PP1). Three PP1 isoforms are prominent in the brain: PP1alpha, PP1beta and PP1gamma1. PP1 localization by a variety of scaffolding proteins is critical for dopamine-mediated modulation of glutamatergic neurotransmission. We have quantified the subcellular distribution of each isoform in primate prefrontal cortex using immunoelectron microscopy. All three are found in spines, dendrites, axon terminals, axons and glia. However, PP1alpha and PP1gamma1 labeling is enriched in spines, whereas PP1beta label is enriched in dendrites. Using post-embedding immunogold labeling, we further examined the distribution of PP1alpha and PP1gamma1 within spines. PP1gamma1 is highly and specifically concentrated in the postsynaptic density (PSD) of these spines, while PP1alpha is enriched in the PSD but also found subjacent to the PSD in moderate amounts. Thus, PP1 isoforms are heterogeneously distributed in the cortical neuropil and within spines. These results suggest that each PP1 isoform has access to a different set of substrates and, furthermore, they demonstrate that the composition of signal transduction proteins varies in different parts of the neuron and even in different regions of a dendritic spine in the primate PFC.

  10. Dephosphorylation of human cyclin-dependent kinases by protein phosphatase type 2C alpha and beta 2 isoforms.

    PubMed

    Cheng, A; Kaldis, P; Solomon, M J

    2000-11-03

    We previously reported that the activating phosphorylation on cyclin-dependent kinases in yeast (Cdc28p) and in humans (Cdk2) is removed by type 2C protein phosphatases. In this study, we characterize this PP2C-like activity in HeLa cell extract and determine that it is due to PP2C beta 2, a novel PP2C beta isoform, and to PP2C alpha. PP2C alpha and PP2C beta 2 co-purified with Mg(2+)-dependent Cdk2/Cdk6 phosphatase activity in DEAE-Sepharose, Superdex-200, and Mono Q chromatographies. Moreover, purified recombinant PP2C alpha and PP2C beta 2 proteins efficiently dephosphorylated monomeric Cdk2/Cdk6 in vitro. The dephosphorylation of Cdk2 and Cdk6 by PP2C isoforms was inhibited by the binding of cyclins. We found that the PP2C-like activity in HeLa cell extract, partially purified HeLa PP2C alpha and PP2C beta 2 isoforms, and the recombinant PP2Cs exhibited a comparable substrate preference for a phosphothreonine containing substrate, consistent with the conservation of threonine residues at the site of activating phosphorylation in CDKs.

  11. Inhibition of alpha interferon but not gamma interferon signal transduction by phorbol esters is mediated by a tyrosine phosphatase.

    PubMed Central

    Petricoin, E; David, M; Igarashi, K; Benjamin, C; Ling, L; Goelz, S; Finbloom, D S; Larner, A C

    1996-01-01

    Previous studies have indicated that the expression of viral oncoproteins, cell transformation, or phorbol ester treatment of cells can inhibit alpha/beta interferon (IFN-alpha/beta)-induced gene expression. The mechanisms by which these promoters of cell growth exert their inhibitory effects vary, but in most instances they involve a disruption of the IFN-alpha/beta-induced transcription complex ISGF3 such that the DNA-binding component of this complex (the 48-kDa ISGF3gamma protein) does not bind to the interferon-stimulated response element (ISRE). In this report, we demonstrated that phorbol ester treatment of human peripheral blood monocytes dramatically inhibits activation of IFN-alpha/B-stimulated early response genes but by a mechanism which does not involve abrogation of the ISRE binding of ISGF3gamma. Phorbol ester treatment of monocytes inhibited IFN alpha-stimulated tyrosine phosphorylation of the transcription factors Stat1alpha, Stat2, and Stat3 and of the tyrosine kinase Tyk2 but had no effect on IFN-gamma activation of Stat1alpha. IFNalpha-stimulated tyrosine phosphorylation of Jak1 and the alpha subunit of the IFN-alpha receptor were unaffected by phorbol 12-myristate 13-acetate (PMA). Moreover, PMA caused the dephosphorylation of Tyk2 but not of Jak1, which was activated by IFN. Pretreatment of cells with vanadate prevented the effects of PMA with regard to PMA-induced Tyk2 dephosphorylation. These observations suggest that PMA exerts its inhibitory effects by activation of a tyrosine phosphatase which selectively regulates Tyk2 but not Jak1 activity. PMID:8657115

  12. B56alpha/protein phosphatase 2A inhibits adipose lipolysis in high-fat diet-induced obese mice.

    PubMed

    Kinney, Brice P; Qiao, Liping; Levaugh, Justin M; Shao, Jianhua

    2010-08-01

    Lipolysis and lipogenesis are two opposite processes that control lipid storage in adipocytes. Impaired adipose lipolysis has been observed in both obese human subjects and animal models. This study investigated the mechanisms underlying impaired adipose lipolysis in a high-fat diet-induced obese (DIO) mouse model. DIO models were created using male C57BL/6 mice. Our results show that beta3 adrenergic receptor-specific agonist BRL37344 induced adipose lipolysis was significantly blunted in DIO mice. The levels of Ser660 phosphorylation of hormone-sensitive lipase (HSL) were significantly decreased in the epididymal fat of DIO mice. However, protein levels of HSL, adipose triglyceride lipase and its coactivator comparative gene identification-58 were similar between DIO and control mice. It is known that upon lipolytic hormone stimulation, protein kinase A phosphorylates HSL Ser660 and activates HSL, whereas protein phosphatase 2A (PP2A) dephosphorylates and inactivates HSL. Interestingly, our study shows that high-fat feeding did not alter epididymal fat cAMP and protein kinase A protein levels but significantly increased the expression of the alpha-isoform of PP2A regulatory subunit B' (B56alpha). To study the role of B56alpha in obesity-associated lipolytic defect, B56alpha was overexpressed or knocked down by adenovirus-mediated gene transduction in cultured 3T3-L1CARDelta1 adipocytes. Overexpression of B56alpha significantly decreased HSL Ser660 phosphorylation. In contrast, knocking down B56alpha increased hormone-stimulated HSL activation and lipolysis in mature 3T3-L1CARDelta1 adipocytes. These results strongly suggest that elevated B56alpha/PP2A inhibits HSL and lipolysis in white adipose tissue of DIO mice.

  13. Study of O-glycan sialylation in C6 cultured glioma cells: regulation of a beta-galactoside alpha 2,3 sialyltransferase activity by Ca2+/calmodulin antagonists and phosphatase inhibitors.

    PubMed

    Reboul, P; George, P; Geoffroy, J; Louisot, P; Broquet, P

    1992-08-14

    We have demonstrated that the alpha 2,3 sialyltransferase (alpha 2,3 ST) from C6 cultured glioma cells was inhibited in vivo by W-7 and related Ca2+/Calmodulin (Ca/CaM) antagonists while protein kinase C effectors had no effect. Dephosphorylation of alpha 2,3 ST by the wide specificity alkaline phosphatase led to inactivation indicating that the enzyme is phosphorylated. The serine/threonine protein phosphatase inhibitors okadaic acid and Calyculin A led also to an inhibition of alpha 2,3 ST activity. In addition, Ca/CaM antagonists and phosphatase inhibitors led both to an inhibition of a alpha 2,3 sialoglycoprotein from C6 glioma cells as demonstrated with lectin affinity blotting. A concerted regulatory mechanism with phosphorylation/dephosphorylation of alpha 2,3 ST is then postulated.

  14. Chlorella powder inhibits the activities of peptidase cathepsin S, PLA2, cyclooxygenase-2, thromboxane synthase, tyrosine phosphatases, tumor necrosis factor-alpha converting enzyme, calpain and kinases.

    PubMed

    Cheng, Fong-Chi; Feng, Jin-Jye; Chen, Kuo-Hsin; Imanishi, Hideyo; Fujishima, Masaki; Takekoshi, Hideo; Naoki, Yo; Shimoda, Minoru

    2009-01-01

    A Chlorella powder was tested in 118 in vitro enzyme assay systems. The powder showed potent inhibitions of peptidase cathepsin S, thromboxane A(2) synthase and cyclooxygenase-2 in a dose-concentration manner with IC(50)+/-standard error of the mean values of 3.46+/-0.93 microg/ml, 3.23+/-0.69 microg/ml, and 44.26+/-9.98 microg/ml, respectively. Other activities observed were inhibitions of tumor necrosis factor-alpha converting enzyme, protein tyrosine phosphatase (SHP-2), calpain, protein kinases and protein tyrosine phosphatases. Chlorella powder had no significant effect on cyclooxygenase-1. These actions to inhibit cyclooxygenase-2 and thromboxane synthase could contribute to the purported anti-inflammatory and anti-thrombotic effects of Chlorella. These results reveal important potential biochemical activities to be developed that, if confirmed by in vivo studies, might be exploited for the prevention or treatment of several serious pathologies, including inflammatory diseases, immune and cancer.

  15. A role for protein phosphatase 2A in regulating p38 mitogen activated protein kinase activation and tumor necrosis factor-alpha expression during influenza virus infection.

    PubMed

    Law, Anna H Y; Tam, Alex H M; Lee, Davy C W; Lau, Allan S Y

    2013-04-02

    Influenza viruses of avian origin continue to pose pandemic threats to human health. Some of the H5N1 and H9N2 virus subtypes induce markedly elevated cytokine levels when compared with the seasonal H1N1 virus. We previously showed that H5N1/97 hyperinduces tumor necrosis factor (TNF)-alpha through p38 mitogen activated protein kinase (MAPK). However, the detailed mechanisms of p38MAPK activation and TNF-alpha hyperinduction following influenza virus infections are not known. Negative feedback regulations of cytokine expression play important roles in avoiding overwhelming production of proinflammatory cytokines. Here we hypothesize that protein phosphatases are involved in the regulation of cytokine expressions during influenza virus infection. We investigated the roles of protein phosphatases including MAPK phosphatase-1 (MKP-1) and protein phosphatase type 2A (PP2A) in modulating p38MAPK activation and downstream TNF-alpha expressions in primary human monocyte-derived macrophages (PBMac) infected with H9N2/G1 or H1N1 influenza virus. We demonstrate that H9N2/G1 virus activated p38MAPK and hyperinduced TNF-alpha production in PBMac when compared with H1N1 virus. H9N2/G1 induced PP2A activity in PBMac and, with the treatment of a PP2A inhibitor, p38MAPK phosphorylation and TNF-alpha production were further increased in the virus-infected macrophages. However, H9N2/G1 did not induce the expression of PP2A indicating that the activation of PP2A is not mediated by p38MAPK in virus-infected PBMac. On the other hand, PP2A may not be the targets of H9N2/G1 in the upstream of p38MAPK signaling pathways since H1N1 also induced PP2A activation in primary macrophages. Our results may provide new insights into the control of cytokine dysregulation.

  16. The E3 Ubiquitin Ligase- and Protein Phosphatase 2A (PP2A)-binding Domains of the Alpha4 Protein Are Both Required for Alpha4 to Inhibit PP2A Degradation

    SciTech Connect

    LeNoue-Newton, Michele; Watkins, Guy R.; Zou, Ping; Germane, Katherine L.; McCorvey, Lisa R.; Wadzinski, Brian E.; Spiller, Benjamin W.

    2012-04-30

    Protein phosphatase 2A (PP2A) is regulated through a variety of mechanisms, including post-translational modifications and association with regulatory proteins. Alpha4 is one such regulatory protein that binds the PP2A catalytic subunit (PP2Ac) and protects it from polyubiquitination and degradation. Alpha4 is a multidomain protein with a C-terminal domain that binds Mid1, a putative E3 ubiquitin ligase, and an N-terminal domain containing the PP2Ac-binding site. In this work, we present the structure of the N-terminal domain of mammalian Alpha4 determined by x-ray crystallography and use double electron-electron resonance spectroscopy to show that it is a flexible tetratricopeptide repeat-like protein. Structurally, Alpha4 differs from its yeast homolog, Tap42, in two important ways: (1) the position of the helix containing the PP2Ac-binding residues is in a more open conformation, showing flexibility in this region; and (2) Alpha4 contains a ubiquitin-interacting motif. The effects of wild-type and mutant Alpha4 on PP2Ac ubiquitination and stability were examined in mammalian cells by performing tandem ubiquitin-binding entity precipitations and cycloheximide chase experiments. Our results reveal that both the C-terminal Mid1-binding domain and the PP2Ac-binding determinants are required for Alpha4-mediated protection of PP2Ac from polyubiquitination and degradation.

  17. MID1 catalyzes the ubiquitination of protein phosphatase 2A and mutations within its Bbox1 domain disrupt polyubiquitination of alpha4 but not of PP2Ac.

    PubMed

    Du, Haijuan; Wu, Kuanlin; Didoronkute, Alma; Levy, Marcus V A; Todi, Nimish; Shchelokova, Anna; Massiah, Michael A

    2014-01-01

    MID1 is a microtubule-associated protein that belongs to the TRIM family. MID1 functions as an ubiquitin E3 ligase, and recently was shown to catalyze the polyubiquitination of, alpha4, a protein regulator of protein phosphatase 2A (PP2A). It has been hypothesized that MID1 regulates PP2A, requiring the intermediary interaction with alpha4. Here we report that MID1 catalyzes the in vitro ubiquitination of the catalytic subunit of PP2A (PP2Ac) in the absence of alpha4. In the presence of alpha4, the level of PP2Ac ubiquitination is reduced. Using the MID1 RING-Bbox1-Bbox2 (RB1B2) construct containing the E3 ligase domains, we investigate the functional effects of mutations within the Bbox domains that are identified in patients with X-linked Opitz G syndrome (XLOS). The RB1B2 proteins harboring the C142S, C145T, A130V/T mutations within the Bbox1 domain and C195F mutation within the Bbox2 domain maintain auto-polyubiquitination activity. Qualitatively, the RB1B2 proteins containing these mutations are able to catalyze the ubiquitination of PP2Ac. In contrast, the RB1B2 proteins with mutations within the Bbox1 domain are unable to catalyze the polyubiquitination of alpha4. These results suggest that unregulated alpha4 may be the direct consequence of these natural mutations in the Bbox1 domain of MID1, and hence alpha4 could play a greater role to account for the increased amount of PP2A observed in XLOS-derived fibroblasts.

  18. MID1 Catalyzes the Ubiquitination of Protein Phosphatase 2A and Mutations within Its Bbox1 Domain Disrupt Polyubiquitination of Alpha4 but Not of PP2Ac

    PubMed Central

    Du, Haijuan; Wu, Kuanlin; Didoronkute, Alma; Levy, Marcus V. A.; Todi, Nimish; Shchelokova, Anna; Massiah, Michael A.

    2014-01-01

    MID1 is a microtubule-associated protein that belongs to the TRIM family. MID1 functions as an ubiquitin E3 ligase, and recently was shown to catalyze the polyubiquitination of, alpha4, a protein regulator of protein phosphatase 2A (PP2A). It has been hypothesized that MID1 regulates PP2A, requiring the intermediary interaction with alpha4. Here we report that MID1 catalyzes the in vitro ubiquitination of the catalytic subunit of PP2A (PP2Ac) in the absence of alpha4. In the presence of alpha4, the level of PP2Ac ubiquitination is reduced. Using the MID1 RING-Bbox1-Bbox2 (RB1B2) construct containing the E3 ligase domains, we investigate the functional effects of mutations within the Bbox domains that are identified in patients with X-linked Opitz G syndrome (XLOS). The RB1B2 proteins harboring the C142S, C145T, A130V/T mutations within the Bbox1 domain and C195F mutation within the Bbox2 domain maintain auto-polyubiquitination activity. Qualitatively, the RB1B2 proteins containing these mutations are able to catalyze the ubiquitination of PP2Ac. In contrast, the RB1B2 proteins with mutations within the Bbox1 domain are unable to catalyze the polyubiquitination of alpha4. These results suggest that unregulated alpha4 may be the direct consequence of these natural mutations in the Bbox1 domain of MID1, and hence alpha4 could play a greater role to account for the increased amount of PP2A observed in XLOS-derived fibroblasts. PMID:25207814

  19. Induction of bone-type alkaline phosphatase in human vascular smooth muscle cells: roles of tumor necrosis factor-alpha and oncostatin M derived from macrophages.

    PubMed

    Shioi, Atsushi; Katagi, Miwako; Okuno, Yasuhisa; Mori, Katsuhito; Jono, Shuichi; Koyama, Hidenori; Nishizawa, Yoshiki

    2002-07-12

    Inflammatory cells such as macrophages and T lymphocytes play an important role in vascular calcification associated with atherosclerosis and cardiac valvular disease. In particular, macrophages activated with cytokines derived from T lymphocytes such as interferon-gamma (IFN-gamma) may contribute to the development of vascular calcification. Moreover, we have shown the stimulatory effect of 1alpha,25-dihydroxyvitamin D3 (1,25(OH)2D3) on in vitro calcification through increasing the expression of alkaline phosphatase (ALP), an ectoenzyme indispensable for bone mineralization, in vascular smooth muscle cells. Therefore, we hypothesized that macrophages may induce calcifying phenotype, especially the expression of ALP in human vascular smooth muscle cells (HVSMCs) in the presence of IFN-gamma and 1,25(OH)2D3. To test this hypothesis, we used cocultures of HVSMCs with human monocytic cell line (THP-1) or peripheral blood monocytes (PBMCs) in the presence of IFN-gamma and 1,25(OH)2D3. THP-1 cells or PBMCs induced ALP activity and its gene expression in HVSMCs and the cells with high expression of ALP calcified their extracellular matrix by the addition of beta-glycerophosphate. Thermostability and immunoassay showed that ALP induced in HVSMCs was bone-specific enzyme. We further identified tumor necrosis factor-alpha (TNF-alpha) and oncostatin M (OSM) as major factors inducing ALP in HVSMCs in the culture supernatants of THP-1 cells. TNF-alpha and OSM, only when applied together, increased ALP activities and in vitro calcification in HVSMCs in the presence of IFN-gamma and 1,25(OH)2D3. These results suggest that macrophages may contribute to the development of vascular calcification through producing various inflammatory mediators, especially TNF-alpha and OSM.

  20. Molecular cloning, structural analysis and tissue expression of protein phosphatase 3 catalytic subunit alpha isoform (PPP3CA) gene in Tianfu goat muscle.

    PubMed

    Wan, Lu; Ma, Jisi; Xu, Gangyi; Wang, Daihua; Wang, Nianlu

    2014-02-07

    Calcineurin, a Ca(2+)/calmodulin-dependent protein phosphatase, plays a critical role in controlling skeletal muscle fiber type. However, little information is available concerning the expression of calcineurin in goat. Therefore, protein phosphatase 3 catalytic subunit alpha isoform (PPP3CA) gene, also called calcineurin Aα, was cloned and its expression characterized in Tianfu goat muscle. Real time quantitative polymerase chain reaction (RT-qPCR) analyses revealed that Tianfu goat PPP3CA was detected in cardiac muscle, biceps femoris muscle, abdominal muscle, longissimus dors muscle, and soleus muscle. High expression levels were found in biceps femoris muscle, longissimus muscle and abdominal muscle (p < 0.01), and low expression levels were seen in cardiac muscle and soleus muscle (p > 0.05). In addition, the spatial-temporal mRNA expression levels showed different variation trends in different muscles with the age of the goats. Western blotting further revealed that PPP3CA protein was expressed in the above-mentioned tissues, with the highest level in biceps femoris muscle, and the lowest level in soleus muscle. In this study, we isolated the full-length coding sequence of Tianfu goat PPP3CA gene, analyzed its structure, and investigated its expression in different muscle tissues from different age stages. These results provide a foundation for understanding the function of the PPP3CA gene in goats.

  1. Structural and kinetic characterization of the LPS biosynthetic enzyme D-alpha,beta-D-heptose-1,7-bisphosphate phosphatase (GmhB) from Escherichia coli.

    PubMed

    Taylor, Patricia L; Sugiman-Marangos, Seiji; Zhang, Kun; Valvano, Miguel A; Wright, Gerard D; Junop, Murray S

    2010-02-09

    Lipopolysaccharide is a major component of the outer membrane of gram-negative bacteria and provides a permeability barrier to many commonly used antibiotics. ADP-heptose residues are an integral part of the LPS inner core, and mutants deficient in heptose biosynthesis demonstrate increased membrane permeability. The heptose biosynthesis pathway involves phosphorylation and dephosphorylation steps not found in other pathways for the synthesis of nucleotide sugar precursors. Consequently, the heptose biosynthetic pathway has been marked as a novel target for antibiotic adjuvants, which are compounds that facilitate and potentiate antibiotic activity. D-alpha,beta-D-heptose-1,7-bisphosphate phosphatase (GmhB) catalyzes the third essential step of LPS heptose biosynthesis. This study describes the first crystal structure of GmhB and enzymatic analysis of the protein. Structure-guided mutations followed by steady state kinetic analysis, together with established precedent for HAD phosphatases, suggest that GmhB functions through a phosphoaspartate intermediate. This study provides insight into the structure-function relationship of GmhB, a new target for combatting gram-negative bacterial infection.

  2. Structural and Kinetic Characterization of the LPS Biosynthetic Enzyme D-alpha,beta-D-heptose-1,7-bisphosphate Phosphatase (GmhB) from Escherichia coli

    SciTech Connect

    Taylor, P.; Sugiman-Marangos, S; Zhang, K; Valvano, M; Wright, G; Junop, M

    2010-01-01

    Lipopolysaccharide is a major component of the outer membrane of Gram-negative bacteria and provides a permeability barrier to many commonly used antibiotics. ADP-heptose residues are an integral part of the LPS inner core, and mutants deficient in heptose biosynthesis demonstrate increased membrane permeability. The heptose biosynthesis pathway involves phosphorylation and dephosphorylation steps not found in other pathways for the synthesis of nucleotide sugar precursors. Consequently, the heptose biosynthetic pathway has been marked as a novel target for antibiotic adjuvants, which are compounds that facilitate and potentiate antibiotic activity. D-{alpha},{beta}-D-Heptose-1,7-bisphosphate phosphatase (GmhB) catalyzes the third essential step of LPS heptose biosynthesis. This study describes the first crystal structure of GmhB and enzymatic analysis of the protein. Structure-guided mutations followed by steady state kinetic analysis, together with established precedent for HAD phosphatases, suggest that GmhB functions through a phosphoaspartate intermediate. This study provides insight into the structure-function relationship of GmhB, a new target for combatting Gram-negative bacterial infection.

  3. Effects of cerulein on keratin 8 phosphorylation and perinuclear reorganization in pancreatic cancer cells: Involvement of downregulation of protein phosphatase 2A and alpha4.

    PubMed

    Park, Mi Kyung; Lee, Chang Hoon

    2016-12-01

    Toxicants can perturb cellular homeostasis by modifying phosphorylation-based signaling. In the present study, we examined the effects of cerulein, an inducer of acute pancreatitis, on keratin 8 (K8) phosphorylation. We found that cerulein dose-dependently induced K8 phosphorylation and perinuclear reorganization in PANC-1 cells, thus leading to migration and invasion. The extracellular signal-regulated kinases (ERK) inhibitor U0126 suppressed cerulein-induced phosphorylation of serine 431 and reorganization of K8. Cerulein reduced the expressions of protein phosphatase 2A (PP2A) via ubiqutination and alpha4. PP2A's involvement in K8 phosphorylation of PANC-1 cells was also confirmed by the observation that PP2A gene silencing resulted in K8 phosphorylation and migration of PANC-1 cells. Overall, these results suggest that cerulein induced phosphorylation and reorganization through ERK activation by downregulating PP2A and alpha4, leading to increased migration and invasion of PANC-1 cells. © 2015 Wiley Periodicals, Inc. Environ Toxicol 31: 2090-2098, 2016. © 2015 Wiley Periodicals, Inc.

  4. Impact of lipid phosphatases SHIP2 and PTEN on the time- and Akt-isoform-specific amelioration of TNF-alpha-induced insulin resistance in 3T3-L1 adipocytes.

    PubMed

    Ikubo, Mariko; Wada, Tsutomu; Fukui, Kazuhito; Ishiki, Manabu; Ishihara, Hajime; Asano, Tomoichiro; Tsuneki, Hiroshi; Sasaoka, Toshiyasu

    2009-01-01

    TNF-alpha is a major contributor to the pathogenesis of insulin resistance associated with obesity and inflammation by serine phosphorylating and degrading insulin receptor substrate-1. Presently, we further found that pretreatment with TNF-alpha inhibited insulin-induced phosphorylation of Akt2 greater than Akt1. Since lipid phosphatases SH2-containing inositol 5'-phoshatase 2 (SHIP2) and phosphatase and tensin homologs deleted on chromosome 10 (PTEN) are negative regulators of insulin's metabolic signaling at the step downstream of phosphatidylinositol 3-kinase, we investigated the Akt isoform-specific properties of these phosphatases in the negative regulation after short- and long-term insulin treatment and examined the influence of inhibition on the amelioration of insulin resistance caused by TNF-alpha in 3T3-L1 adipocytes. Adenovirus-mediated overexpression of WT-SHIP2 decreased the phosphorylation of Akt2 greater than Akt1 after insulin stimulation up to 15 min. Expression of a dominant-negative DeltaIP-SHIP2 enhanced the phosphorylation of Akt2 up to 120 min. On the other hand, overexpression of WT-PTEN inhibited the phosphorylation of both Akt1 and Akt2 after short- but not long-term insulin treatment. The expression of DeltaIP-PTEN enhanced the phosphorylation of Akt1 at 120 min and that of Akt2 at 2 min. Interestingly, the expression of DeltaIP-SHIP2, but not DeltaIP-PTEN, protected against the TNF-alpha inhibition of insulin-induced phosphorylation of Akt2, GSK3, and AS160, whereas both improved the TNF-alpha inhibition of insulin-induced 2-deoxyglucose uptake. The results indicate that these lipid phosphatases possess different characteristics according to the time and preference of Akt isoform-dependent signaling in the negative regulation of the metabolic actions of insulin, whereas both inhibitions are effective in the amelioration of insulin resistance caused by TNF-alpha.

  5. Dimerization of cGMP-dependent protein kinase 1alpha and the myosin-binding subunit of myosin phosphatase: role of leucine zipper domains.

    PubMed

    Surks, Howard K; Mendelsohn, Michael E

    2003-10-01

    Nitric oxide (NO) and nitrovasodilators induce vascular smooth muscle cell relaxation in part by cGMP-dependent protein kinase (cGK)-mediated activation of myosin phosphatase, which dephosphorylates myosin light chains. We recently found that cGMP-dependent protein kinase 1alpha binds directly to the myosin-binding subunit (MBS) of myosin phosphatase via the leucine/isoleucine zipper of cGK. We have now studied the role of the leucine zipper domain of MBS in dimerization with cGK and the leucine/isoleucine zipper and leucine zipper domains of both proteins in homodimerization. Mutagenesis of the MBS leucine zipper domain disrupts cGKIalpha-MBS dimerization. Mutagenesis of the MBS leucine zipper eliminates MBS homodimerization, while similar disruption of the cGKIalpha leucine/isoleucine zipper does not prevent formation of cGK dimers. The MBS leucine zipper domain is phosphorylated by cGK, but this does not have any apparent effect on heterodimer formation between the two proteins. MBS LZ mutants that are unable to bind cGK were poor substrates for cGK. These data support the theory that the MBS leucine zipper domain is necessary and sufficient to mediate both MBS homodimerization and binding of the protein to cGK. In contrast, the leucine/isoleucine zipper of cGK is required for binding to MBS, but not for cGK homodimerization. These data support that the MBS and cGK leucine zipper domains mediate the interaction between these two proteins. The contribution of these domains to both homodimerization and their specific interaction with each other suggest that additional regulatory mechanisms involving these domains may exist.

  6. K+-Phosphatase activity of gill (Na+, K+)-ATPase from the blue crab, Callinectes danae: low-salinity acclimation and expression of the alpha-subunit.

    PubMed

    Masui, D C; Furriel, R P M; Mantelatto, F L M; McNamara, J C; Leone, F A

    2005-04-01

    The kinetic properties of a microsomal gill (Na(+), K(+)) ATPase from the blue crab, Callinectes danae, acclimated to 15 per thousand salinity for 10 days, were analyzed using the substrate p-nitrophenylphosphate. The (Na(+), K(+))-ATPase hydrolyzed the substrate obeying Michaelian kinetics at a rate of V=102.9+/-4.3 U.mg(-1) with K(0.5)=1.7+/-0.1 mmol.L(-1), while stimulation by magnesium (V=93.7+/-2.3 U.mg(-1); K(0.5)=1.40+/-0.03 mmol.L(-1)) and potassium ions (V=94.9+/-3.5 U.mg(-1); K(0.5)=2.9+/-0.1 mmol.L(-1)) was cooperative. K(+)-phosphatase activity was also stimulated by ammonium ions to a rate of V=106.2+/-2.2 U. mg(-1) with K(0.5)=9.8+/-0.2 mmol.L(-1), following cooperative kinetics (n(H)=2.9). However, K(+)-phosphatase activity was not stimulated further by K(+) plus NH(4) (+) ions. Sodium ions (K(I)=22.7+/-1.7 mmol.L(-1)), and orthovanadate (K(I)=28.1+/-1.4 nmol.L(-1)) completely inhibited PNPPase activity while ouabain inhibition reached almost 75% (K(I)=142.0+/-7.1 micromol.L(-1)). Western blotting analysis revealed increased expression of the (Na(+), K(+))-ATPase alpha-subunit in crabs acclimated to 15 per thousand salinity compared to those acclimated to 33 per thousand salinity. The increase in (Na(+), K(+))-ATPase activity in C. danae gill tissue in response to low-salinity acclimation apparently derives from the increased expression of the (Na(+), K( (+) ))-ATPase alpha-subunit; phosphate-hydrolyzing enzymes other than (Na(+), K(+))-ATPase are also expressed. These findings allow a better understanding of the kinetic behavior of the enzymes that underlie the osmoregulatory mechanisms of euryhaline crustaceans. (c) 2005 Wiley-Liss, Inc.

  7. The SH2 domain-containing tyrosine phosphatase PTP1D is required for interferon alpha/beta-induced gene expression.

    PubMed

    David, M; Zhou, G; Pine, R; Dixon, J E; Larner, A C

    1996-07-05

    Interferons (IFNs) induce early response genes by stimulating Janus family (Jak) tyrosine kinases, leading to tyrosine phosphorylation of Stat (signal transducer and activator of transcription) proteins. Previous studies demonstrated that a protein-tyrosine phosphatase (PTP) is required for activation of the ISGF3 transcription complex by IFNalpha/beta, but the specific PTP responsible remained unidentified. We now show that the SH2 domain containing tyrosine phosphatase PTP1D (also designated as SHPTP2, SHPTP3, PTP2C, or Syp) is constitutively associated with the IFNalpha/beta receptor and becomes tyrosine-phosphorylated in response to ligand. Furthermore, transient expression of a phosphatase-inactive mutant or the COOH-terminal SH2 domain of PTP1D causes a dominant negative effect on IFNalpha/beta-induced early response gene expression. These results provide strong evidence that PTP1D functions as a positive regulator of the IFNalpha/beta-induced Jak/Stat signal transduction pathway.

  8. Specificity of a protein phosphatase inhibitor from rabbit skeletal muscle.

    PubMed Central

    Cohen, P; Nimmo, G A; Antoniw, J F

    1977-01-01

    A hear-stable protein, which is a specific inhibitor of protein phosphatase-III, was purified 700-fold from skeletal muscle by a procedure that involved heat-treatment at 95 degrees C, chromatography on DEAE-cellulose and gel filtration on Sephadex G-100. The final step completely resolved the protein phosphatase inhibitor from the protein inhibitor of cyclic AMP-dependent protein kinase. The phosphorylase phosphatase, beta-phosphorylase kinase phosphatase, glycogen synthase phosphatase-1 and glycogen synthase phosphatase-2 activities of protein phosphatase-III [Antoniw, J. F., Nimmo, H. G., Yeaman, S. J. & Cohen, P.(1977) Biochem.J. 162, 423-433] were inhibited in a very similar manner by the protein phosphatase inhibitor and at least 95% inhibition was observed at high concentrations of inhibitor. The two forms of protein phosphatase-III, termed IIIA and IIIB, were equally susceptible to the protein phosphatase inhibitor. The protein phosphatase inhibitor was at least 200 times less effective in inhibiting the activity of protein phosphatase-I and protein phosphatase-II. The high degree of specificity of the inhibitor for protein phosphatase-III was used to show that 90% of the phosphorylase phosphatase and glycogen synthase phosphatase activities measured in muscle extracts are catalysed by protein phosphatase-III. Protein phosphatase-III was tightly associated with the protein-glycogen complex that can be isolated from skeletal muscle, whereas the protein phosphatase inhibitor and protein phosphatase-II were not. The results provide further evidence that the enzyme that catalyses the dephosphorylation of the alpha-subunit of phosphorylase kinase (protein phosphatase-II) and the enzyme that catalyses the dephosphorylation of the beta-subunit of phosphorylase kinase (protein phosphatase-III) are distinct. The results suggest that the protein phosphatase inhibitor may be a useful probe for differentiating different classes of protein phosphatases in mammalian

  9. The Laforin-like dual-specificity phosphatase SEX4 from Arabidopsis hydrolyzes both C6- and C3-phosphate esters introduced by starch-related dikinases and thereby affects phase transition of alpha-glucans.

    PubMed

    Hejazi, Mahdi; Fettke, Joerg; Kötting, Oliver; Zeeman, Samuel C; Steup, Martin

    2010-02-01

    The biochemical function of the Laforin-like dual-specific phosphatase AtSEX4 (EC 3.1.3.48) has been studied. Crystalline maltodextrins representing the A- or the B-type allomorph were prephosphorylated using recombinant glucan, water dikinase (StGWD) or the successive action of both plastidial dikinases (StGWD and AtPWD). AtSEX4 hydrolyzed carbon 6-phosphate esters from both the prephosphorylated A- and B-type allomorphs and the kinetic constants are similar. The phosphatase also acted on prelabeled carbon-3 esters from both crystalline maltodextrins. Similarly, native starch granules prelabeled in either the carbon-6 or carbon-3 position were also dephosphorylated by AtSEX4. The phosphatase did also hydrolyze phosphate esters of both prephosphorylated maltodextrins when the (phospho)glucans had been solubilized by heat treatment. Submillimolar concentrations of nonphosphorylated maltodextrins inhibited AtSEX4 provided they possessed a minimum of length and had been solubilized. As opposed to the soluble phosphomaltodextrins, the AtSEX4-mediated dephosphorylation of the insoluble substrates was incomplete and at least 50% of the phosphate esters were retained in the pelletable (phospho)glucans. The partial dephosphorylation of the insoluble glucans also strongly reduced the release of nonphosphorylated chains into solution. Presumably, this effect reflects fast structural changes that following dephosphorylation occur near the surface of the maltodextrin particles. A model is proposed defining distinct stages within the phosphorylation/dephosphorylation-dependent transition of alpha-glucans from the insoluble to the soluble state.

  10. Homozygous mutation in the eukaryotic translation initiation factor 2alpha phosphatase gene, PPP1R15B, is associated with severe microcephaly, short stature and intellectual disability

    PubMed Central

    Kernohan, Kristin D.; Tétreault, Martine; Liwak-Muir, Urszula; Geraghty, Michael T.; Qin, Wen; Venkateswaran, Sunita; Davila, Jorge; Holcik, Martin; Majewski, Jacek; Richer, Julie; Boycott, Kym M.

    2015-01-01

    Protein translation is an essential cellular process initiated by the association of a methionyl–tRNA with the translation initiation factor eIF2. The Met-tRNA/eIF2 complex then associates with the small ribosomal subunit, other translation factors and mRNA, which together comprise the translational initiation complex. This process is regulated by the phosphorylation status of the α subunit of eIF2 (eIF2α); phosphorylated eIF2α attenuates protein translation. Here, we report a consanguineous family with severe microcephaly, short stature, hypoplastic brainstem and cord, delayed myelination and intellectual disability in two siblings. Whole-exome sequencing identified a homozygous missense mutation, c.1972G>A; p.Arg658Cys, in protein phosphatase 1, regulatory subunit 15b (PPP1R15B), a protein which functions with the PPP1C phosphatase to maintain dephosphorylated eIF2α in unstressed cells. The p.R658C PPP1R15B mutation is located within the PPP1C binding site. We show that patient cells have greatly diminished levels of PPP1R15B–PPP1C interaction, which results in increased eIF2α phosphorylation and resistance to cellular stress. Finally, we find that patient cells have elevated levels of PPP1R15B mRNA and protein, suggesting activation of a compensatory program aimed at restoring cellular homeostasis which is ineffective due to PPP1R15B alteration. PPP1R15B now joins the expanding list of translation-associated proteins which when mutated cause rare genetic diseases. PMID:26307080

  11. Identification of the adipocyte acid phosphatase as a PAO-sensitive tyrosyl phosphatase.

    PubMed Central

    Shekels, L. L.; Smith, A. J.; Van Etten, R. L.; Bernlohr, D. A.

    1992-01-01

    We have partially purified an 18-kDa cytoplasmic protein from 3T3-L1 cells, which dephosphorylates pNPP and the phosphorylated adipocyte lipid binding protein (ALBP), and have identified it by virtue of kinetic and immunological criteria as an acid phosphatase (EC 3.1.3.2). The cytoplasmic acid phosphatase was inactivated by phenylarsine oxide (PAO) (Kinact = 10 microM), and the inactivation could be reversed by the dithiol, 2,3-dimercaptopropanol (Kreact = 23 microM), but not the monothiol, 2-mercaptoethanol. Cloning of the human adipocyte acid phosphatase revealed that two isoforms exist, termed HAAP alpha and HAAP beta (human adipocyte acid phosphatase), which are distinguished by a 34-amino acid isoform-specific domain. Sequence analysis shows HAAP alpha and HAAP beta share 74% and 90% identity with the bovine liver acid phosphatase, respectively, and 99% identity with both isoenzymes of the human red cell acid phosphatase but no sequence similarity to the protein tyrosine phosphatases (EC 3.1.3.48). HAAP beta has been cloned into Escherichia coli, expressed, and purified as a glutathione S-transferase fusion protein. Recombinant HAAP beta was shown to dephosphorylate pNPP and phosphoALBP and to be inactivated by PAO and inhibited by vanadate (Ki = 17 microM). These results describe the adipocyte acid phosphatase as a cytoplasmic enzyme containing conformationally vicinal cysteine residues with properties that suggest it may dephosphorylate tyrosyl phosphorylated cellular proteins. PMID:1304913

  12. Sac phosphatase domain proteins.

    PubMed Central

    Hughes, W E; Cooke, F T; Parker, P J

    2000-01-01

    Advances in our understanding of the roles of phosphatidylinositol phosphates in controlling cellular functions such as endocytosis, exocytosis and the actin cytoskeleton have included new insights into the phosphatases that are responsible for the interconversion of these lipids. One of these is an entirely novel class of phosphatase domain found in a number of well characterized proteins. Proteins containing this Sac phosphatase domain include the yeast Saccharomyces cerevisiae proteins Sac1p and Fig4p. The Sac phosphatase domain is also found within the mammalian phosphoinositide 5-phosphatase synaptojanin and the yeast synaptojanin homologues Inp51p, Inp52p and Inp53p. These proteins therefore contain both Sac phosphatase and 5-phosphatase domains. This review describes the Sac phosphatase domain-containing proteins and their actions, with particular reference to the genetic and biochemical insights provided by study of the yeast Saccharomyces cerevisiae. PMID:10947947

  13. Teaching resources. Protein phosphatases.

    PubMed

    Salton, Stephen R

    2005-03-01

    This Teaching Resource provides lecture notes and slides for a class covering the structure and function of protein phosphatases and is part of the course "Cell Signaling Systems: A Course for Graduate Students." The lecture begins with a discussion of the importance of phosphatases in physiology, recognized by the award of a Nobel Prize in 1992, and then proceeds to describe the two types of protein phosphatases: serine/threonine and tyrosine phosphatases. The information covered includes the structure, regulation, and substrate specificity of protein phosphatases, with an emphasis on their importance in disease and clinical settings.

  14. The MID1 E3 ligase catalyzes the polyubiquitination of Alpha4 (α4), a regulatory subunit of protein phosphatase 2A (PP2A): novel insights into MID1-mediated regulation of PP2A.

    PubMed

    Du, Haijuan; Huang, Yongzhao; Zaghlula, Manar; Walters, Erica; Cox, Timothy C; Massiah, Michael A

    2013-07-19

    Alpha4 (α4) is a key regulator of protein phosphatase 2A (PP2A) and mTOR in steps essential for cell-cycle progression. α4 forms a complex with PP2A and MID1, a microtubule-associated ubiquitin E3 ligase that facilitates MID1-dependent regulation of PP2A and the dephosphorylation of MID1 by PP2A. Ectopic overexpression of α4 is associated with hepatocellular carcinomas, breast cancer, and invasive adenocarcinomas. Here, we provide data suggesting that α4 is regulated by ubiquitin-dependent degradation mediated by MID1. In cells stably expressing a dominant-negative form of MID1, significantly elevated levels of α4 were observed. Treatment of cells with the specific proteasome inhibitor, lactacystin, resulted in a 3-fold increase in α4 in control cells and a similar level in mutant cells. Using in vitro assays, individual MID1 E3 domains facilitated monoubiquitination of α4, whereas full-length MID1 as well as RING-Bbox1 and RING-Bbox1-Bbox2 constructs catalyzed its polyubiquitination. In a novel non-biased functional screen, we identified a leucine to glutamine substitution at position 146 within Bbox1 that abolished MID1-α4 interaction and the subsequent polyubiquitination of α4, indicating that direct binding to Bbox1 was necessary for the polyubiquitination of α4. The mutant had little impact on the RING E3 ligase functionality of MID1. Mass spectrometry data confirmed Western blot analysis that ubiquitination of α4 occurs only within the last 105 amino acids. These novel findings identify a new role for MID1 and a mechanism of regulation of α4 that is likely to impact the stability and activity level of PP2Ac.

  15. Structure of Acid phosphatases.

    PubMed

    Araujo, César L; Vihko, Pirkko T

    2013-01-01

    Acid phosphatases are enzymes that have been studied extensively due to the fact that their dysregulation is associated with pathophysiological conditions. This characteristic has been exploited for the development of diagnostic and therapeutic methods. As an example, prostatic acid phosphatase was the first marker for metastatic prostate cancer diagnosis and the dysregulation of tartrate resistant acid phosphatase is associated with abnormal bone resorption linked to osteoporosis. The pioneering crystallization studies on prostatic acid phosphatase and mammalian tartrate-resistant acid phosphatase conformed significant milestones towards the elucidation of the mechanisms followed by these enzymes (Schneider et al., EMBO J 12:2609-2615, 1993). Acid phosphatases are also found in nonmammalian species such as bacteria, fungi, parasites, and plants, and most of them share structural similarities with mammalian acid phosphatase enzymes. Acid phosphatase (EC 3.1.3.2) enzymes catalyze the hydrolysis of phosphate monoesters following the general equation. Phosphate monoester + H2O -->/<-- alcohol + phosphate. The general classification "acid phosphatase" relies only on the optimum acidic pH for the enzymatic activity in assay conditions using non-physiological substrates. These enzymes accept a wide range of substrates in vitro, ranging from small organic molecules to phosphoproteins, constituting a heterogeneous group of enzymes from the structural point of view. These structural differences account for the divergence in cofactor dependences and behavior against substrates, inhibitors, and activators. In this group only the tartrate-resistant acid phosphatase is a metallo-enzyme whereas the other members do not require metal-ion binding for their catalytic activity. In addition, tartrate-resistant acid phosphatase and erythrocytic acid phosphatase are not inhibited by L-(+)-tartrate ion while the prostatic acid phosphatase is tartrate-sensitive. This is an important

  16. Regulation of alkaline phosphatase expression in human choriocarcinoma cell lines.

    PubMed Central

    Hamilton, T A; Tin, A W; Sussman, H H

    1979-01-01

    The coincident expression of two structurally distinct isoenzymes of human alkaline phosphatase was demonstrated in two independently derived gestational choriocarcinoma cell lines. These proteins were shown to have enzymatic, antigenic, and physical-chemical properties resembling those of isoenzymes from term placenta and adult liver. The regulation of these isoenzymes has been studied during the exposure of both cell lines to 5-bromodeoxyuridine and dibutyryl cyclic AMP. The responses of the alkaline phosphatase isoenzymes to these agents have also been compared with the response of another protein phenotypic to placenta, the alpha subunit of chorionic gonadotropin. The results show that (i) the separate structural genes coding for placental and liver alkaline phosphatases are regulated in a noncoordinate fashion; (ii) both alkaline phosphatase genes respond independently of the alpha subunit; and (iii) the induction of the placental type isoenzyme occurs via at least two independent pathways. Images PMID:218197

  17. 3-Phosphoglycerate Phosphatase in Plants

    PubMed Central

    Randall, D. D.; Tolbert, N. E.; Gremel, D.

    1971-01-01

    3-Phosphoglycerate phosphatase and phosphoglycolate phosphatase were found in leaves of all 52 plants examined. Activities of both phosphatases varied widely between 1 to 20 micromoles per minute per milligram chlorophyll. Plants were grouped into two categories based upon the relative ratio of activity of 3-phosphoglycerate phosphatase to phosphoglycolate phosphatase. This ratio varied between 2:1 to 4:1 in the C4-plants except corn leaves which had a low level of 3-phosphoglycerate phosphatase. This ratio was reversed and varied between 1:2 to 1:6 in all C3-plants except one bean variety which had large amounts of both phosphatases. By differential grinding procedures for C4 plants a major part of the 3-phosphoglycerate phosphatase was found in the mesophyll cells and P-glycolate phosphatase in the bundle sheath cells. Phosphoglycolate phosphatase, but not 3-phosphoglycerate phosphatase, was located in chloroplasts of C3- and C4- plants. Formation of 3-phosphoglycerate phosphatase increased 4- to 12-fold during greening of etiolated sugarcane leaves. This cytosol phosphatase displayed a diurnal variation in sugarcane leaves by increasing 50% during late daylight hours and early evening. It is proposed that the soluble form of 3-phosphoglycerate phosphatase is necessary for carbon transport between the bundle sheath and mesophyll cells during photosynthesis by C4-plants. In C3- and C4-plants this phosphatase initiates the conversion of 3-phosphoglycerate to serine which is an alternate metabolic pathway to glycolate metabolism and photorespiration. PMID:16657822

  18. Alkaline phosphatase: an overview.

    PubMed

    Sharma, Ujjawal; Pal, Deeksha; Prasad, Rajendra

    2014-07-01

    Alkaline phosphatase (ALP; E.C.3.I.3.1.) is an ubiquitous membrane-bound glycoprotein that catalyzes the hydrolysis of phosphate monoesters at basic pH values. Alkaline phosphatase is divided into four isozymes depending upon the site of tissue expression that are Intestinal ALP, Placental ALP, Germ cell ALP and tissue nonspecific alkaline phosphatase or liver/bone/kidney (L/B/K) ALP. The intestinal and placental ALP loci are located near the end of long arm of chromosome 2 and L/B/K ALP is located near the end of the short arm of chromosome 1. Although ALPs are present in many mammalian tissues and have been studied for the last several years still little is known about them. The bone isoenzyme may be involved in mammalian bone calcification and the intestinal isoenzyme is thought to play a role in the transport of phosphate into epithelial cells of the intestine. In this review, we tried to provide an overview about the various forms, structure and functions of alkaline phosphatase with special focus on liver/bone/kidney alkaline phosphatase.

  19. Protein phosphatase-1 modulates the function of Pax-6, a transcription factor controlling brain and eye development.

    PubMed

    Yan, Qin; Liu, Wen-Bin; Qin, Jichao; Liu, Jinping; Chen, He-Ge; Huang, Xiaoqin; Chen, Lili; Sun, Shuming; Deng, Mi; Gong, Lili; Li, Yong; Zhang, Lan; Liu, Yan; Feng, Hao; Xiao, Yamei; Liu, Yun; Li, David W-C

    2007-05-11

    Pax-6 is an evolutionarily conserved transcription factor and acts high up in the regulatory hierarchy controlling eye and brain development in humans, mice, zebrafish, and Drosophila. Previous studies have shown that Pax-6 is a phosphoprotein, and its phosphorylation by ERK, p38, and homeodomain-interacting protein kinase 2 greatly enhances its transactivation activity. However, the protein phosphatases responsible for the dephosphorylation of Pax-6 remain unknown. Here, we present both in vitro and in vivo evidence to show that protein serine/threonine phosphatase-1 is a major phosphatase that directly dephosphorylates Pax-6. First, purified protein phosphatase-1 directly dephosphorylates Pax-6 in vitro. Second, immunoprecipitation-linked Western blot revealed that both protein phosphatase-1alpha and protein phosphatase-1beta interact with Pax-6. Third, overexpression of protein phosphatase-1 in human lens epithelial cells leads to dephosphorylation of Pax-6. Finally, inhibition of protein phosphatase-1 activity by calyculin A or knockdown of protein phosphatase-1alpha and protein phosphatase-1beta by RNA interference leads to enhanced phosphorylation of Pax-6. Moreover, our results also demonstrate that dephosphorylation of Pax-6 by protein phosphatase-1 significantly modulates its function in regulating expression of both exogenous and endogenous genes. These results demonstrate that protein phosphatase 1 acts as a major phosphatase to dephosphorylate Pax-6 and modulate its function.

  20. Direct determination of phosphatase activity from physiological substrates in cells.

    PubMed

    Ren, Zhongyuan; Do, Le Duy; Bechkoff, Géraldine; Mebarek, Saida; Keloglu, Nermin; Ahamada, Saandia; Meena, Saurabh; Magne, David; Pikula, Slawomir; Wu, Yuqing; Buchet, René

    2015-01-01

    A direct and continuous approach to determine simultaneously protein and phosphate concentrations in cells and kinetics of phosphate release from physiological substrates by cells without any labeling has been developed. Among the enzymes having a phosphatase activity, tissue non-specific alkaline phosphatase (TNAP) performs indispensable, multiple functions in humans. It is expressed in numerous tissues with high levels detected in bones, liver and neurons. It is absolutely required for bone mineralization and also necessary for neurotransmitter synthesis. We provided the proof of concept that infrared spectroscopy is a reliable assay to determine a phosphatase activity in the osteoblasts. For the first time, an overall specific phosphatase activity in cells was determined in a single step by measuring simultaneously protein and substrate concentrations. We found specific activities in osteoblast like cells amounting to 116 ± 13 nmol min(-1) mg(-1) for PPi, to 56 ± 11 nmol min(-1) mg(-1) for AMP, to 79 ± 23 nmol min(-1) mg(-1) for beta-glycerophosphate and to 73 ± 15 nmol min(-1) mg(-1) for 1-alpha-D glucose phosphate. The assay was also effective to monitor phosphatase activity in primary osteoblasts and in matrix vesicles. The use of levamisole--a TNAP inhibitor--served to demonstrate that a part of the phosphatase activity originated from this enzyme. An IC50 value of 1.16 ± 0.03 mM was obtained for the inhibition of phosphatase activity of levamisole in osteoblast like cells. The infrared assay could be extended to determine any type of phosphatase activity in other cells. It may serve as a metabolomic tool to monitor an overall phosphatase activity including acid phosphatases or other related enzymes.

  1. Phosphatidyl glycerophosphate phosphatase.

    PubMed

    Chang, Y Y; Kennedy, E P

    1967-09-01

    An enzyme (phosphatidyl glycerophosphate phosphatase) that catalyzes the formation of phosphatidyl glycerol from phosphatidyl glycerophosphate has been rendered soluble by treatment of the particulate fraction of E. coli with Triton X-100 in the presence of EDTA, and has been partially purified. The enzyme is specific for phosphatidyl glycerophosphate and does not catalyze the hydrolysis of other simple phosphomonoesters. It requires Mg(++) for activity and is inhibited by sulfhydryl agents. Some other properties of the enzyme are also described.

  2. Potential role for purple acid phosphatase in the dephosphorylation of wall proteins in tobacco cells.

    PubMed

    Kaida, Rumi; Serada, Satoshi; Norioka, Naoko; Norioka, Shigemi; Neumetzler, Lutz; Pauly, Markus; Sampedro, Javier; Zarra, Ignacio; Hayashi, Takahisa; Kaneko, Takako S

    2010-06-01

    It is not yet known whether dephosphorylation of proteins catalyzed by phosphatases occurs in the apoplastic space. In this study, we found that tobacco (Nicotiana tabacum) purple acid phosphatase could dephosphorylate the phosphoryl residues of three apoplastic proteins, two of which were identified as alpha-xylosidase and beta-glucosidase. The dephosphorylation and phosphorylation of recombinant alpha-xylosidase resulted in a decrease and an increase in its activity, respectively, when xyloglucan heptasaccharide was used as a substrate. Attempted overexpression of the tobacco purple acid phosphatase NtPAP12 in tobacco cells not only decreased the activity levels of the glycosidases but also increased levels of xyloglucan oligosaccharides and cello-oligosaccharides in the apoplast during the exponential phase. We suggest that purple acid phosphatase controls the activity of alpha-xylosidase and beta-glucosidase, which are responsible for the degradation of xyloglucan oligosaccharides and cello-oligosaccharides in the cell walls.

  3. Steady-State Levels of Phosphorylated Mitogen-Activated Protein Kinase Kinase 1/2 Determined by Mortalin/HSPA9 and Protein Phosphatase 1 Alpha in KRAS and BRAF Tumor Cells.

    PubMed

    Wu, Pui-Kei; Hong, Seung-Keun; Park, Jong-In

    2017-09-15

    Although deregulation of MEK/extracellular signal-regulated kinase (ERK) activity is a key feature in cancer, high-magnitude MEK/ERK activity can paradoxically induce growth inhibition. Therefore, additional mechanisms may exist to modulate MEK/ERK activity in favor of tumor cell proliferation. We previously reported that mortalin/HSPA9 can facilitate proliferation of certain KRAS and BRAF tumor cells by modulating MEK/ERK activity. In this study, we demonstrated that mortalin can regulate MEK/ERK activity via protein phosphatase 1α (PP1α). We found that PP1α inhibition increases steady-state levels of phosphorylated MEK1/2 in various tumor cells expressing B-Raf(V600E) or K-Ras(G12C/D) Intriguingly, coimmunoprecipitation and in vitro binding assays revealed that mortalin facilitates PP1α-mediated MEK1/2 dephosphorylation by promoting PP1α-MEK1/2 interaction in an ATP-sensitive manner. The region spanning Val482 to Glu491 in the substrate-binding cavity and the substrate lid of mortalin were necessary for these physical interactions, which is consistent with conventional heat shock protein 70 (HSP70)-client interaction mechanisms. Nevertheless, mortalin depletion did not affect cellular PP1α levels or its regulatory phosphorylation, suggesting a nonconventional role for mortalin in promoting PP1α-MEK1/2 interaction. Of note, PP1α was upregulated in human melanoma and pancreatic cancer biopsy specimens in correlation with mortalin upregulation. PP1α may therefore have a role in tumorigenesis in concert with mortalin, which affects MEK/ERK activity in tumor cells. Copyright © 2017 American Society for Microbiology.

  4. Characterization of a tyrosine phosphatase activity in the oogenesis of Periplaneta americana.

    PubMed

    Oliveira, D M P; Machado, E A

    2006-09-01

    In this work, phosphatase activity was characterized in the ovary and the haemolymph of Periplaneta americana. The optimum pH for these activities was 4.0, and a temperature of 44 degrees C was ideal for the maximal enzyme activity. The phosphatase activities were inhibited by NaF, sodium tartrate, Pi, sodium orthovanadate, and ammonium molybdate. The ovarian phosphatase activity at pH 4.0 was almost exclusive against phosphotyrosine, with little or no effect on the residues of phosphoserine or phosphothreonine. These results indicate that this phosphatase activity is due to the presence of an acid tyrosine phosphatase. The phosphatase activities of acid extracts from P. americana ovaries (OEX) and an acid extract from P. americana haemolymph (HEX) were analyzed in non-denaturant gel electrophoresis using an analog substrate beta-naphtyl phosphate. The gel revealed two bands with phosphatase activity in the ovary and one band in the haemolymph; these bands were excised and submitted to a 10% SDS-PAGE showing a single 70-kDa polypeptide in both samples. Histochemistry of the ovary with alpha-naphtyl phosphate for localization of acid phosphatase activity showed mainly labeling associated to the oocyte peripheral vesicles, basal lamina, and between follicle cells. Electron microscopy analysis showed that acid phosphatase was localized in small peripheral vesicles in the oocyte, but not inside yolk granules. The possible role of this phosphatase during oogenesis and embryogenesis is also discussed in this article.

  5. [Alkaline phosphatase in Amoeba proteus].

    PubMed

    Sopina, V A

    2005-01-01

    In free-living Amoeba proteus (strain B), 3 phosphatase were found after disc-electrophoresis of 10 microg of protein in PAGE and using 1-naphthyl phosphate as a substrate a pH 9.0. These phosphatases differed in their electrophoretic mobilities - "slow" (1-3 bands), "middle" (one band) and "fast" (one band). In addition to 1-naphthyl phosphate, "slow" phosphatases were able to hydrolyse 2-naphthyl phosphate and p-nitrophenyl phosphate. They were slightly activated by Mg2+, completely inhibited by 3 chelators (EDTA, EGTA and 1,10-phenanthroline), L-cysteine, sodium dodecyl sulfate and Fe2+, Zn2+ and Mn2+ (50 mM), considerably inactivated by orthovanadate, molybdate, phosphatase inhibitor cocktail 1, p-nitrophenyl phosphate, Na2HPO4, DL-dithiothreitol and urea and partly inhibited by H2O2, DL-phenylalanine, 2-mercaptoethanol, phosphatase inhibitor cocktail 2 and Ca2+. Imidazole, L-(+)-tartrate, okadaic acid, NaF and sulfhydryl reagents -p-(hydroxy-mercuri)benzoate and N-ethylmaleimide - had no influence on the activity of "slow" phosphatases. "Middle" and "fast" phosphatases, in contrast to "slow" ones, were not inactivated by 3 chelators. The "middle" phosphatase differed from the "fast" one by smaller resistance to urea, Ca2+, Mn2+, phosphates and H2O2 and greater resistance to dithiothreitol and L-(+)-tartrate. In addition, the "fast" phosphatase was inhibited by L-cysteine but the "middle" one was activated by it. Of 5 tested ions (Mg2+, Cu2+, Mn2+, Ca2+ and Zn2+), only Zn2+ reactivated "slow" phosphatases after their inactivation by EDTA treatment. The reactivation of apoenzyme was only partial (about 35 %). Thus, among phosphatases found in amoebae at pH 9.0, only "slow" ones are Zn-metalloenzymes and may be considered as alkaline phosphatases (EC 3.1.3.1). It still remains uncertain, to which particular phosphatase class "middle" and "fast" phosphatases (pH 9.0) may belong.

  6. Soybean root nodule acid phosphatase.

    PubMed Central

    Penheiter, A R; Duff, S M; Sarath, G

    1997-01-01

    Acid phosphatases are ubiquitous enzymes that exhibit activity against a variety of substrates in vitro, although little is known about their intracellular function. In this study, we report the isolation, characterization, and partial sequence of the major acid phosphatase from soybean (Glycine max L.) root nodules. The phosphatase was purified predominantly as a heterodimer with subunits of 28 and 31 kD; homodimers of both subunits were also observed and exhibited phosphatase activity. In addition to the general phosphatase substrate, p-nitrophenyl phosphate, the heterodimeric form of the enzyme readily hydrolyzed 5'-nucleotides, flavin mononucleotide, and O-phospho-L-Tyr. Low or negligible activity was observed with ATP or polyphosphate. Purified nodule acid phosphatase was stimulated by magnesium, inhibited by calcium and EDTA, and competitively inhibited by cGMP and cAMP with apparent Ki values of 7 and 12 microM, respectively. Partial N-terminal and internal sequencing of the nodule acid phosphatase revealed homology to the soybean vegetative storage proteins. There was a 17-fold increase in enzyme activity and a noticeable increase in protein levels detected by immunoblotting methods during nodule development. Both of these parameters were low in young nodules and reached a peak in mature, functional nodules, suggesting that this enzyme is important for efficient nodule metabolism. PMID:9193092

  7. Characteristics of plasmalemma alkaline phosphatase of rat mesenteric artery.

    PubMed

    Kwan, C Y

    1983-01-01

    General characteristics of alkaline phosphatase activity of the plasma membrane-enriched fraction isolated from rat mesenteric arteries were investigated. The vascular smooth muscle plasmalemma alkaline phosphatase is a metalloenzyme which is strongly inhibited by chelating agents and this inhibition can be completely overcome by addition of Mg2+ or Ca2+. Zn2+ only partially reactivates the enzyme in the presence of low concentrations of EDTA. The enzymatic hydrolysis of p-nitrophenyl phosphate, beta-glycerophosphate, alpha-glycerophosphate, or 3'-adenosine monophosphate showed an optimal activity in the alkaline region between pH 9 and 11. The alkaline phosphatase activity is distinctly different from the plasmalemma ATPase and 5'-nucleotidase activities with respect to their pH dependence, influence by added divalent metal ions and stability against heat inactivation. Vanadate ion, being structurally similar to the transition state analog of the phosphoryl group, potently inhibits alkaline phosphatase with an apparent Ki of 1.5 microM. The altered alkaline phosphatase activity of vascular smooth muscle in relation to its possible physiological function and pathophysiological manifestation associated with hypertensive disease are discussed.

  8. Structural Genomics of Protein Phosphatases

    SciTech Connect

    Almo,S.; Bonanno, J.; Sauder, J.; Emtage, S.; Dilorenzo, T.; Malashkevich, V.; Wasserman, S.; Swaminathan, S.; Eswaramoorthy, S.; et al

    2007-01-01

    The New York SGX Research Center for Structural Genomics (NYSGXRC) of the NIGMS Protein Structure Initiative (PSI) has applied its high-throughput X-ray crystallographic structure determination platform to systematic studies of all human protein phosphatases and protein phosphatases from biomedically-relevant pathogens. To date, the NYSGXRC has determined structures of 21 distinct protein phosphatases: 14 from human, 2 from mouse, 2 from the pathogen Toxoplasma gondii, 1 from Trypanosoma brucei, the parasite responsible for African sleeping sickness, and 2 from the principal mosquito vector of malaria in Africa, Anopheles gambiae. These structures provide insights into both normal and pathophysiologic processes, including transcriptional regulation, regulation of major signaling pathways, neural development, and type 1 diabetes. In conjunction with the contributions of other international structural genomics consortia, these efforts promise to provide an unprecedented database and materials repository for structure-guided experimental and computational discovery of inhibitors for all classes of protein phosphatases.

  9. Structural Basis of Response Regulator Dephosphorylation by Rap Phosphatases

    SciTech Connect

    V Parashar; N Mirouze; D Dubnau; M Neiditch

    2011-12-31

    Bacterial Rap family proteins have been most extensively studied in Bacillus subtilis, where they regulate activities including sporulation, genetic competence, antibiotic expression, and the movement of the ICEBs1 transposon. One subset of Rap proteins consists of phosphatases that control B. subtilis and B. anthracis sporulation by dephosphorylating the response regulator Spo0F. The mechanistic basis of Rap phosphatase activity was unknown. Here we present the RapH-Spo0F X-ray crystal structure, which shows that Rap proteins consist of a 3-helix bundle and a tetratricopeptide repeat domain. Extensive biochemical and genetic functional studies reveal the importance of the observed RapH-Spo0F interactions, including the catalytic role of a glutamine in the RapH 3-helix bundle that inserts into the Spo0F active site. We show that in addition to dephosphorylating Spo0F, RapH can antagonize sporulation by sterically blocking phosphoryl transfer to and from Spo0F. Our structure-function analysis of the RapH-Spo0F interaction identified Rap protein residues critical for Spo0F phosphatase activity. This information enabled us to assign Spo0F phosphatase activity to a Rap protein based on sequence alone, which was not previously possible. Finally, as the ultimate test of our newfound understanding of the structural requirements for Rap phosphatase function, a non-phosphatase Rap protein that inhibits the binding of the response regulator ComA to DNA was rationally engineered to dephosphorylate Spo0F. In addition to revealing the mechanistic basis of response regulator dephosphorylation by Rap proteins, our studies support the previously proposed T-loop-Y allostery model of receiver domain regulation that restricts the aromatic 'switch' residue to an internal position when the {beta}4-{alpha}4 loop adopts an active-site proximal conformation.

  10. Signalling functions of alpha-tocopherol in smooth muscle cells.

    PubMed

    Azzi, A; Boscoboinik, D; Clément, S; Ozer, N K; Ricciarelli, R; Stocker, A; Tasinato, A; Sirikçi, O

    1997-01-01

    alpha-Tocopherol but not beta-tocopherol, activates protein phosphatase 2A, decreases protein kinase C activity and attenuates smooth muscle cell proliferation at physiological concentrations. beta-Tocopherol prevents the effects of alpha-tocopherol. Inhibition of protein kinase C alpha, but not of the other isoforms, by the inhibitor Gö6976 prevents the effect of alpha-tocopherol. Protein kinase C alpha, immunoprecipitated from alpha-tocopherol treated cells, is less phosphorylated and inactive. It is proposed that the specific activation of protein phosphatase 2A by alpha-tocopherol results in dephosphorylation and inactivation of protein kinase C alpha. Finally, this cascade of events leads to smooth muscle cell proliferation inhibition.

  11. Dephosphorylation of bovine casein by milk alkaline phosphatase.

    PubMed

    Lorient, D; Linden, G

    1976-02-01

    The pH of optimum activity of alkaline phosphatase from cow's milk depended on the substrate, being 10-1 for rho-nitrophenylphosphate, 8-6 for phosphoserine, 8-0 for phosvitin and 6-8 for casein. Individual casein components were dephosphorylated more rapidly than mixtures of alphas- and beta-caseins or of alphas-, beta-and kappa-caseins and micellar casein. Mixtures of 2 components involving kappa-casein were more readily dephosphorylated than alphas- and beta-casein mixtures. At pH 6-8, lactose, whey proteins and phosphate ions had an inhibitory effect. beta-Lactoglobulin had an inhibitory effect only when the pH of the reaction was lower than the optimum pH value of the enzyme. Mg2+ and Zn2+ were not inhibitory. The optimum conditions for dephosphorylation of casein are described.

  12. Alkaline Phosphatase in Normal Infants

    PubMed Central

    Stephen, Joan M. L.; Stephenson, Pearl

    1971-01-01

    Alkaline phosphatase was measured in plasma from children receiving vitamin D supplements in day nurseries in the London area, and from children exposed to sunlight in the West Indies. The distribution of values showed that there was no precise upper limit which could be used in the diagnosis of subclinical vitamin D deficiency. PMID:5576029

  13. [Comparative-enzymologic study of phosphatase activity of hydrobionts from Pacific Ocean].

    PubMed

    Rozengart, E V; Basova, N E

    2009-01-01

    Activities of acid phosphatase are studied with use as substrates of phenyl phosphate, alpha- and beta-glycerophosphates in various organs and tissues of a large group of industrial hydrobionts of the Pacific basin (12 fish species, 7 invertebrate species. and one mammalian species) and of alkaline phosphatase in various organs of the Commander (Berryteuthis magister) and the New Zealand (Nototodarus sloani sloani) squids. Intertissue and interspecies differences have been revealed in the substrate and inhibitory specificity of the studied enzyme preparations. The method of isolation and a partial purification of preparations of acid phosphatase from tissue of gonads and of alkaline phosphatase from tissues of kidney and liver of individuals of industrial squid species is described.

  14. Crystal structure of lipid phosphatase Escherichia coli phosphatidylglycerophosphate phosphatase B

    PubMed Central

    Fan, Junping; Jiang, Daohua; Zhao, Yan; Liu, Jianfeng; Zhang, Xuejun Cai

    2014-01-01

    Membrane-integrated type II phosphatidic acid phosphatases (PAP2s) are important for numerous bacterial to human biological processes, including glucose transport, lipid metabolism, and signaling. Escherichia coli phosphatidylglycerol-phosphate phosphatase B (ecPgpB) catalyzes removing the terminal phosphate group from a lipid carrier, undecaprenyl pyrophosphate, and is essential for transport of many hydrophilic small molecules across the membrane. We determined the crystal structure of ecPgpB at a resolution of 3.2 Å. This structure shares a similar folding topology and a nearly identical active site with soluble PAP2 enzymes. However, the substrate binding mechanism appears to be fundamentally different from that in soluble PAP2 enzymes. In ecPgpB, the potential substrate entrance to the active site is located in a cleft formed by a V-shaped transmembrane helix pair, allowing lateral movement of the lipid substrate entering the active site from the membrane lipid bilayer. Activity assays of point mutations confirmed the importance of the catalytic residues and potential residues involved in phosphate binding. The structure also suggests an induced-fit mechanism for the substrate binding. The 3D structure of ecPgpB serves as a prototype to study eukaryotic PAP2 enzymes, including human glucose-6-phosphatase, a key enzyme in the homeostatic regulation of blood glucose concentrations. PMID:24821770

  15. Crystal structure of lipid phosphatase Escherichia coli phosphatidylglycerophosphate phosphatase B.

    PubMed

    Fan, Junping; Jiang, Daohua; Zhao, Yan; Liu, Jianfeng; Zhang, Xuejun Cai

    2014-05-27

    Membrane-integrated type II phosphatidic acid phosphatases (PAP2s) are important for numerous bacterial to human biological processes, including glucose transport, lipid metabolism, and signaling. Escherichia coli phosphatidylglycerol-phosphate phosphatase B (ecPgpB) catalyzes removing the terminal phosphate group from a lipid carrier, undecaprenyl pyrophosphate, and is essential for transport of many hydrophilic small molecules across the membrane. We determined the crystal structure of ecPgpB at a resolution of 3.2 Å. This structure shares a similar folding topology and a nearly identical active site with soluble PAP2 enzymes. However, the substrate binding mechanism appears to be fundamentally different from that in soluble PAP2 enzymes. In ecPgpB, the potential substrate entrance to the active site is located in a cleft formed by a V-shaped transmembrane helix pair, allowing lateral movement of the lipid substrate entering the active site from the membrane lipid bilayer. Activity assays of point mutations confirmed the importance of the catalytic residues and potential residues involved in phosphate binding. The structure also suggests an induced-fit mechanism for the substrate binding. The 3D structure of ecPgpB serves as a prototype to study eukaryotic PAP2 enzymes, including human glucose-6-phosphatase, a key enzyme in the homeostatic regulation of blood glucose concentrations.

  16. Protein tyrosine phosphatase: enzymatic assays.

    PubMed

    Montalibet, Jacqueline; Skorey, Kathryn I; Kennedy, Brian P

    2005-01-01

    Activity assays for tyrosine phosphatases are based on the hydrolysis of a arylphosphate moiety from a synthetic substrate yielding a spectroscopically active product. Many different substrates can be used for these assays with p-nitrophenyl phosphate (pNPP), fluorescein diphosphate (FDP), and 6,8-difluoro-4-methylumbellyferyl phosphate (DiFMUP) being the most efficient and versatile. Equally, larger molecules such as phosphotyrosyl peptides can also be used to mimic more natural substrates. Activity assays include the determinations of the rate of dephosphorylation and calculations of kinetic constants such as k(cat) and K(M). These assays are useful to identify and characterize tyrosine phosphatases and are commonly used to evaluate the efficiency of inhibitors.

  17. Alkaline phosphatase of Physarum polycephalum is insoluble.

    PubMed

    Furuhashi, Kiyoshi

    2008-02-01

    The plasmodia of Physarum polycephalum grow as multinucleated cells in the presence of sufficient humidity and nutriment. Under non-illuminating conditions, stresses such as low temperature or high concentrations of salts transform the plasmodia into spherules whereas dehydration induces sclerotization. Some phosphatases including protein phosphatase and acid phosphatase have been purified from the plasmodia, but alkaline phosphatase remains to be elucidated. Phosphatase of the plasmodia, spherules and sclerotia was visualized by electrophoresis gel-staining assay using 5-bromo-4-chloro-3-indolyl phosphate. Insoluble fractions of the sclerotia were abundant in phosphatase activity. The phosphatase which was extracted by nonionic detergent was subjected to column chromatography and preparative electrophoresis. Purified phosphatase showed the highest activity at pH 8.8, indicating that this enzyme belongs to alkaline phosphatase. The apparent molecular mass from sodium dodecyl sulfate-polyacrylamide gel electrophoresis under non-reducing condition was estimated to be 100 kDa whereas that under reducing was 105 kDa. An amount of 1% sodium dodecyl sulfate or 0.5 M NaCl had no effects on the activity although the phosphatase showed heat instability, Mg(2+)-dependency and sensitivity to 2-glycerophosphate or NaF. The extracting conditions and enzymatic properties suggest that this alkaline phosphatase which is in a membrane-bound form plays important roles in phosphate metabolism.

  18. Protein Phosphatase 2A Signaling in Human Prostate Cancer

    DTIC Science & Technology

    2011-06-01

    been shown to be involved in androgen-independent growth of human prostate cancer cells (Carson et al., 1999; Grethe and Porn -Ares, 2006; Murillo et... Porn -Ares MI. (2006). p38 MAPK regulates phosphorylation of Bad via PP2A- dependent suppression of the MEK1/2-ERK1/2 survival pathway in TNF-alpha...threonine phosphatases implicated in cell growth and sig- nalling. Biochem J 2001;353:417–39. 15. Grethe S, Porn -Ares MI. p38 MAPK regulates

  19. The glucose-6-phosphatase system.

    PubMed Central

    van Schaftingen, Emile; Gerin, Isabelle

    2002-01-01

    Glucose-6-phosphatase (G6Pase), an enzyme found mainly in the liver and the kidneys, plays the important role of providing glucose during starvation. Unlike most phosphatases acting on water-soluble compounds, it is a membrane-bound enzyme, being associated with the endoplasmic reticulum. In 1975, W. Arion and co-workers proposed a model according to which G6Pase was thought to be a rather unspecific phosphatase, with its catalytic site oriented towards the lumen of the endoplasmic reticulum [Arion, Wallin, Lange and Ballas (1975) Mol. Cell. Biochem. 6, 75--83]. Substrate would be provided to this enzyme by a translocase that is specific for glucose 6-phosphate, thereby accounting for the specificity of the phosphatase for glucose 6-phosphate in intact microsomes. Distinct transporters would allow inorganic phosphate and glucose to leave the vesicles. At variance with this substrate-transport model, other models propose that conformational changes play an important role in the properties of G6Pase. The last 10 years have witnessed important progress in our knowledge of the glucose 6-phosphate hydrolysis system. The genes encoding G6Pase and the glucose 6-phosphate translocase have been cloned and shown to be mutated in glycogen storage disease type Ia and type Ib respectively. The gene encoding a G6Pase-related protein, expressed specifically in pancreatic islets, has also been cloned. Specific potent inhibitors of G6Pase and of the glucose 6-phosphate translocase have been synthesized or isolated from micro-organisms. These as well as other findings support the model initially proposed by Arion. Much progress has also been made with regard to the regulation of the expression of G6Pase by insulin, glucocorticoids, cAMP and glucose. PMID:11879177

  20. Inositol polyphosphate phosphatases in human disease.

    PubMed

    Hakim, Sandra; Bertucci, Micka C; Conduit, Sarah E; Vuong, David L; Mitchell, Christina A

    2012-01-01

    Phosphoinositide signalling molecules interact with a plethora of effector proteins to regulate cell proliferation and survival, vesicular trafficking, metabolism, actin dynamics and many other cellular functions. The generation of specific phosphoinositide species is achieved by the activity of phosphoinositide kinases and phosphatases, which phosphorylate and dephosphorylate, respectively, the inositol headgroup of phosphoinositide molecules. The phosphoinositide phosphatases can be classified as 3-, 4- and 5-phosphatases based on their specificity for dephosphorylating phosphates from specific positions on the inositol head group. The SAC phosphatases show less specificity for the position of the phosphate on the inositol ring. The phosphoinositide phosphatases regulate PI3K/Akt signalling, insulin signalling, endocytosis, vesicle trafficking, cell migration, proliferation and apoptosis. Mouse knockout models of several of the phosphoinositide phosphatases have revealed significant physiological roles for these enzymes, including the regulation of embryonic development, fertility, neurological function, the immune system and insulin sensitivity. Importantly, several phosphoinositide phosphatases have been directly associated with a range of human diseases. Genetic mutations in the 5-phosphatase INPP5E are causative of the ciliopathy syndromes Joubert and MORM, and mutations in the 5-phosphatase OCRL result in Lowe's syndrome and Dent 2 disease. Additionally, polymorphisms in the 5-phosphatase SHIP2 confer diabetes susceptibility in specific populations, whereas reduced protein expression of SHIP1 is reported in several human leukaemias. The 4-phosphatase, INPP4B, has recently been identified as a tumour suppressor in human breast and prostate cancer. Mutations in one SAC phosphatase, SAC3/FIG4, results in the degenerative neuropathy, Charcot-Marie-Tooth disease. Indeed, an understanding of the precise functions of phosphoinositide phosphatases is not only

  1. Characterization of the human LPIN1-encoded phosphatidate phosphatase isoforms.

    PubMed

    Han, Gil-Soo; Carman, George M

    2010-05-07

    The human LPIN1 gene encodes the protein lipin 1, which possesses phosphatidate (PA) phosphatase (3-sn-phosphatidate phosphohydrolase; EC 3.1.3.4) activity (Han, G.-S., Wu, W.-I., and Carman, G. M. (2006) J. Biol. Chem. 281, 9210-9218). In this work, we characterized human lipin 1 alpha, beta, and gamma isoforms that were expressed in Escherichia coli and purified to near homogeneity. PA phosphatase activities of the alpha, beta, and gamma isoforms were dependent on Mg(2+) or Mn(2+) ions at pH 7.5 at 37 degrees C. The activities were inhibited by concentrations of Mg(2+) and Mn(2+) above their optimums and by Ca(2+), Zn(2+), N-ethylmaleimide, propranolol, and the sphingoid bases sphingosine and sphinganine. The activities were thermally labile at temperatures above 40 degrees C. The alpha, beta, and gamma activities followed saturation kinetics with respect to the molar concentration of PA (K(m) values of 0.35, 0.24, and 0.11 mm, respectively) but followed positive cooperative (Hill number approximately 2) kinetics with respect to the surface concentration of PA (K(m) values of 4.2, 4.5, and 4.3 mol %, respectively) in Triton X-100/PA-mixed micelles. The turnover numbers (k(cat)) for the alpha, beta, and gamma isoforms were 68.8 + or - 3.5, 42.8 + or - 2.5, and 5.7 + or - 0.2 s(-1), respectively, whereas their energy of activation values were 14.2, 15.5, and 18.5 kcal/mol, respectively. The isoform activities were dependent on PA as a substrate and required at least one unsaturated fatty acyl moiety for maximum activity.

  2. [Protein phosphatases: structure and function].

    PubMed

    Bulanova, E G; Budagian, V M

    1994-01-01

    The process of protein and enzyme systems phosphorylation is necessary for cell growth, differentiation and preparation for division and mitosis. The conformation changes of protein as a result of phosphorylation lead to increased enzyme activity and enhanced affinity to substrates. A large group of enzymes--protein kinases--is responsible for phosphorylation process in cell, which are divided into tyrosine- and serine-threonine-kinases depending on their ability to phosphorylate appropriate amino acid residues. In this review has been considered the functional importance and structure of protein phosphatases--enzymes, which are functional antagonists of protein kinases.

