Science.gov

Sample records for phosphatase shp-2 controls

  1. Neuronal Shp2 tyrosine phosphatase controls energy balance and metabolism

    PubMed Central

    Zhang, Eric E.; Chapeau, Emilie; Hagihara, Kazuki; Feng, Gen-Sheng

    2004-01-01

    Shp2, a Src homology 2-containing tyrosine phosphatase, has been implicated in a variety of growth factor or cytokine signaling pathways. However, it is conceivable that this enzyme acts predominantly in one pathway versus the others in a cell, depending on the cellular context. To determine the putative functions of Shp2 in the adult brain, we selectively deleted Shp2 in postmitotic forebrain neurons by crossing CaMKIIα-Cre transgenic mice with a conditional Shp2 mutant (Shp2flox) strain. Surprisingly, a prominent phenotype of the mutant (CaMKIIα-Cre:Shp2flox/flox or CaSKO) mice was the development of early-onset obesity, with increased serum levels of leptin, insulin, glucose, and triglycerides. The mutant mice were not hyperphagic but developed enlarged and steatotic liver. Consistent with previous in vitro data, we found that Shp2 down-regulates Jak2/Stat3 (signal transducer and activator of transcription 3) activation by leptin in the hypothalamus. However, Jak2/Stat3 down-regulation is offset by a dominant Shp2 promotion of the leptin-stimulated Erk pathway, leading to induction rather than suppression of leptin resistance upon Shp2 deletion in the brain. Collectively, these results suggest that a primary function of Shp2 in postmitotic forebrain neurons is to control energy balance and metabolism, and that this phosphatase is a critical signaling component of leptin receptor ObRb in the hypothalamus. Shp2 shows potential as a neuronal target for pharmaceutical sensitization of obese patients to leptin action. PMID:15520383

  2. The tyrosine phosphatase SHP-2 controls urokinase-dependent signaling and functions in human vascular smooth muscle cells

    SciTech Connect

    Kiyan, Julia Haller, Hermann; Dumler, Inna

    2009-04-01

    The urokinase (uPA)/urokinase receptor (uPAR) multifunctional system is an important mediator of functional behaviour of human vascular smooth muscle cells (VSMC). uPAR associates with platelet-derived growth factor receptor {beta} (PDGFR-{beta}), which serves as a transmembrane adaptor for uPAR in VSMC, to transduce intracellular signaling and initiate functional changes. The precise and rapid propagation of these signaling cascades demands both strict and flexible regulatory mechanisms that remain unexplored. We provide evidence that the tyrosine phosphatase SHP-2 mediates these processes. uPA regulated SHP-2 phosphorylation, catalytic activity, and its co-localization and association with the PDGFR-{beta}. Active PDGFR-{beta} was required for the uPA-induced SHP-2 phosphorylation. uPAR-directed STAT1 pathway was disturbed in cells expressing SHP-2 inactive mutant. Both, cell proliferation and migration were impaired in VSMC with downregulated SHP-2. Elucidating the underlying mechanisms, we found that uPA induced SHP-2 recruitment to lipid rafts. Disruption of rafts abolished uPA-related control of SHP-2 phosphorylation, its association with PDGFR-{beta} and finally the VSMC functional responses. Our results demonstrate that SHP-2 plays an important role in uPA-directed signaling and functional control of human VSMC and suggest that this phosphatase might contribute to the pathogenesis of the uPA-related vascular remodeling.

  3. SHP-2 Phosphatase Prevents Colonic Inflammation by Controlling Secretory Cell Differentiation and Maintaining Host-Microbiota Homeostasis

    PubMed Central

    Coulombe, Geneviève; Langlois, Ariane; De Palma, Giada; Langlois, Marie-Josée; Mccarville, Justin L.; Gagné-Sanfaçon, Jessica; Perreault, Nathalie; Feng, Gen-Sheng; Bercik, Premysl; Boudreau, François; Verdu, Elena F.; Rivard, Nathalie

    2017-01-01

    Polymorphisms in the PTPN11 gene encoding for the tyrosine phosphatase SHP-2 were described in patients with ulcerative colitis. We have recently demonstrated that mice with an intestinal epithelial cell-specific deletion of SHP-2 (SHP-2IEC-KO) develop severe colitis 1 month after birth. However, the mechanisms by which SHP-2 deletion induces colonic inflammation remain to be elucidated. We generated SHP-2IEC-KO mice lacking Myd88 exclusively in the intestinal epithelium. The colonic phenotype was histologically analyzed and cell differentiation was determined by electron microscopy and lysozyme or Alcian blue staining. Microbiota composition was analyzed by 16S sequencing. Results show that innate defense genes including those specific to Paneth cells were strongly up-regulated in SHP-2-deficient colons. Expansion of intermediate cells (common progenitors of the Goblet and Paneth cell lineages) was found in the colon of SHP-2IEC-KO mice whereas Goblet cell number was clearly diminished. These alterations in Goblet/intermediate cell ratio were noticed 2 weeks after birth, before the onset of inflammation and were associated with significant alterations in microbiota composition. Indeed, an increase in Enterobacteriaceae and a decrease in Firmicutes were observed in the colon of these mice, indicating that dysbiosis also occurred prior to inflammation. Importantly, loss of epithelial Myd88 expression inhibited colitis development in SHP-2IEC-KO mice, rescued Goblet/intermediate cell ratio, and prevented NFκB hyperactivation and inflammation. These data indicate that SHP-2 is functionally important for the maintenance of appropriate barrier function and host-microbiota homeostasis in the large intestine. PMID:27100271

  4. Src homology 2 domain-containing phosphotyrosine phosphatase 2 (Shp2) controls surface GluA1 protein in synaptic homeostasis.

    PubMed

    Zhang, Bin; Lu, Wen

    2017-09-15

    Src Homology 2 domain-containing phosphotyrosine phosphatase 2 (Shp2) functions in synaptic plasticity, learning, and memory. However, the precise mechanisms by which this multifunctional protein contributes to synaptic function remains largely unknown. Homeostatic plasticity may be viewed as a process of bidirectional synaptic scaling, up or down. Through this process, neuronal circuitry stability is maintained so that changes in synaptic strength may be preserved under changing conditions. A better understanding of these processes is needed. In this regard, we report that phosphorylation of Shp2 at tyrosine 542 and its translocation to the postsynaptic compartment are integral processes in synaptic scaling. Furthermore, we show, using both pharmacological and genetic approaches, that Shp2 phosphatase activity is critical to the regulation of Ser(P)(845) GluA1 and surface expression of this AMPA receptor subunit during synaptic scaling. Thus, Shp2 may contribute meaningfully to synaptic homeostasis. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. Therapeutic Potential of Targeting the Oncogenic SHP2 Phosphatase

    PubMed Central

    2015-01-01

    The Src homology 2 domain containing protein tyrosine phosphatase-2 (SHP2) is an oncogenic phosphatase associated with various kinds of leukemia and solid tumors. Thus, there is substantial interest in developing SHP2 inhibitors as potential anticancer and antileukemia agents. Using a structure-guided and fragment-based library approach, we identified a novel hydroxyindole carboxylic acid-based SHP2 inhibitor 11a-1, with an IC50 value of 200 nM and greater than 5-fold selectivity against 20 mammalian PTPs. Structural and modeling studies reveal that the hydroxyindole carboxylic acid anchors the inhibitor to the SHP2 active site, while interactions of the oxalamide linker and the phenylthiophene tail with residues in the β5–β6 loop contribute to 11a-1’s binding potency and selectivity. Evidence suggests that 11a-1 specifically attenuates the SHP2-dependent signaling inside the cell. Moreover, 11a-1 blocks growth factor mediated Erk1/2 and Akt activation and exhibits excellent antiproliferative activity in lung cancer and breast cancer as well as leukemia cell lines. PMID:25003231

  6. SHP2 Phosphatase Promotes Mast Cell Chemotaxis toward Stem Cell Factor via Enhancing Activation of the Lyn/Vav/Rac Signaling Axis

    PubMed Central

    Sharma, Namit; Everingham, Stephanie; Ramdas, Baskar; Kapur, Reuben; Craig, Andrew W. B.

    2015-01-01

    SHP2 protein–tyrosine phosphatase (encoded by Ptpn11) positively regulates KIT (CD117) signaling in mast cells and is required for mast cell survival and homeostasis in mice. In this study, we uncover a role of SHP2 in promoting chemotaxis of mast cells toward stem cell factor (SCF), the ligand for KIT receptor. Using an inducible SHP2 knockout (KO) bone marrow–derived mast cell (BMMC) model, we observed defects in SCF-induced cell spreading, polarization, and chemotaxis. To address the mechanisms involved, we tested whether SHP2 promotes activation of Lyn kinase that was previously shown to promote mast cell chemotaxis. In SHP2 KO BMMCs, SCF-induced phosphorylation of the inhibitory C-terminal residue (pY507) was elevated compared with control cells, and phosphorylation of activation loop (pY396) was diminished. Because Lyn also was detected by substrate trapping assays, these results are consistent with SHP2 activating Lyn directly by dephosphorylation of pY507. Further analyses revealed a SHP2- and Lyn-dependent pathway leading to phosphorylation of Vav1, Rac activation, and F-actin polymerization in SCF-treated BMMCs. Treatment of BMMCs with a SHP2 inhibitor also led to impaired chemotaxis, consistent with SHP2 promoting SCF-induced chemotaxis of mast cells via a phosphatase-dependent mechanism. Thus, SHP2 inhibitors may be useful to limit SCF/KIT-induced mast cell recruitment to inflamed tissues or the tumor microenvironment. PMID:24733849

  7. SHP2 phosphatase promotes mast cell chemotaxis toward stem cell factor via enhancing activation of the Lyn/Vav/Rac signaling axis.

    PubMed

    Sharma, Namit; Everingham, Stephanie; Ramdas, Baskar; Kapur, Reuben; Craig, Andrew W B

    2014-05-15

    SHP2 protein-tyrosine phosphatase (encoded by Ptpn11) positively regulates KIT (CD117) signaling in mast cells and is required for mast cell survival and homeostasis in mice. In this study, we uncover a role of SHP2 in promoting chemotaxis of mast cells toward stem cell factor (SCF), the ligand for KIT receptor. Using an inducible SHP2 knockout (KO) bone marrow-derived mast cell (BMMC) model, we observed defects in SCF-induced cell spreading, polarization, and chemotaxis. To address the mechanisms involved, we tested whether SHP2 promotes activation of Lyn kinase that was previously shown to promote mast cell chemotaxis. In SHP2 KO BMMCs, SCF-induced phosphorylation of the inhibitory C-terminal residue (pY507) was elevated compared with control cells, and phosphorylation of activation loop (pY396) was diminished. Because Lyn also was detected by substrate trapping assays, these results are consistent with SHP2 activating Lyn directly by dephosphorylation of pY507. Further analyses revealed a SHP2- and Lyn-dependent pathway leading to phosphorylation of Vav1, Rac activation, and F-actin polymerization in SCF-treated BMMCs. Treatment of BMMCs with a SHP2 inhibitor also led to impaired chemotaxis, consistent with SHP2 promoting SCF-induced chemotaxis of mast cells via a phosphatase-dependent mechanism. Thus, SHP2 inhibitors may be useful to limit SCF/KIT-induced mast cell recruitment to inflamed tissues or the tumor microenvironment.

  8. A novel screening model for the molecular drug for diabetes and obesity based on tyrosine phosphatase Shp2.

    PubMed

    Bu, Yanyan; Shi, Tao; Meng, Minghui; Kong, Guiping; Tian, Yingpu; Chen, Quancheng; Yao, Xinsheng; Feng, Gensheng; Chen, Haifeng; Cheng, Haifeng; Lu, Zhongxian

    2011-01-15

    Tyrosine phosphatase Src-homology phosphotyrosyl phosphatase 2 (Shp2) was identified as a potential molecular target for therapeutic treatment of diabetes and obesity. However, there is still no systematic research on the enhancers for the Shp2 enzyme. The present study established a novel powerful model for the high-throughput screening of Shp2 enhancers and successfully identified a new specific Shp2 enhancer, oleanolic acid, from Chinese herbs. Copyright © 2010 Elsevier Ltd. All rights reserved.

  9. Abnormal mesoderm patterning in mouse embryos mutant for the SH2 tyrosine phosphatase Shp-2.

    PubMed Central

    Saxton, T M; Henkemeyer, M; Gasca, S; Shen, R; Rossi, D J; Shalaby, F; Feng, G S; Pawson, T

    1997-01-01

    Shp-1, Shp-2 and corkscrew comprise a small family of cytoplasmic tyrosine phosphatases that possess two tandem SH2 domains. To investigate the biological functions of Shp-2, a targeted mutation has been introduced into the murine Shp-2 gene, which results in an internal deletion of residues 46-110 in the N-terminal SH2 domain. Shp-2 is required for embryonic development, as mice homozygous for the mutant allele die in utero at mid-gestation. The Shp-2 mutant embryos fail to gastrulate properly as evidenced by defects in the node, notochord and posterior elongation. Biochemical analysis of mutant cells indicates that Shp-2 can function as either a positive or negative regulator of MAP kinase activation, depending on the specific receptor pathway stimulated. In particular, Shp-2 is required for full and sustained activation of the MAP kinase pathway following stimulation with fibroblast growth factor (FGF), raising the possibility that the phenotype of Shp-2 mutant embryos results from a defect in FGF-receptor signalling. Thus, Shp-2 modulates tyrosine kinase signalling in vivo and is crucial for gastrulation during mammalian development. PMID:9171349

  10. Abnormal mesoderm patterning in mouse embryos mutant for the SH2 tyrosine phosphatase Shp-2.

    PubMed

    Saxton, T M; Henkemeyer, M; Gasca, S; Shen, R; Rossi, D J; Shalaby, F; Feng, G S; Pawson, T

    1997-05-01

    Shp-1, Shp-2 and corkscrew comprise a small family of cytoplasmic tyrosine phosphatases that possess two tandem SH2 domains. To investigate the biological functions of Shp-2, a targeted mutation has been introduced into the murine Shp-2 gene, which results in an internal deletion of residues 46-110 in the N-terminal SH2 domain. Shp-2 is required for embryonic development, as mice homozygous for the mutant allele die in utero at mid-gestation. The Shp-2 mutant embryos fail to gastrulate properly as evidenced by defects in the node, notochord and posterior elongation. Biochemical analysis of mutant cells indicates that Shp-2 can function as either a positive or negative regulator of MAP kinase activation, depending on the specific receptor pathway stimulated. In particular, Shp-2 is required for full and sustained activation of the MAP kinase pathway following stimulation with fibroblast growth factor (FGF), raising the possibility that the phenotype of Shp-2 mutant embryos results from a defect in FGF-receptor signalling. Thus, Shp-2 modulates tyrosine kinase signalling in vivo and is crucial for gastrulation during mammalian development.

  11. Protein tyrosine phosphatase SHP2 promotes invadopodia formation through suppression of Rho signaling

    PubMed Central

    Tsai, Wan-Chen; Chen, Chien-Lin; Chen, Hong-Chen

    2015-01-01

    Invadopodia are actin-enriched membrane protrusions that are important for extracellular matrix degradation and invasive cell motility. Src homolog domain-containing phosphatase 2 (SHP2), a non-receptor protein tyrosine phosphatase, has been shown to play an important role in promoting cancer metastasis, but the underlying mechanism is unclear. In this study, we found that depletion of SHP2 by short-hairpin RNA suppressed invadopodia formation in several cancer cell lines, particularly in the SAS head and neck squamous cell line. In contrast, overexpression of SHP2 promoted invadopodia formation in the CAL27 head and neck squamous cell line, which expresses low levels of endogenous SHP2. The depletion of SHP2 in SAS cells significantly decreased their invasive motility. The suppression of invadopodia formation by SHP2 depletion was restored by the Clostridium botulinum C3 exoenzyme (a Rho GTPase inhibitor) or Y27632 (a specific inhibitor for Rho-associated kinase). Together, our results suggest that SHP2 may promote invadopodia formation through inhibition of Rho signaling in cancer cells. PMID:26204488

  12. Tyrosine phosphatase activity in mitochondria: presence of Shp-2 phosphatase in mitochondria.

    PubMed

    Salvi, M; Stringaro, A; Brunati, A M; Agostinelli, E; Arancia, G; Clari, G; Toninello, A

    2004-09-01

    Tyrosine phosphorylation by unidentified enzymes has been observed in mitochondria, with recent evidence indicating that non-receptorial tyrosine kinases belonging to the Src family, which represent key players in several transduction pathways, are constitutively present in mitochondria. The extent of protein phosphorylation reflects a coordination balance between the activities of specific kinases and phophatases. The present study demonstrates that purified rat brain mitochondria possess endogenous tyrosine phosphatase activity. Mitochondrial phosphatases were found to be capable of dephosphorylating different exogenous substrates, including paranitrophenylphosphate, (32)P-poly(Glu-Tyr)(4:1) and (32)P-angiotensin. These activities are strongly inhibited by peroxovanadate, a well-known inhibitor of tyrosine phosphatases, but not by inhibitors of alkali or Ser/Thr phosphatases, and mainly take place in the intermembrane space and outer mitochondrial membrane. Using a combination of approaches, we identified the tyrosine phosphatase Shp-2 in mitochondria. Shp-2 plays a crucial role in a number of intracellular signalling cascades and is probably involved in several human diseases. It thus represents the first tyrosine phosphatase shown to be present in mitochondria.

  13. The transition from stem cell to progenitor spermatogonia and male fertility requires the SHP2 protein tyrosine phosphatase.

    PubMed

    Puri, Pawan; Phillips, Bart T; Suzuki, Hitomi; Orwig, Kyle E; Rajkovic, Aleksandar; Lapinski, Philip E; King, Philip D; Feng, Gen-Sheng; Walker, William H

    2014-03-01

    SHP2 is a widely expressed protein tyrosine phosphatase required for signal transduction from multiple cell surface receptors. Gain and loss of function SHP2 mutations in humans are known to cause Noonan and LEOPARD syndromes, respectively, that are characterized by numerous pathological conditions including male infertility. Using conditional gene targeting in the mouse, we found that SHP2 is required for maintaining spermatogonial stem cells (SSCs) and the production of germ cells required for male fertility. After deleting SHP2, spermatogenesis was halted at the initial step during which transit-amplifying undifferentiated spermatogonia are produced from SSCs. In the absence of SHP2, proliferation of SSCs and undifferentiated spermatogonia was inhibited, thus germ cells cannot be replenished and SSCs cannot undergo renewal. However, germ cells beyond the undifferentiated spermatogonia stage of development at the time of SHP2 knockout were able to complete their maturation to become sperm. In cultures of SSCs and their progeny, inhibition of SHP2 activity reduced growth factor-mediated intracellular signaling that regulates SSC proliferation and cell fate. Inhibition of SHP2 also decreased the number of SSCs present in culture and caused SSCs to detach from supporting cells. Injection of mice with an SHP2 inhibitor blocked the production of germ cells from SSCs. Together, our studies show that SHP2 is essential for SSCs to maintain fertility and indicates that the pathogenesis of infertility in humans with SHP2 mutations is due to compromised SSC functions that block spermatogenesis. © AlphaMed Press.

  14. Expression and clinical significance of tyrosine phosphatase SHP-2 in colon cancer.

    PubMed

    Cai, Peifen; Guo, Wenjie; Yuan, Huaqin; Li, Qian; Wang, Weicheng; Sun, Yang; Li, Xiaomin; Gu, Yanhong

    2014-04-01

    Protein-tyrosine phosphatase SHP-2, encoded by gene PTPN11, has been identified as a tumor-promoting factor in several types of leukemia and is hyper-activated by other mechanisms in some solid tumors including gastric cancer, breast cancer, non-small cell lung cancer (NSCLC), etc. But few were reported on the expression and significances of SHP-2 in colon cancer. Here, we detect SHP-2 expression in colon cancer cells, colon cancer-induced by AOM+DSS in mice and 232 human colon cancer specimens, including 58 groups of self-matched adjacent peritumor tissues and normal tissues. We found that compared to the normal colon tissues, SHP-2 significantly decreased in tumor tissues (P<0.001). The same results were got in colon tumor cells as well as mice colon tumors. And in humans samples, low SHP-2 expression showed a significantly correlation with poor tumor differentiation (P<0.05), late TNM stage (P=0.1666) and lymph node metastasis (P<0.05).

  15. Shp2 Controls Female Body Weight and Energy Balance by Integrating Leptin and Estrogen Signals

    PubMed Central

    He, Zhao; Zhang, Sharon S.; Meng, Qingyuan; Li, Shuangwei; Zhu, Helen H.; Raquil, Marie-Astrid; Alderson, Nazilla; Zhang, Hai; Wu, Jiarui; Rui, Liangyou; Cai, Dongsheng

    2012-01-01

    In mammals, leptin regulates food intake and energy balance mainly through the activation of LepRb in the hypothalamus, and estrogen has a leptin-like effect in the hypothalamic control of metabolism. However, it remains to be elucidated how estrogen signaling is intertwined with the leptin pathway. We show here that Shp2, a nonreceptor tyrosine phosphatase, acts to integrate leptin and estrogen signals. The expression of a dominant-active mutant (Shp2D61A) in forebrain neurons conferred female, but not male, transgenic mice resistance to high-fat diet (HFD)-induced obesity and liver steatosis, accompanied by improved insulin sensitivity and glucose homeostasis. Fed with either HFD or regular chow food, Shp2D61A female mice showed dramatically enhanced leptin sensitivity. Microinjection of Shp2D61A-expressing adeno-associated virus into mediobasal hypothalamus elicited a similar antiobese effect in female mice. Biochemical analyses showed a physical association of Shp2 with estrogen receptor alpha, which is necessary for the synergistic and persistent activation of Erk by leptin and estrogen. Together, these results elucidate a mechanism for the direct cross talk of leptin and estrogen signaling and offer one explanation for the propensity of postmenopausal women to develop obesity. PMID:22431513

  16. Genetic evidence that Shp-2 tyrosine phosphatase is a signal enhancer of the epidermal growth factor receptor in mammals

    PubMed Central

    Qu, Cheng-Kui; Yu, Wen-Mei; Azzarelli, Biagio; Feng, Gen-Sheng

    1999-01-01

    By using both genetic and biochemical approaches, we have investigated the physiological role of Shp-2, a cytoplasmic tyrosine phosphatase with two Src homology 2 domains, in signaling pathways downstream of epidermal growth factor receptor (EGF-R). In previous studies, a targeted deletion mutation in the SH2-N domain of Shp-2 was introduced into the murine Shp-2 locus, which resulted in embryonic lethality of homozygous mutant (Shp-2−/−) mice at midgestation. By aggregating Shp-2−/− embryonic stem cells with wild-type embryos, we created Shp-2−/−/wild-type chimeric animals. Most chimeras had open eyelids at birth and abnormal skin development, a phenotype characteristic of mice with mutations in EGF-R signaling components. In genetic crosses, a heterozygous Shp-2 mutation dominantly enhanced the phenotype of a weak mutant allele of EGF-R (wa-2), resulting in distinctive growth retardation, developmental defects in the skin, lung, and intestine, and perinatal mortality that are reminiscent of EGF-R knockout mice. Biochemical analysis revealed that signal propagation proximal to the EGF-R upon EGF stimulation was significantly attenuated in wa-2 fibroblast cells, which was exacerbated by the additional Shp-2 mutation. Thus, we provide biological evidence here that protein-tyrosine phosphatase Shp-2 acts to enhance information flow from the EGF-R in mouse growth and development. PMID:10411909

  17. Deoxycholic acid differentially regulates focal adhesion kinase phosphorylation: role of tyrosine phosphatase ShP2.

    PubMed

    Khare, Sharad; Holgren, Cory; Samarel, Allen M

    2006-12-01

    Environmental factors, including dietary fats, are implicated in colonic carcinogenesis. Dietary fats modulate secondary bile acids including deoxycholic acid (DCA) concentrations in the colon, which are thought to contribute to the nutritional-related component of colon cancer risk. Here we demonstrate, for the first time, that DCA differentially regulated the site-specific phosphorylation of focal adhesion kinase (FAK). DCA decreased adhesion of HCA-7 cells to the substratum and induced dephosphorylation of FAK at tyrosine-576/577 (Tyr-576/577) and Tyr-925. Tyrosine phosphorylation of FAK at Tyr-397 remained unaffected by DCA stimulation. Interestingly, we found that c-Src was constitutively associated with FAK and DCA actually activated Src, despite no change in FAK-397 and an inhibition of FAK-576 phosphorylation. DCA concomitantly and significantly increased association of tyrosine phosphatase ShP2 with FAK. Incubation of immunoprecipitated FAK, in vitro, with glutathione-S-transferase-ShP2 fusion protein resulted in tyrosine dephosphorylation of FAK in a concentration-dependent manner. Antisense oligodeoxynucleotides directed against ShP2 decreased ShP2 protein levels and attenuated DCA-induced FAK dephosphorylation. Inhibition of FAK by adenoviral-mediated overexpression of FAK-related nonkinase and gene silencing of Shp2 both abolished DCA's effect on cell adhesion, thus providing a possible mechanism for inside-out signaling by DCA in colon cancer cells. Our results suggest that DCA differentially regulates focal adhesion complexes and that tyrosine phosphatase ShP2 has a role in DCA signaling.

  18. SHP-2 phosphatase contributes to KRAS-driven intestinal oncogenesis but prevents colitis-associated cancer development

    PubMed Central

    Gagné-Sansfaçon, Jessica; Coulombe, Geneviève; Langlois, Marie-Josée; Langlois, Ariane; Paquet, Marilene; Carrier, Julie; Feng, Gen-Sheng; Qu, Cheng-Kui; Rivard, Nathalie

    2016-01-01

    A major risk factor of developing colorectal cancer (CRC) is the presence of chronic inflammation in the colon. In order to understand how inflammation contributes to CRC development, the present study focused on SHP-2, a tyrosine phosphatase encoded by PTPN11 gene in which polymorphisms have been shown to be markers of colitis susceptibility. Conversely, gain-of-function mutations in PTPN11 gene (E76 residue) have been found in certain sporadic CRC. Results shown herein demonstrate that SHP-2 expression was markedly increased in sporadic human adenomas but not in advanced colorectal tumors. SHP-2 silencing inhibited proliferative, invasive and tumoral properties of both intestinal epithelial cells (IECs) transformed by oncogenic KRAS and of human CRC cells. IEC-specific expression of a SHP-2E76K activated mutant in mice was not sufficient to induce tumorigenesis but markedly promoted tumor growth under the ApcMin/+ background. Conversely, mice with a conditional deletion of SHP-2 in IECs developed colitis-associated adenocarcinomas with age, associated with sustained activation of Wnt/β-catenin, NFκB and STAT3 signalings in the colonic mucosae. Moreover, SHP-2 epithelial deficiency considerably increased tumor load in ApcMin/+ mice, shifting tumor incidence toward the colon. Overall, these results reveal that SHP-2 can exert opposing functions in the large intestine: it can promote or inhibit tumorigenesis depending of the inflammatory context. PMID:27582544

  19. Salicylic Acid Based Small Molecule Inhibitor for the Oncogenic Src Homology-2 Domain Containing Protein Tyrosine Phosphatase-2 (SHP2)

    SciTech Connect

    Zhang, Xian; He, Yantao; Liu, Sijiu; Yu, Zhihong; Jiang, Zhong-Xing; Yang, Zhenyun; Dong, Yuanshu; Nabinger, Sarah C.; Wu, Li; Gunawan, Andrea M.; Wang, Lina; Chan, Rebecca J.; Zhang, Zhong-Yin

    2010-08-13

    The Src homology-2 domain containing protein tyrosine phosphatase-2 (SHP2) plays a pivotal role in growth factor and cytokine signaling. Gain-of-function SHP2 mutations are associated with Noonan syndrome, various kinds of leukemias, and solid tumors. Thus, there is considerable interest in SHP2 as a potential target for anticancer and antileukemia therapy. We report a salicylic acid based combinatorial library approach aimed at binding both active site and unique nearby subpockets for enhanced affinity and selectivity. Screening of the library led to the identification of a SHP2 inhibitor II-B08 (compound 9) with highly efficacious cellular activity. Compound 9 blocks growth factor stimulated ERK1/2 activation and hematopoietic progenitor proliferation, providing supporting evidence that chemical inhibition of SHP2 may be therapeutically useful for anticancer and antileukemia treatment. X-ray crystallographic analysis of the structure of SHP2 in complex with 9 reveals molecular determinants that can be exploited for the acquisition of more potent and selective SHP2 inhibitors.

  20. SHP-1 and SHP-2 in T cells: two phosphatases functioning at many levels

    PubMed Central

    Lorenz, Ulrike

    2009-01-01

    Summary Tyrosine phosphorylation and dephosphorylation of proteins play a critical role for many T-cell functions. The opposing actions of protein tyrosine kinases (PTKs) and protein tyrosine phosphatases (PTPs) determine the level of tyrosine phosphorylation at any time. It is well accepted that PTKs are essential during T-cell signaling; however, the role and importance of PTPs are much less known and appreciated. Both transmembrane and cytoplasmic tyrosine phosphatases have been identified in T cells and shown to regulate T-cell responses. This review focuses on the roles of the two cytoplasmic PTPs, the Src-homology 2 domain (SH2)-containing SHP-1 and SHP-2, in T-cell signaling, development, differentiation, and function. PMID:19290938

  1. Protein Tyrosine Phosphatase 2 (SHP-2) Moderates Signaling by gp130 but Is Not Required for the Induction of Acute-Phase Plasma Protein Genes in Hepatic Cells

    PubMed Central

    Kim, Hongkyun; Hawley, Teresa S.; Hawley, Robert G.; Baumann, Heinz

    1998-01-01

    Signals propagated via the gp130 subunit of the interleukin-6 (IL-6)-type cytokine receptors mediate, among various cellular responses, proliferation of hematopoietic cells and induction of acute-phase plasma protein (APP) genes in hepatic cells. Hematopoietic growth control by gp130 is critically dependent on activation of both STAT3 and protein tyrosine phosphatase 2 (SHP-2). To investigate whether induction of APP genes has a similar requirement for SHP-2, we constructed two chimeric receptors, G-gp130 and G-gp130(Y2F), consisting of the transmembrane and cytoplasmic domains of gp130 harboring either a wild-type or a mutated SHP-2 binding site, respectively, fused to the extracellular domain of the granulocyte colony-stimulating factor (G-CSF) receptor. Rat hepatoma H-35 cells stably expressing the chimeric receptors were generated by retroviral transduction. Both chimeric receptors transmitted a G-CSF-induced signal characteristic of that triggered by IL-6 through the endogenous gp130 receptor; i.e., both activated the appropriate JAK, induced DNA binding activity by STAT1 and STAT3, and up-regulated expression of the target APP genes, those for α-fibrinogen and haptoglobin. Notwithstanding these similarities in the patterns of signaling responses elicited, mutation of the SHP-2 interaction site in G-gp130(Y2F) abrogated ligand-activated receptor recruitment of SHP-2 as expected. Moreover, the tyrosine phosphorylation state of the chimeric receptor, the associated JAK activity, and the induced DNA binding activity of STAT1 and STAT3 were maintained at elevated levels and for an extended period of time in G-gp130(Y2F)-expressing cells following G-CSF treatment compared to that in cells displaying the G-gp130 receptor. H-35 cells ectopically expressing G-gp130(Y2F) were also found to display an enhanced sensitivity to G-CSF and a higher level of induction of APP genes. Overexpression of the enzymatically inactive SHP-2 enhanced the signaling by the wild-type but

  2. Hepatocyte growth factor (HGF) signals through SHP2 to regulate primary mouse myoblast proliferation

    SciTech Connect

    Li, Ju; Reed, Sarah A.; Johnson, Sally E.

    2009-08-01

    Niche localized HGF plays an integral role in G{sub 0} exit and the return to mitotic activity of adult skeletal muscle satellite cells. HGF actions are regulated by MET initiated intracellular signaling events that include recruitment of SHP2, a protein tyrosine phosphatase. The importance of SHP2 in HGF-mediated signaling was examined in myoblasts and primary cultures of satellite cells. Myoblasts stably expressing SHP2 (23A2-SHP2) demonstrate increased proliferation rates by comparison to controls or myoblasts expressing a phosphatase-deficient SHP2 (23A2-SHP2DN). By comparison to 23A2 myoblasts, treatment of 23A2-SHP2 cells with HGF does not further increase proliferation rates and 23A2-SHP2DN myoblasts are unresponsive to HGF. Importantly, the effects of SHP2 are independent of downstream ERK1/2 activity as inclusion of PD98059 does not blunt the HGF-induced proliferative response. SHP2 function was further evaluated in primary satellite cell cultures. Ectopic expression of SHP2 in satellite cells tends to decrease proliferation rates and siSHP2 causes an increase the percentage of dividing myogenic cells. Interestingly, treatment of satellite cells with high concentrations of HGF (50 ng/ml) inhibits proliferation, which can be overcome by knockdown of SHP2. From these results, we conclude that HGF signals through SHP2 in myoblasts and satellite cells to directly alter proliferation rates.

  3. Protein Tyrosine Phosphatases, TC-PTP, SHP1, and SHP2, Cooperate in Rapid Dephosphorylation of Stat3 in Keratinocytes Following UVB Irradiation

    PubMed Central

    Kim, Dae Joon; Tremblay, Michel L.; DiGiovanni, John

    2010-01-01

    Stat3 is initially dephosphorylated in murine keratinocytes in response to UVB irradiation. Treatment with Na3VO4 desensitized keratinocytes to UVB-induced apoptosis with the recovery of phosphorylated Stat3 protein levels, implying that a protein tyrosine phosphatase (PTP) is involved in this mechanism. In the current work, we report that three PTPs including TC45 (the nuclear form of TC-PTP), SHP1, and SHP2 are involved in this rapid dephosphorylation of Stat3 in keratinocytes induced by UVB irradiation. Dephosphorylation of Stat3 was increased rapidly after UVB irradiation of cultured keratinocytes. Knockdown of TC-PTP, SHP1, or SHP2 using RNAi showed that these PTPs are likely responsible for most of the rapid Stat3 dephosphorylation observed following UVB irradiation. The level of phosphorylated Stat3 was significantly higher in keratinocytes transfected with TC-PTP, SHP1, or SHP2 siRNA in the presence or absence of UVB compared with keratinocytes transfected with control siRNA. TC45 was mainly localized in the cytoplasm of keratinocytes and translocated from cytoplasm to nucleus upon UVB irradiation. Stat3 dephosphorylation was associated with nuclear translocation of TC45. Further studies revealed that knockdown of all three phosphatases, using RNAi, prevented the rapid dephosphorylation of Stat3 following UVB irradiation. In mouse epidermis, the level of phosphorylated Stat3 was initially decreased, followed by a significant increase at later time points after UVB exposure. The levels of Stat3 target genes, such as cyclin D1 and c-Myc, followed the changes in activated Stat3 in response to UVB irradiation. Collectively, these results suggest that three phosphatases, TC45, SHP1, and SHP2, are primarily responsible for UVB-mediated Stat3 dephosphorylation and may serve as part of an initial protective mechanism against UV skin carcinogenesis. PMID:20421975

  4. Protein tyrosine phosphatase SHP2 regulates TGF-β1 production in airway epithelia and asthmatic airway remodeling in mice

    PubMed Central

    Qin, X.-J.; Zhang, G.-S.; Zhang, X.; Qiu, Z.-W.; Wang, P.-L.; Li, Y.-W.; Li, W.; Xie, Q.-M.; Ke, Y.-H.; Lee, J. J.; Shen, H.-H.

    2014-01-01

    Background Transforming growth factor (TGF)-β1 produced in airway epithelia has been suggested as a contributor to the airway remodeling observed in asthma patients. The protein tyrosine phosphatase SHP2 is a demonstrable modulator of TGF-β1 production and thus a potential regulator of airway remodeling. Objectives To define the signal event by which SHP2 regulates asthmatic responses in airway epithelial cells by using a mouse model of experimental OVA-induced airway remodeling. Methods The airways of Shp2flox/flox mice were infected with recombinant adenovirus vectors expressing a Cre recombinase–green fluorescence protein (GFP) fusion protein as part of allergen provocation studies using mice sensitized with ovalbumin (OVA) and repeatedly challenged with OVA. Several endpoint pathologies were assessed, including airway hyper-responsiveness (AHR), lung inflammatory score, peribronchial collagen deposition, and α-smooth muscle actin (SMA) hyperplasia. In vitro studies using airway epithelial cells (BEAS-2B) were used to investigate the role of SHP2 in the regulation of pulmonary remodeling events, including the expression of collagen, α-SMA, and TGF-β1. Results Chronic OVA challenges in wild-type mice resulted in airway remodeling and lung dysfunction (e.g., increased inflammatory scores, collagen deposition (fibrosis), smooth muscle hyperplasia, and a significant increase in AHR). These endpoint pathology metrics were each significantly attenuated by conditional shp2 gene knockdown in airway epithelia. In vitro studies using BEAS-2B cells also demonstrated that the level of TGF-β1 production by these cells correlated with the extent of shp2 gene expression. Conclusions SHP2 activities in airway epithelial cells appear to modulate TGF-β1 production and, in turn, regulate allergic airway remodeling following allergen provocation. Clinical Implications Our findings identify SHP2 as a previously underappreciated contributor to the airway remodeling and lung

  5. New and Unexpected Biological Functions for the Src-Homology 2 Domain-Containing Phosphatase SHP-2 in the Gastrointestinal Tract.

    PubMed

    Coulombe, Geneviève; Rivard, Nathalie

    2016-01-01

    SHP-2 is a tyrosine phosphatase expressed in most embryonic and adult tissues. SHP-2 regulates many cellular functions including growth, differentiation, migration, and survival. Genetic and biochemical evidence show that SHP-2 is required for rat sarcoma viral oncogene/extracellular signal-regulated kinases mitogen-activated protein kinase pathway activation by most tyrosine kinase receptors, as well as by G-protein-coupled and cytokine receptors. In addition, SHP-2 can regulate the Janus kinase/signal transducers and activators of transcription, nuclear factor-κB, phosphatidyl-inositol 3-kinase/Akt, RhoA, Hippo, and Wnt/β-catenin signaling pathways. Emerging evidence has shown that SHP-2 dysfunction represents a key factor in the pathogenesis of gastrointestinal diseases, in particular in chronic inflammation and cancer. Variations within the gene locus encoding SHP-2 have been associated with increased susceptibility to develop ulcerative colitis and gastric atrophy. Furthermore, mice with conditional deletion of SHP-2 in intestinal epithelial cells rapidly develop severe colitis. Similarly, hepatocyte-specific deletion of SHP-2 induces hepatic inflammation, resulting in regenerative hyperplasia and development of tumors in aged mice. However, the SHP-2 gene initially was suggested to be a proto-oncogene because activating mutations of this gene were found in pediatric leukemias and certain forms of liver and colon cancers. Moreover, SHP-2 expression is up-regulated in gastric and hepatocellular cancers. Notably, SHP-2 functions downstream of cytotoxin-associated antigen A (CagA), the major virulence factor of Helicobacter pylori, and is associated with increased risks of gastric cancer. Further compounding this complexity, most recent findings suggest that SHP-2 also coordinates carbohydrate, lipid, and bile acid synthesis in the liver and pancreas. This review aims to summarize current knowledge and recent data regarding the biological functions of SHP-2

  6. Shp2 protein tyrosine phosphatase inhibitor activity of estramustine phosphate and its triterpenoid analogs

    PubMed Central

    Scott, Latanya M.; Chen, Liwei; Daniel, Kenyon G.; Brooks, Wesley H.; Guida, Wayne C.; Lawrence, Harshani R.; Sebti, Said M.; Lawrence, Nicholas J.; Wu, Jie

    2010-01-01

    Shp2 protein tyrosine phosphate (PTP) is a novel target for anticancer drug discovery. We identified estramustine phosphate as a Shp2 PTP inhibitor from the National Cancer Institute Approved Oncology Drug set. A focused structure-activity relationship study indicated that the 17- phosphate group is required for the Shp2 PTP inhibitor activity of estramustine phosphate. A search for estramustine phosphate analogs led to identification of two triperpenoids, enoxolone and celastrol, having Shp2 PTP inhibitor activity. With the previously reported PTP1B inhibitor trodusquemine, our study reveals steroids and triterpenoids with negatively charged phosphate, carboxylate, or sulfonate groups as novel pharmacophores of selective PTP inhibitors. PMID:21193311

  7. SHP2 phosphatase as a novel therapeutic target for melanoma treatment

    PubMed Central

    Zhang, Ruo-Yu; Yu, Zhi-Hong; Zeng, Lifan; Zhang, Sheng; Bai, Yunpeng; Miao, Jinmin; Chen, Lan; Xie, Jingwu; Zhang, Zhong-Yin

    2016-01-01

    Melanoma ranks among the most aggressive and deadly human cancers. Although a number of targeted therapies are available, they are effective only in a subset of patients and the emergence of drug resistance often reduces durable responses. Thus there is an urgent need to identify new therapeutic targets and develop more potent pharmacological agents for melanoma treatment. Herein we report that SHP2 levels are frequently elevated in melanoma, and high SHP2 expression is significantly associated with more metastatic phenotype and poorer prognosis. We show that SHP2 promotes melanoma cell viability, motility, and anchorage-independent growth, through activation of both ERK1/2 and AKT signaling pathways. We demonstrate that SHP2 inhibitor 11a-1 effectively blocks SHP2-mediated ERK1/2 and AKT activation and attenuates melanoma cell viability, migration and colony formation. Most importantly, SHP2 inhibitor 11a-1 suppresses xenografted melanoma tumor growth, as a result of reduced tumor cell proliferation and enhanced tumor cell apoptosis. Taken together, our data reveal SHP2 as a novel target for melanoma and suggest SHP2 inhibitors as potential novel therapeutic agents for melanoma treatment. PMID:27650545

  8. Plasiatine, an Unprecedented Indole–Phenylpropanoid Hybrid from Plantago asiatica as a Potent Activator of the Nonreceptor Protein Tyrosine Phosphatase Shp2

    NASA Astrophysics Data System (ADS)

    Gao, Zhong-Hua; Shi, Yi-Ming; Qiang, Zhe; Wang, Xia; Shang, Shan-Zhai; Yang, Yan; Du, Bao-Wen; Peng, Hui-Pan; Ji, Xu; Li, Honglin; Wang, Fei; Xiao, Wei-Lie

    2016-04-01

    Plasiatine (1), isolated from the seeds of Plantago asiatica, is an unprecedented indole analogue linked to a phenylpropanoid moiety via a carbon bond that builds up a novel heteromeric construction with a C19N2 scaffold. Its structure was determined by spectroscopic data and computational evidence. Notably, experimental assay demonstrated that 1 significantly enhanced the activity of the nonreceptor protein tyrosine phosphatase Shp2 in vitro in a concentration-dependent manner with an EC50 value of 0.97 μM, and activated phosphorylation of ERK, a known target of Shp2. Moreover, plasiatine (1) promoted hepatocellular HepG2 cells migration. Molecular docking suggested that plasiatine (1) binds to the catalytic cleft of Shp2. These results identified plasiatine (1) as the first small molecule Shp2 activator, and it warrants further investigation as a novel pharmaceutical tool to study the function of Shp2 in tumorigenesis.

  9. Protein tyrosine phosphatases PTP-1B, SHP-2, and PTEN facilitate Rb/E2F-associated apoptotic signaling.

    PubMed

    Morales, Liza D; Casillas Pavón, Edgar A; Shin, Jun Wan; Garcia, Alexander; Capetillo, Mario; Kim, Dae Joon; Lieman, Jonathan H

    2014-01-01

    To maintain tissue homeostasis, apoptosis is functionally linked to the cell cycle through the retinoblastoma (Rb)/E2F pathway. When the Rb tumor suppressor protein is functionally inactivated, E2F1 elicits an apoptotic response through both intrinsic (caspase-9 mediated) and extrinsic (caspase-8 mediated) apoptotic pathways in order to eliminate hyperproliferative cells. Rb/E2F-associated apoptosis has been demonstrated to be associated with the loss of constitutive transcriptional repression by Rb/E2F complexes and mediated by caspase-8. Protein tyrosine phosphatases (PTPs) PTP-1B and SHP-2 have been previously shown to be directly activated by loss of Rb/E2F repression during Rb/E2F-associated apoptosis. In this current study, we demonstrate that the PTEN tumor suppressor is also directly activated by loss of Rb/E2F repression. We also demonstrate that PTP-1B, SHP-2, and PTEN play a functional role in Rb/E2F-associated apoptosis. Knockdown of PTP1B, SHP2, or PTEN expression with small interfering RNA (siRNA) in apoptotic cells increases cell viability and rescues cells from the Rb/E2F-associated apoptotic response. Furthermore, rescue from apoptosis coincides with inhibition of caspase-8 and caspase-3 cleavage (activation). Our results indicate PTP-1B, SHP-2, and PTEN all play a functional role in Rb/E2F-associated apoptotic signal transduction and provide further evidence that PTP-1B, SHP-2, and PTEN can contribute to tumor suppression through an Rb/E2F-associated mechanism.

  10. LRRK2 Inhibits FAK Activity by Promoting FERM-mediated Autoinhibition of FAK and Recruiting the Tyrosine Phosphatase, SHP-2

    PubMed Central

    Choi, Insup; Byun, Ji-won; Park, Sang Myun; Jou, Ilo

    2016-01-01

    Mutation of leucine-rich repeat kinase 2 (LRRK2) causes an autosomal dominant and late-onset familial Parkinson's disease (PD). Recently, we reported that LRRK2 directly binds to and phosphorylates the threonine 474 (T474)-containing Thr-X-Arg(Lys) (TXR) motif of focal adhesion kinase (FAK), thereby inhibiting the phosphorylation of FAK at tyrosine (Y) 397 residue (pY397-FAK), which is a marker of its activation. Mechanistically, however, it remained unclear how T474-FAK phosphorylation suppressed FAK activation. Here, we report that T474-FAK phosphorylation could inhibit FAK activation via at least two different mechanisms. First, T474 phosphorylation appears to induce a conformational change of FAK, enabling its N-terminal FERM domain to autoinhibit Y397 phosphorylation. This is supported by the observation that the levels of pY397-FAK were increased by deletion of the FERM domain and/or mutation of the FERM domain to prevent its interaction with the kinase domain of FAK. Second, pT474-FAK appears to recruit SHP-2, which is a phosphatase responsible for dephosphorylating pY397-FAK. We found that mutation of T474 into glutamate (T474E-FAK) to mimic phosphorylation induced more strong interaction with SHP-2 than WT-FAK, and that pharmacological inhibition of SHP-2 with NSC-87877 rescued the level of pY397 in HEK293T cells. These results collectively show that LRRK2 suppresses FAK activation through diverse mechanisms that include the promotion of autoinhibition and/or the recruitment of phosphatases, such as SHP-2. PMID:27790061

  11. The Protein Tyrosine Phosphatase, Shp2, Positively Contributes to FLT3-ITD-Induced Hematopoietic Progenitor Hyperproliferation and Malignant Disease In Vivo

    PubMed Central

    Nabinger, Sarah C.; Li, XingJun; Ramdas, Baskar; He, Yantao; Zhang, Xian; Zeng, Lifan; Richine, Briana; Bowling, Joshua D.; Fukuda, Seiji; Goenka, Shreevrat; Liu, Ziyue; Feng, Gen-Sheng; Yu, Menggang; Sandusky, George E.; Boswell, H. Scott; Zhang, Zhong-Yin; Kapur, Reuben; Chan, Rebecca J.