  3. Phosphatidylinositolphosphate phosphatase activities and cancer

    PubMed Central

    Rudge, Simon A.; Wakelam, Michael J. O.

    2016-01-01

    Signaling through the phosphoinositide 3-kinase pathways mediates the actions of a plethora of hormones, growth factors, cytokines, and neurotransmitters upon their target cells following receptor occupation. Overactivation of these pathways has been implicated in a number of pathologies, in particular a range of malignancies. The tight regulation of signaling pathways necessitates the involvement of both stimulatory and terminating enzymes; inappropriate activation of a pathway can thus result from activation or inhibition of the two signaling arms. The focus of this review is to discuss, in detail, the activities of the identified families of phosphoinositide phosphatase expressed in humans, and how they regulate the levels of phosphoinositides implicated in promoting malignancy. PMID:26302980

  4. Electrophoretic separation of alkaline and acid phosphatase isoenzymes from the pulp of monkey teeth.

    PubMed

    Franzén, A; Hasselgren, G

    1978-01-01

    Monkey pulps were homogenized in a Triton tris solution. After three centrifugation steps (800, 20000, and 105000 g) the supernatant was applied on acryl amide columns at pH 7.5 in a tris-diethyl barbituric acid buffer. Electrophoresis was performed at a constant current of 2.5 mA per gel column at 18--20 degrees C. Incubations for alkaline phosphatase (E.C. 3.1.3.1) were carried out at pH 8.3 using naphthol-AS-MX-phosphate as substrate and Fast Red Violet LB salt as coupler. Incubations for acid phosphatase (E.C. 3.1.3.2) were undertaken at pH 5.0 using alpha-naphtyl phosphate as substrate and hexazotized pararosanilin as coupling agent. After the incubations for alkaline phosphatase as well as acid phosphatase two bands showing enzyme activity were demonstrated. By means of treatment with heat (56 degrees C) prior to incubation or addition of vanadate or pyrophosphate to the incubation medium it was shown that the main part of the fast moving alkaline phosphatase band was sensitive to these procedures. The alkaline phosphatase of the slow moving band appeared to be resistant to heat or the addition of inhibitors.

  5. Purification of the Major Soybean Leaf Acid Phosphatase That Is Increased by Seed-Pod Removal.

    PubMed Central

    Staswick, P. E.; Papa, C.; Huang, J. F.; Rhee, Y.

    1994-01-01

    Fruit removal for 5 weeks after flowering increased acid phosphatase activity 10-fold in soybean (Glycine max L. Merr. Var Hobbit) leaves compared with normal seed-pod-bearing plants. The major acid phosphatase activity in leaves was purified over 2700-fold, yielding a single polypeptide of 51 kD with a specific activity of 1353 units/mg protein using p-nitrophenylphosphate as the substrate. Isoelectric focusing demonstrated that the purified protein co-migrated with a majority of the activity that increased in leaves following seed-pod removal. Immunoblot analysis demonstrated that at least part of the increased activity was due to an increased abundance of the phosphatase protein. In situ enzyme activity staining localized most of the total phosphatase activity to vascular tissues, the leaf paraveinal mesophyll cell layer, and the lower epidermis. This distribution and the response to seed-pod removal paralleled previous results for soybean vegetative storage protein (VSP) [alpha] and [beta]. However, in a native polyacrylamide gel the VSP detected by immunological staining of electrophoretically transferred protein did not migrate with the majority of the phosphatase activity. Fractionation of crude leaf protein on concanavalin A-Sepharose yielded a fraction containing 97% of the total VSP but only 0.1% of the total acid phosphatase activity. PMID:12232060

  6. Biochemistry and structure of phosphoinositide phosphatases.

    PubMed

    Kim, Young Jun; Jahan, Nusrat; Bahk, Young Yil

    2013-01-01

    Phosphoinositides are the phosphorylated derivatives of phosphatidylinositol, and play a very significant role in a diverse range of signaling processes in eukaryotic cells. A number of phosphoinositide-metabolizing enzymes, including phosphoinositide-kinases and phosphatases are involved in the synthesis and degradation of these phospholipids. Recently, the function of various phosphatases in the phosphatidylinositol signaling pathway has been of great interest. In the present review we summarize the structural insights and biochemistry of various phosphatases in regulating phosphoinositide metabolism.

  7. Insulin-receptor phosphotyrosyl-protein phosphatases.

    PubMed Central

    King, M J; Sale, G J

    1988-01-01

    Calmodulin-dependent protein phosphatase has been proposed to be an important phosphotyrosyl-protein phosphatase. The ability of the enzyme to attack autophosphorylated insulin receptor was examined and compared with the known ability of the enzyme to act on autophosphorylated epidermal-growth-factor (EGF) receptor. Purified calmodulin-dependent protein phosphatase was shown to catalyse the complete dephosphorylation of phosphotyrosyl-(insulin receptor). When compared at similar concentrations, 32P-labelled EGF receptor was dephosphorylated at greater than 3 times the rate of 32P-labelled insulin receptor; both dephosphorylations exhibited similar dependence on metal ions and calmodulin. Native phosphotyrosyl-protein phosphatases in cell extracts were also characterized. With rat liver, heart or brain, most (75%) of the native phosphatase activity against both 32P-labelled insulin and EGF receptors was recovered in the particulate fraction of the cell, with only 25% in the soluble fraction. This subcellular distribution contrasts with results of previous studies using artificial substrates, which found most of the phosphotyrosyl-protein phosphatase activity in the soluble fraction of the cell. Properties of particulate and soluble phosphatase activity against 32P-labelled insulin and EGF receptors are reported. The contribution of calmodulin-dependent protein phosphatase activity to phosphotyrosyl-protein phosphatase activity in cell fractions was determined by utilizing the unique metal-ion dependence of calmodulin-dependent protein phosphatase. Whereas Ni2+ (1 mM) markedly activated the calmodulin-dependent protein phosphatase, it was found to inhibit potently both particulate and soluble phosphotyrosyl-protein phosphatase activity. In fractions from rat liver, brain and heart, total phosphotyrosyl-protein phosphatase activity against both 32P-labelled receptors was inhibited by 99.5 +/- 6% (mean +/- S.E.M., 30 observations) by Ni2+. Results of Ni2+ inhibition

  8. Protein phosphatases and Alzheimer's disease.

    PubMed

    Braithwaite, Steven P; Stock, Jeffry B; Lombroso, Paul J; Nairn, Angus C

    2012-01-01

    Alzheimer's Disease (AD) is characterized by progressive loss of cognitive function, linked to marked neuronal loss. Pathological hallmarks of the disease are the accumulation of the amyloid-β (Aβ) peptide in the form of amyloid plaques and the intracellular formation of neurofibrillary tangles (NFTs). Accumulating evidence supports a key role for protein phosphorylation in both the normal and pathological actions of Aβ as well as the formation of NFTs. NFTs contain hyperphosphorylated forms of the microtubule-binding protein tau, and phosphorylation of tau by several different kinases leads to its aggregation. The protein kinases involved in the generation and/or actions of tau or Aβ are viable drug targets to prevent or alleviate AD pathology. However, it has also been recognized that the protein phosphatases that reverse the actions of these protein kinases are equally important. Here, we review recent advances in our understanding of serine/threonine and tyrosine protein phosphatases in the pathology of AD. Copyright © 2012 Elsevier Inc. All rights reserved.

  9. alpha-Tocopherol specifically inactivates cellular protein kinase C alpha by changing its phosphorylation state.

    PubMed Central

    Ricciarelli, R; Tasinato, A; Clément, S; Ozer, N K; Boscoboinik, D; Azzi, A

    1998-01-01

    The mechanism of protein kinase C (PKC) regulation by alpha-tocopherol has been investigated in smooth-muscle cells. Treatment of rat aortic A7r5 smooth-muscle cells with alpha-tocopherol resulted in a time- and dose-dependent inhibition of PKC. The inhibition was not related to a direct interaction of alpha-tocopherol with the enzyme nor with a diminution of its expression. Western analysis demonstrated the presence of PKCalpha, beta, delta, epsilon, zeta and micro isoforms in these cells. Autophosphorylation and kinase activities of the different isoforms have shown that only PKCalpha was inhibited by alpha-tocopherol. The inhibitory effects were not mimicked by beta-tocopherol, an analogue of alpha-tocopherol with similar antioxidant properties. The inhibition of PKCalpha by alpha-tocopherol has been found to be associated with its dephosphorylation. Moreover the finding of an activation of protein phosphatase type 2A in vitro by alpha-tocopherol suggests that this enzyme might be responsible for the observed dephosphorylation and subsequent deactivation of PKCalpha. It is therefore proposed that PKCalpha inhibition by alpha-tocopherol is linked to the activation of a protein phosphatase, which in turn dephosphorylates PKCalpha and inhibits its activity. PMID:9693126

  10. alpha-Tocopherol specifically inactivates cellular protein kinase C alpha by changing its phosphorylation state.

    PubMed

    Ricciarelli, R; Tasinato, A; Clément, S; Ozer, N K; Boscoboinik, D; Azzi, A

    1998-08-15

    The mechanism of protein kinase C (PKC) regulation by alpha-tocopherol has been investigated in smooth-muscle cells. Treatment of rat aortic A7r5 smooth-muscle cells with alpha-tocopherol resulted in a time- and dose-dependent inhibition of PKC. The inhibition was not related to a direct interaction of alpha-tocopherol with the enzyme nor with a diminution of its expression. Western analysis demonstrated the presence of PKCalpha, beta, delta, epsilon, zeta and micro isoforms in these cells. Autophosphorylation and kinase activities of the different isoforms have shown that only PKCalpha was inhibited by alpha-tocopherol. The inhibitory effects were not mimicked by beta-tocopherol, an analogue of alpha-tocopherol with similar antioxidant properties. The inhibition of PKCalpha by alpha-tocopherol has been found to be associated with its dephosphorylation. Moreover the finding of an activation of protein phosphatase type 2A in vitro by alpha-tocopherol suggests that this enzyme might be responsible for the observed dephosphorylation and subsequent deactivation of PKCalpha. It is therefore proposed that PKCalpha inhibition by alpha-tocopherol is linked to the activation of a protein phosphatase, which in turn dephosphorylates PKCalpha and inhibits its activity.

  11. Pediatric reference intervals for alkaline phosphatase.

    PubMed

    Zierk, Jakob; Arzideh, Farhad; Haeckel, Rainer; Cario, Holger; Frühwald, Michael C; Groß, Hans-Jürgen; Gscheidmeier, Thomas; Hoffmann, Reinhard; Krebs, Alexander; Lichtinghagen, Ralf; Neumann, Michael; Ruf, Hans-Georg; Steigerwald, Udo; Streichert, Thomas; Rascher, Wolfgang; Metzler, Markus; Rauh, Manfred

    2017-01-01

    Interpretation of alkaline phosphatase activity in children is challenging due to extensive changes with growth and puberty leading to distinct sex- and age-specific dynamics. Continuous percentile charts from birth to adulthood allow accurate consideration of these dynamics and seem reasonable for an analyte as closely linked to growth as alkaline phosphatase. However, the ethical and practical challenges unique to pediatric reference intervals have restricted the creation of such percentile charts, resulting in limitations when clinical decisions are based on alkaline phosphatase activity. We applied an indirect method to generate percentile charts for alkaline phosphatase activity using clinical laboratory data collected during the clinical care of patients. A total of 361,405 samples from 124,440 patients from six German tertiary care centers and one German laboratory service provider measured between January 2004 and June 2015 were analyzed. Measurement of alkaline phosphatase activity was performed on Roche Cobas analyzers using the IFCC's photometric method. We created percentile charts for alkaline phosphatase activity in girls and boys from birth to 18 years which can be used as reference intervals. Additionally, data tables of age- and sex-specific percentile values allow the incorporation of these results into laboratory information systems. The percentile charts provided enable the appropriate differential diagnosis of changes in alkaline phosphatase activity due to disease and changes due to physiological development. After local validation, integration of the provided percentile charts into result reporting facilitates precise assessment of alkaline phosphatase dynamics in pediatrics.

  12. HuPho: the human phosphatase portal.

    PubMed

    Liberti, Susanna; Sacco, Francesca; Calderone, Alberto; Perfetto, Livia; Iannuccelli, Marta; Panni, Simona; Santonico, Elena; Palma, Anita; Nardozza, Aurelio P; Castagnoli, Luisa; Cesareni, Gianni

    2013-01-01

    Phosphatases and kinases contribute to the regulation of protein phosphorylation homeostasis in the cell. Phosphorylation is a key post-translational modification underlying the regulation of many cellular processes. Thus, a comprehensive picture of phosphatase function and the identification of their target substrates would aid a systematic approach to a mechanistic description of cell signalling. Here we present a website designed to facilitate the retrieval of information about human protein phosphatases. To this end we developed a search engine to recover and integrate information annotated in several publicly available web resources. In addition we present a text-mining-assisted annotation effort aimed at extracting phosphatase related data reported in the scientific literature. The HuPho (human phosphatases) website can be accessed at http://hupho.uniroma2.it.

  13. Identification of a novel PP2C-type mitochondrial phosphatase.

    PubMed

    Joshi, Mandar; Jeoung, Nam Ho; Popov, Kirill M; Harris, Robert A

    2007-04-27

    A novel phosphatase has been cloned and partially characterized. It has a mitochondrial leader sequence and its amino acid sequence places it in the PP2C family like two known mitochondrial phosphatases. Western blot analysis of subcellular fractions and confocal microscopy of 3T3L1 preadipocytes expressing the GFP-tagged protein confirm its mitochondrial localization. Western blot analysis indicates that the protein is expressed in several mouse tissues, with highest expression in brain, heart, liver, and kidney. The recombinant protein exhibits Mn(2+)-dependent phosphoserine phosphatase activity against the branched-chain alpha-keto acid dehydrogenase complex, suggesting the enzyme may play a role in regulation of branched chain amino acid catabolism. Whether there are other mitochondrial substrates for the enzyme is not known.

  14. Leishmania mexicana: promastigotes and amastigotes secrete protein phosphatases and this correlates with the production of inflammatory cytokines in macrophages.

    PubMed

    Escalona-Montaño, A R; Ortiz-Lozano, D M; Rojas-Bernabé, A; Wilkins-Rodriguez, A A; Torres-Guerrero, H; Mondragón-Flores, R; Mondragón-Gonzalez, R; Becker, I; Gutiérrez-Kobeh, L; Aguirre-Garcia, M M

    2016-09-01

    Phosphatase activity of Leishmania spp. has been shown to deregulate the signalling pathways of the host cell. We here show that Leishmania mexicana promastigotes and amastigotes secrete proteins with phosphatase activity to the culture medium, which was higher in the Promastigote Secretion Medium (PSM) as compared with the Amastigote Secretion Medium (ASM) and was not due to cell lysis, since parasite viability was not affected by the secretion process. The biochemical characterization showed that the phosphatase activity present in PSM was higher in dephosphorylating the peptide END (pY) INASL as compared with the peptide RRA (pT)VA. In contrast, the phosphatase activity in ASM showed little dephosphorylating capacity for both peptides. Inhibition assays demonstrated that the phosphatase activity of both PSM and ASM was sensible only to protein tyrosine phosphatases inhibitors. An antibody against a protein phosphatase 2C (PP2C) of Leishmania major cross-reacted with a 44·9 kDa molecule in different cellular fractions of L. mexicana promastigotes and amastigotes, however, in PSM and ASM, the antibody recognized a protein about 70 kDa. By electron microscopy, the PP2C was localized in the flagellar pocket of amastigotes. PSM and ASM induced the production of tumor necrosis factor alpha, IL-1β, IL-12p70 and IL-10 in human macrophages.

  15. Protein tyrosine phosphatases as potential therapeutic targets

    PubMed Central

    He, Rong-jun; Yu, Zhi-hong; Zhang, Ruo-yu; Zhang, Zhong-yin

    2014-01-01

    Protein tyrosine phosphorylation is a key regulatory process in virtually all aspects of cellular functions. Dysregulation of protein tyrosine phosphorylation is a major cause of human diseases, such as cancers, diabetes, autoimmune disorders, and neurological diseases. Indeed, protein tyrosine phosphorylation-mediated signaling events offer ample therapeutic targets, and drug discovery efforts to date have brought over two dozen kinase inhibitors to the clinic. Accordingly, protein tyrosine phosphatases (PTPs) are considered next-generation drug targets. For instance, PTP1B is a well-known targets of type 2 diabetes and obesity, and recent studies indicate that it is also a promising target for breast cancer. SHP2 is a bona-fide oncoprotein, mutations of which cause juvenile myelomonocytic leukemia, acute myeloid leukemia, and solid tumors. In addition, LYP is strongly associated with type 1 diabetes and many other autoimmune diseases. This review summarizes recent findings on several highly recognized PTP family drug targets, including PTP1B, Src homology phosphotyrosyl phosphatase 2(SHP2), lymphoid-specific tyrosine phosphatase (LYP), CD45, Fas associated phosphatase-1 (FAP-1), striatal enriched tyrosine phosphatases (STEP), mitogen-activated protein kinase/dual-specificity phosphatase 1 (MKP-1), phosphatases of regenerating liver-1 (PRL), low molecular weight PTPs (LMWPTP), and CDC25. Given that there are over 100 family members, we hope this review will serve as a road map for innovative drug discovery targeting PTPs. PMID:25220640

  16. Multisystemic functions of alkaline phosphatases.

    PubMed

    Buchet, René; Millán, José Luis; Magne, David

    2013-01-01

    Human and mouse alkaline phosphatases (AP) are encoded by a multigene family expressed ubiquitously in multiple tissues. Gene knockout (KO) findings have helped define some of the precise exocytic functions of individual isozymes in bone, teeth, the central nervous system, and in the gut. For instance, deficiency in tissue-nonspecific alkaline phosphatase (TNAP) in mice (Alpl (-/-) mice) and humans leads to hypophosphatasia (HPP), an inborn error of metabolism characterized by epileptic seizures in the most severe cases, caused by abnormal metabolism of pyridoxal-5'-phosphate (the predominant form of vitamin B6) and by hypomineralization of the skeleton and teeth featuring rickets and early loss of teeth in children or osteomalacia and dental problems in adults caused by accumulation of inorganic pyrophosphate (PPi). Enzyme replacement therapy with mineral-targeting TNAP prevented all the manifestations of HPP in mice, and clinical trials with this protein therapeutic are showing promising results in rescuing life-threatening HPP in infants. Conversely, TNAP induction in the vasculature during generalized arterial calcification of infancy (GACI), type II diabetes, obesity, and aging can cause medial vascular calcification. TNAP inhibitors, discussed extensively in this book, are in development to prevent pathological arterial calcification. The brush border enzyme intestinal alkaline phosphatase (IAP) plays an important role in fatty acid (FA) absorption, in protecting gut barrier function, and in determining the composition of the gut microbiota via its ability to dephosphorylate lipopolysaccharide (LPS). Knockout mice (Akp3 (-/-)) deficient in duodenal-specific IAP (dIAP) become obese, and develop hyperlipidemia and hepatic steatosis when fed a high-fat diet (HFD). These changes are accompanied by upregulation in the jejunal-ileal expression of the Akp6 IAP isozyme (global IAP, or gIAP) and concomitant upregulation of FAT/CD36, a phosphorylated fatty acid

  17. Dolichyl-phosphate phosphatase and dolichyl-diphosphate phosphatase in rat-liver microsomes.

    PubMed

    Belocopitow, E; Boscoboinik, D

    1982-06-15

    Dolichyl-phosphate phosphatase and dolichyl-diphosphate phosphatase activities of a liver-cell microsomal preparation were solubilized by treatment with Triton X-100. The 100,000 X g supernatant was then passed through a column of Sepharose-4B--concanavalin A. Both enzyme activities were found in the percolate. This treatment eliminated inhibition by ATP and glucose 6-phosphate in both phosphatase activities. In each case the activities were inhibited by higher concentrations of enzyme preparation due to the presence of phospholipids. The inhibitory effects of either phosphatidylcholine or phosphatidylethanolamine were due to competition for detergent. On the other hand, the effect produced by phosphatidic acid appeared to be different, since it did not change the optimal concentration of Triton X-100 for the two enzymes. Dolichyl-phosphate phosphatase was strongly inhibited by both Pi and PPi, whereas dolichyl-diphosphate phosphatase was only slightly inhibited by Pi and not at all by PPi. Dolichyl-diphosphate phosphatase was more inhibited by divalent cations than dolichyl-phosphate phosphatase. The apparent Km of dolichyl-phosphate phosphatase for dolichyl phosphate was 0.15 mM. Dolichol also inhibited dolichyl-phosphate phosphatase, but it produced a stronger inhibition on dolichyl-diphosphate phosphatase. The inhibitory effect of dolichol was not entirely due to detergent competition.

  18. Alpha Blockers

    MedlinePlus

    ... conditions such as high blood pressure and benign prostatic hyperplasia. Find out more about this class of medication. ... these conditions: High blood pressure Enlarged prostate (benign prostatic hyperplasia) Though alpha blockers are commonly used to treat ...

  19. Alpha Thalassemia

    MedlinePlus

    ... an apparently normal individual has a child with hemoglobin H disease or alpha thalassemia minor. It can ... gene on one chromosome 25% 25% 25% 25% hemoglobin H disease there is a 25% chance with ...

  20. Evolution of alkaline phosphatases in primates.

    PubMed Central

    Goldstein, D J; Rogers, C; Harris, H

    1982-01-01

    Alkaline phosphatase [orthophosphoric-monoester phosphohydrolase (alkaline optimum), EC 3.1.3.1] in placenta, intestine, liver, kidney, bone, and lung from a variety of primate species has been characterized by quantitative inhibition, thermostability, and immunological studies. Characteristic human placental-type alkaline phosphatase occurs in placentas of great apes (chimpanzee and orangutan) but not in placentas of other primates, including gibbon. It is also present in trace amounts in human lung but not in lung or other tissues of various Old and New World monkeys. However, a distinctive alkaline phosphatase resembling it occurs in substantial amounts in lungs from Old World monkeys but not New World monkeys. It appears that duplication of alkaline phosphatase genes and mutations of genetic elements controlling their tissue expression have occurred relatively recently in mammalian evolution. Images PMID:6950431

  1. Multiple Functions of the Eya Phosphotyrosine Phosphatase

    PubMed Central

    2015-01-01

    Eyes absent (Eya), a protein conserved from plants to humans and best characterized as a transcriptional coactivator, is also the prototype for a novel class of eukaryotic aspartyl protein tyrosine phosphatases. This minireview discusses recent breakthroughs in elucidating the substrates and cellular events regulated by Eya's tyrosine phosphatase function and highlights some of the complexities, new questions, and surprises that have emerged from efforts to understand how Eya's unusual multifunctionality influences developmental regulation and signaling. PMID:26667035

  2. Analysis of Smad Phosphatase Activity In Vitro.

    PubMed

    Shen, Tao; Qin, Lan; Lin, Xia

    2016-01-01

    Phosphorylation of Smad1/5/8 at the C-terminal SXS motif by BMP type I receptors is one of the most critical events in BMP signaling. Conversely, protein phosphatases that dephosphorylate phospho-Smad1/5/8 can consequently prevent or terminate BMP signaling. PPM1H is an undercharacterized phosphatase in the PPM family. We recently demonstrated that PPM1H can dephosphorylate Smad1 in the cytoplasm and block BMP signaling responses in cellular assays. Here we describe in vitro method showing that PPM1H is a bona fide phosphatase for Smad1/5/8. PPM1H is produced as GST fusion protein in E. coli, and purified against glutathione sepharose beads. Bacterially purified recombinant PPM1H possesses phosphatase activity toward artificial substrate para-nitrophenyl phosphate (pNPP). Recombinant PPM1H also dephosphorylates immuno-purified phosphorylated Smad1 in test tubes. These direct in vitro phosphatase assays provide convincing evidence demonstrating the role of PPM1H as a specific phosphatase for P-Smad1.

  3. Autophagy Signaling in Prostate Cancer: Identification of a Novel Phosphatase

    DTIC Science & Technology

    2011-08-01

    polynucleotide kinase 3’-phosphatase17 71 CACGTGAACAGGGACACGCTA CACGTGTGAGACAGCCCTGAA CGGGAAGTCCACCTTTCTCAA CAAGCTGGTGATCTTCACCAA PPAP2A phosphatidic acid ...phosphatase type 2A8 97 AACCCTGTCTGTTTACTGTAA CTGACATTGCCAAGTATTCAA CATGCTGTTTGTGGCACTTTA CCGGGCAGAGACCATGTTTGA PPAP2B phosphatidic acid phosphatase...type 2B8 98 AGCGATCGTCCCGGAGAGCAA CAGCACAATTTCAGAAGAAAT CCGGATCTATTACCTGAAGAA CCGGGCACTTGCATACTCTTA PPAP2C phosphatidic acid phosphatase type 2C8 99

  4. Assessing the biological activity of the glucan phosphatase laforin

    PubMed Central

    Romá-Mateo, Carlos; Raththagala, Madushi; Gentry, Mathew S.; Sanz, Pascual

    2017-01-01

    Summary Glucan phosphatases are a recently discovered family of enzymes that dephosphorylate either starch or glycogen and are essential for proper starch metabolism in plants and glycogen metabolism in humans. Mutations in the gene encoding the only human glucan phosphatase, laforin, result in the fatal, neurodegenerative, epilepsy known as Lafora disease. Here, we describe phosphatase assays to assess both generic laforin phosphatase activity and laforin’s unique glycogen phosphatase activity. PMID:27514803

  5. Molecular cloning and characterization of protein phosphatase 2C of vomeronasal sensory epithelium of garter snakes.

    PubMed

    Wang, Dalton; Liu, Weimin; Liu, Jinming; Chen, Ping; Quan, Wei; Halpern, Mimi

    2002-12-15

    The earthworm-derived chemoattractant ES20 interacts with its G-protein-coupled receptors on the plasma membrane of vomeronasal (VN) sensory neurons of garter snakes, resulting in an increase in inositol trisphosphate [J. Biol. Chem. 269 (1994) 16867] and a rapid phosphorylation of the membrane-bound proteins, p42/44 [Biochim. Biophys. Acta 1450 (1999) 320]. The phosphorylation of p42/44 proteins are countervailingly regulated by a protein kinase and an okadaic acid-insensitive but fluoride-sensitive protein phosphatase (PPase) [J. Liu et al. (loc. cit.)]. The phosphorylation of p42/44 induced by ES20 appears to play a role in the regulation of signal transduction pathways by modulating the GTPase activity [J. Liu et al. (loc. cit.)]. A 564-bp fragment of cDNA was obtained from VN RNA of garter snakes by reverse transcription polymerase chain reaction with degenerate primers. The 564-bp fragment was amplified, cloned, and sequenced. Northern blot analysis revealed that both the VN organ (VNO) and brain contained the gene of PPase 2C. A full-length complementary 4119-bp DNA containing an open reading frame of 1146bp that encodes a protein of 382 amino acids with a molecular mass of 49,123Da was obtained from the VN cDNA library of garter snakes. The deduced amino acid sequence showed 88% amino acid identity to bovine protein phosphatase 2C alpha and 87% identity to human and rat PP2C alpha and to Mg(2+)-dependent protein phosphatase 1A of rat and rabbit. In situ hybridization revealed that the mRNA of VN protein phosphatase 2C is expressed in the vomeronasal sensory epithelium. This is the first report of the identification of a type 2C serine/threonine protein phosphatase in the VN system.

  6. Alpha fetoprotein

    MedlinePlus

    ... the liver Liver cancer Malignant teratoma Recovery from hepatitis Problems during pregnancy Alternative Names Fetal alpha globulin; AFP Images Blood ... JL, et al, eds. Obstetrics: Normal and Problem Pregnancies . 6th ed. Philadelphia, PA: Elsevier Saunders; 2012:chap 11. Read More ... cancer - hepatocellular carcinoma Malignant teratoma of the ...

  7. Alkaline phosphatase and bone calcium parameters.

    PubMed

    Fauran-Clavel, M J; Oustrin, J

    1986-01-01

    Effects of cadmium, an alkaline phosphatase inhibitor, on the calcium content of rat bone were investigated in vivo by a radioisotopic method. Disturbance of bone metabolism is observed in both the superficial (delta) and slow exchanges (Ve), which are also significantly decreased. The crystallized calcium bone compartment (E) is also strongly affected. It appears that changes in the superficial calcium exchanges cause the observed decrease in the crystallized calcium mass. The slowing of osteogenesis is confirmed by the decrease of serum alkaline phosphatase activity. A statistical examination of the correlation coefficient reveals a close link (P less than 0.01) between serum alkaline phosphatase activity and the influx of superficial calcium (Vo+) and, as a result, the crystallized bone calcium parameters. These results show that cadmium can be used to study the relationship between alkaline phosphatase and calcification. The present observations allow us to consider the possibility that alkaline phosphatase may play a role in determining the calcium content of the crystallized phases in deep bone through its action on the tissue surface.

  8. The histidine phosphatase superfamily: structure and function.

    PubMed

    Rigden, Daniel J

    2008-01-15

    The histidine phosphatase superfamily is a large functionally diverse group of proteins. They share a conserved catalytic core centred on a histidine which becomes phosphorylated during the course of the reaction. Although the superfamily is overwhelmingly composed of phosphatases, the earliest known and arguably best-studied member is dPGM (cofactor-dependent phosphoglycerate mutase). The superfamily contains two branches sharing very limited sequence similarity: the first containing dPGM, fructose-2,6-bisphosphatase, PhoE, SixA, TIGAR [TP53 (tumour protein 53)-induced glycolysis and apoptosis regulator], Sts-1 and many other activities, and the second, smaller, branch composed mainly of acid phosphatases and phytases. Human representatives of both branches are of considerable medical interest, and various parasites contain superfamily members whose inhibition might have therapeutic value. Additionally, several phosphatases, notably the phytases, have current or potential applications in agriculture. The present review aims to draw together what is known about structure and function in the superfamily. With the benefit of an expanding set of histidine phosphatase superfamily structures, a clearer picture of the conserved elements is obtained, along with, conversely, a view of the sometimes surprising variation in substrate-binding and proton donor residues across the superfamily. This analysis should contribute to correcting a history of over- and mis-annotation in the superfamily, but also suggests that structural knowledge, from models or experimental structures, in conjunction with experimental assays, will prove vital for the future description of function in the superfamily.

  9. Acid phosphatase/phosphotransferases from enteric bacteria.

    PubMed

    Mihara, Y; Utagawa, T; Yamada, H; Asano, Y

    2001-01-01

    We have investigated the enzymatic phosphorylation of nucleosides and found that Morganella morganii phoC acid phosphatase exhibits regioselective pyrophosphate (PP(i))-nucleoside phosphotransferase activity. In this study, we isolated genes encoding an acid phosphatase with regioselective phosphotransferase activity (AP/PTase) from Providencia stuartii, Enterobacter aerogenes, Escherichia blattae and Klebsiella planticola, and compared the primary structures and enzymatic characteristics of these enzymes with those of AP/PTase (PhoC acid phosphatase) from M. morganii. The enzymes were highly homologous in primary structure with M. morganii AP/PTase, and are classified as class A1 acid phosphatases. The synthesis of inosine-5'-monophosphate (5'-IMP) by E. coli overproducing each acid phosphatase was investigated. The P. stuartii enzyme, which is most closely related to the M. morganii enzyme, exhibited high 5'-IMP productivity, similar to the M. morganii enzyme. The 5'-IMP productivities of the E. aerogenes, E. blattae and K. planticola enzymes were inferior to those of the former two enzymes. This result underlines the importance of lower K(m) values for efficient nucleotide production. As these enzymes exhibited a very high degree of homology at the amino acid sequence level, it is likely that local sequence differences in the binding pocket are responsible for the differences in the nucleoside-PP(i) phosphotransferase reaction.

  10. Structure-function analysis of the 3' phosphatase component of T4 polynucleotide kinase/phosphatase.

    PubMed

    Zhu, Hui; Smith, Paul; Wang, Li Kai; Shuman, Stewart

    2007-09-15

    T4 polynucleotide kinase/phosphatase (Pnkp) exemplifies a family of bifunctional enzymes with 5'-kinase and 3' phosphatase activities that function in nucleic acid repair. T4 Pnkp is a homotetramer of a 301-aa polypeptide, which consists of an N-terminal kinase domain of the P-loop phosphotransferase superfamily and a C-terminal phosphatase domain of the DxD acylphosphatase superfamily. The homotetramer is formed via pairs of phosphatase-phosphatase and kinase-kinase homodimer interfaces. Here we identify four side chains-Asp187, Ser211, Lys258, and Asp277-that are required for 3' phosphatase activity. Alanine mutations at these positions abolished phosphatase activity without affecting kinase function or tetramerization. Conservative substitutions of asparagine or glutamate for Asp187 did not revive the 3' phosphatase, nor did arginine or glutamine substitutions for Lys258. Threonine in lieu of Ser211 and glutamate in lieu of Asp277 restored full activity, whereas asparagine at position 277 had no salutary effect. We report a 3.0 A crystal structure of the Pnkp tetramer, in which a sulfate ion is coordinated between Arg246 and Arg279 in a position that we propose mimics one of the penultimate phosphodiesters (5'NpNpNp-3') of the polynucleotide 3'-PO(4) substrate. The amalgam of mutational and structural data engenders a plausible catalytic mechanism for the phosphatase that includes covalent catalysis (via Asp165), general acid-base catalysis (via Asp167), metal coordination (by Asp165, Asp277 and Asp278), and transition state stabilization (via Lys258, Ser211, backbone amides, and the divalent cation). Other critical side chains play architectural roles (Arg176, Asp187, Arg213, Asp254). To probe the role of oligomerization in phosphatase function, we introduced six double-alanine cluster mutations at the phosphatase-phosphatase domain interface, two of which (R297A-Q295A and E292A-D300A) converted Pnkp from a tetramer to a dimer and ablated phosphatase activity.

  11. Structure-Function Analysis of the 3' Phosphatase Component of T4 Polynucleotide Kinase/phosphatase

    SciTech Connect

    Zhu,H.; Smith, P.; Wang, L.; Shuman, S.

    2007-01-01

    T4 polynucleotide kinase/phosphatase (Pnkp) exemplifies a family of bifunctional enzymes with 5'-kinase and 3' phosphatase activities that function in nucleic acid repair. T4 Pnkp is a homotetramer of a 301-aa polypeptide, which consists of an N-terminal kinase domain of the P-loop phosphotransferase superfamily and a C-terminal phosphatase domain of the DxD acylphosphatase superfamily. The homotetramer is formed via pairs of phosphatase-phosphatase and kinase-kinase homodimer interfaces. Here we identify four side chains-Asp187, Ser211, Lys258, and Asp277-that are required for 3' phosphatase activity. Alanine mutations at these positions abolished phosphatase activity without affecting kinase function or tetramerization. Conservative substitutions of asparagine or glutamate for Asp187 did not revive the 3' phosphatase, nor did arginine or glutamine substitutions for Lys258. Threonine in lieu of Ser211 and glutamate in lieu of Asp277 restored full activity, whereas asparagine at position 277 had no salutary effect. We report a 3.0 A crystal structure of the Pnkp tetramer, in which a sulfate ion is coordinated between Arg246 and Arg279 in a position that we propose mimics one of the penultimate phosphodiesters (5'NpNpNp-3') of the polynucleotide 3'-PO(4) substrate. The amalgam of mutational and structural data engenders a plausible catalytic mechanism for the phosphatase that includes covalent catalysis (via Asp165), general acid-base catalysis (via Asp167), metal coordination (by Asp165, Asp277 and Asp278), and transition state stabilization (via Lys258, Ser211, backbone amides, and the divalent cation). Other critical side chains play architectural roles (Arg176, Asp187, Arg213, Asp254). To probe the role of oligomerization in phosphatase function, we introduced six double-alanine cluster mutations at the phosphatase-phosphatase domain interface, two of which (R297A-Q295A and E292A-D300A) converted Pnkp from a tetramer to a dimer and ablated phosphatase activity.

  12. AKAP phosphatase complexes in the heart.

    PubMed

    Redden, John M; Dodge-Kafka, Kimberly L

    2011-10-01

    Directed protein phosphorylation is indisputably critical for a multitude of cellular processes. A growing body of research demonstrates A kinase anchoring proteins (AKAPs) to mediate a significant number of phosphorylation events in the heart. By acting as molecular tethers for the regulatory subunit of protein kinase A, AKAPs focus kinase activity onto specific substrate. In the time since their discovery, the AKAP model has evolved in appreciation of the broader role these scaffolds play in coordinating multiple signaling enzymes to efficiently regulate dynamic cellular processes. The focus of this review is on the emerging role of AKAPs in regulating the 3 main cardiac phosphatases: Protein Phosphatase 1 by AKAP18 and Yotiao, and Protein Phosphatases 2A and 2B by muscle specific A-kinase anchoring protein.

  13. A specific sucrose phosphatase from plant tissues

    PubMed Central

    Hawker, J. S.; Hatch, M. D.

    1966-01-01

    1. A phosphatase that hydrolyses sucrose phosphate (phosphorylated at the 6-position of fructose) was isolated from sugar-cane stem and carrot roots. With partially purified preparations fructose 6-phosphate, glucose 6-phosphate, fructose 1-phosphate, glucose 1-phosphate and fructose 1,6-diphosphate are hydrolysed at between 0 and 2% of the rate for sucrose phosphate. 2. The activity of the enzyme is increased fourfold by the addition of Mg2+ ions and inhibited by EDTA, fluoride, inorganic phosphate, pyrophosphate, Ca2+ and Mn2+ ions. Sucrose (50mm) reduces activity by 60%. 3. The enzyme exhibits maximum activity between pH6·4 and 6·7. The Michaelis constant for sucrose phosphate is between 0·13 and 0·17mm. 4. At least some of the specific phosphatase is associated with particles having the sedimentation properties of mitochondria. 5. A similar phosphatase appears to be present in several other plant species. PMID:4290548

  14. CDC25 phosphatases as potential human oncogenes.

    PubMed

    Galaktionov, K; Lee, A K; Eckstein, J; Draetta, G; Meckler, J; Loda, M; Beach, D

    1995-09-15

    Cyclin-dependent kinases (CDKs) are activated by CDC25 phosphatases, which remove inhibitory phosphate from tyrosine and threonine residues. In human cells, CDC25 proteins are encoded by a multigene family, consisting of CDC25A, CDC25B, and CDC25C. In rodent cells, human CDC25A or CDC25B but not CDC25C phosphatases cooperate with either Ha-RASG12V or loss of RB1 in oncogenic focus formation. Such transformants were highly aneuploid, grew in soft agar, and formed high-grade tumors in nude mice. Overexpression of CDC25B was detected in 32 percent of human primary breast cancers tested. The CDC25 phosphatases may contribute to the development of human cancer.

  15. Androgen metabolism and regulation of rat ventral prostate growth and acid phosphatase during sexual maturation.

    PubMed

    Orlowski, J; Bird, C E; Clark, A F

    1988-01-01

    Androgen metabolism and the regulation of rat ventral prostate cell proliferation and secretory function were examined during sexual maturation. Changes in acid phosphatase (AP) characteristics were measured as a marker of androgen-dependent prostatic secretory function. In immature (21-day-old) rats, total AP activity per cell was low (14.2 +/- 1.3 mol p-nitrophenol phosphate hydrolysed/h per mg DNA); it increased threefold as the weight, protein and DNA contents of the prostate increased to adult (65-day) levels. This corresponded with significant (P less than 0.001) increases in the staining intensities of three of the four bands of secretory AP on isoelectric focusing gels. The extent of inhibition of AP by tartrate decreased at the same time. Secretory AP is known to be relatively tartrate-resistant. The changes in AP activity occurred after prostatic 5 alpha-dihydrotestosterone (5 alpha-DHT) levels increased from 4.6 +/- 0.7 pmol/mg DNA (21 days) to reach a peak of 17.6 +/- 2.3 pmol/mg DNA at 58 days. Prostatic 5 alpha-DHT concentrations were always higher than testosterone levels. Prostatic 5 alpha-androstane-3 alpha,17 beta-diol (3 alpha-Adiol) levels were lower than 5 alpha-DHT levels except on day 58 when levels peaked dramatically at 26.2 +/- 5.5 pmol/mg DNA. Changes in prostatic 5 alpha-DHT and 3 alpha-Adiol levels corresponded with changes in 5 alpha-reductase and 3 alpha-hydroxysteroid oxidoreductase (3 alpha-HSOR) activities. The oxidative reaction of 3 alpha-HSOR was approximately fourfold higher than the reductive reaction, indicating a preference for the formation of 5 alpha-DHT. The plasma levels of testosterone, 5 alpha-DHT and 3 alpha-Adiol cannot account for their respective prostatic levels, indicating the importance of the steroid-metabolizing enzymes in regulating intracellular androgen levels. Changes in the AP characteristics could be correlated with the androgen status of the prostate.

  16. The SIT4 protein phosphatase functions in late G1 for progression into S phase.

    PubMed Central

    Sutton, A; Immanuel, D; Arndt, K T

    1991-01-01

    Saccharomyces cerevisiae strains containing temperature-sensitive mutations in the SIT4 protein phosphatase arrest in late G1 at the nonpermissive temperature. Order-of-function analysis shows that SIT4 is required in late G1 for progression into S phase. While the levels of SIT4 do not change in the cell cycle, SIT4 associates with two high-molecular-weight phosphoproteins in a cell-cycle-dependent fashion. In addition, we have identified a polymorphic gene, SSD1, that in some versions can suppress the lethality due to a deletion of SIT4 and can also partially suppress the phenotypic defects due to a null mutation in BCY1. The SSD1 protein is implicated in G1 control and has a region of similarity to the dis3 protein of Schizosaccharomyces pombe. We have also identified a gene, PPH2alpha, that in high copy number can partially suppress the growth defect of sit4 strains. The PPH2 alpha gene encodes a predicted protein that is 80% identical to the catalytic domain of mammalian type 2A protein phosphatases but also has an acidic amino-terminal extension not present in other phosphatases. Images PMID:1848673

  17. The Glycosylphosphatidylinositol-Anchored Phosphatase from Spirodela oligorrhiza Is a Purple Acid Phosphatase1

    PubMed Central

    Nakazato, Hiroshi; Okamoto, Takashi; Nishikoori, Miwa; Washio, Kenji; Morita, Naoki; Haraguchi, Kensaku; Thompson, Guy A.; Okuyama, Hidetoshi

    1998-01-01

    We recently presented clear evidence that the major low-phosphate-inducible phosphatase of the duckweed Spirodela oligorrhiza is a glycosylphosphatidylinositol (GPI)-anchored protein, and, to our knowledge, is the first described from higher plants (N. Morita, H. Nakazato, H. Okuyama, Y. Kim, G.A. Thompson, Jr. [1996] Biochim Biophys Acta 1290: 53–62). In this report the purified 57-kD phosphatase is shown to be a purple metalloenzyme containing Fe and Mn atoms and having an absorption maximum at 556 nm. The phosphatase activity was only slightly inhibited by tartrate, as expected for a purple acid phosphatase (PAP). Furthermore, the protein cross-reacted with an anti-Arabidopsis PAP antibody on immunoblots. The N-terminal amino acid sequence of the phosphatase was very similar to those of Arabidopsis, red kidney bean (Phaseolus vulgaris), and soybean (Glycine max) PAP. Extracts of S. oligorrhiza plants incubated with the GPI-specific precursor [3H]ethanolamine were treated with antibodies raised against the purified S. oligorrhiza phosphatase. Radioactivity from the resulting immunoprecipitates was specifically associated with a 57-kD band on sodium dodecyl sulfate-polyacrylamide gels. These results, together with previous findings, strongly indicate that the GPI-anchored phosphatase of S. oligorrhiza is a PAP. PMID:9808746

  18. Dephosphorylation of alpha(s)- and beta-caseins and its effect on chaperone activity: a structural and functional investigation.

    PubMed

    Koudelka, Tomas; Hoffmann, Peter; Carver, John A

    2009-07-08

    Milk casein proteins can act as molecular chaperones: under conditions of stress, such as elevated temperature, molecular chaperones stabilize proteins from unfolding, aggregating, and precipitating. In this study, alpha(s)- and beta-caseins were dephosphorylated using alkaline phosphatase. A structural and functional investigation was undertaken to determine the effect of dephosphorylation on the chaperone activity of alpha(s)- and beta-caseins against two types of protein misfolding, i.e., amorphous aggregation and amyloid fibril assembly. The dephosphorylation of alpha(s)- and beta-caseins resulted in a decrease in the chaperone efficiency against both heat- and reduction-induced amorphously aggregating target proteins. In contrast, dephosphorylation had no effect on the chaperone activity of alpha(s)- and beta-caseins against the amyloid-forming target protein kappa-casein. Circular dichroism and fluorescence spectroscopic data indicated that the loss of negative charge associated with dephosphorylation led to an increase in ordered structure of alpha(s)- and beta-caseins. It is concluded that the flexible, dynamic, and relatively unstructured and amphiphatic nature of alpha(s)- and beta-caseins is important in their chaperone action.

  19. Triterpenoids from the leaves of Diospyros kaki (persimmon) and their inhibitory effects on protein tyrosine phosphatase 1B.

    PubMed

    Thuong, Phuong Thien; Lee, Chul Ho; Dao, Trong Tuan; Nguyen, Phi Hung; Kim, Wan Gi; Lee, Sang Jun; Oh, Won Keun

    2008-10-01

    Phytochemical study on a methanol-soluble extract of the leaves of persimmon (Diospyros kaki) resulted in the isolation of two new ursane-type triterpenoids, 3alpha,19alpha-dihydroxyurs-12,20(30)-dien-24,28-dioic acid (1) and 3alpha,19alpha-dihydroxyurs-12-en-24,28-dioic acid (2), together with 12 known ursane- and oleanane-type triterpenoids (3-14). Triterpenoids with a 3beta-hydroxy group were found to inhibit protein tyrosine phosphatase 1B (PTP1B) activity, with IC50 values ranging from 3.1+/-0.2 to 18.8+/-1.3 microM, whereas those with a 3alpha-hydroxy moiety were not active.

  20. Cloning of three human tyrosine phosphatases reveals a multigene family of receptor-linked protein-tyrosine-phosphatases expressed in brain.

    PubMed Central

    Kaplan, R; Morse, B; Huebner, K; Croce, C; Howk, R; Ravera, M; Ricca, G; Jaye, M; Schlessinger, J

    1990-01-01

    A human brainstem cDNA library in bacteriophage lambda gt11 was screened under conditions of reduced hybridization stringency with a leukocyte common antigen (LCA) probe that spanned both conserved cytoplasmic domains. cDNA encoding a receptor-linked protein-tyrosine-phosphatase (protein-tyrosine-phosphate phosphohydrolase, EC 3.1.3.48), RPTPase alpha, has been cloned and sequenced. Human RPTPase alpha consists of 802 amino acids. The extracellular domain of 150 residues includes a hydrophobic signal peptide and eight potential N-glycosylation sites. This is followed by a transmembrane region and two tandemly repeated conserved domains characteristic of all RPTPases identified thus far. The gene for RPTPase alpha has been localized to human chromosome region 20pter-20q12 by analysis of its segregation pattern in rodent-human somatic cell hybrids. Northern blot analysis revealed the presence of two major transcripts of 4.3 and 6.3 kilobases. In addition to RPTPase alpha, two other RPTPases (beta and gamma), identified in the same screen, have been partially cloned and sequenced. Analysis of sequence comparisons among LCA, the LCA-related protein LAR, and RPTPases alpha, beta, and gamma reveals the existence of a multigene family encoding different RPTPases, each containing a distinct extracellular domain, a single hydrophobic transmembrane region, and two tandemly repeated conserved cytoplasmic domains. Images PMID:2169617

  1. Molecular Evolution of Phosphoprotein Phosphatases in Drosophila

    PubMed Central

    Miskei, Márton; Ádám, Csaba; Kovács, László; Karányi, Zsolt; Dombrádi, Viktor

    2011-01-01

    Phosphoprotein phosphatases (PPP), these ancient and important regulatory enzymes are present in all eukaryotic organisms. Based on the genome sequences of 12 Drosophila species we traced the evolution of the PPP catalytic subunits and noted a substantial expansion of the gene family. We concluded that the 18–22 PPP genes of Drosophilidae were generated from a core set of 8 indispensable phosphatases that are present in most of the insects. Retropositons followed by tandem gene duplications extended the phosphatase repertoire, and sporadic gene losses contributed to the species specific variations in the PPP complement. During the course of these studies we identified 5, up till now uncharacterized phosphatase retrogenes: PpY+, PpD5+, PpD6+, Pp4+, and Pp6+ which are found only in some ancient Drosophila. We demonstrated that all of these new PPP genes exhibit a distinct male specific expression. In addition to the changes in gene numbers, the intron-exon structure and the chromosomal localization of several PPP genes was also altered during evolution. The G−C content of the coding regions decreased when a gene moved into the heterochromatic region of chromosome Y. Thus the PPP enzymes exemplify the various types of dynamic rearrangements that accompany the molecular evolution of a gene family in Drosophilidae. PMID:21789237

  2. Phosphatase activities analyzed by in vivo expressions.

    PubMed

    Schweighofer, Alois; Ayatollahi, Zahra; Meskiene, Irute

    2009-01-01

    Protein phosphatases act to reverse phosphorylation-related modifications induced by protein kinases. Type 2C protein phosphatases (PP2C) are monomeric Ser/Thr phosphatases that require a metal for their activity and are abundant in prokaryotes and eukaryotes. In plants, such as Medicago and Arabidopsis PP2Cs control several essential processes, including ABA signaling, development, and wound-induced mitogen-activated protein kinase (MAPK) pathways. In vitro assays with recombinant proteins and yeast two-hybrid systems usually provide initial information about putative PP2C substrates; however, these observations have to be verified in vivo. Therefore, a method for transient expression in isolated Arabidopsis suspension cell protoplasts was developed to assay PP2C action in living cells. This system has proven to be very useful in producing active enzymes and their substrates and in performing enzymatic reactions in vivo. Transient gene expression in isolated cells enabled assembly of functional protein kinase cascades and the creation of phosphorylated targets for PP2Cs. The method is based on the co-transformation and transient co-expression of different PP2C proteins with MAPK. It shows that epitope-tagged PP2C and MAPK proteins exhibit high enzymatic activities and produce substantial protein amounts easily monitored by Western blot analysis. Additionally, PP2C phosphatase activities can be directly tested in protein extracts from protoplasts, suggesting a possibility for analysis of activities of new PP2C family members.

  3. Phosphatase hydrolysis of organic phosphorus compounds

    USDA-ARS?s Scientific Manuscript database

    Phosphatases are diverse groups of enzymes that deserve special attention because of the significant roles they play in mineralizing organic phosphorus (P) into inorganic available form. For getting more insight on the enzymatically hydrolysis of organic P, in this work, we compared the catalytic pa...

  4. Assaying inositol and phosphoinositide phosphatase enzymes.

    PubMed

    Donahue, Janet L; Ercetin, Mustafa; Gillaspy, Glenda E

    2013-01-01

    One critical aspect of phosphoinositide signaling is the turnover of signaling molecules in the pathway. These signaling molecules include the phosphatidylinositol phosphates (PtdInsPs) and inositol phosphates (InsPs). The enzymes that catalyze the breakdown of these molecules are thus important potential regulators of signaling, and in many cases the activity of such enzymes needs to be measured and compared to other enzymes. PtdInsPs and InsPs are broken down by sequential dephosphorylation reactions which are catalyzed by a set of specific phosphatases. Many of the phosphatases can act on both PtdInsP and InsP substrates. The protocols described in this chapter detail activity assays that allow for the measurement of PtdInsP and InsP phosphatase activities in vitro starting with native or recombinant enzymes. Three different assays are described that have different equipment requirements and allow one to test a range of PtdInsP and InsP phosphatases that act on different substrates.

  5. Phosphatase activities as biosignatures of extant life

    NASA Astrophysics Data System (ADS)

    Kobayashi, K.; Itoh, Y.; Edazawa, Y.; Moroi, A.; Takano, Y.

    It has been recognized that terrestrial biosphere expands to such extreme environments as deep subsurface lithosphere high temperature hot springs and stratosphere Possible extraterrestrial biospheres in Mars Europa and Titan are being discussed Many biosignatures or biomarkers have been proposed to detect microbial activities in such extreme environments Phosphate esters are essential for the terrestrial life since they are constituents of nucleic acids and cell mebranes Thus all the terrestrial organisms have phosphatases that are enzymes catalyzing hydrolysis of phosphate esters We analyzed phosphatase activities in the samples obtained in extreme environments such as submarine hydrothermal systems and discussed whether they can be used as biosignatures for extant life Core samples and chimney samples were collected at the Suiyo Seamount Izu-Bonin Arc the Pacific Ocean in 2001 and 2002 and in South Mariana hydrothermal systems the Pacific Oceanas in 2003 both in a part of the Archaean Park Project Phosphatase activity in solid rock samples was measured spectrometrically by using 25 mM p-nitrophenyl phosphate pH 8 0 or pH 6 5 as a substrate as follows Pulverized samples were incuvated with substrate solution for an hour and then production rate of p-nitrophenol was calculated with absorbance at 410 nm Phosphatase activity in extracts was measured fluorometrically by using 4-methylumberyferryl phosphate as a substrate Concentration of amino acids and their enantiomeric ratio were determined by HPLC after HF digestion of the

  6. PP2C gamma: a human protein phosphatase with a unique acidic domain.

    PubMed

    Travis, S M; Welsh, M J

    1997-08-04

    We have cloned a novel cDNA from human skeletal muscle which encodes a protein phosphatase with a unique acidic domain. It is 34% identical to mammalian PP2C alpha and PP2C beta and we call it PP2C gamma. It more closely resembles PP2Cs from Paramecium tetraurelia and Schizosaccharomyces pombe than mammalian PP2Cs. Northern blot analysis shows that PP2C gamma is widely expressed, and is most abundant in testis, skeletal muscle, and heart. Like known PP2Cs, recombinant PP2C gamma requires Mg2+ or Mn2+ for activity. Unlike any other known phosphatase, PP2C gamma has a highly acidic domain: 75% of the 54 residues are glutamate or aspartate.

  7. An acid phosphatase locus expressed in mouse kidney (Apk) and its genetic location on chromosome 10.

    PubMed

    Womack, J E; Auerbach, S B

    1978-04-01

    A genetic locus controlling the electrophoretic mobility of an acid phosphatase in mouse kidney is described. This locus, called acid phosphatase-kidney (Apk), is not expressed in erythrocytes, liver, spleen, heart, lung, brain, skeletal muscle, stomach, or testes. The product of Apk hydrolyzes the substrate naphthol AS-MX phosphoric acid but is not active on alpha-naphthylphosphate or 4-methylumbelliferylphosphate. It is not inactivated by 50 C for 1 hr, nor is its electrophoretic mobility altered by incubation with neuraminidase. The locus is invariant among 31 inbred strains (Apka), with a variant allele (Apkm) observed only in Mus musculus molossinus. Codominant expression was observed in F1 hybrids of M. m. molossinus and inbred strains. Apk was mapped on Chr 10, near the neurological mutant waltzer (v).

  8. Molecular basis of alpha-tocopherol control of smooth muscle cell proliferation.

    PubMed

    Azzi, A; Aratri, E; Boscoboinik, D; Clément, S; Ozer, N K; Ricciarelli, R; Spycher, S

    1998-01-01

    Rat and human vascular smooth muscle cell proliferation is specifically sensitive to alpha-tocopherol, but not beta-tocopherol. The former, but not the latter, is capable of limiting proliferation and inhibiting protein kinase C activity in a dose-dependent manner. The phenomenon occurs at concentrations in the range 10-50 microM. beta-tocopherol addition together with alpha-tocopherol, prevents both cell growth and protein kinase C inhibition. alpha-tocopherol increases de novo synthesis of protein kinase C molecules. The enzyme specific activity, however, is diminished, due to a decreased phosphorylation of protein kinase C, occurring in the presence of alpha-tocopherol. Experiments with protein kinase C isoform-specific inhibitors and precipitating antibodies show that the only isoform affected by alpha-tocopherol is protein kinase C-alpha. The effect of alpha-tocopherol is prevented by okadaic acid indicating a phosphatase of the PP2A type as responsible for protein kinase C-alpha dephosphorylation produced in the presence of alpha-tocopherol. At a gene level alpha-tocopherol but not beta-tocopherol induces a transient activation of alpha-tropomyosin gene transcription and protein expression. It is proposed that, by inhibiting protein kinase C activity via an activation of a phosphatase PP2A, alpha-tocopherol controls smooth muscle cell proliferation through changes in gene expression.

  9. Structure- and function-based characterization of a new phosphoglycolate phosphatase from Thermoplasma acidophilum.

    SciTech Connect

    Kim, Y.; Yakunin, A. F.; Kuznetsova, E.; Xu, X.; Pennycooke, M.; Gu, J.; Cheung, F.; Proudfoot, M.; Arrowsmith, C. H.; Joachimiak, A.; Edwards, A.; Christendat, D.; Biosciences Division; Univ. of Toronto; Clinical Genomics Centre

    2004-01-02

    The protein TA0175 has a large number of sequence homologues, most of which are annotated as unknown and a few as belonging to the haloacid dehalogenase superfamily, but has no known biological function. Using a combination of amino acid sequence analysis, three-dimensional crystal structure information, and kinetic analysis, we have characterized TA0175 as phosphoglycolate phosphatase from Thermoplasma acidophilum. The crystal structure of TA0175 revealed two distinct domains, a larger core domain and a smaller cap domain. The large domain is composed of a centrally located five-stranded parallel {beta}-sheet with strand order S10, S9, S8, S1, S2 and a small {beta}-hairpin, strands S3 and S4. This central sheet is flanked by a set of three {alpha}-helices on one side and two helices on the other. The smaller domain is composed of an open faced {beta}-sandwich represented by three antiparallel {beta}-strands, S5, S6, and S7, flanked by two oppositely oriented {alpha}-helices, H3 and H4. The topology of the large domain is conserved; however, structural variation is observed in the smaller domain among the different functional classes of the haloacid dehalogenase superfamily. Enzymatic assays on TA0175 revealed that this enzyme catalyzed the dephosphorylation of phosphoglycolate in vitro with similar kinetic properties seen for eukaryotic phosphoglycolate phosphatase. Activation by divalent cations, especially Mg{sup 2+}, and competitive inhibition behavior with Cl{sup -} ions are similar between TA0175 and phosphoglycolate phosphatase. The experimental evidence presented for TA0175 is indicative of phosphoglycolate phosphatase.

  10. Structural Basis for the Catalytic Activity of Human Serine/Threonine Protein Phosphatase type 5 (PP5)

    NASA Technical Reports Server (NTRS)

    Swingle, Mark R.; Ciszak, Ewa M.; Honkanen, Richard E.

    2004-01-01

    Serine/threonine protein phosphatase-5 (PP5) is a member of the PPP-gene family of protein phosphatases that is widely expressed in mammalian tissues and is highly conserved among eukaryotes. PP5 associates with several proteins that affect signal transduction networks, including the glucocorticoid receptor (GR)-heat shock protein-90 (Hsp90)-heterocomplex, the CDC16 and CDC27 subunits of the anaphase-promoting complex, elF2alpha kinase, the A subunit of PP2A, the G12-alpha / G13-alpha subunits of heterotrimeric G proteins and DNA-PK. The catalytic domain of PP5 (PP5c) shares 35-45% sequence identity with the catalytic domains of other PPP-phosphatases, including protein phosphatase-1 (PP1), -2A (PP2A), -2B / calcineurin (PP2B), -4 (PP4), -6 (PP6), and -7 (PP7). Like PP1, PP2A and PP4, PP5 is also sensitive to inhibition by okadaic acid, microcystin, cantharidin, tautomycin, and calyculin A. Here we report the crystal structure of the PP5 catalytic domain (PP5c) at a resolution of 1.6 angstroms. From this structure we propose a mechanism for PP5-mediated hydrolysis of phosphoprotein substrates, which requires the precise positioning of two metal ions within a conserved Asp(sup 271)-M(sub 1):M(sub 2)-W(sup 1)-His(sup 304)-Asp(sup 274) catalytic motif. The structure of PP5c provides a possible structural basis for explaining the exceptional catalytic proficiency of protein phosphatases, which are among the most powerful known catalysts. Resolution of the entire C-terminus revealed a novel subdomain, and the structure of the PP5c should also aid development of type-specific inhibitors.

  11. Structural Basis for the Catalytic Activity of Human Serine/Threonine Protein Phosphatase type 5 (PP5)

    NASA Technical Reports Server (NTRS)

    Swingle, Mark R.; Ciszak, Ewa M.; Honkanen, Richard E.

    2004-01-01

    Serine/threonine protein phosphatase-5 (PP5) is a member of the PPP-gene family of protein phosphatases that is widely expressed in mammalian tissues and is highly conserved among eukaryotes. PP5 associates with several proteins that affect signal transduction networks, including the glucocorticoid receptor (GR)-heat shock protein-90 (Hsp90)-heterocomplex, the CDC16 and CDC27 subunits of the anaphase-promoting complex, elF2alpha kinase, the A subunit of PP2A, the G12-alpha / G13-alpha subunits of heterotrimeric G proteins and DNA-PK. The catalytic domain of PP5 (PP5c) shares 35-45% sequence identity with the catalytic domains of other PPP-phosphatases, including protein phosphatase-1 (PP1), -2A (PP2A), -2B / calcineurin (PP2B), -4 (PP4), -6 (PP6), and -7 (PP7). Like PP1, PP2A and PP4, PP5 is also sensitive to inhibition by okadaic acid, microcystin, cantharidin, tautomycin, and calyculin A. Here we report the crystal structure of the PP5 catalytic domain (PP5c) at a resolution of 1.6 angstroms. From this structure we propose a mechanism for PP5-mediated hydrolysis of phosphoprotein substrates, which requires the precise positioning of two metal ions within a conserved Asp(sup 271)-M(sub 1):M(sub 2)-W(sup 1)-His(sup 304)-Asp(sup 274) catalytic motif. The structure of PP5c provides a possible structural basis for explaining the exceptional catalytic proficiency of protein phosphatases, which are among the most powerful known catalysts. Resolution of the entire C-terminus revealed a novel subdomain, and the structure of the PP5c should also aid development of type-specific inhibitors.

  12. Tyrosine phosphatase activity in mitochondria: presence of Shp-2 phosphatase in mitochondria.

    PubMed

    Salvi, M; Stringaro, A; Brunati, A M; Agostinelli, E; Arancia, G; Clari, G; Toninello, A

    2004-09-01

    Tyrosine phosphorylation by unidentified enzymes has been observed in mitochondria, with recent evidence indicating that non-receptorial tyrosine kinases belonging to the Src family, which represent key players in several transduction pathways, are constitutively present in mitochondria. The extent of protein phosphorylation reflects a coordination balance between the activities of specific kinases and phophatases. The present study demonstrates that purified rat brain mitochondria possess endogenous tyrosine phosphatase activity. Mitochondrial phosphatases were found to be capable of dephosphorylating different exogenous substrates, including paranitrophenylphosphate, (32)P-poly(Glu-Tyr)(4:1) and (32)P-angiotensin. These activities are strongly inhibited by peroxovanadate, a well-known inhibitor of tyrosine phosphatases, but not by inhibitors of alkali or Ser/Thr phosphatases, and mainly take place in the intermembrane space and outer mitochondrial membrane. Using a combination of approaches, we identified the tyrosine phosphatase Shp-2 in mitochondria. Shp-2 plays a crucial role in a number of intracellular signalling cascades and is probably involved in several human diseases. It thus represents the first tyrosine phosphatase shown to be present in mitochondria.

  13. [Leucocyte alkaline phosphatase in normal and pathological pregnancy (author's transl)].

    PubMed

    Stark, K H; Zaki, I; Sobolewski, K

    1981-01-01

    The activities of leucocyte alkaline phosphatase were determined in 511 patients with normal and pathological pregnancy. Mean values were compared and the enzyme followed up, and the conclusion was drawn that leucocyte alkaline phosphatase was no safe indicator of foetal condition. No direct relationship were found to exist between leucocyte alkaline phosphatase, total oestrogens, HSAP, HLAP, HPL, and oxytocinase.

  14. Inhibition by dithionite and reactivation by iron of the tartrate-resistant acid phosphatase in bone of osteopetrotic (ia) rats.

    PubMed

    Hammarström, L E; Anderson, T R; Marks, S C; Toverud, S U

    1983-10-01

    The staining intensity and inhibitor sensitivity of acid phosphatase activity was determined histochemically in various tissues of normal and ia rat pups by the use of freeze-dried whole body sections. Activity was determined using alpha-naphthylphosphate as substrate and hexazonium pararosaniline as coupler. Sections from ia rats (6 and 24 days old) showed markedly higher enzyme activity in bone than sections from normal littermates. However, there were no differences between ia and normal pups in acid phosphatase activity in soft tissues and developing teeth. Preincubation of sections with 1-100 mM sodium dithionite (an iron-binding agent) caused a dose-related inhibition of enzyme activity in bone of ia and normal pups, but only slight inhibition of activity in soft tissues. Partial restoration of the dithionite-inhibited activity in bone was achieved by subsequent preincubation in 1 mM FeCl2. Addition of 100 mM sodium tartrate to the staining solution of non-preincubated sections caused almost complete inhibition of activity in soft tissues and the developing teeth but no inhibition of the activity in bone that was sensitive to sodium dithionite. These data indicate a) that sodium dithionite can be used as a specific histochemical inhibitor of the tartrate-resistant acid phosphatase and b) that the source of increased acid phosphatase activity in bone from ia rats is mostly from the tartrate-resistant acid phosphatase.

  15. Molecular Differences between a Mutase and a Phosphatase: Investigations of the Activation Step in Bacillus cereus Phosphopentomutase

    SciTech Connect

    Iverson, T.M.; Panosian, Timothy D.; Birmingham, William R.; Nannemann, David P.; Bachmann, Brian O.

    2012-05-09

    Prokaryotic phosphopentomutases (PPMs) are di-Mn{sup 2+} enzymes that catalyze the interconversion of {alpha}-D-ribose 5-phosphate and {alpha}-D-ribose 1-phosphate at an active site located between two independently folded domains. These prokaryotic PPMs belong to the alkaline phosphatase superfamily, but previous studies of Bacillus cereus PPM suggested adaptations of the conserved alkaline phosphatase catalytic cycle. Notably, B. cereus PPM engages substrates when the active site nucleophile, Thr-85, is phosphorylated. Further, the phosphoenzyme is stable throughout purification and crystallization. In contrast, alkaline phosphatase engages substrates when the active site nucleophile is dephosphorylated, and the phosphoenzyme reaction intermediate is only stably trapped in a catalytically compromised enzyme. Studies were undertaken to understand the divergence of these mechanisms. Crystallographic and biochemical investigations of the PPM{sup T85E} phosphomimetic variant and the neutral corollary PPM{sup T85Q} determined that the side chain of Lys-240 underwent a change in conformation in response to active site charge, which modestly influenced the affinity for the small molecule activator {alpha}-D-glucose 1,6-bisphosphate. More strikingly, the structure of unphosphorylated B. cereus PPM revealed a dramatic change in the interdomain angle and a new hydrogen bonding interaction between the side chain of Asp-156 and the active site nucleophile, Thr-85. This hydrogen bonding interaction is predicted to align and activate Thr-85 for nucleophilic addition to {alpha}-D-glucose 1,6-bisphosphate, favoring the observed equilibrium phosphorylated state. Indeed, phosphorylation of Thr-85 is severely impaired in the PPM{sup D156A} variant even under stringent activation conditions. These results permit a proposal for activation of PPM and explain some of the essential features that distinguish between the catalytic cycles of PPM and alkaline phosphatase.

  16. [ATPase and phosphatase activity of drone brood].

    PubMed

    Bodnarchuk, L I; Stakhman, O S

    2004-01-01

    Most researches on insect enzymes concern carbohydrate and nitrogenous exchange. Data on ATPase activity for larval material of drone brood are absent in the available literature. The drone brood is one of the least investigated apiproducts. Allowing for the important role of ATPase in the vital functions of the insect cells our work was aimed at the study of ATPase of the drone blood activity and that of alkaline and acid phosphatases. When studying liophylised preparations of the drone brood homogenate we have found out high activity of Mg2+, Na+, K+-, Ca2+- and Mg2+-ATPase and of alkaline and acid phosphatase, that is the possible explanation of the high-intensity power and plastic processes proceeding during growth and development of larvae.

  17. Assessment and kinetics of soil phosphatase in Brazilian Savanna systems.

    PubMed

    Ferreira, Adão S; Espíndola, Suéllen P; Campos, Maria Rita C

    2016-05-31

    The activity and kinetics of soil phosphatases are important indicators to evaluate soil quality in specific sites such as the Cerrado (Brazilian Savanna). This study aimed to determine the activity and kinetic parameters of soil phosphatase in Cerrado systems. Soil phosphatase activity was assessed in samples of native Cerrado (NC), no-tillage (NT), conventional tillage (CT) and pasture with Brachiaria brizantha (PBb) and evaluated with acetate buffer (AB), tris-HCl buffer (TB), modified universal buffer (MUB) and low MUB. The Michaelis-Menten equation and Eadie-Hofstee model were applied to obtain the kinetic parameters of soil phosphatase using different concentrations of p-nitrophenol phosphate (p-NPP). MUB showed the lowest soil phosphatase activity in all soils whereas AB in NC and NT presented the highest. Low MUB decreased interferences in the assessment of soil phosphatase activity when compared to MUB, suggesting that organic acids interfere on the soil phosphatase activity. In NC and NT, soil phosphatase activity performed with TB was similar to AB and low MUB. Km values from the Michaels-Menten equation were higher in NC than in NT, which indicate a lower affinity of phosphatase activity for the substrate in NC. Vmax values were also higher in NC than in NT. The Eadie-Hofstee model suggests that NC had more phosphatase isoforms than NT. The study showed that buffer type is of fundamental importance when assessing soil phosphatase activity in Cerrado soils.

  18. Evaluation of APHA and AOAC methods for phosphatase in cheese.

    PubMed

    Murthy, G K; Cox, S

    1988-01-01

    Varieties of market cheese were analyzed for alkaline phosphatase by the modified rapid colorimetric method of the American Public Health Association (APHA) and the official AOAC method, 16.304-16.306. In the APHA method, 5 g cheese (pH less than 7.0) is macerated with 2 mL 1:1 carbonate buffer, or 2 mL water (for cheese with pH greater than 7.0). Addition of 0.1 mL magnesium acetate (1 mg magnesium) to test portions of cheese extracts yielded reproducible and quantitative recovery of added phosphatase. In the AOAC method, macerating 0.5 g cheese with 1 mL borate buffer before adding milk phosphatase improved recovery among cheeses. Addition of magnesium ion increased phosphatase activity in some cheeses. Phosphatases in blue mold-ripened and Swiss cheeses were inactivated by heat faster than was milk phosphatase, yet milk phosphatase added to various soft cheeses was completely inactivated at 60 degrees C for 10 min. The lability of phosphatase was due to the heat-denaturing effect of NaCl present in finished cheeses. Some Mexican style soft cheeses contained both heat-labile and heat-stable phosphatases. These data suggest that the phosphatase test to differentiate milk and microbial phosphatases on the basis of repasteurization and analysis of cheese is no longer valid.

  19. Low resolution structure of the human alpha4 protein (IgBP1) and studies on the stability of alpha4 and of its yeast ortholog Tap42.

    PubMed

    Smetana, Juliana Helena Costa; Oliveira, Cristiano Luiz Pinto; Jablonka, Willy; Aguiar Pertinhez, Thelma; Carneiro, Flavia Raquel Gonçalves; Montero-Lomeli, Monica; Torriani, Iris; Zanchin, Nilson Ivo Tonin

    2006-04-01

    The yeast Tap42 and mammalian alpha4 proteins belong to a highly conserved family of regulators of the type 2A phosphatases, which participate in the rapamycin-sensitive signaling pathway, connecting nutrient availability to cell growth. The mechanism of regulation involves binding of Tap42 to Sit4 and PPH21/22 in yeast and binding of alpha4 to the catalytic subunits of type 2A-related phosphatases PP2A, PP4 and PP6 in mammals. Both recombinant proteins undergo partial proteolysis, generating stable N-terminal fragments. The full-length proteins and alpha4 C-terminal deletion mutants at amino acids 222 (alpha4Delta222), 236 (alpha4Delta236) and 254 (alpha4Delta254) were expressed in E. coli. alpha4Delta254 undergoes proteolysis, producing a fragment similar to the one generated by full-length alpha4, whereas alpha4Delta222 and alpha4Delta236 are highly stable proteins. alpha4 and Tap42 show alpha-helical circular dichroism spectra, as do their respective N-terminal proteolysis resistant products. The cloned truncated proteins alpha4Delta222 and alpha4Delta236, however, possess a higher content of alpha-helix, indicating that the C-terminal region is less structured, which is consistent with its higher sensitivity to proteolysis. In spite of their higher secondary structure content, alpha4Delta222 and alpha4Delta236 showed thermal unfolding kinetics similar to the full-length alpha4. Based on small angle X-ray scattering (SAXS), the calculated radius of gyration for alpha4 and Tap42 were 41.2 +/- 0.8 A and 42.8 +/- 0.7 A and their maximum dimension approximately 142 A and approximately 147 A, respectively. The radii of gyration for alpha4Delta222 and alpha4Delta236 were 21.6 +/- 0.3 A and 25.7 +/- 0.2 A, respectively. Kratky plots show that all studied proteins show variable degree of compactness. Calculation of model structures based on SAXS data showed that alpha4Delta222 and alpha4Delta236 proteins have globular conformation, whereas alpha4 and Tap42 exhibit

  20. Rhizobiales-like Phosphatase 2 from Arabidopsis thaliana Is a Novel Phospho-tyrosine-specific Phospho-protein Phosphatase (PPP) Family Protein Phosphatase*

    PubMed Central

    Uhrig, R. Glen; Labandera, Anne-Marie; Muhammad, Jamshed; Samuel, Marcus; Moorhead, Greg B.

    2016-01-01

    Cellular signaling through protein tyrosine phosphorylation is well established in mammalian cells. Although lacking the classic tyrosine kinases present in humans, plants have a tyrosine phospho-proteome that rivals human cells. Here we report a novel plant tyrosine phosphatase from Arabidopsis thaliana (AtRLPH2) that, surprisingly, has the sequence hallmarks of a phospho-serine/threonine phosphatase belonging to the PPP family. Rhizobiales/Rhodobacterales/Rhodospirillaceae-like phosphatases (RLPHs) are conserved in plants and several other eukaryotes, but not in animals. We demonstrate that AtRLPH2 is localized to the plant cell cytosol, is resistant to the classic serine/threonine phosphatase inhibitors okadaic acid and microcystin, but is inhibited by the tyrosine phosphatase inhibitor orthovanadate and is particularly sensitive to inhibition by the adenylates, ATP and ADP. AtRLPH2 displays remarkable selectivity toward tyrosine-phosphorylated peptides versus serine/threonine phospho-peptides and readily dephosphorylates a classic tyrosine phosphatase protein substrate, suggesting that in vivo it is a tyrosine phosphatase. To date, only one other tyrosine phosphatase is known in plants; thus AtRLPH2 represents one of the missing pieces in the plant tyrosine phosphatase repertoire and supports the concept of protein tyrosine phosphorylation as a key regulatory event in plants. PMID:26742850

  1. Leishmanial phosphatase hydrolyzes phosphoproteins and inositol phosphates

    SciTech Connect

    Saha, A.K.; Das, S.; Glew, R.H.

    1986-05-01

    An extensively purified preparation of the predominant, tartrate-resistant acid phosphatase (ACP) from the external surface of Leishmania donovani promastigotes form catalyzes the dephosphorylation of several phosphoproteins; these include: pyruvate kinase, phosphorylase kinase and histones. However, the protein phosphatase activity of ACP is very low compared with that of other protein phosphates known to be involved in regulating various metabolic pathways. /sup 32/P-labelled inositoltriphosphate (IP3), a well-established second messenger derived from phosphatidylinositol-4,5-diphosphate (PIP2), was a substrate for the leishmanial acid phosphatase; incubation of the IP3 preparation with 13.2 milliunits (1 unit equals 1 ..mu..mol 4-methylumbelliferyl phosphate (MUP) cleaved per min at pH 5.5) of ACP at pH 5.5 for 4 hr resulted in hydrolysis of 75% of the radiolabelled substrate resulting in a mixture of inositoldiphosphate and inositolmonophosphate. In addition PIP2 was hydrolyzed rapidly by ACP at pH 5.5 (V/sub max/, 71 units/mg protein; k/sub m/, 4.16 ..mu..M). In contrast, to MUP which is hydrolzyed most rapidly at pH 5.5, PIP2 hydrolysis was optimal at pH 6.8. These observations raise the possibility that ACP could play a role in the host-phagocyte interaction by degrading the precursor of the second messenger, PIP2 or the second messenger itself, IP3.

  2. Role of Protein Tyrosine Phosphatases in Plants

    PubMed Central

    Shankar, Alka; Agrawal, Nisha; Sharma, Manisha; Pandey, Amita; Pandey, Girdhar K.

    2015-01-01

    Reversible protein phosphorylation is a crucial regulatory mechanism that controls many biological processes in eukaryotes. In plants, phosphorylation events primarily occur on serine (Ser) and threonine (Thr) residues, while in certain cases, it was also discovered on tyrosine (Tyr) residues. In contrary to plants, extensive reports on Tyr phosphorylation regulating a large numbers of biological processes exist in animals. Despite of such prodigious function in animals, Tyr phosphorylation is a least studied mechanism of protein regulation in plants. Recently, various chemical analytical procedures have strengthened the view that Tyr phosphorylation is equally prevalent in plants as in animals. However, regardless of Tyr phosphorylation events occuring in plants, no evidence could be found for the existence of gene encoding for Tyr phosphorylation i.e. the typical Tyr kinases. Various methodologies have suggested that plant responses to stress signals and developmental processes involved modifications in protein Tyr phosphorylation. Correspondingly, various reports have established the role of PTPs (Protein Tyrosine Phosphatases) in the dephosphorylation and inactivation of mitogen activated protein kinases (MAPKs) hence, in the regulation of MAPK signaling cascade. Besides this, many dual specificity protein phosphatases (DSPs) are also known to bind starch and regulate starch metabolism through reversible phosphorylation. Here, we are emphasizing the significant progress on protein Tyr phosphatases to understand the role of these enzymes in the regulation of post-translational modification in plant physiology and development. PMID:26962298

  3. Two potential fish glycerol-3-phosphate phosphatases.

    PubMed

    Raymond, James A

    2015-06-01

    Winter-acclimated rainbow smelt (Osmerus mordax Mitchill) produce high levels of glycerol as an antifreeze. A common pathway to glycerol involves the enzyme glycerol-3-phosphate phosphatase (GPP), but no GPP has yet been identified in fish or any other animal. Here, two phosphatases assembled from existing EST libraries (from winter-acclimated smelt and cold-acclimated smelt hepatocytes) were found to resemble a glycerol-associated phosphatase from a glycerol-producing alga, Dunaliella salina, and a recently discovered GPP from a bacterium, Mycobacterium tuberculosis. Recombinant proteins were generated and were found to have GPP activity on the order of a few μMol Pi/mg enzyme/min. The two enzymes have acidic pH optima (~5.5) similar to that previously determined for GPP activity in liver tissue, with about 1/3 of their peak activities at neutral pH. The two enzymes appear to account for the GPP activity of smelt liver, but due to their reduced activities at neutral pH, their contributions to glycerol production in vivo remain unclear. Similar enzymes may be active in a glycerol-producing insect, Dendroctonus ponderosae.

  4. Primary structure of rat secretory acid phosphatase and comparison to other acid phosphatases.

    PubMed

    Roiko, K; Jänne, O A; Vihko, P

    1990-05-14

    Overlapping cDNA clones encoding rat prostatic acid phosphatase (rPAP) were isolated by using two human prostatic acid phosphatase (hPAP)-encoding cDNAs to screen rat prostatic cDNA libraries. The isolated cDNAs encompassed a total of 1626 nucleotides (nt), of which 1143 nt corresponded to the protein coding sequence encoding a mature polypeptide of 350 amino acids (aa) and a 31-aa long signal peptide-like sequence. The deduced Mr of the mature rPAP was 40,599. RNA blot analysis indicated the presence of three mRNA species (4.9, 2.3 and 1.5 kb in size) in the rat prostate. The deduced aa sequences of rPAP and hPAP show 75% identity, whereas the similarity between rPAP and human lysosomal acid phosphatase (hLAP) is only 45%. Furthermore, the sequence similarity between rPAP and rat lysosomal acid phosphatase (rLAP) is 46% at the aa level. Similar to hPAP, but unlike hLAP and rLAP, the rPAP sequence lacks a membrane-anchoring domain indicating the secretory character of this phosphatase. All six cysteines present in the overlapping areas of the mature rPAP, hPAP, rLAP and hLAP proteins are positionally conserved, suggesting that these residues are important for the tertiary structure of acid phosphatases (APs). The previously reported active site residues, two arginines and one histidine, are also conserved in these APs.

  5. Phosphoinositide phosphatases: just as important as the kinases.

    PubMed

    Dyson, Jennifer M; Fedele, Clare G; Davies, Elizabeth M; Becanovic, Jelena; Mitchell, Christina A

    2012-01-01

    Phosphoinositide phosphatases comprise several large enzyme families with over 35 mammalian enzymes identified to date that degrade many phosphoinositide signals. Growth factor or insulin stimulation activates the phosphoinositide 3-kinase that phosphorylates phosphatidylinositol (4,5)-bisphosphate [PtdIns(4,5)P(2)] to form phosphatidylinositol (3,4,5)-trisphosphate [PtdIns(3,4,5)P(3)], which is rapidly dephosphorylated either by PTEN (phosphatase and tensin homologue deleted on chromosome 10) to PtdIns(4,5)P(2), or by the 5-phosphatases (inositol polyphosphate 5-phosphatases), generating PtdIns(3,4)P(2). 5-phosphatases also hydrolyze PtdIns(4,5)P(2) forming PtdIns(4)P. Ten mammalian 5-phosphatases have been identified, which regulate hematopoietic cell proliferation, synaptic vesicle recycling, insulin signaling, and embryonic development. Two 5-phosphatase genes, OCRL and INPP5E are mutated in Lowe and Joubert syndrome respectively. SHIP [SH2 (Src homology 2)-domain inositol phosphatase] 2, and SKIP (skeletal muscle- and kidney-enriched inositol phosphatase) negatively regulate insulin signaling and glucose homeostasis. SHIP2 polymorphisms are associated with a predisposition to insulin resistance. SHIP1 controls hematopoietic cell proliferation and is mutated in some leukemias. The inositol polyphosphate 4-phosphatases, INPP4A and INPP4B degrade PtdIns(3,4)P(2) to PtdIns(3)P and regulate neuroexcitatory cell death, or act as a tumor suppressor in breast cancer respectively. The Sac phosphatases degrade multiple phosphoinositides, such as PtdIns(3)P, PtdIns(4)P, PtdIns(5)P and PtdIns(3,5)P(2) to form PtdIns. Mutation in the Sac phosphatase gene, FIG4, leads to a degenerative neuropathy. Therefore the phosphatases, like the lipid kinases, play major roles in regulating cellular functions and their mutation or altered expression leads to many human diseases.

  6. Structure of SixA, a histidine protein phosphatase of the ArcB histidine-containing phosphotransfer domain in Escherichia coli.

    PubMed

    Hakoshima, Toshio; Ichihara, Hisako

    2007-01-01

    Escherichia coli protein SixA was the first identified histidine protein phosphatase that dephosphorylates the histidine-containing phosphotransfer (HPt) domain of histidine kinase ArcB. The crystal structures of the free and tungstate-bound forms of SixA revealed an alpha/beta architecture with a fold unlike those previously described in eukaryotic protein phosphatases, but related to a family of phosphatases containing the arginine-histidine-glycine (RHG) motif at their active sites. Compared with these RHG phosphatases, SixA lacks an extra alpha-helical subdomain that forms a lid over the active site, thereby forming a relatively shallow groove important for accommodating the kidney-shaped four-helix bundle of the HPt domain. Sequence database searches revealed that a single SixA homolog was found in a variety of bacteria, where two homologs were found in some bacteria while no homolog was found in others. No SixA homologs were found in the majority of firmicutes and euryarchaea. Structure-based examination and multiple alignment of sequences revealed SixA active residues from loop beta1-H2, which might assist in the identification of SixA homologs among RHG phosphatases even with poor amino acid identity.

  7. Carboxyarabinitol-1-P phosphatase of Phaseolus vulgaris

    SciTech Connect

    Kobza, J.; Moore, B.d.; Seemann, J.R. )

    1990-05-01

    The activity of carboxyarabinitol-1-P (CA1P) phosphatase was detected in clarified stromal extracts by the generation of {sup 14}C-carboxyarabinitol from {sup 14}C-CA1P. Carboxyribitol-1-P dependent activity was 3% of the CA1P dependent activity, indicating the enzyme was specific for CA1P. Inclusion of DTT in the assay was required for maximum velocity, but it appears that the enzyme is not regulated by thioredoxin in vivo. Activity o f the CA1P phosphatase was stimulated by RuBP, NADPH and FBP, though the latter two metabolites were required at nonphysiological concentrations in order to achieve significant stimulation. Contrary to a previous report on purified tobacco enzyme, ATP stimulated the CA1P phosphatase activity. In the presence of 1 mM RuBP or ATP, rates of 2 or 3 {mu}mol mg{sup {minus}1} Chl h{sup {minus}1}, respectively, were observed at 1 mM CA1P. These rates were 3-4 fold higher than the rate observed in the absence of effectors and are 2-4 times the in vivo rate of degradation of CA1P during dark/light transitions. The rates from bean were about 7 fold higher than rates reported for the enzyme from tobacco. Changes in the levels of ATP and RuBP associated with dark/light transitions could modulate the enzyme activity in vivo, but it remains to be established if this is the only mechanism for the required regulation of the enzyme.

  8. Auxiliary phosphatases in two-component signal transduction.

    PubMed

    Silversmith, Ruth E

    2010-04-01

    Signal termination in two-component systems occurs by loss of the phosphoryl group from the response regulator protein. This review explores our current understanding of the structures, catalytic mechanisms and means of regulation of the known families of phosphatases that catalyze response regulator dephosphorylation. The CheZ and CheC/CheX/FliY families, despite different overall structures, employ identical catalytic strategies using an amide side chain to orient a water molecule for in-line attack of the aspartyl phosphate. Spo0E phosphatases contain sequence and structural features that suggest a strategy similar to the chemotaxis phosphatases but the mechanism used by the Rap phosphatases is not yet elucidated. Identification of features shared by phosphatase families may aid in the identification of currently unrecognized classes of response regulator phosphatases. Copyright 2010 Elsevier Ltd. All rights reserved.

  9. Effect of Bacteria and Amoebae on Rhizosphere Phosphatase Activity

    PubMed Central

    Gould, W. Douglas; Coleman, David C.; Rubink, Amy J.

    1979-01-01

    The contributions of various components of soil microflora and microfauna to rhizosphere phosphatase activity were determined with hydroponic cultures. Three treatments were employed: (i) plants alone (Bouteloua gracilis (H.B.K.) Lag. ex Steud.) (ii) plants plus bacteria (Pseudomonas sp.), and (iii) plants plus bacteria plus amoebae (Acanthamoeba sp.). No alkaline phosphatase was detected, but an appreciable amount of acid phosphatase activity (120 to 500 nmol of p-nitrophenylphosphate hydrolyzed per h per plant) was found in the root culture solutions. The presence of bacteria or bacteria and amoebae increased the amount of acid phosphatase in solution, and properties of additional activity were identical to properties of plant acid phosphatase. The presence of bacteria or bacteria and amoebae increased both solution and root phosphatase activities at most initial phosphate concentrations. PMID:16345390

  10. Desialylated alkaline phosphatase: activation by 4-nitrophenol.

    PubMed

    Nayudu, P R

    1984-01-01

    Mouse ileal alkaline phosphatase is a sialyl enzyme (12-14 moles per mole of enzyme). When partially desialylated by treatment with neuraminidase, the enzyme loses most of its activity, associated with reduced apparent Vmax and Km. Part of that loss, however, is recovered as the product 4-nitrophenol's concentration builds up in the cuvette. Experimental results are presented to demonstrate that the activation is due to the binding of 4-nitrophenol as a ligand by the partially desialylated enzyme and that both the loss of activity by sialic acid removal and activation by ligand-binding are correlated with changes in protein conformation.

  11. Subunits of the alkaline phosphatase of Bacillus licheniformis: chemical, physicochemical, and dissociation studies.

    PubMed

    Hulett, F M; Schaffel, S D; Campbell, L L

    1976-11-01

    The alkaline phosphatase (orthophosphoric monoester phosphydrolase, EC 3.1.3.1) of Bacillus licheniformis MC14 was studied in an attempt to determine the number of subunits contained in the 120,000-molecular-weight native enzyme. Two moles of arginine was liberated per mole of native enzyme by carboxypeptidases A and B in the presence of sodium dodecyl sulfate. The effect on the native enzyme of progressively lowering the solvent buffer pH was monitored by determining the molecular weight by sedimentation equilibrium analysis, the sedimentation coefficient, the frictional coefficient, and the percent alpha-helix content of the enzyme. The alkaline phosphatase dissociates into two subunits around pH 4. At pH 2.8 a further decrease in S value, but no change in molecular weight, is observed, indicating a change in conformation. The frictional coefficients and percent alpha-helix content agree with this interpretation. A subunit molecular weight of 59,000 was calculated from sodium dodecyl sulfate gels.

  12. Phosphatase specificity and pathway insulation in signaling networks.

    PubMed

    Rowland, Michael A; Harrison, Brian; Deeds, Eric J

    2015-02-17

    Phosphatases play an important role in cellular signaling networks by regulating the phosphorylation state of proteins. Phosphatases are classically considered to be promiscuous, acting on tens to hundreds of different substrates. We recently demonstrated that a shared phosphatase can couple the responses of two proteins to incoming signals, even if those two substrates are from otherwise isolated areas of the network. This finding raises a potential paradox: if phosphatases are indeed highly promiscuous, how do cells insulate themselves against unwanted crosstalk? Here, we use mathematical models to explore three possible insulation mechanisms. One approach involves evolving phosphatase KM values that are large enough to prevent saturation by the phosphatase's substrates. Although this is an effective method for generating isolation, the phosphatase becomes a highly inefficient enzyme, which prevents the system from achieving switch-like responses and can result in slow response kinetics. We also explore the idea that substrate degradation can serve as an effective phosphatase. Assuming that degradation is unsaturatable, this mechanism could insulate substrates from crosstalk, but it would also preclude ultrasensitive responses and would require very high substrate turnover to achieve rapid dephosphorylation kinetics. Finally, we show that adaptor subunits, such as those found on phosphatases like PP2A, can provide effective insulation against phosphatase crosstalk, but only if their binding to substrates is uncoupled from their binding to the catalytic core. Analysis of the interaction network of PP2A's adaptor domains reveals that although its adaptors may isolate subsets of targets from one another, there is still a strong potential for phosphatase crosstalk within those subsets. Understanding how phosphatase crosstalk and the insulation mechanisms described here impact the function and evolution of signaling networks represents a major challenge for

  13. Nondeletional alpha-thalassemia: first description of alpha Hph alpha and alpha Nco alpha mutations in a Spanish population.

    PubMed

    Ayala, S; Colomer, D; Aymerich, M; Pujades, A; Vives-Corrons, J L

    1996-07-01

    Several different deletions underlie the molecular basis of alpha-thalassemia. The most common alpha-thalassemia determinant in Spain is the rightward deletion (-alpha 3.7). To our knowledge, however, no cases of alpha-thalassemia due to nondeletional mutations have so far been described in this particular Mediterranean area. Here, we report the existence of nondeletional forms of alpha-thalassemia in ten Spanish families. The alpha 2-globin gene was characterized in ten unrelated patients and their relatives only when the presence of deletional alpha-thalassemia was ruled out. The alpha 2-globin gene analysis was performed using the polymerase chain reaction (PCR) followed by restriction enzyme analysis or by allelespecific priming. This allowed the identification of a 5-base pair (bp) deletion at the donor site of IVS I (alpha Hph alpha) in 9 cases and the alpha 2 initiation codon mutation (alpha Nco alpha) in one case. Although these alpha 2-globin gene mutations are found in other mediterranean areas, our results demonstrate their presence in the Spanish population and suggest that the alpha Hph alpha/alpha alpha genotype is probably the most common nondeletional form of alpha-thalassemia in Spain.

  14. Inorganic Phosphate as an Important Regulator of Phosphatases

    PubMed Central

    Dick, Claudia Fernanda; Dos-Santos, André Luiz Araújo; Meyer-Fernandes, José Roberto

    2011-01-01

    Cellular metabolism depends on the appropriate concentration of intracellular inorganic phosphate (Pi). Pi starvation-responsive genes appear to be involved in multiple metabolic pathways, implying a complex Pi regulation system in microorganisms and plants. A group of enzymes is required for absorption and maintenance of adequate phosphate levels, which is released from phosphate esters and anhydrides. The phosphatase system is particularly suited for the study of regulatory mechanisms because phosphatase activity is easily measured using specific methods and the difference between the repressed and derepressed levels of phosphatase activity is easily detected. This paper analyzes the protein phosphatase system induced during phosphate starvation in different organisms. PMID:21755037

  15. Regulated protein kinases and phosphatases in cell cycle decisions.

    PubMed

    Novak, Bela; Kapuy, Orsolya; Domingo-Sananes, Maria Rosa; Tyson, John J

    2010-12-01

    Many aspects of cell physiology are controlled by protein kinases and phosphatases, which together determine the phosphorylation state of targeted substrates. Some of these target proteins are themselves kinases or phosphatases or other components of a regulatory network characterized by feedback and feed-forward loops. In this review we describe some common regulatory motifs involving kinases, phosphatases, and their substrates, focusing particularly on bistable switches involved in cellular decision processes. These general principles are applied to cell cycle transitions, with special emphasis on the roles of regulated phosphatases in orchestrating progression from one phase to the next of the DNA replication-division cycle.

  16. Functional size of the thylakoid phosphatases determined by radiation inactivation.

    PubMed

    Hsu, L H; Tzeng, C M; Pan, R L

    1993-02-22

    Radiation inactivation technique was employed to determine the functional size of phosphatases from thylakoid membrane. The enzymatic activities of phosphatases decayed in a simple function with the increase of radiation dosage. D37 values of 18.8 +/- 2.4-14.1 +/- 1.5 Mrad were obtained, using phosphoserine, phosphothreonine, p-nitrophenol phosphate, and phospho-histone V-S, respectively, as substrates. The molecular masses of 48.2 +/- 6.3-61 +/- 5.7 kDa were yielded by target theory analysis. We thus speculate that the thylakoid alkaline phosphatase is probably a monomer while acid phosphatase is functionally a dimer in situ.

  17. Regulated protein kinases and phosphatases in cell cycle decisions

    PubMed Central

    Novak, Bela; Kapuy, Orsolya; Domingo-Sananes, Maria Rosa; Tyson, John J

    2013-01-01

    Many aspects of cell physiology are controlled by protein kinases and phosphatases, which together determine the phosphorylation state of targeted substrates. Some of these target proteins are themselves kinases or phosphatases or other components of a regulatory network characterized by feedback and feed-forward loops. In this review we describe some common regulatory motifs involving kinases, phosphatases, and their substrates, focusing particularly on bistable switches involved in cellular decision processes. These general principles are applied to cell cycle transitions, with special emphasis on the roles of regulated phosphatases in orchestrating progression from one phase to the next of the DNA replication-division cycle. PMID:20678910

  18. Biology of tartrate-resistant acid phosphatase.

    PubMed

    Lamp, E C; Drexler, H G

    2000-11-01

    Tartrate-resistant acid phosphatase (TRAP) is a member of the ubiquitously expressed enzyme family of the acid phosphatases. Nearly 30 years ago, TRAP became known to hematologists as cytochemical marker enzyme of hairy cell leukemia. Physiologically, TRAP is primarily a cytochemical marker of macrophages, osteoclasts and dendritic cells. TRAP is localized intracellularly in the lysosomal compartment. Recent data suggest also secretion of TRAP by some cell types, in particular by osteoclasts. Human, mouse and rat TRAP are biochemically well characterized. While the complete genomic sequence of TRAP has been elucidated, only limited information on the genetic details of the gene and its regulation is available. It appears that the intracellular iron content is involved in the regulation of the enzyme. The physiological substrates for this enzyme have not been identified yet and consequently the functional role of TRAP remains completely unknown, though some hypotheses have been forwarded, e.g. involvement in bone resorption and iron homeostasis (transport, metabolism). Taken together, research on the biology of TRAP has been intensive and has led to considerable progress on a number of fronts, including the cloning of the gene. Further studies are, however, still required to determine the role of TRAP in vivo.

  19. Protein Phosphatases and Alzheimer’s Disease

    PubMed Central

    Braithwaite, Steven P.; Stock, Jeffry B.; Lombroso, Paul J.; Nairn, Angus C.

    2013-01-01

    Alzheimer’s Disease (AD) is characterized by progressive loss of cognitive function, linked to marked neuronal loss. Pathological hallmarks of the disease are the accumulation of the amyloid-β (Aβ) peptide in the form of amyloid plaques and the intracellular formation of neurofibrillary tangles (NFTs). Accumulating evidence supports a key role for protein phosphorylation in both the normal and pathological actions of Aβ as well as the formation of NFTs. NFTs contain hyperphosphorylated forms of the microtubule-binding protein tau, and phosphorylation of tau by several different kinases leads to its aggregation. The protein kinases involved in the generation and/or actions of tau or Aβ are viable drug targets to prevent or alleviate AD pathology. However, it has also been recognized that the protein phosphatases that reverse the actions of these protein kinases are equally important. Here, we review recent advances in our understanding of serine/threonine and tyrosine protein phosphatases in the pathology of AD. PMID:22340724

  20. Purple acid phosphatase of the human macrophage and osteoclast. Characterization, molecular properties, and crystallization of the recombinant di-iron-oxo protein secreted by baculovirus-infected insect cells.

    PubMed

    Hayman, A R; Cox, T M

    1994-01-14

    The purple phosphatases catalyze hydrolysis of phosphate esters (optimum pH approximately 5) and are resistant to inhibition by dextro-rotatory tartrate; their distinctive color is due to Fe(III)-phenolate charge-transfer transitions at their active site. Expression of human purple phosphatase, designated type 5 acid phosphatase, is restricted to osteoclasts and other activated cells of monohistiocytic lineage, but its biological rôle in relation to bone resorption and phagocytosis is unknown. To characterize this enzyme further, we have engineered the human type 5 acid phosphatase into a baculovirus vector expression system that enabled milligram quantities of purple protein to be purified from medium containing Sf9 host cells. The phosphatase cDNA was transcribed as a single RNA species of 1.5 kilobases as in human tissues. Tartrate-resistant acid phosphatase activity reacting with uteroferrin antisera appeared in the culture medium, from which up to 8 mg/liter was purified by two-step cation-exchange chromatography at pH 8.0. Two isoforms of approximately 36 kDa were identified by SDS-polyacrylamide electrophoresis and were converted to a single species of apparent molecular size 34 kDa upon treatment with N-glycosidase F, indicating secreted glycoforms of a single polypeptide. Mass spectroscopy showed that the mean molecular mass of the active, secreted glycoprotein was 35849 Da. The recombinant enzyme (specific activity, 190 mumol p-nitrophenol/min/mg at 37 degrees C) contained 2 iron atoms/molecule and formed purple, monoclinic crystals. Exposure to the ferric chelator, 1,2-dimethyl-3-hydroxypyrid-4-one, rapidly inactivated the enzyme, which was not inhibited by alpha, alpha'-bipyridyl, a ferrous chelator. That ferric iron is essential for enzymatic catalysis, was further indicated by the synergistic effects of the reductant, dithiothreitol, and bipyridyl on phosphatase activity. The recombinant purple phosphatase catalyzed the peroxidation of 5

  1. Rat serum alkaline phosphatase electrophoretic fractions: variations with feeding, starvation and cellulose fibre ingestion.

    PubMed

    Martins, M J; Dias, P O; Hipólito-Reis, C

    1998-12-01

    The effect of feeding, starvation and fibre ingestion on alkaline phosphatase (ALP) activity (E.C. 3.1.3.1) was studied in Wistar rat serum. Using identical assay conditions for total ALP activity determination and for electrophoretic ALP isoenzymes/fractions activity calculation, alpha- and beta-naphthyl phosphates and p-nitrophenyl phosphate were used as substrates and 2-amino-2-methyl-1-propanol/HCI was used as buffer, respectively. Total activity with beta-naphthyl phosphate was significantly higher than with alpha-naphthyl phosphate and p-nitrophenyl phosphate; with alpha-naphthyl phosphate it was significantly higher than with p-nitrophenyl phosphate. With all substrates, fed animals had significantly higher total activity than starving ones. Electrophoresis allowed the separation of two fractions. The second fraction activity was significantly higher in the fed group than in the starving ones, irrespective of the substrate used. Starving animals with fibre showed higher values of this fraction than starving animals without fibre, the difference reaching statistical significance with alpha-naphthyl phosphate. The first fraction predominated in both starved groups and the second in the fed group. The second fraction was identified as intestinal ALP. We conclude that the mechanical stimulation of the digestive tract appears to influence the passage of intestinal ALP to serum. The experimental conditions used enable quantification of electrophoretic fractions based on total activity. Activity depends on the substrate used.

  2. Characterization of a novel plant PP2C-like protein Ser/Thr phosphatase as a calmodulin-binding protein.

    PubMed

    Takezawa, Daisuke

    2003-09-26

    Protein phosphatases regulated by calmodulin (CaM) mediate the action of intracellular Ca2+ and modulate functions of various target proteins by dephosphorylation. In plants, however, the role of Ca2+ in the regulation of protein dephosphorylation is not well understood due to a lack of information on characteristics of CaM-regulated protein phosphatases. Screening of a cDNA library of the moss Physcomitrella patens by using 35S-labeled calmodulin as a ligand resulted in identification of a gene, PCaMPP, that encodes a protein serine/threonine phosphatase with 373 amino acids. PCaMPP had a catalytic domain with sequence similarity to type 2C protein phosphatases (PP2Cs) with six conserved metal-associating amino acid residues and also had an extra C-terminal domain. Recombinant GST fusion proteins of PCaMPP exhibited Mn2+-dependent phosphatase activity, and the activity was inhibited by pyrophosphate and 1 mm Ca2+ but not by okadaic acid, orthovanadate, or beta-glycerophosphate. Furthermore, the PCaMPP activity was increased 1.7-fold by addition of CaM at nanomolar concentrations. CaM binding assays using deletion proteins and a synthetic peptide revealed that the CaM-binding region resides within the basic amphiphilic amino acid region 324-346 in the C-terminal domain. The CaM-binding region had sequence similarity to amino acids in one of three alpha-helices in the C-terminal domain of human PP2Calpha, suggesting a novel role of the C-terminal domains for the phosphatase activity. These results provide the first evidence showing possible regulation of PP2C-related phosphatases by Ca2+/CaM in plants. Genes similar to PCaMPP were found in genomes of various higher plant species, suggesting that PCaMPP-type protein phosphatases are conserved in land plants.

  3. Multiple forms of phosphatase from human brain: isolation and partial characterization of affi-gel blue nonbinding phosphatase activities.

    PubMed

    Cheng, L Y; Wang, J Z; Gong, C X; Pei, J J; Zaidi, T; Grundke-Iqbal, I; Iqbal, K

    2001-04-01

    Phosphatases extracted from a human brain were resolved into two main groups, namely affi-gel blue-binding phosphatases and affi-gel blue-nonbinding phosphatases. Affi-gel blue binding phosphatases were further separated into four different phosphatase activities, designated P1-P4, and described previously. In the present study we describe the affi-gel blue-nonbinding phosphatases which were separated into seven different phosphatase activities, designated P5-P11 by poly-(L-lysine)-agarose and aminohexyl Sepharose 4B chromatographies. These seven phosphatase activities were active toward nonprotein phosphoester. P7-P11 and to some extent P5 could also dephosphorylate a phosphoprotein. They displayed different enzyme kinetics. On the basis of activity peak, the apparent molecular mass as estimated by Sephadex G-200 column chromatography for P5 was 49 kDa; P6, 32 kDa; P7, 150 kDa; P8, 250 kDa; P9, 165 kDa; P10, 90 kDa and P11, 165 kDa. Immunoblot analysis indicated that P8-P11 may belong to PP2B family, whereas P7 may associate with PP2A. The phosphatases P7-P11 were found to be effective in the dephosphorylation of Alzheimer's disease abnormally hyperphosphorylated tau. The resulting dephosphorylated tau regained its activity in promoting the microtubule assembly, suggesting that P7-P11 might regulate the phosphorylation of tau protein in the brain.

  4. Phosphatase Specificity and Pathway Insulation in Signaling Networks

    PubMed Central

    Rowland, Michael A.; Harrison, Brian; Deeds, Eric J.

    2015-01-01

    Phosphatases play an important role in cellular signaling networks by regulating the phosphorylation state of proteins. Phosphatases are classically considered to be promiscuous, acting on tens to hundreds of different substrates. We recently demonstrated that a shared phosphatase can couple the responses of two proteins to incoming signals, even if those two substrates are from otherwise isolated areas of the network. This finding raises a potential paradox: if phosphatases are indeed highly promiscuous, how do cells insulate themselves against unwanted crosstalk? Here, we use mathematical models to explore three possible insulation mechanisms. One approach involves evolving phosphatase KM values that are large enough to prevent saturation by the phosphatase’s substrates. Although this is an effective method for generating isolation, the phosphatase becomes a highly inefficient enzyme, which prevents the system from achieving switch-like responses and can result in slow response kinetics. We also explore the idea that substrate degradation can serve as an effective phosphatase. Assuming that degradation is unsaturatable, this mechanism could insulate substrates from crosstalk, but it would also preclude ultrasensitive responses and would require very high substrate turnover to achieve rapid dephosphorylation kinetics. Finally, we show that adaptor subunits, such as those found on phosphatases like PP2A, can provide effective insulation against phosphatase crosstalk, but only if their binding to substrates is uncoupled from their binding to the catalytic core. Analysis of the interaction network of PP2A’s adaptor domains reveals that although its adaptors may isolate subsets of targets from one another, there is still a strong potential for phosphatase crosstalk within those subsets. Understanding how phosphatase crosstalk and the insulation mechanisms described here impact the function and evolution of signaling networks represents a major challenge for

  5. Small interfering RNA of alkaline phosphatase inhibits matrix mineralization.

    PubMed

    Kotobuki, Noriko; Matsushima, Asako; Kato, Youichi; Kubo, Yoko; Hirose, Motohiro; Ohgushi, Hajime

    2008-05-01

    To investigate the cascade of matrix mineralization, cells expressing high and low alkaline phosphatase (ALP) were separated from human osteoblast-like (HOS) cells by fluorescence-activated cell sorting with an ALP antibody. After these cells had been recloned from single cells and then cultured under osteogenic conditions, high-ALP-expressing HOS (H-HOS) cells showed matrix mineralization, but low-ALP-expressing HOS (L-HOS) cells did not. The interaction among osteogenic-related genes, such as runt-related transcription factor 2 (RUNX2), collagen type I alpha1 chain (COL1A1), tissue non-specific ALP, and osteocalcin (OCN), is well known as being related to matrix mineralization. Quantitative real-time polymerase chain reaction revealed that the gene expression of ALP was higher in H-HOS cells than in L-HOS, whereas the gene expression of RUNX2, COL1A1, and OCN was lower in H-HOS cells than in L-HOS cells. When small interfering RNAs (siRNAs) of these osteogenic-related genes were introduced into H-HOS cells by transfection, only ALP siRNA inhibited matrix mineralization. Furthermore, the expression of not only the ALP gene, but also the COL1A1 and RUNX2 genes was influenced by the inhibition of ALP, although the expression of OCN was not affected by the inhibition of ALP. We have been able to confirm that the ALP gene is a strong candidate as the trigger of matrix mineralization. These results indicate the usefulness of cloned osteogenic cells in investigating the molecular mechanisms of matrix mineralization, the function of which can be modulated by using a variety of siRNAs.

  6. Violacein cytotoxicity on human blood lymphocytes and effect on phosphatases.

    PubMed

    Bromberg, N; Justo, G Z; Haun, M; Durán, N; Ferreira, C V

    2005-10-01

    Given the importance of protein phosphorylation in the context of cellular functions, abnormal protein phosphatase activity has been implicated in several diseases, including cancer. These critical roles of protein phosphatases qualify them as potential targets for the development of medicinal compounds that possess distinct modes of action such as violacein. In this work, studies with this natural indolic pigment at a concentration of 10.0 micromol L(-1) demonstrated a 20% activation of total protein phosphatase extracted from human lymphocytes. Although no alteration was observed on protein tyrosine phosphatase (CD45), 30% of inhibition was achieved in cytoplasmatic protein phosphatase activity after incubation with 10.0 micromol L(-1) violacein. Additionally, 5.0 micromol L(-1) of violacein inhibited by 50% the serum tartrate-resistant acid phosphatase activity. Violacein presented toxic effect on lymphocytes with IC50 values of 3 and 10 micromol L(-1) for protein content and protein phosphatase activity, respectively. These findings suggest an important role for protein phosphatases in the mechanisms controlling proliferation and cell death.

  7. Distinct phosphatase activity profiles in two strains of Trypanosoma cruzi.

    PubMed

    Morales-Neto, R; Hulshof, L; Ferreira, C V; Gadelha, F R

    2009-12-01

    Phosphorylation of parasite proteins plays a key role in the process of cell invasion by Trypanosoma cruzi, the etiologic agent of Chagas' disease. In this sense, characterization of parasite kinases and phosphatases could open new possibilities for the rational design of chemotherapeutic agents for the treatment of Chagas' disease. In this work, we analyzed phosphatase activities in T. cruzi homogenates from 2 strains belonging to different lineages and with different resistance to oxidative stress. Tulahuen 2 cells (Lineage I) showed higher phosphatase activities and specificity constants when compared to the Y strain (Lineage II). Tulahuen 2 had an optimum phosphatase activity at pH 4.0 and the Y strain at pH 7.0. In both cases, neutral–basic, but not acid, phosphatase activities were increased in the presence of Mg2+. Although calcium had an inhibitory effect at a pH of 7.0 and 8.0 in the Y strain, this inhibition was restricted to pH 8.0 in the other strain. Different substrates and acid phosphotyrosine and alkaline phosphatase inhibitors exhibited distinct effects on the phosphatase activity of both strains. Our results provide a better understanding of T. cruzi phosphatases and reinforce the notion of heterogeneity among T. cruzi populations.

  8. A remote CheZ orthologue retains phosphatase function.

    PubMed

    Lertsethtakarn, Paphavee; Ottemann, Karen M

    2010-07-01

    Aspartyl-phosphate phosphatases underlie the rapid responses of bacterial chemotaxis. One such phosphatase, CheZ, was originally proposed to be restricted to beta and gamma proteobacter, suggesting only a small subset of microbes relied on this protein. A putative CheZ phosphatase was identified genetically in the epsilon proteobacter Helicobacter pylori (Mol Micro 61:187). H. pylori utilizes a chemotaxis system consisting of CheAY, three CheVs, CheW, CheY(HP) and the putative CheZ to colonize the host stomach. Here we investigate whether this CheZ has phosphatase activity. We phosphorylated potential targets in vitro using either a phosphodonor or the CheAY kinase and [gamma-(32)P]-ATP, and found that H. pylori CheZ (CheZ(HP)) efficiently dephosphorylates CheY(HP) and CheAY and has additional weak activity on CheV2. We detected no phosphatase activity towards CheV1 or CheV3. Mutations corresponding to Escherichia coli CheZ active site residues or deletion of the C-terminal region inactivate CheZ(HP) phosphatase activity, suggesting the two CheZs function similarly. Bioinformatics analysis suggests that CheZ phosphatases are found in all proteobacteria classes, as well as classes Aquificae, Deferribacteres, Nitrospira and Sphingobacteria, demonstrating that CheZ phosphatases are broadly distributed within Gram-negative bacteria.

  9. Biogeochemical drivers of phosphatase activity in salt marsh sediments

    NASA Astrophysics Data System (ADS)

    Freitas, Joana; Duarte, Bernardo; Caçador, Isabel

    2014-10-01

    Although nitrogen has become a major concern for wetlands scientists dealing with eutrophication problems, phosphorous represents another key element, and consequently its biogeochemical cycling has a crucial role in eutrophication processes. Microbial communities are a central component in trophic dynamics and biogeochemical processes on coastal systems, since most of the processes in sediments are microbial-mediated due to enzymatic action, including the mineralization of organic phosphorus carried out by acid phosphatase activity. In the present work, the authors investigate the biogeochemical sediment drivers that control phosphatase activities. Authors also aim to assess biogeochemical factors' influence on the enzyme-mediated phosphorous cycling processes in salt marshes. Plant rhizosediments and bare sediments were collected and biogeochemical features, including phosphatase activities, inorganic and organic phosphorus contents, humic acids content and pH, were assessed. Acid phosphatase was found to give the highest contribution for total phosphatase activity among the three pH-isoforms present in salt marsh sediments, favored by acid pH in colonized sediments. Humic acids also appear to have an important role inhibiting phosphatase activity. A clear relation of phosphatase activity and inorganic phosphorous was also found. The data presented reinforces the role of phosphatase in phosphorous cycling.

  10. Characterization of DNA Substrate Binding to the Phosphatase Domain of the DNA Repair Enzyme Polynucleotide Kinase/Phosphatase.

    PubMed

    Havali-Shahriari, Zahra; Weinfeld, Michael; Glover, J N Mark

    2017-03-28

    Polynucleotide kinase/phosphatase (PNKP) is a DNA strand break repair enzyme that uses separate 5' kinase and 3' phosphatase active sites to convert damaged 5'-hydroxyl/3'-phosphate strand termini to ligatable 5'-phosphate/3'-hydroxyl ends. The phosphatase active site has received particular attention as a target of inhibition in cancer therapy development. The phosphatase domain dephosphorylates a range of single- and double-stranded substrates; however, structural studies have shown that the phosphatase catalytic cleft can bind only single-stranded substrates. Here we use a catalytically inactive but structurally intact phosphatase mutant to probe interactions between PNKP and a variety of single- and double-stranded DNA substrates using an electrophoretic mobility shift assay. This work indicates that the phosphatase domain binds 3'-phosphorylated single-stranded DNAs in a manner that is highly dependent on the presence of the 3'-phosphate. Double-stranded substrate binding, in contrast, is not as dependent on the 3'-phosphate. Experiments comparing blunt-end, 3'-overhanging, and frayed-end substrates indicate that the predicted loss of energy due to base pair disruption upon binding of the phosphatase active site is likely balanced by favorable interactions between the liberated complementary strand and PNKP. Comparison of the effects on substrate binding of mutations within the phosphatase active site cleft with mutations in surrounding positively charged surfaces suggests that the surrounding surfaces are important for binding to double-stranded substrates. We further show that while fluorescence polarization methods can detect specific binding of single-stranded DNAs with the phosphatase domain, this method does not detect specific interactions between the PNKP phosphatase and double-stranded substrates.

  11. Mutations responsible for 3-phosphoserine phosphatase deficiency.

    PubMed

    Veiga-da-Cunha, Maria; Collet, Jean-François; Prieur, Benoît; Jaeken, Jaak; Peeraer, Yves; Rabbijns, Anja; Van Schaftingen, Emile

    2004-02-01

    We report the identification of the mutations in the only known case of L-3-phosphoserine phosphatase deficiency, a recessively inherited condition. The two mutations correspond to the replacement of the semiconserved Asp32 residue by an asparagine and of the extremely conserved Met52 by a threonine. The effects of both mutations were studied on the human recombinant enzyme, expressed in Escherichia coli. Met52Thr almost abolished the enzymatic activity, whereas the Asp32Asn mutation caused a 50% decrease in Vmax. In addition, L-serine, which inhibits the conversion of [(14)C] phosphoserine to serine when catalysed by the wild-type enzyme, had a lesser inhibitory effect on the Asp32Asn mutant, indicating a reduction in the rate of phosphoenzyme hydrolysis. These modifications in the properties of the enzyme are consistent with the modification in the kinetic properties observed in fibroblasts from the patient.

  12. Inhibition of renal alkaline phosphatase by cimetidine.

    PubMed

    Minai-Tehrani, Dariush; Khodai, Somayeh; Aminnaseri, Somayeh; Minoui, Saeed; Sobhani-Damavadifar, Zahra; Alavi, Sana; Osmani, Raheleh; Ahmadi, Shiva

    2011-08-01

    Alkaline phosphatase (ALP) belongs to hydrolase group of enzymes. It is responsible for removing phosphate groups from many types of molecules, including nucleotides and proteins. Cimetidine (trade name Tagamet) is an antagonist of histamine H2-receptor that inhibits the production of gastric acid. Cimetidine is used for the treatment of gastrointestinal diseases. In this study the inhibitory effect of cimetidine on mouse renal ALP activity was investigated. Our results showed that cimetidine can inhibit ALP by uncompetitive inhibition. In the absence of inhibitor the V(max) and K(m) of the enzyme were found to be 13.7 mmol/mg prot.min and 0.25 mM, respectively. Both the Vmax and Km of the enzyme decreased with increasing cimetidine concentrations (0- 1.2 mM). The Ki and IC(50) of cimetidine were determined to be about 0.5 mM and 0.52 mM, respectively.

  13. Ab initio alpha-alpha scattering

    NASA Astrophysics Data System (ADS)

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A.; Luu, Thomas; Meißner, Ulf-G.

    2015-12-01

    Processes such as the scattering of alpha particles (4He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei—nuclei with even and equal numbers of protons and neutrons—is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the ‘adiabatic projection method’ to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  14. Ab initio alpha-alpha scattering.

    PubMed

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Luu, Thomas; Meißner, Ulf-G

    2015-12-03

    Processes such as the scattering of alpha particles ((4)He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei--nuclei with even and equal numbers of protons and neutrons--is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the 'adiabatic projection method' to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  15. Functional characterization of lysophosphatidic acid phosphatase from Arabidopsis thaliana.

    PubMed

    Reddy, Venky Sreedhar; Rao, D K Venkata; Rajasekharan, Ram

    2010-04-01

    Lysophosphatidic acid (LPA) acts as a signaling molecule that regulates diverse cellular processes and it can rapidly be metabolized by phosphatase and acyltransferase. LPA phosphatase gene has not been identified and characterized in plants so far. The BLAST search revealed that the At3g03520 is similar to phospholipase family, and distantly related to bacterial phosphatases. The conserved motif, (J)4XXXNXSFD, was identified in both At3g03520 like phospholipases and acid phosphatases. In silico expression analysis of At3g03520 revealed a high expression during phosphate starvation and abiotic stresses. This gene was overexpressed in Escherichia coli and shown to posses LPA specific phosphatase activity. These results suggest that this gene possibly plays a role in signal transduction and storage lipid synthesis.

  16. Phosphoglucan phosphatase function sheds light on starch degradation.

    PubMed

    Silver, Dylan M; Kötting, Oliver; Moorhead, Greg B G

    2014-07-01

    Phosphoglucan phosphatases are novel enzymes that remove phosphates from complex carbohydrates. In plants, these proteins are vital components in the remobilization of leaf starch at night. Breakdown of starch is initiated through reversible glucan phosphorylation to disrupt the semi-crystalline starch structure at the granule surface. The phosphoglucan phosphatases starch excess 4 (SEX4) and like-SEX4 2 (LSF2) dephosphorylate glucans to provide access for amylases that release maltose and glucose from starch. Another phosphatase, LSF1, is a putative inactive scaffold protein that may act as regulator of starch degradative enzymes at the granule surface. Absence of these phosphatases disrupts starch breakdown, resulting in plants accumulating excess starch. Here, we describe recent advances in understanding the biochemical and structural properties of each of these starch phosphatases.

  17. [Roles of phosphatases in pathogen infection: a review].

    PubMed

    Zhu, Pei; Li, Xinqiang; Li, Zhenlun

    2012-02-01

    Phosphatases play a key role not only in cell physiological functions of an organism, but also in host-pathogen interactions. Many studies demonstrated that some Gram-negative pathogenic bacteria could evade host immunity and promote pathogenicity by injecting phosphatases into host cells through type III secretion system. However, there were few reports about pathogenic fungi evading the immunity of hosts. Our researches indicated that the entomogenic fungus Metarhizium anisopliae could dephosphorylate the signal transduction substance of locust humoral immunity specifically in vitro by secreting extracellular protein tyrosine phosphatase, which implied that the fungus might interfere with the immune defense of locust. To provide reference for further studies of the functions of phosphatases, we reviewed the types of phosphatases and their roles in pathogen infection.

  18. Intestinal alkaline phosphatase to treat necrotizing enterocolitis.

    PubMed

    Biesterveld, Ben E; Koehler, Shannon M; Heinzerling, Nathan P; Rentea, Rebecca M; Fredrich, Katherine; Welak, Scott R; Gourlay, David M

    2015-06-15

    Intestinal alkaline phosphatase (IAP) activity is decreased in necrotizing enterocolitis (NEC), and IAP supplementation prevents NEC development. It is not known if IAP given after NEC onset can reverse the course of the disease. We hypothesized that enteral IAP given after NEC induction would not reverse intestinal injury. NEC was induced in Sprague-Dawley pups by delivery preterm followed by formula feedings with lipopolysaccharide (LPS) and hypoxia exposure and continued up to 4 d. IAP was added to feeds on day 2 until being sacrificed on day 4. NEC severity was scored based on hematoxylin and eosin-stained terminal ileum sections, and AP activity was measured using a colorimetric assay. IAP and interleukin-6 expression were measured using real time polymerase chain reaction. NEC pups' alkaline phosphatase (AP) activity was decreased to 0.18 U/mg compared with controls of 0.57 U/mg (P < 0.01). Discontinuation of LPS and hypoxia after 2 d increased AP activity to 0.36 U/mg (P < 0.01). IAP supplementation in matched groups did not impact total AP activity or expression. Discontinuing LPS and hypoxia after NEC onset improved intestinal injury scores to 1.14 compared with continued stressors, score 2.25 (P < 0.01). IAP supplementation decreased interleukin-6 expression two-fold (P < 0.05), though did not reverse NEC intestinal damage (P = 0.5). This is the first work to demonstrate that removing the source of NEC improves intestinal damage and increases AP activity. When used as a rescue treatment, IAP decreased intestinal inflammation though did not impact injury making it likely that IAP is best used preventatively to those neonates at risk. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. Mechanism of the phosphatase component of Clostridium thermocellum polynucleotide kinase-phosphatase.

    PubMed

    Keppetipola, Niroshika; Shuman, Stewart

    2006-01-01

    Polynucleotide kinase-phosphatase (Pnkp) from Clostridium thermocellum catalyzes ATP-dependent phosphorylation of 5'-OH termini of DNA or RNA polynucleotides and Ni(2+)/Mn(2+)-dependent dephosphorylation of 2',3' cyclic phosphate, 2'-phosphate, and 3'-phosphate ribonucleotides. CthPnkp is an 870-amino-acid polypeptide composed of three domains: an N-terminal module similar to bacteriophage T4 polynucleotide kinase, a central module that resembles the dinuclear metallo-phosphoesterase superfamily, and a C-terminal ligase-like adenylyltransferase domain. Here we conducted a mutational analysis of CthPnkp that identified 11 residues required for Ni(2+)-dependent phosphatase activity with 2'-AMP and 3'-AMP. Eight of the 11 CthPnkp side chains were also required for Ni(2+)-dependent hydrolysis of p-nitrophenyl phosphate. The ensemble of essential side chains includes the conserved counterparts (Asp187, His189, Asp233, Arg237, Asn263, His264, His323, His376, and Asp392 in CthPnkp) of all of the amino acids that form the dinuclear metal-binding site and the phosphate-binding site of bacteriophage lambda phosphatase. Three residues (Asp236, His264, and Arg237) required for activity with 2'-AMP or 3'-AMP were dispensable for Ni(2+)-dependent hydrolysis of p-nitrophenyl phosphate. Our findings, together with available structural information, provide fresh insights to the metallophosphoesterase mechanism, including the roles of His264 and Asp236 in proton donation to the leaving group. Deletion analysis defined an autonomous phosphatase domain, CthPnkp-(171-424).

  20. Functional interrelationships in the alkaline phosphatase superfamily: phosphodiesterase activity of Escherichia coli alkaline phosphatase.

    PubMed

    O'Brien, P J; Herschlag, D

    2001-05-15

    Escherichia coli alkaline phosphatase (AP) is a proficient phosphomonoesterase with two Zn(2+) ions in its active site. Sequence homology suggests a distant evolutionary relationship between AP and alkaline phosphodiesterase/nucleotide pyrophosphatase, with conservation of the catalytic metal ions. Furthermore, many other phosphodiesterases, although not evolutionarily related, have a similar active site configuration of divalent metal ions in their active sites. These observations led us to test whether AP could also catalyze the hydrolysis of phosphate diesters. The results described herein demonstrate that AP does have phosphodiesterase activity: the phosphatase and phosphodiesterase activities copurify over several steps; inorganic phosphate, a strong competitive inhibitor of AP, inhibits the phosphodiesterase and phosphatase activities with the same inhibition constant; a point mutation that weakens phosphate binding to AP correspondingly weakens phosphate inhibition of the phosphodiesterase activity; and mutation of active site residues substantially reduces both the mono- and diesterase activities. AP accelerates the rate of phosphate diester hydrolysis by 10(11)-fold relative to the rate of the uncatalyzed reaction [(k(cat)/K(m))/k(w)]. Although this rate enhancement is substantial, it is at least 10(6)-fold less than the rate enhancement for AP-catalyzed phosphate monoester hydrolysis. Mutational analysis suggests that common active site features contribute to hydrolysis of both phosphate monoesters and phosphate diesters. However, mutation of the active site arginine to serine, R166S, decreases the monoesterase activity but not the diesterase activity, suggesting that the interaction of this arginine with the nonbridging oxygen(s) of the phosphate monoester substrate provides a substantial amount of the preferential hydrolysis of phosphate monoesters. The observation of phosphodiesterase activity extends the previous observation that AP has a low level of

  1. Phosphatidylinositol anchor of HeLa cell alkaline phosphatase

    SciTech Connect

    Jemmerson, R.; Low, M.G.

    1987-09-08

    Alkaline phosphatase from cancer cells, HeLa TCRC-1, was biosynthetically labeled with either /sup 3/H-fatty acids or (/sup 3/H)ethanolamine as analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and fluorography of immunoprecipitated material. Phosphatidylinositol-specific phospholipase C (PI-PLC) released a substantial proportion of the /sup 3/H-fatty acid label from immunoaffinity-purified alkaline phosphatase but had no effect on the radioactivity of (/sup 3/H)ethanolamine-labeled material. PI-PLC also liberated catalytically active alkaline phosphatase from viable cells, and this could be selectively blocked by monoclonal antibodies to alkaline phosphatase. However, the alkaline phosphatase released from /sup 3/H-fatty acid labeled cells by PI-PLC was not radioactive. By contrast, treatment with bromelain removed both the /sup 3/H-fatty acid and the (/sup 3/H)ethanolamine label from purified alkaline phosphatase. Subtilisin was also able to remove the (/sup 3/H)ethanolamine label from the purified alkaline phosphatase. The /sup 3/H radioactivity in alkaline phosphatase purified from (/sup 3/H)ethanolamine-labeled cells comigrated with authentic (/sup 3/H)ethanolamine by anion-exchange chromatography after acid hydrolysis. The data suggest that the /sup 3/H-fatty acid and (/sup 3/H)ethanolamine are covalently attached to the carboxyl-terminal segment since bromelain and subtilisin both release alkaline phosphatase from the membrane by cleavage at that end of the polypeptide chain. The data are consistent with findings for other proteins recently shown to be anchored in the membrane through a glycosylphosphatidylinositol structure and indicate that a similar structure contributes to the membrane anchoring of alkaline phosphatase.

  2. alpha-Hexachlorocyclohexane (alpha-HCH)

    Integrated Risk Information System (IRIS)

    alpha - Hexachlorocyclohexane ( alpha - HCH ) ; CASRN 319 - 84 - 6 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Ass

  3. Molecular cloning of a pancreatic islet-specific glucose-6-phosphatase catalytic subunit-related protein.

    PubMed

    Arden, S D; Zahn, T; Steegers, S; Webb, S; Bergman, B; O'Brien, R M; Hutton, J C

    1999-03-01

    A pancreatic islet-specific glucose-6-phosphatase-related protein (IGRP) was cloned using a subtractive cDNA expression cloning procedure from mouse insulinoma tissue. Two alternatively spliced variants that differed by the presence or absence of a 118-bp exon (exon IV) were detected in normal balb/c mice, diabetic ob/ob mice, and insulinoma tissue. The longer, 1901-bp full-length cDNA encoded a 355-amino acid protein (molecular weight 40,684) structurally related (50% overall identity) to the liver glucose-6-phosphatase and exhibited similar predicted transmembrane topology, conservation of catalytically important residues, and the presence of an endoplasmic reticulum retention signal. The shorter transcript encoded two possible open reading frames (ORFs), neither of which possessed His174, a residue thought to be the phosphoryl acceptor (Pan CJ, Lei KJ, Annabi B, Hemrika W, Chou JY: Transmembrane topology of glucose-6-phosphatase. J Biol Chem 273:6144-6148, 1998). Northern blot and reverse transcription-polymerase chain reaction analysis showed that the mRNA was highly expressed in pancreatic islets and expressed more in beta-cell lines than in an alpha-cell line. It was notably absent in tissues and cell lines of non-islet neuroendocrine origin, and no other major tissue source of the mRNA was found. During development, it was expressed in parallel with insulin mRNA. The mRNA was efficiently translated and glycosylated in an in vitro translation/membrane translocation system and readily transcribed into COS 1, HIT, and CHO cells using cytomegalovirus or Rous sarcoma virus promoters. Whereas the liver glucose-6-phosphatase showed activity in these transfection systems, the IGRP failed to show glucose phosphotransferase or phosphatase activity with p-nitrophenol phosphate, inorganic pyrophosphate, or a range of sugar phosphates hydrolyzed by the liver enzyme. While the metabolic function of the enzyme is not resolved, its remarkable tissue-specific expression

  4. Different designs of kinase-phosphatase interactions and phosphatase sequestration shapes the robustness and signal flow in the MAPK cascade

    PubMed Central

    2012-01-01

    Background The three layer mitogen activated protein kinase (MAPK) signaling cascade exhibits different designs of interactions between its kinases and phosphatases. While the sequential interactions between the three kinases of the cascade are tightly preserved, the phosphatases of the cascade, such as MKP3 and PP2A, exhibit relatively diverse interactions with their substrate kinases. Additionally, the kinases of the MAPK cascade can also sequester their phosphatases. Thus, each topologically distinct interaction design of kinases and phosphatases could exhibit unique signal processing characteristics, and the presence of phosphatase sequestration may lead to further fine tuning of the propagated signal. Results We have built four architecturally distinct types of models of the MAPK cascade, each model with identical kinase-kinase interactions but unique kinases-phosphatases interactions. Our simulations unravelled that MAPK cascade’s robustness to external perturbations is a function of nature of interaction between its kinases and phosphatases. The cascade’s output robustness was enhanced when phosphatases were sequestrated by their target kinases. We uncovered a novel implicit/hidden negative feedback loop from the phosphatase MKP3 to its upstream kinase Raf-1, in a cascade resembling the B cell MAPK cascade. Notably, strength of the feedback loop was reciprocal to the strength of phosphatases’ sequestration and stronger sequestration abolished the feedback loop completely. An experimental method to verify the presence of the feedback loop is also proposed. We further showed, when the models were activated by transient signal, memory (total time taken by the cascade output to reach its unstimulated level after removal of signal) of a cascade was determined by the specific designs of interaction among its kinases and phosphatases. Conclusions Differences in interaction designs among the kinases and phosphatases can differentially shape the robustness and

  5. Intracellular target for alpha-terthienyl photosensitization: involvement of lysosomal membrane damage.

    PubMed

    Sasaki, M; Koyama, S; Tokiwa, K; Fujita, H

    1993-05-01

    Intracellular targets for the photosensitizer alpha-terthienyl (alpha T) were examined by fluorescence microscopy and microfluorospectrometry using human nonkeratinized buccal cells. Intracellular distribution of alpha T was observed as fluorescent patches widely dispersed in the cytoplasm. The distribution of the fluorescent patches was compared with that of acid phosphatase activity visualized as an azo dye produced by the fast garnet 2-methyl-4-[(2-methyl-phenyl)azo]benzenediasonium sulfate reaction. Because both the distribution sites coincided, lysosomes were the likely sites of intracellular affinity of alpha T. However, because acid phosphatase is not a specific lysosomal marker, we tried to detect another lysosomal enzyme, beta-galactosidase, to confirm if the fluorescent patches were lysosomes, using fluorescein-di-(beta-D-galactopyranoside) (FDG) as a fluorogenic substrate. Without UV-A (320-400 nm) irradiation of the cells after uptake of alpha T and FDG, no significant fluorescence was observed. In contrast, with prior UV-A irradiation in the presence of alpha T and FDG, the bright yellow fluorescence of fluorescein, which is the digested product of FDG, was clearly detected in the cells by fluorescence microscopy. This observation implied that inflow of external FDG into the lysosomes is caused by lysosomal membrane damage on alpha T photosensitization. The present results indicated that lysosomes are the primary photosensitization site of alpha T.

  6. Alpha-tocopherol as a modulator of smooth muscle cell proliferation.

    PubMed

    Azzi, A; Boscoboinik, D; Clément, S; Marilley, D; Ozer, N K; Ricciarelli, R; Tasinato, A

    1997-10-01

    The effects of alpha-tocopherol and beta-tocopherol have been studied in rat and human aortic smooth muscle cells. Alpha-tocopherol, but not beta-tocopherol, inhibited smooth muscle cell proliferation and protein kinase C in a dose-dependent manner, at concentrations ranging from 10 to 50 microM. Beta-tocopherol added simultaneously with alpha-tocopherol prevented both proliferation and protein kinase C inhibition. Protein kinase C inhibition was cell cycle-dependent and it was prevented by okadaic acid, a protein phosphatase inhibitor. Protein kinase C activity measured from aortas of cholesterol-fed rabbits was also inhibited by alpha-tocopherol. By using protein kinase C (PKC) isoform-specific inhibitors and immunoprecipitation reactions it was found that PKC-alpha was selectively inhibited by alpha-tocopherol. Further, an activation of protein phosphatase 2A by alpha-tocopherol was found, which caused PKC-alpha dephosphorylation and inhibition. Ultimately, this cascade of events at the level of cell signal transduction leads to the inhibition of smooth muscle cell proliferation.

  7. Alpha-1 antitrypsin test

    MedlinePlus

    ... this page: //medlineplus.gov/ency/article/003715.htm Alpha-1 antitrypsin blood test To use the sharing features on this page, please enable JavaScript. Alpha-1 antitrypsin is a laboratory test to measure ...

  8. HAD superfamily phosphotransferase substrate diversification: structure and function analysis of HAD subclass IIB sugar phosphatase BT4131.

    PubMed

    Lu, Zhibing; Dunaway-Mariano, Debra; Allen, Karen N

    2005-06-21

    The BT4131 gene from the bacterium Bacteroides thetaiotaomicron VPI-5482 has been cloned and overexpressed in Escherichia coli. The protein, a member of the haloalkanoate dehalogenase superfamily (subfamily IIB), was purified to homogeneity, and its X-ray crystal structure was determined to1.9 A resolution using the molecular replacement phasing method. BT4131 was shown by an extensive substrate screen to be a broad-range sugar phosphate phosphatase. On the basis of substrate specificity and gene context, the physiological function of BT4131 in chitin metabolism has been tentatively assigned. Comparison of the BT4131 structure alpha/beta cap domain structure with those of other type IIB enzymes (phosphoglycolate phosphatase, trehalose-6-phosphate phosphatase, and proteins of unknown function known as PDB entries , , and ) identified two conserved loops (BT4131 residues 172-182 and 118-130) in the alphabetabeta(alphabetaalphabeta)alphabetabeta type caps and one conserved loop in the alphabetabetaalphabetabeta type caps, which contribute residues for contact with the substrate leaving group. In BT4131, the two loops contribute one polar and two nonpolar residues to encase the displaced sugar. This finding is consistent with the lax specificity BT4131 has for the ring size and stereochemistry of the sugar phosphate. In contrast, substrate docking showed that the high-specificity phosphoglycolate phosphatase (PDB entry ) uses a single substrate specificity loop to position three polar residues for interaction with the glycolate leaving group. We show how active site "solvent cages" derived from analysis of the structures of the type IIB HAD phosphatases could be used in conjunction with the identity of the residues stationed along the cap domain substrate specificity loops, as a means of substrate identification.

  9. Bacillus cereus Phosphopentomutase Is an Alkaline Phosphatase Family Member That Exhibits an Altered Entry Point into the Catalytic Cycle

    SciTech Connect

    Panosian, Timothy D.; Nannemann, David P.; Watkins, Guy R.; Phelan, Vanessa V.; McDonald, W. Hayes; Wadzinski, Brian E.; Bachmann, Brian O.; Iverson, Tina M.

    2011-09-15

    Bacterial phosphopentomutases (PPMs) are alkaline phosphatase superfamily members that interconvert {alpha}-D-ribose 5-phosphate (ribose 5-phosphate) and {alpha}-D-ribose 1-phosphate (ribose 1-phosphate). We investigated the reaction mechanism of Bacillus cereus PPM using a combination of structural and biochemical studies. Four high resolution crystal structures of B. cereus PPM revealed the active site architecture, identified binding sites for the substrate ribose 5-phosphate and the activator {alpha}-D-glucose 1,6-bisphosphate (glucose 1,6-bisphosphate), and demonstrated that glucose 1,6-bisphosphate increased phosphorylation of the active site residue Thr-85. The phosphorylation of Thr-85 was confirmed by Western and mass spectroscopic analyses. Biochemical assays identified Mn{sup 2+}-dependent enzyme turnover and demonstrated that glucose 1,6-bisphosphate treatment increases enzyme activity. These results suggest that protein phosphorylation activates the enzyme, which supports an intermolecular transferase mechanism. We confirmed intermolecular phosphoryl transfer using an isotope relay assay in which PPM reactions containing mixtures of ribose 5-[{sup 18}O{sub 3}]phosphate and [U-{sup 13}C{sub 5}]ribose 5-phosphate were analyzed by mass spectrometry. This intermolecular phosphoryl transfer is seemingly counter to what is anticipated from phosphomutases employing a general alkaline phosphatase reaction mechanism, which are reported to catalyze intramolecular phosphoryl transfer. However, the two mechanisms may be reconciled if substrate encounters the enzyme at a different point in the catalytic cycle.

  10. The Alpha Centauri System.

    ERIC Educational Resources Information Center

    Soderblom, David R.

    1987-01-01

    Describes the Alpha Centauri star system, which is the closest star system to the sun. Discusses the difficulties associated with measurements involving Alpha Centauri, along with some of the recent advances in stellar seismology. Raises questions about the possibilities of planets around Alpha Centauri. (TW)

  11. The Alpha Antihydrogen Experiment

    NASA Astrophysics Data System (ADS)

    Madsen, N.; Andresen, G.; Bertsche, W.; Boston, A.; Bowe, P. D.; Butler, E.; Cesar, C. L.; Chapman, S.; Charlton, M.; Chartier, M.; Fajans, J.; Funakoshi, R.; Gill, D. R.; Hangst, J. S.; Hardy, W. N.; Hayano, R. S.; Hayden, M.; Hydomako, R.; Jenkins, M. J.; Jørgensen, L. V.; Kurchaninov, L.; Nolan, P.; Olchanski, K.; Olin, A.; Page, R. D.; Povilus, A.; Robicheaux, F.; Sarid, E.; Seif El Nasr, S.; Silveira, D. M.; Storey, J. W.; Thompson, R. I.; van der Werf, D. P.; Wurtele, J. S.; Yamazaki, Y.

    2008-03-01

    ALPHA is a new experiment at the CERN Antiproton Decelerator (AD). The short term goal of ALPHA is trapping of cold antihydrogen, with the long term goal of conducting precise spectroscopic comparisons of hydrogen and antihydrogen. Here we present the current status of ALPHA and the physics considerations and results leading to its design as well as recent progress towards trapping.

  12. The Alpha Centauri System.

    ERIC Educational Resources Information Center

    Soderblom, David R.

    1987-01-01

    Describes the Alpha Centauri star system, which is the closest star system to the sun. Discusses the difficulties associated with measurements involving Alpha Centauri, along with some of the recent advances in stellar seismology. Raises questions about the possibilities of planets around Alpha Centauri. (TW)

  13. Structural Mechanisms of Plant Glucan Phosphatases in Starch Metabolism

    PubMed Central

    Meekins, David A.; Vander Kooi, Craig W.; Gentry, Matthew S.

    2016-01-01

    Glucan phosphatases are a recently discovered class of enzymes that dephosphorylate starch and glycogen, thereby regulating energy metabolism. Plant genomes encode for two glucan phosphatases called Starch EXcess4 (SEX4) and Like Sex Four2 (LSF2) that regulate starch metabolism by selectively dephosphorylating glucose moieties within starch glucan chains. Recently, the structures of both SEX4 and LSF2 were determined, with and without phosphoglucan products bound, revealing the mechanism for their unique activities. This review explores the structural and enzymatic features of the plant glucan phosphatases and outlines how they are uniquely adapted for carrying out their cellular functions. We outline the physical mechanisms employed by SEX4 and LSF2 to interact with starch glucans: SEX4 binds glucan chains via a continuous glucan binding platform comprised of its Dual Specificity Phosphatase (DSP) domain and Carbohydrate Binding Module (CBM) while LSF2 utilizes Surface Binding Sites (SBSs). SEX4 and LSF2 both contain a unique network of aromatic residues in their catalytic DSP domains that serve as glucan engagement platforms and are unique to the glucan phosphatases. We also discuss the phosphoglucan substrate specificities inherent to SEX4 and LSF2 and outline structural features within the active site that govern glucan orientation. This review defines the structural mechanism of the plant glucan phosphatases with respect to phosphatases, starch metabolism, and protein-glucan interaction; thereby providing a framework for their applications in both agricultural and industrial settings. PMID:26934589

  14. Cracking the phosphatase code: docking interactions determine substrate specificity.

    PubMed

    Roy, Jagoree; Cyert, Martha S

    2009-12-08

    Phosphoserine- and phosphothreonine-directed phosphatases display remarkable substrate specificity, yet the sites that they dephosphorylate show little similarity in amino acid sequence. Studies reveal that docking interactions are key for the recognition of substrates and regulators by two conserved phosphatases, protein phosphatase 1 (PP1) and the Ca2+-calmodulin-dependent phosphatase calcineurin. In each case, a small degenerate sequence motif in the interacting protein directs low-affinity binding to a docking surface on the phosphatase that is distinct from the active site; several such interactions combine to confer overall binding specificity. Some docking surfaces are conserved, such as a hydrophobic groove on a face opposite the active site that serves as a major recognition surface for the "RVxF" motif of proteins that interact with PP1 and the "PxIxIT" motif of substrates of calcineurin. Secondary motifs combine with this primary targeting sequence to specify phosphatase binding. A comprehensive interactome for mammalian PP1 was described, analysis of which defines several PP1-binding motifs. Studies of "LxVP," a secondary calcineurin-binding sequence, establish that this motif is a conserved feature of calcineurin substrates and that the immunosuppressants FK506 and cyclosporin A inhibit the phosphatase by interfering with LxVP-mediated docking.

  15. Giardia lamblia: Characterization of ecto-phosphatase activities.

    PubMed

    Amazonas, Juliana Natal; Cosentino-Gomes, Daniela; Werneck-Lacerda, Aline; Pinheiro, Ana Acácia de Sá; Lanfredi-Rangel, Adriana; De Souza, Wanderley; Meyer-Fernandes, José R

    2009-01-01

    Ecto-phosphatase activities of Giardia lamblia were characterized in intact cells, which are able to hydrolyze the artificial substrate p-nitrophenylphosphate (p-NPP) to p-nitrophenol (p-NP) at a rate of 8.4+/-0.8 nmol p-NP/h/10(7) cells. The ecto-phosphatase activities were inhibited at high pH as well as by classical inhibitors of acid phosphatases, such as sodium fluoride and sodium molybdate and by inorganic phosphate, the final product of the reaction. Experiments using a classical inhibitor of phosphotyrosine phosphatase, sodium orthovanadate, also showed that the ecto-phosphatase activity was inhibited in a dose-dependent manner. Different phosphorylated amino acids were used as substrates for the G. lamblia ecto-phosphatase activities the highest rate of phosphate release was achieved using phosphotyrosine. Not only p-NPP hydrolysis but also phosphotyrosine hydrolysis was inhibited by sodium orthovanadate. Phosphotyrosine but not phospho-serine or phospho-threonine inhibited the p-nitrophenylphosphatase activity. We also observed a positive correlation between the ecto-phosphatase activity and the capacity to encystation of G. lamblia trophozoites.

  16. A bifunctional kinase-phosphatase in bacterial chemotaxis.

    PubMed

    Porter, Steven L; Roberts, Mark A J; Manning, Cerys S; Armitage, Judith P

    2008-11-25

    Phosphorylation-based signaling pathways employ dephosphorylation mechanisms for signal termination. Histidine to aspartate phosphosignaling in the two-component system that controls bacterial chemotaxis has been studied extensively. Rhodobacter sphaeroides has a complex chemosensory pathway with multiple homologues of the Escherichia coli chemosensory proteins, although it lacks homologues of known signal-terminating CheY-P phosphatases, such as CheZ, CheC, FliY or CheX. Here, we demonstrate that an unusual CheA homologue, CheA(3), is not only a phosphodonor for the principal CheY protein, CheY(6), but is also is a specific phosphatase for CheY(6)-P. This phosphatase activity accelerates CheY(6)-P dephosphorylation to a rate that is comparable with the measured stimulus response time of approximately 1 s. CheA(3) possesses only two of the five domains found in classical CheAs, the Hpt (P1) and regulatory (P5) domains, which are joined by a 794-amino acid sequence that is required for phosphatase activity. The P1 domain of CheA(3) is phosphorylated by CheA(4), and it subsequently acts as a phosphodonor for the response regulators. A CheA(3) mutant protein without the 794-amino acid region lacked phosphatase activity, retained phosphotransfer function, but did not support chemotaxis, suggesting that the phosphatase activity may be required for chemotaxis. Using a nested deletion approach, we showed that a 200-amino acid segment of CheA(3) is required for phosphatase activity. The phosphatase activity of previously identified nonhybrid histidine protein kinases depends on the dimerization and histidine phosphorylation (DHp) domains. However, CheA(3) lacks a DHp domain, suggesting that its phosphatase mechanism is different from that of other histidine protein kinases.

  17. Enhanced calcium cycling and contractile function in transgenic hearts expressing constitutively active G alpha o* protein.

    PubMed

    Zhu, Ming; Gach, Agnieszka A; Liu, GongXin; Xu, Xiaomei; Lim, Chee Chew; Zhang, Julie X; Mao, Lan; Chuprun, Kurt; Koch, Walter J; Liao, Ronglih; Koren, Gideon; Blaxall, Burns C; Mende, Ulrike

    2008-03-01

    In contrast to the other heterotrimeric GTP-binding proteins (G proteins) Gs and Gi, the functional role of G o is still poorly defined. To investigate the role of G alpha o in the heart, we generated transgenic mice with cardiac-specific expression of a constitutively active form of G alpha o1* (G alpha o*), the predominant G alpha o isoform in the heart. G alpha o expression was increased 3- to 15-fold in mice from 5 independent lines, all of which had a normal life span and no gross cardiac morphological abnormalities. We demonstrate enhanced contractile function in G alpha o* transgenic mice in vivo, along with increased L-type Ca2+ channel current density, calcium transients, and cell shortening in ventricular G alpha o*-expressing myocytes compared with wild-type controls. These changes were evident at baseline and maintained after isoproterenol stimulation. Expression levels of all major Ca2+ handling proteins were largely unchanged, except for a modest reduction in Na+/Ca2+ exchanger in transgenic ventricles. In contrast, phosphorylation of the ryanodine receptor and phospholamban at known PKA sites was increased 1.6- and 1.9-fold, respectively, in G alpha o* ventricles. Density and affinity of beta-adrenoceptors, cAMP levels, and PKA activity were comparable in G alpha o* and wild-type myocytes, but protein phosphatase 1 activity was reduced upon G alpha o* expression, particularly in the vicinity of the ryanodine receptor. We conclude that G alpha o* exerts a positive effect on Ca2+ cycling and contractile function. Alterations in protein phosphatase 1 activity rather than PKA-mediated phosphorylation might be involved in hyperphosphorylation of key Ca2+ handling proteins in hearts with constitutive G alpha o activation.

  18. Evidence for an indirect transcriptional regulation of glucose-6-phosphatase gene expression by liver X receptors

    SciTech Connect

    Grempler, Rolf . E-mail: rolfgrempler@yahoo.de; Guenther, Susanne; Steffensen, Knut R.; Nilsson, Maria; Barthel, Andreas; Schmoll, Dieter

    2005-12-16

    Liver X receptor (LXR) paralogues {alpha} and {beta} (LXR{alpha} and LXR{beta}) are members of the nuclear hormone receptor family and have oxysterols as endogenous ligands. LXR activation reduces hepatic glucose production in vivo through the inhibition of transcription of the key gluconeogenic enzymes phosphoenolpyruvate carboxykinase and glucose-6-phosphatase (G6Pase). In the present study, we investigated the molecular mechanisms involved in the regulation of G6Pase gene expression by LXR. Both T0901317, a synthetic LXR agonist, and the adenoviral overexpression of either LXR{alpha} or LXR{beta} suppressed G6Pase gene expression in H4IIE hepatoma cells. However, compared to the suppression of G6Pase expression seen by insulin, the decrease of G6Pase mRNA by LXR activation was delayed and was blocked by cycloheximide, an inhibitor of protein synthesis. These observations, together with the absence of a conserved LXR-binding element within the G6Pase promoter, suggest an indirect inhibition of G6Pase gene expression by liver X receptors.

  19. Structural and kinetic properties of a novel purple acid phosphatase from phosphate-starved tomato (Lycopersicon esculentum) cell cultures.

    PubMed Central

    Bozzo, Gale G; Raghothama, Kashchandra G; Plaxton, William C

    2004-01-01

    An intracellular acid phosphatase (IAP) from P(i)-starved (-P(i)) tomato ( Lycopersicon esculentum ) suspension cells has been purified to homogeneity. IAP is a purple acid phosphatase (PAP), as the purified protein was violet in colour (lambda(max)=546 nm) and was insensitive to L-tartrate. PAGE, periodic acid-Schiff staining and peptide mapping demonstrated that the enzyme exists as a 142 kDa heterodimer composed of an equivalent ratio of glycosylated and structurally dissimilar 63 (alpha-subunit) and 57 kDa (beta-subunit) polypeptides. However, the nine N-terminal amino acids of the alpha- and beta-subunits were identical, exhibiting similarity to the deduced N-terminal portions of several putative plant PAPs. Quantification of immunoblots probed with rabbit anti-(tomato acid phosphatase) immune serum revealed that the 4-fold increase in IAP activity due to P(i)-deprivation was correlated with similar increases in the amount of antigenic IAP alpha- and beta-subunits. IAP displayed optimal activity at pH 5.1, was activated 150% by 10 mM Mg(2+), but was potently inhibited by Zn(2+), Cu(2+), Fe(3+), molybdate, vanadate, fluoride and P(i). Although IAP demonstrated broad substrate selectivity, its specificity constant ( V (max)/ K (m)) with phosphoenolpyruvate was >250% greater than that obtained with any other substrate. IAP exhibited significant peroxidase activity, which was optimal at pH 9.0 and insensitive to Mg(2+) or molybdate. This IAP is proposed to scavenge P(i) from intracellular phosphate esters in -P(i) tomato. A possible secondary IAP role in the metabolism of reactive oxygen species is discussed. IAP properties are compared with those of two extracellular PAP isoenzymes that are secreted into the medium of -P(i) tomato cells [Bozzo, Raghothama and Plaxton (2002) Eur. J. Biochem. 269, 6278-6286]. PMID:14521509

  20. Structural and kinetic properties of a novel purple acid phosphatase from phosphate-starved tomato (Lycopersicon esculentum) cell cultures.

    PubMed

    Bozzo, Gale G; Raghothama, Kashchandra G; Plaxton, William C

    2004-01-15

    An intracellular acid phosphatase (IAP) from P(i)-starved (-P(i)) tomato ( Lycopersicon esculentum ) suspension cells has been purified to homogeneity. IAP is a purple acid phosphatase (PAP), as the purified protein was violet in colour (lambda(max)=546 nm) and was insensitive to L-tartrate. PAGE, periodic acid-Schiff staining and peptide mapping demonstrated that the enzyme exists as a 142 kDa heterodimer composed of an equivalent ratio of glycosylated and structurally dissimilar 63 (alpha-subunit) and 57 kDa (beta-subunit) polypeptides. However, the nine N-terminal amino acids of the alpha- and beta-subunits were identical, exhibiting similarity to the deduced N-terminal portions of several putative plant PAPs. Quantification of immunoblots probed with rabbit anti-(tomato acid phosphatase) immune serum revealed that the 4-fold increase in IAP activity due to P(i)-deprivation was correlated with similar increases in the amount of antigenic IAP alpha- and beta-subunits. IAP displayed optimal activity at pH 5.1, was activated 150% by 10 mM Mg(2+), but was potently inhibited by Zn(2+), Cu(2+), Fe(3+), molybdate, vanadate, fluoride and P(i). Although IAP demonstrated broad substrate selectivity, its specificity constant ( V (max)/ K (m)) with phosphoenolpyruvate was >250% greater than that obtained with any other substrate. IAP exhibited significant peroxidase activity, which was optimal at pH 9.0 and insensitive to Mg(2+) or molybdate. This IAP is proposed to scavenge P(i) from intracellular phosphate esters in -P(i) tomato. A possible secondary IAP role in the metabolism of reactive oxygen species is discussed. IAP properties are compared with those of two extracellular PAP isoenzymes that are secreted into the medium of -P(i) tomato cells [Bozzo, Raghothama and Plaxton (2002) Eur. J. Biochem. 269, 6278-6286].

  1. The effect of hibernation on protein phosphatases from ground squirrel organs.

    PubMed

    MacDonald, Justin A; Storey, Kenneth B

    2007-12-15

    Protein phosphorylation has been identified as a reversible mechanism for the regulated suppression of metabolism and thermogenesis during mammalian hibernation. The effects of hibernation on the activity of serine/threonine and tyrosine protein phosphatases (PP1, PP2A, PP2C and PTPs) were assessed in five organs of Richardson's ground squirrel. Each phosphatase subfamily responded differently during torpor, and each showed organ-specific patterns of activity changes. The distribution of PP1 catalytic subunit (PP1c) isoforms (alpha, delta, gamma1) was assessed in five organs, and changes in the subcellular distribution of PP1 were observed during hibernation in liver and muscle. For example, in muscle, cytosolic PP1 content increased and myofibril-associated PP1 decreased during torpor. PP1c from ground squirrel liver was purified to homogeneity and characterized; temperature effects on PP1c maximal activity suggested that temperature had little or no effect on relative dephosphorylation potential at low temperatures. However, nucleotide inhibition of PP1c by ATP, ADP and AMP was much weaker at 5 degrees C compared with 37 degrees C assay temperatures. PP2A activity decreased in three organs (brown adipose, kidney, brain) during hibernation whereas PP2C activity was increased in liver and brain. PTPs were assessed using both a general substrate (ENDpYINASL) and a substrate (DADEpYLIPQQG) specific for PTPs containing the SH2-binding site; both revealed hibernation-associated changes in PTP activities. Changes in protein phosphatase activities suggest the relative importance of these modules in controlling metabolic function and cellular processes during mammalian hibernation.

  2. Characterization of dolichol and dolichyl phosphate phosphatase from soya beans (Glycine max).

    PubMed Central

    Ravi, K; Rip, J W; Carroll, K K

    1983-01-01

    A series of polyprenols, ranging in length from 15 to 22 isoprene units, has been isolated from soya beans (Glycine max) and purified by high-pressure liquid chromatography. N.m.r., i.r. and mass spectra of the compounds indicated that they are alpha-saturated polyprenols of the dolichol type. The amount present in dry seeds was about 9 mg/100 g, whereas dolichyl phosphate (Dol-P) was present only in trace amounts. Dol-P phosphatase activity was detected in the microsomal fraction of 5-day-old germinating soya-bean cotyledons. The Dol-P phosphatase activity was linear with respect to time and protein concentration and exhibited a broad pH optimum (pH 7-9). Triton X-100 was necessary for significant enzyme activity. Enzyme activity was slightly enhanced by EDTA, whereas dithiothreitol was without effect. An apparent Km of 5 microM was determined for Dol-P. Bivalent metal ions were not required for enzyme activity. A number of phosphorylated compounds tested as enzyme substrates (including a number of nucleoside phosphates, glucose 6-phosphate, sodium beta-glycerophosphate and Na4P2O7) did not compete with [1-3H]Dol-P as substrate. A number of phospholipids were also tested for their ability to act as Dol-P phosphatase substrates. At 1 mM concentration, phosphatidylcholine, phosphatidylethanolamine, phosphatidic acid and lysophosphatidic acid each inhibited enzymic activity. However, at 0.1 mM concentration, phosphatidylcholine and phosphatidylethanolamine were slightly stimulatory, whereas phosphatidic acid and lysophosphatidic acid were still inhibitory. Phosphatidic acid showed competitive inhibition. PMID:6311165

  3. Penicillin inhibitors of purple acid phosphatase.

    PubMed

    Faridoon; Hussein, Waleed M; Ul Islam, Nazar; Guddat, Luke W; Schenk, Gerhard; McGeary, Ross P

    2012-04-01

    Purple acid phosphatases (PAPs) are binuclear metallohydrolases that have a multitude of biological functions and are found in fungi, bacteria, plants and animals. In mammals, PAP activity is linked with bone resorption and over-expression can lead to bone disorders such as osteoporosis. PAP is therefore an attractive target for the development of drugs to treat this disease. A series of penicillin conjugates, in which 6-aminopenicillanic acid was acylated with aromatic acid chlorides, has been prepared and assayed against pig PAP. The binding mode of most of these conjugates is purely competitive, and some members of this class have potencies comparable to the best PAP inhibitors yet reported. The structurally related penicillin G was shown to be neither an inhibitor nor a substrate for pig PAP. Molecular modelling has been used to examine the binding modes of these compounds in the active site of the enzyme and to rationalise their activities. Crown Copyright © 2012. Published by Elsevier Ltd. All rights reserved.