    2014-01-01

    Internal tandem duplications in the fms-like tyrosine kinase receptor (FLT3-ITDs) confer a poor prognosis in acute myeloid leukemia. We hypothesized that increased recruitment of the protein tyrosine phosphatase, Shp2, to FLT3-ITDs contributes to FLT3 ligand (FL)-independent hyperproliferation and STAT5 activation. Co-immunoprecipitation demonstrated constitutive association of Shp2 with the FLT3-ITD, N51-FLT3, as well as with STAT5. Knock-down of Shp2 in Baf3/N51-FLT3 cells significantly reduced proliferation while having little effect on WT-FLT3-expressing cells. Consistently, mutation of N51-FLT3 tyrosine 599 to phenylalanine or genetic disruption of Shp2 in N51-FLT3-expressing bone marrow low density mononuclear cells reduced proliferation and STAT5 activation. In transplants, genetic disruption of Shp2 in vivo yielded increased latency to and reduced severity of FLT3-ITD-induced malignancy. Mechanistically, Shp2 co-localizes with nuclear phospho-STAT5, is present at functional interferon-γ activation sites (GAS) within the BCL2L1 promoter, and positively activates the human BCL2L1 promoter, suggesting that Shp2 works with STAT5 to promote pro-leukemogenic gene expression. Further, using a small molecule Shp2 inhibitor, the proliferation of N51-FLT3-expressing bone marrow progenitors and primary AML samples was reduced in a dose-dependent manner. These findings demonstrate that Shp2 positively contributes to FLT3-ITD-induced leukemia and suggest that Shp2 inhibition may provide a novel therapeutic approach to acute myeloid leukemia. PMID:23103841

  12. A salicylic acid-based small molecule inhibitor for the oncogenic Src homology-2 domain containing protein tyrosine phosphatase-2 (SHP2)

    PubMed Central

    Zhang, Xian; He, Yantao; Liu, Sijiu; Yu, Zhihong; Jiang, Zhong-Xing; Yang, Zhenyun; Dong, Yuanshu; Nabinger, Sarah C.; Wu, Li; Gunawan, Andrea M.; Wang, Lina; Chan, Rebecca J.; Zhang, Zhong-Yin

    2010-01-01

    The Src homology-2 domain containing protein tyrosine phosphatase-2 (SHP2) plays a pivotal role in growth factor and cytokine signaling. Gain-of-function SHP2 mutations are associated with Noonan syndrome, various kinds of leukemias and solid tumors. Thus there is considerable interest in SHP2 as a potential target for anti-cancer and anti-leukemia therapy. We report a salicylic acid-based combinatorial library approach aimed to bind both active site and unique nearby sub-pockets for enhanced affinity and selectivity. Screening of the library led to the identification of a SHP2 inhibitor II-B08 (compound 9) with highly efficacious cellular activity. Compound 9 blocks growth factor stimulated ERK1/2 activation and hematopoietic progenitor proliferation, providing supporting evidence that chemical inhibition of SHP2 may be therapeutically useful for anti-cancer and anti-leukemia treatment. X-ray crystallographic analysis of the structure of SHP2 in complex with 9 reveals molecular determinants that can be exploited for the acquisition of more potent and selective SHP2 inhibitors. PMID:20170098

  13. G-CSF receptor activation of the Src kinase Lyn is mediated by Gab2 recruitment of the Shp2 phosphatase

    PubMed Central

    Futami, Muneyoshi; Zhu, Quan-sheng; Whichard, Zakary L.; Xia, Ling; Ke, Yuehai; Neel, Benjamin G.; Feng, Gen-Sheng

    2011-01-01

    Src activation involves the coordinated regulation of positive and negative tyrosine phosphorylation sites. The mechanism whereby receptor tyrosine kinases, cytokine receptors, and integrins activate Src is not known. Here, we demonstrate that granulocyte colony-stimulating factor (G-CSF) activates Lyn, the predominant Src kinase in myeloid cells, through Gab2-mediated recruitment of Shp2. After G-CSF stimulation, Lyn dynamically associates with Gab2 in a spatiotemporal manner. The dephosphorylation of phospho-Lyn Tyr507 was abrogated in Shp2-deficient cells transfected with the G-CSF receptor but intact in cells expressing phosphatase-defective Shp2. Auto-phosphorylation of Lyn Tyr396 was impaired in cells treated with Gab2 siRNA. The constitutively activated Shp2E76A directed the dephosphorylation of phospho-Lyn Tyr507 in vitro. Tyr507 did not undergo dephosphorylation in G-CSF–stimulated cells expressing a mutant Gab2 unable to bind Shp2. We propose that Gab2 forms a complex with Lyn and after G-CSF stimulation, Gab2 recruits Shp2, which dephosphorylates phospho-Lyn Tyr507, leading to Lyn activation. PMID:21636860

  14. Receptor Tyrosine Kinase Ubiquitylation Involves the Dynamic Regulation of Cbl-Spry2 by Intersectin 1 and the Shp2 Tyrosine Phosphatase

    PubMed Central

    Okur, Mustafa Nazir; Russo, Angela

    2014-01-01

    Ubiquitylation of receptor tyrosine kinases (RTKs) regulates their trafficking and lysosomal degradation. The multidomain scaffolding protein intersectin 1 (ITSN1) is an important regulator of this process. ITSN1 stimulates ubiquitylation of the epidermal growth factor receptor (EGFR) through enhancing the activity of the Cbl E3 ubiquitin ligase. However, the precise mechanism through which ITSN1 enhances Cbl activity is unclear. Here, we demonstrate that ITSN1 interacts with and recruits the Shp2 tyrosine phosphatase to Spry2 to enhance its dephosphorylation, thereby disrupting the inhibitory effect of Spry2 on Cbl and enhancing EGFR ubiquitylation. In contrast, expression of a catalytically inactive Shp2 mutant reversed the effect of ITSN1 on Spry2 dephosphorylation and decreased Cbl-mediated EGFR ubiquitylation. In addition, disruption of ITSN1 binding to Spry2 through point mutation of the Pro-rich ITSN1 binding site in Spry2 resulted in decreased Shp2-Spry2 interaction and enhanced Spry2 tyrosine phosphorylation. This study demonstrates that ITSN1 enhances Cbl activity, in part, by modulating the interaction of Cbl with Spry2 through recruitment of Shp2 phosphatase to the Cbl-Spry2 complex. These findings reveal a new level of complexity in the regulation of RTKs by Cbl through ITSN1 binding with Shp2 and Spry2. PMID:24216759

  15. A SHPing tale: perspectives on the regulation of SHP-1 and SHP-2 tyrosine phosphatases by the C-terminal tail.

    PubMed

    Poole, Alastair W; Jones, Matthew L

    2005-11-01

    Protein tyrosine phosphorylation is a ubiquitous signalling mechanism and is regulated by a balance between the action of kinases and phosphatases. The SH2 domain-containing phosphatases SHP-1 and SHP-2 are the best studied of the classical non-receptor tyrosine phosphatases, but it is intriguing that despite their close sequence and structural homology these two phosphatases play quite different cellular roles. In particular, whereas SHP-1 plays a largely negative signalling role suppressing cellular activation, SHP-2 plays a largely positive signalling role. Major sequence differences between the two molecules are apparent in the approximately 100 amino acid residues at the extreme C-terminus of the proteins, beyond the phosphatase catalytic domain. Here we review how the differences in the tails of these proteins may regulate their activities and explain some of their functional differences.

  16. HIF-1α Dependent Wound Healing Angiogenesis In Vivo Can Be Controlled by Site-Specific Lentiviral Magnetic Targeting of SHP-2.

    PubMed

    Heun, Yvonn; Pogoda, Kristin; Anton, Martina; Pircher, Joachim; Pfeifer, Alexander; Woernle, Markus; Ribeiro, Andrea; Kameritsch, Petra; Mykhaylyk, Olga; Plank, Christian; Kroetz, Florian; Pohl, Ulrich; Mannell, Hanna

    2017-07-05

    Hypoxia promotes vascularization by stabilization and activation of the hypoxia inducible factor 1α (HIF-1α), which constitutes a target for angiogenic gene therapy. However, gene therapy is hampered by low gene delivery efficiency and non-specific side effects. Here, we developed a gene transfer technique based on magnetic targeting of magnetic nanoparticle-lentivirus (MNP-LV) complexes allowing site-directed gene delivery to individual wounds in the dorsal skin of mice. Using this technique, we were able to control HIF-1α dependent wound healing angiogenesis in vivo via site-specific modulation of the tyrosine phosphatase activity of SHP-2. We thus uncover a novel physiological role of SHP-2 in protecting HIF-1α from proteasomal degradation via a Src kinase dependent mechanism, resulting in HIF-1α DNA-binding and transcriptional activity in vitro and in vivo. Excitingly, using targeting of MNP-LV complexes, we achieved simultaneous expression of constitutively active as well as inactive SHP-2 mutant proteins in separate wounds in vivo and hereby specifically and locally controlled HIF-1α activity as well as the angiogenic wound healing response in vivo. Therefore, magnetically targeted lentiviral induced modulation of SHP-2 activity may be an attractive approach for controlling patho-physiological conditions relying on hypoxic vessel growth at specific sites. Copyright © 2017 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.

  17. Shp2 suppresses the adipogenic differentiation of preadipocyte 3T3-L1 cells at an early stage

    PubMed Central

    Tao, J; Zheng, L; Meng, M; Li, Y; Lu, Z

    2016-01-01

    Tyrosine phosphatase protein Shp2 is a potential therapeutic target for obesity. However, the mechanism of Shp2 during adipogenesis is not fully understood. The present study investigated the role of Shp2 in the terminal differentiation of preadipocytes. The results showed that Shp2 suppressed adipocyte differentiation in 3T3-L1 cells; overexpression of Shp2 reduced lipid droplet production in 3T3-L1 cells, whereas Shp2 knockdown increased lipid droplet production in 3T3-L1 cells. Furthermore, inhibition of Shp2 activity also enhanced adipocyte differentiation. Interestingly, Shp2 expression was specifically decreased early during differentiation in response to stimulation with the dexamethasone–methylisobutylxanthine–insulin (DMI) hormone cocktail. During the first 2 days of differentiation, Shp2 overexpression impaired the DMI-induced phosphorylation of signal transducer and activator of transcription 3 (STAT3) in 3T3-L1 cells and blocked the peak expression of CCAAT/enhancer-binding proteins β and δ during preadipocyte differentiation. In conclusion, Shp2 downregulated the early stages of hormone-induced differentiation of 3T3-L1 cells and inhibited the expression of the first wave of transcription factors by suppressing the DMI-induced STAT3 signaling pathway. These discoveries point to a novel role of Shp2 during adipogenesis and support the hypothesis that Shp2 could be a therapeutic target for the control of obesity. PMID:27551539

  18. Programmed cell death 1 forms negative costimulatory microclusters that directly inhibit T cell receptor signaling by recruiting phosphatase SHP2

    PubMed Central

    Takamatsu, Masako; Kobayashi-Imanishi, Wakana; Hashimoto-Tane, Akiko; Azuma, Miyuki

    2012-01-01

    Programmed cell death 1 (PD-1) is a negative costimulatory receptor critical for the suppression of T cell activation in vitro and in vivo. Single cell imaging elucidated a molecular mechanism of PD-1–mediated suppression. PD-1 becomes clustered with T cell receptors (TCRs) upon binding to its ligand PD-L1 and is transiently associated with the phosphatase SHP2 (Src homology 2 domain–containing tyrosine phosphatase 2). These negative costimulatory microclusters induce the dephosphorylation of the proximal TCR signaling molecules. This results in the suppression of T cell activation and blockade of the TCR-induced stop signal. In addition to PD-1 clustering, PD-1–TCR colocalization within microclusters is required for efficient PD-1–mediated suppression. This inhibitory mechanism also functions in PD-1hi T cells generated in vivo and can be overridden by a neutralizing anti–PD-L1 antibody. Therefore, PD-1 microcluster formation is important for regulation of T cell activation. PMID:22641383

  19. Molecular cloning of MIS, a myeloid inhibitory siglec, that binds protein-tyrosine phosphatases SHP-1 and SHP-2.

    PubMed

    Ulyanova, T; Shah, D D; Thomas, M L

    2001-04-27

    We describe the molecular cloning and characterization of a novel myeloid inhibitory siglec, MIS, that belongs to the family of sialic acid-binding immunoglobulin-like lectins. A full-length MIS cDNA was obtained from murine bone marrow cells. MIS is predicted to contain an extracellular region comprising three immunoglobulin-like domains (V-set amino-terminal domain followed by two C-set domains), a transmembrane domain and a cytoplasmic tail with two immunoreceptor tyrosine-based inhibitory motif (ITIM)-like sequences. The closest relative of MIS in the siglec family is human siglec 8. Extracellular regions of these two siglecs share 47% identity at the amino acid level. Southern blot analysis suggests the presence of one MIS gene. MIS is expressed in the spleen, liver, heart, kidney, lung and testis tissues. Several isoforms of MIS protein exist due to the alternative splicing. In a human promonocyte cell line, MIS was able to bind Src homology 2-containing protein-tyrosine phosphatases, SHP-1 and SHP-2. This binding was mediated by the membrane-proximal ITIM of MIS. Moreover, MIS exerted an inhibitory effect on FcgammaRI receptor-induced calcium mobilization. These data suggest that MIS can play an inhibitory role through its ITIM sequences.

  20. Myeloid specific human CD33 is an inhibitory receptor with differential ITIM function in recruiting the phosphatases SHP-1 and SHP-2.

    PubMed

    Paul, S P; Taylor, L S; Stansbury, E K; McVicar, D W

    2000-07-15

    CD33 is a myeloid specific member of the sialic acid-binding receptor family and is expressed highly on myeloid progenitor cells but at much lower levels in differentiated cells. Human CD33 has two tyrosine residues in its cytoplasmic domain (Y340 and Y358). When phosphorylated, these tyrosines could function as docking sites for the phosphatases, SHP-1 and/or SHP-2, enabling CD33 to function as an inhibitory receptor. Here we demonstrate that CD33 is tyrosine phosphorylated in the presence of the phosphatase inhibitor, pervanadate, and recruits SHP-1 and SHP-2. Co-expression studies suggest that the Src-family kinase Lck is effective at phosphorylating Y340, but not Y358, suggesting that these residues may function in the selective recruitment of adapter molecules and have distinct functions. Further support for overlapping, but nonredundant, roles for Y340 and Y358 comes from peptide-binding studies that revealed the recruitment of both SHP-1 and SHP-2 to Y340 but only SHP-2 to Y358. Analysis using mutants of SHP-1 demonstrated that binding Y340 of CD33 was primarily to the amino Src homology-2 domain of SHP-1. The potential of CD33 to function as an inhibitory receptor was demonstrated by its ability to down-regulate CD64-induced calcium mobilization in U937. The dependence of this inhibition on SHP-1 was demonstrated by blocking CD33-mediated effects with dominant negative SHP-1. This result implies that CD33 is an inhibitory receptor and also that SHP-1 phosphatase has a significant role in mediating CD33 function. Further studies are essential to identify the receptor(s) that CD33 inhibits in vivo and its function in myeloid lineage development. (Blood. 2000;96:483-490)

  1. Tyrosine phosphatases such as SHP-2 act in a balance with Src-family kinases in stabilization of postsynaptic clusters of acetylcholine receptors

    PubMed Central

    Camilleri, Alain A; Willmann, Raffaella; Sadasivam, Gayathri; Lin, Shuo; Rüegg, Markus A; Gesemann, Matthias; Fuhrer, Christian

    2007-01-01

    Background Development of neural networks requires that synapses are formed, eliminated and stabilized. At the neuromuscular junction (NMJ), agrin/MuSK signaling, by triggering downstream pathways, causes clustering and phosphorylation of postsynaptic acetylcholine receptors (AChRs). Postnatally, AChR aggregates are stabilized by molecular pathways that are poorly characterized. Gain or loss of function of Src-family kinases (SFKs) disassembles AChR clusters at adult NMJs in vivo, whereas AChR aggregates disperse rapidly upon withdrawal of agrin from cultured src-/-;fyn-/- myotubes. This suggests that a balance between protein tyrosine phosphatases (PTPs) and protein tyrosine kinases (PTKs) such as those of the Src-family may be essential in stabilizing clusters of AChRs. Results We have analyzed the role of PTPs in maintenance of AChR aggregates, by adding and then withdrawing agrin from cultured myotubes in the presence of PTP or PTK inhibitors and quantitating remaining AChR clusters. In wild-type myotubes, blocking PTPs with pervanadate caused enhanced disassembly of AChR clusters after agrin withdrawal. When added at the time of agrin withdrawal, SFK inhibitors destabilized AChR aggregates but concomitant addition of pervanadate rescued cluster stability. Likewise in src-/-;fyn-/- myotubes, in which agrin-induced AChR clusters form normally but rapidly disintegrate after agrin withdrawal, pervanadate addition stabilized AChR clusters. The PTP SHP-2, known to be enriched at the NMJ, associated and colocalized with MuSK, and agrin increased this interaction. Specific SHP-2 knockdown by RNA interference reduced the stability of AChR clusters in wild-type myotubes. Similarly, knockdown of SHP-2 in adult mouse soleus muscle by electroporation of RNA interference constructs caused disassembly of pretzel-shaped AChR-rich areas in vivo. Finally, we found that src-/-;fyn-/- myotubes contained elevated levels of SHP-2 protein. Conclusion Our data are the first to show

  2. Sprouty-related Ena/Vasodilator-stimulated Phosphoprotein Homology 1-Domain-containing Protein (SPRED1), a Tyrosine-Protein Phosphatase Non-receptor Type 11 (SHP2) Substrate in the Ras/Extracellular Signal-regulated Kinase (ERK) Pathway*

    PubMed Central

    Quintanar-Audelo, Martina; Yusoff, Permeen; Sinniah, Saravanan; Chandramouli, Sumana; Guy, Graeme R.

    2011-01-01

    SHP2 is a tyrosine phosphatase involved in the activation of the Ras/ERK signaling pathway downstream of a number of receptor tyrosine kinases. One of the proposed mechanisms involving SHP2 in this context is to dephosphorylate and inactivate inhibitors of the Ras/ERK pathway. Two protein families bearing a unique, common domain, Sprouty and SPRED proteins, are possible candidates because they have been reported to inhibit the Ras/ERK pathway upon FGF activation. We tested whether any of these proteins are likely substrates of SHP2. Our findings indicate that Sprouty2 binds to the C-terminal tail of SHP2, which is an unlikely substrate binding site, whereas SPRED proteins bind to the tyrosine phosphatase domain that is known to be the binding site for its substrates. Overexpressed SHP2 was able to dephosphorylate SPREDs but not Sprouty2. Finally, we found two tyrosine residues on SPRED1 that are required, when phosphorylated, to inhibit Ras/ERK activation and identified Tyr-420 as a specific dephosphorylation target of SHP2. The evidence obtained indicates that SPRED1 is a likely substrate of SHP2, whose tyrosine dephosphorylation is required to attenuate the inhibitory action of SPRED1 in the Ras/ERK pathway. PMID:21531714

  3. Shp2 SUMOylation promotes ERK activation and hepatocellular carcinoma development

    PubMed Central

    Deng, Rong; Zhao, Xian; Qu, YingYing; Chen, Cheng; Zhu, Changhong; Zhang, Hailong; Yuan, Haihua; Jin, Hui; Liu, Xin; Wang, Yanli; Chen, Qin; Huang, Jian; Yu, Jianxiu

    2015-01-01

    Shp2, an ubiquitously expressed protein tyrosine phosphatase, is essential for regulation of Ras/ERK signaling pathway and tumorigenesis. Here we report that Shp2 is modified by SUMO1 at lysine residue 590 (K590) in its C-terminus, which is reduced by SUMO1-specific protease SENP1. Analysis of wild-type Shp2 and SUMOylation-defective Shp2K590R mutant reveals that SUMOylation of Shp2 promotes EGF-stimulated ERK signaling pathway and increases anchorage-independent cell growth and xenografted tumor growth of hepatocellular carcinoma (HCC) cell lines. Furthermore, we find that mutant Shp2K590R reduces its binding with the scaffolding protein Gab1, and consistent with this, knockdown of SENP1 increased the interaction between Shp2 and Gab1. More surprisingly, we show that human Shp2 (hShp2) and mouse Shp2 (mShp2) have differential effects on ERK activation as a result of different SUMOylation level, which is due to the event of K590 at hShp2 substituted by R594 at mShp2. In summary, our data demonstrate that SUMOylation of Shp2 promotes ERK activation via facilitating the formation of Shp2-Gab1 complex and thereby accelerates HCC cell and tumor growth, which presents a novel regulatory mechanism underlying Shp2 in regulation of HCC development. PMID:25823821

  4. Shp2 signaling in POMC neurons is important for leptin's actions on blood pressure, energy balance, and glucose regulation

    PubMed Central

    da Silva, Alexandre A.; Ebaady, Sabira E.; Sessums, Price O.; Abraham, Ralph S.; Elmquist, Joel K.; Lowell, Bradford B.; Hall, John E.

    2014-01-01

    Previous studies showed that Src homology-2 tyrosine phosphatase (Shp2) is an important regulator of body weight. In this study, we examined the impact of Shp2 deficiency specifically in proopiomelanocortin (POMC) neurons on metabolic and cardiovascular function and on chronic blood pressure (BP) and metabolic responses to leptin. Mice with Shp2 deleted in POMC neurons (Shp2/Pomc-cre) and control mice (Shp2flox/flox) were implanted with telemetry probes and venous catheters for measurement of mean arterial pressure (MAP) and leptin infusion. After at least 5 days of stable control measurements, mice received leptin infusion (2 μg·kg−1·day−1 iv) for 7 days. Compared with Shp2flox/flox controls, Shp2/Pomc-cre mice at 22 wk of age were slightly heavier (34 ± 1 vs. 31 ± 1 g) but consumed a similar amount of food (3.9 ± 0.3 vs. 3.8 ± 0.2 g/day). Leptin infusion reduced food intake in Shp2flox/flox mice (2.6 ± 0.5 g) and Shp2/Pomc-cre mice (3.2 ± 0.3 g). Despite decreasing food intake, leptin infusion increased MAP in control mice, whereas no significant change in MAP was observed in Shp2/Pomc-cre mice. Leptin infusion also decreased plasma glucose and insulin levels in controls (12 ± 1 to 6 ± 1 μU/ml and 142 ± 12 to 81 ± 8 mg/100 ml) but not in Shp2/Pomc-cre mice. Leptin increased V̇o2 by 16 ± 2% in controls and 7 ± 1% in Shp2/Pomc-cre mice. These results indicate that Shp2 signaling in POMC neurons contributes to the long-term BP and antidiabetic actions of leptin and may play a modest role in normal regulation of body weight. PMID:25339680

  5. The Tyrosine Phosphatase SHP2 Associates with CUB Domain-Containing Protein-1 (CDCP1), Regulating Its Expression at the Cell Surface in a Phosphorylation-Dependent Manner

    PubMed Central

    Gandji, Leslie Yewakon; Proust, Richard; Larue, Lionel; Gesbert, Franck

    2015-01-01

    CUB domain-containing protein-1 (CDCP1) is a transmembrane glycoprotein that is phosphorylated by SRC family kinases (SFK) before recruiting and activating PKCδ. CDCP1 is overproduced in many cancers. It promotes metastasis and resistance to anoïkis. The robust production of CDCP1 would be associated with stemness and has been proposed as a novel prognosis marker. The natural transmembrane location of CDCP1 makes it an ideal therapeutic target and treatments based on the use of appropriate antibodies are currently being evaluated. However, we still know very little about the molecular fate of CDCP1 and its downstream signaling events. Improvements in our understanding of the molecular events occurring downstream of CDCP1 are required to make use of changes of CDCP1 production or functions for therapeutic purposes. By the mean of co-immunoprecipitation and affinity precipitation we show here, for the first time, that CDCP1 interacts directly, with the cytosolic tyrosine phosphatase SHP2. Point mutants of CDCP1 show that residues Y734 and Y743 are responsible for its interaction with SHP2. It may therefore compete with SFK. We also demonstrate that a shRNA-mediated down regulation of SHP2 is associated with a stronger CDCP1 phosphorylation and an impairment of antibody-mediated CDCP1 internalization. PMID:25876044

  6. The phosphatase SHP2 regulates the spacing effect for long-term memory induction.

    PubMed

    Pagani, Mario R; Oishi, Kimihiko; Gelb, Bruce D; Zhong, Yi

    2009-10-02

    A property of long-term memory (LTM) induction is the requirement for repeated training sessions spaced over time. This augmentation of memory formation with spaced resting intervals is called the spacing effect. We now show that in Drosophila, the duration of resting intervals required for inducing LTM is regulated by activity levels of the protein tyrosine phosphatase corkscrew (CSW). Overexpression of wild-type CSW in mushroom body neurons shortens the inter-trial interval required for LTM induction, whereas overexpression of constitutively active CSW proteins prolongs these resting intervals. These gain-of-function csw mutations are associated with a clinical condition of mental retardation. Biochemical analysis reveals that LTM-inducing training regimens generate repetitive waves of CSW-dependent MAPK activation, the length of which appears to define the duration of the resting interval. Constitutively active CSW proteins prolong the resting interval by altering the MAPK inactivation cycle. We thus provide insight into the molecular basis of the spacing effect.

  7. LST1/A Is a Myeloid Leukocyte-specific Transmembrane Adaptor Protein Recruiting Protein Tyrosine Phosphatases SHP-1 and SHP-2 to the Plasma Membrane*

    PubMed Central

    Draber, Peter; Stepanek, Ondrej; Hrdinka, Matous; Drobek, Ales; Chmatal, Lukas; Mala, Linda; Ormsby, Tereza; Angelisova, Pavla; Horejsi, Vaclav; Brdicka, Tomas

    2012-01-01

    Transmembrane adaptor proteins are membrane-anchored proteins consisting of a short extracellular part, a transmembrane domain, and a cytoplasmic part with various protein-protein interaction motifs but lacking any enzymatic activity. They participate in the regulation of various signaling pathways by recruiting other proteins to the proximity of cellular membranes where the signaling is often initiated and propagated. In this work, we show that LST1/A, an incompletely characterized protein encoded by MHCIII locus, is a palmitoylated transmembrane adaptor protein. It is expressed specifically in leukocytes of the myeloid lineage, where it localizes to the tetraspanin-enriched microdomains. In addition, it binds SHP-1 and SHP-2 phosphatases in a phosphotyrosine-dependent manner, facilitating their recruitment to the plasma membrane. These data suggest a role for LST1/A in negative regulation of signal propagation. PMID:22589543

  8. SHP2 regulates proliferation and tumorigenicity of glioma stem cells.

    PubMed

    Roccograndi, Laura; Binder, Zev A; Zhang, Logan; Aceto, Nicola; Zhang, Zhuo; Bentires-Alj, Mohamed; Nakano, Ichiro; Dahmane, Nadia; O'Rourke, Donald M

    2017-08-29

    SHP2 is a cytoplasmic protein tyrosine phosphatase (PTPase) involved in multiple signaling pathways and was the first identified proto-oncogene PTPase. Previous work in glioblastoma (GBM) has demonstrated the role of SHP2 PTPase activity in modulating the oncogenic phenotype of adherent GBM cell lines. Mutations in PTPN11, the gene encoding SHP2, have been identified with increasing frequency in GBM. Given the importance of SHP2 in developing neural stem cells, and the importance of glioma stem cells (GSCs) in GBM oncogenesis, we explored the functional role of SHP2 in GSCs. Using paired differentiated and stem cell primary cultures, we investigated the association of SHP2 expression with the tumor stem cell compartment. Proliferation and soft agar assays were used to demonstrate the functional contribution of SHP2 to cell growth and transformation. SHP2 expression correlated with SOX2 expression in GSC lines and was decreased in differentiated cells. Forced differentiation of GSCs by removal of growth factors, as confirmed by loss of SOX2 expression, also resulted in decreased SHP2 expression. Lentiviral-mediated knockdown of SHP2 inhibited proliferation. Finally, growth in soft-agar was similarly inhibited by loss of SHP2 expression. Our results show that SHP2 function is required for cell growth and transformation of the GSC compartment in GBM.

  9. Determination of the catalytic activity of LEOPARD syndrome-associated SHP2 mutants toward parafibromin, a bona fide SHP2 substrate involved in Wnt signaling

    SciTech Connect

    Noda, Saori; Takahashi, Atsushi; Hayashi, Takeru; Tanuma, Sei-ichi; Hatakeyama, Masanori

    2016-01-22

    SHP2, encoded by the PTPN11 gene, is a protein tyrosine phosphatase that plays a key role in the proliferation of cells via RAS-ERK activation. SHP2 also promotes Wnt signaling by dephosphorylating parafibromin. Germline missense mutations of PTPN11 are found in more than half of patients with Noonan syndrome (NS) and LEOPARD syndrome (LS), both of which are congenital developmental disorders with multiple common symptoms. However, whereas NS-associated PTPN11 mutations give rise to gain-of-function SHP2 mutants, LS-associated SHP2 mutants are reportedly loss-of-function mutants. To determine the phosphatase activity of LS-associated SHP2 more appropriately, we performed an in vitro phosphatase assay using tyrosine-phosphorylated parafibromin, a biologically relevant substrate of SHP2 and the positive regulator of Wnt signaling that is activated through SHP2-mediated dephosphorylation. We found that LS-associated SHP2 mutants (Y279C, T468M, Q506P, and Q510E) exhibited a substantially reduced phosphatase activity toward parafibromin when compared with wild-type SHP2. Furthermore, each of the LS-associated mutants displayed a differential degree of decrease in phosphatase activity. Deviation of the SHP2 catalytic activity from a certain range, either too strong or too weak, may therefore lead to similar clinical outcomes in NS and LS, possibly through an imbalanced Wnt signal caused by inadequate dephosphorylation of parafibromin. - Highlights: • LS-associated SHP2 mutants dephosphorylate parafibromin on Y290, Y293, and Y315. • LS-associated SHP2 mutants display a reduced tyrosine phosphatase activity. • LS-specific SHP2-Y279C is catalytically less active than LS-specific SHP2-T468M. • NS/LS-associated SHP2-Q506P has both hyper- and hypomorphic enzymatic properties.

  10. Antidepressant Activity of Enicostemma littorale Blume in Shp2 (Protein Tyrosine Phosphatase)-inhibited Animal Model of Depression

    PubMed Central

    Doss, VA; Kuberapandian, Dharaniyambigai

    2016-01-01

    Background: The objective of this study is to develop a new animal model based on signaling pathways to understand the pathophysiology, therapy of depression, and to investigate the antidepressant activity of Enicostemma littorale which is not yet established. Methods: Animal models of depression were raised by physical methods and administration of methyl isobutyl ketone (100 mg/kg b.w., i.p.,) and a protein tyrosine phosphatase inhibitor, sodium orthovanadate (30 mg/kg b.w., i.p.,) to young Wistar rats. E. littorale aqueous extract (100 mg/kg b.w., oral) was administered. Forced swimming test (FST), biochemical, and histopathological parameters were performed with reference to fluoxetine (20 mg/kg b.w., oral) treatment. Results: High-performance thin-layer chromatography confirmed the presence of swertiamarin, a unique glycoside present in the Gentianaceae family. FST indicated high rates of immobility in depressed groups and low rates in plant extract-administered group with reference to fluoxetine. Biochemical assays indicated significantly (P < 0.05) increased levels of total protein, superoxide dismutase, triglycerides, and total serum cholesterol, whereas significant reduction (P < 0.05) of glutathione peroxidase, catalase, and lipid peroxidation in plant extract-administered groups in comparison to the depressed groups. Histopathological analysis indicated disorganized neuronal architecture during depression whereas rejuvenation of neuronal patterns was observed during treatment with plant extract and fluoxetine. Conclusions: This study shows that sodium orthovanadate induces depression in animals and also establishes the antidepressant activity of E. littorale. PMID:27761214

  11. Tyrosine phosphatases as key regulators of StAR induction and cholesterol transport: SHP2 as a potential tyrosine phosphatase involved in steroid synthesis.

    PubMed

    Cooke, Mariana; Mele, Pablo; Maloberti, Paula; Duarte, Alejandra; Poderoso, Cecilia; Orlando, Ulises; Paz, Cristina; Cornejo Maciel, Fabiana; Podestá, Ernesto J

    2011-04-10

    The phospho-dephosphorylation of intermediate proteins is a key event in the regulation of steroid biosynthesis. In this regard, it is well accepted that steroidogenic hormones act through the activation of serine/threonine (Ser/Thr) protein kinases. Although many cellular processes can be regulated by a crosstalk between different kinases and phosphatases, the relationship of Ser/Thr phosphorylation and tyrosine (Tyr)-dephosphorylation is a recently explored field in the regulation of steroid synthesis. Indeed in steroidogenic cells, one of the targets of hormone-induced Ser/Thr phosphorylation is a protein tyrosine phosphatase. Whereas protein tyrosine phosphatases were initially regarded as household enzymes with constitutive activity, dephosphorylating all the substrates they encountered, evidence is now accumulating that protein tyrosine phosphatases are tightly regulated by various mechanisms. Here, we will describe the role of protein tyrosine phosphatases in the regulation of steroid biosynthesis, relating them to steroidogenic acute regulatory protein, arachidonic acid metabolism and mitochondrial rearrangement.

  12. Shp2 signaling suppresses senescence in PyMT-induced mammary gland cancer in mice

    PubMed Central

    Lan, Linxiang; Holland, Jane D; Qi, Jingjing; Grosskopf, Stefanie; Vogel, Regina; Györffy, Balázs; Wulf-Goldenberg, Annika; Birchmeier, Walter

    2015-01-01

    In this study, we have used techniques from cell biology, biochemistry, and genetics to investigate the role of the tyrosine phosphatase Shp2 in tumor cells of MMTV-PyMT mouse mammary glands. Genetic ablation or pharmacological inhibition of Shp2 induces senescence, as determined by the activation of senescence-associated β-gal (SA-β-gal), cyclin-dependent kinase inhibitor 1B (p27), p53, and histone 3 trimethylated lysine 9 (H3K9me3). Senescence induction leads to the inhibition of self-renewal of tumor cells and blockage of tumor formation and growth. A signaling cascade was identified that acts downstream of Shp2 to counter senescence: Src, focal adhesion kinase, and Map kinase inhibit senescence by activating the expression of S-phase kinase-associated protein 2 (Skp2), Aurora kinase A (Aurka), and the Notch ligand Delta-like 1 (Dll1), which block p27 and p53. Remarkably, the expression of Shp2 and of selected target genes predicts human breast cancer outcome. We conclude that therapies, which rely on senescence induction by inhibiting Shp2 or controlling its target gene products, may be useful in blocking breast cancer. PMID:25736378

  13. Shp2 signaling suppresses senescence in PyMT-induced mammary gland cancer in mice.

    PubMed

    Lan, Linxiang; Holland, Jane D; Qi, Jingjing; Grosskopf, Stefanie; Rademann, Jörg; Vogel, Regina; Györffy, Balázs; Wulf-Goldenberg, Annika; Birchmeier, Walter

    2015-06-03

    In this study, we have used techniques from cell biology, biochemistry, and genetics to investigate the role of the tyrosine phosphatase Shp2 in tumor cells of MMTV-PyMT mouse mammary glands. Genetic ablation or pharmacological inhibition of Shp2 induces senescence, as determined by the activation of senescence-associated β-gal (SA-β-gal), cyclin-dependent kinase inhibitor 1B (p27), p53, and histone 3 trimethylated lysine 9 (H3K9me3). Senescence induction leads to the inhibition of self-renewal of tumor cells and blockage of tumor formation and growth. A signaling cascade was identified that acts downstream of Shp2 to counter senescence: Src, focal adhesion kinase, and Map kinase inhibit senescence by activating the expression of S-phase kinase-associated protein 2 (Skp2), Aurora kinase A (Aurka), and the Notch ligand Delta-like 1 (Dll1), which block p27 and p53. Remarkably, the expression of Shp2 and of selected target genes predicts human breast cancer outcome. We conclude that therapies, which rely on senescence induction by inhibiting Shp2 or controlling its target gene products, may be useful in blocking breast cancer. © 2015 The Authors.

  14. Shp2 Inhibits Proliferation of Esophageal Squamous Cell Cancer via Dephosphorylation of Stat3

    PubMed Central

    Qi, Chen; Han, Tao; Tang, Hua; Huang, Kenan; Min, Jie; Li, Jing; Ding, Xinyu; Xu, Zhifei

    2017-01-01

    Shp2 (Src-homology 2 domain-containing phosphatase 2) was originally reported as an oncogene in kinds of solid tumors and hematologic malignancies. However, recent studies indicated that Shp2 may act as tumor suppressors in several tumor types. We investigated the function of Shp2 in esophageal squamous cell cancer (ESCC). The expression level of Shp2 was analyzed in tumor tissues in comparison with adjacent normal tissues of ESCC patients by immunohistochemistry and Western blot. Shp2 was knocked down by Short hairpin RNA to evaluate its function in ESCC cell lines. The relationship between Shp2 and p-Stat3 (signal transducer and activator of transcription 3) in human ESCC tissues was statistically examined. A significant low expression of Shp2 was found in ESCC tissues. Low expression of Shp2 was related to poorer overall survival in patients from The Cancer Genome Atlas (TCGA) dataset. Knockdown of Shp2 increased the growth of ESCC cell lines both in vivo and vitro. Activation of Stat3 (p-Stat3) was induced by Shp2 depletion. Expression of p-Stat3 was negatively correlated with Shp2 expression in ESCC tissues. Furthermore, knockdown of Shp2 attenuated cisplatin-sensitivity of ESCC cells. Shp2 might suppress the proliferation of ESCC by dephosphorylation of p-Stat3 and represents a novel research field for targeted therapy. PMID:28085101

  15. Shp2 Inhibits Proliferation of Esophageal Squamous Cell Cancer via Dephosphorylation of Stat3.

    PubMed

    Qi, Chen; Han, Tao; Tang, Hua; Huang, Kenan; Min, Jie; Li, Jing; Ding, Xinyu; Xu, Zhifei

    2017-01-12

    Shp2 (Src-homology 2 domain-containing phosphatase 2) was originally reported as an oncogene in kinds of solid tumors and hematologic malignancies. However, recent studies indicated that Shp2 may act as tumor suppressors in several tumor types. We investigated the function of Shp2 in esophageal squamous cell cancer (ESCC). The expression level of Shp2 was analyzed in tumor tissues in comparison with adjacent normal tissues of ESCC patients by immunohistochemistry and Western blot. Shp2 was knocked down by Short hairpin RNA to evaluate its function in ESCC cell lines. The relationship between Shp2 and p-Stat3 (signal transducer and activator of transcription 3) in human ESCC tissues was statistically examined. A significant low expression of Shp2 was found in ESCC tissues. Low expression of Shp2 was related to poorer overall survival in patients from The Cancer Genome Atlas (TCGA) dataset. Knockdown of Shp2 increased the growth of ESCC cell lines both in vivo and vitro. Activation of Stat3 (p-Stat3) was induced by Shp2 depletion. Expression of p-Stat3 was negatively correlated with Shp2 expression in ESCC tissues. Furthermore, knockdown of Shp2 attenuated cisplatin-sensitivity of ESCC cells. Shp2 might suppress the proliferation of ESCC by dephosphorylation of p-Stat3 and represents a novel research field for targeted therapy.

  16. Shp2 Plays a Critical Role in IL-6-Induced EMT in Breast Cancer Cells

    PubMed Central

    Sun, Xuan; Zhang, Jie; Wang, Zhiyong; Ji, Wei; Tian, Ran; Zhang, Fei; Niu, Ruifang

    2017-01-01

    Accumulative evidence demonstrates that the protein tyrosine phosphatase Shp2 functions as a powerful tumor promoter in many types of cancers. Abnormal expression of Shp2 has been implicated in many human malignancies. Overexpression of Shp2 in cancer tissues is correlated with cancer metastasis, resistance to targeted therapy, and poor prognosis. The well-known function of Shp2 is its positive role in regulating cellular signaling initiated by growth factors and cytokines, including interleukin-6 (IL-6). Several recent studies have shown that Shp2 is required for epithelial-mesenchymal transition (EMT), triggered by growth factors. However, whether Shp2 is involved in IL-6-signaling-promoted breast cancer EMT and progression, remains undefined. In this study, we showed that exogenous and endogenous IL-6 can enhance breast cancer invasion and migration, through the promotion of EMT. IL-6 also induces the activation of Erk1/2 and the phosphorylation of Shp2. Knockdown of Shp2 attenuated the IL-6-induced downregulation of E-cadherin, as well as IL-6-promoted cell migration and invasion. Moreover, by using Shp2 phosphatase mutants, phosphor-tyrosine mimicking, and deficiency mutants, we provided evidence that the phosphatase activity of Shp2 and its tyrosine phosphorylation, are necessary for the IL-6-induced downregulation of E-cadherin and the phosphorylation of Erk1/2. Our findings uncover an important function that links Shp2 to IL-6-promoted breast cancer progression. PMID:28208810

  17. LEOPARD-type SHP2 mutant Gln510Glu attenuates cardiomyocyte differentiation and promotes cardiac hypertrophy via dysregulation of Akt/GSK-3β/β-catenin signaling.

    PubMed

    Ishida, Hidekazu; Kogaki, Shigetoyo; Narita, Jun; Ichimori, Hiroaki; Nawa, Nobutoshi; Okada, Yoko; Takahashi, Kunihiko; Ozono, Keiichi

    2011-10-01

    LEOPARD syndrome (LS) is an autosomal dominant inherited multisystemic disorder. Most cases involve mutations in the PTPN11 gene, which encodes the protein tyrosine phosphatase Src homology 2-containing protein phosphatase 2 (SHP2). LS frequently causes severe hypertrophic cardiomyopathy (HCM), even from the fetal period. However, the molecular pathogenesis has not been clearly elucidated. Here, we analyzed the roles of the LS-type SHP2 mutant Gln510Glu (Q510E), which showed the most severe type of HCM in LS, in cardiomyocyte differentiation, and in morphological changes. We generated mutant P19CL6 cell lines, the most convenient cardiomyocyte differentiation model, which continuously expressed SHP2-Q510E, SHP2-D61N (Noonan-type mutant), wild-type SHP2, and green fluorescent protein (native SHP2 expression only). SHP2-Q510E mutant P19CL6 cells showed significant attenuation of myofibrillogenesis, with increased proliferative activity. Mature cardiomyocytes from the SHP2-Q510E mutant were significantly larger than those of controls and the other mutants. However, expression of cardiac-specific transcriptional factors (Gata4, Tbx5, and Nkx2.5) did not differ significantly between the LS-type SHP2-Q510E mutants and the other mutants and controls. Our results indicate that SHP2-Q510E mutants can differentiate into cardiac progenitors but are inhibited from undergoing terminal differentiation into mature cardiomyocytes. In contrast, Akt and glycogen synthase kinase (GSK)-3β phosphorylation were upregulated, and nuclear β-catenin at the late stage of differentiation was highly accumulated in SHP2-Q510E mutant P19CL6 cells. Supplementation with the phosphoinositide 3-kinase/Akt inhibitor LY-294002 during the late stage of differentiation was found to partially restore myofibrillogenesis while suppressing the increase in size of individual mature cardiomyocytes derived from the SHP2-Q510E mutants. Our findings suggest that dysregulation of the Akt/GSK-3

  18. Critical Role of Shp2 in Tumor Growth Involving Regulation of c-Myc

    PubMed Central

    Ren, Yuan; Chen, Zhengming; Chen, Liwei; Fang, Bin; Win-Piazza, Hla; Haura, Eric; Koomen, John M.; Wu, Jie

    2010-01-01

    Activating mutants of Shp2 protein tyrosine phosphatase, encoded by the PTPN11 gene, are linked to leukemia. In solid tumors, however, PTPN11 mutations occur at low frequencies, while the wild-type Shp2 is activated by protein tyrosine kinases (PTKs) in cancer cells and mediates PTK signaling. Therefore, it is important to address whether the wild-type Shp2 plays a functional role critical for tumor growth. Using shRNAs and a PTP-inactive mutant to inhibit Shp2, we find here that tumor growth of DU145 prostate cancer and H292 lung cancer cells depends on Shp2. Suppression of Shp2 inhibited cell proliferation, decreased c-Myc, and increased p27 expression in cell cultures. In H292 tumor tissues, c-Myc–positive cells coincided with Ki67-positive cells, and smaller tumors from Shp2 knockdown cells had less c-Myc–positive cells and more nuclear p27. Shp2-regulated c-Myc expression was mediated by Src and Erk1/2. Down-regulation of c-Myc reduced cell proliferation, while up-regulation of c-Myc in Shp2 knockdown H292 cells partially rescued the inhibitory effect of Shp2 suppression on cell proliferation. Tyrosine phosphoproteomic analysis of H292 tumor tissues showed that Shp2 could both up-regulate and down-regulate tyrosine phosphorylation on cellular proteins. Among other changes, Shp2 inhibition increased phosphorylation of Src Tyr-530 and Cdk1 Thr-14/Tyr-15 and decreased phosphorylation of Erk1- and Erk2-activating sites in the tumors. Significantly, we found that Shp2 positively regulated Gab1 Tyr-627/Tyr-659 phosphorylation. This finding reveals that Shp2 can autoregulate its own activating signal. Shp2 Tyr-62/Tyr-63 phosphorylation was observed in tumor tissues, indicating that Shp2 is activated in the tumors. PMID:21442024

  19. Plexin B1 inhibits MET through direct association and regulates Shp2 expression in melanocytes.

    PubMed

    Soong, Joanne; Scott, Glynis

    2013-01-15

    Plexin B1, the receptor for Semaphorin 4D (Sema4D), is expressed by melanocytes in the skin. We recently showed that Sema4D suppresses activation of the hepatocyte growth factor receptor, MET, in melanocytes, and that knockdown of Plexin B1 results in activation of MET. MET signaling mediates proliferation, survival and migration in melanocytes, and its activation is associated with transformation of melanocytes to melanoma. In this report we investigated the mechanism by which Plexin B1 inhibits MET activation. Our results show that Plexin B1 and MET exist as an oligomeric receptor-receptor complex in melanocytes, and that receptor association is increased by Sema4D. MET and Plexin B1 receptor complexes were identified along the cell body of melanocytes, and Sema4D increased receptor association on dendrites, suggesting that Sema4D regulates MET-dependent processes at precise locations on the melanocyte. Despite activation of MET, Plexin B1 knockdowns proliferated slowly and showed increased apoptosis compared with controls. Shp2, a non-receptor protein tyrosine phosphatase, translates growth and survival signals from MET and other receptor tyrosine kinases. Plexin B1 knockdowns had markedly lower levels of Shp2 compared with controls, and Sema4D upregulated Shp2 expression at the protein and message level in normal melanocytes. Functional studies showed that blockade of Shp2 activity abrogated MET-dependent activation of Erk1/Erk2 and Akt in melanocytes. These results suggest a complex role for Sema4D and Plexin B1 in orchestrating signaling from the MET receptor in melanocytes. Because Shp2 is a downstream adaptor protein for multiple receptors, Sema4D may control the effects of several growth factors on melanocytes through regulation of Shp2.

  20. Shp-2 contributes to anti-RSV activity in human pulmonary alveolar epithelial cells by interfering with the IFN-α-induced Jak/Stat1 pathway.

    PubMed

    Wang, Saisai; Zheng, Gang; Zhao, Lifang; Xu, Feng; Qian, Jing

    2015-10-01

    Src homology phosphotyrosyl phosphatase 2 (Shp-2) is a ubiquitously expressed protein that is involved in a variety of cellular processes, including antiviral interferon signalling pathways. In this study, we investigated the role of Shp-2 in the host cell interactions of human respiratory syncytial virus (RSV). We report significant changes in the expression of Shp-2 in human pulmonary alveolar epithelial cells (A549) upon RSV infection. We also report that blocking Shp-2 does not affect viral replication or virus-induced interferon-alpha (IFN-α) production. Interestingly, whereas A549 cells were activated by IFN-α, the blocking of Shp-2 resulted in increased viral replication that was associated with the reduced expression of the IFN-stimulated genes of 2',5'-oligoadenylate synthetases and Mx1, and the concomitant inhibition of Stat1 tyrosine phosphorylation. Our findings suggest that Shp-2 contributes to the control of RSV replication and progeny production in pulmonary alveolar epithelial cells by interfering with IFN-α-induced Jak/Stat1 pathway activation rather than by affecting the production of IFN-α itself. © 2015 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  1. Shp-2 regulates the TrkB receptor activity in the retinal ganglion cells under glaucomatous stress.

    PubMed

    Gupta, Vivek K; You, Yuyi; Klistorner, Alexander; Graham, Stuart L

    2012-11-01

    Tropomyosin-receptor-kinase B (TrkB receptor) activation plays an important role in the survival of retinal ganglion cells (RGCs). This study reports a novel finding that, SH2 domain-containing phosphatase-2 (Shp-2) binds to the TrkB receptor in RGCs and negatively regulates its activity under glaucomatous stress. This enhanced binding of TrkB and Shp2 is mediated through caveolin. Caveolin 1 and 3 undergo hyper-phosphorylation in RGCs under stress and bind to the Shp2 phosphatase. Shp2 undergoes activation under glaucomatous stress conditions in RGCs in vivo with a concurrent loss of TrkB activity. Inhibiting the Shp2 phosphatase restored TrkB activity in cells exposed to excitotoxic and oxidative stress. Collectively, these findings implicate a molecular basis of Shp2 mediated TrkB deactivation leading to RGC degeneration observed in glaucoma. Copyright © 2012 Elsevier B.V. All rights reserved.

  2. SHP2 regulates osteoclastogenesis by promoting preosteoclast fusion

    USDA-ARS?s Scientific Manuscript database

    Genes that regulate osteoclast development and function under physiological and disease conditions remain incompletely understood. Shp2, a ubiquitously expressed cytoplasmic protein tyrosine phosphatase, was implicated in regulating M-CSF and RANKL-evoked signaling, its role in osteoclastogenesis an...

  3. S-nitrosylated SHP-2 contributes to NMDA receptor-mediated excitotoxicity in acute ischemic stroke

    PubMed Central

    Shi, Zhong-Qing; Sunico, Carmen R.; McKercher, Scott R.; Cui, Jiankun; Feng, Gen-Sheng; Nakamura, Tomohiro; Lipton, Stuart A.

    2013-01-01

    Overproduction of nitric oxide (NO) can cause neuronal damage, contributing to the pathogenesis of several neurodegenerative diseases and stroke (i.e., focal cerebral ischemia). NO can mediate neurotoxic effects at least in part via protein S-nitrosylation, a reaction that covalently attaches NO to a cysteine thiol (or thiolate anion) to form an S-nitrosothiol. Recently, the tyrosine phosphatase Src homology region 2-containing protein tyrosine phosphatase-2 (SHP-2) and its downstream pathways have emerged as important mediators of cell survival. Here we report that in neurons and brain tissue NO can S-nitrosylate SHP-2 at its active site cysteine, forming S-nitrosylated SHP-2 (SNO–SHP-2). We found that NMDA exposure in vitro and transient focal cerebral ischemia in vivo resulted in increased levels of SNO–SHP-2. S-Nitrosylation of SHP-2 inhibited its phosphatase activity, blocking downstream activation of the neuroprotective physiological ERK1/2 pathway, thus increasing susceptibility to NMDA receptor-mediated excitotoxicity. These findings suggest that formation of SNO–SHP-2 represents a key chemical reaction contributing to excitotoxic damage in stroke and potentially other neurological disorders. PMID:23382182

  4. mSiglec-E, a novel mouse CD33-related siglec (sialic acid-binding immunoglobulin-like lectin) that recruits Src homology 2 (SH2)-domain-containing protein tyrosine phosphatases SHP-1 and SHP-2.

    PubMed Central

    Yu, Z; Maoui, M; Wu, L; Banville, D; Shen, S

    2001-01-01

    The sialic acid-binding immunoglobulin-like lectins (siglecs) represent a recently defined distinct subset of the immunoglobulin superfamily. By using the Src homology 2 (SH2)-domain-containing protein tyrosine phosphatase SHP-1 as bait in a yeast two-hybrid screen, we have identified a new member of the mouse siglec family, mSiglec-E. The mSiglec-E cDNA encodes a protein of 467 amino acids that contains three extracellular immunoglobulin-like domains, a transmembrane region and a cytoplasmic tail bearing two immunoreceptor tyrosine-based inhibitory motifs (ITIMs). mSiglec-E is highly expressed in mouse spleen, a tissue rich in leucocytes. The ITIMs of mSiglec-E can recruit SHP-1 and SHP-2, two inhibitory regulators of immunoreceptor signal transduction. This suggests that the function of mSiglec-E is probably an involvement in haematopoietic cells and the immune system as an inhibitory receptor. When expressed in COS-7 cells, mSiglec-E was able to mediate sialic acid-dependent binding to human red blood cells, suggesting that mSiglec-E may function through cell-cell interactions. In comparison with the known members of the siglec family, mSiglec-E exhibits a high degree of sequence similarity to both human siglec-7 and siglec-9. The gene encoding mSiglec-E is localized in the same chromosome as that encoding mouse CD33. Phylogenetic analysis reveals that neither mouse mSiglec-E nor CD33 shows a clear relationship with any human siglecs so far identified. PMID:11171044

  5. Selective activation of SHP2 activity by cisplatin revealed by a novel chemical probe-based assay

    SciTech Connect

    Kuo, Chun-Chen; Chu, Chi-Yuan; Lin, Jing-Jer; Lo, Lee-Chiang

    2010-01-01

    Src homology-2 (SH2) domain-containing phosphatase 2 (SHP2) is known to participate in several different signaling pathways to mediate cell growth, survival, migration, and differentiation. However, due to the lack of proper analytical tools, it is unclear whether the phosphatase activity of SHP2 is activated in most studies. We have previously developed an activity-based probe LCL2 that formed covalent linkage with catalytically active protein tyrosine phosphatases (PTPs). Here, by combining LCL2 with a SHP2 specific antibody, we established an assay system that enables the direct monitoring of SHP2 activity upon cisplatin treatment of cancer cells. The protocol is advantageous over conventional colorimetric or in-gel PTP assays as it is specific and does not require the use of radioisotope reagents. Using this assay, we found SHP2 activity was selectively activated by cisplatin. Moreover, the activation of SHP2 appeared to be specific for cisplatin as other DNA damage agents failed to activate the activity. Although the role of SHP2 activation by cisplatin treatments is still unclear to us, our results provide the first direct evidence for the activation of SHP2 during cisplatin treatments. More importantly, the concept of using activity-based probe in conjunction with target-specific antibodies could be extended to other enzyme classes.

  6. Constitutive MHC class I molecules negatively regulate TLR-triggered inflammatory responses via the Fps-SHP-2 pathway.

    PubMed

    Xu, Sheng; Liu, Xingguang; Bao, Yan; Zhu, Xuhui; Han, Chaofeng; Zhang, Peng; Zhang, Xuemin; Li, Weihua; Cao, Xuetao

    2012-04-22

    The molecular mechanisms that fine-tune Toll-like receptor (TLR)-triggered innate inflammatory responses remain to be fully elucidated. Major histocompatibility complex (MHC) molecules can mediate reverse signaling and have nonclassical functions. Here we found that constitutively expressed membrane MHC class I molecules attenuated TLR-triggered innate inflammatory responses via reverse signaling, which protected mice from sepsis. The intracellular domain of MHC class I molecules was phosphorylated by the kinase Src after TLR activation, then the tyrosine kinase Fps was recruited via its Src homology 2 domain to phosphorylated MHC class I molecules. This led to enhanced Fps activity and recruitment of the phosphatase SHP-2, which interfered with TLR signaling mediated by the signaling molecule TRAF6. Thus, constitutive MHC class I molecules engage in crosstalk with TLR signaling via the Fps-SHP-2 pathway and control TLR-triggered innate inflammatory responses.

  7. Inhibition of SHP2-mediated dephosphorylation of Ras suppresses oncogenesis

    PubMed Central

    Bunda, Severa; Burrell, Kelly; Heir, Pardeep; Zeng, Lifan; Alamsahebpour, Amir; Kano, Yoshihito; Raught, Brian; Zhang, Zhong-Yin; Zadeh, Gelareh; Ohh, Michael

    2015-01-01

    Ras is phosphorylated on a conserved tyrosine at position 32 within the switch I region via Src kinase. This phosphorylation inhibits the binding of effector Raf while promoting the engagement of GTPase-activating protein (GAP) and GTP hydrolysis. Here we identify SHP2 as the ubiquitously expressed tyrosine phosphatase that preferentially binds to and dephosphorylates Ras to increase its association with Raf and activate downstream proliferative Ras/ERK/MAPK signalling. In comparison to normal astrocytes, SHP2 activity is elevated in astrocytes isolated from glioblastoma multiforme (GBM)-prone H-Ras(12V) knock-in mice as well as in glioma cell lines and patient-derived GBM specimens exhibiting hyperactive Ras. Pharmacologic inhibition of SHP2 activity attenuates cell proliferation, soft-agar colony formation and orthotopic GBM growth in NOD/SCID mice and decelerates the progression of low-grade astrocytoma to GBM in a spontaneous transgenic glioma mouse model. These results identify SHP2 as a direct activator of Ras and a potential therapeutic target for cancers driven by a previously ‘undruggable' oncogenic or hyperactive Ras. PMID:26617336

  8. Inhibition of SHP2-mediated dephosphorylation of Ras suppresses oncogenesis.

    PubMed

    Bunda, Severa; Burrell, Kelly; Heir, Pardeep; Zeng, Lifan; Alamsahebpour, Amir; Kano, Yoshihito; Raught, Brian; Zhang, Zhong-Yin; Zadeh, Gelareh; Ohh, Michael

    2015-11-30

    Ras is phosphorylated on a conserved tyrosine at position 32 within the switch I region via Src kinase. This phosphorylation inhibits the binding of effector Raf while promoting the engagement of GTPase-activating protein (GAP) and GTP hydrolysis. Here we identify SHP2 as the ubiquitously expressed tyrosine phosphatase that preferentially binds to and dephosphorylates Ras to increase its association with Raf and activate downstream proliferative Ras/ERK/MAPK signalling. In comparison to normal astrocytes, SHP2 activity is elevated in astrocytes isolated from glioblastoma multiforme (GBM)-prone H-Ras(12V) knock-in mice as well as in glioma cell lines and patient-derived GBM specimens exhibiting hyperactive Ras. Pharmacologic inhibition of SHP2 activity attenuates cell proliferation, soft-agar colony formation and orthotopic GBM growth in NOD/SCID mice and decelerates the progression of low-grade astrocytoma to GBM in a spontaneous transgenic glioma mouse model. These results identify SHP2 as a direct activator of Ras and a potential therapeutic target for cancers driven by a previously 'undruggable' oncogenic or hyperactive Ras.

  9. Glucose regulates insulin mitogenic effect by modulating SHP-2 activation and localization in JAr cells.

    PubMed

    Bifulco, Giuseppe; Di Carlo, Costantino; Caruso, Matilde; Oriente, Francesco; Di Spiezio Sardo, Attilio; Formisano, Pietro; Beguinot, Francesco; Nappi, Carmine

    2002-07-05

    The glucose effect on cell growth has been investigated in the JAr human choriocarcinoma cells. When JAr cells were cultured in the presence of 6 mm glucose (LG), proliferation and thymidine incorporation were induced by serum, epidermal growth factor, and insulin-like growth factor 1 but not by insulin. In contrast, at 25 mm glucose (HG), proliferation and thymidine incorporation were stimulated by insulin, serum, epidermal growth factor, and insulin-like growth factor 1 to a comparable extent, whereas basal levels were 25% lower than those in LG. HG culturing also enhanced insulin-stimulated insulin receptor and insulin receptor substrate 1 (IRS1) tyrosine phosphorylations while decreasing basal phosphorylations. These actions of glucose were accompanied by an increase in cellular tyrosine phosphatase activity. The activity of SHP-2 in HG-treated JAr cells was 400% of that measured in LG-treated cells. SHP-2 co-precipitation with IRS1 was also increased in HG-treated cells. SHP-2 was mainly cytosolic in LG-treated cells. However, HG culturing largely redistributed SHP-2 to the internal membrane compartment, where tyrosine-phosphorylated IRS1 predominantly localizes. Further exposure to insulin rescued SHP-2 cytosolic localization, thereby preventing its interaction with IRS1. Antisense inhibition of SHP-2 reverted the effect of HG on basal and insulin-stimulated insulin receptor and IRS1 phosphorylation as well as that on thymidine incorporation. Thus, in JAr cells, glucose modulates insulin mitogenic action by modulating SHP-2 activity and intracellular localization.

  10. SHP-2 acts via ROCK to regulate the cardiac actin cytoskeleton.

    PubMed

    Langdon, Yvette; Tandon, Panna; Paden, Erika; Duddy, Jennifer; Taylor, Joan M; Conlon, Frank L

    2012-03-01

    Noonan syndrome is one of the most common causes of human congenital heart disease and is frequently associated with missense mutations in the protein phosphatase SHP-2. Interestingly, patients with acute myelogenous leukemia (AML), acute lymphoblastic leukemia (ALL), juvenile myelomonocytic leukemia (JMML) and LEOPARD syndrome frequently carry a second, somatically introduced subset of missense mutations in SHP-2. To determine the cellular and molecular mechanisms by which SHP-2 regulates heart development and, thus, understand how Noonan-associated mutations affect cardiogenesis, we introduced SHP-2 encoding the most prevalent Noonan syndrome and JMML mutations into Xenopus embryos. Resulting embryos show a direct relationship between a Noonan SHP-2 mutation and its ability to cause cardiac defects in Xenopus; embryos expressing Noonan SHP-2 mutations exhibit morphologically abnormal hearts, whereas those expressing an SHP-2 JMML-associated mutation do not. Our studies indicate that the cardiac defects associated with the introduction of the Noonan-associated SHP-2 mutations are coupled with a delay or arrest of the cardiac cell cycle in M-phase and a failure of cardiomyocyte progenitors to incorporate into the developing heart. We show that these defects are a result of an underlying malformation in the formation and polarity of cardiac actin fibers and F-actin deposition. We show that these defects can be rescued in culture and in embryos through the inhibition of the Rho-associated, coiled-coil-containing protein kinase 1 (ROCK), thus demonstrating a direct relationship between SHP-2(N308D) and ROCK activation in the developing heart.

  11. Shp2-Dependent ERK Signaling Is Essential for Induction of Bergmann Glia and Foliation of the Cerebellum

    PubMed Central

    Li, Kairong; Leung, Alan W.; Guo, Qiuxia; Yang, Wentian

    2014-01-01

    Folding of the cortex and the persistence of radial glia (RG)-like cells called Bergmann glia (BG) are hallmarks of the mammalian cerebellum. Similar to basal RG in the embryonic neocortex, BG maintain only basal processes and continuously express neural stem cell markers. Past studies had focused on the function of BG in granule cell migration and how granule cell progenitors (GCP) regulate cerebellar foliation. The molecular control of BG generation and its role in cerebellar foliation are less understood. Here, we have analyzed the function of the protein tyrosine phosphatase Shp2 in mice by deleting its gene Ptpn11 in the entire cerebellum or selectively in the GCP lineage. Deleting Ptpn11 in the entire cerebellum by En1-cre blocks transformation of RG into BG but preserves other major cerebellar cell types. In the absence of BG, inward invagination of GCP persists but is uncoupled from the folding of the Purkinje cell layer and the basement membrane, leading to disorganized lamination and an absence of cerebellar folia. In contrast, removing Ptpn11 in the GCP lineage by Atoh1-cre has no effect on cerebellar development, indicating that Shp2 is not cell autonomously required in GCP. Furthermore, we demonstrate that Ptpn11 interacts with Fgf8 and is essential for ERK activation in RG and nascent BG. Finally, expressing constitutively active MEK1 rescues BG formation and cerebellar foliation in Shp2-deficient cerebella. Our results demonstrate an essential role of Shp2 in BG specification via fibroblast growth factor/extracellular signal-regulated protein kinase signaling, and reveal a crucial function of BG in organizing cerebellar foliation. PMID:24431450

  12. Critical Role for GAB2 in Neuroblastoma Pathogenesis through the Promotion of SHP2/MYCN Cooperation.

    PubMed

    Zhang, Xiaoling; Dong, Zhiwei; Zhang, Cheng; Ung, Choong Yong; He, Shuning; Tao, Ting; Oliveira, Andre M; Meves, Alexander; Ji, Baoan; Look, A Thomas; Li, Hu; Neel, Benjamin G; Zhu, Shizhen

    2017-03-21

    Growing evidence suggests a major role for Src-homology-2-domain-containing phosphatase 2 (SHP2/PTPN11) in MYCN-driven high-risk neuroblastoma, although biologic confirmation and a plausible mechanism for this contribution are lacking. Using a zebrafish model of MYCN-overexpressing neuroblastoma, we demonstrate that mutant ptpn11 expression in the adrenal gland analog of MYCN transgenic fish promotes the proliferation of hyperplastic neuroblasts, accelerates neuroblastomagenesis, and increases tumor penetrance. We identify a similar mechanism in tumors with wild-type ptpn11 and dysregulated Gab2, which encodes a Shp2 activator that is overexpressed in human neuroblastomas. In MYCN transgenic fish, Gab2 overexpression activated the Shp2-Ras-Erk pathway, enhanced neuroblastoma induction, and increased tumor penetrance. We conclude that MYCN cooperates with either GAB2-activated or mutant SHP2 in human neuroblastomagenesis. Our findings further suggest that combined inhibition of MYCN and the SHP2-RAS-ERK pathway could provide effective targeted therapy for high-risk neuroblastoma patients with MYCN amplification and aberrant SHP2 activation.

  13. SHP-2 deletion in postmigratory neural crest cells results in impaired cardiac sympathetic innervation

    PubMed Central

    Lajiness, Jacquelyn D.; Snider, Paige; Wang, Jian; Feng, Gen-Sheng; Krenz, Maike; Conway, Simon J.

    2014-01-01

    Autonomic innervation is an essential component of cardiovascular regulation that is first established from the neural crest (NC) lineage in utero and continues developing postnatally. Although in vitro studies have indicated that SH2-containing protein tyrosine phosphatase 2 (SHP-2) is a signaling factor critical for regulating sympathetic neuron differentiation, this has yet to be shown in the complex in vivo environment of cardiac autonomic innervation. Targeting SHP-2 within postmigratory NC lineages resulted in a fully penetrant mouse model of diminished sympathetic cardiac innervation and concomitant bradycardia. Immunohistochemistry of the sympathetic nerve marker tyrosine hydroxylase revealed a progressive loss of adrenergic ganglionic neurons and reduction of cardiac sympathetic axon density in Shp2 cKOs. Molecularly, Shp2 cKOs exhibit lineage-specific suppression of activated phospo-ERK1/2 signaling but not of other downstream targets of SHP-2 such as pAKT. Genetic restoration of the phosphorylated-extracellular signal-regulated kinase (pERK) deficiency via lineage-specific expression of constitutively active MEK1 was sufficient to rescue the sympathetic innervation deficit and its physiological consequences. These data indicate that SHP-2 signaling specifically through pERK in postmigratory NC lineages is essential for development and maintenance of sympathetic cardiac innervation postnatally. PMID:24706815

  14. Role of Shp2 in forebrain neurons in regulating metabolic and cardiovascular functions and responses to leptin

    PubMed Central

    do Carmo, Jussara M.; da Silva, Alexandre A.; Sessums, Price O.; Ebaady, Sabira H.; Pace, Benjamin R.; Rushing, John S.; Davis, Mark T.; Hall, John E.

    2014-01-01

    Objective We examined whether deficiency of Shp2 signaling in forebrain neurons alters metabolic and cardiovascular regulation under various conditions and if it attenuates the anorexic and cardiovascular effects of leptin. We also tested whether forebrain Shp2 deficiency alters blood pressure (BP) and heart rate (HR) responses to acute stress. Design Forebrain Shp2-/- mice were generated by crossing Shp2flox/flox mice with CamKIIα-cre mice. At 22 to 24 weeks of age, mice were instrumented for telemetry for measurement of BP, HR and body temperature (BT). Oxygen consumption (VO2), energy expenditure and motor activity were monitored by indirect calorimetry. Results Shp2/CamKIIα-cre mice were heavier (46±3 vs 32±1 g), hyperglycemic, hyperleptinemic, hyperinsulinemic, and hyperphagic compared to Shp2flox/flox control mice. Shp2/CamKIIα-cre mice exhibited reduced food intake responses to fasting/refeeding and impaired regulation of BT when exposed to 15°C and 30°C ambient temperatures. Despite being obese and having many features of metabolic syndrome, Shp2/CamKIIα-cre mice had similar daily average BP and HR compared to Shp2flox/flox mice (112±2 vs 113±1 mmHg and 595±34 vs 650±40 bpm), but exhibited increased BP and HR responses to cold exposure and acute air-jet stress test. Leptin's ability to reduce food intake and to raise BP were markedly attenuated in Shp2/CamKIIα-cre mice. Conclusion These results suggest that forebrain Shp2 signaling regulates food intake, appetite responses to caloric deprivation, and thermogenic control of body temperature during variations in ambient temperature. Deficiency of Shp2 signaling in the forebrain is associated with augmented cardiovascular responses to cold and acute stress but attenuated BP responses to leptin. PMID:24030516

  15. Developmental SHP2 dysfunction underlies cardiac hypertrophy in Noonan syndrome with multiple lentigines

    PubMed Central

    Lauriol, Jessica; Cabrera, Janel R.; Roy, Ashbeel; Keith, Kimberly; Hough, Sara M.; Damilano, Federico; Wang, Bonnie; Segarra, Gabriel C.; Flessa, Meaghan E.; Miller, Lauren E.; Das, Saumya; Bronson, Roderick; Lee, Kyu-Ho; Kontaridis, Maria I.

    2016-01-01

    Hypertrophic cardiomyopathy is a common cause of mortality in congenital heart disease (CHD). Many gene abnormalities are associated with cardiac hypertrophy, but their function in cardiac development is not well understood. Loss-of-function mutations in PTPN11, which encodes the protein tyrosine phosphatase (PTP) SHP2, are implicated in CHD and cause Noonan syndrome with multiple lentigines (NSML), a condition that often presents with cardiac hypertrophic defects. Here, we found that NSML-associated hypertrophy stems from aberrant signaling mechanisms originating in developing endocardium. Trabeculation and valvular hyperplasia were diminished in hearts of embryonic mice expressing a human NSML-associated variant of SHP2, and these defects were recapitulated in mice expressing NSML-associated SHP2 specifically in endothelial, but not myocardial or neural crest, cells. In contrast, mice with myocardial- but not endothelial-specific NSML SHP2 expression developed ventricular septal defects, suggesting that NSML-associated mutations have both cell-autonomous and nonautonomous functions in cardiac development. However, only endothelial-specific expression of NSML-associated SHP2 induced adult-onset cardiac hypertrophy. Further, embryos expressing the NSML-associated SHP2 mutation exhibited aberrant AKT activity and decreased downstream forkhead box P1 (FOXP1)/FGF and NOTCH1/EPHB2 signaling, indicating that SHP2 is required for regulating reciprocal crosstalk between developing endocardium and myocardium. Together, our data provide functional and disease-based evidence that aberrant SHP2 signaling during cardiac development leads to CHD and adult-onset heart hypertrophy. PMID:27348588

  16. Enhanced anti-melanoma efficacy of interferon alfa-2b via inhibition of Shp2.

    PubMed

    Win-Piazza, Hla; Schneeberger, Valentina E; Chen, Liwei; Pernazza, Daniele; Lawrence, Harshani R; Sebti, Said M; Lawrence, Nicholas J; Wu, Jie

    2012-07-01

    Interferon-α2b (IFN-α2b) is used to treat melanoma but there is a need to improve its efficacy. IFN-α2b signaling requires STAT1/STAT2 tyrosine phosphorylation and is subject to negative regulation by phosphatases. In this study, we determined whether inhibition of the protein tyrosine phosphatase Shp2 could enhance IFN-α2b responses in human melanoma cells. Shp2 knockdown increased IFN-α2b-stimulated STAT1 Tyr-701 phosphorylation and ISRE-luciferase activity even though it did not affect STAT2 Tyr-690 phosphorylation in A375 cells. In A375 tumor xenografts, Shp2 knockdown enhanced the anti-melanoma effect of IFN-α2b. Furthermore, the Shp2 inhibitor SPI-112Me increased the IFN-α2b-induced STAT1 activation and anti-proliferative response in A375 and SK-MEL-2 cells. These results demonstrate that inhibition of Shp2 can enhance the anti-melanoma activity of IFN-α2b.

  17. Spinal SIRPα1-SHP2 interaction regulates spinal nerve ligation-induced neuropathic pain via PSD-95-dependent NR2B activation in rats.

    PubMed

    Peng, Hsien-Yu; Chen, Gin-Den; Lai, Cheng-Yuang; Hsieh, Ming-Chun; Lin, Tzer-Bin

    2012-05-01

    The fact that neuropathic pain mechanisms are not well understood is a major impediment in the development of effective clinical treatments. We examined whether the interaction between signal regulatory protein alpha 1 (SIRPα1) and Src homology-2 domain-containing protein tyrosine phosphatase 2 (SHP2), and the downstream spinal SHP2/postsynaptic density 95 (PSD-95)/N-methyl-d-aspartate receptor NR2B subunit signaling cascade play a role in neuropathic pain. Following spinal nerve ligation (L5), we assessed tactile allodynia using the von Frey filament test and analyzed dorsal horn samples (L4-5) by Western blotting, reverse transcription polymerase chain reaction, coimmunoprecipitation, and immunofluorescence. Nerve ligation induced allodynia, SIRPα1, SHP2, phosphorylated SHP2 (pSHP2), and phosphorylated NR2B (pNR2B) expression, and SHP2-PSD-95, pSHP2-PSD-95, PSD-95-NR2B, and PSD-95-pNR2B coimmunoprecipitation in the ipsilateral dorsal horn. In allodynic rats, injury-induced SHP2 immunoreactivity was localized in the ipsilateral dorsal horn neurons and coincident with PSD-95 and NR2B immunoreactivity. SIRPα1 silencing using small interfering RNA (siRNA; 1, 3, or 5μg/rat for 7days) prevented injury-induced allodynia and the associated changes in protein expression, phosphorylation, and coimmunoprecipitation. Intrathecal administration of NSC-87877 (an SHP2 antagonist; 1, 10, or 100μM/rat) and SIRPα1-neutralizing antibodies (1, 10, or 30μg/rat) suppressed spinal nerve ligation-induced allodynia, spinal SHP2 and NR2B phosphorylation, and SHP2/phosphorylated SHP2-PSD-95 and PSD-95-NR2B/phosphorylated NR2B coprecipitation. SHP2 siRNA led to similar effects as the NSC-87877 and SIRPα1 antibody treatments, except it prevented the allodynia-associated spinal SHP2 expression. In conclusion, our results suggest that a spinal SIRPα1-SHP2 interaction exists that subsequently triggers SHP2/PSD-95/NR2B signaling, thereby playing a role in neuropathic pain development.

  18. HER-2/neu raises SHP-2, stops IFN-{gamma} anti-proliferation in bladder cancer

    SciTech Connect

    Su, W.-P.; Tu, I-H.; Hu, S.-W.; Yeh, H.-H.; Shieh, D.-B.; Chen, T.-Y.; Su, W.-C. . E-mail: sunnysu@mail.ncku.edu.tw

    2007-04-27

    Gene amplification or HER-2/neu protein overexpression signals a poor outcome for bladder cancer patients. We investigated the anti-proliferative effect of IFN-{gamma} in HER-2/neu-transfected human bladder cancer cells (TCC-N5 and TCC-N10). The cells continued growing after IFN-{gamma} stimulation but did not activate the Janus kinase (Jak)/Stat pathway. We found Jak/Stat protein phosphatase in TCC-N5 and TCC-N10 cells with upregulated Src homology 2-containing protein tyrosine phosphatase-2 (SHP-2). After the cells had been treated with AG825, a HER-2/neu-specific inhibitor, SHP-2 expression declined, and Jak2/Stat1 reactivated. Similar results were reported in a mouse bladder cancer cell line, MBT2, with constitutive HER-2/neu overexpression. Further, AG825 pretreatment restored the anti-proliferation activity of IFN-{gamma} in TCC-N5 and TCC-N10 cells. Therefore, the suppression of IFN-{gamma} signaling in HER-2/neu-overexpressing bladder cancer cells might be due to SHP-2 upregulation. The regulation of SHP-2 by HER-2/neu provides a new target for blocking the HER-2/neu oncogenic pathwa000.

  19. Loss of PTEN causes SHP2 activation, making lung cancer cells unresponsive to IFN-γ

    SciTech Connect

    Chen, Chia-Ling; Chiang, Tzu-Hui; Tseng, Po-Chun; Wang, Yu-Chih; Lin, Chiou-Feng

    2015-10-23

    Src homology-2 domain-containing phosphatase (SHP) 2, an oncogenic phosphatase, inhibits type II immune interferon (IFN)-γ signaling by subverting signal transducers and activators of transcription 1 tyrosine phosphorylation and activation. For cancer immunoediting, this study aimed to investigate the decrease of phosphatase and tensin homolog deleted on chromosome 10 (PTEN), a tumor suppressor protein, leading to cellular impairment of IFN-γ signaling. In comparison with human lung adenocarcinoma A549 cells, the natural PTEN loss in another human lung adenocarcinoma line, PC14PE6/AS2 cells, presents reduced responsiveness in IFN-γ-induced IFN regulatory factor 1 activation and CD54 expression. Artificially silencing PTEN expression in A549 cells also caused cells to be unresponsive to IFN-γ without affecting IFN-γ receptor expression. IFN-γ-induced inhibition of cell proliferation and cytotoxicity were demonstrated in A549 cells but were defective in PC14PE6/AS2 cells and in PTEN-deficient A549 cells. Aberrant activation of SHP2 by ROS was specifically shown in PC14PE6/AS2 cells and PTEN-deficient A549 cells. Inhibiting ROS and SHP2 rescued cellular responses to IFN-γ-induced cytotoxicity and inhibition of cell proliferation in PC14PE6/AS2 cells. These results demonstrate that a decrease in PTEN facilitates ROS/SHP2 signaling, causing lung cancer cells to become unresponsive to IFN-γ. - Highlights: • This study demonstrates that PTEN decrease causes cellular unresponsive to IFN-γ. • Lung cancer cells with PTEN deficiency show unresponsive to IFN-γ signaling. • PTEN decrease inhibits IFN-γ-induced CD54, cell proliferation inhibition, and cytotoxicity. • ROS-mediated SHP2 activation makes PTEN-deficient cells unresponsive to IFN-γ.

  20. Deletion of SHP-2 in mesenchymal stem cells causes growth retardation, limb and chest deformity, and calvarial defects in mice

    PubMed Central

    Lapinski, Philip E.; Meyer, Melissa F.; Feng, Gen-Sheng; Kamiya, Nobuhiro; King, Philip D.

    2013-01-01

    SUMMARY In mice, induced global disruption of the Ptpn11 gene, which encodes the SHP-2 tyrosine phosphatase, results in severe skeletal abnormalities. To understand the extent to which skeletal abnormalities can be attributed to perturbation of SHP-2 function in bone-forming osteoblasts and chondrocytes, we generated mice in which disruption of Ptpn11 is restricted to mesenchymal stem cells (MSCs) and their progeny, which include both cell types. MSC-lineage-specific SHP-2 knockout (MSC SHP-2 KO) mice exhibited postnatal growth retardation, limb and chest deformity, and calvarial defects. These skeletal abnormalities were associated with an absence of mature osteoblasts and massive chondrodysplasia with a vast increase in the number of terminally differentiated hypertrophic chondrocytes in affected bones. Activation of mitogen activated protein kinases (MAPKs) and protein kinase B (PKB; also known as AKT) was impaired in bone-forming cells of MSC SHP-2 KO mice, which provides an explanation for the skeletal defects that developed. These findings reveal a cell-autonomous role for SHP-2 in bone-forming cells in mice in the regulation of skeletal development. The results add to our understanding of the pathophysiology of skeletal abnormalities observed in humans with germline mutations in the PTPN11 gene (e.g. Noonan syndrome and LEOPARD syndrome). PMID:24077964

  1. Conditional Deletion of Shp2 in the Mammary Gland Leads to Impaired Lobulo-alveolar Outgrowth and Attenuated Stat5 Activation*

    PubMed Central

    Ke, Yuehai; Lesperance, Jacqueline; Zhang, Eric E.; Bard-Chapeau, Emilie A.; Oshima, Robert G.; Muller, William J.; Feng, Gen-Sheng

    2006-01-01

    Stat5 and Stat3, two members of the Stat (signal transducer and activator of transcription) family, are known to play critical roles in mammopoiesis/lactogenesis and involution, respectively, in the mammary gland. Phosphotyrosine phosphatase Shp2 has been shown to dephosphorylate and thus inactivate both Stat5 and Stat3 in vitro. Paradoxically, cell culture studies also suggest a positive role of Shp2 in promoting prolactin-stimulated Stat5 activation. We have shown here that selective deletion of Shp2 in mouse mammary glands suppresses Stat5 activity during pregnancy and lactation, resulting in significant impairment of lobulo-alveolar outgrowth and lactation. In contrast, Stat3 activity was slightly up-regulated shortly before/at involution, leading to normal epithelial cell apoptosis/involution in Shp2-deficient mammary gland. Thus, Shp2 acts to promote Stat5 activation by the JAK2·prolactin receptor complex, while negatively modulating Stat3 activity before the onset of involution. This is the first demonstration that Shp2 manipulates Stat5 and Stat3 activities reciprocally in mammary epithelial cells, providing novel insight into the complex mechanisms for regulation of various Stat family members by a cytoplasmic tyrosine phosphatase. PMID:16959766

  2. LEOPARD syndrome-associated SHP2 mutation confers leanness and protection from diet-induced obesity

    PubMed Central

    Tajan, Mylène; Batut, Aurélie; Cadoudal, Thomas; Deleruyelle, Simon; Le Gonidec, Sophie; Saint Laurent, Céline; Vomscheid, Maëlle; Wanecq, Estelle; Tréguer, Karine; De Rocca Serra-Nédélec, Audrey; Vinel, Claire; Marques, Marie-Adeline; Pozzo, Joffrey; Kunduzova, Oksana; Salles, Jean-Pierre; Tauber, Maithé; Raynal, Patrick; Cavé, Hélène; Edouard, Thomas; Valet, Philippe; Yart, Armelle

    2014-01-01

    LEOPARD syndrome (multiple Lentigines, Electrocardiographic conduction abnormalities, Ocular hypertelorism, Pulmonary stenosis, Abnormal genitalia, Retardation of growth, sensorineural Deafness; LS), also called Noonan syndrome with multiple lentigines (NSML), is a rare autosomal dominant disorder associating various developmental defects, notably cardiopathies, dysmorphism, and short stature. It is mainly caused by mutations of the PTPN11 gene that catalytically inactivate the tyrosine phosphatase SHP2 (Src-homology 2 domain-containing phosphatase 2). Besides its pleiotropic roles during development, SHP2 plays key functions in energetic metabolism regulation. However, the metabolic outcomes of LS mutations have never been examined. Therefore, we performed an extensive metabolic exploration of an original LS mouse model, expressing the T468M mutation of SHP2, frequently borne by LS patients. Our results reveal that, besides expected symptoms, LS animals display a strong reduction of adiposity and resistance to diet-induced obesity, associated with overall better metabolic profile. We provide evidence that LS mutant expression impairs adipogenesis, triggers energy expenditure, and enhances insulin signaling, three features that can contribute to the lean phenotype of LS mice. Interestingly, chronic treatment of LS mice with low doses of MEK inhibitor, but not rapamycin, resulted in weight and adiposity gains. Importantly, preliminary data in a French cohort of LS patients suggests that most of them have lower-than-average body mass index, associated, for tested patients, with reduced adiposity. Altogether, these findings unravel previously unidentified characteristics for LS, which could represent a metabolic benefit for patients, but may also participate to the development or worsening of some traits of the disease. Beyond LS, they also highlight a protective role of SHP2 global LS-mimicking modulation toward the development of obesity and associated disorders

  3. Loss of Ptpn11 (Shp2) drives satellite cells into quiescence

    PubMed Central

    Griger, Joscha; Schneider, Robin; Lahmann, Ines; Schöwel, Verena; Keller, Charles; Spuler, Simone; Nazare, Marc; Birchmeier, Carmen

    2017-01-01

    The equilibrium between proliferation and quiescence of myogenic progenitor and stem cells is tightly regulated to ensure appropriate skeletal muscle growth and repair. The non-receptor tyrosine phosphatase Ptpn11 (Shp2) is an important transducer of growth factor and cytokine signals. Here we combined complex genetic analyses, biochemical studies and pharmacological interference to demonstrate a central role of Ptpn11 in postnatal myogenesis of mice. Loss of Ptpn11 drove muscle stem cells out of the proliferative and into a resting state during muscle growth. This Ptpn11 function was observed in postnatal but not fetal myogenic stem cells. Furthermore, muscle repair was severely perturbed when Ptpn11 was ablated in stem cells due to a deficit in stem cell proliferation and survival. Our data demonstrate a molecular difference in the control of cell cycle withdrawal in fetal and postnatal myogenic stem cells, and assign to Ptpn11 signaling a key function in satellite cell activity. DOI: http://dx.doi.org/10.7554/eLife.21552.001 PMID:28463680

  4. Shp2 Associates with and Enhances Nephrin Tyrosine Phosphorylation and Is Necessary for Foot Process Spreading in Mouse Models of Podocyte Injury.

    PubMed

    Verma, Rakesh; Venkatareddy, Madhusudan; Kalinowski, Anne; Patel, Sanjeevkumar R; Salant, David J; Garg, Puneet

    2015-12-07

    In most forms of glomerular diseases, loss of size selectivity by the kidney filtration barrier is associated with changes in the morphology of podocytes. The kidney filtration barrier is comprised of the endothelial lining, the glomerular basement membrane, and the podocyte intercellular junction, or slit diaphragm. The cell adhesion proteins nephrin and neph1 localize to the slit diaphragm and transduce signals in a Src family kinase Fyn-mediated tyrosine phosphorylation-dependent manner. Studies in cell culture suggest nephrin phosphorylation-dependent signaling events are primarily involved in regulation of actin dynamics and lamellipodium formation. Nephrin phosphorylation is a proximal event that occurs both during development and following podocyte injury. We hypothesized that abrogation of nephrin phosphorylation following injury would prevent nephrin-dependent actin remodeling and foot process morphological changes. Utilizing a biased screening approach, we found nonreceptor Src homology 2 (sh2) domain-containing phosphatase Shp2 to be associated with phosphorylated nephrin. We observed an increase in nephrin tyrosine phosphorylation in the presence of Shp2 in cell culture studies. In the human glomerulopathies minimal-change nephrosis and membranous nephropathy, there is an increase in Shp2 phosphorylation, a marker of increased Shp2 activity. Mouse podocytes lacking Shp2 do not develop foot process spreading when subjected to podocyte injury in vivo using protamine sulfate or nephrotoxic serum (NTS). In the NTS model, we observed a lack of foot process spreading in mouse podocytes with Shp2 deleted and smaller amounts of proteinuria. Taken together, these results suggest that Shp2-dependent signaling events are necessary for changes in foot process structure and function following injury. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  5. Attenuation of Helicobacter pylori CagA x SHP-2 signaling by interaction between CagA and C-terminal Src kinase.

    PubMed

    Tsutsumi, Ryouhei; Higashi, Hideaki; Higuchi, Megumi; Okada, Masato; Hatakeyama, Masanori

    2003-02-07

    Helicobacter pylori (H. pylori) is a causative agent of gastric diseases ranging from gastritis to cancer. The CagA protein is the product of the cagA gene carried among virulent H. pylori strains and is associated with severe disease outcomes, most notably gastric carcinoma. CagA is injected from the attached H. pylori into gastric epithelial cells and undergoes tyrosine phosphorylation. The phosphorylated CagA binds and activates SHP-2 phosphatase and thereby induces a growth factor-like morphological change termed the "hummingbird phenotype." In this work, we demonstrate that CagA is also capable of interacting with C-terminal Src kinase (Csk). As is the case with SHP-2, Csk selectively binds tyrosine-phosphorylated CagA via its SH2 domain. Upon complex formation, CagA stimulates Csk, which in turn inactivates the Src family of protein-tyrosine kinases. Because Src family kinases are responsible for CagA phosphorylation, an essential prerequisite of CagA.SHP-2 complex formation and subsequent induction of the hummingbird phenotype, our results indicate that CagA-Csk interaction down-regulates CagA.SHP-2 signaling by both competitively inhibiting CagA.SHP-2 complex formation and reducing levels of CagA phosphorylation. We further demonstrate that CagA.SHP-2 signaling eventually induces apoptosis in AGS cells. Our results thus indicate that CagA-Csk interaction prevents excess cell damage caused by deregulated activation of SHP-2. Attenuation of CagA activity by Csk may enable cagA-positive H. pylori to persistently infect the human stomach for decades while avoiding excess CagA toxicity to the host.

  6. NOX4-dependent Hydrogen peroxide promotes shear stress-induced SHP2 sulfenylation and eNOS activation.

    PubMed

    Sánchez-Gómez, Francisco J; Calvo, Enrique; Bretón-Romero, Rosa; Fierro-Fernández, Marta; Anilkumar, Narayana; Shah, Ajay M; Schröder, Katrin; Brandes, Ralf P; Vázquez, Jesús; Lamas, Santiago

    2015-12-01

    Laminar shear stress (LSS) triggers signals that ultimately result in atheroprotection and vasodilatation. Early responses are related to the activation of specific signaling cascades. We investigated the participation of redox-mediated modifications and in particular the role of hydrogen peroxide (H2O2) in the sulfenylation of redox-sensitive phosphatases. Exposure of vascular endothelial cells to short periods of LSS (12 dyn/cm(2)) resulted in the generation of superoxide radical anion as detected by the formation of 2-hydroxyethidium by HPLC and its subsequent conversion to H2O2, which was corroborated by the increase in the fluorescence of the specific peroxide sensor HyPer. By using biotinylated dimedone we detected increased total protein sulfenylation in the bovine proteome, which was dependent on NADPH oxidase 4 (NOX4)-mediated generation of peroxide. Mass spectrometry analysis allowed us to identify the phosphatase SHP2 as a protein susceptible to sulfenylation under LSS. Given the dependence of FAK activity on SHP2 function, we explored the role of FAK under LSS conditions. FAK activation and subsequent endothelial NO synthase (eNOS) phosphorylation were promoted by LSS and both processes were dependent on NOX4, as demonstrated in lung endothelial cells isolated from NOX4-null mice. These results support the idea that LSS elicits redox-sensitive signal transduction responses involving NOX4-dependent generation of hydrogen peroxide, SHP2 sulfenylation, and ulterior FAK-mediated eNOS activation.

  7. Chlorogenic Acid Prevents Osteoporosis by Shp2/PI3K/Akt Pathway in Ovariectomized Rats

    PubMed Central

    Zuo, Hui Ling; Yao, Fen Fen; Ruan, Hui Bing; Xu, Jin; Song, Wei; Zhou, Yi Cheng; Wen, Shi Yao; Dai, Jiang Hua; Zhu, Mei Lan; Luo, Jun

    2016-01-01

    Cortex Eucommiae is used worldwide in traditional medicine, various constituents of Cortex Eucommiae, such as chlorogenic acid (CGA), has been reported to exert anti-osteoporosis activity in China, but the mechanism about their contribution to the overall activity is limited. The aims of this study were to determine whether chlorogenic acid can prevent estrogen deficiency-induced osteoporosis and to analyze the mechanism of CGA bioactivity. The effect of CGA on estrogen deficiency-induced osteoporosis was performed in vivo. Sixty female Sprague-Dawley rats were divided randomly among a sham-operated group and five ovariectomy (OVX) plus treatment subgroups: saline vehicle, 17α-ethinylestradiol (E2), or CGA at 9, 27, or 45 mg/kg/d. The rats’ femoral metaphyses were evaluated by micro-computed tomography (μCT). The mechanism of CGA bioactivity was investigated in vitro. Bone mesenchymal stem cells (BMSCs) were treated with CGA, with or without phosphoinositide 3-kinase (PI3K) inhibitor LY294002. BMSCs proliferation and osteoblast differentiation were assessed with 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide (MTT) and alkaline phosphatase, with or without Shp2 interfering RNA (RNAi). The results display that CGA at 27 and 45 mg/kg/day inhibited the decrease of bone mineral density (BMD) that induced by OVX in femur (p< 0.01), significantly promoted the levels of bone turnover markers, and prevented bone volume fraction (BV/TV), connectivity density (CoonD), trabecular number (Tb.N), trabecular thickness (Tb.Th) (all p< 0.01) to decrease and prevented the trabecular separation (Tb.Sp), structure model index (SMI)(both p< 0.01) to increase. CGA at 1 or 10 μM enhanced BMSC proliferation in a dose-dependent manner. CGA at 0.1 to 10 μM increased phosphorylated Akt (p-Akt) and cyclin D1. These effects were reversed by LY294002. CGA at 1 or 10 μM increased BMSC differentiation to osteoblasts (p< 0.01), Shp2 RNAi suppressed CGA-induced osteoblast

  8. A Cross-Species Study of PI3K Protein-Protein Interactions Reveals the Direct Interaction of P85 and SHP2

    NASA Astrophysics Data System (ADS)

    Breitkopf, Susanne B.; Yang, Xuemei; Begley, Michael J.; Kulkarni, Meghana; Chiu, Yu-Hsin; Turke, Alexa B.; Lauriol, Jessica; Yuan, Min; Qi, Jie; Engelman, Jeffrey A.; Hong, Pengyu; Kontaridis, Maria I.; Cantley, Lewis C.; Perrimon, Norbert; Asara, John M.

    2016-02-01

    Using a series of immunoprecipitation (IP) - tandem mass spectrometry (LC-MS/MS) experiments and reciprocal BLAST, we conducted a fly-human cross-species comparison of the phosphoinositide-3-kinase (PI3K) interactome in a drosophila S2R+ cell line and several NSCLC and human multiple myeloma cell lines to identify conserved interacting proteins to PI3K, a critical signaling regulator of the AKT pathway. Using H929 human cancer cells and drosophila S2R+ cells, our data revealed an unexpected direct binding of Corkscrew, the drosophila ortholog of the non-receptor protein tyrosine phosphatase type II (SHP2) to the Pi3k21B (p60) regulatory subunit of PI3K (p50/p85 human ortholog) but no association with Pi3k92e, the human ortholog of the p110 catalytic subunit. The p85-SHP2 association was validated in human cell lines, and formed a ternary regulatory complex with GRB2-associated-binding protein 2 (GAB2). Validation experiments with knockdown of GAB2 and Far-Western blots proved the direct interaction of SHP2 with p85, independent of adaptor proteins and transfected FLAG-p85 provided evidence that SHP2 binding on p85 occurred on the SH2 domains. A disruption of the SHP2-p85 complex took place after insulin/IGF1 stimulation or imatinib treatment, suggesting that the direct SHP2-p85 interaction was both independent of AKT activation and positively regulates the ERK signaling pathway.