  4. Universal phosphatase-coupled glycosyltransferase assay.

    PubMed

    Wu, Zhengliang L; Ethen, Cheryl M; Prather, Brittany; Machacek, Miranda; Jiang, Weiping

    2011-06-01

    A nonradioactive glycosyltransferase assay is described here. This method takes advantage of specific phosphatases that can be added into glycosyltransferase reactions to quantitatively release inorganic phosphate from the leaving groups of glycosyltransferase reactions. The released phosphate group is then detected using colorimetric malachite-based reagents. Because the amount of phosphate released is directly proportional to the sugar molecule transferred in a glycosyltransferase reaction, this method can be used to obtain accurate kinetic parameters of the glycosyltransferase. The assay can be performed in multiwell plates and quantitated by a plate reader, thus making it amenable to high-throughput screening. It has been successfully applied to all glycosyltransferases available to us, including glucosyltransferases, N-acetylglucosaminyltransferases, N-acetylgalactosyltransferases, galactosyltransferases, fucosyltransferases and sialyltransferases. As examples, we first assayed Clostridium difficile toxin B, a protein O-glucosyltransferase that specifically monoglucosylates and inactivates Rho family small GTPases; we then showed that human KTELC1, a homolog of Rumi from Drosophila, was able to hydrolyze UDP-Glc; and finally, we measured the kinetic parameters of human sialyltransferase ST6GAL1.

  5. Protein tyrosine phosphatases: structure-function relationships.

    PubMed

    Tabernero, Lydia; Aricescu, A Radu; Jones, E Yvonne; Szedlacsek, Stefan E

    2008-03-01

    Structural analysis of protein tyrosine phosphatases (PTPs) has expanded considerably in the last several years, producing more than 200 structures in this class of enzymes (from 35 different proteins and their complexes with ligands). The small-medium size of the catalytic domain of approximately 280 residues plus a very compact fold makes it amenable to cloning and overexpression in bacterial systems thus facilitating crystallographic analysis. The low molecular weight PTPs being even smaller, approximately 150 residues, are also perfect targets for NMR analysis. The availability of different structures and complexes of PTPs with substrates and inhibitors has provided a wealth of information with profound effects in the way we understand their biological functions. Developments in mammalian expression technology recently led to the first crystal structure of a receptor-like PTP extracellular region. Altogether, the PTP structural work significantly advanced our knowledge regarding the architecture, regulation and substrate specificity of these enzymes. In this review, we compile the most prominent structural traits that characterize PTPs and their complexes with ligands. We discuss how the data can be used to design further functional experiments and as a basis for drug design given that many PTPs are now considered strategic therapeutic targets for human diseases such as diabetes and cancer.

  6. Identification of human pulmonary alkaline phosphatase isoenzymes.

    PubMed

    Capelli, A; Cerutti, C G; Lusuardi, M; Donner, C F

    1997-04-01

    An increase of alkaline phosphatase (ALP) activity has been observed in the bronchoalveolar lavage fluid (BALF) of patients affected by pulmonary fibrosis in chronic interstitial lung disorders. To characterize the ALP isoenzymes in such cases, we used gel filtration, agarose gel electrophoresis, heat and amino acid inhibition assays, wheat-germ agglutinin (WGA) precipitation, and an immunoassay specific for the bone-isoform of ALP. Only one anodic band representing a high-molecular-weight isoform of ALP (Mr approximately 2,000 kDa) was observed on electrophoresis of BALF. The inhibition assay results were consistent for a tissue-nonspecific isoenzyme sensitive to a temperature of 56 degrees C (71.9 +/- 2.5% inhibition) and to homoarginine (65.7 +/- 1.9%), and resistant to L-phenylalanine and L-leucine. Less than 13% of ALP activity was heat-stable. After incubation of BALF specimens with glycosyl-phosphatidylinositol-phospholipase D plus Nonidet P-40, or with phosphatidylinositol-phospholipase C alone, an electrophoretic cathodic band (Mr approximately 220 kDa) appeared near the bone band of a standard serum. With the WGA assay, 84.4 +/- 3.3% of ALP precipitated and the band disappeared. After immunoassay for the bone isoform, a mean of less than 5% enzyme activity was measured. We conclude that the ALP found in BALF is a pulmonary isoform of a tissue nonspecific isoenzyme.

  7. Emerging Roles of Human Prostatic Acid Phosphatase

    PubMed Central

    Kong, Hoon Young; Byun, Jonghoe

    2013-01-01

    Prostate cancer is one of the most prevalent non-skin related cancers. It is the second leading cause of cancer deaths among males in most Western countries. If prostate cancer is diagnosed in its early stages, there is a higher probability that it will be completely cured. Prostatic acid phosphatase (PAP) is a non-specific phosphomonoesterase synthesized in prostate epithelial cells and its level proportionally increases with prostate cancer progression. PAP was the biochemical diagnostic mainstay for prostate cancer until the introduction of prostate-specific antigen (PSA) which improved the detection of early-stage prostate cancer and largely displaced PAP. Recently, however, there is a renewed interest in PAP because of its usefulness in prognosticating intermediate to high-risk prostate cancers and its success in the immunotherapy of prostate cancer. Although PAP is believed to be a key regulator of prostate cell growth, its exact role in normal prostate as well as detailed molecular mechanism of PAP regulation is still unclear. Here, many different aspects of PAP in prostate cancer are revisited and its emerging roles in other environment are discussed. PMID:24009853

  8. Alkaline Phosphatase, an Unconventional Immune Protein.

    PubMed

    Rader, Bethany A

    2017-01-01

    Recent years have seen an increase in the number of studies focusing on alkaline phosphatases (APs), revealing an expanding complexity of function of these enzymes. Of the four human AP (hAP) proteins, most is known about tissue non-specific AP (TNAP) and intestinal AP (IAP). This review highlights current understanding of TNAP and IAP in relation to human health and disease. TNAP plays a role in multiple processes, including bone mineralization, vitamin B6 metabolism, and neurogenesis, is the genetic cause of hypophosphatasia, influences inflammation through regulation of purinergic signaling, and has been implicated in Alzheimer's disease. IAP regulates fatty acid absorption and has been implicated in the regulation of diet-induced obesity and metabolic syndrome. IAP and TNAP can dephosphorylate bacterial-derived lipopolysaccharide, and IAP has been identified as a potential regulator of the composition of the intestinal microbiome, an evolutionarily conserved function. Endogenous and recombinant bovine APs and recombinant hAPs are currently being explored for their potential as pharmacological agents to treat AP-associated diseases and mitigate multiple sources of inflammation. Continued research on these versatile proteins will undoubtedly provide insight into human pathophysiology, biochemistry, and the human holobiont.

  9. Alkaline Phosphatase, an Unconventional Immune Protein

    PubMed Central

    Rader, Bethany A.

    2017-01-01

    Recent years have seen an increase in the number of studies focusing on alkaline phosphatases (APs), revealing an expanding complexity of function of these enzymes. Of the four human AP (hAP) proteins, most is known about tissue non-specific AP (TNAP) and intestinal AP (IAP). This review highlights current understanding of TNAP and IAP in relation to human health and disease. TNAP plays a role in multiple processes, including bone mineralization, vitamin B6 metabolism, and neurogenesis, is the genetic cause of hypophosphatasia, influences inflammation through regulation of purinergic signaling, and has been implicated in Alzheimer’s disease. IAP regulates fatty acid absorption and has been implicated in the regulation of diet-induced obesity and metabolic syndrome. IAP and TNAP can dephosphorylate bacterial-derived lipopolysaccharide, and IAP has been identified as a potential regulator of the composition of the intestinal microbiome, an evolutionarily conserved function. Endogenous and recombinant bovine APs and recombinant hAPs are currently being explored for their potential as pharmacological agents to treat AP-associated diseases and mitigate multiple sources of inflammation. Continued research on these versatile proteins will undoubtedly provide insight into human pathophysiology, biochemistry, and the human holobiont. PMID:28824625

  10. Inositol phosphatase activity of the Escherichia coli agp-encoded acid glucose-1-phosphatase.

    PubMed

    Cottrill, Michael A; Golovan, Serguei P; Phillips, John P; Forsberg, Cecil W

    2002-09-01

    When screening an Escherichia coli gene library for myo-inositol hexakisphosphate (InsP6) phosphatases (phytases), we discovered that the agp-encoded acid glucose-1-phosphatase also possesses this activity. Purified Agp hydrolyzes glucose-1-phosphate, p-nitrophenyl phosphate, and InsP6 with pH optima, 6.5, 3.5, and 4.5, respectively, and was stable when incubated at pH values ranging from 3 to 10. Glucose-1-phosphate was hydrolyzed most efficiently at 55 degrees C. while InsP6 and p-nitrophenyl phosphate were hydrolyzed maximally at 60 degrees C. The Agp exhibited Km values of (0.39 mM, 13 mM, and 0.54 mM for the hydrolysis of glucose-1-phosphate, p-nitrophenyl phosphate, and InsP6, respectively. High-pressure liquid chromatography (HPLC) analysis of inositol phosphate hydrolysis products of Agp demonstrated that the enzyme catalyzes the hydrolysis of phosphate from each of InsP6, D-Ins(1,2,3,4,5)P5, Ins(1,3,4,5,6)P5, and Ins(1,2,3,4,6)P5, producing D/L-Ins(1,2,4,5,6)P5. D-Ins(1,2,4,5)P4, D/L-Ins(1,4,5,6)P4 and D/L-Ins(1,2,4,6)P4, respectively. These data support the contention that Agp is a 3-phosphatase.

  11. Lily pollen alkaline phytase is a histidine phosphatase similar to mammalian multiple inositol polyphosphate phosphatase (MINPP).

    PubMed

    Mehta, Bakul Dhagat; Jog, Sonali P; Johnson, Steven C; Murthy, Pushpalatha P N

    2006-09-01

    Phytic acid is the most abundant inositol phosphate in cells; it constitutes 1-5% of the dry weight of cereal grains and legumes. Phytases are the primary enzymes responsible for the hydrolysis of phytic acid and thus play important roles in inositol phosphate metabolism. A novel alkaline phytase in lily pollen (LlALP) was recently purified in our laboratory. In this paper, we describe the cloning and characterization of LlALP cDNA from lily pollen. Two isoforms of alkaline phytase cDNAs, LlAlp1 and LlAlp2, which are 1467 and 1533 bp long and encode proteins of 487 and 511 amino acids, respectively, were identified. The deduced amino acid sequences contains the signature heptapeptide of histidine phosphatases, -RHGXRXP-, but shares < 25% identity to fungal histidine acid phytases. Phylogenetic analysis reveals that LlALP is most closely related to multiple inositol polyphosphate phosphatase (MINPP) from humans (25%) and rats (23%). mRNA corresponding to LlAlp1 and LlAlp2 were expressed in leaves, stem, petals and pollen grains. The expression profiles of LlAlp isoforms in anthers indicated that mRNA corresponding to both isoforms were present at all stages of flower development. The expression of LlAlp2 cDNA in Escherichia coli revealed the accumulation of the active enzyme in inclusion bodies and confirmed that the cDNA encodes an alkaline phytase. In summary, plant alkaline phytase is a member of the histidine phosphatase family that includes MINPP and exhibits properties distinct from bacterial and fungal phytases.

  12. The RCN1-encoded A subunit of protein phosphatase 2A increases phosphatase activity in vivo

    NASA Technical Reports Server (NTRS)

    Deruere, J.; Jackson, K.; Garbers, C.; Soll, D.; Delong, A.; Evans, M. L. (Principal Investigator)

    1999-01-01

    Protein phosphatase 2A (PP2A), a heterotrimeric serine/threonine-specific protein phosphatase, comprises a catalytic C subunit and two distinct regulatory subunits, A and B. The RCN1 gene encodes one of three A regulatory subunits in Arabidopsis thaliana. A T-DNA insertion mutation at this locus impairs root curling, seedling organ elongation and apical hypocotyl hook formation. We have used in vivo and in vitro assays to gauge the impact of the rcn1 mutation on PP2A activity in seedlings. PP2A activity is decreased in extracts from rcn1 mutant seedlings, and this decrease is not due to a reduction in catalytic subunit expression. Roots of mutant seedlings exhibit increased sensitivity to the phosphatase inhibitors okadaic acid and cantharidin in organ elongation assays. Shoots of dark-grown, but not light-grown seedlings also show increased inhibitor sensitivity. Furthermore, cantharidin treatment of wild-type seedlings mimics the rcn1 defect in root curling, root waving and hypocotyl hook formation assays. In roots of wild-type seedlings, RCN1 mRNA is expressed at high levels in root tips, and accumulates to lower levels in the pericycle and lateral root primordia. In shoots, RCN1 is expressed in the apical hook and the basal, rapidly elongating cells in etiolated hypocotyls, and in the shoot meristem and leaf primordia of light-grown seedlings. Our results show that the wild-type RCN1-encoded A subunit functions as a positive regulator of the PP2A holoenzyme, increasing activity towards substrates involved in organ elongation and differential cell elongation responses such as root curling.

  13. The RCN1-encoded A subunit of protein phosphatase 2A increases phosphatase activity in vivo

    NASA Technical Reports Server (NTRS)

    Deruere, J.; Jackson, K.; Garbers, C.; Soll, D.; Delong, A.; Evans, M. L. (Principal Investigator)

    1999-01-01

    Protein phosphatase 2A (PP2A), a heterotrimeric serine/threonine-specific protein phosphatase, comprises a catalytic C subunit and two distinct regulatory subunits, A and B. The RCN1 gene encodes one of three A regulatory subunits in Arabidopsis thaliana. A T-DNA insertion mutation at this locus impairs root curling, seedling organ elongation and apical hypocotyl hook formation. We have used in vivo and in vitro assays to gauge the impact of the rcn1 mutation on PP2A activity in seedlings. PP2A activity is decreased in extracts from rcn1 mutant seedlings, and this decrease is not due to a reduction in catalytic subunit expression. Roots of mutant seedlings exhibit increased sensitivity to the phosphatase inhibitors okadaic acid and cantharidin in organ elongation assays. Shoots of dark-grown, but not light-grown seedlings also show increased inhibitor sensitivity. Furthermore, cantharidin treatment of wild-type seedlings mimics the rcn1 defect in root curling, root waving and hypocotyl hook formation assays. In roots of wild-type seedlings, RCN1 mRNA is expressed at high levels in root tips, and accumulates to lower levels in the pericycle and lateral root primordia. In shoots, RCN1 is expressed in the apical hook and the basal, rapidly elongating cells in etiolated hypocotyls, and in the shoot meristem and leaf primordia of light-grown seedlings. Our results show that the wild-type RCN1-encoded A subunit functions as a positive regulator of the PP2A holoenzyme, increasing activity towards substrates involved in organ elongation and differential cell elongation responses such as root curling.

  14. The Aspergillus nidulans pyrG89 mutation alters glycosylation of secreted acid phosphatase.

    PubMed

    Justino, A; Nozawa, S R; Maccheroni, W; May, G S; Martinez-Rossi, N M; Rossi, A

    2001-03-01

    The glycosylation level of the pacA-encoded acid phosphatase secreted by Aspergillus nidulans was reduced in strains pabaA1 pyroA4and pabaA1 pyroA4 pyrG89, compared to strains carrying these mutations singly. The molecular mass of the enzyme secreted by the triple mutant grown at pH 5.0 was 105 and 45 kDa as determined by exclusion chromatography and SDS-PAGE, respectively. In contrast, the pabaA1 strain secreted acid phosphatases of 119 and 62 kDa. The enzyme also had an altered electrophoretic mobility and glycosylation had a protective effect against its heat inactivation. Thus, this combination of mutants alters glycosylation of the enzyme, leading to changes in their structural properties. In spite of this, no deviation was observed in the apparent optimum pH and Michaelis kinetics for enzymatic hydrolysis of p-nitrophenyl phosphate or alpha-naphthyl phosphate.

  15. Lectin histochemistry and alkaline phosphatase activity in the pia mater vessels of spontaneously hypertensive rats (SHR).

    PubMed

    Szumańska, G; Gadamski, R

    1992-01-01

    Some lectins were used to study the localization of sugar residues on the endothelial cell surface in the pia mater blood vessels of control (WKY) and hypertensive rats (SHR). The lectins tested recognized the following residues: beta-D-galactosyl (Ricinus communis agglutinin 120, RCA-1), alpha-L-fucosyl (Ulex europaeus agglutinin, UEA-1), N-acetylglucosaminyl and sialyl (Wheat germ agglutinin, WGA), N-glycolyl-neuraminic acid (Limax flavus agglutinin, LFA), and N-acetyl-D-galactosaminyl (Helix pomatia agglutinin, HPA). Several differences were revealed in the presence of sugar receptors on the surface of endothelial cells between the control and the hypertensive rats. Our studies showed also differences in the localization of the tested glycoconjugates between pial capillaries, small, medium-size and large pial arteries. The histochemical evaluation of alkaline phosphatase revealed an increased activity of the enzyme in the pial vessels of SHRs as compared with control rats with a similar localization of the enzyme activity. Some differences in the distribution of lectin binding sites and alkaline phosphatase activity could be associated with the different functions of particular segments of the pial vascular network.

  16. Protein Phosphatases Involved in Regulating Mitosis: Facts and Hypotheses.

    PubMed

    Kim, Hyun-Soo; Fernandes, Gary; Lee, Chang-Woo

    2016-09-01

    Almost all eukaryotic proteins are subject to post-translational modifications during mitosis and cell cycle, and in particular, reversible phosphorylation being a key event. The recent use of high-throughput experimental analyses has revealed that more than 70% of all eukaryotic proteins are regulated by phosphorylation; however, the mechanism of dephosphorylation, counteracting phosphorylation, is relatively unknown. Recent discoveries have shown that many of the protein phosphatases are involved in the temporal and spatial control of mitotic events, such as mitotic entry, mitotic spindle assembly, chromosome architecture changes and cohesion, and mitotic exit. This implies that certain phosphatases are tightly regulated for timely dephosphorylation of key mitotic phosphoproteins and are essential for control of various mitotic processes. This review describes the physiological and pathological roles of mitotic phosphatases, as well as the versatile role of various protein phosphatases in several mitotic events.

  17. [Phosphatase activity of Bacillus subtilis IMV B-7023].

    PubMed

    Bulavenko, L V; Kurdysh, I K

    2005-01-01

    Phosphatase activity of two strains of bacteria - Bacillus subtilis IMV B-7023 and B. megaterium 12 is investigated. The phosphatase activity is found to reach 260 mkmol/g x hour for B. subtilis IMV B-7023 and 12-100 mkmol/g x hour for B. megaterium 12 at optimal temperature (55 degrees C) and pH (9.5-10.0). Synthesis of alkaline phosphatase is shown to reach its maximum values at the end of logarithmic phase of the culture growth. It is revealed that Mg2+, Ca2+ cations increase phosphotase activity of B. subtilis IMV B-7023, at the same time Cu2+, Mn2+, Zn2+ cations and inorganic phosphate decrease it. Dependence of the rate of phosphatase reaction of B. subtilis IMV B-7023 on substrate concentration is determined.

  18. Structure and Mechanism of the Phosphotyrosyl Phosphatase Activator

    SciTech Connect

    Chao,Y.; Xing, Y.; Chen, Y.; Xu, Y.; Lin, Z.; Li, Z.; Jeffrey, P.; Stock, J.; Shi, Y.

    2006-01-01

    Phosphotyrosyl phosphatase activator (PTPA), also known as PP2A phosphatase activator, is a conserved protein from yeast to human. Here we report the 1.9 {angstrom} crystal structure of human PTPA, which reveals a previously unreported fold consisting of three subdomains: core, lid, and linker. Structural analysis uncovers a highly conserved surface patch, which borders the three subdomains, and an associated deep pocket located between the core and the linker subdomains. The conserved surface patch and the deep pocket are responsible for binding to PP2A and ATP, respectively. PTPA and PP2A A-C dimer together constitute a composite ATPase. PTPA binding to PP2A results in a dramatic alteration of substrate specificity, with enhanced phosphotyrosine phosphatase activity and decreased phosphoserine phosphatase activity. This function of PTPA strictly depends on the composite ATPase activity. These observations reveal significant insights into the function and mechanism of PTPA and have important ramifications for understanding PP2A function.

  19. Cytoskeletal integrity in interphase cells requires protein phosphatase activity.

    PubMed Central

    Eriksson, J E; Brautigan, D L; Vallee, R; Olmsted, J; Fujiki, H; Goldman, R D

    1992-01-01

    Phosphorylation by protein kinases has been established as a key factor in the regulation of cytoskeletal structure. However, little is known about the role of protein phosphatases in cytoskeletal regulation. To assess the possible functions of protein phosphatases in this respect, we studied the effects of the phosphatase inhibitors calyculin A, okadaic acid, and dinophysistoxin 1 (35-methylokadaic acid) on BHK-21 fibroblasts. Within minutes of incubation with these inhibitors, changes are seen in the structural organization of intermediate filaments, followed by a loss of microtubules, as assayed by immunofluorescence. These changes in cytoskeletal structure are accompanied by a rapid and selective increase in vimentin phosphorylation on interphase-specific sites, and they are fully reversible after removal of calyculin A. The results indicate that there is a rapid phosphate turnover on cytoskeletal intermediate filaments and further suggest that protein phosphatases are essential for the maintenance and structural integrity of two major cytoskeletal components. Images PMID:1332069

  20. Acid phosphatase and protease activities in immobilized rat skeletal muscles

    NASA Technical Reports Server (NTRS)

    Witzmann, F. A.; Troup, J. P.; Fitts, R. H.

    1982-01-01

    The effect of hind-limb immobilization on selected Iysosomal enzyme activities was studied in rat hing-limb muscles composed primarily of type 1. 2A, or 2B fibers. Following immobilization, acid protease and acid phosphatase both exhibited signifcant increases in their activity per unit weight in all three fiber types. Acid phosphatase activity increased at day 14 of immobilization in the three muscles and returned to control levels by day 21. Acid protease activity also changed biphasically, displaying a higher and earlier rise than acid phosphatase. The pattern of change in acid protease, but not acid phosphatase, closely parallels observed muscle wasting. The present data therefore demonstrate enhanced proteolytic capacity of all three fiber types early during muscular atrophy. In addition, the data suggest a dependence of basal hydrolytic and proteolytic activities and their adaptive response to immobilization on muscle fiber composition.

  1. Phosphoinositide 5-phosphatases: How do they affect tumourigenesis?

    PubMed

    Miyazawa, Keiji

    2013-01-01

    The activity of biological molecules is often affected by their phosphorylation state. Regulatory phosphorylation operates as a binary switch and is usually controlled by counteracting kinases and phosphatases. However, phosphatidylinositol (PtdIns) has three phosphorylation sites on its inositol ring. The phosphorylation status of PtdIns is controlled by multiple kinases and phosphatases with distinct substrate specificities, serving as a 'lipid code' or 'phosphoinositide code'. Class I phosphoinositide 3-kinase (PI3K) converts PtdIns(4,5)P₂ to PtdIns(3,4,5)P₃, which plays a pivotal role in signals controlling glucose uptake, cytoskeletal reorganization, cell proliferation and apoptosis. PI3K is pro-oncogenic, whereas phosphoinositide phosphatases that degrade PtdIns(3,4,5)P₃ are not always anti-oncogenic. Recent studies have revealed the unique characteristics of phosphoinositide 5-phosphatases.

  2. Acid phosphatase and protease activities in immobilized rat skeletal muscles

    NASA Technical Reports Server (NTRS)

    Witzmann, F. A.; Troup, J. P.; Fitts, R. H.

    1982-01-01

    The effect of hind-limb immobilization on selected Iysosomal enzyme activities was studied in rat hing-limb muscles composed primarily of type 1. 2A, or 2B fibers. Following immobilization, acid protease and acid phosphatase both exhibited signifcant increases in their activity per unit weight in all three fiber types. Acid phosphatase activity increased at day 14 of immobilization in the three muscles and returned to control levels by day 21. Acid protease activity also changed biphasically, displaying a higher and earlier rise than acid phosphatase. The pattern of change in acid protease, but not acid phosphatase, closely parallels observed muscle wasting. The present data therefore demonstrate enhanced proteolytic capacity of all three fiber types early during muscular atrophy. In addition, the data suggest a dependence of basal hydrolytic and proteolytic activities and their adaptive response to immobilization on muscle fiber composition.

  3. Type 2C Protein Phosphatases in Fungi ▿ †

    PubMed Central

    Ariño, Joaquín; Casamayor, Antonio; González, Asier

    2011-01-01

    Type 2C Ser/Thr phosphatases are a remarkable class of protein phosphatases, which are conserved in eukaryotes and involved in a large variety of functional processes. Unlike in other Ser/Thr phosphatases, the catalytic polypeptide is not usually associated with regulatory subunits, and functional specificity is achieved by encoding multiple isoforms. For fungi, most information comes from the study of type 2C protein phosphatase (PP2C) enzymes in Saccharomyces cerevisiae, where seven PP2C-encoding genes (PTC1 to -7) with diverse functions can be found. More recently, data on several Candida albicans PP2C proteins became available, suggesting that some of them can be involved in virulence. In this work we review the available literature on fungal PP2Cs and explore sequence databases to provide a comprehensive overview of these enzymes in fungi. PMID:21076010

  4. Moraxella catarrhalis synthesizes an autotransporter that is an acid phosphatase.

    PubMed

    Hoopman, Todd C; Wang, Wei; Brautigam, Chad A; Sedillo, Jennifer L; Reilly, Thomas J; Hansen, Eric J

    2008-02-01

    Moraxella catarrhalis O35E was shown to synthesize a 105-kDa protein that has similarity to both acid phosphatases and autotransporters. The N-terminal portion of the M. catarrhalis acid phosphatase A (MapA) was most similar (the BLAST probability score was 10(-10)) to bacterial class A nonspecific acid phosphatases. The central region of the MapA protein had similarity to passenger domains of other autotransporter proteins, whereas the C-terminal portion of MapA resembled the translocation domain of conventional autotransporters. Cloning and expression of the M. catarrhalis mapA gene in Escherichia coli confirmed the presence of acid phosphatase activity in the MapA protein. The MapA protein was shown to be localized to the outer membrane of M. catarrhalis and was not detected either in the soluble cytoplasmic fraction from disrupted M. catarrhalis cells or in the spent culture supernatant fluid from M. catarrhalis. Use of the predicted MapA translocation domain in a fusion construct with the passenger domain from another predicted M. catarrhalis autotransporter confirmed the translocation ability of this MapA domain. Inactivation of the mapA gene in M. catarrhalis strain O35E reduced the acid phosphatase activity expressed by this organism, and this mutation could be complemented in trans with the wild-type mapA gene. Nucleotide sequence analysis of the mapA gene from six M. catarrhalis strains showed that this protein was highly conserved among strains of this pathogen. Site-directed mutagenesis of a critical histidine residue (H233A) in the predicted active site of the acid phosphatase domain in MapA eliminated acid phosphatase activity in the recombinant MapA protein. This is the first description of an autotransporter protein that expresses acid phosphatase activity.

  5. Leishmania amazonensis: characterization of an ecto-phosphatase activity.

    PubMed

    de Almeida-Amaral, Elmo Eduardo; Belmont-Firpo, Rodrigo; Vannier-Santos, Marcos André; Meyer-Fernandes, José Roberto

    2006-12-01

    We have characterized a phosphatase activity present on the external surface of Leishmania amazonensis, using intact living parasites. This enzyme hydrolyzes the substrate p-nitrophenylphosphate (p-NPP) at the rate of 25.70+/-1.17 nmol Pi x h(-1) x 10(-7)cells. The dependence on p-NPP concentration shows a normal Michaelis-Menten kinetics for this ecto-phosphatase activity present a V(max) of 31.93+/-3.04 nmol Pi x h(-1) x 10(-7)cells and apparent K(m) of 1.78+/-0.32 mM. Inorganic phosphate inhibited the ecto-phoshatase activity in a dose-dependent manner with the K(i) value of 2.60 mM. Experiments using classical inhibitor of acid phosphatase, such as ammonium molybdate, as well as inhibitors of phosphotyrosine phosphatase, such as sodium orthovanadate and [potassiumbisperoxo(1,10-phenanthroline)oxovanadate(V)] (bpV-PHEN), inhibited the ecto-phosphatase activity, with the K(i) values of 0.33 microM, 0.36 microM and 0.25 microM, respectively. Zinc chloride, another classical phosphotyrosine phosphatase inhibitor, also inhibited the ecto-phosphatase activity in a dose-dependent manner with K(i) 2.62 mM. Zinc inhibition was reversed by incubation with reduced glutathione (GSH) and cysteine, but not serine, showing that cysteine residues are important for enzymatic activity. Promastigote growth in a medium supplemented with 1mM sodium orthovanadate was completely inhibited as compared to the control medium. Taken together, these results suggest that L. amazonensis express a phosphohydrolase ectoenzyme with phosphotyrosine phosphatase activity.

  6. Atomic structure of DUSP26, a novel p53 phosphatase

    PubMed Central

    Lokareddy, Ravi Kumar; Bhardwaj, Anshul; Cingolani, Gino

    2013-01-01

    Regulation of p53 phosphorylation is critical to control its stability and biological activity. Dual Specificity Phosphatase 26 (DUSP26) is a brain phosphatase highly overexpressed in neuroblastoma, which has been implicated in dephosphorylating phospho-Ser20 and phospho-Ser37 in the p53 transactivation domain (TAD). In this paper, we report the 1.68Å crystal structure of a catalytically inactive mutant (Cys152Ser) of DUSP26 lacking the first N-terminal 60 residues (ΔN60-C/S-DUSP26). This structure reveals the architecture of a dual-specificity phosphatase domain related in structure to Vaccinia virus VH1. DUSP26 adopts a closed conformation of the protein tyrosine phosphatase (PTP)-binding loop, which results in an unusually shallow active site pocket and buried catalytic cysteine. A water molecule trapped inside the PTP-binding loop makes close contacts both with main chain and side chain atoms. The hydrodynamic radius (RH) of ΔN60-C/S-DUSP26 measured from velocity sedimentation analysis (RH ~22.7 Å) and gel filtration chromatography (RH ~21.0 Å) is consistent with a globular monomeric protein of ~18 kDa. Instead in crystal, ΔN60-C/S-DUSP26 is more elongated (RH ~37.9 Å), likely due to the extended conformation of C-terminal helix α9, which swings away from the phosphatase core to generate a highly basic surface. As in the case of the phosphatase MKP-4, we propose that a substrate-induced conformational change, possibly involving rearrangement of helix α9 with respect to the phosphatase core, allows DUSP26 to adopt a catalytically active conformation. The structural characterization of DUSP26 presented in this paper provides the first atomic insight into this disease-associated phosphatase. PMID:23298255

  7. The acid phosphatases of Thermoascus crustaceus, a thermophilic fungus.

    PubMed

    Arnold, W N; Garrison, R G; Mann, L C; Wallace, D P

    1988-01-01

    Thermoascus crustaceus, a filamentous, thermophilic ascomycete with pathogenic potential was cultured on Sabouraud's liquid medium at temperatures from 27 to 47 degrees C for periods up to 7 days. Growth rate and yield were optimal at 37 degrees C. Morphological changes were confined to the cell walls, the thickness being greatest at 47 degrees C, which were also more resistant to mechanical disruption. Significant amounts of acid phosphatase (EC 3.1.3.2) activity occurred in the spent media of all cultures but were greatest at 37 degrees C. The proportions of acid phosphatase activity which were operationally defined as soluble or bound were also documented; the optimum pH for acid phosphatase activity in all fractions was 5.0. Extracts were subjected to polyacrylamide gel electrophoresis under non-denaturing conditions and the gels were stained for acid phosphatase activity. This revealed four electrophoretically distinct acid phosphatases which had different susceptibilities to inhibition by fluoride, phosphate, or tartrate. Effects of growth temperature, or phosphate supplement in the culture medium, on the acid phosphatase isoenzyme pattern were judged to be minor. Cytochemistry at the electron microscope level indicated acid phosphatase activity on the surface, in the periplasmic space, and in the cytoplasm, but no trends with regard to growth conditions. A substantial temperature range can be tolerated by this species but it is concluded that neither the general shape of the cells nor the acid phosphatase isoenzyme pattern changes substantially; this contrasts with previously documented differences for this class of enzyme in dimorphic Sporotrix schenckii.

  8. Multiple unfolding intermediates of human placental alkaline phosphatase in equilibrium urea denaturation.

    PubMed Central

    Hung, H C; Chang, G G

    2001-01-01

    Alkaline phosphatase is an enzyme with a typical alpha/beta hydrolase fold. The conformational stability of the human placental alkaline phosphatase was examined with the chemical denaturant urea. The red shifts of fluorescence spectra show a complex unfolding process involving multiple equilibrium intermediates indicating differential stability of the subdomains of the enzyme. None of these unfolding intermediates were observed in the presence of 83 mM NaCl, indicating the importance of ionic interactions in the stabilization of the unfolding intermediates. Guanidinium chloride, on the other hand, could stabilize one of the unfolding intermediates, which is not a salt effect. Some of the unfolding intermediates were also observed in circular dichroism spectroscopy, which clearly indicates steady loss of helical structure during unfolding, but very little change was observed for the beta strand content until the late stage of the unfolding process. The enzyme does not lose its phosphate-binding ability after substantial tertiary structure changes, suggesting that the substrate-binding region is more resistant to chemical denaturant than the other structural domains. Global analysis of the fluorescence spectral change demonstrated the following folding-unfolding process of the enzyme: N <--> I(1) <--> I(2) <--> I(3) <--> I(4) <--> I(5) <--> D. These discrete intermediates are stable at urea concentrations of 2.6, 4.1, 4.7, 5.5, 6.6, and 7.7 M, respectively. These intermediates are further characterized by acrylamide and/or potassium iodide quenching of the intrinsic fluorescence of the enzyme and by the hydrophobic probes, 1-anilinonaphthalene-8-sulfonic acid and 4,4'-dianilino-1,1'-binaphthyl-5,5'-disulfonic acid. The stepwise unfolding process was interpreted by the folding energy landscape in terms of the unique structure of the enzyme. The rigid central beta-strand domain is surrounded by the peripheral alpha-helical and coil structures, which are marginally

  9. Kinetics and mechanism of protein tyrosine phosphatase 1B inactivation by acrolein.

    PubMed

    Seiner, Derrick R; LaButti, Jason N; Gates, Kent S

    2007-09-01

    Human cells are exposed to the electrophilic alpha,beta-unsaturated aldehyde acrolein from a variety of sources. The reaction of acrolein with functionally critical protein thiol residues can yield important biological consequences. Protein tyrosine phosphatases (PTPs) are an important class of cysteine-dependent enzymes whose reactivity with acrolein previously has not been well-characterized. These enzymes catalyze the dephosphorylation of phosphotyrosine residues on proteins via a phosphocysteine intermediate. PTPs work in tandem with protein tyrosine kinases to regulate a number of critically important mammalian signal transduction pathways. We find that acrolein is a potent time-dependent inactivator of the enzyme PTP1B ( k inact = 0.02 +/- 0.005 s (-1) and K I = 2.3 +/- 0.6 x 10 (-4) M). The enzyme activity does not return upon gel filtration of the inactivated enzyme, and addition of the competitive phosphatase inhibitor vanadate slows inactivation of PTP1B by acrolein. Together, these observations suggest that acrolein covalently modifies the active site of PTP1B. Mass spectrometric analysis reveals that acrolein modifies the catalytic cysteine residue at the active site of the enzyme. Aliphatic aldehydes such as glyoxal, acetaldehyde, and propanal are relatively weak inactivators of PTP1B under the conditions employed here. Similarly, unsaturated aldehydes such as crotonaldehyde and 3-methyl-2-butenal bearing substitution at the alkene terminus are poor inactivators of the enzyme. Overall, the data suggest that enzyme inactivation occurs via conjugate addition of the catalytic cysteine residue to the carbon-carbon double bond of acrolein. The results indicate that inactivation of PTPs should be considered as a possible contributor to the diverse biological activities of acrolein and structurally related alpha,beta-unsaturated aldehydes.

  10. Multiple unfolding intermediates of human placental alkaline phosphatase in equilibrium urea denaturation.

    PubMed

    Hung, H C; Chang, G G

    2001-12-01

    Alkaline phosphatase is an enzyme with a typical alpha/beta hydrolase fold. The conformational stability of the human placental alkaline phosphatase was examined with the chemical denaturant urea. The red shifts of fluorescence spectra show a complex unfolding process involving multiple equilibrium intermediates indicating differential stability of the subdomains of the enzyme. None of these unfolding intermediates were observed in the presence of 83 mM NaCl, indicating the importance of ionic interactions in the stabilization of the unfolding intermediates. Guanidinium chloride, on the other hand, could stabilize one of the unfolding intermediates, which is not a salt effect. Some of the unfolding intermediates were also observed in circular dichroism spectroscopy, which clearly indicates steady loss of helical structure during unfolding, but very little change was observed for the beta strand content until the late stage of the unfolding process. The enzyme does not lose its phosphate-binding ability after substantial tertiary structure changes, suggesting that the substrate-binding region is more resistant to chemical denaturant than the other structural domains. Global analysis of the fluorescence spectral change demonstrated the following folding-unfolding process of the enzyme: N <--> I(1) <--> I(2) <--> I(3) <--> I(4) <--> I(5) <--> D. These discrete intermediates are stable at urea concentrations of 2.6, 4.1, 4.7, 5.5, 6.6, and 7.7 M, respectively. These intermediates are further characterized by acrylamide and/or potassium iodide quenching of the intrinsic fluorescence of the enzyme and by the hydrophobic probes, 1-anilinonaphthalene-8-sulfonic acid and 4,4'-dianilino-1,1'-binaphthyl-5,5'-disulfonic acid. The stepwise unfolding process was interpreted by the folding energy landscape in terms of the unique structure of the enzyme. The rigid central beta-strand domain is surrounded by the peripheral alpha-helical and coil structures, which are marginally

  11. Overexpression of Human Bone Alkaline Phosphatase in Pichia Pastoris

    NASA Technical Reports Server (NTRS)

    Karr, Laurel; Malone, Christine, C.; Rose, M. Franklin (Technical Monitor)

    2000-01-01

    The Pichiapastoris expression system was utilized to produce functionally active human bone alkaline phosphatase in gram quantities. Bone alkaline phosphatase is a key enzyme in bone formation and biomineralization, yet important questions about its structural chemistry and interactions with other cellular enzymes in mineralizing tissues remain unanswered. A soluble form of human bone alkaline phosphatase was constructed by deletion of the 25 amino acid hydrophobic C-terminal region of the encoding cDNA and inserted into the X-33 Pichiapastoris strain. An overexpression system was developed in shake flasks and converted to large-scale fermentation. Alkaline phosphatase was secreted into the medium to a level of 32mgAL when cultured in shake flasks. Enzyme activity was 12U/mg measured by a spectrophotometric assay. Fermentation yielded 880mgAL with enzymatic activity of 968U/mg. Gel electrophoresis analysis indicates that greater than 50% of the total protein in the fermentation is alkaline phosphatase. A purification scheme has been developed using ammonium sulfate precipitation followed by hydrophobic interaction chromatography. We are currently screening crystallization conditions of the purified recombinant protein for subsequent X-ray diffraction analyses. Structural data should provide additional information on the role of alkaline phosphatase in normal bone mineralization and in certain bone mineralization anomalies.

  12. Overexpression of Human Bone Alkaline Phosphatase in Pichia Pastoris

    NASA Technical Reports Server (NTRS)

    Karr, Laurel; Malone, Christine, C.; Rose, M. Franklin (Technical Monitor)

    2000-01-01

    The Pichiapastoris expression system was utilized to produce functionally active human bone alkaline phosphatase in gram quantities. Bone alkaline phosphatase is a key enzyme in bone formation and biomineralization, yet important questions about its structural chemistry and interactions with other cellular enzymes in mineralizing tissues remain unanswered. A soluble form of human bone alkaline phosphatase was constructed by deletion of the 25 amino acid hydrophobic C-terminal region of the encoding cDNA and inserted into the X-33 Pichiapastoris strain. An overexpression system was developed in shake flasks and converted to large-scale fermentation. Alkaline phosphatase was secreted into the medium to a level of 32mgAL when cultured in shake flasks. Enzyme activity was 12U/mg measured by a spectrophotometric assay. Fermentation yielded 880mgAL with enzymatic activity of 968U/mg. Gel electrophoresis analysis indicates that greater than 50% of the total protein in the fermentation is alkaline phosphatase. A purification scheme has been developed using ammonium sulfate precipitation followed by hydrophobic interaction chromatography. We are currently screening crystallization conditions of the purified recombinant protein for subsequent X-ray diffraction analyses. Structural data should provide additional information on the role of alkaline phosphatase in normal bone mineralization and in certain bone mineralization anomalies.

  13. OBSERVATIONS ON THE ACID PHOSPHATASES OF EUGLENA GRACILIS

    PubMed Central

    Blum, Jacob J.

    1965-01-01

    When a bleached strain of Euglena is maintained in a medium containing very low con centrations of phosphate, the acid phosphatase activity increases. The increase in acid phosphatase activity is prevented by Actinomycin D and by p-fluorophenylalanine (PFA), indicating that the increased activity is due to de novo synthesis of acid phosphatase. When phosphate is replenished, the acid phosphatase activity decreases to the level characteristic of uninduced cells before there is any appreciable cell division. When cell division resumes in the presence of PFA, the level of acid phosphatase activity remains approximately constant. This indicates that there are two different phosphatases: a constitutive enzyme, whose synthesis is insensitive to the presence of PFA, and an induced enzyme, whose synthesis is sensitive to PFA. These enzymes are not equally sensitive to changes in pH and in fluoride concentration, thus permitting them to be assayed individually in whole toluene-treated cells. Induced cells also acquire the ability to remove phosphate from the medium very rapidly. PMID:14326108

  14. The cytochemistry of tartrate-resistant acid phosphatase. Technical considerations.

    PubMed

    Janckila, A J; Li, C Y; Lam, K W; Yam, L T

    1978-07-01

    Cytochemical demonstration of tartrate-resistant acid phosphatase activity is essential for the diagnosis of leukemic reticuloendotheliosis. In order to perform this test correctly and to interpret the results propertly, it is necessary to understand the technical details of the cytochemical methods thoroughly. The method using naphthol--ASBI phosphoric acid--fast garnet GBC is recommended for this purpose, and factors crucial to the cytochemical study, such as fixation, substrate, coupler, pH and temperature of incubation buffer, counterstains, and mounting media are examined and discussed. Conventional methods for acid phosphatase in the presence and absence of L(+) tartaric acid are also critically examined. The naphthol--ASBI phosphoric acid--fast garnet GBC method is sensitive, technically simple and easily reproducible. Its reaction product is highly chromogenic and is most suitable for cytochemical demonstration of acid phosphatase and tartrate-resistant acid phosphatase activity in cytologic preparations. The naphthol--ASBI phosphoric acid--pararosaniline method is highly specific and is best for histochemical demonstration of acid phosphatase and tartrate-resistant acid phosphatase in tissue sections.

  15. Resolution and purification of three periplasmic phosphatases of Salmonella typhimurium.

    PubMed Central

    Kier, L D; Weppelman, R; Ames, B N

    1977-01-01

    A survey of Salmonella typhimurium enzymes possessing phosphatase or phosphodiesterase activity was made using several different growth conditions. These studies revealed the presence of three major enzymes, all of which were subsequently purified: a cyclic 2' ,3'-nucleotide phosphodiesterase (EC 3.1.4.d), an acid hexose phosphatase (EC 3.1.3.2), and a nonspecific acid phosphatase (EC 3.1.3.2). A fourth enzyme hydrolyzed bis-(p-nitrophenyl)phosphate but none of the other substrates tested. No evidence was found for the existence of an alkaline phosphatase (EC 3.1.3.1) or a specific 5'-nucleotidase (EC 3.1.3.5) in S. typhimurium LT2. All three phosphatases could be measured efficiently in intact cells, which suggested a periplasmic location; however, they were not readily released by osmotic shock procedures. The nonspecific acid phosphatase, which was purified to apparent homogeneity, yielded a single polypeptide band on both sodium dodecyl sulfate and acidic urea gel electrophoretic systems. Images PMID:192712

  16. A Malachite Green-Based Assay to Assess Glucan Phosphatase Activity

    PubMed Central

    Sherwood, Amanda R.; Paasch, Bradley C.; Worby, Carolyn A.; Gentry, Matthew S.

    2012-01-01

    With the recent discovery of a unique class of dual-specificity phosphatases that dephosphorylate glucans, we report an in vitro assay tailored for the detection of phosphatase activity against phosphorylated glucans. We demonstrate that in contrast to a general phosphatase assay utilizing a synthetic substrate, only phosphatases that possess glucan phosphatase activity liberate phosphate from the phosphorylated glucan amylopectin using the described assay. This assay is simple and cost-effective, providing reproducible results that clearly establish the presence or absence of glucan phosphatase activity. The assay described will be a useful tool in characterizing emerging members of the glucan phosphatase family. PMID:23201267

  17. [Phosphatase activity in Amoeba proteus at pH 9.0].

    PubMed

    Sopina, V A

    2007-01-01

    In the free-living amoeba Amoeba proteus (strain B), after PAAG disk-electrophoresis of the homogenate supernatant, at using 1-naphthyl phosphate as a substrate and pH 9.0, three forms of phosphatase activity were revealed; they were arbitrarily called "fast", "intermediate", and "slow" phosphatases. The fast phosphatase has been established to be a fraction of lysosomal acid phosphatase that preserves some low activity at alkaline pH. The question as to which particular class the intermediate phosphatase belongs to has remained unanswered: it can be both acid phosphatase and protein tyrosine phosphatase (PTP). Based on data of inhibitor analysis, large substrate specificity, results of experiments with reactivation by Zn ions after inactivation with EDTA, other than in the fast and intermediate phosphatases localization in the amoeba cell, it is concluded that only slow phosphatase can be classified as alkaline phosphatase (EC 3.1.3.1).

  18. Multiple forms of phosphatase from human brain: isolation and partial characterization of affi-gel blue binding phosphatases.

    PubMed

    Cheng, L Y; Wang, J Z; Gong, C X; Pei, J J; Zaidi, T; Grundke-Iqbal, I; Iqbal, K

    2000-01-01

    Implication of protein phosphatases in Alzheimer disease led us to a systemic investigation of the identification of these enzyme activities in human brain. Human brain phosphatases eluted from DEAE-Sephacel with 0.22 M NaCl were resolved into two main groups by affi-gel blue chromatography, namely affi-gel blue-binding phosphatases and affi-gel blue-nonbinding phosphatases. Affi-gel blue-binding phosphatases were further separated into four different phosphatases, designated P1, P2, P3, and P4 by calmodulin-Sepharose 4B and poly-(L-lysine)-agarose chromatographies. These four phosphatases exhibited activities towards nonprotein phosphoester and two of them, P1 and P4, could dephosphorylate phosphoproteins. The activities of the four phosphatases differed in pH optimum, divalent metal ion requirements, sensitivities to various inhibitors and substrate affinities. The apparent molecular masses as estimated by gel-filtration for P1, P2, P3, and P4 were 97, 45, 42, and 125 kDa, respectively. P1 is markedly similar to PP2B from bovine brain and rabbit skeletal muscle. P4 was labeled with anti-PP2A antibody and may represent a new subtype of PP2A. P1 and P4 were also effective in dephosphorylating Alzheimer disease abnormally hyperphosphorylated tau (AD P-tau). The resulting dephosphorylated AD P-tau had its activity restored in promoting assembly of microtubules in vitro. These results suggest that P1 and P4 might be involved in the regulation of phosphorylation of tau in human brain, especially in neurodegenerative conditions like Alzheimer's disease which are characterized by the abnormal hyperphosphorylation of this protein.

  19. Crystal Structures of the Histidine Acid Phosphatase from Francisella tularensis Provide Insight into Substrate Recognition

    SciTech Connect

    Singh, Harkewal; Felts, Richard L.; Schuermann, Jonathan P.; Reilly, Thomas J.; Tanner, John J.

    2009-12-01

    Histidine acid phosphatases catalyze the transfer of a phosphoryl group from phosphomonoesters to water at acidic pH using an active-site histidine. The histidine acid phosphatase from the category A pathogen Francisella tularensis (FtHAP) has been implicated in intramacrophage survival and virulence, motivating interest in understanding the structure and mechanism of this enzyme. Here, we report a structure-based study of ligand recognition by FtHAP. The 1.70-{angstrom}-resolution structure of FtHAP complexed with the competitive inhibitor L(+)-tartrate was solved using single-wavelength anomalous diffraction phasing. Structures of the ligand-free enzyme and the complex with inorganic phosphate were determined at resolutions of 1.85 and 1.70 {angstrom}, respectively. The structure of the Asp261Ala mutant enzyme complexed with the substrate 3'-AMP was determined at 1.50 {angstrom} resolution to gain insight into substrate recognition. FtHAP exhibits a two-domain fold similar to that of human prostatic acid phosphatase, consisting of an {alpha}/{beta} core domain and a smaller domain that caps the core domain. The structures show that the core domain supplies the phosphoryl binding site, catalytic histidine (His17), and an aspartic acid residue (Asp261) that protonates the leaving group, while the cap domain contributes residues that enforce substrate preference. FtHAP and human prostatic acid phosphatase differ in the orientation of the crucial first helix of the cap domain, implying differences in the substrate preferences of the two enzymes. 3'-AMP binds in one end of a 15-{angstrom}-long tunnel, with the adenine clamped between Phe23 and Tyr135, and the ribose 2'-hydroxyl interacting with Gln132. The importance of the clamp is confirmed with site-directed mutagenesis; mutation of Phe23 and Tyr135 individually to Ala increases K{sub m} by factors of 7 and 10, respectively. The structural data are consistent with a role for FtHAP in scavenging phosphate from small

  20. OH1 from Orf Virus: A New Tyrosine Phosphatase that Displays Distinct Structural Features and Triple Substrate Specificity.

    PubMed

    Segovia, Danilo; Haouz, Ahmed; Porley, Darío; Olivero, Natalia; Martínez, Mariano; Mariadassou, Mahendra; Berois, Mabel; André-Leroux, Gwenaëlle; Villarino, Andrea

    2017-09-01

    Viral tyrosine phosphatases such as VH1 from Vaccinia and Variola virus are recognized as important effectors of host-pathogen interactions. While proteins sharing sequence to VH1 have been identified in other viruses, their structural and functional characterization is not known. In this work, we determined the crystal structure of the VH1 homolog in the Orf virus, herein named OH1. Similarly to Variola and Vaccinia VH1, the structure of OH1 shows a dimer with the typical dual-specificity phosphatase fold. In contrast to VH1, the OH1 dimer is covalently stabilized by a disulfide bond involving residue Cys15 in the N-terminal helix alpha-1 of both monomers, and Cys15 is a conserved residue within the Parapoxvirus genus. The in vitro functional characterization confirms that OH1 is a dual-specificity phosphatase and reveals its ability to dephosphorylate phosphatidylinositol 3,5-bisphosphate, a new activity potentially relevant in phosphoinositide recycling during virion maturation. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Structural elucidation of the NADP(H) phosphatase activity of staphylococcal dual-specific IMPase/NADP(H) phosphatase.

    PubMed

    Bhattacharyya, Sudipta; Dutta, Anirudha; Dutta, Debajyoti; Ghosh, Ananta Kumar; Das, Amit Kumar

    2016-02-01

    NADP(H)/NAD(H) homeostasis has long been identified to play a pivotal role in the mitigation of reactive oxygen stress (ROS) in the intracellular milieu and is therefore critical for the progression and pathogenesis of many diseases. NAD(H) kinases and NADP(H) phosphatases are two key players in this pathway. Despite structural evidence demonstrating the existence and mode of action of NAD(H) kinases, the specific annotation and the mode of action of NADP(H) phosphatases remains obscure. Here, structural evidence supporting the alternative role of inositol monophosphatase (IMPase) as an NADP(H) phosphatase is reported. Crystal structures of staphylococcal dual-specific IMPase/NADP(H) phosphatase (SaIMPase-I) in complex with the substrates D-myo-inositol-1-phosphate and NADP(+) have been solved. The structure of the SaIMPase-I-Ca(2+)-NADP(+) ternary complex reveals the catalytic mode of action of NADP(H) phosphatase. Moreover, structures of SaIMPase-I-Ca(2+)-substrate complexes have reinforced the earlier proposal that the length of the active-site-distant helix α4 and its preceding loop are the predisposing factors for the promiscuous substrate specificity of SaIMPase-I. Altogether, the evidence presented suggests that IMPase-family enzymes with a shorter α4 helix could be potential candidates for previously unreported NADP(H) phosphatase activity.

  2. Interpreting EEG alpha activity.

    PubMed

    Bazanova, O M; Vernon, D

    2014-07-01

    Exploring EEG alpha oscillations has generated considerable interest, in particular with regards to the role they play in cognitive, psychomotor, psycho-emotional and physiological aspects of human life. However, there is no clearly agreed upon definition of what constitutes 'alpha activity' or which of the many indices should be used to characterize it. To address these issues this review attempts to delineate EEG alpha-activity, its physical, molecular and morphological nature, and examine the following indices: (1) the individual alpha peak frequency; (2) activation magnitude, as measured by alpha amplitude suppression across the individual alpha bandwidth in response to eyes opening, and (3) alpha "auto-rhythmicity" indices: which include intra-spindle amplitude variability, spindle length and steepness. Throughout, the article offers a number of suggestions regarding the mechanism(s) of alpha activity related to inter and intra-individual variability. In addition, it provides some insights into the various psychophysiological indices of alpha activity and highlights their role in optimal functioning and behavior. Copyright © 2013 Elsevier Ltd. All rights reserved.

  3. Prostatic acid phosphatase degrades lysophosphatidic acid in seminal plasma.

    PubMed

    Tanaka, Masayuki; Kishi, Yasuhiro; Takanezawa, Yasukazu; Kakehi, Yoshiyuki; Aoki, Junken; Arai, Hiroyuki

    2004-07-30

    Lysophosphatidic acid (LPA) is a lipid mediator with multiple biological activities and is detected in various biological fluids, including human seminal plasma. Due to its cell proliferation stimulatory and anti-apoptotic activities, LPA has been implicated in the progression of some cancers such as ovarian cancer and prostate cancer. Here, we show that prostatic acid phosphatase, which is a non-specific phosphatase and which has been implicated in the progression of prostate cancer, inactivates LPA in human seminal plasma. Human seminal plasma contains both an LPA-synthetic enzyme, lysoPLD, which converts lysophospholipids to LPA and is responsible for LPA production in serum, and its major substrate, lysophosphatidylcholine. In serum, LPA accumulated during incubation at 37 degrees C. However, in seminal plasma, LPA did not accumulate. This discrepancy is explained by the presence of a strong LPA-degrading activity. Incubation of LPA with seminal plasma resulted in the disappearance of LPA and an accompanying accumulation of monoglyceride showing that LPA is degraded by phosphatase activity present in the seminal plasma. When seminal plasma was incubated in the presence of a phosphatase inhibitor, sodium orthovanadate, LPA accumulated, indicating that LPA is produced and degraded in the fluid. Biochemical characterization of the LPA-phosphatase activity identified two phosphatase activities in human seminal plasma. By Western blotting analysis in combination with several column chromatographies, the major activity was revealed to be identical to prostatic acid phosphatase. The present study demonstrates active LPA metabolism in seminal plasma and indicates the possible role of LPA signaling in male sexual organs including prostate cancer.

  4. Human pyridoxal phosphatase. Molecular cloning, functional expression, and tissue distribution.

    PubMed

    Jang, Young Min; Kim, Dae Won; Kang, Tae-Cheon; Won, Moo Ho; Baek, Nam-In; Moon, Byung Jo; Choi, Soo Young; Kwon, Oh-Shin

    2003-12-12

    Pyridoxal phosphatase catalyzes the dephosphorylation of pyridoxal 5'-phosphate (PLP) and pyridoxine 5'-phosphate. A human brain cDNA clone was identified to the PLP phosphatase on the basis of peptide sequences obtained previously. The cDNA predicts a 296-amino acid protein with a calculated Mr of 31698. The open reading frame is encoded by two exons located on human chromosome 22q12.3, and the exon-intron junction contains the GT/AG consensus splice site. In addition, a full-length mouse PLP phosphatase cDNA of 1978 bp was also isolated. Mouse enzyme encodes a protein of 292 amino acids with Mr of 31512, and it is localized on chromosome 15.E1. Human and mouse PLP phosphatase share 93% identity in protein sequence. A BLAST search revealed the existence of putative proteins in organism ranging from bacteria to mammals. Catalytically active human PLP phosphatase was expressed in Escherichia coli, and characteristics of the recombinant enzyme were similar to those of erythrocyte enzyme. The recombinant enzyme displayed Km and kcat values for pyridoxal of 2.5 microM and 1.52 s(-1), respectively. Human PLP phosphatase mRNA is differentially expressed in a tissue-specific manner. A single mRNA transcript of 2.1 kb was detected in all human tissues examined and was highly abundant in the brain. Obtaining the molecular properties for the human PLP phosphatase may provide new direction for investigating metabolic pathway involving vitamin B6.

  5. [Phosphatase activity in Amoeba proteus at low pH].

    PubMed

    Sopina, V A

    2009-01-01

    In free-living Amoeba proteus (strain B), three forms of tartrate-sensitive phosphatase were revealed using PAGE of the supernatant of ameba homogenates obtained with 1% Triton X-100 or distilled water and subsequent staining of gels with 2-naphthyl phosphate as substrate (pH 4.0). The form with the highest mobility in the ameba supernatant was sensitive to all tested phosphatase activity modulators. Two other forms with the lower mobilities were completely or significantly inactivated not only by sodium L-(+)-tartrate, but also by L-(+)-tartaric acid, sodium orthovanadate, ammonium molybdate, EDTA, EGTA, o-phospho-L-tyrosine, DL-dithiotreitol, H2O2, 2-mercaptoethanol, and ions of heavy metals - Fe2+, Fe3+, and Cu2+. Based on results of inhibitory analysis, lysosome location in the ameba cell, and wide substrate specificity of these two forms, it has been concluded that they belong to nonspecific acid phosphomonoesterases (AcP, EC 3.1.3.2). This AcP is suggested to have both phosphomonoesterase and phosphotyrosyl-protein phosphatase activitis. Two ecto-phosphatases were revealed in the culture medium, in which amebas were cultivated. One of them was inhibited by the same reagents as the ameba tartrate-sensitive AcP and seems to be the AcP released into the culture medium in the process of exocytosis of the content of food vacuoles. In the culture medium, apart from this AcP, another phosphatase was revealed, which was not inhibited by any tested inhibitors of AcP and alkaline phosphatase. It cannot be ruled out that this phosphatase belong to the ecto-ATPases found in many protists; however, its ability to hydrolyze ATP has not yet been proven.

  6. Serum alkaline phosphatase screening for vitamin D deficiency states.

    PubMed

    Shaheen, Shehla; Noor, Syed Shahid; Barakzai, Qamaruddin

    2012-07-01

    To determine whether serum vitamin D levels are correlated with serum levels of alkaline phosphatase or not. Cross-sectional, observational study. Multi-centre study, conducted at Liaquat National Hospital and Medical College, National Medical Centre and Medicare Hospital, Karachi, from January to October 2009. Patients attending the Orthopaedic OPDs with complaints of pain in different body regions and serum vitamin D3 levels of ² 30 ng/ml were included in the study. Patients with vitamin D deficiency were further categorized into mild deficiency or insufficiency (vit. D3 = 20-29 ng/ml), moderate deficiency (vit. D3 = 5 - 19 ng/ml) and severe deficiency forms (vit. D3 < 5 ng/ml). Pearson correlation was applied to test the correlation of serum alkaline phosphatase levels with serum vitamin D3 levels. P-value < 0.05 was considered to be significant. Out of 110 samples, 26 had mild (23%), 61 had moderate (55%) and 21 had severe (19.1%) vitamin D deficiencies. All of the patients in the three groups had alkaline phosphatase with in normal limits and the total mean value of the enzyme was 135.97 ± 68.141 U/L. The inter group comparison showed highest values of alkaline phosphatase in the moderate vitamin D deficiency group. The correlation coefficient of alkaline phosphatase and serum vitamin D3 levels was r =0.05 (p =0.593). Serum vitamin D3 levels may not be correlated with increased serum alkaline phosphatase levels. Therefore, alkaline phosphatase may not be used as a screening test to rule out vitamin D deficiency.

  7. Alkaline phosphatase revisited: hydrolysis of alkyl phosphates.

    PubMed

    O'Brien, Patrick J; Herschlag, Daniel

    2002-03-05

    Escherichia coli alkaline phosphatase (AP) is the prototypical two metal ion catalyst with two divalent zinc ions bound approximately 4 A apart in the active site. Studies spanning half a century have elucidated many structural and mechanistic features of this enzyme, rendering it an attractive model for investigating the potent catalytic power of bimetallic centers. Unfortunately, fundamental mechanistic features have been obscured by limitations with the standard assays. These assays generate concentrations of inorganic phosphate (P(i)) in excess of its inhibition constant (K(i) approximately 1 muM). This tight binding by P(i) has affected the majority of published kinetic constants. Furthermore, binding limits k(cat)/K(m) for reaction of p-nitrophenyl phosphate, the most commonly employed substrate. We describe a sensitive (32)P-based assay for hydrolysis of alkyl phosphates that avoids the complication of product inhibition. We have revisited basic mechanistic features of AP with these alkyl phosphate substrates. The results suggest that the chemical step for phosphorylation of the enzyme limits k(cat)/K(m). The pH-rate profile and additional results suggest that the serine nucleophile is active in its anionic form and has a pK(a) of < or = 5.5 in the free enzyme. An inactivating pK(a) of 8.0 is observed for binding of both substrates and inhibitors, and we suggest that this corresponds to ionization of a zinc-coordinated water molecule. Counter to previous suggestions, inorganic phosphate dianion appears to bind to the highly charged AP active site at least as strongly as the trianion. The dependence of k(cat)/K(m) on the pK(a) of the leaving group follows a Brønsted correlation with a slope of beta(lg) = -0.85 +/- 0.1, differing substantially from the previously reported value of -0.2 obtained from data with a less sensitive assay. This steep leaving group dependence is consistent with a largely dissociative transition state for AP-catalyzed hydrolysis of

  8. Glycerol-3-phosphatase of Corynebacterium glutamicum.

    PubMed

    Lindner, Steffen N; Meiswinkel, Tobias M; Panhorst, Maren; Youn, Jung-Won; Wiefel, Lars; Wendisch, Volker F

    2012-06-15

    Formation of glycerol as by-product of amino acid production by Corynebacterium glutamicum has been observed under certain conditions, but the enzyme(s) involved in its synthesis from glycerol-3-phosphate were not known. It was shown here that cg1700 encodes an enzyme active as a glycerol-3-phosphatase (GPP) hydrolyzing glycerol-3-phosphate to inorganic phosphate and glycerol. GPP was found to be active as a homodimer. The enzyme preferred conditions of neutral pH and requires Mg²⁺ or Mn²⁺ for its activity. GPP dephosphorylated both L- and D-glycerol-3-phosphate with a preference for the D-enantiomer. The maximal activity of GPP was estimated to be 31.1 and 1.7 U mg⁻¹ with K(M) values of 3.8 and 2.9 mM for DL- and L-glycerol-3-phosphate, respectively. For physiological analysis a gpp deletion mutant was constructed and shown to lack the ability to produce detectable glycerol concentrations. Vice versa, gpp overexpression increased glycerol accumulation during growth in fructose minimal medium. It has been demonstrated previously that intracellular accumulation of glycerol-3-phosphate is growth inhibitory as shown for a recombinant C. glutamicum strain overproducing glycerokinase and glycerol facilitator genes from E. coli in media containing glycerol. In this strain, overexpression of gpp restored growth in the presence of glycerol as intracellular glycerol-3-phosphate concentrations were reduced to wild-type levels. In C. glutamicum wild type, GPP was shown to be involved in utilization of DL-glycerol-3-phosphate as source of phosphorus, since growth with DL-glycerol-3-phosphate as sole phosphorus source was reduced in the gpp deletion strain whereas it was accelerated upon gpp overexpression. As GPP homologues were found to be encoded in the genomes of many other bacteria, the gpp homologues of Escherichia coli (b2293) and Bacillus subtilis (BSU09240, BSU34970) as well as gpp1 from the plant Arabidosis thaliana were overexpressed in E. coli MG1655 and

  9. Phosphoinositide 5- and 3-phosphatase activities of a voltage-sensing phosphatase in living cells show identical voltage dependence.

    PubMed

    Keum, Dongil; Kruse, Martin; Kim, Dong-Il; Hille, Bertil; Suh, Byung-Chang

    2016-06-28

    Voltage-sensing phosphatases (VSPs) are homologs of phosphatase and tensin homolog (PTEN), a phosphatidylinositol 3,4-bisphosphate [PI(3,4)P2] and phosphatidylinositol 3,4,5-trisphosphate [PI(3,4,5)P3] 3-phosphatase. However, VSPs have a wider range of substrates, cleaving 3-phosphate from PI(3,4)P2 and probably PI(3,4,5)P3 as well as 5-phosphate from phosphatidylinositol 4,5-bisphosphate [PI(4,5)P2] and PI(3,4,5)P3 in response to membrane depolarization. Recent proposals say these reactions have differing voltage dependence. Using Förster resonance energy transfer probes specific for different PIs in living cells with zebrafish VSP, we quantitate both voltage-dependent 5- and 3-phosphatase subreactions against endogenous substrates. These activities become apparent with different voltage thresholds, voltage sensitivities, and catalytic rates. As an analytical tool, we refine a kinetic model that includes the endogenous pools of phosphoinositides, endogenous phosphatase and kinase reactions connecting them, and four exogenous voltage-dependent 5- and 3-phosphatase subreactions of VSP. We show that apparent voltage threshold differences for seeing effects of the 5- and 3-phosphatase activities in cells are not due to different intrinsic voltage dependence of these reactions. Rather, the reactions have a common voltage dependence, and apparent differences arise only because each VSP subreaction has a different absolute catalytic rate that begins to surpass the respective endogenous enzyme activities at different voltages. For zebrafish VSP, our modeling revealed that 3-phosphatase activity against PI(3,4,5)P3 is 55-fold slower than 5-phosphatase activity against PI(4,5)P2; thus, PI(4,5)P2 generated more slowly from dephosphorylating PI(3,4,5)P3 might never accumulate. When 5-phosphatase activity was counteracted by coexpression of a phosphatidylinositol 4-phosphate 5-kinase, there was accumulation of PI(4,5)P2 in parallel to PI(3,4,5)P3 dephosphorylation

  10. Phosphoinositide 5- and 3-phosphatase activities of a voltage-sensing phosphatase in living cells show identical voltage dependence

    PubMed Central

    Keum, Dongil; Kim, Dong-Il; Suh, Byung-Chang

    2016-01-01

    Voltage-sensing phosphatases (VSPs) are homologs of phosphatase and tensin homolog (PTEN), a phosphatidylinositol 3,4-bisphosphate [PI(3,4)P2] and phosphatidylinositol 3,4,5-trisphosphate [PI(3,4,5)P3] 3-phosphatase. However, VSPs have a wider range of substrates, cleaving 3-phosphate from PI(3,4)P2 and probably PI(3,4,5)P3 as well as 5-phosphate from phosphatidylinositol 4,5-bisphosphate [PI(4,5)P2] and PI(3,4,5)P3 in response to membrane depolarization. Recent proposals say these reactions have differing voltage dependence. Using Förster resonance energy transfer probes specific for different PIs in living cells with zebrafish VSP, we quantitate both voltage-dependent 5- and 3-phosphatase subreactions against endogenous substrates. These activities become apparent with different voltage thresholds, voltage sensitivities, and catalytic rates. As an analytical tool, we refine a kinetic model that includes the endogenous pools of phosphoinositides, endogenous phosphatase and kinase reactions connecting them, and four exogenous voltage-dependent 5- and 3-phosphatase subreactions of VSP. We show that apparent voltage threshold differences for seeing effects of the 5- and 3-phosphatase activities in cells are not due to different intrinsic voltage dependence of these reactions. Rather, the reactions have a common voltage dependence, and apparent differences arise only because each VSP subreaction has a different absolute catalytic rate that begins to surpass the respective endogenous enzyme activities at different voltages. For zebrafish VSP, our modeling revealed that 3-phosphatase activity against PI(3,4,5)P3 is 55-fold slower than 5-phosphatase activity against PI(4,5)P2; thus, PI(4,5)P2 generated more slowly from dephosphorylating PI(3,4,5)P3 might never accumulate. When 5-phosphatase activity was counteracted by coexpression of a phosphatidylinositol 4-phosphate 5-kinase, there was accumulation of PI(4,5)P2 in parallel to PI(3,4,5)P3 dephosphorylation

  11. Crystal structure of rat intestinal alkaline phosphatase--role of crown domain in mammalian alkaline phosphatases.

    PubMed

    Ghosh, Kaushik; Mazumder Tagore, Debarati; Anumula, Rushith; Lakshmaiah, Basanth; Kumar, P P B S; Singaram, Senthuran; Matan, Thangavelu; Kallipatti, Sanjith; Selvam, Sabariya; Krishnamurthy, Prasad; Ramarao, Manjunath

    2013-11-01

    Intestinal alkaline phosphatases (IAPs) are involved in the cleavage of phosphate prodrugs to liberate the drug for absorption in the intestine. To facilitate in vitro characterization of phosphate prodrugs, we have cloned, expressed, purified and characterized IAPs from rat and cynomolgus monkey (rIAP and cIAP respectively) which are important pre-clinical species for drug metabolism studies. The recombinant rat and monkey enzymes expressed in Sf9 insect cells (IAP-Ic) were found to be glycosylated and active. Expression of rat IAP in Escherichia coli (rIAP-Ec) led to ~200-fold loss of activity that was partially recovered by the addition of external Zn(2+) and Mg(2+) ions. Crystal structures of rIAP-Ec and rIAP-Ic were determined and they provide rationale for the discrepancy in enzyme activities. Rat IAP-Ic retains its activity in presence of both Zn(2+) and Mg(2+) whereas activity of most other alkaline phosphatases (APs) including the cIAP was strongly inhibited by excess Zn(2+). Based on our crystal structure, we hypothesized the residue Q317 in rIAP, present within 7 Å of the Mg(2+) at M3, to be important for this difference in activity. The Q317H rIAP and H317Q cIAP mutants showed reversal in effect of Zn(2+), corroborating the hypothesis. Further analysis of the two structures indicated a close linkage between glycosylation and crown domain stability. A triple mutant of rIAP, where all the three putative N-linked glycosylation sites were mutated showed thermal instability and reduced activity.

  12. Human prostatic acid phosphatase directly stimulates collagen synthesis and alkaline phosphatase content of isolated bone cells

    SciTech Connect

    Ishibe, M.; Rosier, R.N.; Puzas, J.E. )

    1991-10-01

    Human prostatic acid phosphatase (hPAP) directly enhances the differentiated characteristics of isolated bone cells in vitro. This enzyme, when added to cell cultures for 24 h in vitro stimulates collagen synthesis and the production of alkaline phosphatase. The effects are dose dependent, with statistically significant effects occurring from 0.1-100 nM hPAP. Concentrations higher than 100 nM do not evoke greater effects. The maximal effect of hPAP occurs between 12 and 24 h of exposure. The cells stimulated to the greatest degree are osteoprogenitor cells and osteoblasts. Fibroblasts isolated from the same tissue show a lesser sensitivity to hPAP. hPAP has no detectable effect on cell proliferation, as measured by radiolabeled thymidine incorporation or total DNA synthesis. None of the observations reported in this work can be attributed to contaminating proteins in the hPAP preparation. hPAP was radiolabeled with 125I and was used for affinity binding and cross-linking studies. Scatchard analysis of specific binding indicated the presence of 1.0 X 10(5) high affinity binding sites/cell, with a Kd of 6.5 nM. Cross-linking studies demonstrated the presence of one 320-kDa binding complex. The pH profile and kinetic determinations of Km and maximum velocity for hPAP were similar to those previously reported, except for the finding of positive cooperativity of the substrate with the enzyme under the conditions of our assay. We believe that the direct stimulation of bone-forming cells by hPAP may contribute to the sclerotic nature of skeletal bone around sites of neoplastic prostatic metastases and that the effect of the enzyme is probably mediated by a plasma membrane receptor.

  13. Y-12 Alpha Calutron

    SciTech Connect

    2011-09-23

    The Alpha Calutron video shows the world's only Alpha Calutron magnets located in Building 9731 at the Y-12 National Security Complex, the first building completed on the site early in 1943. The calutrons were used to separate the first isotopes other than uranium.

  14. ALPHA CONTAMINATION MONITORING

    DTIC Science & Technology

    This project was conducted to determine the alpha hazard existing in the vicinity of the missile launch pad following the destruction of a missile ...were used for plutonium particle collection. Because all warhead-carrying missiles were properly launched after Project 2.3 was approved, no alpha contamination data was obtained.

  15. Characterization of Human Bone Alkaline Phosphatase in Pichia Pastoris

    NASA Technical Reports Server (NTRS)

    Malone, Christine C.; Ciszak, Eva; Karr, Laurel J.

    1999-01-01

    A soluble form of human bone alkaline phosphatase has been expressed in a recombinant strain of the methylotrophic yeast Pichia pastoris. We constructed a plasmid containing cDNA encoding for human bone alkaline phosphatase, with the hydrophobic carboxyl terminal portion deleted. Alkaline phosphatase was secreted into the medium to a level of 32mg/L when cultured in shake flasks, and enzyme activity was 12U/mg, as measured by a spectrophotometric assay. By conversion to a fermentation system, a yield of 880mg/L has been achieved with an enzyme activity of 968U/mg. By gel electrophoresis analysis, it appears that greater than 50% of the total protein in the fermentation media is alkaline phosphatase. Although purification procedures are not yet completely optimized, they are expected to include filtration, ion exchange and affinity chromatography. Our presentation will focus on the purification and crystallization results up to the time of the conference. Structural data should provide additional information on the role of alkaline phosphatase in normal bone mineralization and in certain bone mineralization anomalies.

  16. A conserved phosphatase cascade that regulates nuclear membrane biogenesis.

    PubMed

    Kim, Youngjun; Gentry, Matthew S; Harris, Thurl E; Wiley, Sandra E; Lawrence, John C; Dixon, Jack E

    2007-04-17

    A newly emerging family of phosphatases that are members of the haloacid dehalogenase superfamily contains the catalytic motif DXDX(T/V). A member of this DXDX(T/V) phosphatase family known as Dullard was recently shown to be a potential regulator of neural tube development in Xenopus [Satow R, Chan TC, Asashima M (2002) Biochem Biophys Res Commun 295:85-91]. Herein, we demonstrate that human Dullard and the yeast protein Nem1p perform similar functions in mammalian cells and yeast cells, respectively. In addition to similarity in primary sequence, Dullard and Nem1p possess similar domains and show similar substrate preferences, and both localize to the nuclear envelope. Additionally, we show that human Dullard can rescue the aberrant nuclear envelope morphology of nem1Delta yeast cells, functionally replacing Nem1p. Finally, Nem1p, has been shown to deposphorylate the yeast phosphatidic acid phosphatase Smp2p [Santos-Rosa H, Leung J, Grimsey N, Peak-Chew S, Siniossoglou S (2005) EMBO J 24:1931-1941], and we show that Dullard dephosphorylates the mammalian phospatidic acid phosphatase, lipin. Therefore, we propose that Dullard participates in a unique phosphatase cascade regulating nuclear membrane biogenesis, and that this cascade is conserved from yeast to mammals.

  17. Characterization of Human Bone Alkaline Phosphatase in Pichia Pastoris

    NASA Technical Reports Server (NTRS)

    Malone, Christine C.; Ciszak, Eva; Karr, Laurel J.

    1999-01-01

    A soluble form of human bone alkaline phosphatase has been expressed in a recombinant strain of the methylotrophic yeast Pichia pastoris. We constructed a plasmid containing cDNA encoding for human bone alkaline phosphatase, with the hydrophobic carboxyl terminal portion deleted. Alkaline phosphatase was secreted into the medium to a level of 32mg/L when cultured in shake flasks, and enzyme activity was 12U/mg, as measured by a spectrophotometric assay. By conversion to a fermentation system, a yield of 880mg/L has been achieved with an enzyme activity of 968U/mg. By gel electrophoresis analysis, it appears that greater than 50% of the total protein in the fermentation media is alkaline phosphatase. Although purification procedures are not yet completely optimized, they are expected to include filtration, ion exchange and affinity chromatography. Our presentation will focus on the purification and crystallization results up to the time of the conference. Structural data should provide additional information on the role of alkaline phosphatase in normal bone mineralization and in certain bone mineralization anomalies.

  18. Domain-to-domain coupling in voltage-sensing phosphatase

    PubMed Central

    Sakata, Souhei; Matsuda, Makoto; Kawanabe, Akira; Okamura, Yasushi

    2017-01-01

    Voltage-sensing phosphatase (VSP) consists of a transmembrane voltage sensor and a cytoplasmic enzyme region. The enzyme region contains the phosphatase and C2 domains, is structurally similar to the tumor suppressor phosphatase PTEN, and catalyzes the dephosphorylation of phosphoinositides. The transmembrane voltage sensor is connected to the phosphatase through a short linker region, and phosphatase activity is induced upon membrane depolarization. Although the detailed molecular characteristics of the voltage sensor domain and the enzyme region have been revealed, little is known how these two regions are coupled. In addition, it is important to know whether mechanism for coupling between the voltage sensor domain and downstream effector function is shared among other voltage sensor domain-containing proteins. Recent studies in which specific amino acid sites were genetically labeled using a fluorescent unnatural amino acid have enabled detection of the local structural changes in the cytoplasmic region of Ciona intestinalis VSP that occur with a change in membrane potential. The results of those studies provide novel insight into how the enzyme activity of the cytoplasmic region of VSP is regulated by the voltage sensor domain. PMID:28744425

  19. Phosphotyrosine Substrate Sequence Motifs for Dual Specificity Phosphatases

    PubMed Central

    Zhao, Bryan M.; Keasey, Sarah L.; Tropea, Joseph E.; Lountos, George T.; Dyas, Beverly K.; Cherry, Scott; Raran-Kurussi, Sreejith; Waugh, David S.; Ulrich, Robert G.