  9. Phosphoproteomics of collagen receptor networks reveals SHP-2 phosphorylation downstream of wild-type DDR2 and its lung cancer mutants.

    PubMed

    Iwai, Leo K; Payne, Leo S; Luczynski, Maciej T; Chang, Francis; Xu, Huifang; Clinton, Ryan W; Paul, Angela; Esposito, Edward A; Gridley, Scott; Leitinger, Birgit; Naegle, Kristen M; Huang, Paul H

    2013-09-15

    Collagen is an important extracellular matrix component that directs many fundamental cellular processes including differentiation, proliferation and motility. The signalling networks driving these processes are propagated by collagen receptors such as the β1 integrins and the DDRs (discoidin domain receptors). To gain an insight into the molecular mechanisms of collagen receptor signalling, we have performed a quantitative analysis of the phosphorylation networks downstream of collagen activation of integrins and DDR2. Temporal analysis over seven time points identified 424 phosphorylated proteins. Distinct DDR2 tyrosine phosphorylation sites displayed unique temporal activation profiles in agreement with in vitro kinase data. Multiple clustering analysis of the phosphoproteomic data revealed several DDR2 candidate downstream signalling nodes, including SHP-2 (Src homology 2 domain-containing protein tyrosine phosphatase 2), NCK1 (non-catalytic region of tyrosine kinase adaptor protein 1), LYN, SHIP-2 [SH2 (Src homology 2)-domain-containing inositol phosphatase 2], PIK3C2A (phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2α) and PLCL2 (phospholipase C-like 2). Biochemical validation showed that SHP-2 tyrosine phosphorylation is dependent on DDR2 kinase activity. Targeted proteomic profiling of a panel of lung SCC (squamous cell carcinoma) DDR2 mutants demonstrated that SHP-2 is tyrosine-phosphorylated by the L63V and G505S mutants. In contrast, the I638F kinase domain mutant exhibited diminished DDR2 and SHP-2 tyrosine phosphorylation levels which have an inverse relationship with clonogenic potential. Taken together, the results of the present study indicate that SHP-2 is a key signalling node downstream of the DDR2 receptor which may have therapeutic implications in a subset of DDR2 mutations recently uncovered in genome-wide lung SCC sequencing screens.

  10. Targeting SHP2 for EGFR inhibitor resistant non-small cell lung carcinoma

    SciTech Connect

    Xu, Jie; Zeng, Li-Fan; Shen, Weihua; Turchi, John J.; Zhang, Zhong-Yin

    2013-10-04

    Highlights: •SHP2 is required for EGFR inhibitor resistant NSCLC H1975 cell proliferation. •SHP2 inhibitor blocks EGF-stimulated ERK1/2 activation and proliferation. •SHP2 inhibitor exhibits marked anti-tumor activity in H1975 xenograft mice. •SHP2 inhibitor synergizes with PI3K inhibitor in suppressing cell growth. •Targeting SHP2 represents a novel strategy for EGFR inhibitor resistant NSCLCs. -- Abstract: Targeted therapy with inhibitors of epidermal growth factor receptor (EGFR) has produced a noticeable benefit to non-small cell lung cancer (NSCLC) patients whose tumors carry activating mutations (e.g. L858R) in EGFR. Unfortunately, these patients develop drug resistance after treatment, due to acquired secondary gatekeeper mutations in EGFR (e.g. T790M). Given the critical role of SHP2 in growth factor receptor signaling, we sought to determine whether targeting SHP2 could have therapeutic value for EGFR inhibitor resistant NSCLC. We show that SHP2 is required for EGF-stimulated ERK1/2 phosphorylation and proliferation in EGFR inhibitor resistant NSCLC cell line H1975, which harbors the EGFR T790M/L858R double-mutant. We demonstrate that treatment of H1975 cells with II-B08, a specific SHP2 inhibitor, phenocopies the observed growth inhibition and reduced ERK1/2 activation seen in cells treated with SHP2 siRNA. Importantly, we also find that II-B08 exhibits marked anti-tumor activity in H1975 xenograft mice. Finally, we observe that combined inhibition of SHP2 and PI3K impairs both the ERK1/2 and PI3K/AKT signaling axes and produces significantly greater effects on repressing H1975 cell growth than inhibition of either protein individually. Collectively, these results suggest that targeting SHP2 may represent an effective strategy for treatment of EGFR inhibitor resistant NSCLCs.

  11. Gain-of-function mutations of Ptpn11 (Shp2) cause aberrant mitosis and increase susceptibility to DNA damage-induced malignancies.

    PubMed

    Liu, Xia; Zheng, Hong; Li, Xiaobo; Wang, Siying; Meyerson, Howard J; Yang, Wentian; Neel, Benjamin G; Qu, Cheng-Kui

    2016-01-26

    Gain-of-function (GOF) mutations of protein tyrosine phosphatase nonreceptor type 11 Ptpn11 (Shp2), a protein tyrosine phosphatase implicated in multiple cell signaling pathways, are associated with childhood leukemias and solid tumors. The underlying mechanisms are not fully understood. Here, we report that Ptpn11 GOF mutations disturb mitosis and cytokinesis, causing chromosomal instability and greatly increased susceptibility to DNA damage-induced malignancies. We find that Shp2 is distributed to the kinetochore, centrosome, spindle midzone, and midbody, all of which are known to play critical roles in chromosome segregation and cytokinesis. Mouse embryonic fibroblasts with Ptpn11 GOF mutations show a compromised mitotic checkpoint. Centrosome amplification and aberrant mitosis with misaligned or lagging chromosomes are significantly increased in Ptpn11-mutated mouse and patient cells. Abnormal cytokinesis is also markedly increased in these cells. Further mechanistic analyses reveal that GOF mutant Shp2 hyperactivates the Polo-like kinase 1 (Plk1) kinase by enhancing c-Src kinase-mediated tyrosine phosphorylation of Plk1. This study provides novel insights into the tumorigenesis associated with Ptpn11 GOF mutations and cautions that DNA-damaging treatments in Noonan syndrome patients with germ-line Ptpn11 GOF mutations could increase the risk of therapy-induced malignancies.

  12. Critical role of SHP2 (PTPN11) signaling in germinal center-derived lymphoma.

    PubMed

    Jiang, Xin; Guo, Honggang; Wu, Jianguo; He, Qiang; Li, Yiqiao; Wang, Miao; Pan, Hongyang; Li, Wande; Wang, Jinjie; Wang, Qingqing; Shen, Jing; Ke, Yuehai; Zhou, Ren

    2014-12-01

    Germinal center lymphoma is a heterogeneous human lymphoma entity. Here we report that constitutive activity of SHP2 (PTPN11) and its downstream kinase ERK is essential for the viability of germinal center lymphoma cells and disease progression. Mechanistically, SHP2/ERK inhibition impedes c-Myc transcriptional activity, which results in the repression of proliferative phenotype signatures of germinal center lymphoma. Furthermore, SHP2/ERK signaling is required to maintain the CD19/c-Myc loop, which preferentially promotes survival of a distinct subtype of germinal center lymphoma cells carrying the MYC/IGH translocation. These findings demonstrate a critical function for SHP2/ERK signaling upstream of c-Myc in germinal center lymphoma cells and provide a rationale for targeting SHP2 in the therapy of germinal center lymphoma.

  13. Critical role of SHP2 (PTPN11) signaling in germinal center-derived lymphoma

    PubMed Central

    Jiang, Xin; Guo, Honggang; Wu, Jianguo; He, Qiang; Li, Yiqiao; Wang, Miao; Pan, Hongyang; Li, Wande; Wang, Jinjie; Wang, Qingqing; Shen, Jing; Ke, Yuehai; Zhou, Ren

    2014-01-01

    Germinal center lymphoma is a heterogeneous human lymphoma entity. Here we report that constitutive activity of SHP2 (PTPN11) and its downstream kinase ERK is essential for the viability of germinal center lymphoma cells and disease progression. Mechanistically, SHP2/ERK inhibition impedes c-Myc transcriptional activity, which results in the repression of proliferative phenotype signatures of germinal center lymphoma. Furthermore, SHP2/ERK signaling is required to maintain the CD19/c-Myc loop, which preferentially promotes survival of a distinct subtype of germinal center lymphoma cells carrying the MYC/IGH translocation. These findings demonstrate a critical function for SHP2/ERK signaling upstream of c-Myc in germinal center lymphoma cells and provide a rationale for targeting SHP2 in the therapy of germinal center lymphoma. PMID:25193962

  14. Induction of SHP2 deficiency in chondrocytes causes severe scoliosis and kyphosis in mice.

    PubMed

    Kim, Harry K W; Aruwajoye, Olumide; Sucato, Daniel; Richards, B Stephens; Feng, Gen-Sheng; Chen, Di; King, Philip D; Kamiya, Nobuhiro

    2013-10-01

    Genetic engineering techniques were used to develop an animal model of juvenile scoliosis during a postnatal skeletal-growth stage. To investigate the effect of targeted SHP2 (Src homology-2) deficiency in chondrocytes on the development of scoliosis during a juvenile growth stage in mice. Juvenile idiopathic scoliosis can lead to progressive severe spinal deformity. The pathophysiology and molecular mechanisms responsible for the deformity are unknown. Here, we investigated the role of SHP2 deficiency in chondrocytes as a potential cause of juvenile scoliosis. Genetically engineered mice with inducible deletion of SHP2 in chondrocytes were generated. The SHP2 function in chondrocytes was inactivated during a juvenile growth stage from the mouse age of 4 weeks. Radiographical, micro-computed tomographic, and histological assessments were used to analyze spinal changes. When SHP2 deficiency was induced during the juvenile stage, a progressive kyphoscoliotic deformity (thoracic lordosis and thoracolumbar kyphoscoliosis) developed within 2 weeks of the initiation of SHP2 deficiency. The 3-dimensional micro-computed tomography analysis confirmed the kyphoscoliotic deformity with a rotational deformity of the spine and osteophyte formation. The histological analysis revealed disorganization of the vertebral growth plate cartilage. Interestingly, when SHP2 was disrupted during the adolescent to adult stages, no spinal deformity developed. SHP2 plays an important role in normal spine development during skeletal maturation. Chondrocyte-specific deletion of SHP2 at a juvenile stage produced a kyphoscoliotic deformity. This new mouse model will be useful for future investigations of the role of SHP2 deficiency in chondrocytes as a mechanism leading to the development of juvenile scoliosis. N/A.

  15. The role of the inhibitors of interleukin-6 signal transduction SHP2 and SOCS3 for desensitization of interleukin-6 signalling.

    PubMed Central

    Fischer, Patrick; Lehmann, Ute; Sobota, Radoslaw M; Schmitz, Jochen; Niemand, Claudia; Linnemann, Sonja; Haan, Serge; Behrmann, Iris; Yoshimura, Akihiko; Johnston, James A; Müller-Newen, Gerhard; Heinrich, Peter C; Schaper, Fred

    2004-01-01

    The immediate early response of cells treated with IL-6 (interleukin-6) is the activation of the signal transducer and activator of transcription (STAT)3. The Src homology domain 2 (SH2)-containing protein tyrosine phosphatase SHP2 and the feedback inhibitor SOCS3 (suppressor of cytokine signalling) are potent inhibitors of IL-6 signal transduction. Impaired function of SOCS3 or SHP2 leads to enhanced and prolonged IL-6 signalling. The inhibitory function of both proteins depends on their recruitment to the tyrosine motif 759 within glycoprotein gp130. In contrast to inactivation, desensitization of signal transduction is regarded as impaired responsiveness due to prestimulation. Usually, after activation the sensing receptor becomes inactivated by modifications such as phosphorylation, internalization or degradation. We designed an experimental approach which allows discrimination between desensitization and inactivation of IL-6 signal transduction. We observed that pre-stimulation with IL-6 renders cells less sensitive to further stimulation with IL-6. After several hours, the cells become sensitive again. We show that not only signal transduction through previously activated receptors is affected by desensitization but signalling through receptors which were not targeted by the first stimulation was also attenuated ( trans -desensitization). Interestingly, in contrast to inhibition, desensitization does not depend on the presence of functional SHP2. Furthermore, cells lacking SOCS3 show constitutive STAT3 activation which is not affected by pre-stimulation with IL-6. All these observations suggest that desensitization and inhibition of signalling are mechanistically distinct. PMID:14611646

  16. A glutamate switch controls voltage-sensitive phosphatase function

    PubMed Central

    Liu, Lijun; Kohout, Susy C.; Xu, Qiang; Müller, Simone; Kimberlin, Christopher R.; Isacoff, Ehud Y.; Minor, Daniel L.

    2012-01-01

    Ciona intestinalis voltage sensing phosphatase Ci-VSP couples a voltage-sensing domain (VSD) to a lipid phosphatase similar to the tumor suppressor PTEN. How the VSD controls enzyme function has been unclear. Here, we present high-resolution crystal structures of the Ci-VSP enzymatic domain that reveal conformational changes in a key loop, termed the “gating loop”, that controls access to the active site by a mechanism in which residue Glu411 directly competes with substrate. Structure-based mutations that restrict gating loop conformation impair catalytic function and demonstrate that Glu411 also contributes to substrate selectivity. Structure-guided mutations further define an interaction between the gating loop and linker that connects the phosphatase to the VSD for voltage control of enzyme activity. Together, the data suggest that functional coupling between the gating loop and the linker forms the heart of the regulatory mechanism that controls voltage-dependent enzyme activation. PMID:22562138

  17. A glutamate switch controls voltage-sensitive phosphatase function.

    PubMed

    Liu, Lijun; Kohout, Susy C; Xu, Qiang; Müller, Simone; Kimberlin, Christopher R; Isacoff, Ehud Y; Minor, Daniel L

    2012-05-06

    The Ciona intestinalis voltage-sensing phosphatase (Ci-VSP) couples a voltage-sensing domain (VSD) to a lipid phosphatase that is similar to the tumor suppressor PTEN. How the VSD controls enzyme function has been unclear. Here, we present high-resolution crystal structures of the Ci-VSP enzymatic domain that reveal conformational changes in a crucial loop, termed the 'gating loop', that controls access to the active site by a mechanism in which residue Glu411 directly competes with substrate. Structure-based mutations that restrict gating loop conformation impair catalytic function and demonstrate that Glu411 also contributes to substrate selectivity. Structure-guided mutations further define an interaction between the gating loop and linker that connects the phosphatase to the VSD for voltage control of enzyme activity. Together, the data suggest that functional coupling between the gating loop and the linker forms the heart of the regulatory mechanism that controls voltage-dependent enzyme activation.

  18. A human phospholipid phosphatase activated by a transmembrane control module.

    PubMed

    Halaszovich, Christian R; Leitner, Michael G; Mavrantoni, Angeliki; Le, Audrey; Frezza, Ludivine; Feuer, Anja; Schreiber, Daniela N; Villalba-Galea, Carlos A; Oliver, Dominik

    2012-11-01

    In voltage-sensitive phosphatases (VSPs), a transmembrane voltage sensor domain (VSD) controls an intracellular phosphoinositide phosphatase domain, thereby enabling immediate initiation of intracellular signals by membrane depolarization. The existence of such a mechanism in mammals has remained elusive, despite the presence of VSP-homologous proteins in mammalian cells, in particular in sperm precursor cells. Here we demonstrate activation of a human VSP (hVSP1/TPIP) by an intramolecular switch. By engineering a chimeric hVSP1 with enhanced plasma membrane targeting containing the VSD of a prototypic invertebrate VSP, we show that hVSP1 is a phosphoinositide-5-phosphatase whose predominant substrate is PI(4,5)P(2). In the chimera, enzymatic activity is controlled by membrane potential via hVSP1's endogenous phosphoinositide binding motif. These findings suggest that the endogenous VSD of hVSP1 is a control module that initiates signaling through the phosphatase domain and indicate a role for VSP-mediated phosphoinositide signaling in mammals.

  19. Kaempferol suppresses collagen-induced platelet activation by inhibiting NADPH oxidase and protecting SHP-2 from oxidative inactivation.

    PubMed

    Wang, Su Bin; Jang, Ji Yong; Chae, Yun Hee; Min, Ji Hyun; Baek, Jin Young; Kim, Myunghee; Park, Yunjeong; Hwang, Gwi Seo; Ryu, Jae-Sang; Chang, Tong-Shin

    2015-06-01

    Reactive oxygen species (ROS) generated upon collagen stimulation act as second messengers to propagate various platelet-activating events. Among the ROS-generating enzymes, NADPH oxidase (NOX) plays a prominent role in platelet activation. Thus, NOX has been suggested as a novel target for anti-platelet drug development. Although kaempferol has been identified as a NOX inhibitor, the influence of kaempferol on the activation of platelets and the underlying mechanism have never been investigated. Here, we studied the effects of kaempferol on NOX activation, ROS-dependent signaling pathways, and functional responses in collagen-stimulated platelets. Superoxide anion generation stimulated by collagen was significantly inhibited by kaempferol in a concentration-dependent manner. More importantly, kaempferol directly bound p47(phox), a major regulatory subunit of NOX, and significantly inhibited collagen-induced phosphorylation of p47(phox) and NOX activation. In accordance with the inhibition of NOX, ROS-dependent inactivation of SH2 domain-containing protein tyrosine phosphatase-2 (SHP-2) was potently protected by kaempferol. Subsequently, the specific tyrosine phosphorylation of key components (Syk, Vav1, Btk, and PLCγ2) of collagen receptor signaling pathways was suppressed by kaempferol. Kaempferol also attenuated downstream responses, including cytosolic calcium elevation, P-selectin surface exposure, and integrin-αIIbβ3 activation. Ultimately, kaempferol inhibited platelet aggregation and adhesion in response to collagen in vitro and prolonged in vivo thrombotic response in carotid arteries of mice. This study shows that kaempferol impairs collagen-induced platelet activation through inhibition of NOX-derived ROS production and subsequent oxidative inactivation of SHP-2. This effect suggests that kaempferol has therapeutic potential for the prevention and treatment of thrombovascular diseases.

  20. PD-1/SHP-2 inhibits Tc1/Th1 phenotypic responses and the activation of T cells in the tumor microenvironment.

    PubMed

    Li, Jing; Jie, Hyun-Bae; Lei, Yu; Gildener-Leapman, Neil; Trivedi, Sumita; Green, Tony; Kane, Lawrence P; Ferris, Robert L

    2015-02-01

    Immune rejection of tumors is mediated by IFNγ production and T-cell cytolytic activity. These processes are impeded by PD-1, a coinhibitory molecule expressed on T cells that is elevated in tumor-infiltrating lymphocytes (TIL). PD-1 elevation may reflect T-cell exhaustion marked by decreased proliferation, production of type I cytokines, and poor cytolytic activity. Although anti-PD-1 antibodies enhance IFNγ secretion after stimulation of the T-cell receptor (TCR), the mechanistic link between PD-1 and its effects on T-cell help (Tc1/Th1 skewing) remains unclear. In prospectively collected cancer tissues, we found that TIL exhibited dampened Tc1/Th1 skewing and activation compared with peripheral blood lymphocytes (PBL). When PD-1 bound its ligand PD-L1, we observed a marked suppression of critical TCR target genes and Th1 cytokines. Conversely, PD-1 blockade reversed these suppressive effects of PD-1:PD-L1 ligation. We also found that the TCR-regulated phosphatase SHP-2 was expressed higher in TIL than in PBL, tightly correlating with PD-1 expression and negative regulation of TCR target genes. Overall, these results defined a PD-1/SHP-2/STAT1/T-bet signaling axis mediating the suppressive effects of PD-1 on Th1 immunity at tumor sites. Our findings argue that PD-1 or SHP-2 blockade will be sufficient to restore robust Th1 immunity and T-cell activation and thereby reverse immunosuppression in the tumor microenvironment.

  1. Protein tyrosine phosphatases as potential therapeutic targets

    PubMed Central

    He, Rong-jun; Yu, Zhi-hong; Zhang, Ruo-yu; Zhang, Zhong-yin

    2014-01-01

    Protein tyrosine phosphorylation is a key regulatory process in virtually all aspects of cellular functions. Dysregulation of protein tyrosine phosphorylation is a major cause of human diseases, such as cancers, diabetes, autoimmune disorders, and neurological diseases. Indeed, protein tyrosine phosphorylation-mediated signaling events offer ample therapeutic targets, and drug discovery efforts to date have brought over two dozen kinase inhibitors to the clinic. Accordingly, protein tyrosine phosphatases (PTPs) are considered next-generation drug targets. For instance, PTP1B is a well-known targets of type 2 diabetes and obesity, and recent studies indicate that it is also a promising target for breast cancer. SHP2 is a bona-fide oncoprotein, mutations of which cause juvenile myelomonocytic leukemia, acute myeloid leukemia, and solid tumors. In addition, LYP is strongly associated with type 1 diabetes and many other autoimmune diseases. This review summarizes recent findings on several highly recognized PTP family drug targets, including PTP1B, Src homology phosphotyrosyl phosphatase 2(SHP2), lymphoid-specific tyrosine phosphatase (LYP), CD45, Fas associated phosphatase-1 (FAP-1), striatal enriched tyrosine phosphatases (STEP), mitogen-activated protein kinase/dual-specificity phosphatase 1 (MKP-1), phosphatases of regenerating liver-1 (PRL), low molecular weight PTPs (LMWPTP), and CDC25. Given that there are over 100 family members, we hope this review will serve as a road map for innovative drug discovery targeting PTPs. PMID:25220640

  2. Protein tyrosine phosphatase activity in the neural crest is essential for normal heart and skull development

    PubMed Central

    Nakamura, Tomoki; Gulick, James; Colbert, Melissa C.; Robbins, Jeffrey

    2009-01-01

    Mutations within the protein tyrosine phosphatase, SHP2, which is encoded by PTPN11, cause a significant proportion of Noonan syndrome (NS) cases, typically presenting with both cardiac disease and craniofacial abnormalities. Neural crest cells (NCCs) participate in both heart and skull formation, but the role of SHP2 signaling in NCC has not yet been determined. To gain insight into the role of SHP2 in NCC function, we ablated PTPN11 specifically in premigratory NCCs. SHP2-deficient NCCs initially exhibited normal migratory and proliferative patterns, but in the developing heart failed to migrate into the developing outflow tract. The embryos displayed persistent truncus arteriosus and abnormalities of the great vessels. The craniofacial deficits were even more pronounced, with large portions of the face and cranium affected, including the mandible and frontal and nasal bones. The data show that SHP2 activity in the NCC is essential for normal migration and differentiation into the diverse lineages found in the heart and skull and demonstrate the importance of NCC-based normal SHP2 activity in both heart and skull development, providing insight into the syndromic presentation characteristic of NS. PMID:19541608

  3. Modulation in the expression of SHP-1, SHP-2 and PTP1B due to the inhibition of MAPKs, cAMP and neutrophils early on in the development of cerulein-induced acute pancreatitis in rats.

    PubMed

    García-Hernández, Violeta; Sarmiento, Nancy; Sánchez-Bernal, Carmen; Matellán, Laura; Calvo, José J; Sánchez-Yagüe, Jesús

    2014-02-01

    The protein tyrosine phosphatases (PTPs) SHP-1, SHP-2 and PTP1B are overexpressed early on during the development of cerulein -induced acute pancreatitis (AP) in rats, and their levels can be modulated by some species of mitogen-activated protein kinases (MAPKs), the intracellular levels of cAMP and by general leukocyte infiltration, the latter at least for SHP-2 and PTP1B. In this study we show that cerulein treatment activates extracellular signal-regulated kinase (ERK) and c-Jun NH2-terminal kinase (JNK) but not p38 MAPK during the early phase of cerulein-induced AP (2h after the first injection of cerulein). Therefore, by using the MAPK inhibitors SP600125 (a specific JNK inhibitor) and PD98059 (a specific ERK inhibitor), we have unmasked the particular MAPK that underlies the modulation of the expression levels of these PTPs. JNK would act by preventing SHP-1 protein expression from increasing beyond a certain level. ERK 1/2 was the main MAPK involved in the increase in SHP-2 protein expression due to cerulein. JNK negatively modulated the SH2-domain containing PTPs. Both MAPKs played a role in the increase in PTP1B protein expression due to cerulein. Finally, by using the white blood cell inhibitors vinblastine sulfate, gadolinium chloride and FK506 (tacrolimus), we show that the macrophage activity or T-lymphocytes does not modulate the expression of any of the PTPs, although neutrophil infiltration was found to be a regulator of SHP-2 and PTP1B protein expression due to cerulein.

  4. Characterizing SHP2 as a Novel Therapeutic Target in Breast Cancer

    DTIC Science & Technology

    2013-02-01

    binding of inhibitors(4). To understand how these differences may translate into conformational alteration of the active site, the crystal structures...intermolecular interactions that might be critical for binding to both enzymes. Since no crystal structure of SHP2 bound to this phosphopeptide is available, we...stripped from the crystal ) using the genetic algorithm. At least 2000 runs were performed, and the most favorable conformation was selected (Figure 2

  5. Interferon-γ-dependent tyrosine phosphorylation of MEKK4 via Pyk2 is regulated by annexin II and SHP2 in keratinocytes

    PubMed Central

    Halfter, Ursula M.; Derbyshire, Zachary E.; Vaillancourt, Richard R.

    2004-01-01

    IFNγ (interferon-γ) binding to its cognate receptor results, through JAK (Janus kinase), in direct activation of receptor-bound STAT1 (signal transducer and activator of transcription 1), although there is evidence for additional activation of a MAPK (mitogen-activated protein kinase) pathway. In the present paper, we report IFNγ-dependent activation of the MEKK4 (MAPK/extracellular-signal-regulated kinase kinase kinase 4) pathway in HaCaT human keratinocytes. MEKK4 is tyrosine­-phosphorylated and the IFNγ-dependent phosphorylation requires intracellular calcium. Calcium-dependent phosphorylation of MEKK4 is mediated by Pyk2. Moreover, MEKK4 and Pyk2 co-localize in an IFNγ-dependent manner in the perinuclear region. Furthermore, the calcium-binding protein, annexin II, and the calcium-regulated kinase, Pyk2, co-immunoprecipitate with MEKK4 after treatment with IFNγ. Immunofluorescence imaging of HaCaT cells shows an IFNγ-dependent co-localization of annexin II with Pyk2 in the perinuclear region, suggesting that annexin II mediates the calcium-dependent regulation of Pyk2. Tyrosine phosphorylation of MEKK4 correlates with its activity to phosphorylate MKK6 (MAPK kinase 6) in vitro and subsequent p38 MAPK activation in an IFNγ-dependent manner. Additional studies demonstrate that the SH2 (Src homology 2)-domain-containing tyrosine phosphatase SHP2 co-immunoprecipitates with MEKK4 in an IFNγ-dependent manner and co-localizes with MEKK4 after IFNγ stimulation in the perinuclear region in HaCaT cells. Furthermore, we provide evidence that SHP2 dephosphorylates MEKK4 and Pyk2, terminating the MEKK4-dependent branch of the IFNγ signalling pathway. PMID:15601262

  6. The Zds proteins control entry into mitosis and target protein phosphatase 2A to the Cdc25 phosphatase

    PubMed Central

    Wicky, Sidonie; Tjandra, Hendri; Schieltz, David; Yates, John; Kellogg, Douglas R.

    2011-01-01

    The Wee1 kinase restrains entry into mitosis by phosphorylating and inhibiting cyclin-dependent kinase 1 (Cdk1). The Cdc25 phosphatase promotes entry into mitosis by removing Cdk1 inhibitory phosphorylation. Experiments in diverse systems have established that Wee1 and Cdc25 are regulated by protein phosphatase 2A (PP2A), but a full understanding of the function and regulation of PP2A in entry into mitosis has remained elusive. In budding yeast, entry into mitosis is controlled by a specific form of PP2A that is associated with the Cdc55 regulatory subunit (PP2ACdc55). We show here that related proteins called Zds1 and Zds2 form a tight stoichiometric complex with PP2ACdc55 and target its activity to Cdc25 but not to Wee1. Conditional inactivation of the Zds proteins revealed that their function is required primarily at entry into mitosis. In addition, Zds1 undergoes cell cycle–dependent changes in phosphorylation. Together, these observations define a role for the Zds proteins in controlling specific functions of PP2ACdc55 and suggest that upstream signals that regulate PP2ACdc55 may play an important role in controlling entry into mitosis. PMID:21119008

  7. Comparative Analysis of Protein Tyrosine Phosphatases Regulating Microglial Activation

    PubMed Central

    Song, Gyun Jee; Kim, Jaehong; Kim, Jong-Heon; Song, Seungeun; Park, Hana; Zhang, Zhong-Yin

    2016-01-01

    Protein tyrosine phosphatases (PTPs) are key regulatory factors in inflammatory signaling pathways. Although PTPs have been extensively studied, little is known about their role in neuroinflammation. In the present study, we examined the expression of 6 different PTPs (PTP1B, TC-PTP, SHP2, MEG2, LYP, and RPTPβ) and their role in glial activation and neuroinflammation. All PTPs were expressed in brain and glia. The expression of PTP1B, SHP2, and LYP was enhanced in the inflamed brain. The expression of PTP1B, TC-PTP, and LYP was increased after treating microglia cells with lipopolysaccharide (LPS). To examine the role of PTPs in microglial activation and neuroinflammation, we used specific pharmacological inhibitors of PTPs. Inhibition of PTP1B, TC-PTP, SHP2, LYP, and RPTPβ suppressed nitric oxide production in LPS-treated microglial cells in a dose-dependent manner. Furthermore, intracerebroventricular injection of PTP1B, TC-PTP, SHP2, and RPTPβ inhibitors downregulated microglial activation in an LPS-induced neuroinflammation model. Our results indicate that multiple PTPs are involved in regulating microglial activation and neuroinflammation, with different expression patterns and specific functions. Thus, PTP inhibitors can be exploited for therapeutic modulation of microglial activation in neuroinflammatory diseases. PMID:27790059

  8. Genetic interaction between AINTEGUMENTA (ANT) and the ovule identity genes SEEDSTICK (STK), SHATTERPROOF1 (SHP1) and SHATTERPROOF2 (SHP2).

    PubMed

    Losa, Alessia; Colombo, Monica; Brambilla, Vittoria; Colombo, Lucia

    2010-06-01

    AINTEGUMENTA (ANT) promotes initiation and growth of ovule integuments which cell fate is specified by ovule identity factors, such as SEEDSTICK (STK), SHATTERPROOF1 (SHP1) and SHATTERPROOF2 (SHP2). To study the genetic interaction between ANT and the ovule identity genes, we have obtained a stk shp1 shp2 ant quadruple mutant. The molecular and morphological characterization of the quadruple mutant and its comparison with the stk shp1 shp2 triple mutant, the shp1 shp2 ant triple mutant and the stk ant double mutant are here presented.

  9. Negative control in two-component signal transduction by transmitter phosphatase activity.

    PubMed

    Huynh, TuAnh Ngoc; Stewart, Valley

    2011-10-01

    Bifunctional sensor transmitter modules of two-component systems exert both positive and negative control on the receiver domain of the cognate response regulator. In negative control, the transmitter module accelerates the rate of phospho-receiver dephosphorylation. This transmitter phosphatase reaction serves the important physiological functions of resetting response regulator phosphorylation level and suppressing cross-talk. Although the biochemical reactions underlying positive control are reasonably well understood, the mechanism for transmitter phosphatase activity has been unknown. A recent hypothesis is that the transmitter phosphatase reaction is catalysed by a conserved Gln, Asn or Thr residue, via a hydrogen bond between the amide or hydroxyl group and the nucleophilic water molecule in acyl-phosphate hydrolysis. This hypothetical mechanism closely resembles the established mechanisms of auxiliary phosphatases such as CheZ and CheX, and may be widely conserved in two-component signal transduction. In addition to the proposed catalytic residues, transmitter phosphatase activity also requires the correct transmitter conformation and appropriate interactions with the receiver. Evidence suggests that the phosphatase-competent and autokinase-competent states are mutually exclusive, and the corresponding negative and positive activities are likely to be reciprocally regulated through dynamic control of transmitter conformations. © 2011 Blackwell Publishing Ltd.

  10. Negative control in two-component signal transduction by transmitter phosphatase activity

    PubMed Central

    Huynh, TuAnh Ngoc; Stewart, Valley

    2011-01-01

    Bifunctional sensor transmitter modules of two-component systems exert both positive and negative control on the receiver domain of the cognate response regulator. In negative control, the transmitter module accelerates the rate of phospho-receiver dephosphorylation. This transmitter phosphatase reaction serves the important physiological functions of resetting response regulator phosphorylation level and suppressing cross talk. Although the biochemical reactions underlying positive control are reasonably well-understood, the mechanism for transmitter phosphatase activity has been unknown. A recent hypothesis is that the transmitter phosphatase reaction is catalyzed by a conserved Gln, Asn or Thr residue, via a hydrogen bond between the amide or hydroxyl group and the nucleophilic water molecule in acyl-phosphate hydrolysis. This hypothetical mechanism closely resembles the established mechanisms of auxiliary phosphatases such as CheZ and CheX, and may be widely conserved in two-component signal transduction. In addition to the proposed catalytic residues, transmitter phosphatase activity also requires the correct transmitter conformation and appropriate interactions with the receiver. Evidence suggests that the phosphatase-competent and autokinase-competent states are mutually exclusive, and the corresponding negative and positive activities are likely to be reciprocally regulated through dynamic control of transmitter conformations. PMID:21895797

  11. Characterizing SHP2 as a Novel Therapeutic Target in Breast Cancer

    DTIC Science & Technology

    2014-04-01

    hydrogen bond with Y279 of SHP2 (-2.903 kcal/mol). The total intermolecular interaction energy was found to be -14.3 kcal/mol with -8.50 kcal/mol...originating from Van der Waals interactions and hydrogen bonds and -5.80 kcal/mol provided by electrostatic interactions. Overall, the predicted Ki... bond with the -2 position aspartate of the peptide (-4.518 kcal/mol) Another electrostatic interaction was found between histidine 420 and the -1

  12. Protein phosphatase-1 modulates the function of Pax-6, a transcription factor controlling brain and eye development.

    PubMed

    Yan, Qin; Liu, Wen-Bin; Qin, Jichao; Liu, Jinping; Chen, He-Ge; Huang, Xiaoqin; Chen, Lili; Sun, Shuming; Deng, Mi; Gong, Lili; Li, Yong; Zhang, Lan; Liu, Yan; Feng, Hao; Xiao, Yamei; Liu, Yun; Li, David W-C

    2007-05-11

    Pax-6 is an evolutionarily conserved transcription factor and acts high up in the regulatory hierarchy controlling eye and brain development in humans, mice, zebrafish, and Drosophila. Previous studies have shown that Pax-6 is a phosphoprotein, and its phosphorylation by ERK, p38, and homeodomain-interacting protein kinase 2 greatly enhances its transactivation activity. However, the protein phosphatases responsible for the dephosphorylation of Pax-6 remain unknown. Here, we present both in vitro and in vivo evidence to show that protein serine/threonine phosphatase-1 is a major phosphatase that directly dephosphorylates Pax-6. First, purified protein phosphatase-1 directly dephosphorylates Pax-6 in vitro. Second, immunoprecipitation-linked Western blot revealed that both protein phosphatase-1alpha and protein phosphatase-1beta interact with Pax-6. Third, overexpression of protein phosphatase-1 in human lens epithelial cells leads to dephosphorylation of Pax-6. Finally, inhibition of protein phosphatase-1 activity by calyculin A or knockdown of protein phosphatase-1alpha and protein phosphatase-1beta by RNA interference leads to enhanced phosphorylation of Pax-6. Moreover, our results also demonstrate that dephosphorylation of Pax-6 by protein phosphatase-1 significantly modulates its function in regulating expression of both exogenous and endogenous genes. These results demonstrate that protein phosphatase 1 acts as a major phosphatase to dephosphorylate Pax-6 and modulate its function.

  13. Spatial control of protein phosphatase 2A (de)methylation

    SciTech Connect

    Longin, Sari; Zwaenepoel, Karen; Martens, Ellen; Louis, Justin V.; Rondelez, Evelien; Goris, Jozef; Janssens, Veerle

    2008-01-01

    Reversible methylation of the protein phosphatase 2A catalytic subunit (PP2A{sub C}) is an important regulatory mechanism playing a crucial role in the selective recruitment of regulatory B subunits. Here, we investigated the subcellular localization of leucine carboxyl methyltransferase (LCMT1) and protein phosphatase methylesterase (PME-1), the two enzymes catalyzing this process. The results show that PME-1 is predominantly localized in the nucleus and harbors a functional nuclear localization signal, whereas LCMT1 is underrepresented in the nucleus and mainly localizes to the cytoplasm, Golgi region and late endosomes. Indirect immunofluorescence with methylation-sensitive anti-PP2A{sub C} antibodies revealed a good correlation with the methylation status of PP2A{sub C}, demethylated PP2A{sub C} being substantially nuclear. Throughout mitosis, demethylated PP2A{sub C} is associated with the mitotic spindle and during cytokinesis with the cleavage furrow. Overexpression of PME-1, but not of an inactive mutant, results in increased demethylation of PP2A{sub C} in the nucleus, whereas overexpression of a cytoplasmic PME-1 mutant lacking the NLS results in increased demethylation in the cytoplasm-in all cases, however, without any obvious functional consequences. PME-1 associates with an inactive PP2A population, regardless of its esterase activity or localization. We propose that stabilization of this inactive, nuclear PP2A pool is a major in vivo function of PME-1.

  14. Missense substitutions reflecting regulatory control of transmitter phosphatase activity in two-component signalling.

    PubMed

    Huynh, TuAnh Ngoc; Noriega, Chris E; Stewart, Valley

    2013-05-01

    Negative control in two-component signal transduction results from sensor transmitter phosphatase activity for phospho-receiver dephosphorylation. A hypothetical mechanism for this reaction involves a catalytic residue in the H-box active-site region. However, a complete understanding of transmitter phosphatase regulation is hampered by the abundance of kinase-competent, phosphatase-defective missense substitutions (K(+) P(-) phenotype) outside of the active-site region. For the Escherichia coli NarX sensor, a model for the HisKA_3 sequence family, DHp domain K(+) P(-) mutants defined two classes. Interaction mutants mapped to the active site-distal base of the DHp helix 1, whereas conformation mutants were affected in the X-box region of helix 2. Thus, different types of perturbations can influence transmitter phosphatase activity indirectly. By comparison, K(+) P(-) substitutions in the HisKA sensors EnvZ and NtrB additionally map to a third region, at the active site-proximal top of the DHp helix 1, independently identified as important for DHp-CA domain interaction in this sensor class. Moreover, the NarX transmitter phosphatase activity was independent of nucleotides, in contrast to the activity for many HisKA family sensors. Therefore, distinctions involving both the DHp and the CA domains suggest functional diversity in the regulation of HisKA and HisKA_3 transmitter phosphatase activities.

  15. SHP-1 and SHP-2 associate with immunoreceptor tyrosine-based switch motif of programmed death 1 upon primary human T cell stimulation, but only receptor ligation prevents T cell activation.

    PubMed

    Chemnitz, Jens M; Parry, Richard V; Nichols, Kim E; June, Carl H; Riley, James L

    2004-07-15

    To study the cis- and trans-acting factors that mediate programmed death 1 (PD-1) signaling in primary human CD4 T cells, we constructed a chimeric molecule consisting of the murine CD28 extracellular domain and human PD-1 cytoplasmic tail. When introduced into CD4 T cells, this construct mimics the activity of endogenous PD-1 in terms of its ability to suppress T cell expansion and cytokine production. The cytoplasmic tail of PD-1 contains two structural motifs, an ITIM and an immunoreceptor tyrosine-based switch motif (ITSM). Mutation of the ITIM had little effect on PD-1 signaling or functional activity. In contrast, mutation of the ITSM abrogated the ability of PD-1 to block cytokine synthesis and to limit T cell expansion. Further biochemical analyses revealed that the ability of PD-1 to block T cell activation correlated with recruitment of Src homology region 2 domain-containing phosphatase-1 (SHP-1) and SHP-2, and not the adaptor Src homology 2 domain-containing molecule 1A, to the ITSM domain. In TCR-stimulated T cells, SHP-2 associated with PD-1, even in the absence of PD-1 engagement. Despite this interaction, the ability of PD-1 to block T cell activation required receptor ligation, suggesting that colocalization of PD-1 with CD3 and/or CD28 may be necessary for inhibition of T cell activation.

  16. Reduced expression of CD45 Protein-Tyrosine Phosphatase Pr

    DTIC Science & Technology

    2009-05-08

    complex ( MHC ) I (28-14-8), MHC II (M5/114.15.2), CD44 (IM7), and Ly6G (1A8). Cells (1 106) were resuspended in Fc block (anti CD16/CD32 antibody diluted...enzyme (supplemental Fig. 3). Themajority of the phosphatases tested in this panel belong to the class of protein-tyrosine phosphatases (SHP-1, SHP- 2 ...and Sina Bavari‡ 2 From the ‡United States Army Medical Research Institute of Infectious Diseases, Frederick, Maryland 21702-5011, §Target Structure

  17. Control of placental alkaline phosphatase gene expression in HeLa cells: induction of synthesis by prednisolone and sodium butyrate

    SciTech Connect

    Chou, J.Y.; Takahashi, S.

    1987-06-16

    HeLa S/sub 3/ cells produce an alkaline phosphatase indistinguishable from the enzyme from human term placenta. The phosphatase activity in these cells was induced by both prednisolone and sodium butyrate. Both agents stimulated de novo synthesis of the enzyme. The increase in phosphatase activity paralleled the increase in immunoactivity and biosynthesis of placental alkaline phosphatase. The fully processed phosphatase monomer in control, prednisolone-treated or butyrate-treated cells was a 64.5 K polypeptide, measured by both incorporation of L-(/sup 35/S)methionine into enzyme protein and active-site labeling. The 64.5K polypeptide was formed by the incorporation of additional N-acetylneuraminic acid moieties to a precursor polypeptide of 61.5K. However, this biosynthetic pathway was identified only in butyrate-treated cells. In prednisolone-treated cells, the processing of 61.5K to 64.5K monomer was accelerated, and the presence of the 61.5 precursor could only be detected by either neuraminidase or monensin treatment. Phosphatase mRNA which comigrated with the term placental alkaline phosphatase mRNA of 2.7 kilobases was induced in the presence of either prednisolone or butyrate. Alkaline phosphatase mRNA is untreated HeLa S/sub 3/ cells migrated slightly faster than the term placental alkaline phosphatase mRNA. Butyrate also induced a second still faster migrating alkaline phosphatase mRNA. Both prednisolone and butyrate increased the steady-state levels of placental alkaline phosphatase mRNA. The data indicate that the increase in phosphatase mRNA by prednisolone and butyrate resulted in the induction of alkaline phosphatase activity and biosynthesis in HeLa S/sub 3/ cells. Furthermore, both agents induced the expression of different alkaline phosphatase gene transcripts without altering its protein product.

  18. Enteropathogenic Escherichia coli Tir recruits cellular SHP-2 through ITIM motifs to suppress host immune response.

    PubMed

    Yan, Dapeng; Quan, Heming; Wang, Lin; Liu, Feng; Liu, Haipeng; Chen, Jianxia; Cao, Xuetao; Ge, Baoxue

    2013-09-01

    Immune responses to pathogens are regulated by immune receptors containing either an immunoreceptor tyrosine-based activation motif (ITAM) or an immunoreceptor tyrosine-based inhibitory motif (ITIM). The important diarrheal pathogen enteropathogenic Escherichia coli (EPEC) require delivery and insertion of the bacterial translocated intimin receptor (Tir) into the host plasma membrane for pedestal formation. The C-terminal region of Tir, encompassing Y483 and Y511, shares sequence similarity with cellular ITIMs. Here, we show that EPEC Tir suppresses the production of inflammatory cytokines by recruitment of SHP-2 and subsequent deubiquitination of TRAF6 in an ITIM dependent manner. Our findings revealed a novel mechanism by which the EPEC utilize its ITIM motifs to suppress and evade the host innate immune response, which could lead to the development of novel therapeutics to prevent bacterial infection.

  19. The inositol polyphosphate 5-phosphatases: traffic controllers, waistline watchers and tumour suppressors?

    PubMed

    Astle, Megan V; Horan, Kristy A; Ooms, Lisa M; Mitchell, Christina A

    2007-01-01

    Phosphoinositide signals regulate cell proliferation, differentiation, cytoskeletal rearrangement and intracellular trafficking. Hydrolysis of PtdIns(4,5)P2 and PtdIns(3,4,5)P3, by inositol polyphosphate 5-phosphatases regulates synaptic vesicle recycling (synaptojanin-1), hematopoietic cell function [SHIP1(SH2-containing inositol polyphosphate 5-phosphatase-1)], renal cell function [OCRL (oculocerebrorenal syndrome of Lowe)] and insulin signalling (SHIP2). We present here a detailed review of the characteristics of the ten mammalian 5-phosphatases. Knockout mouse phenotypes and underexpression studies are associated with significant phenotypic changes, indicating non-redundant roles, despite, in many cases, overlapping substrate specificity and tissue expression. The extraordinary complexity in the control of phosphoinositide signalling continues to be revealed.

  20. Bcr-abl regulates Stat5 through Shp2, the interferon consensus sequence binding protein (Icsbp/Irf8), growth arrest specific 2 (Gas2) and calpain

    PubMed Central

    Hjort, Elizabeth E.; Huang, Weiqi; Hu, Liping; Eklund, Elizabeth A.

    2016-01-01

    Icsbp/Irf8 is an interferon regulatory transcription factor that functions as a suppressor of myeloid leukemias. Consistent with this activity, Icsbp represses a set of genes encoding proteins that promote cell proliferation/survival. One such gene encodes Gas2, a calpain inhibitor. We previously found that increased Gas2-expression in Bcr-abl+ cells stabilized βcatenin; a Calpain substrate. This was of interest, because βcatenin contributes to disease progression in chronic myeloid leukemia (CML). Calpain has additional substrates implicated in leukemogenesis, including Stat5. In the current study, we hypothesized that Stat5 activity in CML is regulated by Gas2/Calpain. We found that Bcr-abl-induced, Shp2-dependent dephosphorylation of Icsbp impaired repression of GAS2 by this transcription factor. The consequent decrease in Calpain activity stabilized Stat5 protein; increasing the absolute abundance of both phospho and total Stat5. This enhanced repression of the IRF8 promoter by Stat5 in a manner dependent on Icsbp, Gas2 and Calpain, but not Stat5 tyrosine phosphorylation. During normal myelopoiesis, increased expression and phosphorylation of Icsbp inhibits Calpain. In contrast, constitutive activation of Shp2 in Bcr-abl+ cells impairs regulation of Gas2/Calpain by Icsbp, aberrantly stabilizing Stat5 and enhancing IRF8 repression. This novel feedback mechanism enhances leukemogenesis by increasing Stat5 and decreasing Icsbp. Bcr-abl targeted tyrosine kinase inhibitors (TKIs) provide long term disease control, but CML is not cured by these agents. Our studies suggest targeting Calpain might be a rational therapeutic approach to decrease persistent leukemia stem cells (LSCs) during TKI-treatment. PMID:27769062

  1. Protein tyrosine phosphatase-1B contributes to LPS-induced leptin resistance in male rats.

    PubMed

    Borges, Beatriz de Carvalho; Rorato, Rodrigo C; Uchoa, Ernane Torres; Marangon, Paula B; Elias, Carol F; Antunes-Rodrigues, Jose; Elias, Lucila L K

    2015-01-01

    Leptin resistance is induced by the feedback inhibitors tyrosine phosphatase-1B (PTP1B) and decreased Src homology 2 domain-containing tyrosine phosphatase-2 (SHP-2) signaling. To investigate the participation of PTP1B and SHP-2 in LPS-induced leptin resistance, we injected repeated (6-LPS) intraperitoneal LPS doses (100 μg/kg ip) for comparison with a single (1-LPS) treatment and evaluated the expression of SHP-2, PTP1B, p-ERK1/2, and p-STAT3 in the hypothalamus of male Wistar rats. The single LPS treatment increased the expression of p-STAT3 and PTP1B but not SHP-2. The repeated LPS treatment reduced SHP-2, increased PTP1B, and did not change p-STAT3. We observed that the PTP1B expression induced by the endotoxin was highly colocalized with leptin receptor cells in the hypothalamus of LepRb-IRES-Cre-tdTomato reporter mice. The single, but not the repeated, LPS treatment decreased the food intake and body weight. Leptin had no stimulatory effect on the hypophagia, body weight loss, or pSTAT3 expression in 6-LPS rats, indicating leptin unresponsiveness. Notably, the PTP1B inhibitor (3.0 nmol/rat in 5 μl icv) restored the LPS-induced hypophagia in 6-LPS rats and restored the ability of leptin to reduce food intake and body weight as well as to phosphorylate STAT3 in the arcuate, paraventricular, and ventromedial nuclei of the hypothalamus. The present data suggest that an increased PTP1B expression in the hypothalamus underlies the development of leptin resistance during repeated exposure to LPS. Our findings contribute to understanding the mechanisms involved in leptin resistance during low-grade inflammation as seen in obesity.

  2. Phosphonate derivatives of tetraazamacrocycles as new inhibitors of protein tyrosine phosphatases.

    PubMed

    Kobzar, Oleksandr L; Shevchuk, Michael V; Lyashenko, Alesya N; Tanchuk, Vsevolod Yu; Romanenko, Vadim D; Kobelev, Sergei M; Averin, Alexei D; Beletskaya, Irina P; Vovk, Andriy I; Kukhar, Valery P

    2015-07-21

    α,α-Difluoro-β-ketophosphonated derivatives of tetraazamacrocycles were synthesized and found to be potential inhibitors of protein tyrosine phosphatases. N-Substituted conjugates of cyclam and cyclen with bioisosteric phosphonate groups displayed good activities toward T-cell protein tyrosine phosphatase with IC50 values in the micromolar to nanomolar range and showed selectivity over PTP1B, CD45, SHP2, and PTPβ. Kinetic studies indicated that the inhibitors can occupy the region of the active site of TC-PTP. This study demonstrates a new approach which employs tetraazamacrocycles as a molecular platform for designing inhibitors of protein tyrosine phosphatases.

  3. Expression of SHP2 and related markers in non-small cell lung cancer: a tissue microarray study of 80 cases.

    PubMed

    Tang, Chunlan; Luo, Dan; Yang, Heping; Wang, Qingliang; Zhang, Rong; Liu, Guoxiang; Zhou, Xiangdong

    2013-10-01

    The purpose of this study was to assess the relationships between the expression of SHP2 and VEGF, VEGFR-1, VEGFR-2, MMP-2, MMP-9, TIMP-1, TIMP-2, and microvessel density (MVD), as well as the clinicopathologic parameters of these markers in non-small cell lung cancer (NSCLC). Using a tissue microarray, the expression of these 8 markers in 80 NSCLC cases was detected by immunohistochemistry. The expression of the markers was higher in cancer tissues when compared with the surrounding tissues. The MVD was lower in the CD34-positive cancer tissues than in the surrounding tissues. Significantly higher positive rates of expression for SHP2, MMP-9, and MMP-2 were observed in patients with lymph node metastases. The later the clinical stage was, the higher the expression of MMP-9 and MMP-2. The expression of VEGF in patients with lung squamous cell carcinomas was significantly higher than in patients with lung adenocarcinomas. The positive expression of SHP2 correlated significantly with that of VEGFR-2 and the MVD and a survival disadvantage was noted in the patients with SHP2-positive tumors. Therefore, our data suggest that the expression of SHP2 in NSCLC has high specificity and sensitivity and is closely related to lymph node metastasis and the expression of VEGFR-2 and the MVD in patients with NSCLC. SHP2 expression may promote the invasion and metastasis of NSCLC through angiogenesis and the lymphatic system.

  4. Abnormal repression of SHP-1, SHP-2 and SOCS-1 transcription sustains the activation of the JAK/STAT3 pathway and the progression of the disease in multiple myeloma

    PubMed Central

    Skouri, Nour; Ben Ali, Cyrine; Safra, Ines; Abdelkefi, Abderrahman; Ladeb, Saloua; Mrad, Karima; Ben Othman, Tarek; Ben Ahmed, Mélika

    2017-01-01

    Sustained activation of JAK/STAT3 signaling pathway is classically described in Multiple Myeloma (MM). One explanation could be the silencing of the JAK/STAT suppressor genes, through the hypermethylation of SHP-1 and SOCS-1, previously demonstrated in MM cell lines or in whole bone marrow aspirates. The link between such suppressor gene silencing and the degree of bone marrow invasion or the treatment response has not been evaluated in depth. Using real-time RT-PCR, we studied the expression profile of three JAK/STAT suppressor genes: SHP-1, SHP-2 and SOCS-1 in plasma cells freshly isolated from the bone marrows of MM patients and healthy controls. Our data demonstrated an abnormal repression of such genes in malignant plasma cells and revealed a significant correlation between such defects and the sustained activation of the JAK/STAT3 pathway during MM. The repressed expression of SHP-1 and SHP-2 correlated significantly with a high initial degree of bone marrow infiltration but was, unexpectedly, associated with a better response to the induction therapy. Collectively, our data provide new evidences that substantiate the contribution of JAK/STAT suppressor genes in the pathogenesis of MM. They also highlight the possibility that the decreased gene expression of SHP-1 and SHP-2 could be of interest as a new predictive factor of a favorable treatment response, and suggest new potential mechanisms of action of the therapeutic molecules. Whether such defect helps the progression of the disease from monoclonal gammopathy of unknown significance to MM remains, however, to be determined. PMID:28369102

  5. Abnormal repression of SHP-1, SHP-2 and SOCS-1 transcription sustains the activation of the JAK/STAT3 pathway and the progression of the disease in multiple myeloma.

    PubMed

    Beldi-Ferchiou, Asma; Skouri, Nour; Ben Ali, Cyrine; Safra, Ines; Abdelkefi, Abderrahman; Ladeb, Saloua; Mrad, Karima; Ben Othman, Tarek; Ben Ahmed, Mélika

    2017-01-01

    Sustained activation of JAK/STAT3 signaling pathway is classically described in Multiple Myeloma (MM). One explanation could be the silencing of the JAK/STAT suppressor genes, through the hypermethylation of SHP-1 and SOCS-1, previously demonstrated in MM cell lines or in whole bone marrow aspirates. The link between such suppressor gene silencing and the degree of bone marrow invasion or the treatment response has not been evaluated in depth. Using real-time RT-PCR, we studied the expression profile of three JAK/STAT suppressor genes: SHP-1, SHP-2 and SOCS-1 in plasma cells freshly isolated from the bone marrows of MM patients and healthy controls. Our data demonstrated an abnormal repression of such genes in malignant plasma cells and revealed a significant correlation between such defects and the sustained activation of the JAK/STAT3 pathway during MM. The repressed expression of SHP-1 and SHP-2 correlated significantly with a high initial degree of bone marrow infiltration but was, unexpectedly, associated with a better response to the induction therapy. Collectively, our data provide new evidences that substantiate the contribution of JAK/STAT suppressor genes in the pathogenesis of MM. They also highlight the possibility that the decreased gene expression of SHP-1 and SHP-2 could be of interest as a new predictive factor of a favorable treatment response, and suggest new potential mechanisms of action of the therapeutic molecules. Whether such defect helps the progression of the disease from monoclonal gammopathy of unknown significance to MM remains, however, to be determined.

  6. A PTPN11 allele encoding a catalytically impaired SHP2 protein in a patient with a Noonan syndrome phenotype.

    PubMed

    Edwards, Jonathan J; Martinelli, Simone; Pannone, Luca; Lo, Ivan Fai-Man; Shi, Lisong; Edelmann, Lisa; Tartaglia, Marco; Luk, Ho-Ming; Gelb, Bruce D

    2014-09-01

    The RASopathies are a relatively common group of phenotypically similar and genetically related autosomal dominant genetic syndromes caused by missense mutations affecting genes participating in the RAS/mitogen-activated protein kinase (MAPK) pathway that include Noonan syndrome (NS) and Noonan syndrome with multiple lentigines (NSML, formerly LEOPARD syndrome). NS and NSML can be difficult to differentiate during infancy, but the presence of multiple lentigines, café au lait spots, and specific cardiac defects facilitate the diagnosis. Furthermore, individual PTPN11 missense mutations are highly specific to each syndrome and engender opposite biochemical alterations on the function of SHP-2, the protein product of that gene. Here, we report on a 5-year-old male with two de novo PTPN11 mutations in cis, c.1471C>T (p.Pro491Ser), and c.1492C>T (p.Arg498Trp), which are associated with NS and NSML, respectively. This boy's phenotype is intermediate between NS and NSML with facial dysmorphism, short stature, mild global developmental delay, pulmonic stenosis, and deafness but absence of café au lait spots or lentigines. The double-mutant SHP-2 was found to be catalytically impaired. This raises the question of whether clinical differences between NS and NSML can be ascribed solely to the relative SHP-2 catalytic activity.

  7. Sac phosphatase domain proteins.

    PubMed Central

    Hughes, W E; Cooke, F T; Parker, P J

    2000-01-01

    Advances in our understanding of the roles of phosphatidylinositol phosphates in controlling cellular functions such as endocytosis, exocytosis and the actin cytoskeleton have included new insights into the phosphatases that are responsible for the interconversion of these lipids. One of these is an entirely novel class of phosphatase domain found in a number of well characterized proteins. Proteins containing this Sac phosphatase domain include the yeast Saccharomyces cerevisiae proteins Sac1p and Fig4p. The Sac phosphatase domain is also found within the mammalian phosphoinositide 5-phosphatase synaptojanin and the yeast synaptojanin homologues Inp51p, Inp52p and Inp53p. These proteins therefore contain both Sac phosphatase and 5-phosphatase domains. This review describes the Sac phosphatase domain-containing proteins and their actions, with particular reference to the genetic and biochemical insights provided by study of the yeast Saccharomyces cerevisiae. PMID:10947947

  8. Homophilic adhesion and CEACAM1-S regulate dimerization of CEACAM1-L and recruitment of SHP-2 and c-Src

    PubMed Central

    Müller, Mario M.; Klaile, Esther; Vorontsova, Olga; Singer, Bernhard B.

    2009-01-01

    Carcinoembryonic antigen (CEA)–related cell adhesion molecule 1 (CAM1 [CEACAM1]) mediates homophilic cell adhesion and regulates signaling. Although there is evidence that CEACAM1 binds and activates SHP-1, SHP-2, and c-Src, knowledge about the mechanism of transmembrane signaling is lacking. To analyze the regulation of SHP-1/SHP-2/c-Src binding, we expressed various CFP/YFP-tagged CEACAM1 isoforms in epithelial cells. The supramolecular organization of CEACAM1 was examined by cross-linking, coclustering, coimmunoprecipitation, and fluorescence resonance energy transfer. SHP-1/SHP-2/c-Src binding was monitored by coimmunoprecipitation and phosphotyrosine-induced recruitment to CEACAM1-L in cellular monolayers. We find that trans-homophilic CEACAM1 binding induces cis-dimerization by an allosteric mechanism transmitted by the N-terminal immunoglobulin-like domain. The balance of SHP-2 and c-Src binding is dependent on the monomer/dimer equilibrium of CEACAM1-L and is regulated by trans-binding, whereas SHP-1 does not bind under physiological conditions. CEACAM1-L homodimer formation is reduced by coexpression of CEACAM1-S and modulated by antibody ligation. These data suggest that transmembrane signaling by CEACAM1 operates by alteration of the monomer/dimer equilibrium, which leads to changes in the SHP-2/c-Src–binding ratio. PMID:19948503

  9. Negative control of BAK1 by protein phosphatase 2A during plant innate immunity.

    PubMed

    Segonzac, Cécile; Macho, Alberto P; Sanmartín, Maite; Ntoukakis, Vardis; Sánchez-Serrano, José Juan; Zipfel, Cyril

    2014-09-17

    Recognition of pathogen-associated molecular patterns (PAMPs) by surface-localized pattern-recognition receptors (PRRs) activates plant innate immunity, mainly through activation of numerous protein kinases. Appropriate induction of immune responses must be tightly regulated, as many of the kinases involved have an intrinsic high activity and are also regulated by other external and endogenous stimuli. Previous evidences suggest that PAMP-triggered immunity (PTI) is under constant negative regulation by protein phosphatases but the underlying molecular mechanisms remain unknown. Here, we show that protein Ser/Thr phosphatase type 2A (PP2A) controls the activation of PRR complexes by modulating the phosphostatus of the co-receptor and positive regulator BAK1. A potential PP2A holoenzyme composed of the subunits A1, C4, and B'η/ζ inhibits immune responses triggered by several PAMPs and anti-bacterial immunity. PP2A constitutively associates with BAK1 in planta. Impairment in this PP2A-based regulation leads to increased steady-state BAK1 phosphorylation, which can poise enhanced immune responses. This work identifies PP2A as an important negative regulator of plant innate immunity that controls BAK1 activation in surface-localized immune receptor complexes.

  10. Negative control of BAK1 by protein phosphatase 2A during plant innate immunity

    PubMed Central

    Segonzac, Cécile; Macho, Alberto P; Sanmartín, Maite; Ntoukakis, Vardis; Sánchez-Serrano, José Juan; Zipfel, Cyril

    2014-01-01

    Recognition of pathogen-associated molecular patterns (PAMPs) by surface-localized pattern-recognition receptors (PRRs) activates plant innate immunity, mainly through activation of numerous protein kinases. Appropriate induction of immune responses must be tightly regulated, as many of the kinases involved have an intrinsic high activity and are also regulated by other external and endogenous stimuli. Previous evidences suggest that PAMP-triggered immunity (PTI) is under constant negative regulation by protein phosphatases but the underlying molecular mechanisms remain unknown. Here, we show that protein Ser/Thr phosphatase type 2A (PP2A) controls the activation of PRR complexes by modulating the phosphostatus of the co-receptor and positive regulator BAK1. A potential PP2A holoenzyme composed of the subunits A1, C4, and B’η/ζ inhibits immune responses triggered by several PAMPs and anti-bacterial immunity. PP2A constitutively associates with BAK1 in planta. Impairment in this PP2A-based regulation leads to increased steady-state BAK1 phosphorylation, which can poise enhanced immune responses. This work identifies PP2A as an important negative regulator of plant innate immunity that controls BAK1 activation in surface-localized immune receptor complexes. PMID:25085430

  11. SHP2, SOCS3 and PIAS3 Expression Patterns in Medulloblastomas: Relevance to STAT3 Activation and Resveratrol-Suppressed STAT3 Signaling.

    PubMed

    Li, Cong; Li, Hong; Zhang, Peng; Yu, Li-Jun; Huang, Tian-Miao; Song, Xue; Kong, Qing-You; Dong, Jian-Li; Li, Pei-Nan; Liu, Jia

    2016-12-27

    Activated STAT3 signaling is critical for human medulloblastoma cells. SHP2, SOCS3 and PIAS3 are known as the negative regulators of STAT3 signaling, while their relevance to frequent STAT3 activation in medulloblastomas remains unknown. Tissue microarrays were constructed with 17 tumor-surrounding noncancerous brain tissues and 61 cases of the classic medulloblastomas, 44 the large-cell medulloblastomas, and 15 nodular medulloblastomas, which were used for immunohistochemical profiling of STAT3, SHP2, SOCS3 and PIAS3 expression patterns and the frequencies of STAT3 nuclear translocation. Three human medulloblastoma cell lines (Daoy, UW228-2 and UW228-3) were cultured with and without 100 μM resveratrol supplementation. The influences of resveratrol in SHP2, SOCS3 and PIAS3 expression and SOCS3 knockdown in STAT3 activation were analyzed using multiple experimental approaches. SHP2, SOCS3 and PIAS3 levels are reduced in medulloblastomas in vivo and in vitro, of which PIAS3 downregulation is more reversely correlated with STAT3 activation. In resveratrol-suppressed medulloblastoma cells with STAT3 downregulation and decreased incidence of STAT3 nuclear translocation, PIAS3 is upregulated, the SHP2 level remains unchanged and SOCS3 is downregulated. SOCS3 proteins are accumulated in the distal ends of axon-like processes of resveratrol-differentiated medulloblastoma cells. Knockdown of SOCS3 expression by siRNA neither influences cell proliferation nor STAT3 activation or resveratrol sensitivity but inhibits resveratrol-induced axon-like process formation. Our results suggest that (1) the overall reduction of SHP2, SOCS3 and PIAS3 in medulloblastoma tissues and cell lines; (2) the more inverse relevance of PIAS3 expression with STAT3 activation; (3) the favorable prognostic values of PIAS3 for medulloblastomas and (4) the involvement of SOCS3 in resveratrol-promoted axon regeneration of medulloblastoma cells.

  12. SHP2, SOCS3 and PIAS3 Expression Patterns in Medulloblastomas: Relevance to STAT3 Activation and Resveratrol-Suppressed STAT3 Signaling

    PubMed Central

    Li, Cong; Li, Hong; Zhang, Peng; Yu, Li-Jun; Huang, Tian-Miao; Song, Xue; Kong, Qing-You; Dong, Jian-Li; Li, Pei-Nan; Liu, Jia

    2016-01-01

    Background: Activated STAT3 signaling is critical for human medulloblastoma cells. SHP2, SOCS3 and PIAS3 are known as the negative regulators of STAT3 signaling, while their relevance to frequent STAT3 activation in medulloblastomas remains unknown. Methods: Tissue microarrays were constructed with 17 tumor-surrounding noncancerous brain tissues and 61 cases of the classic medulloblastomas, 44 the large-cell medulloblastomas, and 15 nodular medulloblastomas, which were used for immunohistochemical profiling of STAT3, SHP2, SOCS3 and PIAS3 expression patterns and the frequencies of STAT3 nuclear translocation. Three human medulloblastoma cell lines (Daoy, UW228-2 and UW228-3) were cultured with and without 100 μM resveratrol supplementation. The influences of resveratrol in SHP2, SOCS3 and PIAS3 expression and SOCS3 knockdown in STAT3 activation were analyzed using multiple experimental approaches. Results: SHP2, SOCS3 and PIAS3 levels are reduced in medulloblastomas in vivo and in vitro, of which PIAS3 downregulation is more reversely correlated with STAT3 activation. In resveratrol-suppressed medulloblastoma cells with STAT3 downregulation and decreased incidence of STAT3 nuclear translocation, PIAS3 is upregulated, the SHP2 level remains unchanged and SOCS3 is downregulated. SOCS3 proteins are accumulated in the distal ends of axon-like processes of resveratrol-differentiated medulloblastoma cells. Knockdown of SOCS3 expression by siRNA neither influences cell proliferation nor STAT3 activation or resveratrol sensitivity but inhibits resveratrol-induced axon-like process formation. Conclusion: Our results suggest that (1) the overall reduction of SHP2, SOCS3 and PIAS3 in medulloblastoma tissues and cell lines; (2) the more inverse relevance of PIAS3 expression with STAT3 activation; (3) the favorable prognostic values of PIAS3 for medulloblastomas and (4) the involvement of SOCS3 in resveratrol-promoted axon regeneration of medulloblastoma cells. PMID:28035977

  13. Potent inhibition of protein tyrosine phosphatases by copper complexes with multi-benzimidazole derivatives.

    PubMed

    Li, Ying; Lu, Liping; Zhu, Miaoli; Wang, Qingming; Yuan, Caixia; Xing, Shu; Fu, Xueqi; Mei, Yuhua

    2011-12-01

    A series of copper complexes with multi-benzimidazole derivatives, including mono- and di-nuclear, were synthesized and characterized by Fourier transform IR spectroscopy, UV-Vis spectroscopy, elemental analysis, electrospray ionization mass spectrometry. The speciation of Cu/NTB in aqueous solution was investigated by potentiometric pH titrations. Their inhibitory effects against human protein tyrosine phosphatase 1B (PTP1B), T-cell protein tyrosine phosphatase (TCPTP), megakaryocyte protein tyrosine phosphatase 2 (PTP-MEG2), srchomology phosphatase 1 (SHP-1) and srchomology phosphatase 2 (SHP-2) were evaluated in vitro. The five copper complexes exhibit potent inhibition against PTP1B, TCPTP and PTP-MEG2 with almost same inhibitory effects with IC(50) at submicro molar level and about tenfold weaker inhibition versus SHP-1, but almost no inhibition against SHP-2. Kinetic analysis indicates that they are reversible competitive inhibitors of PTP1B. Fluorescence study on the interaction between PTP1B and complex 2 or 4 suggests that the complexes bind to PTP1B with the formation of a 1:1 complex. The binding constant are about 1.14 × 10(6) and 1.87 × 10(6) M(-1) at 310 K for 2 and 4, respectively.

  14. Physiological control of repressible acid phosphatase gene transcripts in Saccharomyces cerevisiae.

    PubMed

    Bostian, K A; Lemire, J M; Halvorson, H O

    1983-05-01

    We have examined the regulation of repressible acid phosphatase (APase; orthophosphoric-monoester phosphohydrolase [acid optimum], EC 3.1.3.2) in Saccharomyces cerevisiae at the physiological and molecular levels, through a series of repression and derepression experiments. We demonstrated that APase synthesis is tightly regulated throughout the growth phase and is influenced by exogenous and endogenous Pi pools. During growth in a nonlimiting Pi medium, APase is repressed. When external Pi becomes limiting, there is a biphasic appearance of APase mRNA and enzyme. Our data on APase mRNA half-lives and on the flux of intracellular Pi and polyphosphate during derepression are consistent with a mechanism of transcriptional autoregulation for the biphasic appearance of APase mRNA. Accordingly, preculture concentrations of Pi control the level of corepressor generated from intracellular polyphosphate degradation. When cells are fully derepressed, APase mRNA levels are constant, and the maximal linear accumulation rate of APase is observed. A scheme to integrate phosphorus metabolism and phosphatase regulation in S. cerevisiae is proposed.

  15. Insulin controls subcellular localization and multisite phosphorylation of the phosphatidic acid phosphatase, lipin 1.

    PubMed

    Harris, Thurl E; Huffman, Todd A; Chi, An; Shabanowitz, Jeffrey; Hunt, Donald F; Kumar, Anil; Lawrence, John C

    2007-01-05

    Brain, liver, kidney, heart, and skeletal muscle from fatty liver dystrophy (fld/fld) mice, which do not express lipin 1 (lipin), contained much less Mg(2+)-dependent phosphatidic acid phosphatase (PAP) activity than tissues from wild type mice. Lipin harboring the fld(2j) (Gly(84) --> Arg) mutation exhibited relatively little PAP activity. These results indicate that lipin is a major PAP in vivo and that the loss of PAP activity contributes to the fld phenotype. PAP activity was readily detected in immune complexes of lipin from 3T3-L1 adipocytes, where the protein was found both as a microsomal form and a soluble, more highly phosphorylated, form. Fifteen phosphorylation sites were identified by mass spectrometric analyses. Insulin increased the phosphorylation of multiple sites and promoted a gel shift that was due in part to phosphorylation of Ser(106). In contrast, epinephrine and oleic acid promoted dephosphorylation of lipin. The PAP-specific activity of lipin was not affected by the hormones or by dephosphorylation of lipin with protein phosphatase 1. However, the ratio of soluble to microsomal lipin was markedly increased in response to insulin and decreased in response to epinephrine and oleic acid. The results suggest that insulin and epinephrine control lipin primarily by changing localization rather than intrinsic PAP activity.

  16. Physiological control of repressible acid phosphatase gene transcripts in Saccharomyces cerevisiae.

    PubMed Central

    Bostian, K A; Lemire, J M; Halvorson, H O

    1983-01-01

    We have examined the regulation of repressible acid phosphatase (APase; orthophosphoric-monoester phosphohydrolase [acid optimum], EC 3.1.3.2) in Saccharomyces cerevisiae at the physiological and molecular levels, through a series of repression and derepression experiments. We demonstrated that APase synthesis is tightly regulated throughout the growth phase and is influenced by exogenous and endogenous Pi pools. During growth in a nonlimiting Pi medium, APase is repressed. When external Pi becomes limiting, there is a biphasic appearance of APase mRNA and enzyme. Our data on APase mRNA half-lives and on the flux of intracellular Pi and polyphosphate during derepression are consistent with a mechanism of transcriptional autoregulation for the biphasic appearance of APase mRNA. Accordingly, preculture concentrations of Pi control the level of corepressor generated from intracellular polyphosphate degradation. When cells are fully derepressed, APase mRNA levels are constant, and the maximal linear accumulation rate of APase is observed. A scheme to integrate phosphorus metabolism and phosphatase regulation in S. cerevisiae is proposed. Images PMID:6346058

  17. Protein phosphatase PHLPP1 controls the light-induced resetting of the circadian clock

    PubMed Central

    Masubuchi, Satoru; Gao, Tianyan; O'Neill, Audrey; Eckel-Mahan, Kristin; Newton, Alexandra C.; Sassone-Corsi, Paolo

    2010-01-01

    The pleckstrin homology domain leucine-rich repeat protein phosphatase 1 (PHLPP1) differentially attenuates Akt, PKC, and ERK1/2 signaling, thereby controlling the duration and amplitude of responses evoked by these kinases. PHLPP1 is expressed in the mammalian central clock, the suprachiasmatic nucleus, where it oscillates in a circadian fashion. To explore the role of PHLPP1 in vivo, we have generated mice with a targeted deletion of the PHLPP1 gene. Here we show that PHLPP1-null mice, although displaying normal circadian rhythmicity, have a drastically impaired capacity to stabilize the circadian period after light-induced resetting, producing a large phase shift after light resetting. Our findings reveal that PHLPP1 exerts a previously unappreciated role in circadian control, governing the consolidation of circadian periodicity after resetting. PMID:20080691

  18. Biophysical assay for tethered signaling reactions reveals tether-controlled activity for the phosphatase SHP-1

    PubMed Central

    Goyette, Jesse; Salas, Citlali Solis; Coker-Gordon, Nicola; Bridge, Marcus; Isaacson, Samuel A.; Allard, Jun; Dushek, Omer

    2017-01-01

    Tethered enzymatic reactions are ubiquitous in signaling networks but are poorly understood. A previously unreported mathematical analysis is established for tethered signaling reactions in surface plasmon resonance (SPR). Applying the method to the phosphatase SHP-1 interacting with a phosphorylated tether corresponding to an immune receptor cytoplasmic tail provides five biophysical/biochemical constants from a single SPR experiment: two binding rates, two catalytic rates, and a reach parameter. Tether binding increases the activity of SHP-1 by 900-fold through a binding-induced allosteric activation (20-fold) and a more significant increase in local substrate concentration (45-fold). The reach parameter indicates that this local substrate concentration is exquisitely sensitive to receptor clustering. We further show that truncation of the tether leads not only to a lower reach but also to lower binding and catalysis. This work establishes a new framework for studying tethered signaling processes and highlights the tether as a control parameter in clustered receptor signaling. PMID:28378014

  19. Biophysical assay for tethered signaling reactions reveals tether-controlled activity for the phosphatase SHP-1.

    PubMed

    Goyette, Jesse; Salas, Citlali Solis; Coker-Gordon, Nicola; Bridge, Marcus; Isaacson, Samuel A; Allard, Jun; Dushek, Omer

    2017-03-01

    Tethered enzymatic reactions are ubiquitous in signaling networks but are poorly understood. A previously unreported mathematical analysis is established for tethered signaling reactions in surface plasmon resonance (SPR). Applying the method to the phosphatase SHP-1 interacting with a phosphorylated tether corresponding to an immune receptor cytoplasmic tail provides five biophysical/biochemical constants from a single SPR experiment: two binding rates, two catalytic rates, and a reach parameter. Tether binding increases the activity of SHP-1 by 900-fold through a binding-induced allosteric activation (20-fold) and a more significant increase in local substrate concentration (45-fold). The reach parameter indicates that this local substrate concentration is exquisitely sensitive to receptor clustering. We further show that truncation of the tether leads not only to a lower reach but also to lower binding and catalysis. This work establishes a new framework for studying tethered signaling processes and highlights the tether as a control parameter in clustered receptor signaling.

  20. [Expression of secreted alkaline phosphatase in hepatocytes controlled by HCV IRES].

    PubMed

    Liu, Shui-ping; Tan, De-ming; Hou, Zhou-hua

    2003-08-01

    To establish a cell model of secreted alkaline phosphatase (SEAP) controlled by HCV internal ribosome entry site (IRES). The fragment of HCV 5' noncoding region (5' NCR) was amplified by polymerase chain reaction (PCR), and was immediately cloned the upstream of the SEAP gene of pSEAP2-Control, an SEAP eukaryotic expression plasmid. With the liposome transfection technique, the resulting recombinant plasmid pdNCRSEAP was transfected into hepatocytes QSG7710, and the SEAP activity of cell culture media was monitored quantitatively by the chemiluminescent method. The regulatory effect of the HCV 5' NCR on the SEAP expression was measured by the treatment of transfected cells with antisense oligodeoxynucleotide (ASODN) at 5 mumol and 10 mumol, respectively. The light emission intensity of pdNCRSEAP expression was 76% that of pSEAP2-Control. The inhibition rates of pNCRSEAP luminescence intensity affected by ASODN of 5 mumol and 10 mumol were 29.2% and 44.6%, respectively, while ASODN had no significant effect on the pSEAP2-Control expression. The SEAP expression of pdNCRSEAP is controlled by HCV 5'NCR. The cell model of drug evaluation targeted at HCV 5'NCR is successfully established and can be analyzed conveniently.

  1. Tyrosine Phosphatase TpbA of Pseudomonas aeruginosa Controls Extracellular DNA via Cyclic Diguanylic Acid Concentrations

    PubMed Central

    Ueda, Akihiro; Wood, Thomas K.

    2010-01-01

    SUMMARY Inactivating the tyrosine phosphatase TpbA of Pseudomonas aeruginosa PA14 induces biofilm formation by 150-fold via increased production of the second messenger cyclic diguanylic acid (c-di-GMP). Here, we show the tpbA mutation reduces extracellular DNA (eDNA) and that increased expression of tpbA increases eDNA; hence, eDNA is inversely proportional to c-di-GMP concentrations. Mutations in diguanylate cyclases PA0169, PA4959, and PA5487 and phosphodiesterase PA4781 corroborate this trend. The tpbA mutation also decreases cell lysis while overexpression of tpbA increases cell lysis. To further link c-di-GMP concentrations and eDNA, the gene encoding phosphodiesterase PA2133 was overexpressed which increased eDNA and decreased biofilm formation by decreasing c-di-GMP. Furthermore, the effect of the tpbB mutation along with the tpbA mutation was examined because loss of TpbB restored the phenotypes controlled by enhanced c-di-GMP in the tpbA mutant. The tpbA tpbB double mutations restored eDNA to that of the PA14 wild-type level. These findings suggest that c-di-GMP, rather than TpbA, controls eDNA. Hence, TpbA acts as a positive regulator of eDNA and cell lysis by reducing c-di-GMP concentrations. PMID:21552365

  2. Role of Protein Phosphorylation and Tyrosine Phosphatases in the Adrenal Regulation of Steroid Synthesis and Mitochondrial Function.

    PubMed

    Paz, Cristina; Cornejo Maciel, Fabiana; Gorostizaga, Alejandra; Castillo, Ana F; Mori Sequeiros García, M Mercedes; Maloberti, Paula M; Orlando, Ulises D; Mele, Pablo G; Poderoso, Cecilia; Podesta, Ernesto J

    2016-01-01

    In adrenocortical cells, adrenocorticotropin (ACTH) promotes the activation of several protein kinases. The action of these kinases is linked to steroid production, mainly through steroidogenic acute regulatory protein (StAR), whose expression and activity are dependent on protein phosphorylation events at genomic and non-genomic levels. Hormone-dependent mitochondrial dynamics and cell proliferation are functions also associated with protein kinases. On the other hand, protein tyrosine dephosphorylation is an additional component of the ACTH signaling pathway, which involves the "classical" protein tyrosine phosphatases (PTPs), such as Src homology domain (SH) 2-containing PTP (SHP2c), and members of the MAP kinase phosphatase (MKP) family, such as MKP-1. PTPs are rapidly activated by posttranslational mechanisms and participate in hormone-stimulated steroid production. In this process, the SHP2 tyrosine phosphatase plays a crucial role in a mechanism that includes an acyl-CoA synthetase-4 (Acsl4), arachidonic acid (AA) release and StAR induction. In contrast, MKPs in steroidogenic cells have a role in the turn-off of the hormonal signal in ERK-dependent processes such as steroid synthesis and, perhaps, cell proliferation. This review analyzes the participation of these tyrosine phosphates in the ACTH signaling pathway and the action of kinases and phosphatases in the regulation of mitochondrial dynamics and steroid production. In addition, the participation of kinases and phosphatases in the signal cascade triggered by different stimuli in other steroidogenic tissues is also compared to adrenocortical cell/ACTH and discussed.

  3. Dual-specificity phosphatase 5 controls the localized inhibition, propagation, and transforming potential of ERK signaling

    PubMed Central

    Kidger, Andrew M.; Rushworth, Linda K.; Stellzig, Julia; Davidson, Jane; Bryant, Christopher J.; Bayley, Cassidy; Caddye, Edward; Rogers, Tim; Keyse, Stephen M.; Caunt, Christopher J.

    2017-01-01

    Deregulated extracellular signal-regulated kinase (ERK) signaling drives cancer growth. Normally, ERK activity is self-limiting by the rapid inactivation of upstream kinases and delayed induction of dual-specificity MAP kinase phosphatases (MKPs/DUSPs). However, interactions between these feedback mechanisms are unclear. Here we show that, although the MKP DUSP5 both inactivates and anchors ERK in the nucleus, it paradoxically increases and prolongs cytoplasmic ERK activity. The latter effect is caused, at least in part, by the relief of ERK-mediated RAF inhibition. The importance of this spatiotemporal interaction between these distinct feedback mechanisms is illustrated by the fact that expression of oncogenic BRAFV600E, a feedback-insensitive mutant RAF kinase, reprograms DUSP5 into a cell-wide ERK inhibitor that facilitates cell proliferation and transformation. In contrast, DUSP5 deletion causes BRAFV600E-induced ERK hyperactivation and cellular senescence. Thus, feedback interactions within the ERK pathway can regulate cell proliferation and transformation, and suggest oncogene-specific roles for DUSP5 in controlling ERK signaling and cell fate. PMID:28053233

  4. The inositol phosphatase SHIP controls Salmonella enterica serovar Typhimurium infection in vivo.

    PubMed

    Bishop, Jennifer L; Sly, Laura M; Krystal, Gerald; Finlay, B Brett

    2008-07-01

    The SH2 domain-containing inositol 5'-phosphatase, SHIP, negatively regulates various hematopoietic cell functions and is critical for maintaining immune homeostasis. However, whether SHIP plays a role in controlling bacterial infections in vivo remains unknown. Salmonella enterica causes human salmonellosis, a disease that ranges in severity from mild gastroenteritis to severe systemic illness, resulting in significant morbidity and mortality worldwide. The susceptibility of ship(+/+) and ship(-/-) mice and bone marrow-derived macrophages to S. enterica serovar Typhimurium infection was compared. ship(-/-) mice displayed an increased susceptibility to both oral and intraperitoneal serovar Typhimurium infection and had significantly higher bacterial loads in intestinal and systemic sites than ship(+/+) mice, indicating a role for SHIP in the gut-associated and systemic pathogenesis of serovar Typhimurium in vivo. Cytokine analysis of serum from orally infected mice showed that ship(-/-) mice produce lower levels of Th1 cytokines than do ship(+/+) animals at 2 days postinfection, and in vitro analysis of supernatants taken from infected bone marrow-derived macrophages derived to mimic the in vivo ship(-/-) alternatively activated (M2) macrophage phenotype correlated with these data. M2 macrophages were the predominant population in vivo in both oral and intraperitoneal infections, since tissue macrophages within the small intestine and peritoneal macrophages from ship(-/-) mice showed elevated levels of the M2 macrophage markers Ym1 and Arginase 1 compared to ship(+/+) cells. Based on these data, we propose that M2 macrophage skewing in ship(-/-) mice contributes to ineffective clearance of Salmonella in vivo.

  5. The MADS Box Genes ABS, SHP1, and SHP2 Are Essential for the Coordination of Cell Divisions in Ovule and Seed Coat Development and for Endosperm Formation in Arabidopsis thaliana

    PubMed Central

    Tekleyohans, Dawit G.; Wittkop, Benjamin; Snowdon, Rod J.

    2016-01-01

    Seed formation is a pivotal process in plant reproduction and dispersal. It begins with megagametophyte development in the ovule, followed by fertilization and subsequently coordinated development of embryo, endosperm, and maternal seed coat. Two closely related MADS-box genes, SHATTERPROOF 1 and 2 (SHP1 and SHP2) are involved in specifying ovule integument identity in Arabidopsis thaliana. The MADS box gene ARABIDOPSIS BSISTER (ABS or TT16) is required, together with SEEDSTICK (STK) for the formation of endothelium, part of the seed coat and innermost tissue layer formed by the maternal plant. Little is known about the genetic interaction of SHP1 and SHP2 with ABS and the coordination of endosperm and seed coat development. In this work, mutant and expression analysis shed light on this aspect of concerted development. Triple tt16 shp1 shp2 mutants produce malformed seedlings, seed coat formation defects, fewer seeds, and mucilage reduction. While shp1 shp2 mutants fail to coordinate the timely development of ovules, tt16 mutants show less peripheral endosperm after fertilization. Failure in coordinated division of the innermost integument layer in early ovule stages leads to inner seed coat defects in tt16 and tt16 shp1 shp2 triple mutant seeds. An antagonistic action of ABS and SHP1/SHP2 is observed in inner seed coat layer formation. Expression analysis also indicates that ABS represses SHP1, SHP2, and FRUITFUL expression. Our work shows that the evolutionary conserved Bsister genes are required not only for endothelium but also for endosperm development and genetically interact with SHP1 and SHP2 in a partially antagonistic manner. PMID:27776173

  6. The MADS Box Genes ABS, SHP1, and SHP2 Are Essential for the Coordination of Cell Divisions in Ovule and Seed Coat Development and for Endosperm Formation in Arabidopsis thaliana.

    PubMed

    Ehlers, Katrin; Bhide, Amey S; Tekleyohans, Dawit G; Wittkop, Benjamin; Snowdon, Rod J; Becker, Annette

    2016-01-01

    Seed formation is a pivotal process in plant reproduction and dispersal. It begins with megagametophyte development in the ovule, followed by fertilization and subsequently coordinated development of embryo, endosperm, and maternal seed coat. Two closely related MADS-box genes, SHATTERPROOF 1 and 2 (SHP1 and SHP2) are involved in specifying ovule integument identity in Arabidopsis thaliana. The MADS box gene ARABIDOPSIS BSISTER (ABS or TT16) is required, together with SEEDSTICK (STK) for the formation of endothelium, part of the seed coat and innermost tissue layer formed by the maternal plant. Little is known about the genetic interaction of SHP1 and SHP2 with ABS and the coordination of endosperm and seed coat development. In this work, mutant and expression analysis shed light on this aspect of concerted development. Triple tt16 shp1 shp2 mutants produce malformed seedlings, seed coat formation defects, fewer seeds, and mucilage reduction. While shp1 shp2 mutants fail to coordinate the timely development of ovules, tt16 mutants show less peripheral endosperm after fertilization. Failure in coordinated division of the innermost integument layer in early ovule stages leads to inner seed coat defects in tt16 and tt16 shp1 shp2 triple mutant seeds. An antagonistic action of ABS and SHP1/SHP2 is observed in inner seed coat layer formation. Expression analysis also indicates that ABS represses SHP1, SHP2, and FRUITFUL expression. Our work shows that the evolutionary conserved Bsister genes are required not only for endothelium but also for endosperm development and genetically interact with SHP1 and SHP2 in a partially antagonistic manner.

  7. On the regulation of protein phosphatase 2A and its role in controlling entry into and exit from mitosis.

    PubMed

    Hunt, Tim

    2013-05-01

    The process of mitosis involves a comprehensive reorganization of the cell: chromosomes condense, the nuclear envelope breaks down, the mitotic spindle is assembled, cells round up and release their ties to the substrate and so on and so forth. This reorganization is triggered by the activation of the protein kinase, Cyclin-Dependent Kinase 1 (CDK1). The end of mitosis is marked by the proteolysis of the cyclin subunit of CDK1, which terminates kinase activity. At this point, the phosphate moieties that altered the properties of hundreds of proteins to bring about the cellular reorganization are removed by protein phosphatases. At least one protein phosphatase, PP2A-B55, is completely shut off in mitosis. Depletion of this particular form of PP2A accelerates entry into mitosis, and blocks exit from mitosis. Control of this phosphatase is achieved by an inhibitor protein (α-endosulfine or ARPP-19) that becomes inhibitory when phosphorylated by a protein kinase called Greatwall, which is itself a substrate of CDK1. Failure to inhibit PP2A-B55 causes arrest of the cell cycle in G2 phase. I will discuss the role of this control mechanism in the control of mitosis.

  8. Macrophage Fusion Is Controlled by the Cytoplasmic Protein Tyrosine Phosphatase PTP-PEST/PTPN12

    PubMed Central

    Rhee, Inmoo; Davidson, Dominique; Souza, Cleiton Martins; Vacher, Jean

    2013-01-01

    Macrophages can undergo cell-cell fusion, leading to the formation of multinucleated giant cells and osteoclasts. This process is believed to promote the proteolytic activity of macrophages toward pathogens, foreign bodies, and extracellular matrices. Here, we examined the role of PTP-PEST (PTPN12), a cytoplasmic protein tyrosine phosphatase, in macrophage fusion. Using a macrophage-targeted PTP-PEST-deficient mouse, we determined that PTP-PEST was not needed for macrophage differentiation or cytokine production. However, it was necessary for interleukin-4-induced macrophage fusion into multinucleated giant cells in vitro. It was also needed for macrophage fusion following implantation of a foreign body in vivo. Moreover, in the RAW264.7 macrophage cell line, PTP-PEST was required for receptor activator of nuclear factor kappa-B ligand (RANKL)-triggered macrophage fusion into osteoclasts. PTP-PEST had no impact on expression of fusion mediators such as β-integrins, E-cadherin, and CD47, which enable macrophages to become fusion competent. However, it was needed for polarization of macrophages, migration induced by the chemokine CC chemokine ligand 2 (CCL2), and integrin-induced spreading, three key events in the fusion process. PTP-PEST deficiency resulted in specific hyperphosphorylation of the protein tyrosine kinase Pyk2 and the adaptor paxillin. Moreover, a fusion defect was induced upon treatment of normal macrophages with a Pyk2 inhibitor. Together, these data argue that macrophage fusion is critically dependent on PTP-PEST. This function is seemingly due to the ability of PTP-PEST to control phosphorylation of Pyk2 and paxillin, thereby regulating cell polarization, migration, and spreading. PMID:23589331

  9. Macrophage fusion is controlled by the cytoplasmic protein tyrosine phosphatase PTP-PEST/PTPN12.

    PubMed

    Rhee, Inmoo; Davidson, Dominique; Souza, Cleiton Martins; Vacher, Jean; Veillette, André

    2013-06-01

    Macrophages can undergo cell-cell fusion, leading to the formation of multinucleated giant cells and osteoclasts. This process is believed to promote the proteolytic activity of macrophages toward pathogens, foreign bodies, and extracellular matrices. Here, we examined the role of PTP-PEST (PTPN12), a cytoplasmic protein tyrosine phosphatase, in macrophage fusion. Using a macrophage-targeted PTP-PEST-deficient mouse, we determined that PTP-PEST was not needed for macrophage differentiation or cytokine production. However, it was necessary for interleukin-4-induced macrophage fusion into multinucleated giant cells in vitro. It was also needed for macrophage fusion following implantation of a foreign body in vivo. Moreover, in the RAW264.7 macrophage cell line, PTP-PEST was required for receptor activator of nuclear factor kappa-B ligand (RANKL)-triggered macrophage fusion into osteoclasts. PTP-PEST had no impact on expression of fusion mediators such as β-integrins, E-cadherin, and CD47, which enable macrophages to become fusion competent. However, it was needed for polarization of macrophages, migration induced by the chemokine CC chemokine ligand 2 (CCL2), and integrin-induced spreading, three key events in the fusion process. PTP-PEST deficiency resulted in specific hyperphosphorylation of the protein tyrosine kinase Pyk2 and the adaptor paxillin. Moreover, a fusion defect was induced upon treatment of normal macrophages with a Pyk2 inhibitor. Together, these data argue that macrophage fusion is critically dependent on PTP-PEST. This function is seemingly due to the ability of PTP-PEST to control phosphorylation of Pyk2 and paxillin, thereby regulating cell polarization, migration, and spreading.

  10. Protein Tyrosine Phosphatase 1B, a major regulator of leptin-mediated control of cardiovascular function

    PubMed Central

    de Chantemèle, Eric J. Belin; Muta, Kenjiro; Mintz, James; Tremblay, Michel L.; Marrero, Mario B.; Fulton, David; Stepp, David W.

    2009-01-01

    Background Obesity causes hypertension and sympathoactivation, a process proposed to be mediated by leptin. Protein tyrosine phosphatase 1B (PTP1B), a major new pharmaceutical target to treat obesity and type II diabetes, constrains leptin’s metabolic actions, but the extent to which PTP1B regulates leptin’s cardiovascular effects is unclear. This study examined the hypothesis that PTP1B is a negative regulator of the cardiovascular effects of leptin. Methods and Results PTP1B KO mice had lower body fat but higher mean arterial pressure (MAP: 116±5 vs. 105±5 mmHg, p<0.05) than controls. Leptin infusion produced a greater anorexic effect in PTP1B KO mice and a marked increase in MAP (135±5 mmHg) in PTP1B KO mice only. Decreased MAP to ganglionic blockade was higher in PTP1B KO mice (−38±3% vs. −29±3%, p<0.05) suggesting increased sympathetic tone. PTP1B deletion blunted MAP responses to phenylephrine (PE) injection (55±10% vs. 93±7%, p<0.05). PE-induced aortic contraction was reduced in PTP1B KO mice (57.7±9 vs. 96.3±12% of KCl, p<0.05), consistent with desensitization to chronically elevated sympathetic tone. Furthermore, PTP1B deletion significantly reduced gene expression of three alpha-1 adrenergic receptor sub-types, consistent with blunted constriction to PE. Conclusion these data indicate that PTP1B is a key regulator of the cardiovascular effects of leptin and that reduced vascular adrenergic reactivity provides a compensatory limit to leptin’s effects on MAP. PMID:19687357

  11. Serine/threonine protein phosphatases: multi-purpose enzymes in control of defense mechanisms

    USDA-ARS?s Scientific Manuscript database

    Serine/threonine protein phosphatases are a group of enzymes involved in the regulation of defense mechanisms in plants. This paper describes the effects of an inhibitor of these enzymes on the expression of all of the genes associated with these defense mechanisms. The results suggest that inhibi...