    2015-01-01

    Protein tyrosine phosphatases dephosphorylate tyrosine residues of proteins, whereas, dual specificity phosphatases (DUSPs) are a subgroup of protein tyrosine phosphatases that dephosphorylate not only Tyr(P) residue, but also the Ser(P) and Thr(P) residues of proteins. The DUSPs are linked to the regulation of many cellular functions and signaling pathways. Though many cellular targets of DUSPs are known, the relationship between catalytic activity and substrate specificity is poorly defined. We investigated the interactions of peptide substrates with select DUSPs of four types: MAP kinases (DUSP1 and DUSP7), atypical (DUSP3, DUSP14, DUSP22 and DUSP27), viral (variola VH1), and Cdc25 (A-C). Phosphatase recognition sites were experimentally determined by measuring dephosphorylation of 6,218 microarrayed Tyr(P) peptides representing confirmed and theoretical phosphorylation motifs from the cellular proteome. A broad continuum of dephosphorylation was observed across the microarrayed peptide substrates for all phosphatases, suggesting a complex relationship between substrate sequence recognition and optimal activity. Further analysis of peptide dephosphorylation by hierarchical clustering indicated that DUSPs could be organized by substrate sequence motifs, and peptide-specificities by phylogenetic relationships among the catalytic domains. The most highly dephosphorylated peptides represented proteins from 29 cell-signaling pathways, greatly expanding the list of potential targets of DUSPs. These newly identified DUSP substrates will be important for examining structure-activity relationships with physiologically relevant targets. PMID:26302245

  20. New Functions of the Inositol Polyphosphate 5-Phosphatases in Cancer.

    PubMed

    Erneux, Christophe; Ghosh, Somadri; Ramos, Ana Raquel; Edimo, William's Elong

    2016-01-01

    Inositol polyphosphate 5-phosphatases act on inositol phosphates and phosphoinositides as substrates. They are 10 different isoenzymes and several splice variants in the human genome that are involved in a series of human pathologies such as the Lowe syndrome, the Joubert and MORM syndromes, breast cancer, glioblastoma, gastric cancer and several other type of cancers. Inositol 5-phosphatases can be amplified in human cancer cells, whereas the 3- and 4- phosphatase tumor suppressor PTEN and INPP4B, repectively are often repressed or deleted. The inositol 5-phosphatases are critically involved in a complex network of higly regulated phosphoinositides, affecting the lipid content of PI(3, 4, 5)P3, PI(4, 5)P2 and PI(3, 4)P2. This has an impact on the normal behavior of many intracellular target proteins e.g. protein kinase B (PKB/Akt) or actin binding proteins and final biological responses. The production of PI(3, 4P)2 by dephosphorylation of the substrate PI(3, 4, 5)P3 is particularly important as it produces a new signal messenger in the control of cell migration, invasion and endocytosis. New inhibitors/activators of inositol 5- phosphatases have recently been identified for the possible control of their activity in several human pathologies such as inflamation and cancer.

  1. Acid phosphatase activities during the germination of Glycine max seeds.

    PubMed

    dos Prazeres, Janaina Nicanuzia; Ferreira, Carmen Veríssima; Aoyama, Hiroshi

    2004-01-01

    In this paper, we describe a study concerning the determination of some characteristics of soybean seedlings and the detection of acid phosphatase activities towards different substrates during the germination. Enzyme activities with p-nitrophenylphosphate (pNPP) and inorganic pyrophosphate (PPi) as substrates were detected from the 5th and 7th days after germination, respectively. Acid phosphatase activities with tyrosine phosphate (TyrP), glucose-6-phosphate (G6P) and phosphoenol pyruvate (PEP) were also observed but to a lesser extent. Under the same conditions, no enzyme activity was detected with phytic acid (PhyAc) as substrate. The appearance of phosphatase activity was coincident with the decrease of inorganic phosphate content during germination; over the same period, the protein content increased up to the 5th day, decreased until the 8th day, and remained constant after this period. Relative to phosphatase activity in the cotyledons, the activities detected in the hypocotyl and roots were 82% and 38%, respectively. During storage the enzyme maintained about 63% of its activity for 3 months at 5 degrees C. The specificity constant (Vmax/Km) values for pNPP and PPi were 212 and 64 mu kat mM-1 mg-1, respectively. Amongst the substrates tested, PPi could be a potential physiological substrate for acid phosphatase during the germination of soybean seeds.

  2. [Granulocyte alkaline phosphatase--a biomarker of chronic benzene exposure].

    PubMed

    Khristeva, V; Meshkov, T

    1994-01-01

    In tracing the cellular population status in the peripheral blood of workers, exposed to benzene, was included and cytochemical determination of the alkaline phosphatase activity in leucocytes. This enzyme is accepted as marker of the neutrophilic granulocytes, as maturation of the cells and their antibacterial activity are parallel to the cytochemical activity of the enzyme. 78 workers from the coke-chemical production from state firm "Kremikovtsi" and 41 workers from the production "Benzene" and "Isopropylbenzene"--Oil Chemical Plant, Burgas are included. The benzene concentrations in the air of the working places in all productions are in the range of 5 to 50 mg/m3. For cytochemical determination of the alkaline phosphatase activity is used the method of L. Kaplow and phosphatase index was calculated. It was established that in 98.4% of all examined the alkaline phosphatase activity is inhibited to different rate, as from 46.5% [61 workers] it is zero. In considerably lower percentage of workers were established and other deviations: leucocytosis or leucopenia, neutropenia, increased percent of band neutrophils and toxic granules. The results of the investigation of the granulocyte population show that from all indices, the activity of granulocyte alkaline phosphatase demonstrates most convincing the early myelotoxic effect of benzene.

  3. The catalytic properties of alkaline phosphatases under various conditions

    NASA Astrophysics Data System (ADS)

    Atyaksheva, L. F.; Chukhrai, E. S.; Poltorak, O. M.

    2008-11-01

    A comparative study was performed to examine the catalytic properties of alkaline phosphatases from bacteria Escherichia coli and bovine and chicken intestines. The activity of enzyme dimers and tetramers was determined. The activity of the dimer was three or four times higher than that of the tetramer. The maximum activity and affinity for 4-nitrophenylphosphate was observed for the bacterial alkaline phosphatase ( K M = 1.7 × 10-5 M, V max = 1800 μmol/(min mg of protein) for dimers and V max = 420 μmol/(min mg of protein) for tetramers). The Michaelis constants were equal for two animal phosphatases in various buffer media (pH 8.5) ((3.5 ± 0.2) × 10-4 M). Five buffer systems were investigated: tris, carbonate, hepes, borate, and glycine buffers, and the lowest catalytic activity of alkaline phosphatases at equal pH was observed in the borate buffer (for enzyme from bovine intestine, V max = 80 μmol/(min mg of protein)). Cu2+ cations formed a complex with tris-(oxymethyl)-aminomethane ( tris-HCl buffer) and inhibited the intestine alkaline phosphatases by a noncompetitive mechanism.

  4. Thermal inactivation of alkali phosphatases under various conditions

    NASA Astrophysics Data System (ADS)

    Atyaksheva, L. F.; Tarasevich, B. N.; Chukhrai, E. S.; Poltorak, O. M.

    2009-02-01

    The thermal inactivation of alkali phosphatases from bacteria Escherichia coli (ECAP), bovine intestines (bovine IAP), and chicken intestines (chicken IAP) was studied in different buffer solutions and in the solid state. The conclusion was made that these enzymes had maximum stability in the solid state, and, in a carbonate buffer solution, their activity decreased most rapidly. It was found that the bacterial enzyme was more stable than animal phosphatases. It was noted that, for ECAP, four intermediate stages preceded the loss of enzyme activity, and, for bovine and chicken IAPs, three intermediate stages were observed. The activation energy of thermal inactivation of ECAP over the range 25-70°C was determined to be 80 kJ/mol; it corresponded to the dissociation of active dimers into inactive monomers. Higher activation energies (˜200 kJ/mol) observed at the initial stage of thermal inactivation of animal phosphatases resulted from the simultaneous loss of enzyme activity caused by dimer dissociation and denaturation. It was shown that the activation energy of denaturation of monomeric animal alkali phosphatases ranged from 330 to 380 kJ/mol depending on buffer media. It was concluded that the inactivation of solid samples of alkali phosphatases at 95°C was accompanied by an about twofold decrease in the content of β structures in protein molecules.

  5. A Novel Inositol Pyrophosphate Phosphatase in Saccharomyces cerevisiae

    PubMed Central

    Steidle, Elizabeth A.; Chong, Lucy S.; Wu, Mingxuan; Crooke, Elliott; Fiedler, Dorothea; Resnick, Adam C.; Rolfes, Ronda J.

    2016-01-01

    Inositol pyrophosphates are high energy signaling molecules involved in cellular processes, such as energetic metabolism, telomere maintenance, stress responses, and vesicle trafficking, and can mediate protein phosphorylation. Although the inositol kinases underlying inositol pyrophosphate biosynthesis are well characterized, the phosphatases that selectively regulate their cellular pools are not fully described. The diphosphoinositol phosphate phosphohydrolase enzymes of the Nudix protein family have been demonstrated to dephosphorylate inositol pyrophosphates; however, the Saccharomyces cerevisiae homolog Ddp1 prefers inorganic polyphosphate over inositol pyrophosphates. We identified a novel phosphatase of the recently discovered atypical dual specificity phosphatase family as a physiological inositol pyrophosphate phosphatase. Purified recombinant Siw14 hydrolyzes the β-phosphate from 5-diphosphoinositol pentakisphosphate (5PP-IP5 or IP7) in vitro. In vivo, siw14Δ yeast mutants possess increased IP7 levels, whereas heterologous SIW14 overexpression eliminates IP7 from cells. IP7 levels increased proportionately when siw14Δ was combined with ddp1Δ or vip1Δ, indicating independent activity by the enzymes encoded by these genes. We conclude that Siw14 is a physiological phosphatase that modulates inositol pyrophosphate metabolism by dephosphorylating the IP7 isoform 5PP-IP5 to IP6. PMID:26828065

  6. Acid phosphatase and lipid peroxidation in human cataractous lens epithelium.

    PubMed

    Vasavada, A R; Thampi, P; Yadav, S; Rawal, U M

    1993-12-01

    The anterior lens epithelial cells undergo a variety of degenerative and proliferative changes during cataract formation. Acid phosphatase is primarily responsible for tissue regeneration and tissue repair. The lipid hydroperoxides that are obtained by lipid peroxidation of polysaturated or unsaturated fatty acids bring about deterioration of biological membranes at cellular and tissue levels. Acid phosphatase and lipid peroxidation activities were studied on the lens epithelial cells of nuclear cataract, posterior subcapsular cataract, mature cataract, and mixed cataract. Of these, mature cataractous lens epithelium showed maximum activity for acid phosphatase (516.83 moles of p-nitrophenol released/g lens epithelium) and maximum levels of lipid peroxidation (86.29 O.D./min/g lens epithelium). In contrast, mixed cataractous lens epithelium showed minimum activity of acid phosphatase (222.61 moles of p-nitrophenol released/g lens epithelium) and minimum levels of lipid peroxidation (54.23 O.D./min/g lens epithelium). From our study, we correlated the maximum activity of acid phosphatase in mature cataractous lens epithelium with the increased areas of superimposed cells associated with the formation of mature cataract. Likewise, the maximum levels of lipid peroxidation in mature cataractous lens epithelium was correlated with increased permeability of the plasma membrane. Conversely, the minimum levels of lipid peroxidation in mixed cataractous lens epithelium makes us presume that factors other than lipid peroxidation may also account for the formation of mixed type of cataract.

  7. Studies on the catalytic mechanism of pig purple acid phosphatase.

    PubMed

    Wynne, C J; Hamilton, S E; Dionysius, D A; Beck, J L; de Jersey, J

    1995-05-10

    Several independent experiments failed to reveal any evidence in support of the involvement of a phosphoryl-enzyme intermediate in the catalytic mechanism of pig allantoic fluid purple acid phosphatase: (i) attempts to label enzyme with phosphate derived from [32P]p-nitrophenyl phosphate were unsuccessful; (ii) values of kcat for a series of phosphate derivative varied over a wide range, with the enzyme showing a marked preference for activated ester and anhydride substrates over those with a stable leaving group; (iii) burst titrations revealed a "burst" of p-nitrophenol from p-nitrophenyl phosphate only when the enzyme was added after the substrate, suggesting that this result was an artifact of the order of addition of reagents; (iv) transphosphorylation from p-nitrophenyl phosphate to acceptor alcohols could not be detected, even under conditions where a transphosphorylation to hydrolysis ratio as low as 0.015 could have been measured; (v) enzyme-catalyzed exchange of 180 between phosphate and water was demonstrated, although at a rate much slower than that observed for other phosphatases where the involvement of a phosphoryl-enzyme intermediate in the mechanism has been clearly established. The present results are compared with those obtained in similar studies on other phosphatases, particularly the highly homologous beef spleen purple acid phosphatase, and their implications for the catalytic mechanism of the purple acid phosphatases are discussed.

  8. Escherichia coli alkaline phosphatase. Kinetic studies with the tetrameric enzyme.

    PubMed

    Halford, S E; Schlesinger, M J; Gutfreund, H

    1972-03-01

    1. The stability of the tetrameric form of Escherichia coli alkaline phosphatase was examined by analytical ultracentrifugation. 2. The stopped-flow technique was used to study the hydrolysis of nitrophenyl phosphates by the alkaline phosphatase tetramer at pH7.5 and 8.3. In both cases transient product formation was observed before the steady state was attained. Both transients consisted of the liberation of 1mol of nitrophenol/2mol of enzyme subunits within the dead-time of the apparatus. The steady-state rates were identical with those observed with the dimer under the same conditions. 3. The binding of 2-hydroxy-5-nitrobenzyl phosphonate to the alkaline phosphatase tetramer was studied by the temperature-jump technique. The self-association of two dimers to form the tetramer is linked to a conformation change within the dimer. This accounts for the differences between the transient phases in the reactions of the dimer and the tetramer with substrate. 4. Addition of P(i) to the alkaline phosphatase tetramer caused it to dissociate into dimers. The tetramer is unable to bind this ligand. It is suggested that the tetramer undergoes a compulsory dissociation before the completion of its first turnover with substrate. 5. On the basis of these findings a mechanism is proposed for the involvement of the alkaline phosphatase tetramer in the physiology of E. coli.

  9. Elevated serum level of human alkaline phosphatase in obesity.

    PubMed

    Khan, Abdul Rehman; Awan, Fazli Rabbi; Najam, Syeda Sadia; Islam, Mehboob; Siddique, Tehmina; Zain, Maryam

    2015-11-01

    To investigate a correlation between serum alkaline phosphatase level and body mass index in human subjects. The comparative cross-sectional study was carried out at the National Institute for Biotechnology and Genetic Engineering, Faisalabad, Pakistan, from April 2012 to June 2013. Blood serum alkaline phosphatase levels were estimated and the subjects were divided into three sub-groups on the basis of their body mass. normal weight (<25kg/m2), overweight (25-27kg/m2) and obese (>27kg/m2) subjects. The serum samples were used for the estimation of clinically important biochemical parameters, using commercial kits on clinical chemistry analyser. Of the 197 subjects, 97(49%) were obese and 100(51%) were non-obese. The serum alkaline phosphatase level increased in obese (214±6.4 IU/L) compared to the non-obese subjects (184.5±5 IU/L). Furthermore, a significant linear relationship (r=0.3;p-0.0001) was found between serum alkaline phosphatase and body mass index. Other biochemical variables were not correlated to the body mass index. Over activity and higher amounts of alkaline phosphatase were linked to the development of obesity.

  10. Isonicotinohydrazones as inhibitors of alkaline phosphatase and ecto-5'-nucleotidase.

    PubMed

    Channar, Pervaiz Ali; Shah, Syed Jawad Ali; Hassan, Sidra; Nisa, Zaib Un; Lecka, Joanna; Sévigny, Jean; Bajorath, Jürgen; Saeed, Aamer; Iqbal, Jamshed

    2017-03-01

    A series of isonicotinohydrazide derivatives was synthesized and tested against recombinant human and rat ecto-5'-nucleotidases (h-e5'NT and r-e5'NT) and alkaline phosphatase isozymes including both bovine tissue-non-specific alkaline phosphatase (b-TNAP) and tissue-specific calf intestinal alkaline phosphatase (c-IAP). These enzymes are implicated in vascular calcifications, hypophosphatasia, solid tumors, and cancers, such as colon, lung, breast, pancreas, and ovary. All tested compounds were active against both enzymes. The most potent inhibitor of h-e5'NT was derivative (E)-N'-(1-(3-(4-fluorophenyl)-5-phenyl-4,5-dihydro-1H-pyrazol-1-yl)ethylidene)isonicotinohydrazide (3j), whereas derivative (E)-N'-(4-hydroxy-3-methoxybenzylidene)isonicotinohydrazide (3g) exhibited significant inhibitory activity against r-e5'NT. In addition, the derivative (E)-N'-(4'-chlorobenzylidene)isonicotinohydrazide (3a) was most potent inhibitor against calf intestinal alkaline phosphatase and the derivative (E)-N'-(4-hydroxy-3-methoxybenzylidene)isonicotinohydrazide (3g) was found to be most potent inhibitor of bovine tissue-non-specific alkaline phosphatase. Furthermore, putative binding modes of potent compounds against e5'NT (human and rat e5'NT) and AP (including b-TNAP and c-IAP) were determined computationally. © 2016 John Wiley & Sons A/S.

  11. Event counting alpha detector

    DOEpatents

    Bolton, Richard D.; MacArthur, Duncan W.

    1996-01-01

    An electrostatic detector for atmospheric radon or other weak sources of alpha radiation. In one embodiment, nested enclosures are insulated from one another, open at the top, and have a high voltage pin inside and insulated from the inside enclosure. An electric field is produced between the pin and the inside enclosure. Air ions produced by collision with alpha particles inside the decay volume defined by the inside enclosure are attracted to the pin and the inner enclosure. With low alpha concentrations, individual alpha events can be measured to indicate the presence of radon or other alpha radiation. In another embodiment, an electrical field is produced between parallel plates which are insulated from a single decay cavity enclosure.

  12. Event counting alpha detector

    DOEpatents

    Bolton, R.D.; MacArthur, D.W.

    1996-08-27

    An electrostatic detector is disclosed for atmospheric radon or other weak sources of alpha radiation. In one embodiment, nested enclosures are insulated from one another, open at the top, and have a high voltage pin inside and insulated from the inside enclosure. An electric field is produced between the pin and the inside enclosure. Air ions produced by collision with alpha particles inside the decay volume defined by the inside enclosure are attracted to the pin and the inner enclosure. With low alpha concentrations, individual alpha events can be measured to indicate the presence of radon or other alpha radiation. In another embodiment, an electrical field is produced between parallel plates which are insulated from a single decay cavity enclosure. 6 figs.

  13. Imaging alpha particle detector

    DOEpatents

    Anderson, David F.

    1985-01-01

    A method and apparatus for detecting and imaging alpha particles sources is described. A conducting coated high voltage electrode (1) and a tungsten wire grid (2) constitute a diode configuration discharge generator for electrons dislodged from atoms or molecules located in between these electrodes when struck by alpha particles from a source (3) to be quantitatively or qualitatively analyzed. A thin polyester film window (4) allows the alpha particles to pass into the gas enclosure and the combination of the glass electrode, grid and window is light transparent such that the details of the source which is imaged with high resolution and sensitivity by the sparks produced can be observed visually as well. The source can be viewed directly, electronically counted or integrated over time using photographic methods. A significant increase in sensitivity over other alpha particle detectors is observed, and the device has very low sensitivity to gamma or beta emissions which might otherwise appear as noise on the alpha particle signal.

  14. Imaging alpha particle detector

    DOEpatents

    Anderson, D.F.

    1980-10-29

    A method and apparatus for detecting and imaging alpha particles sources is described. A dielectric coated high voltage electrode and a tungsten wire grid constitute a diode configuration discharge generator for electrons dislodged from atoms or molecules located in between these electrodes when struck by alpha particles from a source to be quantitatively or qualitatively analyzed. A thin polyester film window allows the alpha particles to pass into the gas enclosure and the combination of the glass electrode, grid and window is light transparent such that the details of the source which is imaged with high resolution and sensitivity by the sparks produced can be observed visually as well. The source can be viewed directly, electronically counted or integrated over time using photographic methods. A significant increase in sensitivity over other alpha particle detectors is observed, and the device has very low sensitivity to gamma or beta emissions which might otherwise appear as noise on the alpha particle signal.

  15. Alpha-particle diagnostics

    SciTech Connect

    Young, K.M.

    1991-01-01

    This paper will focus on the state of development of diagnostics which are expected to provide the information needed for {alpha}- physics studies in the future. Conventional measurement of detailed temporal and spatial profiles of background plasma properties in DT will be essential for such aspects as determining heating effectiveness, shaping of the plasma profiles and effects of MHD, but will not be addressed here. This paper will address (1) the measurement of the neutron source, and hence {alpha}-particle birth profile, (2) measurement of the escaping {alpha}-particles and (3) measurement of the confined {alpha}-particles over their full energy range. There will also be a brief discussion of (4) the concerns about instabilities being generated by {alpha}-particles and the methods necessary for measuring these effects. 51 refs., 10 figs.

  16. Growth inhibition of human lung adenocarcinoma cells by antibodies against epidermal growth factor receptor and by ganglioside GM3: involvement of receptor-directed protein tyrosine phosphatase(s).

    PubMed

    Suarez Pestana, E; Greiser, U; Sánchez, B; Fernández, L E; Lage, A; Perez, R; Böhmer, F D

    1997-01-01

    Growth of the EGF receptor-expressing non-small-cell lung carcinoma cell line H125 seems to be at least partially driven by autocrine activation of the resident EGF receptors. Thus, the possibility of an EGF receptor-directed antiproliferative treatment was investigated in vitro using a monoclonal antibody (alpha EGFR ior egf/r3) against the human EGF receptor and gangliosides which are known to possess antiproliferative and anti-tyrosine kinase activity. The moderate growth-inhibitory effect of alpha EGFR ior egf/r3 was strongly potentiated by the addition of monosialoganglioside GM3. Likewise, the combination of alpha EGFR ior egf/r3 and GM3 inhibited EGF receptor autophosphorylation activity in H125 cells more strongly than either agent alone. A synergistic inhibition of EGF receptor autophosphorylation by alpha EGFR ior egf/r3 and GM3 was also observed in the human epidermoid carcinoma cell line A431. In both cell lines, the inhibition of EGF receptor autophosphorylation by GM3 was prevented by pretreatment of the cells with pervanadate, a potent inhibitor of protein tyrosine phosphatases (PTPases). Also, GM3 accelerated EGF receptor dephosphorylation in isolated A431 cell membranes. These findings indicate that GM3 has the capacity to activate EGF receptor-directed PTPase activity and suggest a novel possible mechanism for the regulation of cellular PTPases.

  17. Growth inhibition of human lung adenocarcinoma cells by antibodies against epidermal growth factor receptor and by ganglioside GM3: involvement of receptor-directed protein tyrosine phosphatase(s).

    PubMed Central

    Suarez Pestana, E.; Greiser, U.; Sánchez, B.; Fernández, L. E.; Lage, A.; Perez, R.; Böhmer, F. D.

    1997-01-01

    Growth of the EGF receptor-expressing non-small-cell lung carcinoma cell line H125 seems to be at least partially driven by autocrine activation of the resident EGF receptors. Thus, the possibility of an EGF receptor-directed antiproliferative treatment was investigated in vitro using a monoclonal antibody (alpha EGFR ior egf/r3) against the human EGF receptor and gangliosides which are known to possess antiproliferative and anti-tyrosine kinase activity. The moderate growth-inhibitory effect of alpha EGFR ior egf/r3 was strongly potentiated by the addition of monosialoganglioside GM3. Likewise, the combination of alpha EGFR ior egf/r3 and GM3 inhibited EGF receptor autophosphorylation activity in H125 cells more strongly than either agent alone. A synergistic inhibition of EGF receptor autophosphorylation by alpha EGFR ior egf/r3 and GM3 was also observed in the human epidermoid carcinoma cell line A431. In both cell lines, the inhibition of EGF receptor autophosphorylation by GM3 was prevented by pretreatment of the cells with pervanadate, a potent inhibitor of protein tyrosine phosphatases (PTPases). Also, GM3 accelerated EGF receptor dephosphorylation in isolated A431 cell membranes. These findings indicate that GM3 has the capacity to activate EGF receptor-directed PTPase activity and suggest a novel possible mechanism for the regulation of cellular PTPases. Images Figure 5 Figure 6 PMID:9010029

  18. Reexamination of the {alpha}-{alpha}''fishbone'' potential

    SciTech Connect

    Day, J. P.; McEwen, J. E.; Elhanafy, M.; Smith, E.; Woodhouse, R.; Papp, Z.

    2011-09-15

    The fishbone potential of composite particles simulates the Pauli effect by nonlocal terms. We determine the {alpha}-{alpha} fishbone potential by simultaneously fitting to two-{alpha} resonance energies, experimental phase shifts, and three-{alpha} binding energies. We found that, essentially, a simple Gaussian can provide a good description of two-{alpha} and three-{alpha} experimental data without invoking three-body potentials.

  19. A glutamate switch controls voltage-sensitive phosphatase function

    PubMed Central

    Liu, Lijun; Kohout, Susy C.; Xu, Qiang; Müller, Simone; Kimberlin, Christopher R.; Isacoff, Ehud Y.; Minor, Daniel L.

    2012-01-01

    Ciona intestinalis voltage sensing phosphatase Ci-VSP couples a voltage-sensing domain (VSD) to a lipid phosphatase similar to the tumor suppressor PTEN. How the VSD controls enzyme function has been unclear. Here, we present high-resolution crystal structures of the Ci-VSP enzymatic domain that reveal conformational changes in a key loop, termed the “gating loop”, that controls access to the active site by a mechanism in which residue Glu411 directly competes with substrate. Structure-based mutations that restrict gating loop conformation impair catalytic function and demonstrate that Glu411 also contributes to substrate selectivity. Structure-guided mutations further define an interaction between the gating loop and linker that connects the phosphatase to the VSD for voltage control of enzyme activity. Together, the data suggest that functional coupling between the gating loop and the linker forms the heart of the regulatory mechanism that controls voltage-dependent enzyme activation. PMID:22562138

  20. Purple acid phosphatase in the walls of tobacco cells.

    PubMed

    Kaida, Rumi; Hayashi, Takahisa; Kaneko, Takako S

    2008-10-01

    Purple acid phosphatase isolated from the walls of tobacco cells appears to be a 220kDa homotetramer composed of 60kDa subunits, which is purple in color and which contains iron as its only metal ion. Although the phosphatase did not require dithiothreitol for activity and was not inhibited by phenylarsine oxide, the enzyme showed a higher catalytic efficiency (k(cat)/K(m)) for phosphotyrosine-containing peptides than for other substrates including p-nitrophenyl-phosphate and ATP. The phosphatase formed as a 120kDa dimer in the cytoplasm and as a 220kDa tetramer in the walls, where Brefeldin A blocked its secretion during wall regeneration. According to our double-immunofluorescence labeling results, the enzyme might be translocated through the Golgi apparatus to the walls at the interphase and to the cell plate during cytokinesis.

  1. Phosphatase Wip1 in Immunity: An Overview and Update

    PubMed Central

    Shen, Xiao-Fei; Zhao, Yang; Jiang, Jin-Peng; Guan, Wen-Xian; Du, Jun-Feng

    2017-01-01

    Wild-type p53-induced phosphatase 1 (Wip1) is a newly identified serine/threonine phosphatase, which belongs to the PP2C family. Due to its involvement in stress-induced networks and overexpression in human tumors, primary studies have mainly focused on the role of Wip1 in tumorigenesis. It now has also been implicated in regulating several other physiological processes such as organism aging and neurogenesis. Recent evidence highlights a new role of Wip1 in controlling immune response through regulating immune cell development and function, as well as through the interplay with inflammatory signaling pathways such NF-κB and p38 mitogen-activated protein kinase. In this short review, we will give an overview of Wip1 in immunity to better understand this important phosphatase. PMID:28144241

  2. A glutamate switch controls voltage-sensitive phosphatase function.

    PubMed

    Liu, Lijun; Kohout, Susy C; Xu, Qiang; Müller, Simone; Kimberlin, Christopher R; Isacoff, Ehud Y; Minor, Daniel L

    2012-05-06

    The Ciona intestinalis voltage-sensing phosphatase (Ci-VSP) couples a voltage-sensing domain (VSD) to a lipid phosphatase that is similar to the tumor suppressor PTEN. How the VSD controls enzyme function has been unclear. Here, we present high-resolution crystal structures of the Ci-VSP enzymatic domain that reveal conformational changes in a crucial loop, termed the 'gating loop', that controls access to the active site by a mechanism in which residue Glu411 directly competes with substrate. Structure-based mutations that restrict gating loop conformation impair catalytic function and demonstrate that Glu411 also contributes to substrate selectivity. Structure-guided mutations further define an interaction between the gating loop and linker that connects the phosphatase to the VSD for voltage control of enzyme activity. Together, the data suggest that functional coupling between the gating loop and the linker forms the heart of the regulatory mechanism that controls voltage-dependent enzyme activation.

  3. Phosphoserine phosphatase deficiency in a patient with Williams syndrome.

    PubMed Central

    Jaeken, J; Detheux, M; Fryns, J P; Collet, J F; Alliet, P; Van Schaftingen, E

    1997-01-01

    Decreased serine levels were found in plasma and cerebrospinal fluid (CSF) of a boy with pre- and postnatal growth retardation, moderate psychomotor retardation, and facial dysmorphism suggestive of Williams syndrome. Fluorescence in situ hybridisation with an elastin gene probe indicated the presence of a submicroscopic 7q11.23 deletion, confirming this diagnosis. Further investigation showed that the phosphoserine phosphatase (EC 3.1.3.3.) activity in lymphoblasts and fibroblasts amounted to about 25% of normal values. Oral serine normalised the plasma and CSF levels of this amino acid and seemed to have some clinical effect. These data suggest that the elastin gene and the phosphoserine phosphatase gene might be closely linked. This seems to be the first report of phosphoserine phosphatase deficiency. PMID:9222972

  4. Inositol 5-phosphatases: insights from the Lowe syndrome protein OCRL.

    PubMed

    Pirruccello, Michelle; De Camilli, Pietro

    2012-04-01

    The precise regulation of phosphoinositide lipids in cellular membranes is crucial for cellular survival and function. Inositol 5-phosphatases have been implicated in a variety of disorders, including various cancers, obesity, type 2 diabetes, neurodegenerative diseases and rare genetic conditions. Despite the obvious impact on human health, relatively little structural and biochemical information is available for this family. Here, we review recent structural and mechanistic work on the 5-phosphatases with a focus on OCRL, whose loss of function results in oculocerebrorenal syndrome of Lowe and Dent 2 disease. Studies of OCRL emphasize how the actions of 5-phosphatases rely on both intrinsic and extrinsic membrane recognition properties for full catalytic function. Additionally, structural analysis of missense mutations in the catalytic domain of OCRL provides insight into the phenotypic heterogeneity observed in Lowe syndrome and Dent disease.

  5. [Interaction of two tumor suppressors: Phosphatase CTDSPL and Rb protein].

    PubMed

    Beniaminov, A D; Krasnov, G S; Dmitriev, A A; Puzanov, G A; Snopok, B A; Senchenko, V N; Kashuba, V I

    2016-01-01

    Earlier we established that CTDSPL gene encoding small carboxy-terminal domain serine phosphatase can be considered a classical tumor suppressor gene. Besides, transfection of tumor cell line MCF-7 with CTDSPL led to the content decrease of inactive phosphorylated form of another tumor suppressor, retinoblastoma protein (Rb), and subsequently to cell cycle arrest at the G1/S boundary. This result implied that small phosphatase CTDSPL is able to specifically dephosphorylate and activate Rb protein. In order to add some fuel to this hypothesis, in the present work we studied the interaction of two tumor suppressors CTDSPL and Rb in vitro. GST pool-down assay revealed that CTDSPL is able to precipitate Rb protein from MCF-7 cell extracts, while surface plasmon resonance technique showed that interaction of the two proteins is direct. Results of this study reassert that phosphatase CTDSPL and Rb could be involved in the common mechanism of cell cycle regulation.

  6. Structural Basis of Response Regulator Dephosphorylation by Rap Phosphatases

    PubMed Central

    Parashar, Vijay; Mirouze, Nicolas; Dubnau, David A.; Neiditch, Matthew B.

    2011-01-01

    Bacterial Rap family proteins have been most extensively studied in Bacillus subtilis, where they regulate activities including sporulation, genetic competence, antibiotic expression, and the movement of the ICEBs1 transposon. One subset of Rap proteins consists of phosphatases that control B. subtilis and B. anthracis sporulation by dephosphorylating the response regulator Spo0F. The mechanistic basis of Rap phosphatase activity was unknown. Here we present the RapH-Spo0F X-ray crystal structure, which shows that Rap proteins consist of a 3-helix bundle and a tetratricopeptide repeat domain. Extensive biochemical and genetic functional studies reveal the importance of the observed RapH-Spo0F interactions, including the catalytic role of a glutamine in the RapH 3-helix bundle that inserts into the Spo0F active site. We show that in addition to dephosphorylating Spo0F, RapH can antagonize sporulation by sterically blocking phosphoryl transfer to and from Spo0F. Our structure-function analysis of the RapH-Spo0F interaction identified Rap protein residues critical for Spo0F phosphatase activity. This information enabled us to assign Spo0F phosphatase activity to a Rap protein based on sequence alone, which was not previously possible. Finally, as the ultimate test of our newfound understanding of the structural requirements for Rap phosphatase function, a non-phosphatase Rap protein that inhibits the binding of the response regulator ComA to DNA was rationally engineered to dephosphorylate Spo0F. In addition to revealing the mechanistic basis of response regulator dephosphorylation by Rap proteins, our studies support the previously proposed T-loop-Y allostery model of receiver domain regulation that restricts the aromatic “switch” residue to an internal position when the β4-α4 loop adopts an active-site proximal conformation. PMID:21346797

  7. Structural basis of response regulator dephosphorylation by Rap phosphatases.

    PubMed

    Parashar, Vijay; Mirouze, Nicolas; Dubnau, David A; Neiditch, Matthew B

    2011-02-08

    Bacterial Rap family proteins have been most extensively studied in Bacillus subtilis, where they regulate activities including sporulation, genetic competence, antibiotic expression, and the movement of the ICEBs1 transposon. One subset of Rap proteins consists of phosphatases that control B. subtilis and B. anthracis sporulation by dephosphorylating the response regulator Spo0F. The mechanistic basis of Rap phosphatase activity was unknown. Here we present the RapH-Spo0F X-ray crystal structure, which shows that Rap proteins consist of a 3-helix bundle and a tetratricopeptide repeat domain. Extensive biochemical and genetic functional studies reveal the importance of the observed RapH-Spo0F interactions, including the catalytic role of a glutamine in the RapH 3-helix bundle that inserts into the Spo0F active site. We show that in addition to dephosphorylating Spo0F, RapH can antagonize sporulation by sterically blocking phosphoryl transfer to and from Spo0F. Our structure-function analysis of the RapH-Spo0F interaction identified Rap protein residues critical for Spo0F phosphatase activity. This information enabled us to assign Spo0F phosphatase activity to a Rap protein based on sequence alone, which was not previously possible. Finally, as the ultimate test of our newfound understanding of the structural requirements for Rap phosphatase function, a non-phosphatase Rap protein that inhibits the binding of the response regulator ComA to DNA was rationally engineered to dephosphorylate Spo0F. In addition to revealing the mechanistic basis of response regulator dephosphorylation by Rap proteins, our studies support the previously proposed T-loop-Y allostery model of receiver domain regulation that restricts the aromatic "switch" residue to an internal position when the β4-α4 loop adopts an active-site proximal conformation.

  8. MDP-1: A novel eukaryotic magnesium-dependent phosphatase.

    PubMed

    Selengut, J D; Levine, R L

    2000-07-18

    We report here the purification, cloning, expression, and characterization of a novel phosphatase, MDP-1. In the course of investigating the reported acid phosphatase activity of carbonic anhydrase III preparations, several discrete phosphatases were discerned. One of these, a magnesium-dependent species of 18.6 kDa, was purified to homogeneity and yielded several peptide sequences from which the parent gene was identified by database searching. Although orthologous genes were identified in fungi and plants as well as mammalian species, there was no apparent homology to any known family of phosphatases. The enzyme was expressed in Escherichia coli with a fusion tag and purified by affinity methods. The recombinant enzyme showed magnesium-dependent acid phosphatase activity comparable to the originally isolated rabbit protein. The enzyme catalyzes the rapid hydrolysis of p-nitrophenyl phosphate, ribose-5-phosphate, and phosphotyrosine. The selectivity for phosphotyrosine over phosphoserine or phosphothreonine is considerable, but the enzyme did not show activity toward five phosphotyrosine-containing peptides. None of the various substrates assayed (including various nucleotide, sugar, amino acid and peptide phosphates, phosphoinositides, and phosphodiesters) exhibited K(M) values lower than 1 mM, and many showed negligible rates of hydrolysis. The enzyme is inhibited by vanadate and fluoride but not by azide, cyanide, calcium, lithium, or tartaric acid. Chemical labeling, refolding, dialysis, and mutagenesis experiments suggest that the enzymatic mechanism is not dependent on cysteine, histidine, or nonmagnesium metal ions. In recognition of these observations, the enzyme has been given the name magnesium-dependent phosphatase-1 (MDP-1).

  9. Phosphatase inhibitors with anti-angiogenic effect in vitro.

    PubMed

    Sylvest, Lene; Bendiksen, Christine Dam; Houen, Gunnar

    2010-01-01

    Levamisole has previously been identified as an inhibitor of angiogenesis in vitro and in vivo, but the mechanism behind the anti-angiogenic behavior has not yet been established. However, one known effect of levamisole is the inhibition of alkaline phosphatase, and this fact encouraged us to test other phosphatase inhibitors for their anti-angiogenic effects by using the same method as used to identify levamisole: an ELISA-based co-culture angiogenesis assay giving quantitative and qualitative results. Historically, intracellular phosphatases have been associated with the downregulation of signaling pathways, and kinases with their upregulation, but lately, the phospatases have also been coupled to positive signaling, which is why inhibition of phosphatases has become associated with anti-tumorigenic and anti-angiogenic effects. The results obtained in this work reveal several agents with anti-angiogenic potential and give a strong indication that phosphatase inhibition is linked to anti-angiogenic activity. An apparent disruption of endothelial tube formation was seen for seven of eight phosphatase inhibitors tested in the angiogenesis assay. By looking at the morphological results, it was seen that most of the inhibitors impaired proliferation and elongation of the endothelial cells, which still had a differentiated appearance. One inhibitor, PTP inhibitor IV, seemed to impair endothelial cell differentiation and induced the same morphology as when cells were treated with levamisole, although at a 200 times lower concentration than that of levamisole. Hence, our work points out compounds with a potential that may be of use in the search for new medical products for the treatment of malignant tumors, or other conditions where angiogenesis plays a central role.

  10. Phosphatase activity on the cell wall of Fonsecaea pedrosoi.

    PubMed

    Kneipp, L F; Palmeira, V F; Pinheiro, A A S; Alviano, C S; Rozental, S; Travassos, L R; Meyer-Fernandes, J R

    2003-12-01

    The activity of a phosphatase was characterized in intact mycelial forms of Fonsecaea pedrosoi, a pathogenic fungus that causes chromoblastomycosis. At pH 5.5, this fungus hydrolyzed p-nitrophenylphosphate (p-NPP) to p-nitrophenol (p-NP) at a rate of 12.78 +/- 0.53 nmol p-NP per h per mg hyphal dry weight. The values of Vmax and apparent Km for p-NPP hydrolyses were measured as 17.89 +/- 0.92 nmol p-NP per h per mg hyphal dry weight and 1.57 +/- 0.26 mmol/l, respectively. This activity was inhibited at increased pH, a finding compatible with an acid phosphatase. The enzymatic activity was strongly inhibited by classical inhibitors of acid phosphatases such as sodium orthovanadate (Ki = 4.23 micromol/l), sodium molybdate (Ki = 7.53 micromol/l) and sodium fluoride (Ki = 126.78 micromol/l) in a dose-dependent manner. Levamizole (1 mmol/l) and sodium tartrate (10 mmol/l), had no effect on the enzyme activity. Cytochemical localization of the acid phosphatase showed electrondense cerium phosphate deposits on the cell wall, as visualized by transmission electron microscopy. Phosphatase activity in F. pedrosoi seems to be associated with parasitism, as sclerotic cells, which are the fungal forms mainly detected in chromoblastomycosis lesions, showed much higher activities than conidia and mycelia did. A strain of F. pedrosoi recently isolated from a human case of chromoblastomycosis also showed increased enzyme activity, suggesting that the expression of surface phosphatases may be stimulated by interaction with the host.

  11. A new member of the alkaline phosphatase superfamily with a formylglycine nucleophile: structural and kinetic characterisation of a phosphonate monoester hydrolase/phosphodiesterase from Rhizobium leguminosarum.

    PubMed

    Jonas, Stefanie; van Loo, Bert; Hyvönen, Marko; Hollfelder, Florian

    2008-12-05

    The alkaline phosphatase superfamily comprises a large number of hydrolytic metalloenzymes such as phosphatases and sulfatases. We have characterised a new member of this superfamily, a phosphonate monoester hydrolase/phosphodiesterase from Rhizobium leguminosarum (R/PMH) both structurally and kinetically. The 1.42 A crystal structure shows structural homology to arylsulfatases with conservation of the core alpha/beta-fold, the mononuclear active site and most of the active-site residues. Sulfatases use a unique formylglycine nucleophile, formed by posttranslational modification of a cysteine/serine embedded in a signature sequence (C/S)XPXR. We provide mass spectrometric and mutational evidence that R/PMH is the first non-sulfatase enzyme shown to use a formylglycine as the catalytic nucleophile. R/PMH hydrolyses phosphonate monoesters and phosphate diesters with similar efficiency. Burst kinetics suggest that substrate hydrolysis proceeds via a double-displacement mechanism. Kinetic characterisation of active-site mutations establishes the catalytic contributions of individual residues. A mechanism for substrate hydrolysis is proposed on the basis of the kinetic data and structural comparisons with E. coli alkaline phosphatase and Pseudomonas aeruginosa arylsulfatase. R/PMH represents a further example of conservation of the overall structure and mechanism within the alkaline phosphatase superfamily.

  12. Alpha and beta thalassemia.

    PubMed

    Muncie, Herbert L; Campbell, James

    2009-08-15

    The thalassemias are a group of inherited hematologic disorders caused by defects in the synthesis of one or more of the hemoglobin chains. Alpha thalassemia is caused by reduced or absent synthesis of alpha globin chains, and beta thalassemia is caused by reduced or absent synthesis of beta globin chains. Imbalances of globin chains cause hemolysis and impair erythropoiesis. Silent carriers of alpha thalassemia and persons with alpha or beta thalassemia trait are asymptomatic and require no treatment. Alpha thalassemia intermedia, or hemoglobin H disease, causes hemolytic anemia. Alpha thalassemia major with hemoglobin Bart's usually results in fatal hydrops fetalis. Beta thalassemia major causes hemolytic anemia, poor growth, and skeletal abnormalities during infancy. Affected children will require regular lifelong blood transfusions. Beta thalassemia intermedia is less severe than beta thalassemia major and may require episodic blood transfusions. Transfusion-dependent patients will develop iron overload and require chelation therapy to remove the excess iron. Bone marrow transplants can be curative for some children with beta thalassemia major. Persons with thalassemia should be referred for preconception genetic counseling, and persons with alpha thalassemia trait should consider chorionic villus sampling to diagnose infants with hemoglobin Bart's, which increases the risk of toxemia and postpartum bleeding. Persons with the thalassemia trait have a normal life expectancy. Persons with beta thalassemia major often die from cardiac complications of iron overload by 30 years of age.

  13. The alpha channeling effect

    SciTech Connect

    Fisch, N. J.

    2015-12-10

    Alpha particles born through fusion reactions in a tokamak reactor tend to slow down on electrons, but that could take up to hundreds of milliseconds. Before that happens, the energy in these alpha particles can destabilize on collisionless timescales toroidal Alfven modes and other waves, in a way deleterious to energy confinement. However, it has been speculated that this energy might be instead be channeled into useful energy, so as to heat fuel ions or to drive current. Such a channeling needs to be catalyzed by waves Waves can produce diffusion in energy of the alpha particles in a way that is strictly coupled to diffusion in space. If these diffusion paths in energy-position space point from high energy in the center to low energy on the periphery, then alpha particles will be cooled while forced to the periphery. The energy from the alpha particles is absorbed by the wave. The amplified wave can then heat ions or drive current. This process or paradigm for extracting alpha particle energy collisionlessly has been called alpha channeling. While the effect is speculative, the upside potential for economical fusion is immense. The paradigm also operates more generally in other contexts of magnetically confined plasma.

  14. Phosphotyrosine as a substrate of acid and alkaline phosphatases.

    PubMed

    Apostoł, I; Kuciel, R; Wasylewska, E; Ostrowski, W S

    1985-01-01

    A new spectrophotometric method for following dephosphorylation of phosphotyrosine has been described. The absorption spectra of phosphotyrosine and tyrosine were plotted over the pH range from 3 to 9. The change in absorbance accompanying the conversion of phosphotyrosine to tyrosine was the greatest at 286 nm. The difference absorption coefficients were calculated for several pH values. Dephosphorylation of phosphotyrosine by acid phosphatases from human prostate gland, from wheat germ and potatoes obeys the Michaelis-Menten equation, whereas alkaline phosphatases calf intestine and E. coli are inhibited by excess of substrate.

  15. Effect of vanadium compounds on acid phosphatase activity.

    PubMed

    Vescina, C M; Sálice, V C; Cortizo, A M; Etcheverry, S B

    1996-01-01

    The direct effect of different vanadium compounds on acid phosphatase (ACP) activity was investigated. Vanadate and vanadyl but not pervanadate inhibited the wheat germ ACP activity. These vanadium derivatives did not alter the fibroblast Swiss 3T3 soluble fraction ACP activity. Using inhibitors of tyrosine phosphatases (PTPases), the wheat germ ACP was partially characterized as a PTPase. This study suggests that the inhibitory ability of different vanadium derivatives to modulate ACP activity seems to depend on the geometry around the vanadium atom more than on the oxidation state. Our results indicate a correlation between the PTPase activity and the sensitivity to vanadate and vanadyl cation.

  16. Colorimetric Determination of Pure Mg2+-dependent Phosphatidate Phosphatase Activity

    PubMed Central

    Havriluk, Tara; Lozy, Fred; Siniossoglou, Symeon; Carman, George M.

    2008-01-01

    The malachite green-molybdate reagent was used for a colorimetric assay of pure Mg2+-dependent phosphatidate phosphatase activity. This enzyme plays a major role in fat metabolism. Enzyme activity was linear with time and protein concentration, and with the concentration of water-soluble dioctanoyl phosphatidate. The colorimetric assay was used to examine enzyme inhibition by phenylglyoxal, propranolol, and dimethyl sulfoxide. Pure enzyme and a water-soluble phosphatidate substrate were required for the assay, which should be applicable to a well-defined large-scale screen of Mg2+-dependent phosphatidate phosphatase inhibitors (or activators). PMID:17910939

  17. Reduced expression of CD45 Protein-Tyrosine Phosphatase Pr

    DTIC Science & Technology

    2009-05-08

    complex ( MHC ) I (28-14-8), MHC II (M5/114.15.2), CD44 (IM7), and Ly6G (1A8). Cells (1 106) were resuspended in Fc block (anti CD16/CD32 antibody diluted...enzyme (supplemental Fig. 3). Themajority of the phosphatases tested in this panel belong to the class of protein-tyrosine phosphatases (SHP-1, SHP- 2 ...and Sina Bavari‡ 2 From the ‡United States Army Medical Research Institute of Infectious Diseases, Frederick, Maryland 21702-5011, §Target Structure

  18. No impact of protein phosphatases on connexin 43 phosphorylation in ischemic preconditioning.

    PubMed

    Totzeck, Andreas; Boengler, Kerstin; van de Sand, Anita; Konietzka, Ina; Gres, Petra; Garcia-Dorado, David; Heusch, Gerd; Schulz, Rainer

    2008-11-01

    Cardiac connexin 43 (Cx43) is involved in infarct propagation, and the uncoupling of Cx43-formed channels reduces infarct size. Cx43-formed channels open upon Cx43 dephosphorylation, and ischemic preconditioning (IP) prevents the ischemia-induced Cx43 dephosphorylation. In addition to the sarcolemma, Cx43 is also present in the cardiomyocyte mitochondria. We now examined the interaction of Cx43 with protein phosphatases PP1alpha, PP2Aalpha, and PP2Balpha and the role of such interaction for Cx43 phosphorylation in preconditioned myocardium. Infarct size (in %area at risk) in left ventricular anterior myocardium of Göttinger minipigs subjected to 90 min of low-flow ischemia and 120 min of reperfusion was 23.1 +/- 2.7 [n = 7, nonpreconditioned (NIP) group] and was reduced by IP to 10.0 +/- 3.2 (n = 6, P < 0.05). Mitochondrial and gap junctional Cx43 dephosphorylation increased after 85 min of ischemia in NIP myocardium, whereas Cx43 phosphorylation was preserved with IP. PP2Aalpha and PP1alpha, but not PP2Balpha, were detected by Western blot analysis in the left ventricular myocardium. Cx43 coprecipitated with PP2Aalpha but not with PP1alpha. Although the total PP2Aalpha immunoreactivity (confocal laser scan) was increased to 154 +/- 24% and 194 +/- 13% of baseline (P < 0.05) after 85 min of ischemia in NIP and IP myocardium, respectively, the PP2A activities were similar between the groups. The amount of PP2Aalpha coimmunoprecipitated with Cx43 remained unchanged. Only PP2Aalpha coprecipitates with Cx43 in pig myocardium. This interaction is not affected by IP, suggesting that PP2Aalpha is not involved in the prevention of the ischemia-induced Cx43 dephosphorylation by IP.

  19. Comparative studies of rat recombinant purple acid phosphatase and bone tartrate-resistant acid phosphatase.

    PubMed

    Ek-Rylander, B; Barkhem, T; Ljusberg, J; Ohman, L; Andersson, K K; Andersson, G

    1997-01-15

    The tartrate-resistant acid phosphatase (TRAP) of rat osteoclasts has been shown to exhibit high (85-94%) identity at the amino acid sequence level with the purple acid phosphatase (PAP) from bovine spleen and with pig uteroferrin. These iron-containing purple enzymes contain a binuclear iron centre, with a tyrosinate-to-Fe(III) charge-transfer transition responsible for the purple colour. In the present study, production of rat osteoclast TRAP could be achieved at a level of 4.3 mg/litre of medium using a baculovirus expression system. The enzyme was purified to apparent homogeneity using a combination of cation-exchange, hydrophobic-interaction, lectin-affinity and gel-permeation chromatography steps. The protein as isolated had a purple colour, a specific activity of 428 units/mg of protein and consisted of the single-chain form of molecular mass 34 kDa, with only trace amounts of proteolytically derived subunits. The recombinant enzyme had the ability to dephosphorylate bone matrix phosphoproteins, as previously shown for bone TRAP. Light absorption spectroscopy of the isolated purple enzyme showed a lambda max at 544 nm, which upon reduction with ascorbic acid changed to 515 nm, concomitant with the transition to a pink colour. EPR spectroscopic analysis of the reduced enzyme at 3.6 K revealed a typical mu-hydr(oxo)-bridged mixed-valent Fe(II)Fe(III) signal with g-values at 1.96, 1.74 and 1.60, proving that recombinant rat TRAP belongs to the family of PAPs. To validate the use of recombinant PAP in substituting for the rat bone counterpart in functional studies, various comparative studies were carried out. The enzyme isolated from bone exhibited a lower K(m) for p-nitrophenyl phosphate and was slightly more sensitive to PAP inhibitors such as molybdate, tungstate, arsenate and phosphate. In contrast with the recombinant enzyme, TRAP from bone was isolated predominantly as the proteolytically cleaved, two-subunit, form. Both the recombinant enzyme and rat

  20. Purinergic Receptor-mediated Rapid Depletion of Nuclear Phosphorylated Akt Depends on Pleckstrin Homology Domain Leucine-rich Repeat Phosphatase, Calcineurin, Protein Phosphatase 2A, and PTEN Phosphatases*

    PubMed Central

    Mistafa, Oras; Ghalali, Aram; Kadekar, Sandeep; Högberg, Johan; Stenius, Ulla

    2010-01-01

    Akt is an important oncoprotein, and data suggest a critical role for nuclear Akt in cancer development. We have previously described a rapid (3–5 min) and P2X7-dependent depletion of nuclear phosphorylated Akt (pAkt) and effects on downstream targets, and here we studied mechanisms behind the pAkt depletion. We show that cholesterol-lowering drugs, statins, or extracellular ATP, induced a complex and coordinated response in insulin-stimulated A549 cells leading to depletion of nuclear pAkt. It involved protein/lipid phosphatases PTEN, pleckstrin homology domain leucine-rich repeat phosphatase (PHLPP1 and -2), protein phosphatase 2A (PP2A), and calcineurin. We employed immunocytology, immunoprecipitation, and proximity ligation assay techniques and show that PHLPP and calcineurin translocated to the nucleus and formed complexes with Akt within 3 min. Also PTEN translocated to the nucleus and then co-localized with pAkt close to the nuclear membrane. An inhibitor of the scaffolding immunophilin FK506-binding protein 51 (FKBP51) and calcineurin, FK506, prevented depletion of nuclear pAkt. Furthermore, okadaic acid, an inhibitor of PP2A, prevented the nuclear pAkt depletion. Chemical inhibition and siRNA indicated that PHLPP, PP2A, and PTEN were required for a robust depletion of nuclear pAkt, and in prostate cancer cells lacking PTEN, transfection of PTEN restored the statin-induced pAkt depletion. The activation of protein and lipid phosphatases was paralleled by a rapid proliferating cell nuclear antigen (PCNA) translocation to the nucleus, a PCNA-p21cip1 complex formation, and cyclin D1 degradation. We conclude that these effects reflect a signaling pathway for rapid depletion of pAkt that may stop the cell cycle. PMID:20605778

  1. Purinergic receptor-mediated rapid depletion of nuclear phosphorylated Akt depends on pleckstrin homology domain leucine-rich repeat phosphatase, calcineurin, protein phosphatase 2A, and PTEN phosphatases.

    PubMed

    Mistafa, Oras; Ghalali, Aram; Kadekar, Sandeep; Högberg, Johan; Stenius, Ulla

    2010-09-03

    Akt is an important oncoprotein, and data suggest a critical role for nuclear Akt in cancer development. We have previously described a rapid (3-5 min) and P2X7-dependent depletion of nuclear phosphorylated Akt (pAkt) and effects on downstream targets, and here we studied mechanisms behind the pAkt depletion. We show that cholesterol-lowering drugs, statins, or extracellular ATP, induced a complex and coordinated response in insulin-stimulated A549 cells leading to depletion of nuclear pAkt. It involved protein/lipid phosphatases PTEN, pleckstrin homology domain leucine-rich repeat phosphatase (PHLPP1 and -2), protein phosphatase 2A (PP2A), and calcineurin. We employed immunocytology, immunoprecipitation, and proximity ligation assay techniques and show that PHLPP and calcineurin translocated to the nucleus and formed complexes with Akt within 3 min. Also PTEN translocated to the nucleus and then co-localized with pAkt close to the nuclear membrane. An inhibitor of the scaffolding immunophilin FK506-binding protein 51 (FKBP51) and calcineurin, FK506, prevented depletion of nuclear pAkt. Furthermore, okadaic acid, an inhibitor of PP2A, prevented the nuclear pAkt depletion. Chemical inhibition and siRNA indicated that PHLPP, PP2A, and PTEN were required for a robust depletion of nuclear pAkt, and in prostate cancer cells lacking PTEN, transfection of PTEN restored the statin-induced pAkt depletion. The activation of protein and lipid phosphatases was paralleled by a rapid proliferating cell nuclear antigen (PCNA) translocation to the nucleus, a PCNA-p21(cip1) complex formation, and cyclin D1 degradation. We conclude that these effects reflect a signaling pathway for rapid depletion of pAkt that may stop the cell cycle.

  2. The Escherichia coli pgpB gene encodes for a diacylglycerol pyrophosphate phosphatase activity.

    PubMed

    Dillon, D A; Wu, W I; Riedel, B; Wissing, J B; Dowhan, W; Carman, G M

    1996-11-29

    We provided genetic and biochemical evidence that supported the conclusion that the product of pgpB gene of Escherichia coli exhibited diacylglycerol pyrophosphate (DGPP) phosphatase activity. DGPP phosphatase activity was absent in pgpB mutant cells and was expressed at high levels in cells carrying the wild-type pgpB gene on a runaway replication plasmid. The pgpB mutant has been primarily characterized by a defect in phosphatidate (PA) phosphatase activity and also exhibits defects in lyso-PA phosphatase and phosphatidylglycerophosphate phosphatase activities. The defective PA phosphatase in the pgpB mutant was shown to be a Mg2+-independent PA phosphatase activity of the DGPP phosphatase enzyme. We characterized DGPP phosphatase activity in membranes from cells overproducing the pgpB gene product. DGPP phosphatase catalyzed the dephosphorylation of the beta phosphate of DGPP to form PA followed by the dephosphorylation of PA to form diacylglycerol. The specificity constant (Vmax/Km) for DGPP was 9.3-fold greater than that for PA. The pH optimum for the DGPP phosphatase reaction was 6. 5. Activity was independent of a divalent cation requirement, was potently inhibited by Mn2+ ions, and was insensitive to inhibition by N-ethylmaleimide. Pure DGPP phosphatase from Saccharomyces cerevisiae was shown to be similar to the E. coli DGPP phosphatase in its ability to utilize lyso-PA and phosphatidylglycerophosphate as substrates in vitro.

  3. Alpha One Foundation

    MedlinePlus

    Languages French (Francais) German (Deutsch) Italian (Italiano) Spanish (Español) Portuguese (Portugues) Swedish (Svenska) Donate One Time Monthly Keep In Touch | About Us | Contact Us | What is the Alpha-1 ...

  4. alpha2-Adrenoreceptor antagonists.

    PubMed

    Mayer, P; Imbert, T

    2001-06-01

    A review of the literature relating to the therapeutic potential of alpha2-adrenoceptor antagonists published between 1990 and 2000 is presented. Although extensively studied since the early 1970s in a wide spectrum of therapeutic applications, the distinction of alpha2-adrenoceptor subtypes and some emerging evidence concerning new applications in neurodegenerative disorders, such as Alzheimer's and Parkinson's diseases, obesity and schizophrenia, have refreshed an interest in this class of agents.

  5. Coaching the alpha male.

    PubMed

    Ludeman, Kate; Erlandson, Eddie

    2004-05-01

    Highly intelligent, confident, and successful, alpha males represent about 70% of all senior executives. Natural leaders, they willingly take on levels of responsibility most rational people would find overwhelming. But many of their quintessential strengths can also make alphas difficult to work with. Their self-confidence can appear domineering. Their high expectations can make them excessively critical. Their unemotional style can keep them from inspiring their teams. That's why alphas need coaching to broaden their interpersonal tool kits while preserving their strengths. Drawing from their experience coaching more than 1,000 senior executives, the authors outline an approach tailored specifically for the alpha. Coaches get the alpha's attention by inundating him with data from 360-degree feedback presented in ways he will find compelling--both hard-boiled metrics and vivid verbatim comments from colleagues about his strengths and weaknesses. A 360-degree assessment is a wake-up call for most alphas, providing undeniable proof that their behavior doesn't work nearly as well as they think it does. That paves the way for a genuine commitment to change. In order to change, the alpha must venture into unfamiliar--and often uncomfortable--psychological territory. He must admit vulnerability, accept accountability not just for his own work for others', connect with his underlying emotions, learn to motivate through a balance of criticism and validation, and become aware of unproductive behavior patterns. The goal of executive coaching is not simply to treat the alpha as an individual problem but to improve the entire team dynamic. Initial success creates an incentive to persevere, and the virtuous cycle reverberates throughout the entire organization.

  6. [alpha-Neurotoxins and alpha-conotoxins--nicotinic cholinoreceptor blockers].

    PubMed

    Utkin, Iu N; Kasheverov, I E; Tsetlin, V I

    1999-11-01

    The review is devoted to the competitive blockers of different nicotinic acetylcholine receptors, alpha-neurotoxins from snake venoms, and alpha-conotoxins from marine snails of the Conidae family. The relationship between the structure and function of these toxins is discussed. Recent data on the mechanism of alpha-neurotoxin and alpha-conotoxin interaction with the nicotinic acetylcholine receptor are presented.

  7. Characterization of Arabidopsis Acid Phosphatase Promoter and Regulation of Acid Phosphatase Expression

    PubMed Central

    Haran, Shoshan; Logendra, Sithes; Seskar, Mirjana; Bratanova, Margarita; Raskin, Ilya

    2000-01-01

    The expression and secretion of acid phosphatase (APase) was investigated in Indian mustard (Brassica juncea L. Czern.) plants using sensitive in vitro and activity gel assays. Phosphorus (P) starvation induced two APases in Indian mustard roots, only one of which was secreted. Northern-blot analysis indicated transcriptional regulation of APase expression. Polymerase chain reaction and Southern-blot analyses revealed two APase homologs in Indian mustard, whereas in Arabidopsis, only one APase homolog was detected. The Arabidopsis APase promoter region was cloned and fused to the β-glucuronidase (GUS) and green fluorescent protein (GFP) reporter genes. GUS expression was first evident in leaves of the P-starved Arabidopsis plants. In P-starved roots, the expression of GUS initiated in lateral root meristems followed by generalized expression throughout the root. GUS expression diminished with the addition of P to the medium. Expression of GFP in P-starved roots also initiated in the lateral root meristems and the recombinant GFP with the APase signal peptide was secreted by the roots into the medium. The APase promoter was specifically activated by low P levels. The removal of other essential elements or the addition of salicylic or jasmonic acids, known inducers of gene expression, did not activate the APase promoter. This novel APase promoter may be used as a plant-inducible gene expression system for the production of recombinant proteins and as a tool to study P metabolism in plants. PMID:11027712

  8. Alpha Particle Diagnostic

    SciTech Connect

    Fisher, Ray, K.

    2009-05-13

    The study of burning plasmas is the next frontier in fusion energy research, and will be a major objective of the U.S. fusion program through U.S. collaboration with our international partners on the ITER Project. For DT magnetic fusion to be useful for energy production, it is essential that the energetic alpha particles produced by the fusion reactions be confined long enough to deposit a significant fraction of their initial ~3.5 MeV energy in the plasma before they are lost. Development of diagnostics to study the behavior of energetic confined alpha particles is a very important if not essential part of burning plasma research. Despite the clear need for these measurements, development of diagnostics to study confined the fast confined alphas to date has proven extremely difficult, and the available techniques remain for the most part unproven and with significant uncertainties. Research under this grant had the goal of developing diagnostics of fast confined alphas, primarily based on measurements of the neutron and ion tails resulting from alpha particle knock-on collisions with the plasma deuterium and tritium fuel ions. One of the strengths of this approach is the ability to measure the alphas in the hot plasma core where the interesting ignition physics will occur.

  9. Expression and distribution of tartrate-resistant purple acid phosphatase in the rat nervous system.

    PubMed

    Lång, P; Schultzberg, M; Andersson, G

    2001-03-01

    Tartrate-resistant purple acid phosphatase (TRAP) of osteoclasts and certain cells of the monocyte-macrophage lineage belongs to the family of purple acid phosphatases (PAPs). We provide here evidence for TRAP/PAP expression in the central and peripheral nervous systems in the rat. TRAP/PAP protein was partially purified and characterized from the trigeminal ganglion, brain, and spinal cord. The TRAP activity (U/mg tissue) in these tissues was about 10-20 times lower than in bone. Reducing agents, e.g. ascorbate and ferric iron, increased the TRAP activity from the neural tissues (nTRAP) and addition of oxidizing agents completely inactivated both bone and nTRAP. The IC(50) for three known oxyanion inhibitors of TRAP/PAP was similar for bone and nTRAP with the same rank order of potency (molybdate > tungstate > phosphate). This indicates that the redox-sensitive binuclear iron center characteristic of mammalian PAPs is present also in nTRAP. Western blots of partially purified nTRAP revealed a band with the expected size of 35 kD. The expression of TRAP in the trigeminal ganglion, brain, and spinal cord was confirmed at the mRNA level by RT-PCR. In situ hybridization histochemistry demonstrated TRAP mRNA expression in small ganglion cells of the trigeminal ganglion, in alpha-motor neurons of the ventral spinal cord, and in Purkinje cells of the cerebellum. TRAP-like immunoreactivity was encountered in the cytoplasm of neuronal cell bodies in specific areas of both the central and the peripheral nervous system. Together, the data demonstrate that active TRAP/PAP is expressed in certain parts of the rat nervous system.

  10. Methods to distinguish various types of protein phosphatase activity

    SciTech Connect

    Brautigan, D.L.; Shriner, C.L.

    1988-01-01

    To distinguish the action of protein Tyr(P) and protein Ser(P)/Thr(P) phosphatases on /sup 32/P-labeled phosphoproteins in subcellular fractions different inhibitors and activators are utilized. Comparison of the effects of added compounds provides a convenient, indirect method to characterize dephosphorylation reactions. Protein Tyr(P) phosphatases are specifically inhibited by micromolar Zn2+ or vanadate, and show maximal activity in the presence of EDTA. The other class of cellular phosphatases, specific for protein Ser(P) and Thr(P) residues, are inhibited by fluoride and EDTA. In this class of enzymes two major functional types can be distinguished: those sensitive to inhibition by the heat-stable protein inhibitor-2 and not stimulated by polycations, and those not sensitive to inhibition and stimulated by polycations. Preparation of /sup 32/P-labeled Tyr(P) and Ser(P) phosphoproteins also is presented for the direct measurement of phosphatase activities in preparations by the release of acid-soluble (/sup 32/P)phosphate.

  11. A human phospholipid phosphatase activated by a transmembrane control module.

    PubMed

    Halaszovich, Christian R; Leitner, Michael G; Mavrantoni, Angeliki; Le, Audrey; Frezza, Ludivine; Feuer, Anja; Schreiber, Daniela N; Villalba-Galea, Carlos A; Oliver, Dominik

    2012-11-01

    In voltage-sensitive phosphatases (VSPs), a transmembrane voltage sensor domain (VSD) controls an intracellular phosphoinositide phosphatase domain, thereby enabling immediate initiation of intracellular signals by membrane depolarization. The existence of such a mechanism in mammals has remained elusive, despite the presence of VSP-homologous proteins in mammalian cells, in particular in sperm precursor cells. Here we demonstrate activation of a human VSP (hVSP1/TPIP) by an intramolecular switch. By engineering a chimeric hVSP1 with enhanced plasma membrane targeting containing the VSD of a prototypic invertebrate VSP, we show that hVSP1 is a phosphoinositide-5-phosphatase whose predominant substrate is PI(4,5)P(2). In the chimera, enzymatic activity is controlled by membrane potential via hVSP1's endogenous phosphoinositide binding motif. These findings suggest that the endogenous VSD of hVSP1 is a control module that initiates signaling through the phosphatase domain and indicate a role for VSP-mediated phosphoinositide signaling in mammals.

  12. Effects of organic dairy manure amendment on soil phosphatase activities

    USDA-ARS?s Scientific Manuscript database

    Organic dairy production is increasing in the U.S. due to concerns over environmental, human, and animal health. It is well known that the application of livestock manure to soil can influence enzyme activities involved in nutrient cycling and soil fertility, such as soil phosphatases; however, orga...

  13. Okadaic acid: the archetypal serine/threonine protein phosphatase inhibitor.

    PubMed

    Dounay, A B; Forsyth, C J

    2002-11-01

    As the first recognized member of the "okadaic acid class" of phosphatase inhibitors, the marine natural product okadaic acid is perhaps the most well-known member of a diverse array of secondary metabolites that have emerged as valuable probes for studying the roles of various cellular protein serine/threonine phosphatases. This review provides a historical perspective on the role that okadaic acid has played in stimulating a broad spectrum of modern scientific research as a result of the natural product's ability to bind to and inhibit important classes of protein serine / threonine phosphatases. The relationships between the structure and biological activities of okadaic acid are briefly reviewed, as well as the structural information regarding the particular cellular receptors protein phosphatases 1 (PP1) and 2A. Laboratory syntheses of okadaic acid and its analogs are thoroughly reviewed. Finally, an interpretation of the critical contacts observed between okadaic acid and PP1 by X-ray crystallography is provided, and specific molecular recognition hypotheses that are testable via the synthesis and assay of non-natural analogs of okadaic acid are suggested.

  14. Structural and functional basis of protein phosphatase 5 substrate specificity.

    PubMed

    Oberoi, Jasmeen; Dunn, Diana M; Woodford, Mark R; Mariotti, Laura; Schulman, Jacqualyn; Bourboulia, Dimitra; Mollapour, Mehdi; Vaughan, Cara K

    2016-08-09

    The serine/threonine phosphatase protein phosphatase 5 (PP5) regulates hormone- and stress-induced cellular signaling by association with the molecular chaperone heat shock protein 90 (Hsp90). PP5-mediated dephosphorylation of the cochaperone Cdc37 is essential for activation of Hsp90-dependent kinases. However, the details of this mechanism remain unknown. We determined the crystal structure of a Cdc37 phosphomimetic peptide bound to the catalytic domain of PP5. The structure reveals PP5 utilization of conserved elements of phosphoprotein phosphatase (PPP) structure to bind substrate and provides a template for many PPP-substrate interactions. Our data show that, despite a highly conserved structure, elements of substrate specificity are determined within the phosphatase catalytic domain itself. Structure-based mutations in vivo reveal that PP5-mediated dephosphorylation is required for kinase and steroid hormone receptor release from the chaperone complex. Finally, our data show that hyper- or hypoactivity of PP5 mutants increases Hsp90 binding to its inhibitor, suggesting a mechanism to enhance the efficacy of Hsp90 inhibitors by regulation of PP5 activity in tumors.

  15. Purification and characterization of two wheat-embryo protein phosphatases.

    PubMed

    Polya, G M; Haritou, M

    1988-04-15

    Two protein phosphatases (enzymes I and II) were extensively purified from wheat embryo by a procedure involving chromatography on DEAE-cellulose, phenyl-Sepharose CL-4B, DEAE-Sephacel and Ultrogel AcA 44. Preparations of enzyme I (Mr 197,000) are heterogeneous. Preparations of enzyme II (Mr 35,000) contain only one major polypeptide (Mr 17,500), which exactly co-purifies with protein phosphatase II on gel filtration and is not present in preparations of enzyme I. However, this major polypeptide has been identified as calmodulin. Calmodulin and protein phosphatase II can be separated by further chromatography on phenyl-Sepharose CL-4B. Protein phosphatases I and II do not require Mg2+ or Ca2+ for activity. Both enzymes catalyse the dephosphorylation of phosphohistone H1 (phosphorylated by wheat-germ Ca2+-dependent protein kinase) and of phosphocasein (phosphorylated by wheat-germ Ca2+-independent casein kinase), but neither enzyme dephosphorylates a range of non-protein phosphomonoesters tested. Both enzymes are inhibited by Zn2+, Hg2+, vanadate, molybdate, F-, pyrophosphate and ATP.

  16. Anion and divalent cation activation of phosphoglycolate phosphatase from leaves.

    PubMed

    Husic, H D; Tolbert, N E

    1984-02-15

    Phosphoglycolate (P-glycolate) phosphatase was purified 223-fold from spinach leaves by (NH4)2SO4 fractionation, DEAE-cellulose chromatography, and Sephadex G-200 chromatography. The partially purified enzyme had a broad pH optimum between 5.6 and 8.0 and was specific for the hydrolysis of P-glycolate with a Km (P-glycolate) of 26 microM. The enzyme was activated by divalent cations including Mg2+, Co2+, Mn2+, and Zn2+, and by anions including Cl-, Br-, NO-3, and HCOO-. Neither anions nor divalent cations activated the enzyme without the other. The P-glycolate phosphatase activities from tobacco leaves or the green algae, Chlamydomonas reinhardtii, also required Mg2+ and were activated by chloride. In addition, the enzyme was allosterically inhibited by ribose 5-phosphate. The activation of P-glycolate phosphatase by both anions and divalent cations and the inhibition by ribose 5-phosphate may be involved in the in vivo regulation of P-glycolate phosphatase activity.

  17. Biocatalysis with Sol-Gel Encapsulated Acid Phosphatase

    ERIC Educational Resources Information Center

    Kulkarni, Suhasini; Tran, Vu; Ho, Maggie K.-M.; Phan, Chieu; Chin, Elizabeth; Wemmer, Zeke; Sommerhalter, Monika

    2010-01-01

    This experiment was performed in an upper-level undergraduate biochemistry laboratory course. Students learned how to immobilize an enzyme in a sol-gel matrix and how to perform and evaluate enzyme-activity measurements. The enzyme acid phosphatase (APase) from wheat germ was encapsulated in sol-gel beads that were prepared from the precursor…

  18. Phosphatase inhibitors activate normal and defective CFTR chloride channels.

    PubMed Central

    Becq, F; Jensen, T J; Chang, X B; Savoia, A; Rommens, J M; Tsui, L C; Buchwald, M; Riordan, J R; Hanrahan, J W

    1994-01-01

    The cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel is regulated by phosphorylation and dephosphorylation at multiple sites. Although activation by protein kinases has been studied in some detail, the dephosphorylation step has received little attention. This report examines the mechanisms responsible for the dephosphorylation and spontaneous deactivation ("rundown") of CFTR chloride channels excised from transfected Chinese hamster ovary (CHO) and human airway epithelial cells. We report that the alkaline phosphatase inhibitors bromotetramisole, 3-isobutyl-1-methylxanthine, theophylline, and vanadate slow the rundown of CFTR channel activity in excised membrane patches and reduce dephosphorylation of CFTR protein in isolated membranes. It was also found that in unstimulated cells, CFTR channels can be activated by exposure to phosphatase inhibitors alone. Most importantly, exposure of mammalian cells to phosphatase inhibitors alone activates CFTR channels that have disease-causing mutations, provided the mutant channels are present in the plasma membrane (R117H, G551D, and delta F508 after cooling). These results suggest that CFTR dephosphorylation is dynamic and that membrane-associated phosphatase activity may be a potential therapeutic target for the treatment of cystic fibrosis. Images PMID:7522329

  19. Yeast Acid Phosphatases and Phytases: Production, Characterization and Commercial Prospects

    NASA Astrophysics Data System (ADS)

    Kaur, Parvinder; Satyanarayana, T.

    The element phosphorus is critical to all life forms as it forms the basic component of nucleic acids and ATP and has a number of indispensable biochemical roles. Unlike C or N, the biogeochemical cycling of phosphorus is very slow, and thus making it the growth-limiting element in most soils and aquatic systems. Phosphohydrolases (e.g. acid phosphatases and phytases) are enzymes that break the C-O-P ester bonds and provide available inorganic phosphorus from various inassimilable organic forms of phosphorus like phytates. These enzymes are of significant value in effectively combating phosphorus pollution. Although phytases and acid phosphatases are produced by various plants, animals and micro organisms, microbial sources are more promising for the production on a commercial scale. Yeasts being the simplest eukaryotes are ideal candidates for phytase and phos-phatase research due to their mostly non-pathogenic and GRAS status. They have not, however, been utilized to their full potential. This chapter focuses attention on the present state of knowledge on the production, characterization and potential commercial prospects of yeast phytases and acid phosphatases.

  20. Biocatalysis with Sol-Gel Encapsulated Acid Phosphatase

    ERIC Educational Resources Information Center

    Kulkarni, Suhasini; Tran, Vu; Ho, Maggie K.-M.; Phan, Chieu; Chin, Elizabeth; Wemmer, Zeke; Sommerhalter, Monika

    2010-01-01

    This experiment was performed in an upper-level undergraduate biochemistry laboratory course. Students learned how to immobilize an enzyme in a sol-gel matrix and how to perform and evaluate enzyme-activity measurements. The enzyme acid phosphatase (APase) from wheat germ was encapsulated in sol-gel beads that were prepared from the precursor…

  1. Specificity profiling of protein phosphatases toward phosphoseryl and phosphothreonyl peptides.

    PubMed

    Xiao, Qing; Luechapanichkul, Rinrada; Zhai, Yujing; Pei, Dehua

    2013-07-03

    A combinatorial library method was developed to systematically profile the substrate specificity of protein phosphatases toward phosphoseryl (pS) and phosphothreonyl (pT) peptides. Application of this method and a previously reported phosphotyrosyl (pY) library screening technique to dual-specificity phosphatase (DUSP) VH1 of vaccinia virus revealed that VH1 is highly active toward both pS/pT and pY peptides. VH1 exhibits different and more stringent sequence specificity toward pS/pT than pY substrates. Unlike previously characterized protein tyrosine phosphatases (PTPs), the activity and specificity of VH1 are primarily determined by the amino acid residues C-terminal to the pS, pT, or pY residue. In contrast, the mammalian VH1-related (VHR) DUSP has intrinsically low catalytic activity toward pS and pT substrates, suggesting that its primary physiological function is to dephosphorylate pY residues in substrate proteins. This method is applicable to other DUSPs and protein-serine/threonine phosphatases, and the substrate specificity data will be useful for identifying the physiological substrates of these enzymes.

  2. Effect of Poultry Manure Amendment on Soil Phosphatase Activity

    USDA-ARS?s Scientific Manuscript database

    Animal manure has traditionally been used as a fertilizer source. Manure phosphorus (P) exists in many forms, not all of which are immediately available. Microbial and plant-derived phosphatases can mineralize some organic P forms. Increased understanding of effects of manure application on soil p...

  3. New form of acid phosphatase during lysosome biogenesis.

    PubMed Central

    Rao, G R; Aithal, H N; Toback, F G; Getz, G S

    1981-01-01

    Lysosome formation was induced in cells of the renal medulla by feeding rats on a K+-deficient diet. The role of the endoplasmic reticulum in the production of acid phosphatase, a typical lysosomal enzyme, was examined. Lysosomal and microsomal fractions were prepared for study by differential centrifugation of homogenates of renal papilla and inner stripe of red medulla. Acid phosphatase activity in the microsomal fraction was distinguished from the activity in the lysosomal fraction in normal tissue by differences in pH optima, tartrate inhibition, distribution of multiple forms after polyacrylamide-gel electrophoresis and detergent-sensitivity. During progressive K+ depletion, acid phosphatase activity in both microsomal and lysosomal fractions of the tissue increased 3-fold. In the lysosomes, K+ depletion was associated with the appearance of a new band of acid phosphatase. The neuraminidase-sensitivity of this band on polyacrylamide-gel electrophoresis indicated that the enzyme protein had been modified by the addition of sialic acid residues. K+ depletion also altered the lysosomal enzyme so that thiol compounds were able to stimulate its activity. Images Fig. 4. PMID:7326004

  4. Functional Diversity of Haloacid Dehalogenase Superfamily Phosphatases from Saccharomyces cerevisiae

    PubMed Central

    Kuznetsova, Ekaterina; Nocek, Boguslaw; Brown, Greg; Makarova, Kira S.; Flick, Robert; Wolf, Yuri I.; Khusnutdinova, Anna; Evdokimova, Elena; Jin, Ke; Tan, Kemin; Hanson, Andrew D.; Hasnain, Ghulam; Zallot, Rémi; de Crécy-Lagard, Valérie; Babu, Mohan; Savchenko, Alexei; Joachimiak, Andrzej; Edwards, Aled M.; Koonin, Eugene V.; Yakunin, Alexander F.