  12. Serine/threonine protein phosphatases: multi-purpose enzymes in control of defense mechanisms

    USDA-ARS?s Scientific Manuscript database

    Serine/threonine protein phosphatases are a group of enzymes involved in the regulation of defense mechanisms in plants. This paper describes the effects of an inhibitor of these enzymes on the expression of all of the genes associated with these defense mechanisms. The results suggest that inhibi...

  13. Discovery of protein phosphatase inhibitor classes by biology-oriented synthesis

    PubMed Central

    Nören-Müller, Andrea; Reis-Corrêa, Ivan; Prinz, Heino; Rosenbaum, Claudia; Saxena, Krishna; Schwalbe, Harald J.; Vestweber, Dietmar; Cagna, Guiseppe; Schunk, Stefan; Schwarz, Oliver; Schiewe, Hajo; Waldmann, Herbert

    2006-01-01

    Protein phosphatases have very recently emerged as important targets for chemical biology and medicinal chemistry research, and new phosphatase inhibitor classes are in high demand. The underlying frameworks of natural products represent the evolutionarily selected fractions of chemical space explored by nature so far and meet the criteria of relevance to nature and biological prevalidation most crucial to inhibitor development. We refer to synthesis efforts and compound collection development based on these criteria as biology-oriented synthesis. For the discovery of phosphatase inhibitor classes by means of this approach, four natural product-derived or -inspired medium-sized compound collections were synthesized and investigated for inhibition of the tyrosine phosphatases VE-PTP, Shp-2, PTP1B, MptpA, and MptpB and the dual-specificity phosphatases Cdc25A and VHR. The screen yielded four unprecedented and selective phosphatase inhibitor classes for four phosphatases with high hit rates. For VE-PTP and MptpB the first inhibitors were discovered. These results demonstrate that biology-oriented synthesis is an efficient approach to the discovery of new compound classes for medicinal chemistry and chemical biology research that opens up new opportunities for the study of phosphatases, which may lead to the development of new drug candidates. PMID:16809424

  14. Receptor Type Protein Tyrosine Phosphatase ζ-Pleiotrophin Signaling Controls Endocytic Trafficking of DNER That Regulates Neuritogenesis▿ †

    PubMed Central

    Fukazawa, Nobuna; Yokoyama, Seisuke; Eiraku, Mototsugu; Kengaku, Mineko; Maeda, Nobuaki

    2008-01-01

    Protein tyrosine phosphatase ζ (PTPζ) is a receptor type protein tyrosine phosphatase that uses pleiotrophin as a ligand. Pleiotrophin inactivates the phosphatase activity of PTPζ, resulting in the increase of tyrosine phosphorylation levels of its substrates. We studied the functional interaction between PTPζ and DNER, a Notch-related transmembrane protein highly expressed in cerebellar Purkinje cells. PTPζ and DNER displayed patchy colocalization in the dendrites of Purkinje cells, and immunoprecipitation experiments indicated that these proteins formed complexes. Several tyrosine residues in and adjacent to the tyrosine-based and the second C-terminal sorting motifs of DNER were phosphorylated and were dephosphorylated by PTPζ, and phosphorylation of these tyrosine residues resulted in the accumulation of DNER on the plasma membrane. DNER mutants lacking sorting motifs accumulated on the plasma membrane of Purkinje cells and Neuro-2A cells and induced their process extension. While normal DNER was actively endocytosed and inhibited the retinoic-acid-induced neurite outgrowth of Neuro-2A cells, pleiotrophin stimulation increased the tyrosine phosphorylation level of DNER and suppressed the endocytosis of this protein, which led to the reversal of this inhibition, thus allowing neurite extension. These observations suggest that pleiotrophin-PTPζ signaling controls subcellular localization of DNER and thereby regulates neuritogenesis. PMID:18474614

  15. CD150 association with either the SH2-containing inositol phosphatase or the SH2-containing protein tyrosine phosphatase is regulated by the adaptor protein SH2D1A.

    PubMed

    Shlapatska, L M; Mikhalap, S V; Berdova, A G; Zelensky, O M; Yun, T J; Nichols, K E; Clark, E A; Sidorenko, S P

    2001-05-01

    CD150 (SLAM/IPO-3) is a cell surface receptor that, like the B cell receptor, CD40, and CD95, can transmit positive or negative signals. CD150 can associate with the SH2-containing inositol phosphatase (SHIP), the SH2-containing protein tyrosine phosphatase (SHP-2), and the adaptor protein SH2 domain protein 1A (SH2D1A/DSHP/SAP, also called Duncan's disease SH2-protein (DSHP) or SLAM-associated protein (SAP)). Mutations in SH2D1A are found in X-linked lymphoproliferative syndrome and non-Hodgkin's lymphomas. Here we report that SH2D1A is expressed in tonsillar B cells and in some B lymphoblastoid cell lines, where CD150 coprecipitates with SH2D1A and SHIP. However, in SH2D1A-negative B cell lines, including B cell lines from X-linked lymphoproliferative syndrome patients, CD150 associates only with SHP-2. SH2D1A protein levels are up-regulated by CD40 cross-linking and down-regulated by B cell receptor ligation. Using GST-fusion proteins with single replacements of tyrosine at Y269F, Y281F, Y307F, or Y327F in the CD150 cytoplasmic tail, we found that the same phosphorylated Y281 and Y327 are essential for both SHP-2 and SHIP binding. The presence of SH2D1A facilitates binding of SHIP to CD150. Apparently, SH2D1A may function as a regulator of alternative interactions of CD150 with SHP-2 or SHIP via a novel TxYxxV/I motif (immunoreceptor tyrosine-based switch motif (ITSM)). Multiple sequence alignments revealed the presence of this TxYxxV/I motif not only in CD2 subfamily members but also in the cytoplasmic domains of the members of the SHP-2 substrate 1, sialic acid-binding Ig-like lectin, carcinoembryonic Ag, and leukocyte-inhibitory receptor families.

  16. Development of conductometric biosensors based on alkaline phosphatases for the water quality control

    NASA Astrophysics Data System (ADS)

    Berezhetskyy, A.

    2008-09-01

    Researches are focused on the elaboration of enzymatic microconductometric device for heavy metal ions detection in water solutions. The manuscript includes a general introduction, the first chapter contains bibliographic review, the second chapter described the fundamentals of conductometric transducers, the third chapter examining the possibility to create and to optimize conductometric biosensor based on bovine alkaline phosphatase for heavy metals ions detection, the fourth chapter devoted to creation and optimization of conductometric biosensor based on alkaline phosphatase active microalgae and sol gel technology, the last chapter described application of the proposed algal biosensor for measurements of heavy metal ions toxicity of waste water, general conclusions stating the progresses achieved in the field of environmental monitoring

  17. A family of metal-dependent phosphatases implicated in metabolite damage-control

    SciTech Connect

    Huang, Lili; Khusnutdinova, Anna; Nocek, Boguslaw; Brown, Greg; Xu, Xiaohui; Cui, Hong; Petit, Pierre; Flick, Robert; Zallot, Rémi; Balmant, Kelly; Ziemak, Michael J.; Shanklin, John; de Crécy-Lagard, Valérie; Fiehn, Oliver; Gregory, Jesse F.; Joachimiak, Andrzej; Savchenko, Alexei; Yakunin, Alexander F.; Hanson, Andrew D.

    2016-06-20

    DUF89 family proteins occur widely in both prokaryotes and eukaryotes, but their functions are unknown. Here we define three DUF89 subfamilies (I, II, and III), with subfamily II being split into stand-alone proteins and proteins fused to pantothenate kinase (PanK). We demonstrated that DUF89 proteins have metal-dependent phosphatase activity against reactive phosphoesters or their damaged forms, notably sugar phosphates (subfamilies II and III), phosphopantetheine and its S-sulfonate or sulfonate (subfamily II-PanK fusions), and nucleotides (subfamily I). Genetic and comparative genomic data strongly associated DUF89 genes with phosphoester metabolism. The crystal structure of the yeast (Saccharomyces cerevisiae) subfamily III protein YMR027W revealed a novel phosphatase active site with fructose 6-phosphate and Mg2+ bound near conserved signature residues Asp254 and Asn255 that are critical for activity. These findings indicate that DUF89 proteins are previously unrecognized hydrolases whose characteristic in vivo function is to limit potentially harmful buildups of normal or damaged phosphometabolites.

  18. A family of metal-dependent phosphatases implicated in metabolite damage-control

    DOE PAGES

    Huang, Lili; Shanklin, John; Khusnutdinova, Anna; ...

    2016-06-20

    DUF89 family proteins occur widely in pro- and eukaryotes but their functions are unknown. Here we define three DUF89 subfamilies (I, II, and III), subfamily II being split into standalone proteins and proteins fused to pantothenate kinase (PanK). We demonstrated that DUF89 proteins have metaldependent phosphatase activity against reactive phosphoesters or their damaged forms, notably sugar phosphates (subfamilies II and III), phosphopantetheine and its S-sulfonate or sulfonate (subfamily II-PanK fusions), and nucleotides (subfamily I). Genetic and comparative genomic data strongly associated DUF89 genes with phosphoester metabolism. The crystal structure of the yeast (Saccharomyces cerevisiae) subfamily III protein YMR027W revealed amore » novel phosphatase active site with fructose 6-phosphate and Mg2+ bound near conserved signature residues Asp254 and Asn255 that are critical for activity. These findings indicate that DUF89 proteins are previously unrecognized hydrolases whose characteristic in vivo function is to limit potentially harmful buildups of normal or damaged phosphometabolites.« less

  19. A family of metal-dependent phosphatases implicated in metabolite damage-control

    SciTech Connect

    Huang, Lili; Shanklin, John; Khusnutdinova, Anna; Nocek, Boguslaw; Brown, Greg; Xu, Xiaohui; Cui, Hong; Petit, Pierre; Flick, Robert; Zallot, Remi; Balmant, Kelly; Ziemak, Michael J.; de Crecy-Lagard, Valerie; Fiehn, Oliver; Gregory, III, Jesse F.; Joachimiak, Andrzej; Savchenko, Alexie; Yakunin, Alexander F.; Hanson, Andrew D.

    2016-06-20

    DUF89 family proteins occur widely in pro- and eukaryotes but their functions are unknown. Here we define three DUF89 subfamilies (I, II, and III), subfamily II being split into standalone proteins and proteins fused to pantothenate kinase (PanK). We demonstrated that DUF89 proteins have metaldependent phosphatase activity against reactive phosphoesters or their damaged forms, notably sugar phosphates (subfamilies II and III), phosphopantetheine and its S-sulfonate or sulfonate (subfamily II-PanK fusions), and nucleotides (subfamily I). Genetic and comparative genomic data strongly associated DUF89 genes with phosphoester metabolism. The crystal structure of the yeast (Saccharomyces cerevisiae) subfamily III protein YMR027W revealed a novel phosphatase active site with fructose 6-phosphate and Mg2+ bound near conserved signature residues Asp254 and Asn255 that are critical for activity. These findings indicate that DUF89 proteins are previously unrecognized hydrolases whose characteristic in vivo function is to limit potentially harmful buildups of normal or damaged phosphometabolites.

  20. A family of metal-dependent phosphatases implicated in metabolite damage-control

    SciTech Connect

    Huang, Lili; Shanklin, John; Khusnutdinova, Anna; Nocek, Boguslaw; Brown, Greg; Xu, Xiaohui; Cui, Hong; Petit, Pierre; Flick, Robert; Zallot, Remi; Balmant, Kelly; Ziemak, Michael J.; de Crecy-Lagard, Valerie; Fiehn, Oliver; Gregory, III, Jesse F.; Joachimiak, Andrzej; Savchenko, Alexie; Yakunin, Alexander F.; Hanson, Andrew D.

    2016-06-20

    DUF89 family proteins occur widely in pro- and eukaryotes but their functions are unknown. Here we define three DUF89 subfamilies (I, II, and III), subfamily II being split into standalone proteins and proteins fused to pantothenate kinase (PanK). We demonstrated that DUF89 proteins have metaldependent phosphatase activity against reactive phosphoesters or their damaged forms, notably sugar phosphates (subfamilies II and III), phosphopantetheine and its S-sulfonate or sulfonate (subfamily II-PanK fusions), and nucleotides (subfamily I). Genetic and comparative genomic data strongly associated DUF89 genes with phosphoester metabolism. The crystal structure of the yeast (Saccharomyces cerevisiae) subfamily III protein YMR027W revealed a novel phosphatase active site with fructose 6-phosphate and Mg2+ bound near conserved signature residues Asp254 and Asn255 that are critical for activity. These findings indicate that DUF89 proteins are previously unrecognized hydrolases whose characteristic in vivo function is to limit potentially harmful buildups of normal or damaged phosphometabolites.

  1. Phosphatase control of 4E-BP1 phosphorylation state is central for glycolytic regulation of retinal protein synthesis.

    PubMed

    Gardner, Thomas W; Abcouwer, Steven F; Losiewicz, Mandy K; Fort, Patrice E

    2015-09-15

    Control of protein synthesis in insulin-responsive tissues has been well characterized, but relatively little is known about how this process is regulated in nervous tissues. The retina exhibits a relatively high protein synthesis rate, coinciding with high basal Akt and metabolic activities, with the majority of retinal ATP being derived from aerobic glycolysis. We examined the dependency of retinal protein synthesis on the Akt-mTOR signaling and glycolysis using ex vivo rat retinas. Akt inhibitors significantly reduced retinal protein synthesis but did not affect glycolytic lactate production. Surprisingly, the glycolytic inhibitor 2-deoxyglucose (2-DG) markedly inhibited Akt1 and Akt3 activities, as well as protein synthesis. The effects of 2-DG, and 2-fluorodeoxyglucose (2-FDG) on retinal protein synthesis correlated with inhibition of lactate production and diminished ATP content, with all these effects reversed by provision of d-mannose. 2-DG treatment was not associated with increased AMPK, eEF2, or eIF2α phosphorylation; instead, it caused rapid dephosphorylation of 4E-BP1. 2-DG reduced total mTOR activity by 25%, but surprisingly, it did not reduce mTORC1 activity, as indicated by unaltered raptor-associated mTOR autophosphorylation and ribosomal protein S6 phosphorylation. Dephosphorylation of 4E-BP1 was largely prevented by inhibition of PP1/PP2A phosphatases with okadaic acid and calyculin A, and inhibition of PPM1 phosphatases with cadmium. Thus, inhibition of retinal glycolysis diminished Akt and protein synthesis coinciding with accelerated dephosphorylation of 4E-BP1 independently of mTORC1. These results demonstrate a novel mechanism regulating protein synthesis in the retina involving an mTORC1-independent and phosphatase-dependent regulation of 4E-BP1. Copyright © 2015 the American Physiological Society.

  2. Phosphatase control of 4E-BP1 phosphorylation state is central for glycolytic regulation of retinal protein synthesis

    PubMed Central

    Gardner, Thomas W.; Abcouwer, Steven F.; Losiewicz, Mandy K.

    2015-01-01

    Control of protein synthesis in insulin-responsive tissues has been well characterized, but relatively little is known about how this process is regulated in nervous tissues. The retina exhibits a relatively high protein synthesis rate, coinciding with high basal Akt and metabolic activities, with the majority of retinal ATP being derived from aerobic glycolysis. We examined the dependency of retinal protein synthesis on the Akt-mTOR signaling and glycolysis using ex vivo rat retinas. Akt inhibitors significantly reduced retinal protein synthesis but did not affect glycolytic lactate production. Surprisingly, the glycolytic inhibitor 2-deoxyglucose (2-DG) markedly inhibited Akt1 and Akt3 activities, as well as protein synthesis. The effects of 2-DG, and 2-fluorodeoxyglucose (2-FDG) on retinal protein synthesis correlated with inhibition of lactate production and diminished ATP content, with all these effects reversed by provision of d-mannose. 2-DG treatment was not associated with increased AMPK, eEF2, or eIF2α phosphorylation; instead, it caused rapid dephosphorylation of 4E-BP1. 2-DG reduced total mTOR activity by 25%, but surprisingly, it did not reduce mTORC1 activity, as indicated by unaltered raptor-associated mTOR autophosphorylation and ribosomal protein S6 phosphorylation. Dephosphorylation of 4E-BP1 was largely prevented by inhibition of PP1/PP2A phosphatases with okadaic acid and calyculin A, and inhibition of PPM1 phosphatases with cadmium. Thus, inhibition of retinal glycolysis diminished Akt and protein synthesis coinciding with accelerated dephosphorylation of 4E-BP1 independently of mTORC1. These results demonstrate a novel mechanism regulating protein synthesis in the retina involving an mTORC1-independent and phosphatase-dependent regulation of 4E-BP1. PMID:26199279

  3. Enzyme Activity of Phosphatase of Regenerating Liver (PRL-1) Is Controlled by Redox Environment and Its C-terminal Residues†

    PubMed Central

    Skinner, Andria L.; Vartia, Anthony A.; Williams, Todd D.; Laurence, Jennifer S.

    2009-01-01

    Phosphatase of regenerating liver-1 (PRL-1) belongs to a unique subfamily of protein tyrosine phosphatases (PTPases) associated with oncogenic and metastatic phenotypes. While considerable evidence exists to supports a role for PRL-1 in promoting proliferation, the biological regulators and effectors of PRL-1 activity remain unknown. PRL-1 activity is inhibited by disulfide bond formation at the active site in vitro, suggesting PRL-1 may be susceptible to redox regulation in vivo. Because PRL-1 has been observed to localize to several different subcellular locations and cellular redox conditions vary with tissue type, age, stage of cell cycle and subcellular location, we determined the reduction potential of the active site disulfide bond that controls phosphatase activity to better understand the function of PRL-1 in various cellular environments. We used high-resolution solution NMR spectroscopy to measure the potential and found it to be −364.3 ± 1.5 mV. Because normal cellular environments range from −170 to −320 mV, we concluded that nascent PRL-1 would be primarily oxidized inside cells. Our studies show that a significant conformational change accompanies activation, suggesting a post-translational modification may alter the reduction potential, conferring activity. We further demonstrate that alteration of the C-terminus renders the protein reduced and active in vitro, implying the C-terminus is an important regulator of PRL-1 function. These data provide a basis for understanding how subcellular localization regulates the activity of PRL-1 and, with further investigation, may help reveal how PRL-1 promotes unique outcomes in different cellular systems, including proliferation in both normal and diseased states. PMID:19341304

  4. Comparative Evaluation of Efficacy of Three Different Herbal Toothpastes on Salivary Alkaline Phosphatase and Salivary Acid Phosphatase - A Randomized Controlled Trial

    PubMed Central

    Dodamani, Arun; Karibasappa, G. N.; Deshmukh, Manjiri; Naik, Rahul

    2016-01-01

    Introduction Very few researches in the past have tried to evaluate the effect of herbal toothpaste on saliva and salivary constituents like alkaline phosphatase and acid phosphatase which play an important role in maintaining oral health. Aim To evaluate and compare the effect of three different herbal toothpastes on Salivary Alkaline Phosphatase (ALP) and salivary Acid Phosphatase (ACP). Material and Methods The present study was a preliminary study conducted among 45 dental students (15 subjects in each group) in the age group of 19-21 years. Subjects in each group were randomly intervened with three different herbal toothpastes respectively (Group A – Patanjali Dant Kanti, Group B - Himalaya Complete Care and Group C – Vicco Vajradanti). Unstimulated saliva sample were collected before and after brushing and salivary ACP and salivary ALP levels were assessed at an interval of one week each for a period of four weeks starting from day one. Compiled data was analyzed using chi square test, paired t-test and ANOVA based on the nature of the obtained data. Results All the three toothpastes showed significant (p<0.001) reduction in ACP and ALP levels at each interval. For patanjali toothpaste, the mean reduction was in the range of 2.55 – 2.62 IU/L for ACP and 2.94 – 2.99 IU/L for ALP. For Himalaya toothpaste, the mean reduction was in the range of 1.39 – 1.47 IU/L for ACP and 1.55 – 1.61 IU/L for ALP. For Vicco toothpaste, the mean reduction was in the range of 2.46 – 2.50 IU/L for ACP and 2.64 – 2.77 IU/L for ALP. Patanjali and Vicco toothpaste were significantly effective in reducing the levels of salivary ACP and ALP more than Himalaya toothpaste (p<0.05). Conclusion Herbal toothpastes, especially Dant Kanti and Vicco Vajradanti, showed significant reduction in levels of ACP and ALP resulting in overall improvement towards the oral health. PMID:27790584

  5. TIMAP-protein phosphatase 1-complex controls endothelin-1 production via ECE-1 dephosphorylation.

    PubMed

    Boratkó, Anita; Veréb, Zoltán; Petrovski, Goran; Csortos, Csilla

    2016-04-01

    Endothelin induced signaling pathways can affect blood pressure and vascular tone, but the influence of endothelins on tumor cells is also significant. We have detected elevated endothelin-1 secretion from TIMAP (TGF-β inhibited membrane associated protein) depleted vascular endothelial cells. The autocrine signaling activated by the elevated endothelin-1 level through the ETB receptors evoked an angiogenic-like phenotype, the cells assumed an elongated morphology, and enhanced tube formation and wound healing abilities. The depleted protein, TIMAP, is a highly specific and abundant protein in the endothelial cells, and it is a regulatory/targeting subunit for the catalytic subunit of protein phosphatase 1 (PP1c). Protein-protein interaction between the TIMAP-PP1c complex and the endothelin converting enzyme-1 (ECE-1) was detected, the latter of which is a transmembrane protein that produces the biologically active 21-amino acid form of endothelin-1 from proendothelin. The results indicate that silencing of TIMAP induces a reduction in TIMAP-PP1c activity connected to ECE-1. This leads to an increase in the amount of ECE-1 protein in the plasma membrane and a consequent increase in endothelin-1 secretion. Similarly, activation of PKC, the kinase responsible for ECE-1 phosphorylation increased ECE-1 protein level in the membrane fraction of the endothelial cells. The elevated ECE-1 level was mitigated in time in normal cells, but was clearly preserved in TIMAP-depleted cells. Overall, our results indicate that PKC-phosphorylated ECE-1 is a TIMAP-PP1c substrate and this phosphatase complex has an important role in endothelin-1 production of EC through the regulation of ECE-1 activity.

  6. Target-specific control of lymphoid-specific protein tyrosine phosphatase (Lyp) activity

    PubMed Central

    Walton, Zandra E.; Bishop, Anthony C.

    2010-01-01

    Lymphoid-specific protein tyrosine phosphatase (Lyp), a member of the protein tyrosine phosphatase (PTP) superfamily of enzymes, is an important mediator of human-leukocyte signaling. Lyp has also emerged as a potential anti-autoimmune therapeutic target, owing to the association of a Lyp-activating mutation with an array of autoimmune disorders. Toward the goal of generating a selective inhibitor of Lyp activity that could be used for investigating Lyp’s roles in cell signaling and autoimmune-disease progression, here we report that Lyp’s PTP domain can be readily sensitized to target-specific inhibition by a cell-permeable small molecule. Insertion of a tetracysteine-motif-containing peptide at a conserved position in Lyp’s catalytic domain generated a mutant enzyme (Lyp-CCPGCC) that retains activity comparable to that of wild-type Lyp in the absence of added ligand. Upon addition of a tetracysteine-targeting biarsenical compound (FlAsH), however, the activity of the Lyp-CCPGCC drops dramatically, as assayed with either small-molecule or phosphorylated-peptide PTP substrates. We show that FlAsH-induced Lyp-CCPGCC inhibition is potent, specific, rapid, and independent of the nature of the PTP substrate used in the inhibition assay. Moreover, we show that FlAsH can be used to specifically target overexpressed Lyp-CCPGCC in a complex proteomic mixture. Since the mammalian-cell permeability of FlAsH is well established, it is likely that FlAsH-mediated inhibition of Lyp-CCPGCC will be useful for specifically targeting Lyp activity in engineered leukocytes and autoimmune-disease models. PMID:20594861

  7. Cdk1 and okadaic acid-sensitive phosphatases control assembly of nuclear pore complexes in Drosophila embryos.

    PubMed

    Onischenko, Evgeny A; Gubanova, Natalia V; Kiseleva, Elena V; Hallberg, Einar

    2005-11-01

    Disassembly and reassembly of the nuclear pore complexes (NPCs) is one of the major events during open mitosis in higher eukaryotes. However, how this process is controlled by the mitotic machinery is not clear. To investigate this we developed a novel in vivo model system based on syncytial Drosophila embryos. We microinjected different mitotic effectors into the embryonic cytoplasm and monitored the dynamics of disassembly/reassembly of NPCs in live embryos using fluorescently labeled wheat germ agglutinin (WGA) or in fixed embryos using electron microscopy and immunostaining techniques. We found that in live embryos Cdk1 activity was necessary and sufficient to induce disassembly of NPCs as well as their cytoplasmic mimics: annulate lamellae pore complexes (ALPCs). Cdk1 activity was also required for keeping NPCs and ALPCs disassembled during mitosis. In agreement recombinant Cdk1/cyclin B was able to induce phosphorylation and dissociation of nucleoporins from the NPCs in vitro. Conversely, reassembly of NPCs and ALPCs was dependent on the activity of protein phosphatases, sensitive to okadaic acid (OA). Our findings suggest a model where mitotic disassembly/reassembly of the NPCs is regulated by a dynamic equilibrium of Cdk1 and OA-sensitive phosphatase activities and provide evidence that mitotic phosphorylation mediates disassembly of the NPC.

  8. Targeted nanoconjugate co-delivering siRNA and tyrosine kinase inhibitor to KRAS mutant NSCLC dissociates GAB1-SHP2 post oncogene knockdown

    NASA Astrophysics Data System (ADS)

    Srikar, R.; Suresh, Dhananjay; Zambre, Ajit; Taylor, Kristen; Chapman, Sarah; Leevy, Matthew; Upendran, Anandhi; Kannan, Raghuraman

    2016-08-01

    A tri-block nanoparticle (TBN) comprising of an enzymatically cleavable porous gelatin nanocore encapsulated with gefitinib (tyrosine kinase inhibitor (TKI)) and surface functionalized with cetuximab-siRNA conjugate has been synthesized. Targeted delivery of siRNA to undruggable KRAS mutated non-small cell lung cancer cells would sensitize the cells to TKI drugs and offers an efficient therapy for treating cancer; however, efficient delivery of siRNA and releasing it in cytoplasm remains a major challenge. We have shown TBN can efficiently deliver siRNA to cytoplasm of KRAS mutant H23 Non-Small Cell Lung Cancer (NSCLC) cells for oncogene knockdown; subsequently, sensitizing it to TKI. In the absence of TKI, the nanoparticle showed minimal toxicity suggesting that the cells adapt a parallel GAB1 mediated survival pathway. In H23 cells, activated ERK results in phosphorylation of GAB1 on serine and threonine residues to form GAB1-p85 PI3K complex. In the absence of TKI, knocking down the oncogene dephosphorylated ERK, and negated the complex formation. This event led to tyrosine phosphorylation at Tyr627 domain of GAB1 that regulated EGFR signaling by recruiting SHP2. In the presence of TKI, GAB1-SHP2 dissociation occurs, leading to cell death. The outcome of this study provides a promising platform for treating NSCLC patients harboring KRAS mutation.

  9. Xenopus laevis FGF receptor substrate 3 (XFrs3) is important for eye development and mediates Pax6 expression in lens placode through its Shp2-binding sites.

    PubMed

    Kim, Yeon-Jin; Bahn, Minjin; Kim, Yong Hwan; Shin, Jee-Yoon; Cheong, Seon-Woo; Ju, Bong-Gun; Kim, Won-Sun; Yeo, Chang-Yeol

    2015-01-01

    Members of the fibroblast growth factor (FGF) family play important roles during various developmental processes including eye development. FRS (FGF receptor substrate) proteins bind to FGFR and serve as adapters for coordinated assembly of multi-protein complexes involved in Ras/MAPK and PI3 kinase/Akt pathways. Here, we identified Xenopus laevis Frs3 (XFrs3), a homolog of vertebrate Frs3, and investigated its roles during embryogenesis. XFrs3 is expressed maternally and zygotically with specific expression patterns throughout the early development. Knockdown of XFrs3 using a specific antisense morpholino oligonucleotide (MO) caused reduction of Pax6 expression in the lens placode, and defects in the eye ranging from microphthalmia to anophthalmia. XFrs3 MO-induced defects were alleviated by wild type XFrs3 or a mutant XFrs3 (XFrs3-4YF), in which the putative tyrosine phosphorylation sites served as Grb2-binding sites are mutated. However, another XFrs3 mutant (XFrs3-2YF), in which the putative Shp2-binding sites are mutated, could not rescue the defects of XFrs3 morphants. In addition, we found that XFrs3 is important for FGF or IGF-induced ERK activation in ectodermal tissue. Taken together, our results suggest that signaling through Shp2-binding sites of XFrs3 is necessary for the eye development in Xenopus laevis.

  10. Targeted nanoconjugate co-delivering siRNA and tyrosine kinase inhibitor to KRAS mutant NSCLC dissociates GAB1-SHP2 post oncogene knockdown

    PubMed Central

    Srikar, R.; Suresh, Dhananjay; Zambre, Ajit; Taylor, Kristen; Chapman, Sarah; Leevy, Matthew; Upendran, Anandhi; Kannan, Raghuraman

    2016-01-01

    A tri-block nanoparticle (TBN) comprising of an enzymatically cleavable porous gelatin nanocore encapsulated with gefitinib (tyrosine kinase inhibitor (TKI)) and surface functionalized with cetuximab-siRNA conjugate has been synthesized. Targeted delivery of siRNA to undruggable KRAS mutated non-small cell lung cancer cells would sensitize the cells to TKI drugs and offers an efficient therapy for treating cancer; however, efficient delivery of siRNA and releasing it in cytoplasm remains a major challenge. We have shown TBN can efficiently deliver siRNA to cytoplasm of KRAS mutant H23 Non-Small Cell Lung Cancer (NSCLC) cells for oncogene knockdown; subsequently, sensitizing it to TKI. In the absence of TKI, the nanoparticle showed minimal toxicity suggesting that the cells adapt a parallel GAB1 mediated survival pathway. In H23 cells, activated ERK results in phosphorylation of GAB1 on serine and threonine residues to form GAB1-p85 PI3K complex. In the absence of TKI, knocking down the oncogene dephosphorylated ERK, and negated the complex formation. This event led to tyrosine phosphorylation at Tyr627 domain of GAB1 that regulated EGFR signaling by recruiting SHP2. In the presence of TKI, GAB1-SHP2 dissociation occurs, leading to cell death. The outcome of this study provides a promising platform for treating NSCLC patients harboring KRAS mutation. PMID:27530552

  11. PI3K p110δ uniquely promotes gain-of-function Shp2-induced GM-CSF hypersensitivity in a model of JMML.

    PubMed

    Goodwin, Charles B; Li, Xing Jun; Mali, Raghuveer S; Chan, Gordon; Kang, Michelle; Liu, Ziyue; Vanhaesebroeck, Bart; Neel, Benjamin G; Loh, Mignon L; Lannutti, Brian J; Kapur, Reuben; Chan, Rebecca J

    2014-05-01

    Although hyperactivation of the Ras-Erk signaling pathway is known to underlie the pathogenesis of juvenile myelomonocytic leukemia (JMML), a fatal childhood disease, the PI3K-Akt signaling pathway is also dysregulated in this disease. Using genetic models, we demonstrate that inactivation of phosphatidylinositol-3-kinase (PI3K) catalytic subunit p110δ, but not PI3K p110α, corrects gain-of-function (GOF) Shp2-induced granulocyte macrophage-colony-stimulating factor (GM-CSF) hypersensitivity, Akt and Erk hyperactivation, and skewed hematopoietic progenitor distribution. Likewise, potent p110δ-specific inhibitors curtail the proliferation of GOF Shp2-expressing hematopoietic cells and cooperate with mitogen-activated or extracellular signal-regulated protein kinase kinase (MEK) inhibition to reduce proliferation further and maximally block Erk and Akt activation. Furthermore, the PI3K p110δ-specific inhibitor, idelalisib, also demonstrates activity against primary leukemia cells from individuals with JMML. These findings suggest that selective inhibition of the PI3K catalytic subunit p110δ could provide an innovative approach for treatment of JMML, with the potential for limiting toxicity resulting from the hematopoietic-restricted expression of p110δ.

  12. NLRP3 tyrosine phosphorylation is controlled by protein tyrosine phosphatase PTPN22

    PubMed Central

    Spalinger, Marianne R.; Kasper, Stephanie; Gottier, Claudia; Lang, Silvia; Atrott, Kirstin; Vavricka, Stephan R.; Scharl, Sylvie; Gutte, Petrus M.; Grütter, Markus G.; Beer, Hans-Dietmar; Contassot, Emmanuel; Chan, Andrew C.; Dai, Xuezhi; Rawlings, David J.; Mair, Florian; Becher, Burkhard; Falk, Werner; Fried, Michael; Rogler, Gerhard

    2016-01-01

    Inflammasomes form as the result of the intracellular presence of danger-associated molecular patterns and mediate the release of active IL-1β, which influences a variety of inflammatory responses. Excessive inflammasome activation results in severe inflammatory conditions, but physiological IL-1β secretion is necessary for intestinal homeostasis. Here, we have described a mechanism of NLRP3 inflammasome regulation by tyrosine phosphorylation of NLRP3 at Tyr861. We demonstrated that protein tyrosine phosphatase non-receptor 22 (PTPN22), variants in which are associated with chronic inflammatory disorders, dephosphorylates NLRP3 upon inflammasome induction, allowing efficient NLRP3 activation and subsequent IL-1β release. In murine models, PTPN22 deficiency resulted in pronounced colitis, increased NLRP3 phosphorylation, but reduced levels of mature IL-1β. Conversely, patients with inflammatory bowel disease (IBD) that carried an autoimmunity-associated PTPN22 variant had increased IL-1β levels. Together, our results identify tyrosine phosphorylation as an important regulatory mechanism for NLRP3 that prevents aberrant inflammasome activation. PMID:27043286

  13. Specific control of BMP signaling and mesenchymal differentiation by cytoplasmic phosphatase PPM1H

    PubMed Central

    Shen, Tao; Sun, Chuang; Zhang, Zhengmao; Xu, Ningyi; Duan, Xueyan; Feng, Xin-Hua; Lin, Xia

    2014-01-01

    Bone morphogenetic proteins (BMPs) belong to the TGF-β superfamily of structurally related signaling proteins that regulate a wide array of cellular functions. The key step in BMP signal transduction is the BMP receptor-mediated phosphorylation of transcription factors Smad1, 5, and 8 (collectively Smad1/5/8), which leads to the subsequent activation of BMP-induced gene transcription in the nucleus. In this study, we describe the identification and characterization of PPM1H as a novel cytoplasm-localized Smad1/5/8-specific phosphatase. PPM1H directly interacts with Smad1/5/8 through its Smad-binding domain, and dephosphorylates phospho-Smad1/5/8 (P-Smad1/5/8) in the cytoplasm. Ectopic expression of PPM1H attenuates BMP signaling, whereas loss of PPM1H activity or expression greatly enhances BMP-dependent gene regulation and mesenchymal differentiation. In conclusion, this study suggests that PPM1H acts as a gatekeeper to prevent excessive BMP signaling through dephosphorylation and subsequent nuclear exclusion of P-Smad1/5/8 proteins. PMID:24732009

  14. Actin Dynamics Is Controlled by a Casein Kinase II and Phosphatase 2C Interplay on Toxoplasma gondii Toxofilin

    PubMed Central

    Delorme, Violaine; Cayla, Xavier; Faure, Grazyna; Garcia, Alphonse; Tardieux, Isabelle

    2003-01-01

    Actin polymerization in Apicomplexa protozoa is central to parasite motility and host cell invasion. Toxofilin has been characterized as a protein that sequesters actin monomers and caps actin filaments in Toxoplasma gondii. Herein, we show that Toxofilin properties in vivo as in vitro depend on its phosphorylation. We identify a novel parasitic type 2C phosphatase that binds the Toxofilin/G-actin complex and a casein kinase II-like activity in the cytosol, both of which modulate the phosphorylation status of Toxofilin serine53. The interplay of these two molecules controls Toxofilin binding of G-actin as well as actin dynamics in vivo. Such functional interactions should play a major role in actin sequestration, a central feature of actin dynamics in Apicomplexa that underlies the spectacular speed and nature of parasite gliding motility. PMID:12802063

  15. Light-inducible and clock-controlled expression of MAP kinase phosphatase 1 in mouse central pacemaker neurons.

    PubMed

    Doi, Masao; Cho, Sehyung; Yujnovsky, Irene; Hirayama, Jun; Cermakian, Nicolas; Cato, Andrew C B; Sassone-Corsi, Paolo

    2007-04-01

    MAP kinase phosphatase 1 (MKP1) is a negative regulator for the mitogen-activated protein kinase (MAPK)-mediated signal transduction, a key pathway that leads to the regulated expression of circadian clock genes. Here the authors analyzed mkp1 expression by in situ hybridization and found that mkp1 is a light-inducible and clock-controlled gene expressed in the central pacemaker neurons of the hypothalamic SCN. Interestingly, mkp1 presents a marked similarity to the clock core gene per1 in terms of the gene expression profiles as well as the gene promoter organization. Both mkp1 and per1 are subject to bimodal regulation in the SCN: the external light-dependent acute up-regulation and the functional clock-dependent circadian oscillation. Consistent with this, the authors show that mkp1 gene has a per1-like promoter that contains 2 functionally distinct elements: cAMP-responsive element (CRE) and E-box. CRE sites present in the mkp1 promoter constitute the functional binding sites for the CRE binding protein (CREB), which serves as an important regulator that mediates the light-induced signaling cascades in the SCN neurons. Furthermore, the authors show that the E-box present in the mkp1 promoter is necessary and sufficient for transcriptional control exerted by circadian clock core regulators that include a positive complex CLOCK/BMAL1 and a negative factor CRY1. The authors' studies on mkp1 have identified for the first time a gene encoding a phosphatase that functions in light-dependent and time-of-day-dependent manners in the mammalian central clock structure SCN.

  16. Role of Protein Phosphorylation and Tyrosine Phosphatases in the Adrenal Regulation of Steroid Synthesis and Mitochondrial Function

    PubMed Central

    Paz, Cristina; Cornejo Maciel, Fabiana; Gorostizaga, Alejandra; Castillo, Ana F.; Mori Sequeiros García, M. Mercedes; Maloberti, Paula M.; Orlando, Ulises D.; Mele, Pablo G.; Poderoso, Cecilia; Podesta, Ernesto J.

    2016-01-01

    In adrenocortical cells, adrenocorticotropin (ACTH) promotes the activation of several protein kinases. The action of these kinases is linked to steroid production, mainly through steroidogenic acute regulatory protein (StAR), whose expression and activity are dependent on protein phosphorylation events at genomic and non-genomic levels. Hormone-dependent mitochondrial dynamics and cell proliferation are functions also associated with protein kinases. On the other hand, protein tyrosine dephosphorylation is an additional component of the ACTH signaling pathway, which involves the “classical” protein tyrosine phosphatases (PTPs), such as Src homology domain (SH) 2-containing PTP (SHP2c), and members of the MAP kinase phosphatase (MKP) family, such as MKP-1. PTPs are rapidly activated by posttranslational mechanisms and participate in hormone-stimulated steroid production. In this process, the SHP2 tyrosine phosphatase plays a crucial role in a mechanism that includes an acyl-CoA synthetase-4 (Acsl4), arachidonic acid (AA) release and StAR induction. In contrast, MKPs in steroidogenic cells have a role in the turn-off of the hormonal signal in ERK-dependent processes such as steroid synthesis and, perhaps, cell proliferation. This review analyzes the participation of these tyrosine phosphates in the ACTH signaling pathway and the action of kinases and phosphatases in the regulation of mitochondrial dynamics and steroid production. In addition, the participation of kinases and phosphatases in the signal cascade triggered by different stimuli in other steroidogenic tissues is also compared to adrenocortical cell/ACTH and discussed. PMID:27375556

  17. Rif1 controls DNA replication by directing Protein Phosphatase 1 to reverse Cdc7-mediated phosphorylation of the MCM complex.

    PubMed

    Hiraga, Shin-Ichiro; Alvino, Gina M; Chang, Fujung; Lian, Hui-Yong; Sridhar, Akila; Kubota, Takashi; Brewer, Bonita J; Weinreich, Michael; Raghuraman, M K; Donaldson, Anne D

    2014-02-15

    Initiation of eukaryotic DNA replication requires phosphorylation of the MCM complex by Dbf4-dependent kinase (DDK), composed of Cdc7 kinase and its activator, Dbf4. We report here that budding yeast Rif1 (Rap1-interacting factor 1) controls DNA replication genome-wide and describe how Rif1 opposes DDK function by directing Protein Phosphatase 1 (PP1)-mediated dephosphorylation of the MCM complex. Deleting RIF1 partially compensates for the limited DDK activity in a cdc7-1 mutant strain by allowing increased, premature phosphorylation of Mcm4. PP1 interaction motifs within the Rif1 N-terminal domain are critical for its repressive effect on replication. We confirm that Rif1 interacts with PP1 and that PP1 prevents premature Mcm4 phosphorylation. Remarkably, our results suggest that replication repression by Rif1 is itself also DDK-regulated through phosphorylation near the PP1-interacting motifs. Based on our findings, we propose that Rif1 is a novel PP1 substrate targeting subunit that counteracts DDK-mediated phosphorylation during replication. Fission yeast and mammalian Rif1 proteins have also been implicated in regulating DNA replication. Since PP1 interaction sites are evolutionarily conserved within the Rif1 sequence, it is likely that replication control by Rif1 through PP1 is a conserved mechanism.

  18. Matrix gla protein and alkaline phosphatase are differently modulated in human dermal fibroblasts from PXE patients and controls.

    PubMed

    Boraldi, Federica; Annovi, Giulia; Vermeer, Cees; Schurgers, Leon J; Trenti, Tommaso; Tiozzo, Roberta; Guerra, Deanna; Quaglino, Daniela

    2013-04-01

    Mineralization of elastic fibers in pseudoxanthoma elasticum (PXE) has been associated with low levels of carboxylated matrix gla protein (MGP), most likely as a consequence of reduced vitamin K (vit K) availability. Unexpectedly, vit K supplementation does not exert beneficial effects on soft connective tissue mineralization in the PXE animal model. To understand the effects of vit K supplementation and in the attempt to interfere with pathways leading to the accumulation of calcium and phosphate within PXE-mineralized soft connective tissues, we have conducted in vitro studies on dermal fibroblasts isolated from control subjects and from PXE patients. Cells were cultured in standard conditions and in calcifying medium (CM) in the presence of vit K1 and K2, or levamisole, an alkaline phosphatase (ALP) inhibitor. Control and PXE fibroblasts were characterized by a similar dose-dependent uptake of both vit K1 and vit K2, thus promoting a significant increase of total protein carboxylation in all cell lines. Nevertheless, MGP carboxylation remained much less in PXE fibroblasts. Interestingly, PXE fibroblasts exhibited a significantly higher ALP activity. Consistently, the mineralization process induced in vitro by a long-term culture in CM appeared unaffected by vit K, whereas it was abolished by levamisole.

  19. CRL4-DCAF1 ubiquitin E3 ligase directs protein phosphatase 2A degradation to control oocyte meiotic maturation.

    PubMed

    Yu, Chao; Ji, Shu-Yan; Sha, Qian-Qian; Sun, Qing-Yuan; Fan, Heng-Yu

    2015-08-18

    Oocyte meiosis is a specialized cell cycle that gives rise to fertilizable haploid gametes and is precisely controlled in various dimensions. We recently found that E3 ubiquitin ligase CRL4 is required for female fertility by regulating DNA hydroxymethylation to maintain oocyte survival and to promote zygotic genome reprogramming. However, not all phenotypes of CRL4-deleted oocytes could be explained by this mechanism. Here we show that CRL4 controls oocyte meiotic maturation by proteasomal degradation of protein phosphatase 2A scaffold subunit, PP2A-A. Oocyte-specific deletion of DDB1 or DCAF1 (also called VPRBP) results in delayed meiotic resumption and failure to complete meiosis I along with PP2A-A accumulation. DCAF1 directly binds to and results in the poly-ubiquitination of PP2A-A. Moreover, combined deletion of Ppp2r1a rescues the meiotic defects caused by DDB1/DCAF1 deficiency. These results provide in vivo evidence that CRL4-directed PP2A-A degradation is physiologically essential for regulating oocyte meiosis and female fertility.

  20. Mitogen-activated protein kinase phosphatase-1 expression in macrophages is controlled by lymphocytes during macrophage activation.

    PubMed

    Luo, Chong; Yang, Xiqiang; Yao, Lan; Jiang, Liping; Liu, Wei; Li, Xin; Wang, Lijia

    2012-01-01

    The viewpoints on the control of innate immune cells by the adaptive immune system during sepsis remain controversial. Mitogen-activated protein kinase phosphatase-1 (MKP-1) is essential to the negative control of innate immunity and suppresses the activation of macrophages by inhibiting activated mitogen-activated protein kinase (MAPK). The purpose of the current study was to observe inflammatory response and macrophage activation in mice with severe combined immunodeficiency (SCID) with endotoxemia and to determine the role of MKP-1 in the control of macrophage activation by the adaptive immune system. Endotoxemia was induced in wild-type and SCID mice by an intraperitoneal injection of lipopolysaccharide (LPS), and all of the SCID mice died. SCID mice produced more inflammatory cytokines than BALB/c mice systemically and locally. TNF-α mRNA expression was higher and MKP-1 mRNA expression was lower in peritoneal macrophages (PMa) from SCID mice compared to PMa from wild-type mice after and even before LPS injection. Thioglycollate-stimulated PMa from wild-type mice were stimulated with LPS in vitro in the presence or absence of pan-T cells. The levels of TNF-α and IL-6 were higher in the supernatants from PMa cultured alone compared to PMa co-cultured with pan-T cells, and PMa MKP-1 mRNA and protein expression were higher when PMa were co-cultured with pan-T cells. Therefore, pan-T cells can up-regulate MKP-1 expression in macrophages and inhibit the secretion of inflammatory cytokines secretion by macrophages. In SCID mice, lymphocyte deficiency, especially T cell deficiency, causes insufficient MKP-1 expression in macrophages, which can be responsible for the severe inflammation and bad prognosis of septic SCID mice. MKP-1 plays an important role in the control of macrophage activation by the adaptive immune system.

  1. Activity of guard cell anion channel SLAC1 is controlled by drought-stress signaling kinase-phosphatase pair

    PubMed Central

    Geiger, Dietmar; Scherzer, Sönke; Mumm, Patrick; Stange, Annette; Marten, Irene; Bauer, Hubert; Ache, Peter; Matschi, Susanne; Liese, Anja; Al-Rasheid, Khaled A. S.; Romeis, Tina; Hedrich, Rainer

    2009-01-01

    In response to drought stress the phytohormone ABA (abscisic acid) induces stomatal closure and, therein, activates guard cell anion channels in a calcium-dependent as well as-independent manner. Two key components of the ABA signaling pathway are the protein kinase OST1 (open stomata 1) and the protein phosphatase ABI1 (ABA insensitive 1). The recently identified guard cell anion channel SLAC1 appeared to be the key ion channel in this signaling pathway but remained electrically silent when expressed heterologously. Using split YFP assays, we identified OST1 as an interaction partner of SLAC1 and ABI1. Upon coexpression of SLAC1 with OST1 in Xenopus oocytes, SLAC1-related anion currents appeared similar to those observed in guard cells. Integration of ABI1 into the SLAC1/OST1 complex, however, prevented SLAC1 activation. Our studies demonstrate that SLAC1 represents the slow, deactivating, weak voltage-dependent anion channel of guard cells controlled by phosphorylation/dephosphorylation. PMID:19955405

  2. Protein Kinase C Controls Binding of Igo/ENSA Proteins to Protein Phosphatase 2A in Budding Yeast.

    PubMed

    Thai, Vu; Dephoure, Noah; Weiss, Amit; Ferguson, Jacqueline; Leitao, Ricardo; Gygi, Steven P; Kellogg, Douglas R

    2017-03-24

    Protein phosphatase 2A (PP2A) plays important roles in controlling mitosis in all eukaryotic cells. The form of PP2A that controls mitosis is associated with a conserved regulatory subunit that is called B55 in vertebrates and Cdc55 in budding yeast. The activity of this form of PP2A can be inhibited by binding of conserved Igo/ENSA proteins. Although the mechanisms that activate Igo/ENSA to bind and inhibit PP2A are well understood, little is known about how Igo/Ensa are inactivated. Here, we have analyzed regulation of Igo/ENSA in the context of a checkpoint pathway that links mitotic entry to membrane growth in budding yeast. Protein kinase C (Pkc1) relays signals in the pathway by activating PP2A(Cdc55) We discovered that constitutively active Pkc1 can drive cells through a mitotic checkpoint arrest, which suggests that Pkc1-dependent activation of PP2A(Cdc55) plays a critical role in checkpoint signaling. We therefore used mass spectrometry to determine how Pkc1 modifies the PP2A(Cdc55) complex. This revealed that Pkc1 induces changes in the phosphorylation of multiple subunits of the complex, as well as dissociation of Igo/ENSA. Pkc1 directly phosphorylates Cdc55 and Igo/ENSA, and phosphorylation site mapping and mutagenesis indicate that phosphorylation of Cdc55 contributes to Igo/ENSA dissociation. Association of Igo2 with PP2A(Cdc55) is regulated during the cell cycle, yet mutation of Pkc1-dependent phosphorylation sites on Cdc55 and Igo2 did not cause defects in mitotic progression. Together, the data suggest that Pkc1 controls PP2A(Cdc55) by multiple overlapping mechanisms. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. The control of inflammation via the phosphorylation and dephosphorylation of tristetraprolin: a tale of two phosphatases.

    PubMed

    Clark, Andrew R; Dean, Jonathan L E

    2016-10-15

    Twenty years ago, the first description of a tristetraprolin (TTP) knockout mouse highlighted the fundamental role of TTP in the restraint of inflammation. Since then, work from several groups has generated a detailed picture of the expression and function of TTP. It is a sequence-specific RNA-binding protein that orchestrates the deadenylation and degradation of several mRNAs encoding inflammatory mediators. It is very extensively post-translationally modified, with more than 30 phosphorylations that are supported by at least two independent lines of evidence. The phosphorylation of two particular residues, serines 52 and 178 of mouse TTP (serines 60 and 186 of the human orthologue), has profound effects on the expression, function and localisation of TTP. Here, we discuss the control of TTP biology via its phosphorylation and dephosphorylation, with a particular focus on recent advances and on questions that remain unanswered.

  4. The control of inflammation via the phosphorylation and dephosphorylation of tristetraprolin: a tale of two phosphatases

    PubMed Central

    Clark, Andrew R.; Dean, Jonathan L.E.

    2016-01-01

    Twenty years ago, the first description of a tristetraprolin (TTP) knockout mouse highlighted the fundamental role of TTP in the restraint of inflammation. Since then, work from several groups has generated a detailed picture of the expression and function of TTP. It is a sequence-specific RNA-binding protein that orchestrates the deadenylation and degradation of several mRNAs encoding inflammatory mediators. It is very extensively post-translationally modified, with more than 30 phosphorylations that are supported by at least two independent lines of evidence. The phosphorylation of two particular residues, serines 52 and 178 of mouse TTP (serines 60 and 186 of the human orthologue), has profound effects on the expression, function and localisation of TTP. Here, we discuss the control of TTP biology via its phosphorylation and dephosphorylation, with a particular focus on recent advances and on questions that remain unanswered. PMID:27911715

  5. Yeast PAH1-encoded phosphatidate phosphatase controls the expression of CHO1-encoded phosphatidylserine synthase for membrane phospholipid synthesis.

    PubMed

    Han, Gil-Soo; Carman, George M

    2017-08-11

    The PAH1-encoded phosphatidate phosphatase (PAP), which catalyzes the committed step for the synthesis of triacylglycerol in Saccharomyces cerevisiae, exerts a negative regulatory effect on the level of phosphatidate used for the de novo synthesis of membrane phospholipids. This raises the question whether PAP thereby affects the expression and activity of enzymes involved in phospholipid synthesis. Here, we examined the PAP-mediated regulation of CHO1-encoded phosphatidylserine synthase (PSS), which catalyzes the committed step for the synthesis of major phospholipids via the CDP-diacylglycerol pathway. The lack of PAP in the pah1Δ mutant highly elevated PSS activity, exhibiting a growth-dependent up-regulation from the exponential to the stationary phase of growth. Immunoblot analysis showed that the elevation of PSS activity results from an increase in the level of the enzyme encoded by CHO1 Truncation analysis and site-directed mutagenesis of the CHO1 promoter indicated that Cho1 expression in the pah1Δ mutant is induced through the inositol-sensitive upstream activation sequence (UASINO), a cis-acting element for the phosphatidate-controlled Henry (Ino2-Ino4/Opi1) regulatory circuit. The abrogation of Cho1 induction and PSS activity by a CHO1 UASINO mutation suppressed pah1Δ effects on lipid synthesis, nuclear/endoplasmic reticulum membrane morphology, and lipid droplet formation, but not on growth at elevated temperature. Loss of the DGK1-encoded diacylglycerol kinase, which converts diacylglycerol to phosphatidate, partially suppressed the pah1Δ-mediated induction of Cho1 and PSS activity. Collectively, these data showed that PAP activity controls the expression of PSS for membrane phospholipid synthesis. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Multilevel Control of Arabidopsis 3-Hydroxy-3-Methylglutaryl Coenzyme A Reductase by Protein Phosphatase 2A[W

    PubMed Central

    Leivar, Pablo; Antolín-Llovera, Meritxell; Ferrero, Sergi; Closa, Marta; Arró, Montserrat; Ferrer, Albert; Boronat, Albert; Campos, Narciso

    2011-01-01

    Plants synthesize a myriad of isoprenoid products that are required both for essential constitutive processes and for adaptive responses to the environment. The enzyme 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) catalyzes a key regulatory step of the mevalonate pathway for isoprenoid biosynthesis and is modulated by many endogenous and external stimuli. In spite of that, no protein factor interacting with and regulating plant HMGR in vivo has been described so far. Here, we report the identification of two B′′ regulatory subunits of protein phosphatase 2A (PP2A), designated B′′α and B′′β, that interact with HMGR1S and HMGR1L, the major isoforms of Arabidopsis thaliana HMGR. B′′α and B′′β are Ca2+ binding proteins of the EF-hand type. We show that HMGR transcript, protein, and activity levels are modulated by PP2A in Arabidopsis. When seedlings are transferred to salt-containing medium, B′′α and PP2A mediate the decrease and subsequent increase of HMGR activity, which results from a steady rise of HMGR1-encoding transcript levels and an initial sharper reduction of HMGR protein level. In unchallenged plants, PP2A is a posttranslational negative regulator of HMGR activity with the participation of B′′β. Our data indicate that PP2A exerts multilevel control on HMGR through the five-member B′′ protein family during normal development and in response to a variety of stress conditions. PMID:21478440

  7. The matricellular protein CCN1 controls retinal angiogenesis by targeting VEGF, Src homology 2 domain phosphatase-1 and Notch signaling.

    PubMed

    Chintala, Hemabindu; Krupska, Izabela; Yan, Lulu; Lau, Lester; Grant, Maria; Chaqour, Brahim

    2015-07-01

    Physiological angiogenesis depends on the highly coordinated actions of multiple angiogenic regulators. CCN1 is a secreted cysteine-rich and integrin-binding matricellular protein required for proper cardiovascular development. However, our understanding of the cellular origins and activities of this molecule is incomplete. Here, we show that CCN1 is predominantly expressed in angiogenic endothelial cells (ECs) at the leading front of actively growing vessels in the mouse retina. Endothelial deletion of CCN1 in mice using a Cre-Lox system is associated with EC hyperplasia, loss of pericyte coverage and formation of dense retinal vascular networks lacking the normal hierarchical arrangement of arterioles, capillaries and venules. CCN1 is a product of an immediate-early gene that is transcriptionally induced in ECs in response to stimulation by vascular endothelial growth factor (VEGF). We found that CCN1 activity is integrated with VEGF receptor 2 (VEGF-R2) activation and downstream signaling pathways required for tubular network formation. CCN1-integrin binding increased the expression of and association between Src homology 2 domain-containing protein tyrosine phosphatase-1 (SHP-1) and VEGF-R2, which leads to rapid dephosphorylation of VEGF-R2 tyrosine, thus preventing EC hyperproliferation. Predictably, CCN1 further brings receptors/signaling molecules into proximity that are otherwise spatially separated. Furthermore, CCN1 induces integrin-dependent Notch activation in cultured ECs, and its targeted gene inactivation in vivo alters Notch-dependent vascular specification and remodeling, suggesting that functional levels of Notch signaling requires CCN1 activity. These data highlight novel functions of CCN1 as a naturally optimized molecule, fine-controlling key processes in physiological angiogenesis and safeguarding against aberrant angiogenic responses.

  8. An ABA-regulated and Golgi-localized protein phosphatase controls water loss during leaf senescence in Arabidopsis.

    PubMed

    Zhang, Kewei; Xia, Xiuying; Zhang, Yanyan; Gan, Su-Sheng

    2012-02-01

    It is known that a senescing leaf loses water faster than a non-senescing leaf and that ABA has an important role in promoting leaf senescence. However, questions such as why water loss is faster, how water loss is regulated, and how ABA functions in leaf senescence are not well understood. Here we report on the identification and functional analysis of a leaf senescence associated gene called SAG113. The RNA blot and GUS reporter analyses all show that SAG113 is expressed in senescing leaves and is induced by ABA in Arabidopsis. The SAG113 expression levels are significantly reduced in aba2 and abi4 mutants. A GFP fusion protein analysis revealed that SAG113 protein is localized in the Golgi apparatus. SAG113 encodes a protein phosphatase that belongs to the PP2C family and is able to functionally complement a yeast PP2C-deficient mutant TM126 (ptc1Δ). Leaf senescence is delayed in the SAG113 knockout mutant compared with that in the wild type, stomatal movement in the senescing leaves of SAG113 knockouts is more sensitive to ABA than that of the wild type, and the rate of water loss in senescing leaves of SAG113 knockouts is significantly reduced. In contrast, inducible over-expression of SAG113 results in a lower sensitivity of stomatal movement to ABA treatment, more rapid water loss, and precocious leaf senescence. No other aspects of growth and development, including seed germination, were observed. These findings suggest that SAG113, a negative regulator of ABA signal transduction, is specifically involved in the control of water loss during leaf senescence.

  9. The matricellular protein CCN1 controls retinal angiogenesis by targeting VEGF, Src homology 2 domain phosphatase-1 and Notch signaling

    PubMed Central

    Chintala, Hemabindu; Krupska, Izabela; Yan, Lulu; Lau, Lester; Grant, Maria; Chaqour, Brahim

    2015-01-01

    Physiological angiogenesis depends on the highly coordinated actions of multiple angiogenic regulators. CCN1 is a secreted cysteine-rich and integrin-binding matricellular protein required for proper cardiovascular development. However, our understanding of the cellular origins and activities of this molecule is incomplete. Here, we show that CCN1 is predominantly expressed in angiogenic endothelial cells (ECs) at the leading front of actively growing vessels in the mouse retina. Endothelial deletion of CCN1 in mice using a Cre-Lox system is associated with EC hyperplasia, loss of pericyte coverage and formation of dense retinal vascular networks lacking the normal hierarchical arrangement of arterioles, capillaries and venules. CCN1 is a product of an immediate-early gene that is transcriptionally induced in ECs in response to stimulation by vascular endothelial growth factor (VEGF). We found that CCN1 activity is integrated with VEGF receptor 2 (VEGF-R2) activation and downstream signaling pathways required for tubular network formation. CCN1-integrin binding increased the expression of and association between Src homology 2 domain-containing protein tyrosine phosphatase-1 (SHP-1) and VEGF-R2, which leads to rapid dephosphorylation of VEGF-R2 tyrosine, thus preventing EC hyperproliferation. Predictably, CCN1 further brings receptors/signaling molecules into proximity that are otherwise spatially separated. Furthermore, CCN1 induces integrin-dependent Notch activation in cultured ECs, and its targeted gene inactivation in vivo alters Notch-dependent vascular specification and remodeling, suggesting that functional levels of Notch signaling requires CCN1 activity. These data highlight novel functions of CCN1 as a naturally optimized molecule, fine-controlling key processes in physiological angiogenesis and safeguarding against aberrant angiogenic responses. PMID:26002917

  10. Enzymes that control the thiamine diphosphate pool in plant tissues. Properties of thiamine pyrophosphokinase and thiamine-(di)phosphate phosphatase purified from Zea mays seedlings.

    PubMed

    Rapala-Kozik, Maria; Gołda, Anna; Kujda, Marta

    2009-04-01

    The pool of thiamine diphosphate (TDP), available for TDP-dependent enzymes involved in the major carbohydrate metabolic pathways, is controlled by two enzyme systems that act in the opposite directions. The thiamine pyrophosphokinase (TPK) activates thiamine into TDP and the numerous phosphatases perform the reverse two-step dephosphorylation of TDP to thiamine monophosphate (TMP) and then to free thiamine. Properties and a possible cooperation of those enzymes in higher plants have not been extensively studied. In this work, we characterize highly purified preparations of TPK and a TDP/TMP phosphatase isolated from 6-day Zea mays seedlings. TPK was the 29-kDa monomeric protein, with the optimal activity at pH 9.0, the K(m) values of 12.4microM and 4.7mM for thiamine and ATP, respectively, and the V(max) value of 360pmol TDPmin(-1)mg(-1) protein. The enzyme required magnesium ions, and the best phosphate donor was GTP. The purified phosphatase was the dimer of 24kDa subunits, showed the optimal activity at pH 5.0 and had a rather broad substrate specificity, although TDP, but not TMP, was one of the preferable substrates. The K(m) values for TDP and TMP were 36microM and 49microM, respectively, and the V(max) value for TDP was significantly higher than for TMP (164 versus 60nmolesmin(-1)mg(-1) protein). The total activities of TPK and TDP phosphatases were similarly decreased when the seedlings were grown under the illumination, suggesting a coordinated regulation of both enzymes to stabilize the pool of the essential coenzyme.

  11. Regulation of tyrosine phosphatases in the adventitia during vascular remodelling

    SciTech Connect

    Micke, Patrick; Hackbusch, Daniel; Mercan, Sibel; Stawowy, Philipp; Ostman, Arne; Kappert, Kai

    2009-05-15

    Protein tyrosine phosphatases (PTPs) are regulators of growth factor signalling in vascular remodelling. The aim of this study was to evaluate PTP expression in the context of PDGF-signalling in the adventitia after angioplasty. Utilising a rat carotid artery model, the adventitial layers of injured and non-injured vessels were laser microdissected. The mRNA expression of the PDGF {beta}-receptor, the ligands PDGF-A/B/C/D and the receptor-antagonising PTPs (DEP-1, TC-PTP, SHP-2, PTP1B) were determined and correlated to vascular morphometrics, proliferation markers and PDGF {beta}-receptor phosphorylation. The levels of the PDGF {beta}-receptor, PDGF-C and PDGF-D were upregulated concurrently with the antagonising PTPs DEP-1 and TC-PTP at day 8, and normalised at day 14 after vessel injury. Although the proliferation parameters were time-dependently altered in the adventitial layer, the phosphorylation of the PDGF {beta}-receptor remained unchanged. The expression dynamics of specific PTPs indicate a regulatory role of PDGF-signalling also in the adventitia during vascular remodelling.

  12. Chlorella powder inhibits the activities of peptidase cathepsin S, PLA2, cyclooxygenase-2, thromboxane synthase, tyrosine phosphatases, tumor necrosis factor-alpha converting enzyme, calpain and kinases.

    PubMed

    Cheng, Fong-Chi; Feng, Jin-Jye; Chen, Kuo-Hsin; Imanishi, Hideyo; Fujishima, Masaki; Takekoshi, Hideo; Naoki, Yo; Shimoda, Minoru

    2009-01-01

    A Chlorella powder was tested in 118 in vitro enzyme assay systems. The powder showed potent inhibitions of peptidase cathepsin S, thromboxane A(2) synthase and cyclooxygenase-2 in a dose-concentration manner with IC(50)+/-standard error of the mean values of 3.46+/-0.93 microg/ml, 3.23+/-0.69 microg/ml, and 44.26+/-9.98 microg/ml, respectively. Other activities observed were inhibitions of tumor necrosis factor-alpha converting enzyme, protein tyrosine phosphatase (SHP-2), calpain, protein kinases and protein tyrosine phosphatases. Chlorella powder had no significant effect on cyclooxygenase-1. These actions to inhibit cyclooxygenase-2 and thromboxane synthase could contribute to the purported anti-inflammatory and anti-thrombotic effects of Chlorella. These results reveal important potential biochemical activities to be developed that, if confirmed by in vivo studies, might be exploited for the prevention or treatment of several serious pathologies, including inflammatory diseases, immune and cancer.

  13. Negative Feed-forward Control of Tumor Necrosis Factor (TNF) by Tristetraprolin (ZFP36) Is Limited by the Mitogen-activated Protein Kinase Phosphatase, Dual-specificity Phosphatase 1 (DUSP1)

    PubMed Central

    Shah, Suharsh; Mostafa, Mahmoud M.; McWhae, Andrew; Traves, Suzanne L.; Newton, Robert

    2016-01-01

    TNF is central to inflammation and may play a role in the pathogenesis of asthma. The 3′-untranslated region of the TNF transcript contains AU-rich elements (AREs) that are targeted by the RNA-binding protein, tristetraprolin (also known as zinc finger protein 36 (ZFP36)), which is itself up-regulated by inflammatory stimuli, to promote mRNA degradation. Using primary human bronchial epithelial and pulmonary epithelial A549 cells, we confirm that interleukin-1β (IL1B) induces expression of dual-specificity phosphatase 1 (DUSP1), ZFP36, and TNF. Whereas IL1B-induced DUSP1 is involved in feedback control of MAPK pathways, ZFP36 exerts negative (incoherent) feed-forward control of TNF mRNA and protein expression. DUSP1 silencing increased IL1B-induced ZFP36 expression at 2 h and profoundly repressed TNF mRNA at 6 h. This was partly due to increased TNF mRNA degradation, an effect that was reduced by ZFP36 silencing. This confirms a regulatory network, whereby DUSP1-dependent negative feedback control reduces feed-forward control by ZFP36. Conversely, whereas DUSP1 overexpression and inhibition of MAPKs prevented IL1B-induced expression of ZFP36, this was associated with increased TNF mRNA expression at 6 h, an effect that was predominantly due to elevated transcription. This points to MAPK-dependent feed-forward control of TNF involving ZFP36-dependent and -independent mechanisms. In terms of repression by dexamethasone, neither silencing of DUSP1, silencing of ZFP36, nor silencing of both together prevented the repression of IL1B-induced TNF expression, thereby demonstrating the need for further repressive mechanisms by anti-inflammatory glucocorticoids. In summary, these data illustrate why understanding the competing effects of feedback and feed-forward control is relevant to the development of novel anti-inflammatory therapies. PMID:26546680

  14. Teaching resources. Protein phosphatases.

    PubMed

    Salton, Stephen R

    2005-03-01

    This Teaching Resource provides lecture notes and slides for a class covering the structure and function of protein phosphatases and is part of the course "Cell Signaling Systems: A Course for Graduate Students." The lecture begins with a discussion of the importance of phosphatases in physiology, recognized by the award of a Nobel Prize in 1992, and then proceeds to describe the two types of protein phosphatases: serine/threonine and tyrosine phosphatases. The information covered includes the structure, regulation, and substrate specificity of protein phosphatases, with an emphasis on their importance in disease and clinical settings.

  15. Inositol polyphosphate 5-phosphatase-controlled Ins(1,4,5)P3/Ca2+ is crucial for maintaining pollen dormancy and regulating early germination of pollen.

    PubMed

    Wang, Yuan; Chu, Yu-Jia; Xue, Hong-Wei

    2012-06-01

    Appropriate pollen germination is crucial for plant reproduction. Previous studies have revealed the importance of dehydration in maintaining pollen dormancy; here, we show that phosphatidylinositol pathway-controlled Ins(1,4,5)P(3)/Ca(2+) levels are crucial for maintaining pollen dormancy in Arabidopsis thaliana. An interesting phenotype, precocious pollen germination within anthers, results from a disruption of inositol polyphosphate 5-phosphatase 12 (5PT12). The knockout mutant 5pt12 has normal early pollen development and pollen dehydration, and exhibits hypersensitive ABA responses, indicating that precocious pollen germination is not caused either by abnormal dehydration or by suppressed ABA signaling. Deficiency of 5PT13 (a close paralog of 5PT12) synergistically enhances precocious pollen germination. Both basal Ins(1,4,5)P(3) levels and endogenous Ca(2+) levels are elevated in pollen from 5pt12 mutants, and 5pt12 5pt13 double mutants show an even higher precocious germination rate along with much higher levels of Ins(1,4,5)P(3)/Ca(2+). Strikingly, exogenous Ca(2+) stimulates the germination of wild-type pollen at floral stage 12, even in very low humidity, both in vitro and in vivo, and treatment with BAPTA, a [Ca(2+)](cyt) inhibitor, reduces the precocious pollen germination rates of 5pt12, 5pt13 and 5pt12 5pt13 mutants. These results indicate that the increase in the levels of Ins(1,4,5)P(3)/Ca(2+) caused by deficiency of inositol polyphosphate 5-phosphatases is sufficient to break pollen dormancy and to trigger early germination. The study reveals that independent of dehydration, the control of Ins(1,4,5)P(3)/Ca(2+) levels by Inositol polyphosphate 5-phosphatases is crucial for maintaining pollen dormancy.

  16. Pleckstrin Homology (PH) Domain Leucine-rich Repeat Protein Phosphatase Controls Cell Polarity by Negatively Regulating the Activity of Atypical Protein Kinase C.

    PubMed

    Xiong, Xiaopeng; Li, Xin; Wen, Yang-An; Gao, Tianyan

    2016-11-25

    The proper establishment of epithelial polarity allows cells to sense and respond to signals that arise from the microenvironment in a spatiotemporally controlled manner. Atypical PKCs (aPKCs) are implicated as key regulators of epithelial polarity. However, the molecular mechanism underlying the negative regulation of aPKCs remains largely unknown. In this study, we demonstrated that PH domain leucine-rich repeat protein phosphatase (PHLPP), a novel family of Ser/Thr protein phosphatases, plays an important role in regulating epithelial polarity by controlling the phosphorylation of both aPKC isoforms. Altered expression of PHLPP1 or PHLPP2 disrupted polarization of Caco2 cells grown in 3D cell cultures as indicated by the formation of aberrant multi-lumen structures. Overexpression of PHLPP resulted in a decrease in aPKC phosphorylation at both the activation loop and the turn motif sites; conversely, knockdown of PHLPP increased aPKC phosphorylation. Moreover, in vitro dephosphorylation experiments revealed that both aPKC isoforms were substrates of PHLPP. Interestingly, knockdown of PKCζ, but not PKCι, led to similar disruption of the polarized lumen structure, suggesting that PKCζ likely controls the polarization process of Caco2 cells. Furthermore, knockdown of PHLPP altered the apical membrane localization of aPKCs and reduced the formation of aPKC-Par3 complex. Taken together, our results identify a novel role of PHLPP in regulating aPKC and cell polarity. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. S-nitrosylation of endogenous protein tyrosine phosphatases in endothelial insulin signaling.

    PubMed

    Hsu, Ming-Fo; Pan, Kuan-Ting; Chang, Fan-Yu; Khoo, Kay-Hooi; Urlaub, Henning; Cheng, Ching-Feng; Chang, Geen-Dong; Haj, Fawaz G; Meng, Tzu-Ching

    2016-10-01

    Nitric oxide (NO) exerts its biological function through S-nitrosylation of cellular proteins. Due to the labile nature of this modification under physiological condition, identification of S-nitrosylated residue in enzymes involved in signaling regulation remains technically challenging. The present study investigated whether intrinsic NO produced in endothelium-derived MS-1 cells response to insulin stimulation might target endogenous protein tyrosine phosphatases (PTPs). For this, we have developed an approach using a synthetic reagent that introduces a phenylacetamidyl moiety on S-nitrosylated Cys, followed by detection with anti-phenylacetamidyl Cys (PAC) antibody. Coupling with sequential blocking of free thiols with multiple iodoacetyl-based Cys-reactive chemicals, we employed this PAC-switch method to show that endogenous SHP-2 and PTP1B were S-nitrosylated in MS-1 cells exposed to insulin. The mass spectrometry detected a phenylacetamidyl moiety specifically present on the active-site Cys463 of SHP-2. Focusing on the regulatory role of PTP1B, we showed S-nitrosylation to be the principal Cys reversible redox modification in endothelial insulin signaling. The PAC-switch method in an imaging format illustrated that a pool of S-nitrosylated PTP1B was colocalized with activated insulin receptor to the cell periphery, and that such event was endothelial NO synthase (eNOS)-dependent. Moreover, ectopic expression of the C215S mutant of PTP1B that mimics the active-site Cys215 S-nitrosylated form restored insulin responsiveness in eNOS-ablated cells, which was otherwise insensitive to insulin stimulation. This work not only introduces a new method that explores the role of physiological NO in regulating signal transduction, but also highlights a positive NO effect on promoting insulin responsiveness through S-nitrosylation of PTP1B's active-site Cys215.

  18. Selective Regulation of NR2B by Protein Phosphatase-1 for the Control of the NMDA Receptor in Neuroprotection

    PubMed Central

    Grewe, Benjamin F.; Tyagarajan, Shiva K.; Helmchen, Fritjof; Mansuy, Isabelle M.

    2012-01-01

    An imbalance between pro-survival and pro-death pathways in brain cells can lead to neuronal cell death and neurodegeneration. While such imbalance is known to be associated with alterations in glutamatergic and Ca2+ signaling, the underlying mechanisms remain undefined. We identified the protein Ser/Thr phosphatase protein phosphatase-1 (PP1), an enzyme associated with glutamate receptors, as a key trigger of survival pathways that can prevent neuronal death and neurodegeneration in the adult hippocampus. We show that PP1α overexpression in hippocampal neurons limits NMDA receptor overactivation and Ca2+ overload during an excitotoxic event, while PP1 inhibition favors Ca2+ overload and cell death. The protective effect of PP1 is associated with a selective dephosphorylation on a residue phosphorylated by CaMKIIα on the NMDA receptor subunit NR2B, which promotes pro-survival pathways and associated transcriptional programs. These results reveal a novel contributor to the mechanisms of neuroprotection and underscore the importance of PP1-dependent dephosphorylation in these mechanisms. They provide a new target for the development of potential therapeutic treatment of neurodegeneration. PMID:22479519

  19. Association between Phosphatase Related Gene Variants and Coronary Artery Disease: Case-Control Study and Meta-Analysis

    PubMed Central

    Han, Xia; Zhang, Lijun; Zhang, Zhiqiang; Zhang, Zengtang; Wang, Jianchun; Yang, Jun; Niu, Jiamin

    2014-01-01

    Recent studies showed that the serum alkaline phosphatase is an independent predictor of the coronary artery disease (CAD). In this work, we aimed to summarize the association between three phosphatase related single nucleotide polymorphisms (rs12526453, rs11066301 and rs3828329) and the risk of CAD in Han Chinese. Our results showed that the rs3828329 of the ACP1 gene was closely related to the risk of CAD in Han Chinese (OR = 1.45, p = 0.0006). This significant association of rs3828329 with CAD was only found in the females (Additive model: OR = 1.80, p = 0.001; dominant model: OR = 1.69, p = 0.03; recessive model: OR = 1.96, p = 0.0008). Moreover, rs3828329 was likely to exert its effect in females aged 65 years and older (OR = 2.27, p = 0.001). Further meta-analyses showed that the rs12526453 of PHACTR11 gene (OR = 1.14, p < 0.0001, random-effect method) and the rs11066301 of PTPN11 gene (OR = 1.15, p < 0.0001, fixed-effects method) were associated with CAD risk in multiple populations. Our results showed that the polymorphisms rs12526453 and rs11066301 are significantly associated with the CAD risk in multiple populations. The rs3828329 of ACP1 gene is also a risk factor of CAD in Han Chinese females aged 65 years and older. PMID:25123136

  20. c-Jun controls the efficiency of MAP kinase signaling by transcriptional repression of MAP kinase phosphatases

    SciTech Connect

    Sprowles, Amy; Wu Yimi; Kung, H.-J.; Wisdom, Ron . E-mail: ronald.wisdom@ucdmc.ucdavis.edu

    2005-08-15

    The mammalian JNK signaling pathway regulates the transcriptional response of cells to environmental stress, including UV irradiation. This signaling pathway is composed of a classical MAP kinase cascade; activation results in phosphorylation of the transcription factor substrates c-Jun and ATF2, and leads to changes in gene expression. The defining components of this pathway are conserved in the fission yeast S. pombe, where the genetic studies have shown that the ability of the JNK homolog Spc1 to be activated in response to UV irradiation is dependent on the presence of the transcription factor substrate Atf1. We have used genetic analysis to define the role of c-Jun in activation of the mammalian JNK signaling pathway. Our results show that optimal activation of JNK requires the presence of its transcription factor substrate c-Jun. Mutational analysis shows that the ability of c-Jun to support efficient activation of JNK requires the ability of Jun to bind DNA, suggesting a transcriptional mechanism. Consistent with this, we show that c-Jun represses the expression of several MAP kinase phosphatases. In the absence of c-Jun, the increased expression of MAP kinase phosphatases leads to impaired activation of the ERK, JNK, and p38 MAP kinases after pathway activation. The results show that one function of c-Jun is to regulate the efficiency of signaling by the ERK, p38, and JNK MAP kinases, a function that is likely to affect cellular responses to many different stimuli.

  1. Loss of Tyrosine Phosphatase Dependent Inhibition Promotes Activation of Tyrosine Kinase c-Src in Detached Pancreatic Cells

    PubMed Central

    Connelly, Sarah F.; Isley, Beth A.; Baker, Cheryl H.; Gallick, Gary E.; Summy, Justin M.

    2010-01-01

    Despite an intense focus on novel therapeutic strategies, pancreatic adenocarcinoma remains one of the deadliest human malignancies. The frequent and rapid mortality associated with pancreatic cancer may be attributed to several factors, including late diagnosis, rapid tumor invasion into surrounding tissues, and formation of distant metastases. Both local invasion and metastasis require disruption of tumor cell contacts with the extracellular matrix. Detachment of normal cells from the extracellular matrix leads to a form of programmed cell death termed anoikis. Pancreatic cancer cells avert anoikis by activation of signaling pathways that allow for adhesion-independent survival. In the present studies, cellular signaling pathways activated in detached pancreatic cancer cells were examined. We demonstrate a rapid and robust activation of Src kinase in detached pancreatic cancer cells, relative to adherent. Src autophosphorylation rapidly returned to baseline levels upon reattachment to tissue culture plastic, in the presence or absence of specific extracellular matrix proteins. Treatment of pancreatic cancer cells with tyrosine phosphatase inhibitors increased steady-state Src autophosphorylation in adherent cells and abrogated the detachment-induced increase in Src autophosphorylation. Src was found to co-immunoprecipitate with the Src Homology 2 (SH2) domain containing protein tyrosine phosphatase (SHP-2) in pancreatic cancer cells, suggesting that SHP-2 may participate in regulation of Src autophosphorylation in adherent cells. Src family kinase (SFK) dependent increases in Akt and Jun N-terminal kinase (JNK) phosphorylation were observed in detached cells, indicating the potential for Src-dependent activation of survival and stress pathways in pancreatic cancer cells that have detached from the extracellular matrix. PMID:20945416

  2. The Phosphatase PP4c Controls Spindle Orientation to Maintain Proliferative Symmetric Divisions in the Developing Neocortex

    PubMed Central

    Xie, Yunli; Jüschke, Christoph; Esk, Christopher; Hirotsune, Shinji; Knoblich, Juergen A.

    2013-01-01

    Summary In the developing neocortex, progenitor cells expand through symmetric division before they generate cortical neurons through multiple rounds of asymmetric cell division. Here, we show that the orientation of the mitotic spindle plays a crucial role in regulating the transition between those two division modes. We demonstrate that the protein phosphatase PP4c regulates spindle orientation in early cortical progenitor cells. Upon removing PP4c, mitotic spindles fail to orient in parallel to the neuroepithelial surface and progenitors divide with random orientation. As a result, their divisions become asymmetric and neurogenesis starts prematurely. Biochemical and genetic experiments show that PP4c acts by dephosphorylating the microtubule binding protein Ndel1, thereby enabling complex formation with Lis1 to form a functional spindle orientation complex. Our results identify a key regulator of cortical development and demonstrate that changes in the orientation of progenitor division are responsible for the transition between symmetric and asymmetric cell division. PMID:23830831

  3. Resveratrol inhibits collagen-induced platelet stimulation through suppressing NADPH oxidase and oxidative inactivation of SH2 domain-containing protein tyrosine phosphatase-2.

    PubMed

    Jang, Ji Yong; Min, Ji Hyun; Wang, Su Bin; Chae, Yun Hee; Baek, Jin Young; Kim, Myunghee; Ryu, Jae-Sang; Chang, Tong-Shin

    2015-12-01

    Reactive oxygen species (ROS) produced upon collagen stimulation are implicated in propagating various platelet-activating pathways. Among ROS-producing enzymes, NADPH oxidase (NOX) is largely responsible for collagen receptor-dependent ROS production. Therefore, NOX has been proposed as a novel target for the development of antiplatelet agent. We here investigate whether resveratrol inhibits collagen-induced NOX activation and further examine the effects of resveratrol on ROS-dependent signaling pathways in collagen-stimulated platelets. Collagen-induced superoxide anion production in platelets was inhibited by resveratrol. Resveratrol suppressed collagen-induced phosphorylation of p47(phox), a major regulatory subunit of NOX. Correlated with the inhibitory effects on NOX, resveratrol protected SH2 domain-containing protein tyrosine phosphatase-2 (SHP-2) from ROS-mediated inactivation and subsequently attenuated the specific tyrosine phosphorylation of key components (spleen tyrosine kinase, Vav1, Bruton's tyrosine kinase, and phospholipase Cγ2) for collagen receptor signaling cascades. Resveratrol also inhibited downstream responses such as cytosolic calcium elevation, P-selectin surface exposure, and integrin-αIIbβ3 activation. Furthermore, resveratrol inhibited platelet aggregation and adhesion in response to collagen. The antiplatelet effects of resveratrol through the inhibition of NOX-derived ROS production and subsequent oxidative inactivation of SHP-2 suggest that resveratrol is a potential compound for prevention and treatment of thrombovascular diseases.

  4. A novel double-negative feedback loop between miR-489 and the HER2-SHP2-MAPK signaling axis regulates breast cancer cell proliferation and tumor growth.

    PubMed

    Patel, Yogin; Shah, Nirav; Lee, Ji Shin; Markoutsa, Eleni; Jie, Chunfa; Liu, Shou; Botbyl, Rachel; Reisman, David; Xu, Peisheng; Chen, Hexin

    2016-04-05

    Human epidermal growth factor receptor 2 (HER2 or ErBb2) is a receptor tyrosine kinase overexpressed in 20-30% of breast cancers and associated with poor prognosis and outcome. Dysregulation of several microRNAs (miRNAs) plays a key role in breast cancer progression and metastasis. In this study, we screened and identified miRNAs dysregualted in HER2-positive breast cancer cells. Our molecular study demonstrated that miR-489 was specifically downregulated by the HER2-downstream signaling, especially through the MAPK pathway. Restoration or overexpression of miR-489 in HER2-positive breast cancer cells significantly inhibited cell growth in vitro and decreased the tumorigenecity and tumor growth in xenograft mice. Mechanistically, we found that overexpression of miR-489 led to the decreased levels of HER2 and SHP2 and thus attenuated HER2-downstream signaling. Furthermore, we for the first time demonstrated that HER2 is a direct target of miR-489 and therefore HER2-SHP2-MAPK and miR-489 signaling pathways form a mutually inhibitory loop. Using quantitative real-time PCR analysis and Fluorescent in situ hybridization technique (FISH), we found that miR-489 was expressed at significantly lower level in tumor tissues compared to the adjacent normal tissues. Downregulation of miR-489 in breast cancers was associated with aggressive tumor phenotypes. Overall, our results define a double-negative feedback loop involving miR-489 and the HER2-SHP2-MAPK signaling axis that can regulate breast cancer cell proliferation and tumor progression and might have therapeutic relevance for HER2-positive breast cancer.

  5. Structure of Acid phosphatases.

    PubMed

    Araujo, César L; Vihko, Pirkko T

    2013-01-01

    Acid phosphatases are enzymes that have been studied extensively due to the fact that their dysregulation is associated with pathophysiological conditions. This characteristic has been exploited for the development of diagnostic and therapeutic methods. As an example, prostatic acid phosphatase was the first marker for metastatic prostate cancer diagnosis and the dysregulation of tartrate resistant acid phosphatase is associated with abnormal bone resorption linked to osteoporosis. The pioneering crystallization studies on prostatic acid phosphatase and mammalian tartrate-resistant acid phosphatase conformed significant milestones towards the elucidation of the mechanisms followed by these enzymes (Schneider et al., EMBO J 12:2609-2615, 1993). Acid phosphatases are also found in nonmammalian species such as bacteria, fungi, parasites, and plants, and most of them share structural similarities with mammalian acid phosphatase enzymes. Acid phosphatase (EC 3.1.3.2) enzymes catalyze the hydrolysis of phosphate monoesters following the general equation. Phosphate monoester + H2O -->/<-- alcohol + phosphate. The general classification "acid phosphatase" relies only on the optimum acidic pH for the enzymatic activity in assay conditions using non-physiological substrates. These enzymes accept a wide range of substrates in vitro, ranging from small organic molecules to phosphoproteins, constituting a heterogeneous group of enzymes from the structural point of view. These structural differences account for the divergence in cofactor dependences and behavior against substrates, inhibitors, and activators. In this group only the tartrate-resistant acid phosphatase is a metallo-enzyme whereas the other members do not require metal-ion binding for their catalytic activity. In addition, tartrate-resistant acid phosphatase and erythrocytic acid phosphatase are not inhibited by L-(+)-tartrate ion while the prostatic acid phosphatase is tartrate-sensitive. This is an important

  6. The protein tyrosine phosphatase PTP1B is a negative regulator of CD40 and BAFF-R signaling and controls B cell autoimmunity

    PubMed Central

    Hobeika, Elias; Biesen, Robert; Kollert, Florian; Taddeo, Adriano; Voll, Reinhard E.; Hiepe, Falk

    2014-01-01

    Tyrosine phosphorylation of signaling molecules that mediate B cell activation in response to various stimuli is tightly regulated by protein tyrosine phosphatases (PTPs). PTP1B is a ubiquitously expressed tyrosine phosphatase with well-characterized functions in metabolic signaling pathways. We show here that PTP1B negatively regulates CD40, B cell activating factor receptor (BAFF-R), and TLR4 signaling in B cells. Specifically, PTP1B counteracts p38 mitogen-activated protein kinase (MAPK) activation by directly dephosphorylating Tyr182 of this kinase. Mice with a B cell–specific PTP1B deficiency show increased T cell–dependent immune responses and elevated total serum IgG. Furthermore, aged animals develop systemic autoimmunity with elevated serum anti-dsDNA, spontaneous germinal centers in the spleen, and deposition of IgG immune complexes and C3 in the kidney. In a clinical setting, we observed that B cells of rheumatoid arthritis patients have significantly reduced PTP1B expression. Our data suggest that PTP1B plays an important role in the control of B cell activation and the maintenance of immunological tolerance. PMID:24590766

  7. Dual regulation of cofilin activity by LIM kinase and Slingshot-1L phosphatase controls platelet-derived growth factor-induced migration of human aortic smooth muscle cells.

    PubMed

    San Martín, Alejandra; Lee, Moo Yeol; Williams, Holly C; Mizuno, Kensaku; Lassègue, Bernard; Griendling, Kathy K

    2008-02-29

    Platelet-derived growth factor (PDGF) plays a central role in vascular healing, atherosclerosis, and restenosis, partly by stimulating vascular smooth muscle cell (VSMC) migration. Migration requires rapid turnover of actin filaments, which is partially controlled by cofilin. Although cofilin is negatively regulated by Ser3 phosphorylation, the upstream signaling pathways have not been defined, nor has its role in VSMC migration been studied. We hypothesized that PDGF-induced migration of VSMCs involves cofilin activation and that this is regulated by the serine kinase LIM kinase (LIMK) and the novel phosphatase Slingshot (SSH)1L. In human VSMCs, stimulation with PDGF increased G-actin incorporation into the actin cytoskeleton. PDGF transiently activated the cofilin kinase, LIMK, with a peak at 5 minutes. However, cofilin was dephosphorylated between 5 and 45 minutes, with a maximum of 43+/-5% dephosphorylation at 30 minutes, suggesting that PDGF also activates a cofilin phosphatase. We found that VSMCs express SSH1L, which is induced and activated (564+/-73 versus 1021+/-141 picomoles of PO(4); P=0.015) by PDGF. Of importance, small interfering RNA directed against SSH1L blocked cofilin dephosphorylation and decreased migration (528+/-33 versus 318+/-25 cells/field; P<0.01). Taken together, our results suggest that PDGF participates in actin dynamics by dual regulation of cofilin activity via LIMK and SSH1L.

  8. Molecular Control of Acid Phosphatase Secretion into the Rhizosphere of Proteoid Roots from Phosphorus-Stressed White Lupin1

    PubMed Central

    Miller, Susan Stade; Liu, Junqi; Allan, Deborah L.; Menzhuber, Christopher J.; Fedorova, Maria; Vance, Carroll P.

    2001-01-01

    White lupin (Lupinus albus) grown under P deficiency displays a suite of highly coordinated adaptive responses. Included among these is secretion of copious amounts of acid phosphatase (APase). Although numerous reports document that plants secrete APases in response to P deficiency, little is known of the biochemical and molecular events involved in this process. Here we characterize the secreted APase protein, cDNA, and gene from white lupin. The secreted APase enzyme is a glycoprotein with broad substrate specificity. It is synthesized as a preprotein with a deduced Mr of 52,000 containing a 31-amino acid presequence. Analysis of the presequence predicts that the protein is targeted to outside the cell. The processed protein has a predicted Mr of 49,000 but migrates as a protein with Mr of 70,000 on sodium dodecyl sulfate gels. This is likely due to glycosylation. Enhanced expression is fairly specific to proteoid roots of P-stressed plants and involves enhanced synthesis of both enzyme protein and mRNA. Secreted APase appears to be encoded by a single gene containing seven exons interrupted by six introns. The 5′-upstream putative promoter of the white lupin-secreted APase contains a 50-base pair region having 72% identity to an Arabidopsis APase promoter that is responsive to P deficiency. The white lupin-secreted APase promoter and targeting sequence may be useful tools for genetically engineering important proteins from plant roots. PMID:11598233

  9. A complex between contactin-1 and the protein tyrosine phosphatase PTPRZ controls the development of oligodendrocyte precursor cells

    SciTech Connect

    Lamprianou, Smaragda; Chatzopoulou, Elli; Thomas, Jean-Léon; Bouyain, Samuel; Harroch, Sheila

    2013-09-23

    The six members of the contactin (CNTN) family of neural cell adhesion molecules are involved in the formation and maintenance of the central nervous system (CNS) and have been linked to mental retardation and neuropsychiatric disorders such as autism. Five of the six CNTNs bind to the homologous receptor protein tyrosine phosphatases gamma (PTPRG) and zeta (PTPRZ), but the biological roles of these interactions remain unclear. We report here the cocrystal structure of the carbonic anhydrase-like domain of PTPRZ bound to tandem Ig repeats of CNTN1 and combine these structural data with binding assays to show that PTPRZ binds specifically to CNTN1 expressed at the surface of oligodendrocyte precursor cells. Furthermore, analyses of glial cell populations in wild-type and PTPRZ-deficient mice show that the binding of PTPRZ to CNTN1 expressed at the surface of oligodendrocyte precursor cells inhibits their proliferation and promotes their development into mature oligodendrocytes. Overall, these results implicate the PTPRZ/CNTN1 complex as a previously unknown modulator of oligodendrogenesis.

  10. The tail of KdsC: conformational changes control the activity of a haloacid dehalogenase superfamily phosphatase.

    PubMed

    Biswas, Tapan; Yi, Li; Aggarwal, Parag; Wu, Jing; Rubin, John R; Stuckey, Jeanne A; Woodard, Ronald W; Tsodikov, Oleg V

    2009-10-30

    The phosphatase KdsC cleaves 3-deoxy-D-manno-octulosonate 8-phosphate to generate a molecule of inorganic phosphate and Kdo. Kdo is an essential component of the lipopolysaccharide envelope in Gram-negative bacteria. Because lipopolysaccharide is an important determinant of bacterial resistance and toxicity, KdsC is a potential target for novel antibacterial agents. KdsC belongs to the broad haloacid dehalogenase superfamily. In haloacid dehalogenase superfamily enzymes, substrate specificity and catalytic efficiency are generally dictated by a fold feature called the cap domain. It is therefore not clear why KdsC, which lacks a cap domain, is catalytically efficient and highly specific to 3-deoxy-D-manno-octulosonate 8-phosphate. Here, we present a set of seven structures of tetrameric Escherichia coli KdsC (ranging from 1.4 to 3.06 A in resolution) that model different intermediate states in its catalytic mechanism. A crystal structure of product-bound E. coli KdsC shows how the interface between adjacent monomers defines the active site pocket. Kdo is engaged in a network of polar and nonpolar interactions with residues at this interface, which explains substrate specificity. Furthermore, this structural and kinetic analysis strongly suggests that the binding of the flexible C-terminal region (tail) to the active site makes KdsC catalytically efficient by facilitating product release.

  11. Luminescent Aggregated Copper Nanoclusters Nanoswitch Controlled by Hydrophobic Interaction for Real-Time Monitoring of Acid Phosphatase Activity.