    2015-01-01

    The haloacid dehalogenase (HAD)-like enzymes comprise a large superfamily of phosphohydrolases present in all organisms. The Saccharomyces cerevisiae genome encodes at least 19 soluble HADs, including 10 uncharacterized proteins. Here, we biochemically characterized 13 yeast phosphatases from the HAD superfamily, which includes both specific and promiscuous enzymes active against various phosphorylated metabolites and peptides with several HADs implicated in detoxification of phosphorylated compounds and pseudouridine. The crystal structures of four yeast HADs provided insight into their active sites, whereas the structure of the YKR070W dimer in complex with substrate revealed a composite substrate-binding site. Although the S. cerevisiae and Escherichia coli HADs share low sequence similarities, the comparison of their substrate profiles revealed seven phosphatases with common preferred substrates. The cluster of secondary substrates supporting significant activity of both S. cerevisiae and E. coli HADs includes 28 common metabolites that appear to represent the pool of potential activities for the evolution of novel HAD phosphatases. Evolution of novel substrate specificities of HAD phosphatases shows no strict correlation with sequence divergence. Thus, evolution of the HAD superfamily combines the conservation of the overall substrate pool and the substrate profiles of some enzymes with remarkable biochemical and structural flexibility of other superfamily members. PMID:26071590

  5. Mitogen-activated protein kinase phosphatase-1 (MKP-1): >100-fold nocturnal and norepinephrine-induced changes in the rat pineal gland.

    PubMed

    Price, Donald M; Chik, Constance L; Terriff, David; Weller, Joan; Humphries, Ann; Carter, David A; Klein, David C; Ho, Anthony K

    2004-11-05

    The norepinephrine-driven increase in mitogen-activated protein kinase (MAPK) activity is part of the mechanism that regulates arylalkylamine N-acetyltransferase (AA-NAT) activity in the rat pineal gland. We now report a marked nocturnal increase in the expression of a MAPK phosphatase, MAP kinase phosphatase-1 (MKP-1), that was blocked by maintaining animals in constant light or treatment with propranolol. MKP-1 expression was regulated by norepinephrine acting through both alpha- and beta-adrenergic receptors. These results establish a nocturnal increase in pineal MKP-1 expression that is under the control of a photoneural system. Because substrates of MKP-1 can influence AA-NAT activity, our findings suggest the involvement of MKP-1 in the regulation of the nocturnal AA-NAT signal.

  6. Dephosphorylation of phosphopeptides by calcineurin (protein phosphatase 2B).

    PubMed

    Donella-Deana, A; Krinks, M H; Ruzzene, M; Klee, C; Pinna, L A

    1994-01-15

    38 (6-32 residues) enzymically phosphorylated synthetic peptides have been assayed as substrates for calcineurin, a Ca2+/calmodulin-dependent protein phosphatase (PP-2B) belonging to the family of Ser/Thr-specific enzymes but also active on phosphotyrosine residues. Many peptides reproduce, with suitable modifications, naturally occurring phosphoacceptor sites. While protein phosphatases 2A and 2C are also very active on short phosphopeptides, an extended N-terminal stretch appears to be a necessary, albeit not sufficient, condition for an optimal dephosphorylation, comparable to that of protein substrates, of both phosphoseryl and phosphotyrosyl peptides by calcineurin. This finding corroborates the view that higher-order structure is an important determinant for the substrate specificity of calcineurin. However, a number of shorter peptides are also appreciably dephosphorylated by this enzyme, their efficiency as substrates depending on local structural features. All the peptides that are appreciably dephosphorylated by calcineurin contain basic residue(s) on the N-terminal side. A basic residue located at position -3 relative to the phosphorylated residue plays a particularly relevant positive role in determining the dephosphorylation of short phosphopeptides. Acidic residue(s) adjacent to the C-terminal side of the phosphoamino acid are conversely powerful negative determinants, preventing the dephosphorylation of otherwise suitable peptide substrates. However, calcineurin displays an only moderate preference for phosphothreonyl peptides which are conversely strikingly preferred over their phosphoseryl counterparts by the other classes of Ser/Thr-specific protein phosphatases. Moreover calcineurin does not perceive as a strong negative determinant the motif Ser/Thr-Pro in peptides where this motif prevents dephosphorylation by the other classes of Ser/Thr protein phosphatases. Whenever tested on phosphotyrosyl peptides, calcineurin exhibits a specificity which

  7. Decryptification of Acid Phosphatase in Arthrospores of Geotrichum Species Treated with Dimethyl Sulfoxide and Acetone

    PubMed Central

    Cotter, David A.; Martel, Anita J.; MacDonald, Paul

    1975-01-01

    Decryptification of acid phosphatase in Geotrichum sp. arthrospores was accomplished using acetone or dimethyl sulfoxide treatment. Both dimethyl sulfoxide and acetone irreversibly destroyed the integrity of the spore membranes without solubilizing acid phosphatase. PMID:1167386

  8. Phosphatase acitivity as biosignatures in terrestrial extreme environments

    NASA Astrophysics Data System (ADS)

    Kawai, Jun; Nakamoto, Saki; Hara, Masashi; Obayashi, Yumiko; Kaneko, Takeo; Mita, Hajime; Yoshimura, Yoshitaka; Takano, Yoshinori; Kobayashi, Kensei

    Since phosphate esters are essential for the terrestrial life, phosphatase activity can be a can-didate for biosignatures of biological activity. It has been recognized that terrestrial biosphere expands to such extreme environments as deep subsurface lithosphere, high temperature hot springs and stratosphere. We analyzed phosphatase activities in the samples obtained in ex-treme environments such as submarine hydrothermal systems and Antarctica , and discussed whether they can be used as biosignatures for extant life. Core samples and chimney samples were collected at Tarama Knoll in Okinawa Trough in 2009, both in a part of the Archaean Park Project. Surface soil samples are obtained at the Sites 1-8 near Showa Base in Antarctica during the 47th Japan Antarctic exploration mission in 2005-6. Alkaline Phosphatase activ-ity in sea water and in soil was measured spectrometrically by using 25 mM p-nitrophenyl phosphate (pH 8.0) as a substrate. Phosphatase activities in extracts were measured fluoro-metrically by using 4-methylumberyferryl phosphate as a substrate. Concentration of amino acids and their enantiomeric ratios were also determined by HPLC . Significant enzymatic ac-tivities were revealed in both some of the hydrothermal sub-vent systems and Antarctica soils, which is crucial evidence of vigorous microbial oasis. It is consistent with the fact that large enantiomeric excess of L-form amino acids were found in the same core sequences. Optimum temperatures of ALP in the chimney, Antarctica soil and YNU campus soil were 353 K, 313 K, and 333 K, respectively. The present results suggested that phosphatase activities,, together with amino acids, can be used as possible biosignatures for extant life.

  9. The relationship between the MMP system, adrenoceptors and phosphoprotein phosphatases

    PubMed Central

    Rietz, A; Spiers, JP

    2012-01-01

    The MMPs and their inhibitors [tissue inhibitor of MMPs (TIMPs) ] form the mainstay of extracellular matrix homeostasis. They are expressed in response to numerous stimuli including cytokines and GPCR activation. This review highlights the importance of adrenoceptors and phosphoprotein phosphatases (PPP) in regulating MMPs in the cardiovascular system, which may help explain some of the beneficial effects of targeting the adrenoceptor system in tissue remodelling and will establish emerging crosstalk between these three systems. Although α- and β-adrenoceptor activation increases MMP but decreases TIMP expression, MMPs are implicated in the growth stimulatory effects of adrenoceptor activation through transactivation of epidermal growth factor receptor. Furthermore, they have recently been found to catalyse the proteolysis of β-adrenoceptors and modulate vascular tone. While the mechanisms underpinning these effects are not well defined, reversible protein phosphorylation by kinases and phosphatases may be key. In particular, PPP (Ser/Thr phosphatases) are not only critical in resensitization and internalization of adrenoceptors but also modulate MMP expression. The interrelationship is complex as isoprenaline (ISO) inhibits okadaic acid [phosphoprotein phosphatase type 1/phosphoprotein phosphatase type 2A (PP2A) inhibitor]-mediated MMP expression. While this may be simply due to its ability to transiently increase PP2A activity, there is evidence for MMP-9 that ISO prevents okadaic acid-mediated expression of MMP-9 through a β-arrestin, NF-κB-dependent pathway, which is abolished by knock-down of PP2A. It is essential that crosstalk between MMPs, adrenoceptors and PPP are investigated further as it will provide important insight into how adrenoceptors modulate cardiovascular remodelling, and may identify new targets for pharmacological manipulation of the MMP system. PMID:22364165

  10. Expression of the alpha subunit of human chorionic gonadotropin is specifically correlated with tumorigenic expression in human cell hybrids.

    PubMed Central

    Stanbridge, E J; Rosen, S W; Sussman, H H

    1982-01-01

    The expression of HeLa parent phenotype protein markers, the alpha subunit of human chorionic gonadotropin and placental alkaline phosphatase isoenzymes, has been evaluated in paired tumorigenic and nontumorigenic HeLa-fibroblast human cell hybrids. Both of these proteins have been used clinically as markers of malignancy. The results showed that both are expressed in the hybrids. Expression of the gonadotropin subunit in the hybrids is specifically correlated with tumorigenicity; the placental alkaline phosphatase isoenzyme showed no such correlation and was expressed in both tumorigenic and nontumorigenic hybrids. PMID:6959112

  11. Formation and properties of organo-phosphatase complexes by abiotic and biotic polymerization of pyrogallol-phosphatase mixtures.

    PubMed

    Rao, Maria A; Del Gaudio, Stefania; Scelza, Rosalia; Gianfreda, Liliana

    2010-04-28

    In this paper, the catalytic efficacy of peroxidase and manganese oxide, both commonly present in soil, to catalyze the formation of pyrogallol-phosphatase complexes was compared. The influence of several factors (e.g., the concentration of pyrogallol, the amount of catalysts, the nature of manganese oxide, birnessite, or pyrolusite, the incubation time, and the pH) on the transformation of pyrogallol and the characteristics and properties of the pyrogallol-phosphatase interaction products were investigated. The pyrogallol transformation mediated by both catalysts was very fast and increased by increasing the catalyst concentration. The nature of the catalyst also influenced the size and the molecular mass of the formed complexes. When polymerization of pyrogallol occurred with high intensity, a loss of phosphatase activity occurred, and it strongly depended on the pH at which the process was carried out and the catalyst. In particular, with peroxidase, the phosphatase activity was much lower in either suspensions or supernatants and not measurable in the insoluble complexes as compared to that measured in the presence of manganese oxides.

  12. Protein phosphatase 2A: a highly regulated family of serine/threonine phosphatases implicated in cell growth and signalling.

    PubMed Central

    Janssens, V; Goris, J

    2001-01-01

    Protein phosphatase 2A (PP2A) comprises a family of serine/threonine phosphatases, minimally containing a well conserved catalytic subunit, the activity of which is highly regulated. Regulation is accomplished mainly by members of a family of regulatory subunits, which determine the substrate specificity, (sub)cellular localization and catalytic activity of the PP2A holoenzymes. Moreover, the catalytic subunit is subject to two types of post-translational modification, phosphorylation and methylation, which are also thought to be important regulatory devices. The regulatory ability of PTPA (PTPase activator), originally identified as a protein stimulating the phosphotyrosine phosphatase activity of PP2A, will also be discussed, alongside the other regulatory inputs. The use of specific PP2A inhibitors and molecular genetics in yeast, Drosophila and mice has revealed roles for PP2A in cell cycle regulation, cell morphology and development. PP2A also plays a prominent role in the regulation of specific signal transduction cascades, as witnessed by its presence in a number of macromolecular signalling modules, where it is often found in association with other phosphatases and kinases. Additionally, PP2A interacts with a substantial number of other cellular and viral proteins, which are PP2A substrates, target PP2A to different subcellular compartments or affect enzyme activity. Finally, the de-regulation of PP2A in some specific pathologies will be touched upon. PMID:11171037

  13. Effects of proteolysis and reduction on phosphatase and ROS-generating activity of human tartrate-resistant acid phosphatase.

    PubMed

    Fagerlund, Katja M; Ylipahkala, Hannele; Tiitinen, Sari L; Janckila, Anthony J; Hamilton, Susan; Mäentausta, Olli; Väänänen, H Kalervo; Halleen, Jussi M

    2006-05-15

    Osteoclasts and macrophages express high amounts of tartrate-resistant acid phosphatase (TRACP), an enzyme with unknown biological function. TRACP contains a disulfide bond, a protease-sensitive loop peptide, and a redox-active iron that can catalyze formation of reactive oxygen species (ROS). We studied the effects of proteolytic cleavage by trypsin, reduction of the disulfide bond by beta-mercaptoethanol, and reduction of the redox-active iron by ascorbate on the phosphatase and ROS-generating activity of baculovirus-generated recombinant human TRACP. Ascorbate alone and trypsin in combination with beta-mercaptoethanol increased k(cat)/K(m) of the phosphatase activity seven- to ninefold. The pH-optimum was changed from 5.4-5.6 to 6.2-6.4 by ascorbate and trypsin cleavage. Trypsin cleavage increased k(cat)/K(m) of the ROS-generating activity 2.5-fold without affecting the pH-optimum (7.0). These results suggest that the protease-sensitive loop peptide, redox-active iron, and disulfide bond are important regulatory sites in TRACP, and that the phosphatase and ROS-generating activity are performed with different reaction mechanisms.

  14. Regulation of the synthesis of barley aleurone. cap alpha. -amylase by gibberellic acid and calcium ions

    SciTech Connect

    Jones, R.L.; Carbonell, J.

    1984-09-01

    The effects of gibberellic acid (GA/sub 3/) and calcium ions on the production of ..cap alpha..-amylase and acid phosphatase by isolated aleurone layers of barley (Hordeum vulgare L. cv Himalaya) were studied. Aleurone layers not previously exposed to GA/sub 3/ or CA/sup 2 +/ show qualitative and quantitative changes in hydrolase production following incubation in either GA/sub 3/ or CA/sup 2 +/ or both. In cubation in H/sub 2/O or CA/sup 2 +/ results in the production of low levels of ..cap alpha..-amylase or acid phosphatase. The addition of GA/sub 3/ to the incubation medium causes 10- to 20-fold increase in the amounts of these enzymes released from the tissue, and addition of CA/sup 2 +/ at 10 millimolar causes a further 8- to 9-fold increase in ..cap alpha..-amylase release and a 75% increase in phosphatase release. Production of ..cap alpha..-amylase isoenzymes is also modified by the levels of GA/sub 3/ and CA/sup 2 +/ in the incubation medium. ..cap alpha..-amylase 2 is produced under all conditions of incubation, while ..cap alpha..-amylase 1 appears only when layers are incubated in GA/sub 3/ or GA/sub 3/ plus CA/sup 2 +/. The synthesis of ..cap alpha..-amylases 3 and 4 requires the presence of both GA/sub 3/ and CA/sup 2 +/ in the incubation medium. Laurell rocket immunoelectrophoresis shows that two distinct groups of ..cap alpha..-amylase antigens are present in incubation media of aleurone layers incubated with both GA/sub 3/ and CA/sup 2 +/, while only one group of antigens is found in media of layers incubated in GA/sub 3/ alone. Strontium ions can be substituted for CA/sup 2 +/ in increasing hydrolase production, although higher concentrations of Sr/sup 2 +/ are requried for maximal response. We conclude that GA/sub 3/ is required for the production of ..cap alpha..-amylase 1 and that both GA/sub 3/ and either CA/sup 2 +/ or Sr/sup 2 +/ are required for the production of isoenzymes 3 and 4 of barley aleurone ..cap alpha..-amylase. 22 references, 8

  15. alpha-Synuclein stimulates differentiation of osteosarcoma cells: relevance to down-regulation of proteasome activity.

    PubMed

    Fujita, Masayo; Sugama, Shuei; Nakai, Masaaki; Takenouchi, Takato; Wei, Jianshe; Urano, Tomohiko; Inoue, Satoshi; Hashimoto, Makoto

    2007-02-23

    Because a limited study previously showed that alpha-synuclein (alpha-syn), the major pathogenic protein for Parkinson disease, was expressed in differentiating brain tumors as well as various peripheral cancers, the main objective of the present study was to determine whether alpha-syn might be involved in the regulation of tumor differentiation. For this purpose, alpha-syn and its non-amyloidogenic homologue beta-syn were stably transfected to human osteosarcoma MG63 cell line. Compared with beta-syn-overexpressing and vector-transfected cells, alpha-syn-overexpressing cells exhibited distinct features of differentiated osteoblastic phenotype, as shown by up-regulation of alkaline phosphatase and osteocalcin as well as inductive matrix mineralization. Further studies revealed that proteasome activity was significantly decreased in alpha-syn-overexpressing cells compared with other cell types, consistent with the fact that proteasome inhibitors stimulate differentiation of various osteoblastic cells. In alpha-syn-overexpressing cells, protein kinase C (PKC) activity was significantly decreased, and reactivation of PKC by phorbol ester significantly restored the proteasome activity and abrogated cellular differentiation. Moreover, activity of lysosome was up-regulated in alpha-syn-overexpressing cells, and treatment of these cells with autophagy-lysosomal inhibitors resulted in a decrease of proteasome activity associated with up-regulation of alpha-syn expression, leading to enhance cellular differentiation. Taken together, these results suggest that the stimulatory effect of alpha-syn on tumor differentiation may be attributed to down-regulation of proteasome, which is further modulated by alterations of various factors, such as protein kinase C signaling pathway and a autophagy-lysosomal degradation system. Thus, the mechanism of alpha-syn regulation of tumor differentiation and neuropathological effects of alpha-syn may considerably overlap with each other.

  16. A karyopherin alpha2 nuclear transport pathway is regulated by glucose in hepatic and pancreatic cells.

    PubMed

    Cassany, Aurélia; Guillemain, Ghislaine; Klein, Christophe; Dalet, Véronique; Brot-Laroche, Edith; Leturque, Armelle

    2004-01-01

    We studied the role of the karyopherin alpha2 nuclear import carrier (also known as importin alpha2) in glucose signaling. In mhAT3F hepatoma cells, GFP-karyopherin alpha2 accumulated massively in the cytoplasm within minutes of glucose extracellular addition and returned to the nucleus after glucose removal. In contrast, GFP-karyopherin alpha1 distribution was unaffected regardless of glucose concentration. Glucose increased GFP-karyopherin alpha2 nuclear efflux by a factor 80 and its shuttling by a factor 4. These glucose-induced movements were not due to glycolytic ATP production. The mechanism involved was leptomycin B-insensitive, but phosphatase- and energy-dependent. HepG2 and COS-7 cells displayed no glucose-induced GFP-karyopherin alpha2 movements. In pancreatic MIN-6 cells, the glucose-induced movements of karyopherin alpha2 and the stimulation of glucose-induced gene transcription were simultaneously lost between passages 28 and 33. Thus, extracellular glucose regulates a nuclear transport pathway by increasing the nuclear efflux and shuttling of karyopherin alpha2 in cells in which glucose can stimulate the transcription of sugar-responsive genes.

  17. LAR, liprin alpha and the regulation of active zone morphogenesis.

    PubMed

    Stryker, Emily; Johnson, Karl G

    2007-11-01

    Active zones are protein-rich regions of neurons that act as sites of synaptic vesicle fusion and neurotransmitter release at the pre-synaptic terminus. Although the discovery that the receptor protein tyrosine phosphatase LAR and its cytoplasmic binding partner liprin alpha are essential for proper active zone formation is nearly a decade old, the underlying mechanisms are still poorly understood. Recent studies have identified a number of binding partners for both LAR and liprin alpha, several of which play key roles in active zone assembly. These include nidogen, dallylike and syndecan--extracellular ligands for LAR that regulate synapse morphogenesis. In addition, liprin-alpha-interacting proteins such as ERC2, RIM and the MALS/Veli-Cask-Mint1 complex cooperate to form a dense molecular scaffold at the active zone that is crucial for proper synaptic function. These studies allow us to propose testable models of LAR and liprin alpha function, and provide insights into the fundamental molecular mechanisms of synapse formation and stabilization.

  18. Alpha irradiation modeling

    SciTech Connect

    Keeton, S C; Mount, M E

    1999-03-26

    With the end of the Cold War and the associated limitations imposed on the nuclear weapons stockpile by strategic arms treaties, much has changed in the stockpile stewardship program. Weapons that were originally designed for stockpile lives on the order of 15 to 20 years are now being evaluated for much longer periods: in some cases as much as 60 years. As such, issues that were once considered to be of no consequence are being reexamined. Among these is the extent of the radiation dose received by secondary organics over time that results from the intrinsic alpha source of the weapon components. This report describes the results of work performed to estimate the alpha radiation deposition in the organic components of an LLNL system at specific points in its stockpile life. Included are discussions of the development of the intrinsic time- and energy-dependent alpha source term per unit mass, estimation of the effective source and absorber material thicknesses, development of a simplified model for the total intrinsic alpha source term and energy deposition in the absorber, and the alpha radiation deposition in the organic components of a selected LLNL weapon.

  19. Detection of endogenous alkaline phosphatase activity in intact cells by flow cytometry using the fluorogenic ELF-97 phosphatase substrate

    NASA Technical Reports Server (NTRS)

    Telford, W. G.; Cox, W. G.; Stiner, D.; Singer, V. L.; Doty, S. B.

    1999-01-01

    BACKGROUND: The alkaline phosphatase (AP) substrate 2-(5'-chloro-2'-phosphoryloxyphenyl)-6-chloro-4-(3H)-quinazolinone (ELF((R))-97 for enzyme-labeled fluorescence) has been found useful for the histochemical detection of endogenous AP activity and AP-tagged proteins and oligonucleotide probes. In this study, we evaluated its effectiveness at detecting endogenous AP activity by flow cytometry. METHODS: The ELF-97 phosphatase substrate was used to detect endogenous AP activity in UMR-106 rat osteosarcoma cells and primary cultures of chick chondrocytes. Cells were labeled with the ELF-97 reagent and analyzed by flow cytometry using an argon ultraviolet (UV) laser. For comparison purposes, cells were also assayed for AP using a Fast Red Violet LB azo dye assay previously described for use in detecting AP activity by flow cytometry. RESULTS: The ELF-97 phosphatase substrate effectively detected endogenous AP activity in UMR-106 cells, with over 95% of the resulting fluorescent signal resulting from AP-specific activity (as determined by levamisole inhibition of AP activity). In contrast, less than 70% of the fluorescent signal from the Fast Red Violet LB (FRV) assay was AP-dependent, reflecting the high intrinsic fluorescence of the unreacted components. The ELF-97 phosphatase assay was also able to detect very low AP activity in chick chondrocytes that was undetectable by the azo dye method. CONCLUSIONS: The ELF-97 phosphatase assay was able to detect endogenous AP activity in fixed mammalian and avian cells by flow cytometry with superior sensitivity to previously described assays. This work also shows the applicability of ELF-97 to flow cytometry, supplementing its previously demonstrated histochemical applications. Copyright 1999 Wiley-Liss, Inc.

  20. Detection of endogenous alkaline phosphatase activity in intact cells by flow cytometry using the fluorogenic ELF-97 phosphatase substrate

    NASA Technical Reports Server (NTRS)

    Telford, W. G.; Cox, W. G.; Stiner, D.; Singer, V. L.; Doty, S. B.

    1999-01-01

    BACKGROUND: The alkaline phosphatase (AP) substrate 2-(5'-chloro-2'-phosphoryloxyphenyl)-6-chloro-4-(3H)-quinazolinone (ELF((R))-97 for enzyme-labeled fluorescence) has been found useful for the histochemical detection of endogenous AP activity and AP-tagged proteins and oligonucleotide probes. In this study, we evaluated its effectiveness at detecting endogenous AP activity by flow cytometry. METHODS: The ELF-97 phosphatase substrate was used to detect endogenous AP activity in UMR-106 rat osteosarcoma cells and primary cultures of chick chondrocytes. Cells were labeled with the ELF-97 reagent and analyzed by flow cytometry using an argon ultraviolet (UV) laser. For comparison purposes, cells were also assayed for AP using a Fast Red Violet LB azo dye assay previously described for use in detecting AP activity by flow cytometry. RESULTS: The ELF-97 phosphatase substrate effectively detected endogenous AP activity in UMR-106 cells, with over 95% of the resulting fluorescent signal resulting from AP-specific activity (as determined by levamisole inhibition of AP activity). In contrast, less than 70% of the fluorescent signal from the Fast Red Violet LB (FRV) assay was AP-dependent, reflecting the high intrinsic fluorescence of the unreacted components. The ELF-97 phosphatase assay was also able to detect very low AP activity in chick chondrocytes that was undetectable by the azo dye method. CONCLUSIONS: The ELF-97 phosphatase assay was able to detect endogenous AP activity in fixed mammalian and avian cells by flow cytometry with superior sensitivity to previously described assays. This work also shows the applicability of ELF-97 to flow cytometry, supplementing its previously demonstrated histochemical applications. Copyright 1999 Wiley-Liss, Inc.

  1. Transcriptional regulation of glucose-6-phosphatase catalytic subunit promoter by insulin and glucose in the carnivorous fish, Sparus aurata.

    PubMed

    Salgado, M C; Metón, I; Egea, M; Baanante, I V

    2004-12-01

    Increase in glucose-6-phosphatase catalytic subunit (G6Pase, G6pc) transcription enhances hepatic glucose production in non-insulin-dependent diabetes mellitus (NIDDM). The fact that carnivorous fish is an alternative model to study NIDDM led us to clone and characterise the first G6pc promoter region reported for fish and non-mammalian animals. The 5'-flanking region of G6pc from gilthead sea bream (Sparus aurata) was isolated by chromosome walking. With SMART RACE-PCR, the transcription start site was located 106 base pairs (bp) upstream of the translational start. Transfection analysis in HepG2 cells located a functional promoter in the 850 bp 5'-flanking isolated fragment (positions -770 to +80 relative to the transcription start). Sequential 5'-deletion analysis of the promoter fragment revealed that a core functional promoter for basal transcription is comprised within the 190 bp upstream of the transcription start site. In vivo, glucose and insulin reduced G6Pase mRNA levels in the fish liver. Transfection experiments in HepG2 cells showed that insulin repressed S. aurata G6pc under high-glucose conditions. Synergistic activation of piscine G6pc promoter was induced by cotransfection with expression plasmids for hepatocyte nuclear factor-4alpha (HNF-4alpha) and peroxisome proliferator-activated receptor-gamma coactivator-1 (PGC-1alpha). No direct relationship was found between PGC-1alpha coactivation of HNF-4alpha transactivation and the repressive effect of insulin. Interestingly, insulin hardly affected G6pc promoter activity in the absence of glucose, suggesting that a reduced capacity of insulin-dependent repression of piscine G6pc may lead to insulin resistance in carnivorous fish.

  2. ALPHA MIS: Reference manual

    SciTech Connect

    Lovin, J.K.; Haese, R.L.; Heatherly, R.D.; Hughes, S.E.; Ishee, J.S.; Pratt, S.M.; Smith, D.W.

    1992-02-01

    ALPHA is a powerful and versatile management information system (MIS) initiated and sponsored and by the Finance and Business Management Division of Oak Ridge National Laboratory, who maintain and develop it in concert with the Business Systems Division for its Information Center. A general-purpose MIS, ALPHA allows users to access System 1022 and System 1032 databases to obtain and manage information. From a personal computer or a data terminal, Energy Systems employees can use ALPHA to control their own report reprocessing. Using four general commands (Database, Select, Sort, and Report) they can (1) choose a mainframe database, (2) define subsets within it, (3) sequentially order a subset by one or more variables, and (4) generate a report with their own or a canned format.

  3. Lipoarabinomannan of Mycobacterium tuberculosis promotes protein tyrosine dephosphorylation and inhibition of mitogen-activated protein kinase in human mononuclear phagocytes. Role of the Src homology 2 containing tyrosine phosphatase 1.

    PubMed

    Knutson, K L; Hmama, Z; Herrera-Velit, P; Rochford, R; Reiner, N E

    1998-01-02

    Lipoarabinomannan (LAM) is a putative virulence factor of Mycobacterium tuberculosis that inhibits monocyte functions, and this may involve antagonism of cell signaling pathways. The effects of LAM on protein tyrosine phosphorylation in cells of the human monocytic cell line THP-1 were examined. LAM promoted tyrosine dephosphorylation of multiple cell proteins and attenuated phorbol 12-myristate 13-acetate-induced activation of mitogen-activated protein kinase. To examine whether these effects of LAM could be related to activation of a phosphatase, fractions from LAM-treated cells were analyzed for dephosphorylation of para-nitrophenol phosphate. The data show that LAM induced increased phosphatase activity associated with the membrane fraction. The Src homology 2 containing tyrosine phosphatase 1 (SHP-1) is important for signal termination and was examined as a potential target of LAM. Exposure of cells to LAM brought about (i) an increase in tyrosine phosphorylation of SHP-1, and (ii) translocation of the phosphatase to the membrane. Phosphatase assay of SHP-1 immunoprecipitated from LAM-treated cells, using phosphorylated mitogen-activated protein kinase as substrate, indicated that LAM promoted increased activity of SHP-1 in vivo. LAM also activated SHP-1 directly in vitro. Exposure of cells to LAM also attenuated the expression of tumor necrosis factor-alpha, interleukin-12, and major histocompatibility class II molecules. These results suggest that one mechanism by which LAM deactivates monocytes involves activation of SHP-1.

  4. Myosin light chain phosphatase activation is involved in the hydrogen sulfide-induced relaxation in mouse gastric fundus.

    PubMed

    Dhaese, Ingeborg; Lefebvre, Romain A

    2009-03-15

    The relaxant effect of hydrogen sulfide (H(2)S) in the vascular tree is well established but its influence and mechanism of action in gastrointestinal smooth muscle was hardly investigated. The influence of H(2)S on contractility in mouse gastric fundus was therefore examined. Sodium hydrogen sulfide (NaHS; H(2)S donor) was administered to prostaglandin F(2alpha) (PGF(2alpha))-contracted circular muscle strips of mouse gastric fundus, before and after incubation with interfering drugs. NaHS caused a concentration-dependent relaxation of the pre-contracted mouse gastric fundus strips. The K(+) channels blockers glibenclamide, apamin, charybdotoxin, 4-aminopyridin and barium chloride had no influence on the NaHS-induced relaxation. The relaxation by NaHS was also not influenced by L-NAME, ODQ and SQ 22536, inhibitors of the cGMP and cAMP pathway, by nerve blockers capsazepine, omega-conotoxin and tetrodotoxin or by several channel and receptor blockers (ouabain, nifedipine, 2-aminoethyl diphenylborinate, ryanodine and thapsigargin). The myosin light chain phosphatase (MLCP) inhibitor calyculin-A reduced the NaHS-induced relaxation, but the Rho-kinase inhibitor Y-27632 had no influence. We show that NaHS is able to relax PGF(2alpha)-contracted mouse gastric fundus strips. The results suggest that in the mouse gastric fundus, H(2)S causes relaxation at least partially via activation of MLCP.

  5. Mammalian inositol polyphosphate 5-phosphatase II can compensate for the absence of all three yeast Sac1-like-domain-containing 5-phosphatases.

    PubMed Central

    O'Malley, C J; McColl, B K; Kong, A M; Ellis, S L; Wijayaratnam, A P; Sambrook, J; Mitchell, C A

    2001-01-01

    Phosphatidylinositol 4,5-bisphosphate [PtdIns(4,5)P(2)] plays a complex role in generating intracellular signalling molecules, and also in regulating actin-binding proteins, vesicular trafficking and vacuolar fusion. Four inositol polyphosphate 5-phosphatases (hereafter called 5-phosphatases) have been identified in Saccharomyces cerevisiae: Inp51p, Inp52p, Inp53p and Inp54p. Each enzyme contains a 5-phosphatase domain which hydrolyses PtdIns(4,5)P(2), forming PtdIns4P, while Inp52p and Inp53p also express a polyphosphoinositide phosphatase domain within the Sac1-like domain. Disruption of any two yeast 5-phosphatases containing a Sac1-like domain results in abnormalities in actin polymerization, plasma membrane, vacuolar morphology and bud-site selection. Triple null mutant 5-phosphatase strains are non-viable. To investigate the role of PtdIns(4,5)P(2) in mediating the phenotype of double and triple 5-phosphatase null mutant yeast, we determined whether a mammalian PtdIns(4,5)P(2) 5-phosphatase, 5-phosphatase II, which lacks polyphosphoinositide phosphatase activity, could correct the phenotype of triple 5-phosphatase null mutant yeast and restore cellular PtdIns(4,5)P(2) levels to near basal values. Mammalian 5-phosphatase II expressed under an inducible promoter corrected the growth, cell wall, vacuolar and actin polymerization defects of the triple 5-phosphatase null mutant yeast strains. Cellular PtdIns(4,5)P(2) levels in various 5-phosphatase double null mutant strains demonstrated significant accumulation (4.5-, 3- and 2-fold for Deltainp51Deltainp53, Deltainp51Deltainp52 and Deltainp52Deltainp53 double null mutants respectively), which was corrected significantly following 5-phosphatase II expression. Collectively, these studies demonstrate the functional and cellular consequences of PtdIns(4,5)P(2) accumulation and the evolutionary conservation of function between mammalian and yeast PtdIns(4,5)P(2) 5-phosphatases. PMID:11311145

  6. Mice lacking tartrate-resistant acid phosphatase (Acp 5) have disordered macrophage inflammatory responses and reduced clearance of the pathogen, Staphylococcus aureus.

    PubMed

    Bune, A J; Hayman, A R; Evans, M J; Cox, T M

    2001-01-01

    Tartrate-resistant acid phosphatase (TRAP) is a lysosomal di-iron protein of mononuclear phagocytes and osteoclasts. Hitherto, no role for the enzyme in immunity has been identified; however, knockout mice lacking TRAP have a skeletal phenotype caused by an intrinsic osteoclast defect. To investigate a putative function for TRAP in macrophages (Mphi), we investigated proinflammatory responses and systemic microbial clearance in knockout mice compared with age- and gender-matched congenic wild-type mice. Phorbol 12-myristate 13-acetate (PMA)-stimulated and interferon-gamma (IFN-gamma)-induced superoxide formation was enhanced in peritoneal Mphi lacking TRAP; nitrite production in response to stimulation with lipopolysaccharide (LPS) and IFN-gamma was also increased. In addition, secretion of the proinflammatory cytokines, tumour necrosis factor-alpha (TNF-alpha), interleukin (IL)-1beta and IL-12, was significantly greater in TRAP-deficient Mphi when stimulated with LPS, with or without addition of either TNF-alpha or IFN-gamma. The activity of tartrate-sensitive (lysosomal) acid phosphatase was increased in Mphi from the knockout mice but activities of the lysosomal hydrolases N-acetyl beta-glucosaminidase and acid beta-glucuronidase were unchanged, indicating selective activation of compensatory acid phosphatase activity. Evidence of impaired Mphi function in vivo was obtained in TRAP knockout mice, which showed delayed clearance of the microbial pathogen, Staphylococcus aureus, after sublethal intraperitoneal inoculation. After microbial challenge, peritoneal exudates obtained from TRAP knockout mice had a reduced population of Mphi. As peritoneal Mphi and neutrophils lacking TRAP were able to phagocytose and kill S. aureus normally in vitro, TRAP may directly or indirectly influence recruitment of Mphi to sites of microbial invasion. Our study shows that TRAP participates in the inflammatory response of the Mphi and influences effector signalling pathways in

  7. The Apollo Alpha Spectrometer.

    NASA Technical Reports Server (NTRS)

    Jagoda, N.; Kubierschky, K.; Frank, R.; Carroll, J.

    1973-01-01

    Located in the Science Instrument Module of Apollo 15 and 16, the Alpha Particle Spectrometer was designed to detect and measure the energy of alpha particles emitted by the radon isotopes and their daughter products. The spectrometer sensor consisted of an array of totally depleted silicon surface barrier detectors. Biased amplifier and linear gate techniques were utilized to reduce resolution degradation, thereby permitting the use of a single 512 channel PHA. Sensor identification and in-flight radioactive calibration were incorporated to enhance data reduction.

  8. The Apollo Alpha Spectrometer.

    NASA Technical Reports Server (NTRS)

    Jagoda, N.; Kubierschky, K.; Frank, R.; Carroll, J.

    1973-01-01

    Located in the Science Instrument Module of Apollo 15 and 16, the Alpha Particle Spectrometer was designed to detect and measure the energy of alpha particles emitted by the radon isotopes and their daughter products. The spectrometer sensor consisted of an array of totally depleted silicon surface barrier detectors. Biased amplifier and linear gate techniques were utilized to reduce resolution degradation, thereby permitting the use of a single 512 channel PHA. Sensor identification and in-flight radioactive calibration were incorporated to enhance data reduction.

  9. Phosphorylation and dephosphorylation of human platelet surface proteins by an ecto-protein kinase/phosphatase system.

    PubMed

    Naik, U P; Kornecki, E; Ehrlich, Y H

    1991-04-17

    We have characterized a novel ecto-protein kinase activity and a novel ecto-protein phosphatase activity on the membrane surface of human platelets. Washed intact platelets, when incubated with [gamma-32P]ATP in Tyrode's buffer, showed the phosphorylation of a membrane surface protein migrating with an apparent molecular mass of 42 kDa on 5-15% SDS polyacrylamide gradient gels. The 42 kDa protein could be further resolved on 15% SDS gels into two proteins of 39 kDa and 42 kDa. In this gel system, it was found that the 39 kDa protein became rapidly phosphorylated and dephosphorylated, whereas the 42 kDa protein was phosphorylated and dephosphorylated at a much slower rate. NaF inhibited the dephosphorylation of these proteins indicating the involvement of an ecto-protein phosphatase. The platelet membrane ecto-protein kinase responsible for the phosphorylation of both of these proteins was identified as a serine kinase and showed dependency on divalent cations Mg2+ or Mn2+ ions. Ca2+ ions potentiated the Mg(2+)-dependent ecto-protein kinase activity. The ecto-protein kinase rapidly phosphorylated histone and casein added exogenously to the extracellular medium of intact platelets. Following activation of platelets by alpha-thrombin, the incorporation of [32P]phosphate from exogenously added [gamma-32P]ATP by endogenous protein substrates was reduced by 90%, suggesting a role of the ecto-protein kinase system in the regulation of platelet function. The results presented here demonstrate that both protein kinase and protein phosphatase activities reside on the membrane surface of human platelets. These activities are capable of rapidly phosphorylating and dephosphorylating specific surface platelet membrane proteins which may play important roles in early events of platelet activation and secretion.

  10. Repeated probing of Southwestern blots using alkaline phosphatase stripping.

    PubMed

    Jia, Yinshan; Jiang, Daifeng; Jarrett, Harry W

    2010-11-05

    Southwestern blotting is when a DNA sequence is used to probe DNA-binding proteins on an electrophoretic gel blot. It would be highly desirable to be able to probe a blot repeatedly with different DNA sequences. Alkaline phosphatase can remove 5'-phosphoryl groups from DNA and radiolabeled 5'-(32)P-DNA probes are commonly used in Southwestern blotting. Here is shown that once probed, the radioisotope signal on the blot can be effectively removed by brief digestion with alkaline phosphatase, and the blot can then be repeatedly probed at least six times with different DNA probes. This exceeds the repetitions possible with another commonly used method using SDS. The technique can be used with either one-dimensional or multi-dimensional Southwestern blots and does not have a large effect on the phosphorylation state of the blotted proteins. An alternative method using T4 polynucleotide kinase stripping is also introduced but was less well characterized.

  11. Purification and Characterization of Acid Phosphatase V from Aspergillus nidulans

    PubMed Central

    Harsanyi, Zsolt; Dorn, Gordon L.

    1972-01-01

    Acid phosphatase V of Aspergillus nidulans was purified by ammonium sulfate precipitation, gel filtration, and ion-exchange chromatography. The enzyme demonstrated a charge microheterogeneity on starch and acrylamide gel electrophoresis, but proved to be homogeneous on ultracentrifugation and gel filtration. Phosphatase V was found to be a classic acid orthophosphoric monoester phosphohydrolase, and it cleaved p-nitrophenylphosphate, glucose-6-phosphate, and uridine-5′-monophosphate at maximal rates. It was inhibited by fluoride, borate, and molybdate ions, and demonstrated end-product inhibition by inorganic phosphate. Metallic ions or cofactors were not required for activity. The molecular weight was estimated to be 100,000, the S20,w was calculated to be 4.1, and the pH optimum was found to be 6.1. Images PMID:4552990

  12. Inositol lipid phosphatases in membrane trafficking and human disease.

    PubMed

    Billcliff, Peter G; Lowe, Martin

    2014-07-15

    The specific interaction of phosphoinositides with proteins is critical for a plethora of cellular processes, including cytoskeleton remodelling, mitogenic signalling, ion channel regulation and membrane traffic. The spatiotemporal restriction of different phosphoinositide species helps to define compartments within the cell, and this is particularly important for membrane trafficking within both the secretory and endocytic pathways. Phosphoinositide homoeostasis is tightly regulated by a large number of inositol kinases and phosphatases, which respectively phosphorylate and dephosphorylate distinct phosphoinositide species. Many of these enzymes have been implicated in regulating membrane trafficking and, accordingly, their dysregulation has been linked to a number of human diseases. In the present review, we focus on the inositol phosphatases, concentrating on their roles in membrane trafficking and the human diseases with which they have been associated.

  13. Translating protein phosphatase research into treatments for neurodegenerative diseases.

    PubMed

    Sundaram, Jeyapriya R; Lee, Irene C J; Shenolikar, Shirish

    2017-02-08

    Many of the major neurodegenerative disorders are characterized by the accumulation of intracellular protein aggregates in neurons and other cells in brain, suggesting that errors in protein quality control mechanisms associated with the aging process play a critical role in the onset and progression of disease. The increased understanding of the unfolded protein response (UPR) signaling network and, more specifically, the structure and function of eIF2α phosphatases has enabled the development or discovery of small molecule inhibitors that show great promise in restoring protein homeostasis and ameliorating neuronal damage and death. While this review focuses attention on one or more eIF2α phosphatases, the wide range of UPR proteins that are currently being explored as potential drug targets bodes well for the successful future development of therapies to preserve neuronal function and treat neurodegenerative disease. © 2017 The Author(s); published by Portland Press Limited on behalf of the Biochemical Society.

  14. Myosin phosphatase Fine-tunes Zebrafish Motoneuron Position during Axonogenesis

    PubMed Central

    Granato, Michael

    2016-01-01

    During embryogenesis the spinal cord shifts position along the anterior-posterior axis relative to adjacent tissues. How motor neurons whose cell bodies are located in the spinal cord while their axons reside in adjacent tissues compensate for such tissue shift is not well understood. Using live cell imaging in zebrafish, we show that as motor axons exit from the spinal cord and extend through extracellular matrix produced by adjacent notochord cells, these cells shift several cell diameters caudally. Despite this pronounced shift, individual motoneuron cell bodies stay aligned with their extending axons. We find that this alignment requires myosin phosphatase activity within motoneurons, and that mutations in the myosin phosphatase subunit mypt1 increase myosin phosphorylation causing a displacement between motoneuron cell bodies and their axons. Thus, we demonstrate that spinal motoneurons fine-tune their position during axonogenesis and we identify the myosin II regulatory network as a key regulator. PMID:27855159

  15. Repeated probing of Southwestern blots using alkaline phosphatase stripping

    PubMed Central

    Jia, Yinshan; Jiang, Daifeng; Jarrett, Harry W.

    2010-01-01

    Southwestern blotting is when a DNA sequence is used to probe DNA-binding proteins on an electrophoretic gel blot. It would be highly desirable to be able to probe a blot repeatedly with different DNA sequences. Alkaline phosphatase can remove 5′-phosphoryl groups from DNA and radiolabeled 5′-32P-DNA probes are commonly used in Southwestern blotting. Here is shown that once probed, the radioisotope signal on the blot can be effectively removed by brief digestion with alkaline phosphatase, and the blot can then be repeatedly probed at least six times with different DNA probes. This exceeds the repetitions possible with another commonly used method using SDS. The technique can be used with either one-dimensional or multi-dimensional Southwestern blots and does not have a large effect on the phosphorylation state of the blotted proteins. An alternative method using T4 polynucleotide kinase stripping is also introduced but was less well characterized. PMID:20926088

  16. Radiation inactivation analysis of rat liver microsomal glucose 6-phosphatase

    SciTech Connect

    Ness, G.C.; Sample, C.E.; McCreery, M.J.; Sukalski, K.A.; Nordlie, R.C.

    1986-05-01

    Attempts to obtain the molecular weight of microsomal glucose-6-phosphatase based on solubilization and purification have yielded widely divergent results. Since radiation inactivation analysis can be used to obtain molecular weights of proteins within the native membrane environments, this technique was applied. Identical target sizes of about 70 kd for both glucose 6-phosphate phosphohydrolase and carbamyl phosphate:glucose phosphotransferase were observed. This value was unaffected by adding deoxycholate, which disrupts the microsomal membranes, to the microsomal suspensions prior to irradiation. The data suggest that the glucose 6-phosphate transport function and the glucose 6-phosphate phosphohydrolase activity of microsomal glucose 6-phosphatase either residue on a single polypeptide or on two covalently linked polypeptides.

  17. Hybrids of chemical derivatives of Escherichia coli alkaline phosphatase.

    PubMed

    Meighen, E; Yue, R

    1975-12-15

    The activities of hybrid dimers of alkaline phosphatase containing two chemically modified subunits have been investigated. One hybrid species was prepared by dissociation and reconstitution of a mixture of two variants produced by chemical modification of the native enzyme with succinic anhydride and tetranitromethane, respectively. The succinyl-nitrotyrosyl hybrid was separated from the other members of the hybrid set by DEAE-Sephadex chromatography and then converted to a succinyl-aminotyrosyl hybrid by reduction of the modified tyrosine residues with sodium dithionite. A comparison of the activities of these two hybrids with the activities of the succinyl, nitrotyrosyl and aminotyrosyl derivatives has shown that either the subunits of alkaline phosphatase function independently or if the subunits turnover alternately in a reciprocating mechanism, then the intrinsic activity of each subunit must be strongly dependent on its partner subunit.

  18. Cytochemical localization of acid phosphatase in Leishmania mexicana amazonensis.

    PubMed

    Pimenta, P F; De Souza, W

    1986-01-01

    Acid phosphatase was cytochemically detected at the ultrastructural level in infective and non-infective promastigotes and in amastigotes of the parasitic protozoan Leishmania mexicana amazonensis. Cerium chloride was used as the capture agent of the phosphate liberated during the hydrolysis of the substrate (Na-beta-glycerophosphate). Reaction product, indicative of enzyme activity, was seen in the outer face of the plasma membrane of many, but not all, infective and noninfective promastigote forms. No reaction product was seen in the plasma membrane of amastigote forms. Reaction product was seen in the endoplasmic reticulum, in the Golgi complex, in vesicles located close to the flagellar pocket and in cytoplasmic structures which may represent lysosomes. No reaction product was seen when the substrate was omitted from or sodium fluoride was added to the incubation medium. The possible role played by the acid phosphatase present in the plasma membrane of Leishmania parasites is discussed.

  19. Protein kinase and protein phosphatase expression in the central nervous system of G93A mSOD over-expressing mice.

    PubMed

    Hu, Jie Hong; Chernoff, Ken; Pelech, Steven; Krieger, Charles

    2003-04-01

    The expressions of 78 protein kinases, 24 protein phosphatases and 31 phosphoproteins were investigated by Kinetworks trade mark analysis in brain and spinal cord tissue of transgenic mice over-expressing G93A mutant superoxide dismutase (mSOD), a murine model of amyotrophic lateral sclerosis (ALS). In the brains of affected mSOD mice, we observed increased expression of cAMP-dependent protein kinase (PKA, 111% increase compared with control), and protein phosphatase 2B Aalpha-catalytic subunit (calcineurin, 109% increase), and reductions in the levels of PAK3 (76% decrease) and protein phosphatase 2C Cbeta-subunit (32% decrease). Increased Ser259 phosphorylation of Raf1 (126% increase) in mSOD mice correlated with higher expression of p73 Raf1 (147% increase). There was also increased p73 Raf1 (69% increase) and Ser259 phosphorylation (45% increase) in the spinal cords of mSOD mice. While adducin underwent enhanced phosphorylation (alphaS724, 90% increase; gammaS662, 290% increase) in mSOD brain, its phosphorylation was lower in the mSOD spinal cord (alphaS724, 53% decrease; gammaS662, 46% decrease). In spinal cords of affected mSOD mice, we also observed elevated expression of casein kinase 1delta (CK1delta, 157% increase), JAK2 (84% increase), PKA (183% increase), protein kinase C (PKC) delta (123% increase), p124 PKC micro (142% increase), and RhoA kinase (221% increase), and enhanced phosphorylation of extracellular regulated kinases 1 (ERK1, T202/Y204, 90% increase), and 2 (ERK2, T185/Y187, 73% increase), p38 MAP kinase (T180/Y182, 1570% increase), and PKBalpha (T308, 154% increase; S473, 61% increase). There was also reduced phosphorylation of RB (S780, 45% decrease; S807/S811, 65% decrease), Src (Y418, 63% decrease) and p40 SAPK/JNKbeta (T183/Y185, 43% decrease). Variability in the expression of kinases, phosphatases and phosphorylation of their substrates was observed even in mutant animals having a similar phenotype. The expression and phosphorylation

  20. Detection of bacterial phosphatase activity by means of an original and simple test.

    PubMed Central

    Satta, G; Grazi, G; Varaldo, P E; Fontana, R

    1979-01-01

    A new test for the detection of bacterial phosphatase activity has been devised. The test is performed using agar media containing both methyl green (MG) and phenolphthalein diphosphate (PDP); in these media phosphatase-producing strains grow deep-green-stained colonies whereas non-producing strains do not. A total of 739 different strains were tested, including 593 staphylococci, 95 micrococci, 11 streptococci, 10 corynebacteria, 14 enterobacteria, and 16 candidae. All strains found phosphatase-positive according to the conventional phosphatase test displayed deep-green-stained colonies on MG-PDP media, whereas all phosphatase-negative strains showed unstained colonies on the same media. The main advantages of the present phosphatase test as compared with other conventional ones are that it is more simple to perform, it can reveal the phosphatase activity of colonies grown in deep agar, and can be incorporated into commercial multitest kits. PMID:87403

  1. Cytochemical characterization of yolk granule acid phosphatase during early development of the oyster Crassostrea gigas (Thunberg)

    NASA Astrophysics Data System (ADS)

    Wang, Yiyan; Sun, Hushan; Wang, Yanjie; Yan, Dongchun; Wang, Lei

    2015-03-01

    In this study, a cytochemical method and transmission electron microscopy was used to examine acid phosphatase activities of yolk granules throughout the early developmental stages of the Pacific oyster Crassostrea gigas. This study aimed to investigate the dynamic change of yolk granule acid phosphatase, and the mechanisms underlying its involvement in yolk degradation during the early developmental stages of molluscs. Three types of yolk granules (YGI, YGII, and YGIII) that differed in electron density and acid phosphatase reaction were identified in early cleavage, morula, blastula, gastrula, trochophore, and veliger stages. The morphological heterogeneities of the yolk granules were related to acid phosphatase activity and degrees of yolk degradation, indicating the association of acid phosphatase with yolk degradation in embryos and larvae of molluscs. Fusion of yolk granules was observed during embryogenesis and larval development of C. gigas. The fusion of YGI (free of acid phosphatase reaction) with YGII (rich in acid phosphatase reaction) could be the way by which yolk degradation is triggered.

  2. Human HAD phosphatases: structure, mechanism, and roles in health and disease.

    PubMed

    Seifried, Annegrit; Schultz, Jörg; Gohla, Antje

    2013-01-01

    Phosphatases of the haloacid dehalogenase (HAD) superfamily of hydrolases are an ancient and very large class of enzymes that have evolved to dephosphorylate a wide range of low- and high molecular weight substrates with often exquisite specificities. HAD phosphatases constitute approximately one-fifth of all human phosphatase catalytic subunits. While the overall sequence similarity between HAD phosphatases is generally very low, family members can be identified based on the presence of a characteristic Rossmann-like fold and the active site sequence DxDx(V/T). HAD phosphatases employ an aspartate residue as a nucleophile in a magnesium-dependent phosphoaspartyl transferase reaction. Although there is genetic evidence demonstrating a causal involvement of some HAD phosphatases in diseases such as cancer, cardiovascular, metabolic and neurological disorders, the physiological roles of many of these enzymes are still poorly understood. In this review, we discuss the structure and evolution of human HAD phosphatases, and summarize their known functions in health and disease.

  3. Protein Phosphatase 2A Signaling in Human Prostate Cancer

    DTIC Science & Technology

    2014-08-01

    We observed that LNCaP cells under steroid-depleted condition had ~4.3 fold decreased cell growth as compared to the cells grown in regular ...with ceramide decreased their growth (~34%) in regular media, whereas in steroid-deprived media, ceramide treatment showed even more potent effect...androgen independent) under regular or steroid-reduced conditions. Our immu- noblot and in vitro phosphatase activity data show that both the

  4. Targeting the Reversibly Oxidized Protein Tyrosine Phosphatase Superfamily

    PubMed Central

    Boivin, Benoit; Yang, Ming; Tonks, Nicholas K.

    2010-01-01

    Controlled production of reactive oxygen species leads to reversible oxidation of protein tyrosine phosphatases (PTPs) and has emerged as an important tier of regulation over phosphorylation-dependent signal transduction. We present a modified cysteinyl-labeling assay that detects reversible oxidation of members of each of the different PTP subclasses. Here, we describe the methods for enriching reversibly oxidized PTPs from complex protein extracts, illustrating the procedure in IMR90 fibroblasts. PMID:20807953

  5. Membrane interaction and functional plasticity of inositol polyphosphate 5-phosphatases.

    PubMed

    Braun, Werner; Schein, Catherine H

    2014-05-06

    In this issue of Structure, Trésaugues and colleagues determined the interaction of membrane-bound phosphoinositides with three clinically significant human inositol polyphosphate 5-phosphatases (I5Ps). A comparison to the structures determined with soluble substrates revealed differences in the binding mode and suggested how the I5Ps and apurinic endonuclease (APE1) activities evolved from the same metal-binding active center.

  6. Impact of ionic aluminium on extracellular phosphatases in acidified lakes.

    PubMed

    Bittl, T; Vrba, J; Nedoma, J; Kopácek, J

    2001-09-01

    We studied direct inhibiting effects of aluminium (Al) on extracellular phosphatases produced by the plankton of acidified lakes in the Bohemian Forest. In laboratory experiments we tested the effect of different Al concentrations (0-1000 microg l(-1)) on kinetic parameters of acid phosphatases (pH optimum approximately 5.0) at pH between 4.5 and 5.2. We observed a significant reduction of an apparent substrate affinity at Al concentrations between 300 and 1000 microg l(-1) at pH 4.5 and 4.8 (but not at 5.2). In contrast, maximum acid phosphatase activity (AcPA) remained unchanged. Such behaviour of saturation kinetics is compatible with the assumption that ionic Al acts as a competitive inhibitor of acid phosphatases. To decide whether the observed Al effects could be explained alternatively by complexation of Al with substrate, we tested statistically the best fits of data with both possible models (competitive versus complexation). Experimental results supported the competitive hypothesis rather than the complexation model suggested originally by some authors. Furthermore, we tested the Al effect within a wide range of pH from 4.0 to 6.0. For pH values < 5.2, the results of an Al-pH matrix experiment gave a more detailed picture: the higher the Al concentration, the wider the pH range in which Al could negatively affect AcPA. The ecological ramifications of this effect were evaluated in the context of field AcPA data on three strongly acidified lakes.

  7. Hypervalent Organochalcogenanes as Inhibitors of Protein Tyrosine Phosphatases

    PubMed Central

    Piovan, Leandro; Wu, Li; Zhang, Zhong-Yin; Andrade, Leandro H.

    2011-01-01

    A series of organochalcogenanes was synthesized and evaluated as protein tyrosine phosphatases (PTPs) inhibitors. The results indicate that organochalcogenanes inactivate the PTPs in a time- and concentration-dependent fashion, most likely through covalent modification of the active site sulfur-moiety by the chalcogen atom. Consequently, organochalcogenanes represent a new class of mechanism-based probes to modulate the PTP-mediated cellular processes. PMID:21240419

  8. phoD Alkaline Phosphatase Gene Diversity in Soil

    PubMed Central

    Kertesz, Michael A.; Bünemann, Else K.

    2015-01-01

    Phosphatase enzymes are responsible for much of the recycling of organic phosphorus in soils. The PhoD alkaline phosphatase takes part in this process by hydrolyzing a range of organic phosphoesters. We analyzed the taxonomic and environmental distribution of phoD genes using whole-genome and metagenome databases. phoD alkaline phosphatase was found to be spread across 20 bacterial phyla and was ubiquitous in the environment, with the greatest abundance in soil. To study the great diversity of phoD, we developed a new set of primers which targets phoD genes in soil. The primer set was validated by 454 sequencing of six soils collected from two continents with different climates and soil properties and was compared to previously published primers. Up to 685 different phoD operational taxonomic units were found in each soil, which was 7 times higher than with previously published primers. The new primers amplified sequences belonging to 13 phyla, including 71 families. The most prevalent phoD genes identified in these soils were affiliated with the orders Actinomycetales (13 to 35%), Bacillales (1 to 29%), Gloeobacterales (1 to 18%), Rhizobiales (18 to 27%), and Pseudomonadales (0 to 22%). The primers also amplified phoD genes from additional orders, including Burkholderiales, Caulobacterales, Deinococcales, Planctomycetales, and Xanthomonadales, which represented the major differences in phoD composition between samples, highlighting the singularity of each community. Additionally, the phoD bacterial community structure was strongly related to soil pH, which varied between 4.2 and 6.8. These primers reveal the diversity of phoD in soil and represent a valuable tool for the study of phoD alkaline phosphatase in environmental samples. PMID:26253682

  9. Low serum alkaline phosphatase activity in Kikuchi-Fujimoto disease

    PubMed Central

    Inamo, Yasuji

    2017-01-01

    Abstract Various laboratory findings are helpful in making a diagnosis of Kikuchi-Fujimoto disease (KFD); however, they are not specific. We found decreased serum alkaline phosphatase (SAP) activity in children with KFD. The levels of SAP fell in the acute phase and recovered during convalescence. We conclude that low SAP activity is a characteristic of KFD and may be an auxiliary diagnostic marker for the disease. PMID:28248884

  10. The Aspergillus fumigatus sitA Phosphatase Homologue Is Important for Adhesion, Cell Wall Integrity, Biofilm Formation, and Virulence.

    PubMed

    Bom, Vinícius Leite Pedro; de Castro, Patrícia Alves; Winkelströter, Lizziane K; Marine, Marçal; Hori, Juliana I; Ramalho, Leandra Naira Zambelli; dos Reis, Thaila Fernanda; Goldman, Maria Helena S; Brown, Neil Andrew; Rajendran, Ranjith; Ramage, Gordon; Walker, Louise A; Munro, Carol A; Rocha, Marina Campos; Malavazi, Iran; Hagiwara, Daisuke; Goldman, Gustavo H

    2015-08-01

    Aspergillus fumigatus is an opportunistic pathogenic fungus able to infect immunocompromised patients, eventually causing disseminated infections that are difficult to control and lead to high mortality rates. It is important to understand how the signaling pathways that regulate these factors involved in virulence are orchestrated. Protein phosphatases are central to numerous signal transduction pathways. Here, we characterize the A. fumigatus protein phosphatase 2A SitA, the Saccharomyces cerevisiae Sit4p homologue. The sitA gene is not an essential gene, and we were able to construct an A. fumigatus null mutant. The ΔsitA strain had decreased MpkA phosphorylation levels, was more sensitive to cell wall-damaging agents, had increased β-(1,3)-glucan and chitin, was impaired in biofilm formation, and had decreased protein kinase C activity. The ΔsitA strain is more sensitive to several metals and ions, such as MnCl2, CaCl2, and LiCl, but it is more resistant to ZnSO4. The ΔsitA strain was avirulent in a murine model of invasive pulmonary aspergillosis and induces an augmented tumor necrosis factor alpha (TNF-α) response in mouse macrophages. These results stress the importance of A. fumigatus SitA as a possible modulator of PkcA/MpkA activity and its involvement in the cell wall integrity pathway.

  11. The Aspergillus fumigatus sitA Phosphatase Homologue Is Important for Adhesion, Cell Wall Integrity, Biofilm Formation, and Virulence

    PubMed Central

    Bom, Vinícius Leite Pedro; de Castro, Patrícia Alves; Winkelströter, Lizziane K.; Marine, Marçal; Hori, Juliana I.; Ramalho, Leandra Naira Zambelli; dos Reis, Thaila Fernanda; Goldman, Maria Helena S.; Brown, Neil Andrew; Rajendran, Ranjith; Ramage, Gordon; Walker, Louise A.; Munro, Carol A.; Rocha, Marina Campos; Malavazi, Iran; Hagiwara, Daisuke

    2015-01-01

    Aspergillus fumigatus is an opportunistic pathogenic fungus able to infect immunocompromised patients, eventually causing disseminated infections that are difficult to control and lead to high mortality rates. It is important to understand how the signaling pathways that regulate these factors involved in virulence are orchestrated. Protein phosphatases are central to numerous signal transduction pathways. Here, we characterize the A. fumigatus protein phosphatase 2A SitA, the Saccharomyces cerevisiae Sit4p homologue. The sitA gene is not an essential gene, and we were able to construct an A. fumigatus null mutant. The ΔsitA strain had decreased MpkA phosphorylation levels, was more sensitive to cell wall-damaging agents, had increased β-(1,3)-glucan and chitin, was impaired in biofilm formation, and had decreased protein kinase C activity. The ΔsitA strain is more sensitive to several metals and ions, such as MnCl2, CaCl2, and LiCl, but it is more resistant to ZnSO4. The ΔsitA strain was avirulent in a murine model of invasive pulmonary aspergillosis and induces an augmented tumor necrosis factor alpha (TNF-α) response in mouse macrophages. These results stress the importance of A. fumigatus SitA as a possible modulator of PkcA/MpkA activity and its involvement in the cell wall integrity pathway. PMID:25911225

  12. From Alpha to Omega

    ERIC Educational Resources Information Center

    Czaja, Paul Clement

    2006-01-01

    The Alpha point of the authors' life as a Montessori educator began in 1959, when he was a graduate student studying philosophy at Fordham University in the Bronx, New York. While studying the works of the great American philosopher William James, the author came across the writings of Maria Montessori and immediately became captivated by her…

  13. [alpha]-Oxocarboxylic Acids

    ERIC Educational Resources Information Center

    Kerber, Robert C.; Fernando, Marian S.

    2010-01-01

    Several [alpha]-oxocarboxylic acids play key roles in metabolism in plants and animals. However, there are inconsistencies between the structures as commonly portrayed and the reported acid ionization constants, which result because the acids are predominantly hydrated in aqueous solution; that is, the predominant form is RC(OH)[subscript 2]COOH…

  14. Alpha Antihydrogen Experiment

    NASA Astrophysics Data System (ADS)

    Fujiwara, M. C.; Andresen, G. B.; Ashkezari, M. D.; Baquero-Ruiz, M.; Bertsche, W.; Bray, C. C.; Butler, E.; Cesar, C. L.; Chapman, S.; Charlton, M.; Cesar, C. L.; Fajans, J.; Friesen, T.; Gill, D. R.; Hangst, J. S.; Hardy, W. N.; Hayano, R. S.; Hayden, M. E.; Humphries, A. J.; Hydomako, R.; Jonsell, S.; Kurchaninov, L.; Lambo, R.; Madsen, N.; Menary, S.; Nolan, P.; Olchanski, K.; Olin, A.; Povilus, A.; Pusa, P.; Robicheaux, F.; Sarid, E.; Silveira, D. M.; So, C.; Storey, J. W.; Thompson, R. I.; van der Werf, D. P.; Wilding, D.; Wurtele, J. S.; Yamazaki, Y.

    2011-12-01

    ALPHA is an experiment at CERN, whose ultimate goal is to perform a precise test of CPT symmetry with trapped antihydrogen atoms. After reviewing the motivations, we discuss our recent progress toward the initial goal of stable trapping of antihydrogen, with some emphasis on particle detection techniques.

  15. From Alpha to Omega

    ERIC Educational Resources Information Center

    Czaja, Paul Clement

    2006-01-01

    The Alpha point of the authors' life as a Montessori educator began in 1959, when he was a graduate student studying philosophy at Fordham University in the Bronx, New York. While studying the works of the great American philosopher William James, the author came across the writings of Maria Montessori and immediately became captivated by her…

  16. [alpha]-Oxocarboxylic Acids

    ERIC Educational Resources Information Center

    Kerber, Robert C.; Fernando, Marian S.

    2010-01-01

    Several [alpha]-oxocarboxylic acids play key roles in metabolism in plants and animals. However, there are inconsistencies between the structures as commonly portrayed and the reported acid ionization constants, which result because the acids are predominantly hydrated in aqueous solution; that is, the predominant form is RC(OH)[subscript 2]COOH…

  17. The phosphatase calcineurin regulates pathological TDP-43 phosphorylation.

    PubMed

    Liachko, Nicole F; Saxton, Aleen D; McMillan, Pamela J; Strovas, Timothy J; Currey, Heather N; Taylor, Laura M; Wheeler, Jeanna M; Oblak, Adrian L; Ghetti, Bernardino; Montine, Thomas J; Keene, C Dirk; Raskind, Murray A; Bird, Thomas D; Kraemer, Brian C

    2016-10-01

    Detergent insoluble inclusions of TDP-43 protein are hallmarks of the neuropathology in over 90 % of amyotrophic lateral sclerosis (ALS) cases and approximately half of frontotemporal dementia (FTLD-TDP) cases. In TDP-43 proteinopathy disorders, lesions containing aggregated TDP-43 protein are extensively post-translationally modified, with phosphorylated TDP-43 (pTDP) being the most consistent and robust marker of pathological TDP-43 deposition. Abnormally phosphorylated TDP-43 has been hypothesized to mediate TDP-43 toxicity in many neurodegenerative disease models. To date, several different kinases have been implicated in the genesis of pTDP, but no phosphatases have been shown to reverse pathological TDP-43 phosphorylation. We have identified the phosphatase calcineurin as an enzyme binding to and catalyzing the removal of pathological C-terminal phosphorylation of TDP-43 in vitro. In C. elegans models of TDP-43 proteinopathy, genetic elimination of calcineurin results in accumulation of excess pTDP, exacerbated motor dysfunction, and accelerated neurodegenerative changes. In cultured human cells, treatment with FK506 (tacrolimus), a calcineurin inhibitor, results in accumulation of pTDP species. Lastly, calcineurin co-localizes with pTDP in degenerating areas of the central nervous system in subjects with FTLD-TDP and ALS. Taken together, these findings suggest calcineurin acts on pTDP as a phosphatase in neurons. Furthermore, patient treatment with calcineurin inhibitors may have unappreciated adverse neuropathological consequences.

  18. Phosphoregulators: Protein Kinases and Protein Phosphatases of Mouse

    PubMed Central

    Forrest, Alistair R.R.; Ravasi, Timothy; Taylor, Darrin; Huber, Thomas; Hume, David A.; Grimmond, Sean

    2003-01-01

    With the completion of the human and mouse genome sequences, the task now turns to identifying their encoded transcripts and assigning gene function. In this study, we have undertaken a computational approach to identify and classify all of the protein kinases and phosphatases present in the mouse gene complement. A nonredundant set of these sequences was produced by mining Ensembl gene predictions and publicly available cDNA sequences with a panel of InterPro domains. This approach identified 561 candidate protein kinases and 162 candidate protein phosphatases. This cohort was then analyzed using TribeMCL protein sequence similarity clustering followed by CLUSTALV alignment and hierarchical tree generation. This approach allowed us to (1) distinguish between true members of the protein kinase and phosphatase families and enzymes of related biochemistry, (2) determine the structure of the families, and (3) suggest functions for previously uncharacterized members. The classifications obtained by this approach were in good agreement with previous schemes and allowed us to demonstrate domain associations with a number of clusters. Finally, we comment on the complementary nature of cDNA and genome-based gene detection and the impact of the FANTOM2 transcriptome project. PMID:12819143

  19. PTPL1: a large phosphatase with a split personality.

    PubMed

    Abaan, Ogan D; Toretsky, Jeffrey A

    2008-06-01

    Protein tyrosine phosphatase, PTPL1, (also known as PTPN13, FAP-1, PTP-BAS, PTP1E) is a non-receptor type PTP and, at 270 kDa, is the largest phosphatase within this group. In addition to the well-conserved PTP domain, PTPL1 contains at least 7 putative macromolecular interaction domains. This structural complexity indicates that PTPL1 may modulate diverse cellular functions, perhaps exerting both positive and negative effects. In accordance with this idea, while certain studies suggest that PTPL1 can act as a tumor-promoting gene other experimental studies have suggested that PTPL1 may function as a tumor suppressor. The role of PTPL1 in the cancer cell is therefore likely to be both complex and context dependent with possible roles including the modulation of growth, stress-response, and cytoskeletal remodeling pathways. Understanding the nature of molecular complexes containing PTPL1, its interaction partners, substrates, regulation and subcellular localization are key to unraveling the complex personality of this protein phosphatase.

  20. Crystallization of recombinant Haemophilus influenzaee (P4) acid phosphatase

    SciTech Connect

    Ou, Zhonghui; Felts, Richard L.; Reilly, Thomas J.; Nix, Jay C.; Tanner, John J.

    2006-05-01

    Lipoprotein e (P4) is a class C acid phosphatase and a potential vaccine candidate for nontypeable H. influenzae infections. This paper reports the crystallization of recombinant e (P4) and the acquisition of a 1.7 Å resolution native X-ray diffraction data set. Haemophilus influenzae infects the upper respiratory tract of humans and can cause infections of the middle ear, sinuses and bronchi. The virulence of the pathogen is thought to involve a group of surface-localized macromolecular components that mediate interactions at the host–pathogen interface. One of these components is lipoprotein e (P4), which is a class C acid phosphatase and a potential vaccine candidate for nontypeable H. influenzae infections. This paper reports the crystallization of recombinant e (P4) and the acquisition of a 1.7 Å resolution native X-ray diffraction data set. The space group is P4{sub 2}2{sub 1}2, with unit-cell parameters a = 65.6, c = 101.4 Å, one protein molecule per asymmetric unit and 37% solvent content. This is the first report of the crystallization of a class C acid phosphatase.

  1. Acid Phosphatase Development during Ripening of Avocado 1

    PubMed Central

    Sacher, Joseph A.

    1975-01-01

    The activity and subcellular distribution of acid phosphatase were assayed during ethylene-induced ripening of whole fruit or thick slices of avocado (Persea americana Mill. var. Fuerte and Hass). The activity increased up to 30-fold during ripening in both the supernatant fraction and the Triton X-100 extract of the precipitate of a 30,000g centrifugation of tissue homogenates from whole fruit or slices ripening in moist air. Enzyme activity in the residual precipitate after Triton extraction remained constant. The development of acid phosphatase in thick slices ripened in moist air was similar to that in intact fruit, except that enzyme development and ripening were accelerated about 24 hours in the slices. The increase in enzyme activity that occurs in slices ripening in moist air was inhibited when tissue sections were infiltrated with solutions, by aspiration for 2 minutes or by soaking for 2 hours, anytime 22 hours or more after addition of ethylene. This inhibition was independent of the presence or absence of cycloheximide or sucrose (0.3-0.5m). However, the large decline in enzyme activity in the presence of cycloheximide, as compared with the controls, indicated that synthesis of acid phosphatase was occurring at all stages of ripening. PMID:16659087

  2. The role of phosphatases in the initiation of skeletal mineralization.

    PubMed

    Millán, José Luis

    2013-10-01

    Endochondral ossification is a carefully orchestrated process mediated by promoters and inhibitors of mineralization. Phosphatases are implicated, but their identities and functions remain unclear. Mutations in the tissue-nonspecific alkaline phosphatase (TNAP) gene cause hypophosphatasia, a heritable form of rickets and osteomalacia, caused by an arrest in the propagation of hydroxyapatite (HA) crystals onto the collagenous extracellular matrix due to accumulation of extracellular inorganic pyrophosphate (PPi), a physiological TNAP substrate and a potent calcification inhibitor. However, TNAP knockout (Alpl(-/-)) mice are born with a mineralized skeleton and have HA crystals in their chondrocyte- and osteoblast-derived matrix vesicles (MVs). We have shown that PHOSPHO1, a soluble phosphatase with specificity for two molecules present in MVs, phosphoethanolamine and phosphocholine, is responsible for initiating HA crystal formation inside MVs and that PHOSPHO1 and TNAP have nonredundant functional roles during endochondral ossification. Double ablation of PHOSPHO1 and TNAP function leads to the complete absence of skeletal mineralization and perinatal lethality, despite normal systemic phosphate and calcium levels. This strongly suggests that the Pi needed for initiation of MV-mediated mineralization is produced locally in the perivesicular space. As both TNAP and nucleoside pyrophosphohydrolase-1 (NPP1) behave as potent ATPases and pyrophosphatases in the MV compartment, our current model of the mechanisms of skeletal mineralization implicate intravesicular PHOSPHO1 function and Pi influx into MVs in the initiation of mineralization and the functions of TNAP and NPP1 in the extravesicular progression of mineralization.

  3. Isolation of Lysophosphatidic Acid Phosphatase from Developing Peanut Cotyledons1

    PubMed Central

    Shekar, Sunil; Tumaney, Ajay W.; Rao, T.J.V. Sreenivasa; Rajasekharan, Ram

    2002-01-01

    The soluble fraction of immature peanut (Arachis hypogaea) was capable of dephosphorylating [3H]lysophosphatidic acid (LPA) to generate monoacylglycerol (MAG). The enzyme responsible for the generation of MAG, LPA phosphatase, has been identified in plants and purified by successive chromatography separations on octyl-Sepharose, Blue Sepharose, Superdex-75, and heparin-agarose to apparent homogeneity from developing peanuts. This enzyme was purified 5,048-fold to a final specific activity of 858 nmol min−1 mg−1. The enzyme has a native molecular mass of approximately 39 kD determined by gel filtration and migrates as a single band on sodium dodecyl sulfate-polyacrylamide gel electrophoresis with a subunit molecular mass of 39 ± 1.5 kD. The Km values for oleoyl-, stearoyl-, and palmitoyl-sn-glycerol-3-phosphate were determined to be 28.6, 39.3, and 47.9 μm, respectively. The LPA phosphatase was specific to LPA and did not utilize any other substrate such as glycerol-3-phosphate, phosphatidic acid, or p-nitrophenylphosphate. The enzyme activity was stimulated by the low concentrations of detergents such as Triton X-100 and octylglucoside. Cations had no effect on the enzyme activity. Fatty acids, sphingosine, and sphingomyelin at low concentrations stimulated the enzyme activity. The identification of LPA phosphatase in plants demonstrates the existence of MAG biosynthetic machinery in plants. PMID:11891254

  4. Phosphatidate Phosphatase, a Key Regulator of Lipid Homeostasis

    PubMed Central

    Pascual, Florencia; Carman, George M.

    2012-01-01

    Yeast Pah1p phosphatidate phosphatase (PAP) catalyzes the penultimate step in the synthesis of triacylglycerol. PAP plays a crucial role in lipid homeostasis by controlling the relative proportions of its substrate phosphatidate and its product diacylglycerol. The cellular amounts of these lipid intermediates influence the synthesis of triacylglycerol and the pathways by which membrane phospholipids are synthesized. Physiological functions affected by PAP activity include phospholipid synthesis gene expression, nuclear/endoplasmic reticulum membrane growth, lipid droplet formation, and vacuole homeostasis and fusion. Yeast lacking Pah1p PAP activity are acutely sensitive to fatty acid-induced toxicity and exhibit respiratory deficiency. PAP is distinguished in its cellular location, catalytic mechanism, and physiological functions from Dpp1p and Lpp1p lipid phosphate phosphatases that utilize a variety of substrates that include phosphatidate. Phosphorylation/dephosphorylation is a major mechanism by which Pah1p PAP activity is regulated. Pah1p is phosphorylated by cytosolic-associated Pho85p-Pho80p, Cdc28p-cyclin B, and protein kinase A and is dephosphorylated by the endoplasmic reticulum-associated Nem1p-Spo7p phosphatase. The dephosphorylation of Pah1p stimulates PAP activity and facilitates the association with the membrane/phosphatidate allowing for its reaction and triacylglycerol synthesis. PMID:22910056

  5. Phosphatidate phosphatase regulates membrane phospholipid synthesis via phosphatidylserine synthase.

    PubMed

    Carman, George M; Han, Gil-Soo

    2017-08-16

    The yeast Saccharomyces cerevisiae serves as a model eukaryote to elucidate the regulation of lipid metabolism. In exponentially growing yeast, a diverse set of membrane lipids are synthesized from the precursor phosphatidate via the liponucleotide intermediate CDP-diacylglycerol. As cells exhaust nutrients and progress into the stationary phase, phosphatidate is channeled via diacylglycerol to the synthesis of triacylglycerol. The CHO1-encoded phosphatidylserine synthase, which catalyzes the committed step in membrane phospholipid synthesis via CDP-diacylglycerol, and the PAH1-encoded phosphatidate phosphatase, which catalyzes the committed step in triacylglycerol synthesis are regulated throughout cell growth by genetic and biochemical mechanisms to control the balanced synthesis of membrane phospholipids and triacylglycerol. The loss of phosphatidate phosphatase activity (e.g., pah1Δ mutation) increases the level of phosphatidate and its conversion to membrane phospholipids by inducing Cho1 expression and phosphatidylserine synthase activity. The regulation of the CHO1 expression is mediated through the inositol-sensitive upstream activation sequence (UASINO), a cis-acting element for the phosphatidate-controlled Henry (Ino2-Ino4/Opi1) regulatory circuit. Consequently, phosphatidate phosphatase activity regulates phospholipid synthesis through the transcriptional regulation of the phosphatidylserine synthase enzyme. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Crosstalk between kinases, phosphatases and miRNAs in cancer.

    PubMed

    Abrantes, Júlia L F; Tornatore, Thaís F; Pelizzaro-Rocha, Karin J; de Jesus, Marcelo B; Cartaxo, Rodrigo T; Milani, Renato; Ferreira-Halder, Carmen V

    2014-12-01

    Reversible phosphorylation of proteins, performed by kinases and phosphatases, is the major post translational protein modification in eukaryotic cells. This intracellular event represents a critical regulatory mechanism of several signaling pathways and can be related to a vast array of diseases, including cancer. Cancer research has produced increasing evidence that kinase and phosphatase activity can be compromised by mutations and also by miRNA silencing, performed by small non-coding and endogenously produced RNA molecules that lead to translational repression. miRNAs are believed to target about one-third of human mRNAs while a single miRNA may target about 200 transcripts simultaneously. Regulation of the phosphorylation balance by miRNAs has been a topic of intense research over the last years, spanning topics going as far as cancer aggressiveness and chemotherapy resistance. By addressing recent studies that have shown miRNA expression patterns as phenotypic signatures of cancers and how miRNA influence cellular processes such as apoptosis, cell cycle control, angiogenesis, inflammation and DNA repair, we discuss how kinases, phosphatases and miRNAs cooperatively act in cancer biology.

  7. An alkaline phosphatase reporter for use in Clostridium difficile.

    PubMed

    Edwards, Adrianne N; Pascual, Ricardo A; Childress, Kevin O; Nawrocki, Kathryn L; Woods, Emily C; McBride, Shonna M

    2015-04-01

    Clostridium difficile is an anaerobic, Gram-positive pathogen that causes severe gastrointestinal disease in humans and other mammals. C. difficile is notoriously difficult to work with and, until recently, few tools were available for genetic manipulation and molecular analyses. Despite the recent advances in the field, there is no simple or cost-effective technique for measuring gene transcription in C. difficile other than direct transcriptional analyses (e.g., quantitative real-time PCR and RNA-seq), which are time-consuming, expensive and difficult to scale-up. We describe the development of an in vivo reporter assay that can provide qualitative and quantitative measurements of C. difficile gene expression. Using the Enterococcus faecalis alkaline phosphatase gene, phoZ, we measured expression of C. difficile genes using a colorimetric alkaline phosphatase assay. We show that inducible alkaline phosphatase activity correlates directly with native gene expression. The ability to analyze gene expression using a standard reporter is an important and critically needed tool to study gene regulation and design genetic screens for C. difficile and other anaerobic clostridia. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. In vitro enzymatic assays of protein tyrosine phosphatase 1B.

    PubMed

    Lubben, T; Clampit, J; Stashko, M; Trevillyan, J; Jirousek, M R

    2001-08-01

    Many hormone or growth factor receptors signal via the activation of protein-tyrosine kinases and phosphatases. Alteration of the phosphorylation state of tyrosine residues in certain proteins can directly regulate enzyme activity or cause formation of protein complexes necessary for transducing intracellular signals. Genetic and biochemical evidence also implicates protein-tyrosine phosphatases in several disease processes, including negative regulation of insulin receptor signaling at the level of the insulin receptor and perhaps in signaling at the IRS-1 level. The expression of protein tyrosine phosphatase-1B (PTP1B) is elevated in muscle and adipose tissue in insulin-resistant states both in man and rodents suggesting that PTP1B may play a role in the insulin-resistant state associated with diabetes and obesity. As described in this unit, PTP1B activity can be determined with the small molecule substrate, p-nitrophenyl phosphate (pNPP), in which the cleavage of the phosphate results in production of p-nitrophenol (pNP) and an increase in absorbance at 405 nm. Alternatively, PTP1B activity can be measured as described using model phosphotyrosyl-containing peptide substrates in which the release of free phosphate from the peptide is determined using a malachite green colorimetric assay.

  9. Calcitonin releases acid phosphatase from rat ventral prostate explants.

    PubMed

    Latif, A; Nakhla, A M

    1994-01-01

    Inclusion of salmon calcitonin in the culture medium of rat ventral prostate explants diminished l-tartarate-sensitive acid phosphatase activity in the tissues with a concomitant increment of the enzyme activity in the medium. The effect of the hormone was dose-dependent for a dose range of 10(-12)-10(-6) M. Acid phosphatase activity in prostate explants decreased from 38.6 +/- 3.5 to 20.5 +/- 2.8, whereas it increased from 0.60 +/- 0.15 to 2.80 +/- 0.40 nmol p-nitrophenol liberated/mg protein/30 min in the culture medium. Tissues exposed to 10(-6) M salmon calcitonin had higher acetylcholinesterase activity (8.8 +/- 0.7) than non-exposed ones (6.2 +/- 0.5 mumol substrate hydrolyzed/g tissue/min). These results suggest that locally produced calcitonin causes a release for prostatic acid phosphatase from prostate tissues possibly through its interaction with the cholinergic system.

  10. Physiological aspects of alkaline phosphatase in selected cyanobacteria.

    PubMed

    Doonan, B B; Jensen, T E

    1980-01-01

    The alkaline phosphatase of Plectonema boryanum shows a considerable increase in activity following placement of the cells in a phosphate free medium. Five days of phosphate starvation result in a 14-fold increase of alkaline phosphatase activity. Growth in the presence of inhibitors of transcription and translation indicate that the synthesis of the enzyme is de novo. Orthophosphate causes an immediate inhibition of enzyme activity. Enzyme was extracted from P. boryanum with lysozyme or polymyxin B treatment in order to make comparative studies of cell bound and cell free enzyme. Of several enzyme specific inhibitors tested, mercuric chloride was the most effective. Temperature studies showed that the cell bound enzyme was most active at 40 degrees C while the cell free enzyme was most active at 70 degrees C. The pH optimum was 9 for the cell free enzyme, and 8.8 for the cell bound. The enzyme was tested to determine if it could hydrolyse a number of different organic compounds. It hydrolysed p-nitrophenol phosphate 100%, fructose-6-phosphate 45%, beta-glycerol phosphate 25% and other compounds to a lesser degree. Of seventeen other Cyanobacteria tested for alkaline phosphatase, all were positive, and of these eleven were inducible for the enzyme. Ten of the isolates released some of the enzyme into the culture medium. Michaelis constants for the enzyme were also determined.

  11. Radiation inactivation analysis of rat liver microsomal glucose-6-phosphatase

    SciTech Connect

    Ness, G.C.; Sukalski, K.A.; Sample, C.E.; Pendleton, L.C.; McCreery, M.J.; Nordlie, R.C.

    1989-05-05

    Radiation inactivation analysis was utilized to estimate the sizes of the units catalyzing the various activities of hepatic microsomal glucose-6-phosphatase. This technique revealed that the target molecular weights for mannose-6-P phosphohydrolase, glucose-6-P phosphohydrolase, and carbamyl-P:glucose phosphotransferase activities were all about Mr 75,000. These results are consistent with the widely held view that all of these activities are catalyzed by the same protein or proteins. Certain observations indicate that the molecular organization of microsomal glucose-6-phosphatase is better described by the conformational hypothesis which envisions the enzyme as a single covalent structure rather than by the substrate transport model which requires the participation of several physically separate polypeptides. These include the findings: (1) that the target sizes for glucose-6-P phosphohydrolase and carbamyl-P:glucose phosphotransferase activities were not larger than that for mannose-6-P phosphohydrolase in intact microsomes and (2) that the target size for glucose-6-P phosphohydrolase in disrupted microsomes was not less than that observed in intact microsomes. These findings are most consistent with a model for glucose-6-phosphatase of a single polypeptide or a disulfide-linked dimer which spans the endoplasmic reticulum with the various activities of this multifunctional enzyme residing in distinct protein domains.

  12. Centromeric binding and activity of Protein Phosphatase 4

    PubMed Central

    Lipinszki, Zoltan; Lefevre, Stephane; Savoian, Matthew S.; Singleton, Martin R.; Glover, David M.; Przewloka, Marcin R.

    2015-01-01

    The cell division cycle requires tight coupling between protein phosphorylation and dephosphorylation. However, understanding the cell cycle roles of multimeric protein phosphatases has been limited by the lack of knowledge of how their diverse regulatory subunits target highly conserved catalytic subunits to their sites of action. Phosphoprotein phosphatase 4 (PP4) has been recently shown to participate in the regulation of cell cycle progression. We now find that the EVH1 domain of the regulatory subunit 3 of Drosophila PP4, Falafel (Flfl), directly interacts with the centromeric protein C (CENP-C). Unlike other EVH1 domains that interact with proline-rich ligands, the crystal structure of the Flfl amino-terminal EVH1 domain bound to a CENP-C peptide reveals a new target-recognition mode for the phosphatase subunit. We also show that binding of Flfl to CENP-C is required to bring PP4 activity to centromeres to maintain CENP-C and attached core kinetochore proteins at chromosomes during mitosis. PMID:25562660

  13. The role of serine/threonine protein phosphatases in exocytosis.

    PubMed Central

    Sim, Alistair T R; Baldwin, Monique L; Rostas, John A P; Holst, Jeff; Ludowyke, Russell I

    2003-01-01

    Modulation of exocytosis is integral to the regulation of cellular signalling, and a variety of disorders (such as epilepsy, hypertension, diabetes and asthma) are closely associated with pathological modulation of exocytosis. Emerging evidence points to protein phosphatases as key regulators of exocytosis in many cells and, therefore, as potential targets for the design of novel therapies to treat these diseases. Diverse yet exquisite regulatory mechanisms have evolved to direct the specificity of these enzymes in controlling particular cell processes, and functionally driven studies have demonstrated differential regulation of exocytosis by individual protein phosphatases. This Review discusses the evidence for the regulation of exocytosis by protein phosphatases in three major secretory systems, (1) mast cells, in which the regulation of exocytosis of inflammatory mediators plays a major role in the respiratory response to antigens, (2) insulin-secreting cells in which regulation of exocytosis is essential for metabolic control, and (3) neurons, in which regulation of exocytosis is perhaps the most complex and is essential for effective neurotransmission. PMID:12749763

  14. Hepatic effects of a methionine-choline-deficient diet in hepatocyte RXR{alpha}-null mice

    SciTech Connect

    Gyamfi, Maxwell Afari; Tanaka, Yuji; He Lin; Klaassen, Curtis D.; Wan, Y.-J.Y.

    2009-01-15

    Retinoid X receptor-{alpha} (RXR{alpha}) is an obligate partner for several nuclear hormone receptors that regulate important physiological processes in the liver. In this study the impact of hepatocyte RXR{alpha} deficiency on methionine and choline deficient (MCD) diet-induced steatosis, oxidative stress, inflammation, and hepatic transporters gene expression were examined. The mRNA of sterol regulatory element-binding protein (SREBP)-regulated genes, important for lipid synthesis, were not altered in wild type (WT) mice, but were increased 2.0- to 5.4-fold in hepatocyte RXR{alpha}-null (H-RXR{alpha}-null) mice fed a MCD diet for 14 days. Furthermore, hepatic mRNAs and proteins essential for fatty acid {beta}-oxidation were not altered in WT mice, but were decreased in the MCD diet-fed H-RXR{alpha}-null mice, resulting in increased hepatic free fatty acid levels. Cyp2e1 enzyme activity and lipid peroxide levels were induced only in MCD-fed WT mice. In contrast, hepatic mRNA levels of pro-inflammatory factors were increased only in H-RXR{alpha}-null mice fed the MCD diet. Hepatic uptake transporters Oatp1a1 and Oatp1b2 mRNA levels were decreased in WT mice fed the MCD diet, whereas the efflux transporter Mrp4 was increased. However, in the H-RXR{alpha}-null mice, the MCD diet only moderately decreased Oatp1a1 and induced both Oatp1a4 and Mrp4 gene expression. Whereas the MCD diet increased serum bile acid levels and alkaline phosphatase activity in both WT and H-RXR{alpha}-null mice, serum ALT levels were induced (2.9-fold) only in the H-RXR{alpha}-null mice. In conclusion, these data suggest a critical role for RXR{alpha} in hepatic fatty acid homeostasis and protection against MCD-induced hepatocyte injury.

  15. Influence of triethyl phosphate on phosphatase activity in shooting range soil: Isolation of a zinc-resistant bacterium with an acid phosphatase

    DOE PAGES

    Story, Sandra; Brigmon, Robin L.

    2016-12-19

    Phosphatase-mediated hydrolysis of organic phosphate may be a viable means of stabilizing heavy metals via precipitation as a metal phosphate in bioremediation applications. We investigated the effect of triethyl phosphate (TEP) on soil microbial-phosphatase activity in a heavy-metal contaminated soil. Gaseous TEP has been used at subsurface sites for bioremediation of organic contaminants but not applied in heavy-metal contaminated areas. Little is known about how TEP affects microbial activity in soils and it is postulated that TEP can serve as a phosphate source in nutrient-poor groundwater and soil/sediments. Over a 3-week period, TEP amendment to microcosms containing heavy-metal contaminated soilmore » resulted in increased activity of soil acid-phosphatase and repression of alkaline phosphatase, indicating a stimulatory effect on the microbial population. A soil-free enrichment of microorganisms adapted to heavy-metal and acidic conditions was derived from the TEP-amended soil microcosms using TEP as the sole phosphate source and the selected microbial consortium maintained a high acid-phosphatase activity with repression of alkaline phosphatase. Addition of 5 mM zinc to soil-free microcosms had little effect on acid phosphatase but inhibited alkaline phosphatase. One bacterial member from the consortium, identified as Burkholderia cepacia sp., expressed an acid-phosphatase activity uninhibited by high concentrations of zinc and produced a soluble, indigo pigment under phosphate limitation. The pigment was produced in a phosphate-free medium and was not produced in the presence of TEP or phosphate ion, indicative of purple acid-phosphatase types that are pressed by bioavailable phosphate. Finally, these results demonstrate that TEP amendment was bioavailable and increased overall phosphatase activity in both soil and soil-free microcosms supporting the possibility of positive outcomes in bioremediation applications.« less

  16. Influence of triethyl phosphate on phosphatase activity in shooting range soil: Isolation of a zinc-resistant bacterium with an acid phosphatase.

    PubMed

    Story, Sandra; Brigmon, Robin L

    2017-03-01

    Phosphatase-mediated hydrolysis of organic phosphate may be a viable means of stabilizing heavy metals via precipitation as a metal phosphate in bioremediation applications. We investigated the effect of triethyl phosphate (TEP) on soil microbial-phosphatase activity in a heavy-metal contaminated soil. Gaseous TEP has been used at subsurface sites for bioremediation of organic contaminants but not applied in heavy-metal contaminated areas. Little is known about how TEP affects microbial activity in soils and it is postulated that TEP can serve as a phosphate source in nutrient-poor groundwater and soil/sediments. Over a 3-week period, TEP amendment to microcosms containing heavy-metal contaminated soil resulted in increased activity of soil acid-phosphatase and repression of alkaline phosphatase, indicating a stimulatory effect on the microbial population. A soil-free enrichment of microorganisms adapted to heavy-metal and acidic conditions was derived from the TEP-amended soil microcosms using TEP as the sole phosphate source and the selected microbial consortium maintained a high acid-phosphatase activity with repression of alkaline phosphatase. Addition of 5mM zinc to soil-free microcosms had little effect on acid phosphatase but inhibited alkaline phosphatase. One bacterial member from the consortium, identified as Burkholderia cepacia sp., expressed an acid-phosphatase activity uninhibited by high concentrations of zinc and produced a soluble, indigo pigment under phosphate limitation. The pigment was produced in a phosphate-free medium and was not produced in the presence of TEP or phosphate ion, indicative of purple acid-phosphatase types that are pressed by bioavailable phosphate. These results demonstrate that TEP amendment was bioavailable and increased overall phosphatase activity in both soil and soil-free microcosms supporting the possibility of positive outcomes in bioremediation applications. Copyright © 2016. Published by Elsevier Inc.

  17. Influence of triethyl phosphate on phosphatase activity in shooting range soil: Isolation of a zinc-resistant bacterium with an acid phosphatase

    SciTech Connect

    Story, Sandra; Brigmon, Robin L.

    2016-12-19

    Phosphatase-mediated hydrolysis of organic phosphate may be a viable means of stabilizing heavy metals via precipitation as a metal phosphate in bioremediation applications. We investigated the effect of triethyl phosphate (TEP) on soil microbial-phosphatase activity in a heavy-metal contaminated soil. Gaseous TEP has been used at subsurface sites for bioremediation of organic contaminants but not applied in heavy-metal contaminated areas. Little is known about how TEP affects microbial activity in soils and it is postulated that TEP can serve as a phosphate source in nutrient-poor groundwater and soil/sediments. Over a 3-week period, TEP amendment to microcosms containing heavy-metal contaminated soil resulted in increased activity of soil acid-phosphatase and repression of alkaline phosphatase, indicating a stimulatory effect on the microbial population. A soil-free enrichment of microorganisms adapted to heavy-metal and acidic conditions was derived from the TEP-amended soil microcosms using TEP as the sole phosphate source and the selected microbial consortium maintained a high acid-phosphatase activity with repression of alkaline phosphatase. Addition of 5 mM zinc to soil-free microcosms had little effect on acid phosphatase but inhibited alkaline phosphatase. One bacterial member from the consortium, identified as Burkholderia cepacia sp., expressed an acid-phosphatase activity uninhibited by high concentrations of zinc and produced a soluble, indigo pigment under phosphate limitation. The pigment was produced in a phosphate-free medium and was not produced in the presence of TEP or phosphate ion, indicative of purple acid-phosphatase types that are pressed by bioavailable phosphate. Finally, these results demonstrate that TEP amendment was bioavailable and increased overall phosphatase activity in both soil and soil-free microcosms supporting the possibility of positive outcomes in bioremediation applications.

  18. Combination of alkaline phosphatase anti-alkaline phosphatase (APAAP)- and avidin-biotin-alkaline phosphatase complex (ABAP)-techniques for amplification of immunocytochemical staining of human testicular tissue.

    PubMed

    Davidoff, M S; Schulze, W; Holstein, A F

    1991-01-01

    An amplification procedure was developed for the visualization of antigens in human testis using monoclonal antibodies against desmin and vimentin. The technique combines the high sensitive and specific APAAP- and ABAP-methods. Depending on the quality of the antibodies used and the processing of the material prior to the immunocytochemical staining the amplification technique may be applied either as a single APAAP and ABAP- or as a double APAAP and ABAP-combination. Especially after the double amplification reaction a distinct increase of the staining intensity of the vimentin- (in Sertoli cells, myofibroblasts of the lamina propria, and fibroblasts of the interstitium) and desmin- (in myofibroblasts of the lamina propria and smooth muscle cells of the blood vessels) like immunoreactivity was observed. If different diazonium salts were used for the visualization of the alkaline phosphatase activity (e.g. Fast Red TR Salt, Fast Blue BB Salt) desmin- and vimentin-like immunoreactivity can be demonstrated in the same tissue section in a double sequential staining approach. For double staining, the alkaline phosphatase technique may be combined successfully with a technique or a combination that uses peroxidase as a marker.

  19. Radial-velocity variations in Alpha Ori, Alpha Sco, and Alpha Her

    SciTech Connect

    Smith, M.A.; Patten, B.M.; Goldberg, L. Computer Sciences Corp., Seabrook, MD Iowa State Univ., Ames )

    1989-12-01

    Radial-velocity observations of Alpha Ori, Alpha Sco A, and Alpha Her A are used to study radial-velocity periodicities in M supergiants. The data refer to several metallic lines in the H-alpha region and to H-alpha itself. It is shown that Alpha Ori and Alpha Sco A have cycle lengths of about 1 yr and semiamplitudes of 2 km/s. It is suggested that many semiregular red supergiant varibles such as Alpha Ori may be heading toward chaos. All three stars show short-term stochastic flucutations with an amplitude of 1-2 km/s. It is found that the long-term variability of H-alpha velocities may be a consequence of intermittent failed ejections. 58 refs.

  20. Purification and characterization of an extracellular alkaline phosphatase from Penicillium chrysogenum.

    PubMed

    Politino, M; Brown, J; Usher, J J

    1996-01-01

    An extracellular alkaline phosphatase from Penicillium chrysogenum was purified to homogeneity using DEAE ion-exchange chromatography and size exclusion chromatography. SDS-PAGE of the purified enzyme indicated a molecular weight of 58,000. The mobility of the native enzyme on a Superose 12 column suggests that the active form of the enzyme is a monomer. The enzyme catalyzes the hydrolysis of phosphate from a variety of substrates including p-nitrophenyl phosphate, alpha-naphthyl phosphate and the anti-tumor compound etoposide phosphate. The apparent K(m) for the substrate p-nitrophenyl phosphate is 1.3 mM and the enzyme is inhibited by inorganic phosphate. The pH optimum of the enzyme is 9.0 with a broad optimal temperature range between 40 and 50 degrees C. The isoelectric point of the enzyme is approximately 5.5. The enzyme is a glycoprotein; digestion with endoglycosidase H indicates that the protein consists primarily of N-linked carbohydrates. Enzymatic activity is enhanced by the addition of divalent cations such as Mg+2 and Mn+2 and inhibited by addition of a chelator such as EDTA suggesting a metal ion requirement. The enzyme was found to be an inexpensive catalyst for the conversion of etoposide phosphate to etoposide in the manufacture of this anti-tumor compound.

  1. Acid phosphatase role in chickpea/maize intercropping.

    PubMed

    Li, S M; Li, L; Zhang, F S; Tang, C

    2004-08-01

    Organic P comprises 30-80 % of the total P in most agricultural soils. It has been proven that chickpea facilitates P uptake from an organic P source by intercropped wheat. In this study, acid phosphatase excreted from chickpea roots is quantified and the contribution of acid phosphatase to the facilitation of P uptake by intercropped maize receiving phytate is examined. For the first experiment using hydroponics, maize (Zea mays 'Zhongdan No. 2') and chickpea (Cicer arietinum 'Sona') were grown in either the same or separate containers, and P was supplied as phytate, KH2PO4 at 0.25 mmol P L(-1), or not at all. The second experiment involved soil culture with three types of root separation between the two species: (1) plastic sheet, (2) nylon mesh, and (3) no barrier. Maize plants were grown in one compartment and chickpea in the other. Phosphorus was supplied as phytate, Ca(H2PO4)2 at 50 mg P kg(-1), or no P added. In the hydroponics study, the total P uptake by intercropped maize supplied with phytate was 2.1-fold greater than when it was grown as a monoculture. In the soil experiment, when supplied with phytate, total P uptake by maize with mesh barrier and without root barrier was 2.2 and 1.5 times, respectively, as much as that with solid barrier. In both experiments, roots of both maize and chickpea supplied with phytate and no P secreted more acid phosphatase than those with KH2PO4 or Ca(H2PO4)2. However, average acid phosphatase activity of chickpea roots supplied with phytate was 2-3-fold as much as maize. Soil acid phosphatase activity in the rhizosphere of chickpea was also significantly higher than maize regardless of P sources. Chickpea can mobilize organic P in both hydroponic and soil cultures, leading to an interspecific facilitation in utilization of organic P in maize/chickpea intercropping.

  2. Proteomic analysis of protein phosphatase Z1 from Candida albicans.

    PubMed

    Márkus, Bernadett; Szabó, Krisztina; Pfliegler, Walter P; Petrényi, Katalin; Boros, Enikő; Pócsi, István; Tőzsér, József; Csősz, Éva; Dombrádi, Viktor

    2017-01-01

    Protein phosphatase Z is a "novel type" fungus specific serine/threonine protein phosphatase. Previously our research group identified the CaPPZ1 gene in the opportunistic pathogen Candida albicans and reported that the gene deletion had several important physiological consequences. In order to reveal the protein targets and the associated mechanisms behind the functions of the phosphatase a proteomic method was adopted for the comparison of the cappz1 deletion mutant and the genetically matching QMY23 control strain. Proteins extracted from the control and deletion mutant strains were separated by two-dimensional gel electrophoresis and the protein spots were stained with RuBPS and Pro-Q Diamond in order to visualize the total proteome and the phosphoproteome, respectively. The alterations in spot intensities were determined by densitometry and were analysed with the Delta2D (Decodon) software. Spots showing significantly different intensities between the mutant and control strains were excised from the gels and were digested with trypsin. The resulting peptides were identified by LC-MS/MS mass spectrometry. As many as 15 protein spots were found that exhibited significant changes in their intensity upon the deletion of the phosphatase and 20 phosphoproteins were identified in which the level of phosphorylation was modified significantly in the mutant. In agreement with previous findings we found that the affected proteins function in protein synthesis, oxidative stress response, regulation of morphology and metabolism. Among these proteins we identified two potential CaPpz1 substrates (Eft2 and Rpp0) that may regulate the elongation step of translation. RT-qPCR experiments revealed that the expression of the genes coding for the affected proteins was not altered significantly. Thus, the absence of CaPpz1 exerted its effects via protein synthesis/degradation and phosphorylation/dephosphorylation. In addition, our proteomics data strongly suggested a role for Ca

  3. Purification and characterization of a low-molecular-weight acid phosphatase--a phosphotyrosyl-protein phosphatase from bovine heart.

    PubMed

    Zhang, Z Y; Van Etten, R L

    1990-10-01

    A low-molecular-weight acid phosphatase that is representative of a group recently shown to be phosphotyrosyl protein phosphatases was purified to homogeneity from bovine heart. The enzyme was a monomer with a molecular mass of 18 kDa and had an isoelectric point of 7.0. The absorption coefficient, E1% 1cm was 9.65 at 280 nm. The enzyme had pH optima of 5.3 and 6.0 with the substrates p-nitrophenyl phosphate and tyrosine phosphate, respectively. When measured at pH 5 and 37 degrees C, the enzyme had specific activities of 114 and 86 mumol min-1 mg-1 for p-nitrophenyl phosphate and tyrosine O-phosphate, respectively, while the Km values were 0.38 and 14 mM. The enzyme was highly specific for aryl monophosphate esters and showed little or no activity toward aliphatic phosphate esters, with the remarkable exception of flavin mononucleotide (FMN) and certain of its structural analogs. As shown by 31P NMR data, the activity toward FMN was due to the hydrolysis of one of the eight components present in the (commercial) sample. Both molybdate and vanadate were potent inhibitors, with inhibition constants of 37 and 29 microM, respectively; tartrate and fluoride had little effect on enzymatic activity. A two-stage reversible denaturation of the enzyme by guanidine HCl was observed with midpoints of 0.25 and 1.75 M, respectively. The amino acid composition was homologous to the low-molecular-weight acid phosphatases from other tissue. The enzyme showed immunological cross-reactivity against low-molecular-weight human liver acid phosphatase. There were 7 or 8 accessible cysteines on the monomeric protein and at least one was essential for enzyme activity. The enzyme also had phosphotransferase activity, for example transferring phosphate from p-nitrophenyl phosphate to a wide variety of alcohol acceptors.

  4. Summary of Alpha Particle Transport

    SciTech Connect

    Medley, S.S.; White, R.B.; Zweben, S.J.

    1998-08-19

    This paper summarizes the talks on alpha particle transport which were presented at the 5th International Atomic Energy Agency's Technical Committee Meeting on "Alpha Particles in Fusion Research" held at the Joint European Torus, England in September 1997.

  5. Identification of a non-purple tartrate-resistant acid phosphatase: an evolutionary link to Ser/Thr protein phosphatases?

    PubMed Central

    Hadler, Kieran S; Huber, Thomas; Cassady, A Ian; Weber, Jane; Robinson, Jodie; Burrows, Allan; Kelly, Gregory; Guddat, Luke W; Hume, David A; Schenk, Gerhard; Flanagan, Jack U

    2008-01-01

    Background Tartrate-resistant acid phosphatases (TRAcPs), also known as purple acid phosphatases (PAPs), are a family of binuclear metallohydrolases that have been identified in plants, animals and fungi. The human enzyme is a major histochemical marker for the diagnosis of bone-related diseases. TRAcPs can occur as a small form possessing only the ~35 kDa catalytic domain, or a larger ~55 kDa form possessing both a catalytic domain and an additional N-terminal domain of unknown function. Due to its role in bone resorption the 35 kDa TRAcP has become a promising target for the development of anti-osteoporotic chemotherapeutics. Findings A new human gene product encoding a metallohydrolase distantly related to the ~55 kDa plant TRAcP was identified and characterised. The gene product is found in a number of animal species, and is present in all tissues sampled by the RIKEN mouse transcriptome project. Construction of a homology model illustrated that six of the seven metal-coordinating ligands in the active site are identical to that observed in the TRAcP family. However, the tyrosine ligand associated with the charge transfer transition and purple color of TRAcPs is replaced by a histidine. Conlusion The gene product identified here may represent an evolutionary link between TRAcPs and Ser/Thr protein phosphatases. Its biological function is currently unknown but is unlikely to be associated with bone metabolism. PMID:18771593

  6. Identification of a non-purple tartrate-resistant acid phosphatase: an evolutionary link to Ser/Thr protein phosphatases?

    PubMed

    Hadler, Kieran S; Huber, Thomas; Cassady, A Ian; Weber, Jane; Robinson, Jodie; Burrows, Allan; Kelly, Gregory; Guddat, Luke W; Hume, David A; Schenk, Gerhard; Flanagan, Jack U

    2008-09-04

    Tartrate-resistant acid phosphatases (TRAcPs), also known as purple acid phosphatases (PAPs), are a family of binuclear metallohydrolases that have been identified in plants, animals and fungi. The human enzyme is a major histochemical marker for the diagnosis of bone-related diseases. TRAcPs can occur as a small form possessing only the ~35 kDa catalytic domain, or a larger ~55 kDa form possessing both a catalytic domain and an additional N-terminal domain of unknown function. Due to its role in bone resorption the 35 kDa TRAcP has become a promising target for the development of anti-osteoporotic chemotherapeutics. A new human gene product encoding a metallohydrolase distantly related to the ~55 kDa plant TRAcP was identified and characterised. The gene product is found in a number of animal species, and is present in all tissues sampled by the RIKEN mouse transcriptome project. Construction of a homology model illustrated that six of the seven metal-coordinating ligands in the active site are identical to that observed in the TRAcP family. However, the tyrosine ligand associated with the charge transfer transition and purple color of TRAcPs is replaced by a histidine. The gene product identified here may represent an evolutionary link between TRAcPs and Ser/Thr protein phosphatases. Its biological function is currently unknown but is unlikely to be associated with bone metabolism.

  7. Protein Phosphatase Methyl-Esterase PME-1 Protects Protein Phosphatase 2A from Ubiquitin/Proteasome Degradation.

    PubMed

    Yabe, Ryotaro; Miura, Akane; Usui, Tatsuya; Mudrak, Ingrid; Ogris, Egon; Ohama, Takashi; Sato, Koichi

    2015-01-01

    Protein phosphatase 2A (PP2A) is a conserved essential enzyme that is implicated as a tumor suppressor based on its central role in phosphorylation-dependent signaling pathways. Protein phosphatase methyl esterase (PME-1) catalyzes specifically the demethylation of the C-terminal Leu309 residue of PP2A catalytic subunit (PP2Ac). It has been shown that PME-1 affects the activity of PP2A by demethylating PP2Ac, but also by directly binding to the phosphatase active site, suggesting loss of PME-1 in cells would enhance PP2A activity. However, here we show that PME-1 knockout mouse embryonic fibroblasts (MEFs) exhibit lower PP2A activity than wild type MEFs. Loss of PME-1 enhanced poly-ubiquitination of PP2Ac and shortened the half-life of PP2Ac protein resulting in reduced PP2Ac levels. Chemical inhibition of PME-1 and rescue experiments with wild type and mutated PME-1 revealed methyl-esterase activity was necessary to maintain PP2Ac protein levels. Our data demonstrate that PME-1 methyl-esterase activity protects PP2Ac from ubiquitin/proteasome degradation.

  8. Phosphatase activity of the voltage-sensing phosphatase, VSP, shows graded dependence on the extent of activation of the voltage sensor.

    PubMed

    Sakata, Souhei; Okamura, Yasushi

    2014-03-01

    The voltage-sensing phosphatase (VSP) consists of a voltage sensor and a cytoplasmic phosphatase region, and the movement of the voltage sensor is coupled to the phosphatase activity. However, its coupling mechanisms still remain unclear. One possible scenario is that the phosphatase is activated only when the voltage sensor is in a fully activated state. Alternatively, the enzymatic activity of single VSP proteins could be graded in distinct activated states of the voltage sensor, and partial activation of the voltage sensor could lead to partial activation of the phosphatase. To distinguish between these two possibilities, we studied a voltage sensor mutant of zebrafish VSP, where the voltage sensor moves in two steps as evidenced by analyses of charge movements of the voltage sensor and voltage clamp fluorometry. Measurements of the phosphatase activity toward phosphatidylinositol 4,5-bisphosphate revealed that both steps of voltage sensor activation are coupled to the tuning of phosphatase activities, consistent with the idea that the phosphatase activity is graded by the magnitude of the movement of the voltage sensor.

  9. Phosphatase activity of the voltage-sensing phosphatase, VSP, shows graded dependence on the extent of activation of the voltage sensor

    PubMed Central

    Sakata, Souhei; Okamura, Yasushi

    2014-01-01

    The voltage-sensing phosphatase (VSP) consists of a voltage sensor and a cytoplasmic phosphatase region, and the movement of the voltage sensor is coupled to the phosphatase activity. However, its coupling mechanisms still remain unclear. One possible scenario is that the phosphatase is activated only when the voltage sensor is in a fully activated state. Alternatively, the enzymatic activity of single VSP proteins could be graded in distinct activated states of the voltage sensor, and partial activation of the voltage sensor could lead to partial activation of the phosphatase. To distinguish between these two possibilities, we studied a voltage sensor mutant of zebrafish VSP, where the voltage sensor moves in two steps as evidenced by analyses of charge movements of the voltage sensor and voltage clamp fluorometry. Measurements of the phosphatase activity toward phosphatidylinositol 4,5-bisphosphate revealed that both steps of voltage sensor activation are coupled to the tuning of phosphatase activities, consistent with the idea that the phosphatase activity is graded by the magnitude of the movement of the voltage sensor. PMID:24277865

  10. HB Hillingdon [alpha46(CE4)Phe-->Val (alpha1 Or alpha2)]: a new alpha chain hemoglobin variant.

    PubMed

    Babb, Anna; Solaiman, Susannah; Green, Brian N; Mantio, Debbie; Patel, Ketan

    2009-01-01

    Routine antenatal hemoglobinopathy screening detected a new alpha chain variant that eluted with Hb A(2) on cation exchange high performance liquid chromatography (HPLC) in a lady of Sri Lankan origin who had normal hematological indices. The mutation was identified by electrospray ionization mass spectrometry (ESI-MS) as alpha46(CE4)Phe-->Val, inferring that the variant was due to a single base change at codon 46 (TTC>GTC) of the alpha1- or alpha2-globin genes.

  11. Tyrosine phosphatases as key regulators of StAR induction and cholesterol transport: SHP2 as a potential tyrosine phosphatase involved in steroid synthesis.

    PubMed

    Cooke, Mariana; Mele, Pablo; Maloberti, Paula; Duarte, Alejandra; Poderoso, Cecilia; Orlando, Ulises; Paz, Cristina; Cornejo Maciel, Fabiana; Podestá, Ernesto J

    2011-04-10

    The phospho-dephosphorylation of intermediate proteins is a key event in the regulation of steroid biosynthesis. In this regard, it is well accepted that steroidogenic hormones act through the activation of serine/threonine (Ser/Thr) protein kinases. Although many cellular processes can be regulated by a crosstalk between different kinases and phosphatases, the relationship of Ser/Thr phosphorylation and tyrosine (Tyr)-dephosphorylation is a recently explored field in the regulation of steroid synthesis. Indeed in steroidogenic cells, one of the targets of hormone-induced Ser/Thr phosphorylation is a protein tyrosine phosphatase. Whereas protein tyrosine phosphatases were initially regarded as household enzymes with constitutive activity, dephosphorylating all the substrates they encountered, evidence is now accumulating that protein tyrosine phosphatases are tightly regulated by various mechanisms. Here, we will describe the role of protein tyrosine phosphatases in the regulation of steroid biosynthesis, relating them to steroidogenic acute regulatory protein, arachidonic acid metabolism and mitochondrial rearrangement.

  12. Structural basis for the glucan phosphatase activity of Starch Excess4

    SciTech Connect

    Vander Kooi, Craig W.; Taylor, Adam O.; Pace, Rachel M.; Meekins, David A.; Guo, Hou-Fu; Kim, Youngjun; Gentry, Matthew S.

    2010-11-12

    Living organisms utilize carbohydrates as essential energy storage molecules. Starch is the predominant carbohydrate storage molecule in plants while glycogen is utilized in animals. Starch is a water-insoluble polymer that requires the concerted activity of kinases and phosphatases to solubilize the outer surface of the glucan and mediate starch catabolism. All known plant genomes encode the glucan phosphatase Starch Excess4 (SEX4). SEX4 can dephosphorylate both the starch granule surface and soluble phosphoglucans and is necessary for processive starch metabolism. The physical basis for the function of SEX4 as a glucan phosphatase is currently unclear. Herein, we report the crystal structure of SEX4, containing phosphatase, carbohydrate-binding, and C-terminal domains. The three domains of SEX4 fold into a compact structure with extensive interdomain interactions. The C-terminal domain of SEX4 integrally folds into the core of the phosphatase domain and is essential for its stability. The phosphatase and carbohydrate-binding domains directly interact and position the phosphatase active site toward the carbohydrate-binding site in a single continuous pocket. Mutagenesis of the phosphatase domain residue F167, which forms the base of this pocket and bridges the two domains, selectively affects the ability of SEX4 to function as a glucan phosphatase. Together, these results reveal the unique tertiary architecture of SEX4 that provides the physical basis for its function as a glucan phosphatase.

  13. Gallium nitrate inhibits alkaline phosphatase activity in a differentiating mesenchymal cell culture.

    PubMed

    Boskey, A L; Ziecheck, W; Guidon, P; Doty, S B

    1993-02-01

    The effect of gallium nitrate on alkaline phosphatase activity in a differentiating chick limb-bud mesenchymal cell culture was monitored in order to gain insight into the observation that rachitic rats treated with gallium nitrate failed to show the expected increase in serum alkaline phosphatase activity. Cultures maintained in media containing 15 microM gallium nitrate showed drastically decreased alkaline phosphatase activities in the absence of significant alterations in total protein synthesis and DNA content. However, addition of 15 microM gallium nitrate to cultures 18 h before assay for alkaline phosphatase activity had little effect. At the light microscopic and electron microscopic level, gallium-treated cultures differed morphologically from gallium-free cultures: with gallium present, there were fewer hypertrophic chondrocytes and cartilage nodules were flatter and further apart. Because of altered morphology, staining with an antibody against chick cartilage alkaline phosphatase appeared less extensive; however, all nodules stained equivalently relative to gallium-free controls. Histochemical staining for alkaline phosphatase activity was negative in gallium-treated cultures, demonstrating that the alkaline phosphatase protein present was not active. The defective alkaline phosphatase activity in cultures maintained in the presence of gallium was also evidenced when cultures were supplemented with the alkaline phosphatase substrate, beta-glycerophosphate (beta GP). The data presented suggest that gallium inhibits alkaline phosphatase activity in this culture system and that gallium causes alterations in the differentiation of mesenchymal cells into hypertrophic chondrocytes.

  14. The ALPHA Magnetic Spectrometer

    NASA Astrophysics Data System (ADS)

    Viertel, G. M.; Capell, M.

    1998-12-01

    The ALPHA Magnetic Spectrometer (AMS) will be the first large magnetic spectrometer in space. It is scheduled to be installed on the future International Space Station ALPHA (ISSA) in the year 2002 to perform measurements of the charged particle composition to answer fundamental questions in particle physics and astrophysics. Before installation on ISSA, AMS will fly on the shuttle DISCOVERY for a period of 10 days starting in May 1998. This will enable AMS to perform a test of the apparatus and first measurements. The AMS detector has five major components: A permanent NdFeB magnet, six planes of Silicon double-sided microstrip detectors, a plastic scintillator time of flight hodoscope, a plastic scintillator anticoincidence counter and an Aerogel Cherenkov threshold counter. In addition, there are electronics, support infrastructure and interfaces.

  15. Simultaneous quantification of GABAergic 3alpha,5alpha/3alpha,5beta neuroactive steroids in human and rat serum.

    PubMed

    Porcu, Patrizia; O'Buckley, Todd K; Alward, Sarah E; Marx, Christine E; Shampine, Lawrence J; Girdler, Susan S; Morrow, A Leslie

    2009-01-01

    The 3alpha,5alpha- and 3alpha,5beta-reduced derivatives of progesterone, deoxycorticosterone, dehydroepiandrosterone and testosterone enhance GABAergic neurotransmission and produce inhibitory neurobehavioral and anti-inflammatory effects. Despite substantial information on the progesterone derivative (3alpha,5alpha)-3-hydroxypregnan-20-one (3alpha,5alpha-THP, allopregnanolone), the physiological significance of the other endogenous GABAergic neuroactive steroids has remained elusive. Here, we describe the validation of a method using gas chromatography-mass spectrometry to simultaneously identify serum levels of the eight 3alpha,5alpha- and 3alpha,5beta-reduced derivatives of progesterone, deoxycorticosterone, dehydroepiandrosterone and testosterone. The method shows specificity, sensitivity and enhanced throughput compared to other methods already available for neuroactive steroid quantification. Administration of pregnenolone to rats and progesterone to women produced selective effects on the 3alpha,5alpha- and 3alpha,5beta-reduced neuroactive steroids, indicating differential regulation of their biosynthetic pathways. Pregnenolone administration increased serum levels of 3alpha,5alpha-THP (+1488%, p<0.001), (3alpha,5alpha)-3,21-dihydroxypregnan-20-one (3alpha,5alpha-THDOC, +205%, p<0.01), (3alpha,5alpha)-3-hydroxyandrostan-17-one (3alpha,5alpha-A, +216%, p<0.001), (3alpha,5alpha,17beta)-androstane-3,17-diol (3alpha,5alpha-A-diol, +190%, p<0.01). (3alpha,5beta)-3-hydroxypregnan-20-one (3alpha,5beta-THP) and (3alpha,5beta)-3-hydroxyandrostan-17-one (3alpha,5beta-A) were not altered, while (3alpha,5beta)-3,21-dihydroxypregnan-20-one (3alpha,5beta-THDOC) and (3alpha,5beta,17beta)-androstane-3,17-diol (3alpha,5beta-A-diol) were increased from undetectable levels to 271+/-100 and 2.4+/-0.9 pg+/-SEM, respectively (5/8 rats). Progesterone administration increased serum levels of 3alpha,5alpha-THP (+1806%, p<0.0001), 3alpha,5beta-THP (+575%, p<0.001), 3alpha,5alpha

  16. Overexpression of {alpha}-catenin increases osteoblastic differentiation in mouse mesenchymal C3H10T1/2 cells

    SciTech Connect

    Kim, Dohee; Yang, Jae-Yeon; Shin, Chan Soo

    2009-05-15

    {alpha}- and {beta}-Catenin link cadherins to the actin-based cytoskeleton at adherens junctions and regulate cell-cell adhesion. Although roles of cadherins and canonical Wnt-/{beta}-catenin-signaling in osteoblastic differentiation have been extensively studied, the role of {alpha}-catenin is not known. Murine embryonic mesenchymal stem cells, C3H10T1/2 cells, were transduced with retrovirus encoding {alpha}-catenin (MSCV-{alpha}-catenin-HA-GFP). In the presence of Wnt-3A conditioned medium or osteogenic medium ({beta}-glycerol phosphate and ascorbic acid), cells overexpressing {alpha}-catenin showed enhanced osteoblastic differentiation as measured by alkaline phosphatase (ALP) staining and ALP activity assay compared to cells transduced with empty virus (MSCV-GFP). In addition, mRNA expression of osteocalcin and Runx2 was significantly increased compared to control. Cell aggregation assay revealed that {alpha}-catenin overexpression has significantly increased cell-cell aggregation. However, cellular {beta}-catenin levels (total, cytoplasmic-nuclear ratio) and {beta}-catenin-TCF/LEF transcriptional activity did not change by overexpression of {alpha}-catenin. Knock-down of {alpha}-catenin using siRNA decreased osteoblastic differentiation as measured by ALP assay. These results suggest that {alpha}-catenin overexpression increases osteoblastic differentiation by increasing cell-cell adhesion rather than Wnt-/{beta}-catenin-signaling.

  17. Antihydrogen studies in ALPHA

    NASA Astrophysics Data System (ADS)

    Madsen, N.; ALPHA Collaboration

    2016-11-01

    The ALPHA experiment studies antihydrogen as a means to investigate the symmetry of matter and antimatter. Spectroscopic studies of the anti-atom hold the promise of the most precise direct comparisons of matter and antimatter possible. ALPHA was the first to trap antihydrogen in a magnetic trap, allowing the first ever detection of atomic transitions in an anti-atom. More recently, through stochastic heating, we have also been able to put a new limit on the charge neutrality of antihydrogen. ALPHA is currently preparing to perform the first laser-spectroscopy of antihydrogen, hoping to excite the 2s state using a two-photon transition from the 1s state. We discuss the recent results as well as the key developments that led to these successes and discuss how we are preparing to perform the first laser-spectroscopy. We will also discuss plans to use our novel technique for gravitational tests on antihydrogen for a direct measurement of the sign of the gravitational force on antihydrogen.

  18. Acute toxicity studies of alpha-ketoglutarate: a promising antidote for cyanide poisoning.

    PubMed

    Bhattacharya, R; Kumar, D; Sugendran, K; Pant, S C; Tulsawani, R K; Vijayaraghavan, R

    2001-01-01

    Recently we have shown that cyanide poisoning by the oral (p.o.) route could be antagonized significantly by pretreatment or simultaneous treatment of alpha-ketoglutarate (alpha-KG), administered p.o. in rodents. The protective effect of alpha-KG was dose dependent (0.125-2.0 g kg(-1)) and the effect was significant at a dose above 1.0 g kg(-1). In order to establish the safety of alpha-KG, various haematological, biochemical and histological parameters were studied following p.o. administration of 2.0 g kg(-1)alpha-KG in female rats, and various physiological parameters were studied following p.o. administration of 2.0 or 4.0 g kg(-1)alpha-KG in anaesthetized male rats. The p.o. LD(50) of alpha-KG in male and female rats was >5.0 g kg(-1) and no toxic signs were observed in the surviving animals. Except for an increase in plasma alkaline phosphatase and urea levels after 1 h and a decrease in inorganic phosphorus levels after 7 days of treatment, no significant change in haematology, biochemistry or histology of the vital organs were observed. Mean arterial pressure and neuromuscular transmission were decreased at 4.0 g kg(-1)alpha-KG but other physiological variables such as heart rate, respiratory rate, rectal temperature, left ventricular pressure (systolic), arterial pressure (systolic) and arterial pressure (diastolic) were not altered. The changes observed at 4.0 g kg(-1)alpha-KG are unlikely to be of toxicological concern. The results indicate that alpha-KG at 2.0 g kg(-1) (p.o.)-a dose offering maximum antidotal efficacy-is non-toxic and therefore can be considered suitable for cyanide poisoning. Copyright 2001 John Wiley & Sons, Ltd.

  19. Promoting Uranium Immobilization by the Activities of Microbial Phosphatases

    SciTech Connect

    Robert J. Martinez; Melanie J. Beazley; Samuel M. Webb; Martial Taillefert; and Patricia A. Sobecky

    2007-04-19

    The overall objective of this project is to examine the activity of nonspecific phosphohydrolases present in naturally occurring subsurface microorganisms for the purpose of promoting the immobilization of radionuclides through the production of uranium [U(VI)] phosphate precipitates. Specifically, we hypothesize that the precipitation of U(VI) phosphate minerals may be promoted through the microbial release and/or accumulation of PO4 3- as a means to detoxify radionuclides and heavy metals. An experimental approach was designed to determine the extent of phosphatase activity in bacteria previously isolated from contaminated subsurface soils collected at the ERSP Field Research Center (FRC) in Oak Ridge, TN. Screening of 135 metal resistant isolates for phosphatase activity indicated the majority (75 of 135) exhibited a phosphatase-positive phenotype. During this phase of the project, a PCR based approach has also been designed to assay FRC isolates for the presence of one or more classes of the characterized non-specific acid phophastase (NSAP) genes likely to be involved in promoting U(VI) precipitation. Testing of a subset of Pb resistant (Pbr) Arthrobacter, Bacillus and Rahnella strains indicated 4 of the 9 Pbr isolates exhibited phosphatase phenotypes suggestive of the ability to bioprecipitate U(VI). Two FRC strains, a Rahnella sp. strain Y9602 and a Bacillus sp. strain Y9-2, were further characterized. The Rahnella sp. exhibited enhanced phosphatase activity relative to the Bacillus sp. Whole-cell enzyme assays identified a pH optimum of 5.5, and inorganic phosphate accumulated in pH 5.5 synthetic groundwater (designed to mimic FRC conditions) incubations of both strains in the presence of a model organophosphorus substrate provided as the sole C and P source. Kinetic experiments showed that these two organisms can grow in the presence of 200 μM dissolved uranium and that Rahnella is much more efficient in precipitating U(VI) than Bacillus sp. The

  20. FIG4 regulates lysosome membrane homeostasis independent of phosphatase function

    PubMed Central

    Bharadwaj, Rajnish; Cunningham, Kathleen M.; Zhang, Ke; Lloyd, Thomas E.

    2016-01-01

    FIG4 is a phosphoinositide phosphatase that is mutated in several diseases including Charcot-Marie-Tooth Disease 4J (CMT4J) and Yunis-Varon syndrome (YVS). To investigate the mechanism of disease pathogenesis, we generated Drosophila models of FIG4-related diseases. Fig4 null mutant animals are viable but exhibit marked enlargement of the lysosomal compartment in muscle cells and neurons, accompanied by an age-related decline in flight ability. Transgenic animals expressing Drosophila Fig4 missense mutations corresponding to human pathogenic mutations can partially rescue lysosomal expansion phenotypes, consistent with these mutations causing decreased FIG4 function. Interestingly, Fig4 mutations predicted to inactivate FIG4 phosphatase activity rescue lysosome expansion phenotypes, and mutations in the phosphoinositide (3) phosphate kinase Fab1 that performs the reverse enzymatic reaction also causes a lysosome expansion phenotype. Since FIG4 and FAB1 are present together in the same biochemical complex, these data are consistent with a model in which FIG4 serves a phosphatase-independent biosynthetic function that is essential for lysosomal membrane homeostasis. Lysosomal phenotypes are suppressed by genetic inhibition of Rab7 or the HOPS complex, demonstrating that FIG4 functions after endosome-to-lysosome fusion. Furthermore, disruption of the retromer complex, implicated in recycling from the lysosome to Golgi, does not lead to similar phenotypes as Fig4, suggesting that the lysosomal defects are not due to compromised retromer-mediated recycling of endolysosomal membranes. These data show that FIG4 plays a critical noncatalytic function in maintaining lysosomal membrane homeostasis, and that this function is disrupted by mutations that cause CMT4J and YVS. PMID:26662798

  1. Phosphoprotein phosphatase of bovine spleen cell nuclei: physicochemical properties

    SciTech Connect

    Rezyapkin, V.I.; Leonova, L.E.; Komkova, A.I.

    1986-01-10

    The physicochemical properties of phosphoprotein phosphatase (EC 1.3.1.16) from bovine spleen cell nuclei were studied. The enzyme possesses broad substrate specificity and catalyzes the dephosphorylation of phosphocasein, ATP, ADP, and p-nitrophenyl phosphate (pNPP). K/sub m/ for ATP, ADP, and pNPP are equal to 0.44, 0.43, and 1.25 mM, respectively. M/sub r/ of the enzyme, according to the data of gel filtraction of Sephadex G-75 and electrophoresis in polyacrylamide gel of various concentrations is approx. 33,000. In electrophoresis in the presence of SDS, two protein bands with M/sub r/ 12,000 and 18,000 are detected. In the enzyme molecule, acid amino acid residues predominate; two free SH groups and two disulfide bridges are detected. Phosphoprotein phosphatase is a glycoprotein, containing approx. 22% carbonhydrates. The protein possesses a supplementary absorption maximum at 560 nm. Ammonium molybdate is a competitive inhibitor with K/sub i/ 0.37 ..mu..M, while sodium fluoride is a noncompetitive inhibitor with K/sub i/ 1.3 mM. Incubation in the presence of 2 mM phenylmethylsulfonyl fluoride for 25 h leads to a loss of approx. 46% of the enzymatic activity. Ammonium molybdate, sodium fluoride, and PMSF are reversible inhibitors. Modifications of the SH groups, NH/sub 2/ groups, and histidine leads to a decrease in the enzymatic activity. Incubation of phosphoprotein phosphatase with (..gamma..-/sup 32/P)ATP leads to the incorporation of 0.33 mole /sup 33/P per mole of the enzyme. The mechanism of hydrolysis of the phosphodiester bond, catalyzed by the enzyme, is discussed.

  2. Characterization of the protein tyrosine phosphatase PRL from Entamoeba histolytica.

    PubMed

    Ramírez-Tapia, Ana Lilia; Baylón-Pacheco, Lidia; Espíritu-Gordillo, Patricia; Rosales-Encina, José Luis

    2015-12-01

    Protein tyrosine phosphatase of regenerating liver (PRL) is a group of phosphatases that has not been broadly studied in protozoan parasites. In humans, PRLs are involved in metastatic cancer, the promotion of cell migration and invasion. PTPs have been increasingly recognized as important effectors of host-pathogen interactions. We characterized the only putative protein tyrosine phosphatase PRL (PTP EhPRL) in the eukaryotic human intestinal parasite Entamoeba histolytica. Here, we reported that the EhPRL protein possessed the classical HCX5R catalytic motif of PTPs and the CAAX box characteristic of the PRL family and exhibited 31-32% homology with the three human PRL isoforms. In amebae, the protein was expressed at low but detectable levels. The recombinant protein (rEhPRL) had enzymatic activity with the 3-o-methyl fluorescein phosphate (OMFP) substrate; this enzymatic activity was inhibited by the PTP inhibitor o-vanadate. Using immunofluorescence we showed that native EhPRL was localized to the cytoplasm and plasma membrane. When the trophozoites interacted with collagen, EhPRL relocalized over time to vesicle-like structures. Interaction with fibronectin increased the presence of the enzyme in the cytoplasm. Using RT-PCR, we demonstrated that EhPRL mRNA expression was upregulated when the trophozoites interacted with collagen but not with fibronectin. Trophozoites recovered from amoebic liver abscesses showed higher EhPRL mRNA expression levels than normal trophozoites. These results strongly suggest that EhPRL may play an important role in the biology and adaptive response of the parasite to the host environment during amoebic liver abscess development, thereby participating in the pathogenic mechanism.

  3. FIG4 regulates lysosome membrane homeostasis independent of phosphatase function.

    PubMed

    Bharadwaj, Rajnish; Cunningham, Kathleen M; Zhang, Ke; Lloyd, Thomas E

    2016-02-15

    FIG4 is a phosphoinositide phosphatase that is mutated in several diseases including Charcot-Marie-Tooth Disease 4J (CMT4J) and Yunis-Varon syndrome (YVS). To investigate the mechanism of disease pathogenesis, we generated Drosophila models of FIG4-related diseases. Fig4 null mutant animals are viable but exhibit marked enlargement of the lysosomal compartment in muscle cells and neurons, accompanied by an age-related decline in flight ability. Transgenic animals expressing Drosophila Fig4 missense mutations corresponding to human pathogenic mutations can partially rescue lysosomal expansion phenotypes, consistent with these mutations causing decreased FIG4 function. Interestingly, Fig4 mutations predicted to inactivate FIG4 phosphatase activity rescue lysosome expansion phenotypes, and mutations in the phosphoinositide (3) phosphate kinase Fab1 that performs the reverse enzymatic reaction also causes a lysosome expansion phenotype. Since FIG4 and FAB1 are present together in the same biochemical complex, these data are consistent with a model in which FIG4 serves a phosphatase-independent biosynthetic function that is essential for lysosomal membrane homeostasis. Lysosomal phenotypes are suppressed by genetic inhibition of Rab7 or the HOPS complex, demonstrating that FIG4 functions after endosome-to-lysosome fusion. Furthermore, disruption of the retromer complex, implicated in recycling from the lysosome to Golgi, does not lead to similar phenotypes as Fig4, suggesting that the lysosomal defects are not due to compromised retromer-mediated recycling of endolysosomal membranes. These data show that FIG4 plays a critical noncatalytic function in maintaining lysosomal membrane homeostasis, and that this function is disrupted by mutations that cause CMT4J and YVS.

  4. Osseous plate alkaline phosphatase is anchored by GPI.

    PubMed

    Pizauro, J M; Ciancaglini, P; Leone, F A

    1994-02-01

    Alkaline phosphatase activity was released up to 100% from the membrane by using 0.1 U of phosphatidylinositol-specific phospholipase C from B. thuringiensis. The M(r) of solubilized enzyme was 145,000 by Sephacryl S-300 gel filtration and 66,000 by SDS-PAGE, suggesting a dimeric structure. Solubilization of the membrane-bound enzyme with phospholipase C did not destroy its ability to hydrolyze p-nitrophenyl phosphate (PNPP) (264.3 mumol min-1 mg-1),ATP (42.0 mumol min-1 mg-1) and pyrophosphate (28.4 mumol min-1 mg-1). The hydrolysis of ATP and PNPP by solubilized enzyme exhibited "Michaelian" kinetics with K0.5 = 70 and 979 microM, respectively. For pyrophosphate, K0.5 was 128 microM and site-site interactions were observed (n = 1.4). Magnesium ions were stimulatory (Kd = 1.5 mM) but zinc ions were powerful non-competitive inhibitors (Kd = 6.2 microM) of solubilized enzyme. Treatment of solubilized alkaline phosphatase with Chellex 100 reduced the original PNPPase activity to 5%. Cobalt (K0.5 = 10.1 microM), magnesium (K0.5 = 29.5 microM) and manganese ions (K0.5 = 5 microM) restored the activity of the apoenzyme with positive cooperativity, suggesting that phosphatidylinositol-specific phospholipase C-solubilized alkaline phosphatase is a metalloenzyme. The stimulation of the apoenzyme by calcium ions (K0.5 = 653 microM) was lower than that observed for the other ions (26%) and exhibited site-site interactions (n = 0.7). Zinc ions had no effect on the apoenzyme of the solubilized enzyme.

  5. PEST family phosphatases in immunity, autoimmunity, and autoinflammatory disorders.

    PubMed

    Veillette, André; Rhee, Inmoo; Souza, Cleiton Martins; Davidson, Dominique

    2009-03-01

    The proline-, glutamic acid-, serine- and threonine-rich (PEST) family of protein tyrosine phosphatases (PTPs) includes proline-enriched phosphatase (PEP)/lymphoid tyrosine phosphatase (LYP), PTP-PEST, and PTP-hematopoietic stem cell fraction (HSCF). PEP/LYP is a potent inhibitor of T-cell activation, principally by suppressing the activity of Src family protein tyrosine kinases (PTKs). This function seems to be dependent, at least in part, on the ability of PEP to bind C-terminal Src kinase (Csk), a PTK also involved in inactivating Src kinases. Interestingly, a polymorphism of LYP in humans (R620W) is a significant risk factor for autoimmune diseases including type 1 diabetes, rheumatoid arthritis, and lupus. The R620W mutation may be a 'gain-of-function' mutation. In non-hematopoietic cells, PTP-PEST is a critical regulator of adhesion and migration. This effect correlates with the aptitude of PTP-PEST to dephosphorylate cytoskeletal proteins such as Cas, focal adhesion associated-kinase (FAK), Pyk2, and PSTPIP. While not established, a similar function may also exist in immune cells. Additionally, overexpression studies provided an indication that PTP-PEST may be a negative regulator of lymphocyte activation. Interestingly, mutations in a PTP-PEST- and PTP-HSCF-interacting protein, PSTPIP1, were identified in humans with pyogenic sterile arthritis, pyoderma gangrenosum, and acne (PAPA) syndrome and familial recurrent arthritis, two autoinflammatory diseases. These mutations abrogate the ability of PSTPIP1 to bind PTP-PEST and PTP-HSCF, suggesting that these two PTPs may be negative regulators of inflammation.

  6. Assay of phosphotyrosyl protein phosphatase using synthetic peptide 1142-1153 of the insulin receptor.

    PubMed

    King, M J; Sale, G J

    1988-09-12

    Synthetic peptide 1142-1153 of the insulin receptor was phosphorylated on tyrosine by the insulin receptor and found to be a potent substrate for dephosphorylation by rat liver particulate and soluble phosphotyrosyl protein phosphatases. Apparent Km values were approximately 5 microM. Vm values (nmol phosphate removed/min per mg protein) were 0.62 (particulate) and 0.2 (soluble). This corresponds to 80% of total activity being membrane-associated, indicating that membrane-bound phosphatases are important receptor phosphatases. The phosphatase activities were distinct from acid and alkaline phosphatase. In conclusion peptide 1142-1153 provides a useful tool for the further study and characterization of phosphotyrosyl protein phosphatases.

  7. Fluorescence spectroscopy measures yeast PAH1-encoded phosphatidate phosphatase interaction with liposome membranes

    PubMed Central

    Xu, Zhi; Su, Wen-Min; Carman, George M.

    2012-01-01

    Phosphatidate (PA) phosphatase, the enzyme that catalyzes the penultimate step in triacylglycerol synthesis, is a cytosolic enzyme that must associate with the membrane where its substrate PA resides. Fluorescence spectroscopy was used to measure the interaction of yeast PAH1-encoded PA phosphatase with model liposome membranes. PA phosphatase contains five tryptophan residues and exhibited inherit fluorescence that increased upon interaction with phosphatidylcholine liposomes. The interaction was enhanced by inclusion of other phospholipids and especially the substrate PA. Interaction was dependent on both the concentration of phosphatidylcholine-PA liposomes as well as the surface concentration of PA in liposomes. Mg2+ ions, which were required for catalysis, did not affect PA phosphatase interaction with phosphatidylcholine-PA liposomes. PA phosphatase was a substrate for protein kinase A, protein kinase C, and casein kinase II, and these phosphorylations decreased PA phosphatase interaction with phosphatidylcholine-PA liposome membranes. PMID:22180632

  8. Probable levetiracetam-related serum alkaline phosphatase elevation

    PubMed Central

    2012-01-01

    Background Levetiracetam (LEV) is an antiepileptic drug with a favorable tolerability and safety profile with little or no effect on liver function. Case presentation Here, we reported an epileptic pediatric patient who developed a significant elevation in serum alkaline phosphatase level (ALP) during LEV monotherapy. Moreover, the serum ALP level was surprisingly decreased to normal after LEV discontinuation. The Naranjo Adverse Drug Reaction Probability Scale score was 6, indicating firstly LEV was a probable cause for the increased serum ALP. Conclusions Cautious usage and concerns of the LEV-associated potential ALP elevation should be considered when levetiracetam is prescribed to epilepsy patients, especially pediatric patients. PMID:22994584

  9. A description of alkaline phosphatases from marine organisms

    NASA Astrophysics Data System (ADS)

    Tian, Jiyuan; Jia, Hongbing; Yu, Juan

    2016-07-01

    Alkaline phosphatases (APs) are non-specific phosphohydrolases, and they are widely used in clinical diagnostics and biological studies. APs are widespread in nature and exhibit different structural formulations. Based on the diversity of biogenetic sources, APs exhibit temperature-propensity traits, and they are classified as psychrophilic, mesophilic, and thermophilic. In this article, the characteristics of psychrophilic APs from marine organisms were described, accompanied by a simple description of APs from other organisms. This review will facilitate better utilization of marine APs in the biotechnology field.

  10. Promoting Uranium Immobilization by the Activities of Microbial Phosphatases

    SciTech Connect

    Martinez, Robert J.; Beazley, Melanie J.; Wilson, Jarad J.; Taillefert, Martial; Sobecky, Patricia A.

    2005-04-05

    The overall goal of this project is to examine the role of nonspecific phosphohydrolases present in naturally occurring subsurface microorganisms for the purpose of promoting the immobilization of radionuclides through the production of uranium [U(VI)] phosphate precipitates. Specifically, we hypothesize that the precipitation of U(VI) phosphate minerals may be promoted through the microbial release and/or accumulation of PO{sub 4}{sup 3-}. During this phase of the project we have been conducting assays to determine the effects of pH, inorganic anions and organic ligands on U(VI) mineral formation and precipitation when FRC bacterial isolates were grown in simulated groundwater medium. The molecular characterization of FRC isolates has also been undertaken during this phase of the project. Analysis of a subset of gram-positive FRC isolates cultured from FRC soils (Areas 1, 2 and 3) and background sediments have indicated a higher percentage of isolates exhibiting phosphatase phenotypes (i.e., in particular those surmised to be PO{sub 4}{sup 3-}-irrepressible) relative to isolates from the reference site. A high percentage of strains that exhibited such putatively PO{sub 4}{sup 3-}-irrepressible phosphatase phenotypes were also resistant to the heavy metals lead and cadmium. Previous work on FRC strains, including Arthrobacter, Bacillus and Rahnella spp., has demonstrated differences in tolerance to U(VI) toxicity (200 {micro}M) in the absence of organophosphate substrates. For example, Arthrobacter spp. exhibited the greatest tolerance to U(VI) while the Rahnella spp. have been shown to facilitate the precipitation of U(VI) from solution and the Bacillus spp. demonstrate the greatest sensitivity to acidic conditions and high concentrations of U(VI). PCR-based detection of FRC strains are being conducted to determine if non-specific acid phosphatases of the known molecular classes [i.e., classes A, B and C] are present in these FRC isolates. Additionally, these

  11. Protein Phosphatase 2A Signaling in Human Prostate Cancer

    DTIC Science & Technology

    2012-06-01

    immunoblot and malachite green based assay, respectively. We observe that LNCaP- shPPP2CA cells have low PP2ACα expression (Figure 1A) and activity...regulated family of serine/threonine phosphatases implicated in cell growth and signalling. Biochem J 2001;353:417-39. (6) Jennbacken K, Gustavsson H...cancer cells - - - shPPP2CA. Expression and activity of catalytic subunit of PP2A (PP2ACα) was determined by immunoblot and melachite green - based

  12. Targeting Protein Tyrosine Phosphatases for Anticancer Drug Discovery

    PubMed Central

    Scott, Latanya. M.; Lawrence, Harshani. R.; Sebti, Saïd. M.; Lawrence, Nicholas. J.; Wu, Jie.

    2010-01-01

    Protein tyrosine phosphatases (PTPs) are a diverse family of enzymes encoded by 107 genes in the human genome. Together with protein tyrosine kinases (PTKs), PTPs regulate various cellular activities essential for the initiation and maintenance of malignant phenotypes. While PTK inhibitors are now used routinely for cancer treatment, the PTP inhibitor development field is still in the discovery phase. In this article, the suitability of targeting PTPs for novel anticancer drug discovery is discussed. Examples are presented for PTPs that have been targeted for anticancer drug discovery as well as potential new PTP targets for novel anticancer drug discovery. PMID:20337577

  13. Evans Blue and other dyes as protein tyrosine phosphatase inhibitors.

    PubMed

    Shrestha, Suja; Shim, Yi Sup; Kim, Ki Chul; Lee, Keun-Hyeung; Cho, Hyeongjin

    2004-04-19

    Commonly used dyes including Evans Blue and Trypan Blue were examined for their inhibitory activities against protein tyrosine phosphatases (PTPases), all of them showed inhibition of PTPases with different potencies. Of the 13 dyes tested, four exhibited IC(50) value of less than 10 microM, Evans Blue lowest IC(50) of 1.3 microM against PTP1B. Care must be taken in the use of dyes for clinical or biochemical experiments to avoid unwanted side effects. Some of the low molecular weight dyes might be useful as lead compounds for the development of potent and selective PTPase inhibitors.

  14. Regulation of TGF-β Signaling by Protein Phosphatases

    PubMed Central

    Liu, Ting; Feng, Xin-Hua

    2011-01-01

    Tight regulation of TGF-β superfamily signaling is important for normal cellular functions and tissue homeostasis. Since TGF-β superfamily signaling pathways are activated by a short phosphorylation cascade, from receptor phosphorylation to subsequent phosphorylation and activation of downstream signal transducer R-Smads, reversible phosphorylation serves as a critical step to assure the proper TGF-β signaling. This article will review the current progress on the understanding of dynamic phosphorylation in TGF-β signaling and the essential role of protein phosphatases in this process. PMID:20704570

  15. The protein phosphatase-1/inhibitor-2 complex differentially regulates GSK3 dephosphorylation and increases sarcoplasmic/endoplasmic reticulum calcium ATPase 2 levels

    SciTech Connect

    King, Taj D.; Gandy, Johanna C.; Bijur, Gautam N. . E-mail: gautam@uab.edu

    2006-11-01

    The ubiquitously expressed protein glycogen synthase kinase-3 (GSK3) is constitutively active, however its activity is markedly diminished following phosphorylation of Ser21 of GSK3{alpha} and Ser9 of GSK3{beta}. Although several kinases are known to phosphorylate Ser21/9 of GSK3, for example Akt, relatively much less is known about the mechanisms that cause the dephosphorylation of GSK3 at Ser21/9. In the present study KCl-induced plasma membrane depolarization of SH-SY5Y cells, which increases intracellular calcium concentrations caused a transient decrease in the phosphorylation of Akt at Thr308 and Ser473, and GSK3 at Ser21/9. Overexpression of the selective protein phosphatase-1 inhibitor protein, inhibitor-2, increased basal GSK3 phosphorylation at Ser21/9 and significantly blocked the KCl-induced dephosphorylation of GSK3{beta}, but not GSK3{alpha}. The phosphorylation of Akt was not affected by the overexpression of inhibitor-2. GSK3 activity is known to affect sarcoplasmic/endoplasmic reticulum calcium ATPase 2 (SERCA2) levels. Overexpression of inhibitor-2 or treatment of cells with the GSK3 inhibitors lithium and SB216763 increased the levels of SERCA2. These results indicate that the protein phosphatase-1/inhibitor-2 complex differentially regulates GSK3 dephosphorylation induced by KCl and that GSK3 activity regulates SERCA2 levels.

  16. Structure-function analysis of 2-keto-3-deoxy-D-glycero-D-galactonononate-9-phosphate phosphatase defines specificity elements in type C0 haloalkanoate dehalogenase family members.

    PubMed

    Lu, Zhibing; Wang, Liangbing; Dunaway-Mariano, Debra; Allen, Karen N

    2009-01-09

    The phosphotransferases of the haloalkanoate dehalogenase superfamily (HADSF) act upon a wide range of metabolites in all eukaryotes and prokaryotes and thus constitute a significant force in cell function. The challenge posed for biochemical function assignment of HADSF members is the identification of the structural determinants that target a specific metabolite. The "8KDOP" subfamily of the HADSF is defined by the known structure and catalytic activity of 2-keto-3-deoxy-8-phospho-d-manno-octulosonic acid (KDO-8-P) phosphatase. Homologues of this enzyme have been uniformly annotated as KDO-8-P phosphatase. One such gene, BT1713, from the Bacteroides thetaiotaomicron genome was recently found to encode the enzyme 2-keto-3-deoxy-d-glycero-d-galacto-9-phosphonononic acid (KDN-9-P) phosphatase in the biosynthetic pathway of the 9-carbon alpha-keto acid, 2-keto-3-deoxy-d-glycero-d-galactonononic acid (KDN). To find the structural elements that provide substrate-specific interactions and to allow identification of genomic sequence markers, the x-ray crystal structures of BT1713 liganded to the cofactor Mg(2+)and complexed with tungstate or VO(3)(-)/Neu5Ac were determined to 1.1, 1.85, and 1.63 A resolution, respectively. The structures define the active site to be at the subunit interface and, as confirmed by steady-state kinetics and site-directed mutagenesis, reveal Arg-64(*), Lys-67(*), and Glu-56 to be the key residues involved in sugar binding that are essential for BT1713 catalytic function. Bioinformatic analyses of the differentially conserved residues between BT1713 and KDO-8-P phosphatase homologues guided by the knowledge of the structure-based specificity determinants define Glu-56 and Lys-67(*) to be the key residues that can be used in future annotations.

  17. Simplified preparation of a phosphatase inhibitor and further studies of its action.

    PubMed

    Coburn, S P; Schaltenbrand, W E

    1978-05-01

    1-Pyrrolidinecarbothioic acid (2-pyridylmethylene) hydrazide chelates Zn2+ but not Mg2+. This compound is about twice as effective as EDTA for inhibiting alkaline phosphatase from calf mucosa, and approx. 1000-fold more effective than EDTA for inhibiting acid phosphatase from wheat germ. The compound did not inhibit pyridoxine kinase activity in human leucocytes at the highest concentration tested (33 micron). Therefore it may be a useful tool for either examining or eliminating the effects of phosphatases in complex enzyme systems.

  18. Key role of succinate dehydrogenase in insulin-induced inactivation of protein tyrosine phosphatases.

    PubMed

    Pomytkin, I A; Kolesova, O E

    2002-06-01

    We studied the role of mitochondria in insulin-induced inactivation of protein tyrosine phosphatases in the liver. The mitochondrial respiratory chain is an insulin-sensitive source of H(2)O(2)that acts as a physiological inhibitor of protein tyrosine phosphatases. Succinate dehydrogenase plays a key role in insulin-stimulated generation of H(2)O(2)and inactivation of liver protein tyrosine phosphatases.

  19. Trypanosoma rangeli: differential expression of ecto-phosphatase activities in response to inorganic phosphate starvation.

    PubMed

    Dick, Claudia Fernanda; Dos-Santos, André Luiz Araújo; Fonseca-de-Souza, André L; Rocha-Ferreira, Juliana; Meyer-Fernandes, José Roberto

    2010-04-01

    In this work, we showed that living cells of Trypanosoma rangeli express different ecto-phosphatase activities in response to different inorganic phosphate (Pi) concentrations in the culture medium. The ecto-phosphatase activity from T. rangeli grown at low-Pi concentration was inhibited by the increase of the pH, while the ecto-phosphatase of the cells grown at high Pi concentration was not modulated by the change of the pH of the medium. Okadaic acid inhibited only the ecto-phosphatase activity from cells grown at low-Pi concentration but not the ecto-phosphatase activity from cells grown at high-Pi concentration. Accordingly, phosphatase activity from T. rangeli grown at low Pi concentration was able to hydrolyze P-serine and P-threonine at high rate but not P-tyrosine. The phosphatase activity from T. rangeli grown at high-Pi concentration was able to hydrolyze P-serine, P-threonine and P-tyrosine with the same rate. The addition of anterior midgut homogenate of Rhodnius prolixus on the epimastigotes suspension inhibited the enzyme activity of T. rangeli grown at low-Pi concentration. On the other hand, anterior midgut homogenate had no effect in the ecto-phosphatase of T. rangeli maintained at high-Pi concentration. Altogether, the results described here indicate that ecto-phosphatase activities hydrolyzing phosphorylated compounds present in the extracellular medium of T. rangeli are regulated by the external Pi concentration.

  20. Alkaline Phosphatase Assay for Freshwater Sediments: Application to Perturbed Sediment Systems

    PubMed Central

    Sayler, Gary S.; Puziss, Marla; Silver, Martin

    1979-01-01

    The p-nitrophenyl phosphate hydrolysis-phosphatase assay was modified for use in freshwater sediment. Laboratory studies indicated that the recovery of purified alkaline phosphatase activity was 100% efficient in sterile freshwater sediments when optimized incubation and sonication conditions were used. Field studies of diverse freshwater sediments demonstrated the potential use of this assay for determining stream perturbation. Significant correlations between phosphatase and total viable cell counts, as well as adenosine triphosphate biomass, suggested that alkaline phosphatase activity has utility as an indicator of microbial population density and biomass in freshwater sediments. PMID:16345464

  1. Phosphatase of Chlamydomonas reinhardi: biochemical and cytochemical approach with specific mutants.

    PubMed Central

    Matagne, R F; Loppes, R; Deltour, R

    1976-01-01

    The unicellular alga Chlamydomonas reinhardi produces two constitutive acid phosphatases and three depressible phosphatases (a neutral and two alkaline ones) that can utilize napthyl phosphate as a substrate. Specific mutants depressible phosphatase were used to investigate biochemical properties and the cytochemical localization of these enzymes. The two constitutive phosphatases show similar pH optima (about 5.0) and Km values (2 x 10(-3) to 3.3 x 10(-3) M) but differ in their heat sensitivity and affinity for glycerophosphate. Images PMID:4437

  2. Effect of aluminum phosphate on alkaline phosphatase activity of polyurethane foam immobilized cyanobacteria.

    PubMed

    Ramalingam, N; Prasanna, B Gowtham

    2006-09-01

    The impact of insoluble phosphorus such as aluminum and rock phosphate on alkaline phosphatase activity of polyurethane foam immobilized cyanobacteria was assessed. Polyurethane foam immobilized Nodularia recorded the highest alkaline phosphatase activity of 9.04 (m. mol p-nitrophenol released h(-1) mg(-1) protein) in vitro. A higher concentration of aluminum phosphate was recorded a 25% reduction in alkaline phosphatase activity, ammonia content, and available phosphorus in culture filtrate of polyurethane foam immobilized cyanobacteria. In general, immobilized cyanobacteria exhibited a higher alkaline phosphatase activity in rock phosphate than aluminum phosphate.

  3. Characterization of the 2',3' cyclic phosphodiesterase activities of Clostridium thermocellum polynucleotide kinase-phosphatase and bacteriophage lambda phosphatase.

    PubMed

    Keppetipola, Niroshika; Shuman, Stewart

    2007-01-01

    Clostridium thermocellum polynucleotide kinase-phosphatase (CthPnkp) catalyzes 5' and 3' end-healing reactions that prepare broken RNA termini for sealing by RNA ligase. The central phosphatase domain of CthPnkp belongs to the dinuclear metallophosphoesterase superfamily exemplified by bacteriophage lambda phosphatase (lambda-Pase). CthPnkp is a Ni(2+)/Mn(2+)-dependent phosphodiesterase-monoesterase, active on nucleotide and non-nucleotide substrates, that can be transformed toward narrower metal and substrate specificities via mutations of the active site. Here we characterize the Mn(2+)-dependent 2',3' cyclic nucleotide phosphodiesterase activity of CthPnkp, the reaction most relevant to RNA repair pathways. We find that CthPnkp prefers a 2',3' cyclic phosphate to a 3',5' cyclic phosphate. A single H189D mutation imposes strict specificity for a 2',3' cyclic phosphate, which is cleaved to form a single 2'-NMP product. Analysis of the cyclic phosphodiesterase activities of mutated CthPnkp enzymes illuminates the active site and the structural features that affect substrate affinity and k(cat). We also characterize a previously unrecognized phosphodiesterase activity of lambda-Pase, which catalyzes hydrolysis of bis-p-nitrophenyl phosphate. lambda-Pase also has cyclic phosphodiesterase activity with nucleoside 2',3' cyclic phosphates, which it hydrolyzes to yield a mixture of 2'-NMP and 3'-NMP products. We discuss our results in light of available structural and functional data for other phosphodiesterase members of the binuclear metallophosphoesterase family and draw inferences about how differences in active site composition influence catalytic repertoire.

  4. Catalytic and substrate promiscuity: distinct multiple chemistries catalysed by the phosphatase domain of receptor protein tyrosine phosphatase.

    PubMed

    Srinivasan, Bharath; Marks, Hanna; Mitra, Sreyoshi; Smalley, David M; Skolnick, Jeffrey

    2016-07-15

    The presence of latent activities in enzymes is posited to underlie the natural evolution of new catalytic functions. However, the prevalence and extent of such substrate and catalytic ambiguity in evolved enzymes is difficult to address experimentally given the order-of-magnitude difference in the activities for native and, sometimes, promiscuous substrate/s. Further, such latent functions are of special interest when the activities concerned do not fall into the domain of substrate promiscuity. In the present study, we show a special case of such latent enzyme activity by demonstrating the presence of two mechanistically distinct reactions catalysed by the catalytic domain of receptor protein tyrosine phosphatase isoform δ (PTPRδ). The primary catalytic activity involves the hydrolysis of a phosphomonoester bond (C─O─P) with high catalytic efficiency, whereas the secondary activity is the hydrolysis of a glycosidic bond (C─O─C) with poorer catalytic efficiency. This enzyme also displays substrate promiscuity by hydrolysing diester bonds while being highly discriminative for its monoester substrates. To confirm these activities, we also demonstrated their presence on the catalytic domain of protein tyrosine phosphatase Ω (PTPRΩ), a homologue of PTPRδ. Studies on the rate, metal-ion dependence, pH dependence and inhibition of the respective activities showed that they are markedly different. This is the first study that demonstrates a novel sugar hydrolase and diesterase activity for the phosphatase domain (PD) of PTPRδ and PTPRΩ. This work has significant implications for both understanding the evolution of enzymatic activity and the possible physiological role of this new chemistry. Our findings suggest that the genome might harbour a wealth of such alternative latent enzyme activities in the same protein domain that renders our knowledge of metabolic networks incomplete. © 2016 The Author(s). published by Portland Press Limited on behalf of the

  5. Mass loss in Alpha Cygni - Synthetic H-Alpha profiles

    NASA Technical Reports Server (NTRS)

    Kunasz, P. B.; Morrison, N. D.

    1982-01-01

    Alpha Cygni (A2 Ia) is the brightest and best-studied A type supergiant. The star's position in the H-R diagram makes the determination of its mass loss rate extremely important. The present investigation is concerned with a semiempirical modeling of the H-alpha profile in Alpha Cyg in connection with the objective of estimating the mass loss rate and further constraining the physical state of the stellar wind. The synthetic H-alpha profiles considered are compared with the observed profiles in Alpha Cyg. It is concluded that a spherically symmetric, steady-state model, with the network of hydrogen transitions treated in detail, can fit the deeper observed profiles but not the shallower ones. The obtained results indicate that, within the context of the turbulent models, the mass loss rate of Alpha Cyg is (1.7 + or - 0.4) x 10 to the -7th solar mass per year.

  6. Characterization of a murine gene encoding a developmentally regulated cytoplasmic dual-specificity mitogen-activated protein kinase phosphatase.

    PubMed Central

    Dickinson, Robin J; Williams, David J; Slack, David N; Williamson, Jill; Seternes, Ole-Morten; Keyse, Stephen M

    2002-01-01

    Mitogen-activated protein kinases (MAPKs) play a vital role in cellular growth control, but far less is known about these signalling pathways in the context of embryonic development. Duration and magnitude of MAPK activation are crucial factors in cell fate decisions, and reflect a balance between the activities of upstream activators and specific MAPK phosphatases (MKPs). Here, we report the isolation and characterization of the murine Pyst3 gene, which encodes a cytosolic dual-specificity MKP. This enzyme selectively interacts with, and is catalytically activated by, the 'classical' extracellular signal-regulated kinases (ERKs) 1 and 2 and, to a lesser extent, the stress-activated MAPK p38alpha. These properties define the ability of this enzyme to dephosphorylate and inactivate ERK1/2 and p38alpha, but not JNK (c-Jun N-terminal kinase) in vivo. When expressed in mammalian cells, the Pyst3 protein is predominantly cytoplasmic. Furthermore, leptomycin B causes a complete redistribution of the protein to the nucleus, implicating a CRM (chromosomal region maintenance)1/exportin 1-dependent nuclear export signal in determining the subcellular localization of this enzyme. Finally, whole-mount in situ hybridization studies in mouse embryos reveal that the Pyst3 gene is expressed specifically in the placenta, developing liver and in migratory muscle cells. Our results suggest that this enzyme may have a critical role in regulating the activity of MAPK signalling during early development and organogenesis. PMID:11988087

  7. Specific Immunoassays for Placental Alkaline Phosphatase As a Tumor Marker

    PubMed Central

    Stinghen, Sérvio T.; Moura, Juliana F.; Zancanella, Patrícia; Rodrigues, Giovanna A.; Pianovski, Mara A.; Lalli, Enzo; Arnold, Dodie L.; Minozzo, João C.; Callefe, Luis G.; Ribeiro, Raul C.; Figueiredo, Bonald C.

    2006-01-01

    Human placental (hPLAP) and germ cell (PLAP-like) alkaline phosphatases are polymorphic and heat-stable enzymes. This study was designed to develop specific immunoassays for quantifying hPLAP and PLAP-like enzyme activity (EA) in sera of cancer patients, pregnant women, or smokers. Polyclonal sheep anti-hPLAP antibodies were purified by affinity chromatography with whole hPLAP protein (ICA-PLAP assay) or a synthetic peptide (aa 57–71) of hPLAP (ICA-PEP assay); the working range was 0.1–11 U/L and cutoff value was 0.2 U/L EA for nonsmokers. The intra- and interassay coefficients of variation were 3.7%–6.5% (ICA-PLAP assay) and 9.0%–9.9% (ICA-PEP assay). An insignificant cross-reactivity was noted for high levels of unheated intestinal alkaline phosphatase in ICA-PEP assay. A positive correlation between the regression of tumor size and EA was noted in a child with embryonal carcinoma. It can be concluded that ICA-PEP assay is more specific than ICA-PLAP, which is still useful to detect other PLAP/PLAP-like phenotypes. PMID:17489017

  8. Dual Specificity Phosphatase 5 Is Essential for T Cell Survival

    PubMed Central

    Schauder, David M.; Cossette, Stephanie M.; Bordas, Michelle; Cui, Weiguo; Ramchandran, Ramani

    2016-01-01

    The mitogen-activated protein kinase (MAPK) pathway regulates many key cellular processes such as differentiation, apoptosis, and survival. The final proteins in this pathway, ERK1/2, are regulated by dual specificity phosphatase 5 (DUSP5). DUSP5 is a nuclear, inducible phosphatase with high affinity and fidelity for ERK1/2. By regulating the final step in the MAPK signaling cascade, DUSP5 exerts strong regulatory control over a central cellular pathway. Like other DUSPs, DUSP5 plays an important role in immune function. In this study, we have utilized new knockout mouse reagents to explore its function further. We demonstrate that global loss of DUSP5 does not result in any gross phenotypic changes. However, loss of DUSP5 affects memory/effector CD8+ T cell populations in response to acute viral infection. Specifically, Dusp5-/- mice have decreased proportions of short-lived effector cells (SLECs) and increased proportions of memory precursor effector cells (MPECs) in response to infection. Further, we show that this phenotype is T cell intrinsic; a bone marrow chimera model restricting loss of DUSP5 to the CD8+ T cell compartment displays a similar phenotype. Dusp5-/- T cells also display increased proliferation, increased apoptosis, and altered metabolic profiles, suggesting that DUSP5 is a pro-survival protein in T cells. PMID:27936095

  9. Therapeutic Potential of Targeting the Oncogenic SHP2 Phosphatase

    PubMed Central

    2015-01-01

    The Src homology 2 domain containing protein tyrosine phosphatase-2 (SHP2) is an oncogenic phosphatase associated with various kinds of leukemia and solid tumors. Thus, there is substantial interest in developing SHP2 inhibitors as potential anticancer and antileukemia agents. Using a structure-guided and fragment-based library approach, we identified a novel hydroxyindole carboxylic acid-based SHP2 inhibitor 11a-1, with an IC50 value of 200 nM and greater than 5-fold selectivity against 20 mammalian PTPs. Structural and modeling studies reveal that the hydroxyindole carboxylic acid anchors the inhibitor to the SHP2 active site, while interactions of the oxalamide linker and the phenylthiophene tail with residues in the β5–β6 loop contribute to 11a-1’s binding potency and selectivity. Evidence suggests that 11a-1 specifically attenuates the SHP2-dependent signaling inside the cell. Moreover, 11a-1 blocks growth factor mediated Erk1/2 and Akt activation and exhibits excellent antiproliferative activity in lung cancer and breast cancer as well as leukemia cell lines. PMID:25003231

  10. Spatial control of protein phosphatase 2A (de)methylation

    SciTech Connect

    Longin, Sari; Zwaenepoel, Karen; Martens, Ellen; Louis, Justin V.; Rondelez, Evelien; Goris, Jozef; Janssens, Veerle

    2008-01-01

    Reversible methylation of the protein phosphatase 2A catalytic subunit (PP2A{sub C}) is an important regulatory mechanism playing a crucial role in the selective recruitment of regulatory B subunits. Here, we investigated the subcellular localization of leucine carboxyl methyltransferase (LCMT1) and protein phosphatase methylesterase (PME-1), the two enzymes catalyzing this process. The results show that PME-1 is predominantly localized in the nucleus and harbors a functional nuclear localization signal, whereas LCMT1 is underrepresented in the nucleus and mainly localizes to the cytoplasm, Golgi region and late endosomes. Indirect immunofluorescence with methylation-sensitive anti-PP2A{sub C} antibodies revealed a good correlation with the methylation status of PP2A{sub C}, demethylated PP2A{sub C} being substantially nuclear. Throughout mitosis, demethylated PP2A{sub C} is associated with the mitotic spindle and during cytokinesis with the cleavage furrow. Overexpression of PME-1, but not of an inactive mutant, results in increased demethylation of PP2A{sub C} in the nucleus, whereas overexpression of a cytoplasmic PME-1 mutant lacking the NLS results in increased demethylation in the cytoplasm-in all cases, however, without any obvious functional consequences. PME-1 associates with an inactive PP2A population, regardless of its esterase activity or localization. We propose that stabilization of this inactive, nuclear PP2A pool is a major in vivo function of PME-1.

  11. Mammalian intestinal alkaline phosphatase acts as highly active exopolyphosphatase.

    PubMed

    Lorenz, B; Schröder, H C

    2001-06-11

    Recent results revealed that inorganic polyphosphates (polyP), being energy-rich linear polymers of orthophosphate residues known from bacteria and yeast, also exist in higher eukaryotes. However, the enzymatic basis of their metabolism especially in mammalian cells is still uncertain. Here we demonstrate for the first time that alkaline phosphatase from calf intestine (CIAP) is able to cleave polyP molecules up to a chain length of about 800. The enzyme acts as an exopolyphosphatase degrading polyP in a processive manner. The pH optimum is in the alkaline range. Divalent cations are not required for catalytic activity but inhibit the degradation of polyP. The rate of hydrolysis of short-chain polyP by CIAP is comparable to that of the standard alkaline phosphatase (AP) substrate p-nitrophenyl phosphate. The specific activity of the enzyme decreases with increasing chain length of the polymer both in the alkaline and in the neutral pH range. The K(m) of the enzyme also decreases with increasing chain length. The mammalian tissue non-specific isoform of AP was not able to hydrolyze polyP under the conditions applied while the placental-type AP and the bacterial (Escherichia coli) AP displayed polyP-degrading activity.

  12. Plant species richness increases phosphatase activities in an experimental grassland

    NASA Astrophysics Data System (ADS)

    Hacker, Nina; Wilcke, Wolfgang; Oelmann, Yvonne

    2014-05-01

    Plant species richness has been shown to increase aboveground nutrient uptake requiring the mobilization of soil nutrient pools. For phosphorus (P) the underlying mechanisms for increased P release in soil under highly diverse grassland mixtures remain obscure because aboveground P storage and concentrations of inorganic and organic P in soil solution and differently reactive soil P pools are unrelated (Oelmann et al. 2011). The need of plants and soil microorganisms for P can increase the exudation of enzymes hydrolyzing organically bound P (phosphatases) which might represent an important release mechanism of inorganic P in a competitive environment such as highly diverse grassland mixtures. Our objectives were to test the effects of i) plant functional groups (legumes, grasses, non-leguminous tall and small herbs), and of (ii) plant species richness on microbial P (Pmic) and phosphatase activities in soil. In autumn 2013, we measured Pmic and alkaline phosphomonoesterase and phosphodiesterase activities in soil of 80 grassland mixtures comprising different community compositions and species richness (1, 2, 4, 8, 16, 60) in the Jena Experiment. In general, Pmic and enzyme activities were correlated (r = 0.59 and 0.46 for phosphomonoesterase and phosphodiesterase activities, respectively; p

  13. Evolution of the metazoan protein phosphatase 2C superfamily.

    PubMed

    Stern, Adi; Privman, Eyal; Rasis, Michal; Lavi, Sara; Pupko, Tal

    2007-01-01

    Members of the protein phosphatase 2C (PP2C) superfamily are Mg(2+)/Mn(2+)-dependent serine/threonine phosphatases, which are essential for regulation of cell cycle and stress signaling pathways in cells. In this study, a comprehensive genomic analysis of all available metazoan PP2C sequences was conducted. The phylogeny of PP2C was reconstructed, revealing the existence of 15 vertebrate families which arose following a series of gene duplication events. Relative dating of these duplications showed that they occurred in two active periods: before the divergence of bilaterians and before vertebrate diversification. PP2C families which duplicated during the first period take part in different signaling pathways, whereas PP2C families which diverged in the second period display tissue expression differences yet participate in similar signaling pathways. These differences were found to involve variation of expression in tissues which show higher complexity in vertebrates, such as skeletal muscle and the nervous system. Further analysis was performed with the aim of identifying the functional domains of PP2C. The conservation pattern across the entire PP2C superfamily revealed an extensive domain of more than 50 amino acids which is highly conserved throughout all PP2C members. Several insertion or deletion events were found which may have led to the specialization of each PP2C family.

  14. Inhibition of a protein tyrosine phosphatase using mesoporous oxides.

    PubMed

    Kapoor, S; Girish, T S; Mandal, S S; Gopal, B; Bhattacharyya, A J

    2010-03-11

    The feasibility of utilizing mesoporous matrices of alumina and silica for the inhibition of enzymatic activity is presented here. These studies were performed on a protein tyrosine phosphatase by the name chick retinal tyrosine phosphotase-2 (CRYP-2), a protein that is identical in sequence to the human glomerular epithelial protein-1 and involved in hepatic carcinoma. The inhibition of CRYP-2 is of tremendous therapeutic importance. Inhibition of catalytic activity was examined using the sustained delivery of p-nitrocatechol sulfate (pNCS) from bare and amine functionalized mesoporous silica (MCM-48) and mesoporous alumina (Al(2)O(3)). Among the various mesoporous matrices employed, amine functionalized MCM-48 exhibited the best release of pNCS and also inhibition of CRYP-2. The maximum speed of reaction v(max) (=160 +/- 10 micromol/mnt/mg) and inhibition constant K(i) (=85.0 +/- 5.0 micromol) estimated using a competitive inhibition model were found to be very similar to inhibition activities of protein tyrosine phosphatases using other methods.

  15. Perspective: Tyrosine phosphatases as novel targets for antiplatelet therapy.

    PubMed

    Tautz, Lutz; Senis, Yotis A; Oury, Cécile; Rahmouni, Souad

    2015-06-15

    Arterial thrombosis is the primary cause of most cases of myocardial infarction and stroke, the leading causes of death in the developed world. Platelets, highly specialized cells of the circulatory system, are key contributors to thrombotic events. Antiplatelet drugs, which prevent platelets from aggregating, have been very effective in reducing the mortality and morbidity of these conditions. However, approved antiplatelet therapies have adverse side effects, most notably the increased risk of bleeding. Moreover, there remains a considerable incidence of arterial thrombosis in a subset of patients receiving currently available drugs. Thus, there is a pressing medical need for novel antiplatelet agents with a more favorable safety profile and less patient resistance. The discovery of novel antiplatelet targets is the matter of intense ongoing research. Recent findings demonstrate the potential of targeting key signaling molecules, including kinases and phosphatases, to prevent platelet activation and aggregation. Here, we offer perspectives to targeting members of the protein tyrosine phosphatase (PTP) superfamily, a major class of enzymes in signal transduction. We give an overview of previously identified PTPs in platelet signaling, and discuss their potential as antiplatelet drug targets. We also introduce VHR (DUSP3), a PTP that we recently identified as a major player in platelet biology and thrombosis. We review our data on genetic deletion as well as pharmacological inhibition of VHR, providing proof-of-principle for a novel and potentially safer VHR-based antiplatelet therapy. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. Intestinal alkaline phosphatase: novel functions and protective effects.

    PubMed

    Lallès, Jean-Paul

    2014-02-01

    Important protective roles of intestinal alkaline phosphatase (IAP)--including regulation of intestinal surface pH, absorption of lipids, detoxification of free nucleotides and bacterial lipopolysaccharide, attenuation of intestinal inflammation, and possible modulation of the gut microbiota--have been reviewed recently. IAP is modulated by numerous nutritional factors. The present review highlights new findings on the properties of IAP and extends the list of its protective functions. Critical assessment of data suggests that some IAP properties are a direct result of dephosphorylation of proinflammatory moieties, while others (e.g., gut barrier protection and microbiota shaping) may be secondary to IAP-mediated downregulation of inflammation. IAP and tissue-nonspecific alkaline phosphatase isoforms characterize the small intestine and the colon, respectively. Gastrointestinal administration of exogenous IAP ameliorates gut inflammation and favors gut tissue regeneration, whereas enteral and systemic IAP administration attenuates systemic inflammation only. Finally, the IAP gene family has a strong evolutionary link to food-driven changes in gastrointestinal tract anatomy and microbiota composition. Therefore, stimulation of IAP activity by dietary intervention is a goal for preserving gut homeostasis and health by minimizing low-grade inflammation. © 2013 International Life Sciences Institute.

  17. Regulation of FcεRI signaling by lipid phosphatases.

    PubMed

    Kuhny, Marcel; Zorn, Carolin N; Huber, Michael

    2014-01-01

    Mast cells (MCs) are tissue-resident sentinels of hematopoietic origin that play a prominent role in allergic diseases. They express the high-affinity receptor for IgE (FcεRI), which when cross-linked by multivalent antigens triggers the release of preformed mediators, generation of arachidonic acid metabolites, and the synthesis of cytokines and chemokines. Stimulation of the FcεRI with increasing antigen concentrations follows a characteristic bell-shaped dose-responses curve. At high antigen concentrations, the so-called supra-optimal conditions, repression of FcεRI-induced responses is facilitated by activation and incorporation of negative signaling regulators. In this context, the SH2-containing inositol-5'-phosphatase, SHIP1, has been demonstrated to be of particular importance. SHIP1 with its catalytic and multiple protein interaction sites provides several layers of control for FcεRI signaling. Regulation of SHIP1 function occurs on various levels, e.g., protein expression, receptor and membrane recruitment, competition for protein-protein interaction sites, and activating modifications enhancing the phosphatase function. Apart from FcεRI-mediated signaling, SHIP1 can be activated by diverse unrelated receptor systems indicating its involvement in the regulation of antigen-dependent cellular responses by autocrine feedback mechanisms or tissue-specific and/or (patho-) physiologically determined factors. Thus, pharmacologic engagement of SHIP1 may represent a beneficial strategy for patients suffering from acute or chronic inflammation or allergies.

  18. Activity of alkaline phosphatase adsorbed and grafted on "polydopamine" films.

    PubMed

    Ball, Vincent

    2014-09-01

    The oxidation of dopamine in slightly basic solutions and in the presence of oxygen as an oxidant allows for the deposition of dopamine-eumelanin ("polydopamine") films on almost all kinds of materials allowing for an easy secondary functionalization. Molecules carrying nucleophilic groups like thiols and amines can be easily grafted on those films. Herein we show that alkaline phosphatase (ALP), as a model enzyme, adsorbs to "polydopamine" films and part of the adsorbed enzyme is rapidly desorbed in contact with Tris buffer. However a significant part of the enzyme remains irreversibly adsorbed and keeps some enzymatic activity for at least 2 weeks whereas ALP adsorbed on quartz slides is rapidly and quantitatively deactivated. In addition we estimated the Michaelis constant Km of the enzyme irreversibly bound to the "polydopamine" film. The Michaelis constant, and hence the affinity constant between paranitrophenol phosphate and ALP are almost identical between the enzyme bound on the film and the free enzyme in solution. Complementarily, it was found that "polydopamine" films display some phosphatase like catalytic activity. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Possible functions of alkaline phosphatase in dental mineralization: cadmium effects.

    PubMed

    Wöltgens, J H; Lyaruu, D M; Bervoets, T J

    1991-06-01

    In mineralizing dental tissues the non-specific alkaline phosphatase, using paranitrophenylphosphate (p-NPP) as substrate, is also capable of splitting inorganic pyrophosphate (PPi). In contrast to the p-NPP-ase part of the enzyme, the PPi-ase part requires Zn2+ as a cofactor for its hydrolytic activity. The PPi-ase activity of the enzyme can be inhibited by cadmium ions (Cd2+), perhaps by replacing Zn2+ from the active site of the enzyme molecule. In addition to splitting PPi, the PPi-ase part of the enzyme may also be involved in the phosphorylation process of yet undetermined organic macromolecules. Cd2+ inhibits this phosphorylation process. Inhibition of the PPi-ase activity can also be accomplished by ascorbic acid known for its capacity to complex bivalent cations. Ascorbic acid may accordingly also remove Zn2+ from the active site of the PPi-ase. It is suggested that in developing dental tissues alkaline phosphatase is not only associated with the transport of phosphate ions towards the mineralization front, but is also involved in the phosphorylation of organic macromolecules, a process activated the PPi-ase part of the enzyme.

  20. Isozymes of bovine intestinal alkaline phosphatase. Characterization and functional studies

    SciTech Connect

    Besman, M.J.A.

    1986-01-01

    The membrane-associated alkaline phosphatases of calf and adult bovine small intestines have been isolated to homogeneity by a novel method developed to purify large quantities of enzyme. Chromatofocusing revealed the existence of two isozymes in calf tissue while only one form was present in the adult. The three amphiphilic metallo protein dimers were characterized as to total amino acid and carbohydrate content, zinc stoichiometries and mode of carbohydrate linkage. The molecular relationship between the three enzymes was defined by tryptic peptide HPLC-mapping and N-terminal sequencing, and demonstrated the existence of two calf isozymes of unique primary sequence, only one of which is expressed in the adult animal. In the presence of protease inhibitors, two new, higher M/sub r/ species (66,000 and 62,000 daltons vs 60,000 daltons) of adult bovine alkaline phosphatase were demonstrated by electrophoresis of /sup 32/P/sub i/-labeled tissue, probing gels by autoradiography and Western blotting. The in vivo enzyme was isolated using a modified, rapid procedure; the two higher M/sub r/ species copurified.

  1. Characterization of Schistosome Tegumental Alkaline Phosphatase (SmAP)

    PubMed Central

    Bhardwaj, Rita; Skelly, Patrick J.

    2011-01-01

    Schistosomes are parasitic platyhelminths that currently infect over 200 million people globally. The parasites can live for years in a putatively hostile environment - the blood of vertebrates. We have hypothesized that the unusual schistosome tegument (outer-covering) plays a role in protecting parasites in the blood; by impeding host immunological signaling pathways we suggest that tegumental molecules help create an immunologically privileged environment for schistosomes. In this work, we clone and characterize a schistosome alkaline phosphatase (SmAP), a predicted ∼60 kDa glycoprotein that has high sequence conservation with members of the alkaline phosphatase protein family. The SmAP gene is most highly expressed in intravascular parasite life stages. Using immunofluorescence and immuno-electron microscopy, we confirm that SmAP is expressed at the host/parasite interface and in internal tissues. The ability of living parasites to cleave exogenous adenosine monophosphate (AMP) and generate adenosine is very largely abolished when SmAP gene expression is suppressed following RNAi treatment targeting the gene. These results lend support to the hypothesis that schistosome surface enzymes such as SmAP could dampen host immune responses against the parasites by generating immunosuppressants such as adenosine to promote their survival. This notion does not rule out other potential functions for the adenosine generated e.g. in parasite nutrition. PMID:21483710

  2. New functional aspects of the atypical protein tyrosine phosphatase VHZ.

    PubMed

    Kuznetsov, Vyacheslav I; Hengge, Alvan C

    2013-11-12

    LDP3 (VHZ) is the smallest classical protein tyrosine phosphatase (PTP) known to date and was originally misclassified as an atypical dual-specificity phosphatase. Kinetic isotope effects with steady-state and pre-steady-state kinetics of VHZ and mutants with p-nitrophenol phosphate have revealed several unusual properties. VHZ is significantly more active than previously reported but remains one of the least active PTPs. Highly unusual for a PTP, VHZ possesses two acidic residues (E134 and D65) in the active site. D65 occupies the position corresponding to the typical general acid in the PTP family. However, VHZ primarily utilizes E134 as the general acid, with D65 taking over this role when E134 is mutated. This unusual behavior is facilitated by two coexisting, but unequally populated, substrate binding modes. Unlike most classical PTPs, VHZ exhibits phosphotransferase activity. Despite the presence of the Q-loop that normally prevents alcoholysis of the phosphoenzyme intermediate in other classical PTPs, VHZ readily phosphorylates ethylene glycol. Although mutations of Q-loop residues affect this phosphotransferase activity, mutations on the IPD loop that contains the general acid exert more control over this process. A single P68V substitution on this loop completely abolishes phosphotransferase activity. The ability of native VHZ to catalyze transphosphorylation may lead to an imbalance of intracellular phosphorylation, which could explain the correlation of its overexpression with several types of cancer.

  3. S100 Proteins Modulate Protein Phosphatase 5 Function

    PubMed Central

    Yamaguchi, Fuminori; Umeda, Yoshinori; Shimamoto, Seiko; Tsuchiya, Mitsumasa; Tokumitsu, Hiroshi; Tokuda, Masaaki; Kobayashi, Ryoji

    2012-01-01

    PP5 is a unique member of serine/threonine phosphatases comprising a regulatory tetratricopeptide repeat (TPR) domain and functions in signaling pathways that control many cellular responses. We reported previously that Ca2+/S100 proteins directly associate with several TPR-containing proteins and lead to dissociate the interactions of TPR proteins with their client proteins. Here, we identified protein phosphatase 5 (PP5) as a novel target of S100 proteins. In vitro binding studies demonstrated that S100A1, S100A2, S100A6, and S100B proteins specifically interact with PP5-TPR and inhibited the PP5-Hsp90 interaction. In addition, the S100 proteins activate PP5 by using a synthetic phosphopeptide and a physiological protein substrate, Tau. Overexpression of S100A1 in COS-7 cells induced dephosphorylation of Tau. However, S100A1 and permanently active S100P inhibited the apoptosis signal-regulating kinase 1 (ASK1) and PP5 interaction, resulting the inhibition of dephosphorylation of phospho-ASK1 by PP5. The association of the S100 proteins with PP5 provides a Ca2+-dependent regulatory mechanism for the phosphorylation status of intracellular proteins through the regulation of PP5 enzymatic activity or PP5-client protein interaction. PMID:22399290

  4. Protein kinase and phosphatase activities of thylakoid membranes

    SciTech Connect

    Michel, H.; Shaw, E.K.; Bennett, J.

    1987-01-01

    Dephosphorylation of the 25 and 27 kDa light-harvesting Chl a/b proteins (LHCII) of the thylakoid membranes is catalyzed by a phosphatase which differs from previously reported thylakoid-bound phosphatases in having an alkaline pH optimum (9.0) and a requirement for Mg/sup 2 +/ ions. Dephosphorylation of the 8.3 kDa psb H gene product requires a Mg/sup 2 +/ ion concentration more than 200 fold higher than that for dephosphorylation of LHC II. The 8.3 kDa and 27 kDa proteins appear to be phosphorylated by two distinct kinases, which differ in substrate specificity and sensitivity to inhibitors. The plastoquinone antagonist 2,5-dibromo-3-methyl-6-isopropyl-benzoquinone (DBMIB) inhibits phosphorylation of the 27 kDa LHC II much more readily than phosphorylation of the 8.3 kDa protein. A similar pattern of inhibition is seen for two synthetic oligopeptides (MRKSATTKKAVC and ATQTLESSSRC) which are analogs of the phosphorylation sites of the two proteins. Possible modes of action of DBMIB are discussed. 45 refs., 7 figs., 3 tabs.

  5. Detailed Structural Characterization of Unbound Protein Phosphatase 1 Inhibitors

    PubMed Central

    Dancheck, Barbara; Nairn, Angus C.; Peti, Wolfgang

    2009-01-01

    Protein Phosphatase 1 (PP1) is an essential and ubiquitous serine/threonine protein phosphatase that is regulated by more than 100 known inhibitor and targeting proteins. It is currently unclear how protein inhibitors distinctly and specifically regulate PP1 to enable rapid responses to cellular alterations. We demonstrate that two PP1 inhibitors, I-2 and DARPP-32, belong to the class of intrinsically unstructured proteins (IUPs). We show that both inhibitors have distinct preferences for transient local and long range structure. These preferences are likely their structural signature for their interaction with PP1. Furthermore, we show that upon phosphorylation of Thr34 in DARPP-32, which turns DARPP-32 into a potent inhibitor of PP1, neither local nor long range structure of DARPP-32 is altered. Therefore, our data suggests a role for these transient 3-dimensional topologies in binding mechanisms that enable extensive contacts with PP1's invariant surfaces. Together, these interactions enable potent and selective inhibition of PP1. PMID:18954090

  6. Protein Phosphatase 1α Interacting Proteins in the Human Brain

    PubMed Central

    Esteves, Sara L.C.; Domingues, Sara C.; da Cruz e Silva, Odete A.B.; da Cruz e Silva, Edgar F.

    2012-01-01

    Abstract Protein Phosphatase 1 (PP1) is a major serine/threonine-phosphatase whose activity is dependent on its binding to regulatory subunits known as PP1 interacting proteins (PIPs), responsible for targeting PP1 to a specific cellular location, specifying its substrate or regulating its action. Today, more than 200 PIPs have been described involving PP1 in panoply of cellular mechanisms. Moreover, several PIPs have been identified that are tissue and event specific. In addition, the diversity of PP1/PIP complexes can further be achieved by the existence of several PP1 isoforms that can bind preferentially to a certain PIP. Thus, PP1/PIP complexes are highly specific for a particular function in the cell, and as such, they are excellent pharmacological targets. Hence, an in-depth survey was taken to identify specific PP1α PIPs in human brain by a high-throughput Yeast Two-Hybrid approach. Sixty-six proteins were recognized to bind PP1α, 39 being novel PIPs. A large protein interaction databases search was also performed to integrate with the results of the PP1α Human Brain Yeast Two-Hybrid and a total of 246 interactions were retrieved. PMID:22321011

  7. A fragment of alpha-actinin promotes monocyte/macrophage maturation in vitro.

    PubMed

    Luikart, S; Wahl, D; Hinkel, T; Masri, M; Oegema, T

    1999-02-01

    Conditioned media (CM) from cultures of HL-60 myeloid leukemia cells grown on extracellular bone marrow matrix contains a factor that induces macrophage-like maturation of HL-60 cells. This factor was purified from the CM of HL-60 cells grown on bone marrow stroma by ammonium sulfate precipitation, then sequential chromatography on DEAE, affi-gel blue affinity, gel exclusion, and wheat germ affinity columns, followed by C-4 reverse phase HPLC, and SDS-PAGE. The maturation promoting activity of the CM was identified in a single 31 kD protein. Amino acid sequence analysis of four internal tryptic peptides of this protein confirmed significant homology with amino acid residues 48-60, 138-147, 215-220, and 221-236 of human cytoskeletal alpha-actinin. An immunoaffinity purified rabbit polyclonal anti-chicken alpha-actinin inhibited the activity of HL-60 conditioned media. A 27 kD amino-terminal fragment of alpha-actinin produced by thermolysin digestion of chicken gizzard alpha-actinin, but not intact alpha-actinin, had maturation promoting activity on several cell types, including blood monocytes, as measured by lysozyme secretion and tartrate-resistant acid phosphatase staining. We conclude that an extracellular alpha-actinin fragment can promote monocyte/macrophage maturation. This represents the first example of a fragment of a cytoskeletal component, which may be released during tissue remodeling and repair, playing a role in phagocyte maturation.

  8. Background canceling surface alpha detector

    DOEpatents

    MacArthur, D.W.; Allander, K.S.; Bounds, J.A.

    1996-06-11

    A background canceling long range alpha detector which is capable of providing output proportional to both the alpha radiation emitted from a surface and to radioactive gas emanating from the surface. The detector operates by using an electrical field between first and second signal planes, an enclosure and the surface or substance to be monitored for alpha radiation. The first and second signal planes are maintained at the same voltage with respect to the electrically conductive enclosure, reducing leakage currents. In the presence of alpha radiation and radioactive gas decay, the signal from the first signal plane is proportional to both the surface alpha radiation and to the airborne radioactive gas, while the signal from the second signal plane is proportional only to the airborne radioactive gas. The difference between these two signals is proportional to the surface alpha radiation alone. 5 figs.

  9. Background canceling surface alpha detector

    DOEpatents

    MacArthur, Duncan W.; Allander, Krag S.; Bounds, John A.

    1996-01-01

    A background canceling long range alpha detector which is capable of providing output proportional to both the alpha radiation emitted from a surface and to radioactive gas emanating from the surface. The detector operates by using an electrical field between first and second signal planes, an enclosure and the surface or substance to be monitored for alpha radiation. The first and second signal planes are maintained at the same voltage with respect to the electrically conductive enclosure, reducing leakage currents. In the presence of alpha radiation and radioactive gas decay, the signal from the first signal plane is proportional to both the surface alpha radiation and to the airborne radioactive gas, while the signal from the second signal plane is proportional only to the airborne radioactive gas. The difference between these two signals is proportional to the surface alpha radiation alone.

  10. Alkaline Phosphatase, Soluble Extracellular Adenine Nucleotides, and Adenosine Production after Infant Cardiopulmonary Bypass.

    PubMed

    Davidson, Jesse A; Urban, Tracy; Tong, Suhong; Twite, Mark; Woodruff, Alan; Wischmeyer, Paul E; Klawitter, Jelena

    2016-01-01

    Decreased alkaline phosphatase activity after infant cardiac surgery is associated with increased post-operative cardiovascular support requirements. In adults undergoing coronary artery bypass grafting, alkaline phosphatase infusion may reduce inflammation. Mechanisms underlying these effects have not been explored but may include decreased conversion of extracellular adenine nucleotides to adenosine. 1) Evaluate the association between alkaline phosphatase activity and serum conversion of adenosine monophosphate to adenosine after infant cardiac surgery; 2) assess if inhibition/supplementation of serum alkaline phosphatase modulates this conversion. Pre/post-bypass serum samples were obtained from 75 infants <4 months of age. Serum conversion of 13C5-adenosine monophosphate to 13C5-adenosine was assessed with/without selective inhibition of alkaline phosphatase and CD73. Low and high concentration 13C5-adenosine monophosphate (simulating normal/stress concentrations) were used. Effects of alkaline phosphatase supplementation on adenosine monophosphate clearance were also assessed. Changes in serum alkaline phosphatase activity were strongly correlated with changes in 13C5-adenosine production with or without CD73 inhibition (r = 0.83; p<0.0001). Serum with low alkaline phosphatase activity (≤80 U/L) generated significantly less 13C5-adenosine, particularly in the presence of high concentration 13C5-adenosine monophosphate (10.4μmol/L vs 12.9μmol/L; p = 0.0004). Inhibition of alkaline phosphatase led to a marked decrease in 13C5-adenosine production (11.9μmol/L vs 2.7μmol/L; p<0.0001). Supplementation with physiologic dose human tissue non-specific alkaline phosphatase or high dose bovine intestinal alkaline phosphatase doubled 13C5-adenosine monophosphate conversion to 13C5-adenosine (p<0.0001). Alkaline phosphatase represents the primary serum ectonucleotidase after infant cardiac surgery and low post-operative alkaline phosphatase activity leads to

  11. The TriTryp phosphatome: analysis of the protein phosphatase catalytic domains.

    PubMed

    Brenchley, Rachel; Tariq, Humera; McElhinney, Helen; Szöor, Balázs; Huxley-Jones, Julie; Stevens, Robert; Matthews, Keith; Tabernero, Lydia

    2007-11-26

    The genomes of the three parasitic protozoa Trypanosoma cruzi, Trypanosoma brucei and Leishmania major are the main subject of this study. These parasites are responsible for devastating human diseases known as Chagas disease, African sleeping sickness and cutaneous Leishmaniasis, respectively, that affect millions of people in the developing world. The prevalence of these neglected diseases results from a combination of poverty, inadequate prevention and difficult treatment. Protein phosphorylation is an important mechanism of controlling the development of these kinetoplastids. With the aim to further our knowledge of the biology of these organisms we present a characterisation of the phosphatase complement (phosphatome) of the three parasites. An ontology-based scan of the three genomes was used to identify 86 phosphatase catalytic domains in T. cruzi, 78 in T. brucei, and 88 in L. major. We found interesting differences with other eukaryotic genomes, such as the low proportion of tyrosine phosphatases and the expansion of the serine/threonine phosphatase family. Additionally, a large number of atypical protein phosphatases were identified in these species, representing more than one third of the total phosphatase complement. Most of the atypical phosphatases belong to the dual-specificity phosphatase (DSP) family and show considerable divergence from classic DSPs in both the domain organisation and sequence features. The analysis of the phosphatome of the three kinetoplastids indicates that they possess orthologues to many of the phosphatases reported in other eukaryotes, including humans. However, novel domain architectures and unusual combinations of accessory domains, suggest distinct functional roles for several of the kinetoplastid phosphatases, which await further experimental exploration. These distinct traits may be exploited in the selection of suitable new targets for drug development to prevent transmission and spread of the diseases, taking

  12. Molecular enzymology underlying regulation of protein phosphatase-1 by natural toxins.

    PubMed

    Holmes, C F B; Maynes, J T; Perreault, K R; Dawson, J F; James, M N G

    2002-11-01

    The protein serine/threonine phosphatases constitute a unique class of enzymes that are critical for cell regulation, as they must counteract the activities of thousands of protein kinases in human cells. Uncontrolled inhibition of phosphatase activity by toxic inhibitors can lead to widespread catastrophic effects. Over the past decade, a number of natural product toxins have been identified that specifically and potently inhibit protein phosphatase-1 and 2A. Amongst these are the cyanobacteria-derived cyclic heptapeptide microcystin-LR and the polyether fatty acid okadaic acid from dinoflagellate sources. The molecular mechanism underlying potent inhibition of protein phosphatase-1 by these toxins is becoming clear through insights gathered from diverse sources. These include: 1. Comparison of structure-activity relationships amongst the different classes of toxins. 2. Delineation of the structural differences between protein phosphatase-1 and 2A that account for their differing sensitivity to toxins, particularly okadaic acid and microcystin-LR. 3. Determination of the crystal structure of protein phosphatase-1 with microcystin-LR, okadaic acid and calyculin bound. 4. Site-specific mutagenesis and biochemical analysis of protein phosphatase-1 mutants. Taken together, these data point to a common binding site on protein phosphatase-1 for okadaic acid, microcystin-LR and the calyculins. However, careful analysis of these data suggest that each toxin binds to the common binding site in a subtly different way, relying on distinct structural interactions such as hydrophobic binding, hydrogen bonding and electrostatic interactions to different degrees. The insights derived from studying the molecular enzymology of protein phosphatase-1 may help explain the different sensitivities of other structurally conserved protein serine/theonine phosphatases to toxin inhibition. Furthermore, studies on the binding of structurally diverse toxins at the active site of protein

  13. Long range alpha particle detector

    DOEpatents

    MacArthur, Duncan W.; Wolf, Michael A.; McAtee, James L.; Unruh, Wesley P.; Cucchiara, Alfred L.; Huchton, Roger L.

    1993-01-01

    An alpha particle detector capable of detecting alpha radiation from distant sources. In one embodiment, a high voltage is generated in a first electrically conductive mesh while a fan draws air containing air molecules ionized by alpha particles through an air passage and across a second electrically conductive mesh. The current in the second electrically conductive mesh can be detected and used for measurement or alarm. The detector can be used for area, personnel and equipment monitoring.

  14. Long range alpha particle detector

    DOEpatents

    MacArthur, D.W.; Wolf, M.A.; McAtee, J.L.; Unruh, W.P.; Cucchiara, A.L.; Huchton, R.L.

    1993-02-02

    An alpha particle detector capable of detecting alpha radiation from distant sources. In one embodiment, a high voltage is generated in a first electrically conductive mesh while a fan draws air containing air molecules ionized by alpha particles through an air passage and across a second electrically conductive mesh. The current in the second electrically conductive mesh can be detected and used for measurement or alarm. The detector can be used for area, personnel and equipment monitoring.

  15. Are alpha-gliadins glycosylated?

    PubMed

    Turner, J B; Garner, G V; Gordon, D B; Brookes, S J; Smith, C A

    2002-02-01

    Alpha-gliadins isolated by carboxymethylcellulose chromatography contain noncovalently bound glucose probably due to contaminating proteoglycans and to material shed from the column. Traces of carbohydrate remain strongly bound to alpha-gliadins even after harsh denaturation, but our results indicate alpha-gliadins are not glycoproteins. Suggestions that gliadins are glycoproteins are probably due to contamination with this glucose and the presence of these proteoglycans.

  16. Drosophila melanogaster importin alpha1 and alpha3 can replace importin alpha2 during spermatogenesis but not oogenesis.

    PubMed Central

    Mason, D Adam; Fleming, Robert J; Goldfarb, David S

    2002-01-01

    Importin alpha's mediate the nuclear transport of many classical nuclear localization signal (cNLS)-containing proteins. Multicellular animals contain multiple importin alpha genes, most of which fall into three conventional phylogenetic clades, here designated alpha1, alpha2, and alpha3. Using degenerate PCR we cloned Drosophila melanogaster importin alpha1, alpha2, and alpha3 genes, demonstrating that the complete conventional importin alpha gene family arose prior to the split between invertebrates and vertebrates. We have begun to analyze the genetic interactions among conventional importin alpha genes by studying their capacity to rescue the male and female sterility of importin alpha2 null flies. The sterility of alpha2 null males was rescued to similar extents by importin alpha1, alpha2, and alpha3 transgenes, suggesting that all three conventional importin alpha's are capable of performing the important role of importin alpha2 during spermatogenesis. In contrast, sterility of alpha2 null females was rescued only by importin alpha2 transgenes, suggesting that it plays a paralog-specific role in oogenesis. Female infertility was also rescued by a mutant importin alpha2 transgene lacking a site that is normally phosphorylated in ovaries. These rescue experiments suggest that male and female gametogenesis have distinct requirements for importin alpha2. PMID:12019231

  17. Structural and mechanistic characterization of L-histidinol phosphate phosphatase from the polymerase and histidinol phosphatase family of proteins.

    PubMed

    Ghodge, Swapnil V; Fedorov, Alexander A; Fedorov, Elena V; Hillerich, Brandan; Seidel, Ronald; Almo, Steven C; Raushel, Frank M

    2013-02-12

    L-Histidinol phosphate phosphatase (HPP) catalyzes the hydrolysis of L-histidinol phosphate to L-histidinol and inorganic phosphate, the penultimate step in the biosynthesis of L-histidine. HPP from the polymerase and histidinol phosphatase (PHP) family of proteins possesses a trinuclear active site and a distorted (β/α)(7)-barrel protein fold. This group of enzymes is closely related to the amidohydrolase superfamily of enzymes. The mechanism of phosphomonoester bond hydrolysis by the PHP family of HPP enzymes was addressed. Recombinant HPP from Lactococcus lactis subsp. lactis that was expressed in Escherichia coli contained a mixture of iron and zinc in the active site and had a catalytic efficiency of ~10(3) M(-1) s(-1). Expression of the protein under iron-free conditions resulted in the production of an enzyme with a 2 order of magnitude improvement in catalytic efficiency and a mixture of zinc and manganese in the active site. Solvent isotope and viscosity effects demonstrated that proton transfer steps and product dissociation steps are not rate-limiting. X-ray structures of HPP were determined with sulfate, L-histidinol phosphate, and a complex of L-histidinol and arsenate bound in the active site. These crystal structures and the catalytic properties of variants were used to identify the structural elements required for catalysis and substrate recognition by the HPP family of enzymes within the amidohydrolase superfamily.

  18. Kinetic mechanism of the Zn-dependent aryl-phosphatase activity of myo-inositol-1-phosphatase.

    PubMed

    Caselli, Anna; Casolaro, Mario; Ranaldi, Francesco; Manao, Giampaolo; Camici, Guido; Giachetti, Eugenio

    2007-02-01

    Myo-inositol-1-phosphatase (EC 3.1.3.25) is able to hydrolyze myo-inositol-1-phosphate in the presence of Mg(2+) ions at neutral pH, and also p-nitrophenyl phosphate in the presence of Zn(2+)-ions at acidic pH. This enzyme plays a role in phosphatidylinositol cell signalling and is a putative target of lithium therapy in manic depression. We elucidate here the kinetic mechanism of the Zn-dependent activity of myo-inositol-1-phosphatase. As part of this analysis it was necessary to determine the basicity constants of p-nitrophenyl phosphate and the stability constant of its metal-complex in the presence of zinc chloride. We find that the Zn-dependent reaction may be described either by a rapid-equilibrium random mechanism or an ordered steady-state mechanism in which the substrate binds to the free enzyme prior to the metal ion. In both models the Zn-substrate complex acts as a high affinity inhibitor, yielding a dead-end species through its binding to the enzyme-Zn-substrate in rapid-equilibrium or to the enzyme-phosphate complexes in a steady-state model. Phosphate is a competitive inhibitor of the enzyme with respect to the substrate and an uncompetitive inhibitor with respect to zinc ions.

  19. Structure and chromosomal localization of the human gene of the phosphotyrosyl phosphatase activator (PTPA) of protein phosphatase 2A

    SciTech Connect

    Van Hoof, C.; Cayla, X.; Merlevede, W.; Goris, J.

    1995-07-20

    The PTPA gene encodes a specific phosphotyrosyl phosphatase activator of the dimeric form of protein phosphatase 2A. PTPA, cloned from human genomic libraries, is encoded by one single-copy gene, composed of 10 exons and 9 introns with a total length of about 60 kb. The transcription start site was determined, and the 5{prime} flanking sequence was analyzed for its potential as a promotor. This region lacks a TATA sequence in the appropriate position relative to the transcription start, is very GC-rich, and contains upstream of the transcription start four Sp1 sites, a feature common to many TATA-less promotors. Based on the homology with DNA binding consensus sequences of transcription factors, we identified in this promotor region several putative DNA binding sites for transcription factors, such as NF-{kappa}B, Myb, Ets-1, Myc, and ATF. Transfection experiments with a construct containing the PTPA promotor region inserted 5{prime} of a luciferase reporter gene revealed that the 5{prime} flanking sequence of the PTPA gene indeed displayed promotor activity that seems to be cell-line dependent. By fluorescence in situ hybridization and G-banding, the PTPA gene was localized to the 9q34 region. The PTPA gene is positioned centromeric of c-abl in a region embracing several genes implicated in oncogenesis. 28 refs., 8 figs., 1 tab.

  20. The Zds proteins control entry into mitosis and target protein phosphatase 2A to the Cdc25 phosphatase

    PubMed Central

    Wicky, Sidonie; Tjandra, Hendri; Schieltz, David; Yates, John; Kellogg, Douglas R.

    2011-01-01

    The Wee1 kinase restrains entry into mitosis by phosphorylating and inhibiting cyclin-dependent kinase 1 (Cdk1). The Cdc25 phosphatase promotes entry into mitosis by removing Cdk1 inhibitory phosphorylation. Experiments in diverse systems have established that Wee1 and Cdc25 are regulated by protein phosphatase 2A (PP2A), but a full understanding of the function and regulation of PP2A in entry into mitosis has remained elusive. In budding yeast, entry into mitosis is controlled by a specific form of PP2A that is associated with the Cdc55 regulatory subunit (PP2ACdc55). We show here that related proteins called Zds1 and Zds2 form a tight stoichiometric complex with PP2ACdc55 and target its activity to Cdc25 but not to Wee1. Conditional inactivation of the Zds proteins revealed that their function is required primarily at entry into mitosis. In addition, Zds1 undergoes cell cycle–dependent changes in phosphorylation. Together, these observations define a role for the Zds proteins in controlling specific functions of PP2ACdc55 and suggest that upstream signals that regulate PP2ACdc55 may play an important role in controlling entry into mitosis. PMID:21119008

  1. Mechanistic aspects of the low-molecular-weight phosphatase activity of the calmodulin-activated phosphatase, calcineurin.

    PubMed

    Martin, B L; Graves, D J

    1986-11-05

    Product and substrate analogs have been employed as inhibitors of the low-molecular-weight phosphatase activity of calcineurin, a calmodulin-activated protein phosphatase. Product inhibition kinetics demonstrate that both products, para-nitrophenol and inorganic phosphate, inhibit para-nitrophenyl phosphate hydrolysis in a competitive manner. Inorganic phosphate is a linear competitive inhibitor, whereas the inhibition by para-nitrophenol is more complex. An analog of para-nitrophenol, pentafluorophenol, was found to be a linear competitive inhibitor. These patterns indicate a rapid equilibrium random kinetic mechanism for calcineurin. This mechanism suggests that calcineurin does not generate a phosphoryl enzyme during its catalytic reaction. Application of sulfate analogs indicates that binding of substrate occurs via the phosphoryl moiety. It is suggested that binding is a function of the affinity of ligand for the metal ion involved in calcineurin action. The dependence of the kinetic parameters of calcineurin upon pH was examined to provide information concerning the role of protonation in the activity and specificity of calcineurin. Log (VM) versus pH data for two low-molecular-weight substrates, para-nitrophenyl phosphate and tyrosine-O-phosphate, reveal a pKa value for the enzyme-substrate complex. Analysis of log (VM/KM) data yields a pKa value for the free enzyme of 8.0. Protonation of the phenolic leaving group during hydrolysis is not the rate-limiting step in calcineurin catalysis.

  2. High sequence homology between protein tyrosine acid phosphatase from boar seminal vesicles and human prostatic acid phosphatase.

    PubMed

    Wysocki, Paweł; Płucienniczak, Grazyna; Strzezek, Jerzy

    2009-01-01

    Boar seminal vesicle protein tyrosine acid phosphatase (PTAP) and human prostatic acid phosphatase (PAP) show high affinity for protein phosphotyrosine residues. The physico-chemical and kinetic properties of the boar and human enzymes are different. The main objective of this study was to establish the nucleotide sequence of cDNA encoding boar PTAP and compare it with that of human PAP cDNA. Also, the amino-acid sequence of boar PTAP was compared with the sequence of human PAP. PTAP was isolated from boar seminal vesicle fluid and sequenced. cDNA to boar seminal vesicle RNA was synthesized, amplified by PCR, cloned in E. coli and sequenced. The obtained N-terminal amino-acid sequence of boar PTAP showed 92% identity with the N-terminal amino-acid sequence of human PAP. The determined sequence of a 354 bp nucleotide fragment (GenBank accession number: GQ184596) showed 90% identity with the corresponding sequence of human PAP. On the basis of this sequence a 118 amino acid fragment of boar PTAP was predicted. This fragment showed 89% identity with the corresponding fragment of human PAP and had a similar hydropathy profile. The compared sequences differ in terms of their isoelectric points and amino-acid composition. This may explain the differences in substrate specificity and inhibitor resistance of boar PTAP and human PAP.

  3. Alpha particle confinement in tokamaks

    SciTech Connect

    White, R.B.; Mynick, H.E.

    1988-11-01

    An assessment of diffusive tokamak transport mechanisms of concern for alpha particles indicates that the ''stochastic regime'' is the only one which appears to pose a real danger for adequate alpha confinement. This fact, in conjunction with the threshold character of that mechanism, allows one to decide whether an alpha born at a given location will be lost or confined, according to a very simple criterion. Implementing this criterion numerically results in a new code for the assessment of alpha confinement, which is orders of magnitude faster than earlier codes used for this purpose. 13 refs., 3 figs., 1 tab.

  4. Modeling Solar Lyman Alpha Irradiance

    NASA Technical Reports Server (NTRS)

    Pap, J.; Hudson, H. S.; Rottman, G. J.; Willson, R. C.; Donnelly, R. F.; London, J.

    1990-01-01

    Solar Lyman alpha irradiance is estimated from various solar indices using linear regression analyses. Models developed with multiple linear regression analysis, including daily values and 81-day running means of solar indices, predict reasonably well both the short- and long-term variations observed in Lyman alpha. It is shown that the full disk equivalent width of the He line at 1083 nm offers the best proxy for Lyman alpha, and that the total irradiance corrected for sunspot effect also has a high correlation with Lyman alpha.

  5. Dolichyl phosphate phosphatase in rat liver microsomes. Avoidance of the use of detergent in testing the effect of phospholipids on dolichyl phosphate phosphatase.

    PubMed

    Boscoboinik, D O; Morera, S; Belocopitow, E

    1984-06-06

    A system was developed for testing the effect of phospholipids on dolichyl phosphate phosphatase, a membrane-associated enzyme. This enzyme was solubilized, delipidated, stabilized and concentrated in such a way that minimal quantities of Triton X-100 were carried by enzyme extracts to the incubation mixture. Its substrate, dolichyl phosphate, could be kept in aqueous medium as suspended particles without addition of detergent. When dolichyl phosphate phosphatase was assayed using the substrate in this detergent-free form, values for Km, pH optimum and temperature optimum were different from those obtained with detergent-solubilized substrate. This assay of dolichyl phosphate phosphatase almost free of detergent allowed testing of the effect of specific phospholipids on enzyme activity with minimal interference produced by endogenous phospholipids or exogenous detergent. Sphingomyelin, phosphatidylethanolamine or phosphatidylcholine (zwitterionic phospholipids) acted as activators, whereas phosphatidic acid and phosphatidylinositol, negatively-charged phospholipids, were inhibitors of dolichyl phosphate phosphatase.

  6. Protein phosphatase 2A dysfunction in Alzheimer’s disease

    PubMed Central

    Sontag, Jean-Marie; Sontag, Estelle

    2014-01-01

    Protein phosphatase 2A (PP2A) is a large family of enzymes that account for the majority of brain Ser/Thr phosphatase activity. While PP2A enzymes collectively modulate most cellular processes, sophisticated regulatory mechanisms are ultimately responsible for ensuring isoform-specific substrate specificity. Of particular interest to the Alzheimer’s disease (AD) field, alterations in PP2A regulators and PP2A catalytic activity, subunit expression, methylation and/or phosphorylation, have been reported in AD-affected brain regions. “PP2A” dysfunction has been linked to tau hyperphosphorylation, amyloidogenesis and synaptic deficits that are pathological hallmarks of this neurodegenerative disorder. Deregulation of PP2A enzymes also affects the activity of many Ser/Thr protein kinases implicated in AD. This review will more specifically discuss the role of the PP2A/Bα holoenzyme and PP2A methylation in AD pathogenesis. The PP2A/Bα isoform binds to tau and is the primary tau phosphatase. Its deregulation correlates with increased tau phosphorylation in vivo and in AD. Disruption of PP2A/Bα-tau protein interactions likely contribute to tau deregulation in AD. Significantly, alterations in one-carbon metabolism that impair PP2A methylation are associated with increased risk for sporadic AD, and enhanced AD-like pathology in animal models. Experimental studies have linked deregulation of PP2A methylation with down-regulation of PP2A/Bα, enhanced phosphorylation of tau and amyloid precursor protein, tau mislocalization, microtubule destabilization and neuritic defects. While it remains unclear what are the primary events that underlie “PP2A” dysfunction in AD, deregulation of PP2A enzymes definitely affects key players in the pathogenic process. As such, there is growing interest in developing PP2A-centric therapies for AD, but this may be a daunting task without a better understanding of the regulation and function of specific PP2A enzymes. PMID:24653673

  7. 3' Phosphatase activity toward phosphatidylinositol 3,4-bisphosphate [PI(3,4)P2] by voltage-sensing phosphatase (VSP).

    PubMed

    Kurokawa, Tatsuki; Takasuga, Shunsuke; Sakata, Souhei; Yamaguchi, Shinji; Horie, Shigeo; Homma, Koichi J; Sasaki, Takehiko; Okamura, Yasushi

    2012-06-19

    Voltage-sensing phosphatases (VSPs) consist of a voltage-sensor domain and a cytoplasmic region with remarkable sequence similarity to phosphatase and tensin homolog deleted on chromosome 10 (PTEN), a tumor suppressor phosphatase. VSPs dephosphorylate the 5' position of the inositol ring of both phosphatidylinositol 3,4,5-trisphosphate [PI(3,4,5)P(3)] and phosphatidylinositol 4,5-bisphosphate [PI(4,5)P(2)] upon voltage depolarization. However, it is unclear whether VSPs also have 3' phosphatase activity. To gain insights into this question, we performed in vitro assays of phosphatase activities of Ciona intestinalis VSP (Ci-VSP) and transmembrane phosphatase with tensin homology (TPTE) and PTEN homologous inositol lipid phosphatase (TPIP; one human ortholog of VSP) with radiolabeled PI(3,4,5)P(3). TLC assay showed that the 3' phosphate of PI(3,4,5)P(3) was not dephosphorylated, whereas that of phosphatidylinositol 3,4-bisphosphate [PI(3,4)P(2)] was removed by VSPs. Monitoring of PI(3,4)P(2) levels with the pleckstrin homology (PH) domain from tandem PH domain-containing protein (TAPP1) fused with GFP (PH(TAPP1)-GFP) by confocal microscopy in amphibian oocytes showed an increase of fluorescence intensity during depolarization to 0 mV, consistent with 5' phosphatase activity of VSP toward PI(3,4,5)P(3). However, depolarization to 60 mV showed a transient increase of GFP fluorescence followed by a decrease, indicating that, after PI(3,4,5)P(3) is dephosphorylated at the 5' position, PI(3,4)P(2) is then dephosphorylated at the 3' position. These results suggest that substrate specificity of the VSP changes with membrane potential.

  8. Yeast Nem1-Spo7 Protein Phosphatase Activity on Pah1 Phosphatidate Phosphatase Is Specific for the Pho85-Pho80 Protein Kinase Phosphorylation Sites*

    PubMed Central

    Su, Wen-Min; Han, Gil-Soo; Carman, George M.

    2014-01-01

    Pah1 is the phosphatidate phosphatase in the yeast Saccharomyces cerevisiae that produces diacylglycerol for triacylglycerol synthesis and concurrently controls the levels of phosphatidate used for phospholipid synthesis. Phosphorylation and dephosphorylation of Pah1 regulate its subcellular location and phosphatidate phosphatase activity. Compared with its phosphorylation by multiple protein kinases, Pah1 is dephosphorylated by a protein phosphatase complex consisting of Nem1 (catalytic subunit) and Spo7 (regulatory subunit). In this work, we characterized the Nem1-Spo7 phosphatase complex for its enzymological, kinetic, and regulatory properties with phosphorylated Pah1. The dephosphorylation of Pah1 by Nem1-Spo7 phosphatase resulted in the stimulation (6-fold) of phosphatidate phosphatase activity. For Pah1 phosphorylated by the Pho85-Pho80 kinase complex, maximum Nem1-Spo7 phosphatase activity required Mg2+ ions (8 mm) and Triton X-100 (0.25 mm) at pH 5.0. The energy of activation for the reaction was 8.4 kcal/mol, and the enzyme was thermally labile at temperatures above 40 °C. The enzyme activity was inhibited by sodium vanadate, sodium fluoride, N-ethylmaleimide, and phenylglyoxal but was not significantly affected by lipids or nucleotides. Nem1-Spo7 phosphatase activity was dependent on the concentrations of Pah1 phosphorylated by Pho85-Pho80, Cdc28-cyclin B, PKA, and PKC with kcat and Km values of 0.29 s−1 and 81 nm, 0.11 s−1 and 127 nm, 0.10 s−1 and 46 nm, and 0.02 s−1 and 38 nm, respectively. Its specificity constant (kcat/Km) for Pah1 phosphorylated by Pho85-Pho80 was 1.6-, 4-, and 6-fold higher, respectively, than that phosphorylated by PKA, Cdc28-cyclin B, and PKC. PMID:25359770

  9. Yeast Nem1-Spo7 protein phosphatase activity on Pah1 phosphatidate phosphatase is specific for the Pho85-Pho80 protein kinase phosphorylation sites.

    PubMed

    Su, Wen-Min; Han, Gil-Soo; Carman, George M

    2014-12-12

    Pah1 is the phosphatidate phosphatase in the yeast Saccharomyces cerevisiae that produces diacylglycerol for triacylglycerol synthesis and concurrently controls the levels of phosphatidate used for phospholipid synthesis. Phosphorylation and dephosphorylation of Pah1 regulate its subcellular location and phosphatidate phosphatase activity. Compared with its phosphorylation by multiple protein kinases, Pah1 is dephosphorylated by a protein phosphatase complex consisting of Nem1 (catalytic subunit) and Spo7 (regulatory subunit). In this work, we characterized the Nem1-Spo7 phosphatase complex for its enzymological, kinetic, and regulatory properties with phosphorylated Pah1. The dephosphorylation of Pah1 by Nem1-Spo7 phosphatase resulted in the stimulation (6-fold) of phosphatidate phosphatase activity. For Pah1 phosphorylated by the Pho85-Pho80 kinase complex, maximum Nem1-Spo7 phosphatase activity required Mg(2+) ions (8 mm) and Triton X-100 (0.25 mm) at pH 5.0. The energy of activation for the reaction was 8.4 kcal/mol, and the enzyme was thermally labile at temperatures above 40 °C. The enzyme activity was inhibited by sodium vanadate, sodium fluoride, N-ethylmaleimide, and phenylglyoxal but was not significantly affected by lipids or nucleotides. Nem1-Spo7 phosphatase activity was dependent on the concentrations of Pah1 phosphorylated by Pho85-Pho80, Cdc28-cyclin B, PKA, and PKC with kcat and Km values of 0.29 s(-1) and 81 nm, 0.11 s(-1) and 127 nm, 0.10 s(-1) and 46 nm, and 0.02 s(-1) and 38 nm, respectively. Its specificity constant (kcat/Km) for Pah1 phosphorylated by Pho85-Pho80 was 1.6-, 4-, and 6-fold higher, respectively, than that phosphorylated by PKA, Cdc28-cyclin B, and PKC. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. Molecular characterization of alpha 1- and alpha 2-adrenoceptors.

    PubMed

    Harrison, J K; Pearson, W R; Lynch, K R

    1991-02-01

    Three 'alpha 1-adrenoceptors' and three 'alpha 2-adrenoceptors' have now been cloned. How closely do these receptors match the native receptors that have been identified pharmacologically? What are the properties of these receptors, and how do they relate to other members of the cationic amine receptor family? Kevin Lynch and his colleagues discuss these questions in this review.

  11. Alpha Kappa Alpha Sorority's Reading Improvement Program for Minorities.

    ERIC Educational Resources Information Center

    Marable, June Morehead

    This document discusses the founding and establishment of Alpha Kappa Alpha Sorority's reading experience pilot project. The efforts of this project were aligned with those of Right to Read and Reading Is Fundamental (RIF). Because of the response from parents and children, plans are being made to increase present operations within the next…

  12. Characterization of a Soluble Phosphatidic Acid Phosphatase in Bitter Melon (Momordica charantia)

    PubMed Central

    Cao, Heping; Sethumadhavan, Kandan; Grimm, Casey C.; Ullah, Abul H. J.

    2014-01-01

    Momordica charantia is often called bitter melon, bitter gourd or bitter squash because its fruit has a bitter taste. The fruit has been widely used as vegetable and herbal medicine. Alpha-eleostearic acid is the major fatty acid in the seeds, but little is known about its biosynthesis. As an initial step towards understanding the biochemical mechanism of fatty acid accumulation in bitter melon seeds, this study focused on a soluble phosphatidic acid phosphatase (PAP, 3-sn-phosphatidate phosphohydrolase, EC 3.1.3.4) that hydrolyzes the phosphomonoester bond in phosphatidate yielding diacylglycerol and Pi. PAPs are typically categorized into two subfamilies: Mg2+-dependent soluble PAP and Mg2+-independent membrane-associated PAP. We report here the partial purification and characterization of an Mg2+-independent PAP activity from developing cotyledons of bitter melon. PAP protein was partially purified by successive centrifugation and UNOsphere Q and S columns from the soluble extract. PAP activity was optimized at pH 6.5 and 53–60°C and unaffected by up to 0.3 mM MgCl2. The Km and Vmax values for dioleoyl-phosphatidic acid were 595.4 µM and 104.9 ηkat/mg of protein, respectively. PAP activity was inhibited by NaF, Na3VO4, Triton X-100, FeSO4 and CuSO4, but stimulated by MnSO4, ZnSO4 and Co(NO3)2. In-gel activity assay and mass spectrometry showed that PAP activity was copurified with a number of other proteins. This study suggests that PAP protein is probably associated with other proteins in bitter melon seeds and that a new class of PAP exists as a soluble and Mg2+-independent enzyme in plants. PMID:25203006

  13. Enhanced cell adhesion on bioinert ceramics mediated by the osteogenic cell membrane enzyme alkaline phosphatase.

    PubMed

    Aminian, Alieh; Shirzadi, Bahareh; Azizi, Zahra; Maedler, Kathrin; Volkmann, Eike; Hildebrand, Nils; Maas, Michael; Treccani, Laura; Rezwan, Kurosch

    2016-12-01

    Functional bone and dental implant materials are required to guide cell response, offering cues that provide specific instructions to cells at the implant/tissue interface while maintaining full biocompatibility as well as the desired structural requirements and functions. In this work we investigate the influence of covalently immobilized alkaline phosphatase (ALP), an enzyme involved in bone mineralization, on the first contact and initial cell adhesion. To this end, ALP is covalently immobilized by carbodiimide-mediated chemoligation on two highly bioinert ceramics, alpha-alumina (Al2O3) and yttria-stabilized zirconia (Y-TZP) that are well-established for load-bearing applications. The physicochemical surface properties are evaluated by profilometry, zeta potential and water contact angle measurements. The initial cell adhesion of human osteoblasts (HOBs), human osteoblast-like cells (MG-63) and mesenchymal stromal cells (hMSCs) was investigated. Cell adhesion was assessed at serum free condition via quantification of percentage of adherent cells, adhesion area and staining of the focal adhesion protein vinculin. Our findings show that after ALP immobilization, the Al2O3 and Y-TZP surfaces gained a negative charge and their hydrophilicity was increased. In the presence of surface-immobilized ALP, a higher cell adhesion, more pronounced cell spreading and a higher number of focal contact points were found. Thereby, this work gives evidence that surface functionalization with ALP can be utilized to modify inert materials for biological conversion and faster bone regeneration on inert and potentially load-bearing implant materials. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Characterization of a soluble phosphatidic acid phosphatase in bitter melon (Momordica charantia).

    PubMed

    Cao, Heping; Sethumadhavan, Kandan; Grimm, Casey C; Ullah, Abul H J

    2014-01-01

    Momordica charantia is often called bitter melon, bitter gourd or bitter squash because its fruit has a bitter taste. The fruit has been widely used as vegetable and herbal medicine. Alpha-eleostearic acid is the major fatty acid in the seeds, but little is known about its biosynthesis. As an initial step towards understanding the biochemical mechanism of fatty acid accumulation in bitter melon seeds, this study focused on a soluble phosphatidic acid phosphatase (PAP, 3-sn-phosphatidate phosphohydrolase, EC 3.1.3.4) that hydrolyzes the phosphomonoester bond in phosphatidate yielding diacylglycerol and P(i). PAPs are typically categorized into two subfamilies: Mg(2+)-dependent soluble PAP and Mg(2+)-independent membrane-associated PAP. We report here the partial purification and characterization of an Mg(2+)-independent PAP activity from developing cotyledons of bitter melon. PAP protein was partially purified by successive centrifugation and UNOsphere Q and S columns from the soluble extract. PAP activity was optimized at pH 6.5 and 53-60 °C and unaffected by up to 0.3 mM MgCl2. The K(m) and Vmax values for dioleoyl-phosphatidic acid were 595.4 µM and 104.9 ηkat/mg of protein, respectively. PAP activity was inhibited by NaF, Na(3)VO(4), Triton X-100, FeSO4 and CuSO4, but stimulated by MnSO4, ZnSO4 and Co(NO3)2. In-gel activity assay and mass spectrometry showed that PAP activity was copurified with a number of other proteins. This study suggests that PAP protein is probably associated with other proteins in bitter melon seeds and that a new class of PAP exists as a soluble and Mg(2+)-independent enzyme in plants.

  15. Mitogen-Activated Protein Kinase Phosphatase 1 Disrupts Proinflammatory Protein Synthesis in Endotoxin-Adapted Monocytes

    PubMed Central

    Brudecki, Laura; Ferguson, Donald A.; McCall, Charles E.

    2013-01-01

    Autotoxic production of proinflammatory mediators during early sepsis induces excessive inflammation, and their later suppression may limit the immune response. We previously reported that sepsis differentially represses transcription and translation of tumor necrosis factor alpha (TNF-α) and interleukin 1β (IL-1β) to reprogram sepsis inflammation. This switch is gene specific and plays a crucial role in the clinically relevant syndrome of endotoxin adaptation/tolerance, multiorgan failure, and poor sepsis outcome. To further define the mechanisms responsible for translation disruption that follows inflammation induction, we used THP-1 human promonocytes as a model of Toll-like receptor 4 (TLR4) responses found in sepsis. We showed that phosphorylation-dependent activation of p38 mitogen-activated protein kinase (MAPK) and translation disruption of TNF-α and IL-6 follow increased MAPK phosphatase 1 (MKP-1) expression and that MKP-1 knockdown rephosphorylates p38 and restores the capacity to translate TNF-α and IL-6 mRNAs. We also observed that the RNA-binding protein motif 4 (RBM4), a p38 MAPK target, accumulates in an unphosphorylated form in the cytosol in endotoxin-adapted cells, suggesting that dephosphorylated RBM4 may function as a translational repressor. Moreover, MKP-1 knockdown promotes RBM4 phosphorylation, blocks its transfer from the nucleus to the cytosol, and reverses translation repression. We also found that microRNA 146a (miR-146a) knockdown prevents and miR-146a transfection induces MKP-1 expression, which lead to increases or decreases in TNF-α and IL-6 translation, respectively. We conclude that a TLR4-, miR-146a-, p38 MAPK-, and MKP-1-dependent autoregulatory pathway regulates the translation of proinflammatory genes during the acute inflammatory response by spatially and temporally modifying the phosphorylation state of RBM4 translational repressor protein. PMID:23825193

  16. Protein Tyrosine Phosphatase 1B, a major regulator of leptin-mediated control of cardiovascular function

    PubMed Central

    de Chantemèle, Eric J. Belin; Muta, Kenjiro; Mintz, James; Tremblay, Michel L.; Marrero, Mario B.; Fulton, David; Stepp, David W.

    2009-01-01

    Background Obesity causes hypertension and sympathoactivation, a process proposed to be mediated by leptin. Protein tyrosine phosphatase 1B (PTP1B), a major new pharmaceutical target to treat obesity and type II diabetes, constrains leptin’s metabolic actions, but the extent to which PTP1B regulates leptin’s cardiovascular effects is unclear. This study examined the hypothesis that PTP1B is a negative regulator of the cardiovascular effects of leptin. Methods and Results PTP1B KO mice had lower body fat but higher mean arterial pressure (MAP: 116±5 vs. 105±5 mmHg, p<0.05) than controls. Leptin infusion produced a greater anorexic effect in PTP1B KO mice and a marked increase in MAP (135±5 mmHg) in PTP1B KO mice only. Decreased MAP to ganglionic blockade was higher in PTP1B KO mice (−38±3% vs. −29±3%, p<0.05) suggesting increased sympathetic tone. PTP1B deletion blunted MAP responses to phenylephrine (PE) injection (55±10% vs. 93±7%, p<0.05). PE-induced aortic contraction was reduced in PTP1B KO mice (57.7±9 vs. 96.3±12% of KCl, p<0.05), consistent with desensitization to chronically elevated sympathetic tone. Furthermore, PTP1B deletion significantly reduced gene expression of three alpha-1 adrenergic receptor sub-types, consistent with blunted constriction to PE. Conclusion these data indicate that PTP1B is a key regulator of the cardiovascular effects of leptin and that reduced vascular adrenergic reactivity provides a compensatory limit to leptin’s effects on MAP. PMID:19687357

  17. The role of hydrogen peroxide and RRR-alpha-tocopherol in smooth muscle cell proliferation.

    PubMed

    Azzi, A; Cantoni, O; Ozer, N; Boscoboinik, D; Spycher, S

    1996-01-01

    Oxidants can be considered early growth signals, since they have been shown to activate a number of pathways that are also stimulated by growth factors. In particular, H(2)O(2) activates the protein kinase C signal transduction pathway in smooth muscle cells. These events certainly play a role in the activation of the DNA synthesis machinery although it is still unclear whether they can also regulate the lethal response. Evidence exists of an oxidant-mediated increase in tyrosine protein phosphorylation as an early event in the signal transduction cascade of growth factor receptors, leading to augmentation of cell proliferation. Oxidants can also induce transcription of enzymes, such as ornithine decarboxylase and the phosphatase CL-100. CL-100 is the first example of a new class of protein phosphatases responsible for modulating the activation of MAP kinase following exposure of quiescent cells to growth factors and further implicates MAP kinase activation/deactivation in the cellular response to hydrogen peroxide. Moreover H(2)O(2) activates the MAP kinase cascade by stimulating the tyrosine kinase and protein kinase C pathways. JNK1, a relative of the MAP kinase group, is activated by dual phosphorylation at Thr and Tyr during the UV response. RRR-alpha-tocopherol and RRR-beta-tocopherol have different and competing effects on smooth muscle cell proliferation, indicating that they do not act as antioxidants. The earliest event brought by RRR-alpha-tocopherol in the signal transduction cascade contolling receptor mediated cell growth is the inhibition of the transcription factor AP-1, activated by phorbol esters. RRR-beta-tocopherol alone is without effect but in combination with RRR-alpha-tocopherol prevents the AP-1-inhibiting effect of the latter. Protein kinase C is inhibited by RRR-alpha-tocopherol and not by RRR-beta-tocopherol, which also in this case prevented the effect of RRR-alpha-tocopherol. The inhibition of RRR-alpha-tocopherol of protein kinase C

  18. Stimulation of phosphatidylglycerolphosphate phosphatase activity by unsaturated fatty acids in rat heart.

    PubMed

    Cao, S G; Hatch, G M

    1994-07-01

    Phosphatidylglycerolphosphate (PGP) synthase and PGP phosphatase catalyze the sequential synthesis of phosphatidylglycerol from cytidine-5'-diphosphate 1,2-diacyl-sn-glycerol (CDP-DG) and glycerol-3-phosphate. PGP synthase and PGP phosphatase activities were characterized in rat heart mitochondrial fractions, and the effect of fatty acids on the activity of these enzymes was determined. PGP synthase was observed to be a heat labile enzyme that exhibited apparent Km values for CDP-PG and glycerol-3-phosphate of 46 and 20 microM, respectively. The addition of exogenous oleic acid to the assay mixture did not affect PGP synthase activity. PGP phosphatase was observed to be a heat labile enzyme, and addition of oleic acid to the assay mixture caused a concentration-dependent stimulation of PGP phosphatase activity. Maximum stimulation (1.9-fold) of enzyme activity was observed in the presence of 0.5 mM oleic acid, but the stimulation was slightly attenuated by the presence of albumin in the assay. The presence of oleic acid in the assay mixture caused the inactivation of PGP phosphatase activity to be retarded at 55 degrees C. Stimulation of PGP phosphatase activity was also observed with arachidonic acid, whereas taurocholic, stearic and palmitic acids did not significantly affect PGP phosphatase activity. The activity of mitochondrial phosphatidic acid phosphohydrolase was not affected by inclusion of oleic acid in the incubation mixture. We postulate that unsaturated fatty acids stimulate PGP phosphatase activity in rat heart.

  19. Conserved sequence motifs among bacterial, eukaryotic, and archaeal phosphatases that define a new phosphohydrolase superfamily.

    PubMed Central

    Thaller, M. C.; Schippa, S.; Rossolini, G. M.

    1998-01-01

    Members of a new molecular family of bacterial nonspecific acid phosphatases (NSAPs), indicated as class C, were found to share significant sequence similarities to bacterial class B NSAPs and to some plant acid phosphatases, representing the first example of a family of bacterial NSAPs that has a relatively close eukaryotic counterpart. Despite the lack of an overall similarity, conserved sequence motifs were also identified among the above enzyme families (class B and class C bacterial NSAPs, and related plant phosphatases) and several other families of phosphohydrolases, including bacterial phosphoglycolate phosphatases, histidinol-phosphatase domains of the bacterial bifunctional enzymes imidazole-glycerolphosphate dehydratases, and bacterial, eukaryotic, and archaeal phosphoserine phosphatases and threalose-6-phosphatases. These conserved motifs are clustered within two domains, separated by a variable spacer region, according to the pattern [FILMAVT]-D-[ILFRMVY]-D-[GSNDE]-[TV]-[ILVAM]-[AT S VILMC]-X-¿YFWHKR)-X-¿YFWHNQ¿-X( 102,191)-¿KRHNQ¿-G-D-¿FYWHILVMC¿-¿QNH¿-¿FWYGP¿-D -¿PSNQYW¿. The dephosphorylating activity common to all these proteins supports the definition of this phosphatase motif and the inclusion of these enzymes into a superfamily of phosphohydrolases that we propose to indicate as "DDDD" after the presence of the four invariant aspartate residues. Database searches retrieved various hypothetical proteins of unknown function containing this or similar motifs, for which a phosphohydrolase activity could be hypothesized. PMID:9684901

  20. Alkaline phosphatase-polyresorcinol complex: characterization and application to seed coating.

    PubMed

    Pilar, María C; Ortega, Natividad; Perez-Mateos, Manuel; Busto, María D

    2009-03-11

    An alkaline phosphatase (EC 3.1.3.1) from Escherichia coli ATCC27257 was immobilized by copolymerization with resorcinol. The phosphatase-polyresorcinol complex synthesized retained about 74% of the original enzymatic activity. The pH and temperature profile of the immobilized and free enzyme revealed a similar behavior. Kinetic parameters were determined: K(m) and K(i) values were 2.44 and 0.423 mM, respectively, for the phosphatase-polyresorcinol complex and 1.07 and 0.069 mM, respectively, for free phosphatase. The thermal and storage stabilities of the immobilized phosphatase were higher than those of the native one. On addition to soil, free enzyme was completely inactivated in 4 days, whereas the phosphatase-polyresorcinol complex was comparatively stable. Barley seed coated with the immobilized enzyme exhibited higher rhizosphere phosphatase activity. Under pot culture conditions, an increase in the soil inorganic phosphorus was detected when the seed was encapsulated with the phosphatase-polyresorcinol complex, and a positive influence on biomass and inorganic phosphorus concentration of shoot was observed.

  1. Interdomain Communication in the Mycobacterium tuberculosis Environmental Phosphatase Rv1364c*

    PubMed Central

    Greenstein, Andrew E.; Hammel, Michal; Cavazos, Alexandra; Alber, Tom

    2009-01-01

    An “environmental phosphatase” controls bacterial transcriptional responses through alternative sigma factor subunits of RNA polymerase and a partner switching mechanism has been proposed to mediate phosphatase regulation. In many bacteria, the environmental phosphatase and multiple regulators are encoded in separate genes whose products form transient complexes. In contrast, in the Mycobacterium tuberculosis homolog, Rv1364c, the phosphatase is fused to two characteristic regulatory modules with sequence similarities to anti-sigma factor kinases and anti-anti-sigma factor proteins. Here we exploit this fusion to explore interactions between the phosphatase and the regulatory domains. We show quantitatively that the anti-sigma factor kinase domain activates the phosphatase domain, the kinase-phosphatase fusion protein autophosphorylates in Escherichia coli, and phosphorylation is antagonized by the phosphatase activity. Small angle x-ray scattering defines solution structures consistent with the interdomain communication observed biochemically. Taken together, these data indicate that Rv1364c provides a single chain framework to understand the structure, function, and regulation of environmental phosphatases throughout the bacterial kingdom. PMID:19700407

  2. Identification and molecular modeling of a novel, plant-like, human purple acid phosphatase.

    PubMed

    Flanagan, J U; Cassady, A I; Schenk, G; Guddat, L W; Hume, D A

    2006-08-01

    Purple acid phosphatases are a family of binuclear metallohydrolases that have been identified in plants, animals and fungi. Only one isoform of approximately 35 kDa has been isolated from animals, where it is associated