    PubMed

    Huang, Yuanyuan; Feng, Hui; Liu, Weidong; Zhou, Yingying; Tang, Cong; Ao, Hang; Zhao, Meizhi; Chen, Guilin; Chen, Jianrong; Qian, Zhaosheng

    2016-12-06

    A reversible luminescence nanoswitch through competitive hydrophobic interaction among copper nanoclusters, p-nitrophenol and α-cyclodextrin is established, and a reliable real-time luminescent assay for acid phosphatase (ACP) activity is developed on the basis of this luminescence nanoswitch. Stable and intensely luminescent copper nanoclusters (CuNCs) were synthesized via a green one-pot approach. The hydrophobic nature of CuNCs aggregate surface is identified, and further used to drive the adsorption of p-nitrophenol on the surface of CuNCs aggregate due to their hydrophobic interaction. This close contact switches off the luminescence of CuNCs aggregate through static quenching mechanism. However, the introduction of α-cyclodextrin switches on the luminescence since stronger host-guest interaction between α-cyclodextrin and p-nitrophenol causes the removal of p-nitrophenol from the surface of CuNCs. This nanoswitch in response to external stimulus p-nitrophenol or α-cyclodextrin can be run in a reversible way. Luminescence quenching by p-nitrophenol is further utilized to develop ACP assay using p-nitrophenyl phosphate ester as the substrate. Quantitative measurement of ACP level with a low detection limit of 1.3 U/L was achieved based on this specific detection strategy. This work reports a luminescence nanoswitch mediated by hydrophobic interaction, and provides a sensitive detection method for ACP level which is capable for practical detection in human serum and seminal plasma.

  12. C-terminal domain small phosphatase 1 and MAP kinase reciprocally control REST stability and neuronal differentiation

    PubMed Central

    Corson, Glen M.; McCleskey, Maxwell; Oyer, Jon A.; Mandel, Gail

    2014-01-01

    The repressor element 1 (RE1) silencing transcription factor (REST) in stem cells represses hundreds of genes essential to neuronal function. During neurogenesis, REST is degraded in neural progenitors to promote subsequent elaboration of a mature neuronal phenotype. Prior studies indicate that part of the degradation mechanism involves phosphorylation of two sites in the C terminus of REST that require activity of beta-transducin repeat containing E3 ubiquitin protein ligase, βTrCP. We identify a proline-directed phosphorylation motif, at serines 861/864 upstream of these sites, which is a substrate for the peptidylprolyl cis/trans isomerase, Pin1, as well as the ERK1/2 kinases. Mutation at S861/864 stabilizes REST, as does inhibition of Pin1 activity. Interestingly, we find that C-terminal domain small phosphatase 1 (CTDSP1), which is recruited by REST to neuronal genes, is present in REST immunocomplexes, dephosphorylates S861/864, and stabilizes REST. Expression of a REST peptide containing S861/864 in neural progenitors inhibits terminal neuronal differentiation. Together with previous work indicating that both REST and CTDSP1 are expressed to high levels in stem cells and down-regulated during neurogenesis, our results suggest that CTDSP1 activity stabilizes REST in stem cells and that ERK-dependent phosphorylation combined with Pin1 activity promotes REST degradation in neural progenitors. PMID:25197063

  13. The Tail of KdsC: Conformational Changes Control the Activity of a Haloacid Dehalogenase Superfamily Phosphatase

    SciTech Connect

    Biswas, Tapan; Yi, Li; Aggarwal, Parag; Wu, Jing; Rubin, John R.; Stuckey, Jeanne A.; Woodard, Ronald W.; Tsodikov, Oleg V.

    2010-01-28

    The phosphatase KdsC cleaves 3-deoxy-d-manno-octulosonate 8-phosphate to generate a molecule of inorganic phosphate and Kdo. Kdo is an essential component of the lipopolysaccharide envelope in Gram-negative bacteria. Because lipopolysaccharide is an important determinant of bacterial resistance and toxicity, KdsC is a potential target for novel antibacterial agents. KdsC belongs to the broad haloacid dehalogenase superfamily. In haloacid dehalogenase superfamily enzymes, substrate specificity and catalytic efficiency are generally dictated by a fold feature called the cap domain. It is therefore not clear why KdsC, which lacks a cap domain, is catalytically efficient and highly specific to 3-deoxy-d-manno-octulosonate 8-phosphate. Here, we present a set of seven structures of tetrameric Escherichia coli KdsC (ranging from 1.4 to 3.06 {angstrom} in resolution) that model different intermediate states in its catalytic mechanism. A crystal structure of product-bound E. coli KdsC shows how the interface between adjacent monomers defines the active site pocket. Kdo is engaged in a network of polar and nonpolar interactions with residues at this interface, which explains substrate specificity. Furthermore, this structural and kinetic analysis strongly suggests that the binding of the flexible C-terminal region (tail) to the active site makes KdsC catalytically efficient by facilitating product release.

  14. Calcineurin phosphatase as a negative regulator of fear memory in hippocampus: control on nuclear factor-κB signaling in consolidation and reconsolidation.

    PubMed

    de la Fuente, Verónica; Federman, Noel; Fustiñana, María Sol; Zalcman, Gisela; Romano, Arturo

    2014-12-01

    Protein phosphatases are important regulators of neural plasticity and memory. Some studies support that the Ca(2+) /calmodulin-dependent phosphatase calcineurin (CaN) is, on the one hand, a negative regulator of memory formation and, on the other hand, a positive regulator of memory extinction and reversal learning. However, the signaling mechanisms by which CaN exerts its action in such processes are not well understood. Previous findings support that CaN negatively regulate the nuclear factor kappaB (NF-κB) signaling pathway during extinction. Here, we have studied the role of CaN in contextual fear memory consolidation and reconsolidation in the hippocampus. We investigated the CaN control on the NF-κB signaling pathway, a key mechanism that regulates gene expression in memory processes. We found that post-training intrahippocampal administration of the CaN inhibitor FK506 enhanced memory retention one day but not two weeks after training. Accordingly, the inhibition of CaN by FK506 increased NF-κB activity in dorsal hippocampus. The administration of the NF-κB signaling pathway inhibitor sulfasalazine (SSZ) impeded the enhancing effect of FK506. In line with our findings in consolidation, FK506 administration before memory reactivation enhanced memory reconsolidation when tested one day after re-exposure to the training context. Strikingly, memory was also enhanced two weeks after training, suggesting that reinforcement during reconsolidation is more persistent than during consolidation. The coadministration of SSZ and FK506 blocked the enhancement effect in reconsolidation, suggesting that this facilitation is also dependent on the NF-κB signaling pathway. In summary, our results support a novel mechanism by which memory formation and reprocessing can be controlled by CaN regulation on NF-κB activity. © 2014 Wiley Periodicals, Inc.

  15. Local control of phosphatidylinositol 4-phosphate signaling in the Golgi apparatus by Vps74 and Sac1 phosphoinositide phosphatase

    PubMed Central

    Wood, Christopher S.; Hung, Chia-Sui; Huoh, Yu-San; Mousley, Carl J.; Stefan, Christopher J.; Bankaitis, Vytas; Ferguson, Kathryn M.; Burd, Christopher G.

    2012-01-01

    In the Golgi apparatus, lipid homeostasis pathways are coordinated with the biogenesis of cargo transport vesicles by phosphatidylinositol 4-kinases (PI4Ks) that produce phosphatidylinositol 4-phosphate (PtdIns4P), a signaling molecule that is recognized by downstream effector proteins. Quantitative analysis of the intra-Golgi distribution of a PtdIns4P reporter protein confirms that PtdIns4P is enriched on the trans-Golgi cisterna, but surprisingly, Vps74 (the orthologue of human GOLPH3), a PI4K effector required to maintain residence of a subset of Golgi proteins, is distributed with the opposite polarity, being most abundant on cis and medial cisternae. Vps74 binds directly to the catalytic domain of Sac1 (KD = 3.8 μM), the major PtdIns4P phosphatase in the cell, and PtdIns4P is elevated on medial Golgi cisternae in cells lacking Vps74 or Sac1, suggesting that Vps74 is a sensor of PtdIns4P level on medial Golgi cisternae that directs Sac1-mediated dephosphosphorylation of this pool of PtdIns4P. Consistent with the established role of Sac1 in the regulation of sphingolipid biosynthesis, complex sphingolipid homeostasis is perturbed in vps74Δ cells. Mutant cells lacking complex sphingolipid biosynthetic enzymes fail to properly maintain residence of a medial Golgi enzyme, and cells lacking Vps74 depend critically on complex sphingolipid biosynthesis for growth. The results establish additive roles of Vps74-mediated and sphingolipid-dependent sorting of Golgi residents. PMID:22553352

  16. Effect of controlled redox potential and dissolved oxygen on the in vitro refolding of an E. coli alkaline phosphatase and chicken lysozyme.

    PubMed

    Meneses-Acosta, Angélica; Vizcaíno-Meza, Luis Rodolfo; Ayala-Castro, Hector G; Contreras, Martha A; Ortega-López, Jaime; Ramírez, Octavio T

    2013-05-10

    The development of efficient purification strategies of recombinant active protein derived from inclusion bodies requires the knowledge of the effect of environmental variables, such as redox potential (RP) and dissolved oxygen tension (DOT), in order to control the protein folding process. However, that information is scarce and only few in vitro studies of the impact of such variables have been reported under constant controlled conditions. In this work, the effect of controlled RP and DOT on the refolding of E. coli alkaline phosphatase (AP) and chicken lysozyme (CL) enzymes were studied. Disulphide bonds of both enzymes were reduced in an instrumented vessel using 2-mercaptoethanol and nitrogen. In the latter case, guanidine hydrochloride was also used to denature the protein. Such conditions caused protein conformational changes, as determined by the intrinsic fluorescence spectra that correlated with a decrease on the activity in both cases. Reduced enzymes were then oxidized, under different constant and predetermined RP or DOT, by manipulating the gas composition in the vessel. Folding kinetics were followed as the recovery of enzyme activity. Results showed that the percentage of recovery and rate of increase of enzymatic activity directly depended on the RP and DOT. A higher folding efficiency was found under controlled DOT compared to controlled RP conditions. These results are useful for establishing protein folding strategies to improve the recovery of active protein from inclusion bodies. Copyright © 2013 Elsevier Inc. All rights reserved.

  17. Control of Inflammatory Responses: a New Paradigm for the Treatment of Chronic Neuronal Diseases

    PubMed Central

    Woo, Joo Hong; Lee, Jee Hoon; Kim, Hyunmi; Park, Soo Jung; Joe, Eun-hye

    2015-01-01

    The term 'inflammation' was first introduced by Celsus almost 2000 years ago. Biological and medical researchers have shown increasing interest in inflammation over the past few decades, in part due to the emerging burden of chronic and degenerative diseases resulting from the increased longevity that has arisen thanks to modern medicine. Inflammation is believed to play critical roles in the pathogenesis of degenerative brain diseases, including Alzheimer's disease and Parkinson's disease. Accordingly, researchers have sought to combat such diseases by controlling inflammatory responses. In this review, we describe the endogenous inflammatory stimulators and signaling pathways in the brain. In particular, our group has focused on the JAK-STAT pathway, identifying anti-inflammatory targets and testing the effects of various anti-inflammatory drugs. This work has shown that the JAK-STAT pathway and its downstream are negatively regulated by phosphatases (SHP2 and MKP-1), inhibitory proteins (SOCS1 and SOCS3) and a nuclear receptor (LXR). These negative regulators are controlled at various levels (e.g. transcriptional, post-transcriptional and post-translational). Future study of these proteins could facilitate the manipulation of the inflammatory response, which plays ubiquitous, diverse and ambivalent roles under physiological and pathological conditions. PMID:26113788

  18. Control of Inflammatory Responses: a New Paradigm for the Treatment of Chronic Neuronal Diseases.

    PubMed

    Woo, Joo Hong; Lee, Jee Hoon; Kim, Hyunmi; Park, Soo Jung; Joe, Eun-Hye; Jou, Ilo

    2015-06-01

    The term 'inflammation' was first introduced by Celsus almost 2000 years ago. Biological and medical researchers have shown increasing interest in inflammation over the past few decades, in part due to the emerging burden of chronic and degenerative diseases resulting from the increased longevity that has arisen thanks to modern medicine. Inflammation is believed to play critical roles in the pathogenesis of degenerative brain diseases, including Alzheimer's disease and Parkinson's disease. Accordingly, researchers have sought to combat such diseases by controlling inflammatory responses. In this review, we describe the endogenous inflammatory stimulators and signaling pathways in the brain. In particular, our group has focused on the JAK-STAT pathway, identifying anti-inflammatory targets and testing the effects of various anti-inflammatory drugs. This work has shown that the JAK-STAT pathway and its downstream are negatively regulated by phosphatases (SHP2 and MKP-1), inhibitory proteins (SOCS1 and SOCS3) and a nuclear receptor (LXR). These negative regulators are controlled at various levels (e.g. transcriptional, post-transcriptional and post-translational). Future study of these proteins could facilitate the manipulation of the inflammatory response, which plays ubiquitous, diverse and ambivalent roles under physiological and pathological conditions.

  19. Evolution of alkaline phosphatases in primates.

    PubMed Central

    Goldstein, D J; Rogers, C; Harris, H

    1982-01-01

    Alkaline phosphatase [orthophosphoric-monoester phosphohydrolase (alkaline optimum), EC 3.1.3.1] in placenta, intestine, liver, kidney, bone, and lung from a variety of primate species has been characterized by quantitative inhibition, thermostability, and immunological studies. Characteristic human placental-type alkaline phosphatase occurs in placentas of great apes (chimpanzee and orangutan) but not in placentas of other primates, including gibbon. It is also present in trace amounts in human lung but not in lung or other tissues of various Old and New World monkeys. However, a distinctive alkaline phosphatase resembling it occurs in substantial amounts in lungs from Old World monkeys but not New World monkeys. It appears that duplication of alkaline phosphatase genes and mutations of genetic elements controlling their tissue expression have occurred relatively recently in mammalian evolution. Images PMID:6950431

  20. 3-Phosphoglycerate Phosphatase in Plants

    PubMed Central

    Randall, D. D.; Tolbert, N. E.; Gremel, D.

    1971-01-01

    3-Phosphoglycerate phosphatase and phosphoglycolate phosphatase were found in leaves of all 52 plants examined. Activities of both phosphatases varied widely between 1 to 20 micromoles per minute per milligram chlorophyll. Plants were grouped into two categories based upon the relative ratio of activity of 3-phosphoglycerate phosphatase to phosphoglycolate phosphatase. This ratio varied between 2:1 to 4:1 in the C4-plants except corn leaves which had a low level of 3-phosphoglycerate phosphatase. This ratio was reversed and varied between 1:2 to 1:6 in all C3-plants except one bean variety which had large amounts of both phosphatases. By differential grinding procedures for C4 plants a major part of the 3-phosphoglycerate phosphatase was found in the mesophyll cells and P-glycolate phosphatase in the bundle sheath cells. Phosphoglycolate phosphatase, but not 3-phosphoglycerate phosphatase, was located in chloroplasts of C3- and C4- plants. Formation of 3-phosphoglycerate phosphatase increased 4- to 12-fold during greening of etiolated sugarcane leaves. This cytosol phosphatase displayed a diurnal variation in sugarcane leaves by increasing 50% during late daylight hours and early evening. It is proposed that the soluble form of 3-phosphoglycerate phosphatase is necessary for carbon transport between the bundle sheath and mesophyll cells during photosynthesis by C4-plants. In C3- and C4-plants this phosphatase initiates the conversion of 3-phosphoglycerate to serine which is an alternate metabolic pathway to glycolate metabolism and photorespiration. PMID:16657822

  1. Serine/threonine protein phosphatase-mediated control of the peptidoglycan cross-linking L,D-transpeptidase pathway in Enterococcus faecium.

    PubMed

    Sacco, Emmanuelle; Cortes, Mélanie; Josseaume, Nathalie; Rice, Louis B; Mainardi, Jean-Luc; Arthur, Michel

    2014-07-08

    The last step of peptidoglycan polymerization involves two families of unrelated transpeptidases that are the essential targets of β-lactam antibiotics. D,D-transpeptidases of the penicillin-binding protein (PBP) family are active-site serine enzymes that use pentapeptide precursors and are the main or exclusive cross-linking enzymes in nearly all bacteria. However, peptidoglycan cross-linking is performed mainly by active-site cysteine L,D-transpeptidases that use tetrapeptides in Mycobacterium tuberculosis, Clostridium difficile, and β-lactam-resistant mutants of Enterococcus faecium. We have investigated reprogramming of the E. faecium peptidoglycan assembly pathway by a switch from pentapeptide to tetrapeptide precursors and bypass of PBPs by L,D-transpeptidase Ldtfm. Mutational alterations of two signal transduction systems were necessary and sufficient for activation of the L,D-transpeptidation pathway, which is essentially cryptic in wild-type strains. The first one is a classical two-component regulatory system, DdcRS, that controls the activity of Ldtfm at the substrate level. As previously described, loss of DdcS phosphatase activity leads to production of the D,D-carboxypeptidase DdcY and conversion of the pentapeptide into the tetrapeptide substrate of Ldtfm. Here we show that full bypass of PBPs by Ldtfm also requires increased Ser/Thr protein phosphorylation resulting from impaired activity of phosphoprotein phosphatase StpA. This enzyme negatively controlled the level of protein phosphorylation both by direct dephosphorylation of target proteins and by dephosphorylation of its cognate kinase Stk. In combination with production of DdcY, increased protein phosphorylation by this eukaryotic-enzyme-like Ser/Thr protein kinase was sufficient for activation of the L,D-transpeptidation pathway in the absence of mutational alteration of peptidoglycan synthesis enzymes. Importance: The mechanism of acquisition of high-level ampicillin resistance involving

  2. Alkaline phosphatase: an overview.

    PubMed

    Sharma, Ujjawal; Pal, Deeksha; Prasad, Rajendra

    2014-07-01

    Alkaline phosphatase (ALP; E.C.3.I.3.1.) is an ubiquitous membrane-bound glycoprotein that catalyzes the hydrolysis of phosphate monoesters at basic pH values. Alkaline phosphatase is divided into four isozymes depending upon the site of tissue expression that are Intestinal ALP, Placental ALP, Germ cell ALP and tissue nonspecific alkaline phosphatase or liver/bone/kidney (L/B/K) ALP. The intestinal and placental ALP loci are located near the end of long arm of chromosome 2 and L/B/K ALP is located near the end of the short arm of chromosome 1. Although ALPs are present in many mammalian tissues and have been studied for the last several years still little is known about them. The bone isoenzyme may be involved in mammalian bone calcification and the intestinal isoenzyme is thought to play a role in the transport of phosphate into epithelial cells of the intestine. In this review, we tried to provide an overview about the various forms, structure and functions of alkaline phosphatase with special focus on liver/bone/kidney alkaline phosphatase.

  3. Protein phosphatase 5 mediates lipid metabolism through reciprocal control of glucocorticoid receptor and peroxisome proliferator-activated receptor-γ (PPARγ).

    PubMed

    Hinds, Terry D; Stechschulte, Lance A; Cash, Harrison A; Whisler, Donald; Banerjee, Ananya; Yong, Weidong; Khuder, Saja S; Kaw, Meenakshi K; Shou, Weinian; Najjar, Sonia M; Sanchez, Edwin R

    2011-12-16

    Glucocorticoid receptor-α (GRα) and peroxisome proliferator-activated receptor-γ (PPARγ) regulate adipogenesis by controlling the balance between lipolysis and lipogenesis. Here, we show that protein phosphatase 5 (PP5), a nuclear receptor co-chaperone, reciprocally modulates the lipometabolic activities of GRα and PPARγ. Wild-type and PP5-deficient (KO) mouse embryonic fibroblast cells were used to show binding of PP5 to both GRα and PPARγ. In response to adipogenic stimuli, PP5-KO mouse embryonic fibroblast cells showed almost no lipid accumulation with reduced expression of adipogenic markers (aP2, CD36, and perilipin) and low fatty-acid synthase enzymatic activity. This was completely reversed following reintroduction of PP5. Loss of PP5 increased phosphorylation of GRα at serines 212 and 234 and elevated dexamethasone-induced activity at prolipolytic genes. In contrast, PPARγ in PP5-KO cells was hyperphosphorylated at serine 112 but had reduced rosiglitazone-induced activity at lipogenic genes. Expression of the S112A mutant rescued PPARγ transcriptional activity and lipid accumulation in PP5-KO cells pointing to Ser-112 as an important residue of PP5 action. This work identifies PP5 as a fulcrum point in nuclear receptor control of the lipolysis/lipogenesis equilibrium and as a potential target in the treatment of obesity.

  4. The Phosphatase PTP-PEST/PTPN12 Regulates Endothelial Cell Migration and Adhesion, but Not Permeability, and Controls Vascular Development and Embryonic Viability*

    PubMed Central

    Souza, Cleiton Martins; Davidson, Dominique; Rhee, Inmoo; Gratton, Jean-Philippe; Davis, Elaine C.; Veillette, André

    2012-01-01

    Protein-tyrosine phosphatase (PTP)-PEST (PTPN12) is ubiquitously expressed. It is essential for normal embryonic development and embryonic viability in mice. Herein we addressed the involvement of PTP-PEST in endothelial cell functions using a combination of genetic and biochemical approaches. By generating primary endothelial cells from an inducible PTP-PEST-deficient mouse, we found that PTP-PEST is not needed for endothelial cell differentiation and proliferation or for the control of endothelial cell permeability. Nevertheless, it is required for integrin-mediated adhesion and migration of endothelial cells. PTP-PEST-deficient endothelial cells displayed increased tyrosine phosphorylation of Cas, paxillin, and Pyk2, which were previously also implicated in integrin functions. By eliminating PTP-PEST in endothelial cells in vivo, we obtained evidence that expression of PTP-PEST in endothelial cells is required for normal vascular development and embryonic viability. Therefore, PTP-PEST is a key regulator of integrin-mediated functions in endothelial cells seemingly through its capacity to control Cas, paxillin, and Pyk2. This function explains at least in part the essential role of PTP-PEST in embryonic development and viability. PMID:23105101

  5. The phosphatase PTP-PEST/PTPN12 regulates endothelial cell migration and adhesion, but not permeability, and controls vascular development and embryonic viability.

    PubMed

    Souza, Cleiton Martins; Davidson, Dominique; Rhee, Inmoo; Gratton, Jean-Philippe; Davis, Elaine C; Veillette, André

    2012-12-14

    Protein-tyrosine phosphatase (PTP)-PEST (PTPN12) is ubiquitously expressed. It is essential for normal embryonic development and embryonic viability in mice. Herein we addressed the involvement of PTP-PEST in endothelial cell functions using a combination of genetic and biochemical approaches. By generating primary endothelial cells from an inducible PTP-PEST-deficient mouse, we found that PTP-PEST is not needed for endothelial cell differentiation and proliferation or for the control of endothelial cell permeability. Nevertheless, it is required for integrin-mediated adhesion and migration of endothelial cells. PTP-PEST-deficient endothelial cells displayed increased tyrosine phosphorylation of Cas, paxillin, and Pyk2, which were previously also implicated in integrin functions. By eliminating PTP-PEST in endothelial cells in vivo, we obtained evidence that expression of PTP-PEST in endothelial cells is required for normal vascular development and embryonic viability. Therefore, PTP-PEST is a key regulator of integrin-mediated functions in endothelial cells seemingly through its capacity to control Cas, paxillin, and Pyk2. This function explains at least in part the essential role of PTP-PEST in embryonic development and viability.

  6. Budding yeast Swe1 is involved in the control of mitotic spindle elongation and is regulated by Cdc14 phosphatase during mitosis.

    PubMed

    Raspelli, Erica; Cassani, Corinne; Chiroli, Elena; Fraschini, Roberta

    2015-01-02

    Cyclin-dependent kinase (Cdk1) activity is required for mitotic entry, and this event is restrained by an inhibitory phosphorylation of the catalytic subunit Cdc28 on a conserved tyrosine (Tyr(19)). This modification is brought about by the protein kinase Swe1 that inhibits Cdk1 activation thus blocking mitotic entry. Swe1 levels are regulated during the cell cycle, and they decrease during G2/M concomitantly to Cdk1 activation, which drives entry into mitosis. However, after mitotic entry, a pool of Swe1 persists, and we collected evidence that it is involved in controlling mitotic spindle elongation. We also describe that the protein phosphatase Cdc14 is implicated in Swe1 regulation; in fact, we observed that Swe1 dephosphorylation in vivo depends on Cdc14 that, in turn, is able to control its subcellular localization. In addition we show that the lack of Swe1 causes premature mitotic spindle elongation and that high levels of Swe1 block mitotic spindle elongation, indicating that Swe1 inhibits this process. Importantly, these effects are not dependent upon the role of in Cdk1 inhibition. These data fit into a model in which Cdc14 binds and inhibits Swe1 to allow timely mitotic spindle elongation. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. Protein phosphatase 6 regulates mitotic spindle formation by controlling the T-loop phosphorylation state of Aurora A bound to its activator TPX2

    PubMed Central

    Zeng, Kang; Bastos, Ricardo Nunes

    2010-01-01

    Many protein kinases are activated by a conserved regulatory step involving T-loop phosphorylation. Although there is considerable focus on kinase activator proteins, the importance of specific T-loop phosphatases reversing kinase activation has been underappreciated. We find that the protein phosphatase 6 (PP6) holoenzyme is the major T-loop phosphatase for Aurora A, an essential mitotic kinase. Loss of PP6 function by depletion of catalytic or regulatory subunits interferes with spindle formation and chromosome alignment because of increased Aurora A activity. Aurora A T-loop phosphorylation and the stability of the Aurora A–TPX2 complex are increased in cells depleted of PP6 but not other phosphatases. Furthermore, purified PP6 acts as a T-loop phosphatase for Aurora A–TPX2 complexes in vitro, whereas catalytically inactive mutants cannot dephosphorylate Aurora A or rescue the PPP6C depletion phenotype. These results demonstrate a hitherto unappreciated role for PP6 as the T-loop phosphatase regulating Aurora A activity during spindle formation and suggest the general importance of this form of regulation. PMID:21187329

  8. Mononuclear copper(II) complexes with 3,5-substituted-4-salicylidene-amino-3,5-dimethyl-1,2,4-triazole: synthesis, structure and potent inhibition of protein tyrosine phosphatases.

    PubMed

    Ma, Ling; Lu, Liping; Zhu, Miaoli; Wang, Qingming; Li, Ying; Xing, Shu; Fu, Xueqi; Gao, Zengqiang; Dong, Yuhui

    2011-06-28

    Six copper complexes of Schiff base ligands containing 3,5-substituted-4-salicylideneamino-3,5-dimethyl-1,2,4-triazole have been synthesized and well characterized. The structures of complexes 1 and 2 were determined by X-ray crystal analysis. Fluorescence and potentiometric study indicated that in the physiological pH range, one ligand was dissociated from the complexes to form 1:1 mononucleus copper complexes. The complexes potently inhibit protein tyrosine phosphatase 1B (PTP1B), T-cell protein tyrosine phosphatase (TCPTP), megakaryocyte protein tyrosine phosphatase 2 (PTP-MEG2) and Src homology phosphatase 1 (SHP-1) with 3-4 fold selectivity against PTP1B over TCPTP and PTP-MEG2, and 3-9 fold over SHP-1, but display almost no inhibition against Src homology phosphatase 2 (SHP-2). Complex 1 inhibits PTP1B with a competitive model with K(i) of 30 nM. Substitution with small groups at the phenyl of the ligand does not obviously influence the inhibitory ability of the complexes.

  9. Access Denied: Snf1 Activation Loop Phosphorylation Is Controlled by Availability of the Phosphorylated Threonine 210 to the PP1 Phosphatase*

    PubMed Central

    Rubenstein, Eric M.; McCartney, Rhonda R.; Zhang, Chao; Shokat, Kevan M.; Shirra, Margaret K.; Arndt, Karen M.; Schmidt, Martin C.

    2011-01-01

    Phosphorylation of the Saccharomyces cerevisiae Snf1 kinase activation loop is determined by the integration of two reaction rates: the rate of phosphorylation by upstream kinases and the rate of dephosphorylation by Glc7. The activities of the Snf1-activating kinases do not appear to be glucose-regulated, since immune complex kinase assays with each of the three Snf1-activating kinases show similar levels of activity when prepared from cells grown in either high or low glucose. In contrast, the dephosphorylation of the Snf1 activation loop was strongly regulated by glucose. When de novo phosphorylation of Snf1 was inhibited, phosphorylation of the Snf1 activation loop was found to be stable in low glucose but rapidly lost upon the addition of glucose. A greater than 10-fold difference in the rates of Snf1 activation loop dephosphorylation was detected. However, the activity of the Glc7-Reg1 phosphatase may not itself be directly regulated by glucose, since the Glc7-Reg1 enzyme was active in low glucose toward another substrate, the transcription factor Mig1. Glucose-mediated regulation of Snf1 activation loop dephosphorylation is controlled by changes in the ability of the Snf1 activation loop to act as a substrate for Glc7. PMID:17991748

  10. Deletion of protein tyrosine phosphatase 1b in proopiomelanocortin neurons reduces neurogenic control of blood pressure and protects mice from leptin- and sympatho-mediated hypertension.

    PubMed

    Bruder-Nascimento, Thiago; Butler, Benjamin R; Herren, David J; Brands, Michael W; Bence, Kendra K; Belin de Chantemèle, Eric J

    2015-12-01

    Protein tyrosine phosphatase 1b (Ptp1b), which represses leptin signaling, is a promising therapeutic target for obesity. Genome wide deletion of Ptp1b, increases leptin sensitivity, protects mice from obesity and diabetes, but alters cardiovascular function by increasing blood pressure (BP). Leptin-control of metabolism is centrally mediated and involves proopiomelanocortin (POMC) neurons. Whether these neurons contribute to leptin-mediated increases in BP remain unclear. We hypothesized that increasing leptin signaling in POMC neurons with Ptp1b deletion will sensitize the cardiovascular system to leptin and enhance neurogenic control of BP. We analyzed the cardiovascular phenotype of Ptp1b+/+ and POMC-Ptp1b-/- mice, at baseline and after 7 days of leptin infusion or sympatho-activation with phenylephrine. POMCPtp1b deletion did not alter baseline cardiovascular hemodynamics (BP, heart rate) but reduced BP response to ganglionic blockade and plasma catecholamine levels that suggests a decreased neurogenic control of BP. In contrast, POMC-Ptp1b deletion increased vascular adrenergic reactivity and aortic α-adrenergic receptors expression. Chronic leptin treatment reduced vascular adrenergic reactivity and blunted diastolic and mean BP increases in POMC-Ptp1b-/- mice only. Similarly POMC-Ptp1b-/- mice exhibited a blunted increased in diastolic and mean BP accompanied by a gradual reduction in adrenergic reactivity in response to chronic vascular sympatho-activation with phenylephrine. Together these data rule out our hypothesis but suggest that deletion of Ptp1b in POMC neurons protects from leptin- and sympatho-mediated increases in BP. Vascular adrenergic desensitization appears as a protective mechanism against hypertension, and POMC-Ptp1b as a key therapeutic target for the treatment of metabolic and cardiovascular dysfunctions associated with obesity. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  11. [Establishment and the significance of a cell model of secreted alkaline phosphatase co-controlled by HCV 5'NCR and NS3 serine protease].

    PubMed

    Liu, Shui-Ping; Tan, De-Ming; Yang, Yong-Feng; Hou, Zhou-Hua

    2004-09-01

    To establish a cell model of secreted alkaline phosphatase (SEAP) co-controlled by HCV 5'NCR and NS3 serine protease in an effort to develop new antiviral agents. The fragments of HCV 5'NCR and NS3/4A-SEAP were amplified by PCR. They were fused into pBluescript SK+ to generate 5'NCR-NS3/4A-SEAP chimeric plasmid. The resulting chimeric gene was subcloned into HindIII/Bsu36 I site of pSEAP2-Control (a SEAP eukaryotic expression plasmid), to generate pNCR-NS3/4A-SEAP, in which the SEAP was fused in-frame to the downstream of NS4A/4B cleavage site. The SEAP activity in the culture media of transiently transfected cells was monitored quantitatively. The regulatory effect of HCV 5'NCR and NS3 serine protease on SEAP expression was measured by treatment of transfected cells with antisense oligodeoxynucleotide (ASODN) against HCV 5'NCR and TPCK, a irreversible serine protease inhibitor. The SEAP activity in the culture media reached 80801+/-4794 RLU, and was significantly inhibited by 5 micromol/L, 10 micromol/L of ASODN (t=4.315, p<0.01; t=6.985, p<0.001) and 100 micromol/L of TPCK (t=6.949, P<0.001). A cell model of SEAP co-controlled by HCV 5'NCR and NS3 serine protease has been successfully established. This might promote the screening of anti-viral drugs

  12. Phosphoinositide phosphatases: just as important as the kinases.

    PubMed

    Dyson, Jennifer M; Fedele, Clare G; Davies, Elizabeth M; Becanovic, Jelena; Mitchell, Christina A

    2012-01-01

    Phosphoinositide phosphatases comprise several large enzyme families with over 35 mammalian enzymes identified to date that degrade many phosphoinositide signals. Growth factor or insulin stimulation activates the phosphoinositide 3-kinase that phosphorylates phosphatidylinositol (4,5)-bisphosphate [PtdIns(4,5)P(2)] to form phosphatidylinositol (3,4,5)-trisphosphate [PtdIns(3,4,5)P(3)], which is rapidly dephosphorylated either by PTEN (phosphatase and tensin homologue deleted on chromosome 10) to PtdIns(4,5)P(2), or by the 5-phosphatases (inositol polyphosphate 5-phosphatases), generating PtdIns(3,4)P(2). 5-phosphatases also hydrolyze PtdIns(4,5)P(2) forming PtdIns(4)P. Ten mammalian 5-phosphatases have been identified, which regulate hematopoietic cell proliferation, synaptic vesicle recycling, insulin signaling, and embryonic development. Two 5-phosphatase genes, OCRL and INPP5E are mutated in Lowe and Joubert syndrome respectively. SHIP [SH2 (Src homology 2)-domain inositol phosphatase] 2, and SKIP (skeletal muscle- and kidney-enriched inositol phosphatase) negatively regulate insulin signaling and glucose homeostasis. SHIP2 polymorphisms are associated with a predisposition to insulin resistance. SHIP1 controls hematopoietic cell proliferation and is mutated in some leukemias. The inositol polyphosphate 4-phosphatases, INPP4A and INPP4B degrade PtdIns(3,4)P(2) to PtdIns(3)P and regulate neuroexcitatory cell death, or act as a tumor suppressor in breast cancer respectively. The Sac phosphatases degrade multiple phosphoinositides, such as PtdIns(3)P, PtdIns(4)P, PtdIns(5)P and PtdIns(3,5)P(2) to form PtdIns. Mutation in the Sac phosphatase gene, FIG4, leads to a degenerative neuropathy. Therefore the phosphatases, like the lipid kinases, play major roles in regulating cellular functions and their mutation or altered expression leads to many human diseases.

  13. Regulated protein kinases and phosphatases in cell cycle decisions.

    PubMed

    Novak, Bela; Kapuy, Orsolya; Domingo-Sananes, Maria Rosa; Tyson, John J

    2010-12-01

    Many aspects of cell physiology are controlled by protein kinases and phosphatases, which together determine the phosphorylation state of targeted substrates. Some of these target proteins are themselves kinases or phosphatases or other components of a regulatory network characterized by feedback and feed-forward loops. In this review we describe some common regulatory motifs involving kinases, phosphatases, and their substrates, focusing particularly on bistable switches involved in cellular decision processes. These general principles are applied to cell cycle transitions, with special emphasis on the roles of regulated phosphatases in orchestrating progression from one phase to the next of the DNA replication-division cycle.

  14. Regulated protein kinases and phosphatases in cell cycle decisions

    PubMed Central

    Novak, Bela; Kapuy, Orsolya; Domingo-Sananes, Maria Rosa; Tyson, John J

    2013-01-01

    Many aspects of cell physiology are controlled by protein kinases and phosphatases, which together determine the phosphorylation state of targeted substrates. Some of these target proteins are themselves kinases or phosphatases or other components of a regulatory network characterized by feedback and feed-forward loops. In this review we describe some common regulatory motifs involving kinases, phosphatases, and their substrates, focusing particularly on bistable switches involved in cellular decision processes. These general principles are applied to cell cycle transitions, with special emphasis on the roles of regulated phosphatases in orchestrating progression from one phase to the next of the DNA replication-division cycle. PMID:20678910

  15. Hypersensitive to red and blue 1 and its modification by protein phosphatase 7 are implicated in the control of Arabidopsis stomatal aperture.

    PubMed

    Sun, Xiaodong; Kang, Xiaojun; Ni, Min

    2012-01-01

    The stomatal pores are located on the plant leaf epidermis and regulate CO(2) uptake for photosynthesis and the loss of water by transpiration. Their stomatal aperture therefore affects photosynthesis, water use efficiency, and agricultural crop yields. Blue light, one of the environmental signals that regulates the plant stomatal aperture, is perceived by the blue/UV-A light-absorbing cryptochromes and phototropins. The signal transduction cascades that link the perception of light to the stomatal opening response are still largely unknown. Here, we report two new players, Hypersensitive to Red and Blue 1 (HRB1) and Protein Phosphatase 7 (PP7), and their genetic and biochemical interactions in the control of stomatal aperture. Mutations in either HRB1 or PP7 lead to the misregulation of the stomatal aperture and reduce water loss under blue light. Both HRB1 and PP7 are expressed in the guard cells in response to a light-to-dark or dark-to-light transition. HRB1 interacts with PP7 through its N-terminal ZZ-type zinc finger motif and requires a functional PP7 for its stomatal opening response. HRB1 is phosphorylated in vivo, and PP7 can dephosphorylate HRB1. HRB1 is mostly dephosphorylated in a protein complex of 193 kDa in the dark, and blue light increases complex size to 285 kDa. In the pp7 mutant, this size shift is impaired, and HRB1 is predominately phosphorylated. We propose that a modification of HRB1 by PP7 under blue light is essential to acquire a proper conformation or to bring in new components for the assembly of a functional HRB1 protein complex. Guard cells control stomatal opening in response to multiple environmental or biotic stimuli. This study may furnish strategies that allow plants to enjoy the advantages of both constitutive and ABA-induced protection under water-limiting conditions.

  16. Hypersensitive to Red and Blue 1 and Its Modification by Protein Phosphatase 7 Are Implicated in the Control of Arabidopsis Stomatal Aperture

    PubMed Central

    Ni, Min

    2012-01-01

    The stomatal pores are located on the plant leaf epidermis and regulate CO2 uptake for photosynthesis and the loss of water by transpiration. Their stomatal aperture therefore affects photosynthesis, water use efficiency, and agricultural crop yields. Blue light, one of the environmental signals that regulates the plant stomatal aperture, is perceived by the blue/UV-A light-absorbing cryptochromes and phototropins. The signal transduction cascades that link the perception of light to the stomatal opening response are still largely unknown. Here, we report two new players, Hypersensitive to Red and Blue 1 (HRB1) and Protein Phosphatase 7 (PP7), and their genetic and biochemical interactions in the control of stomatal aperture. Mutations in either HRB1 or PP7 lead to the misregulation of the stomatal aperture and reduce water loss under blue light. Both HRB1 and PP7 are expressed in the guard cells in response to a light-to-dark or dark-to-light transition. HRB1 interacts with PP7 through its N-terminal ZZ-type zinc finger motif and requires a functional PP7 for its stomatal opening response. HRB1 is phosphorylated in vivo, and PP7 can dephosphorylate HRB1. HRB1 is mostly dephosphorylated in a protein complex of 193 kDa in the dark, and blue light increases complex size to 285 kDa. In the pp7 mutant, this size shift is impaired, and HRB1 is predominately phosphorylated. We propose that a modification of HRB1 by PP7 under blue light is essential to acquire a proper conformation or to bring in new components for the assembly of a functional HRB1 protein complex. Guard cells control stomatal opening in response to multiple environmental or biotic stimuli. This study may furnish strategies that allow plants to enjoy the advantages of both constitutive and ABA-induced protection under water-limiting conditions. PMID:22589732

  17. Diverse Levels of Sequence Selectivity and Catalytic Efficiency of Protein-Tyrosine Phosphatases

    PubMed Central

    Selner, Nicholas G.; Luechapanichkul, Rinrada; Chen, Xianwen; Neel, Benjamin G.; Zhang, Zhong-Yin; Knapp, Stefan; Bell, Charles E.; Pei, Dehua

    2014-01-01

    The sequence selectivity of 14 classical protein-tyrosine phosphatases (PTPs) (PTPRA, PTPRB, PTPRC, PTPRD, PTPRO, PTP1B, SHP-1, SHP-2, HePTP, PTP-PEST, TCPTP, PTPH1, PTPD1, and PTPD2) was systematically profiled by screening their catalytic domains against combinatorial peptide libraries. All of the PTPs exhibit similar preference for pY peptides rich in acidic amino acids and disfavor positively charged sequences, but differ vastly in their degrees of preference/disfavor. Some PTPs (PTP-PEST, SHP-1, and SHP-2) are highly selective for acidic over basic (or neutral) peptides (by >105-fold), whereas others (PTPRA and PTPRD) show no to little sequence selectivity. PTPs also have diverse intrinsic catalytic efficiencies (kcat/KM values against optimal substrates), which differ by >105-fold due to different kcat and/or KM values. Moreover, PTPs show little positional preference for the acidic residues relative to the pY residue. Mutation of Arg47 of PTP1B, which is located near the pY-1 and pY-2 residues of a bound substrate, decreased the enzymatic activity by 3–18-fold toward all pY substrates containing acidic residues anywhere within the pY-6 to pY+5 region. Similarly, mutation of Arg24, which is situated near the C-terminus of a bound substrate, adversely affected the kinetic activity of all acidic substrates. A co-crystal structure of PTP1B bound with a nephrin pY1193 peptide suggests that Arg24 engages in electrostatic interactions with acidic residues at the pY+1, pY+2, and likely other positions. These results suggest that long-range electrostatic interactions between positively charged residues near the PTP active site and acidic residues on pY substrates allow a PTP to bind acidic substrates with similar affinities and the varying levels of preference for acidic sequences by different PTPs are likely caused by the different electrostatic potentials near their active sites. The implications of the varying sequence selectivity and intrinsic catalytic

  18. Inside-out Signaling Promotes Dynamic Changes in the Carcinoembryonic Antigen-related Cellular Adhesion Molecule 1 (CEACAM1) Oligomeric State to Control Its Cell Adhesion Properties*

    PubMed Central

    Patel, Prerna C.; Lee, Hannah S. W.; Ming, Aaron Y. K.; Rath, Arianna; Deber, Charles M.; Yip, Christopher M.; Rocheleau, Jonathan V.; Gray-Owen, Scott D.

    2013-01-01

    Cell-cell contacts are fundamental to multicellular organisms and are subject to exquisite levels of control. The carcinoembryonic antigen-related cell adhesion molecule 1 (CEACAM1) can engage in both cis-homophilic (parallel) oligomerization and trans-homophilic (anti-parallel) binding. In this study, we establish that the CEACAM1 transmembrane domain has a propensity to form cis-dimers via the transmembrane-embedded 432GXXXG436 motif and that this basal state is overcome when activated calmodulin binds to the CEACAM1 cytoplasmic domain. Although mutation of the 432GXXXG436 motif reduced CEACAM1 oligomerization, it did not affect surface localization of the receptor or influence CEACAM1-dependent cellular invasion by the pathogenic Neisseria. The mutation did, however, have a striking effect on CEACAM1-dependent cellular aggregation, increasing both the kinetics of cell-cell association and the size of cellular aggregates formed. CEACAM1 association with tyrosine kinase c-Src and tyrosine phosphatases SHP-1 and SHP-2 was not affected by the 432GXXXG436 mutation, consistent with their association with the monomeric form of wild type CEACAM1. Collectively, our results establish that a dynamic oligomer-to-monomer shift in surface-expressed CEACAM1 facilitates trans-homophilic binding and downstream effector signaling. PMID:24005674

  19. Molecular analysis of Aedes aegypti classical protein tyrosine phosphatases uncovers an ortholog of mammalian PTP-1B implicated in the control of egg production in mosquitoes.

    PubMed

    Moretti, Debora Monteiro; Ahuja, Lalima Gagan; Nunes, Rodrigo Dutra; Cudischevitch, Cecília Oliveira; Daumas-Filho, Carlos Renato Oliveira; Medeiros-Castro, Priscilla; Ventura-Martins, Guilherme; Jablonka, Willy; Gazos-Lopes, Felipe; Senna, Raquel; Sorgine, Marcos Henrique Ferreira; Hartfelder, Klaus; Capurro, Margareth; Atella, Georgia Correa; Mesquita, Rafael Dias; Silva-Neto, Mário Alberto Cardoso

    2014-01-01

    Protein Tyrosine Phosphatases (PTPs) are enzymes that catalyze phosphotyrosine dephosphorylation and modulate cell differentiation, growth and metabolism. In mammals, PTPs play a key role in the modulation of canonical pathways involved in metabolism and immunity. PTP1B is the prototype member of classical PTPs and a major target for treating human diseases, such as cancer, obesity and diabetes. These signaling enzymes are, hence, targets of a wide array of inhibitors. Anautogenous mosquitoes rely on blood meals to lay eggs and are vectors of the most prevalent human diseases. Identifying the mosquito ortholog of PTP1B and determining its involvement in egg production is, therefore, important in the search for a novel and crucial target for vector control. We conducted an analysis to identify the ortholog of mammalian PTP1B in the Aedes aegypti genome. We identified eight genes coding for classical PTPs. In silico structural and functional analyses of proteins coded by such genes revealed that four of these code for catalytically active enzymes. Among the four genes coding for active PTPs, AAEL001919 exhibits the greatest degree of homology with the mammalian PTP1B. Next, we evaluated the role of this enzyme in egg formation. Blood feeding largely affects AAEL001919 expression, especially in the fat body and ovaries. These tissues are critically involved in the synthesis and storage of vitellogenin, the major yolk protein. Including the classical PTP inhibitor sodium orthovanadate or the PTP substrate DiFMUP in the blood meal decreased vitellogenin synthesis and egg production. Similarly, silencing AAEL001919 using RNA interference (RNAi) assays resulted in 30% suppression of egg production. The data reported herein implicate, for the first time, a gene that codes for a classical PTP in mosquito egg formation. These findings raise the possibility that this class of enzymes may be used as novel targets to block egg formation in mosquitoes.

  20. Molecular Analysis of Aedes aegypti Classical Protein Tyrosine Phosphatases Uncovers an Ortholog of Mammalian PTP-1B Implicated in the Control of Egg Production in Mosquitoes

    PubMed Central

    Moretti, Debora Monteiro; Ahuja, Lalima Gagan; Nunes, Rodrigo Dutra; Cudischevitch, Cecília Oliveira; Daumas-Filho, Carlos Renato Oliveira; Medeiros-Castro, Priscilla; Ventura-Martins, Guilherme; Jablonka, Willy; Gazos-Lopes, Felipe; Senna, Raquel; Sorgine, Marcos Henrique Ferreira; Hartfelder, Klaus; Capurro, Margareth; Atella, Georgia Correa; Mesquita, Rafael Dias; Silva-Neto, Mário Alberto Cardoso

    2014-01-01

    Background Protein Tyrosine Phosphatases (PTPs) are enzymes that catalyze phosphotyrosine dephosphorylation and modulate cell differentiation, growth and metabolism. In mammals, PTPs play a key role in the modulation of canonical pathways involved in metabolism and immunity. PTP1B is the prototype member of classical PTPs and a major target for treating human diseases, such as cancer, obesity and diabetes. These signaling enzymes are, hence, targets of a wide array of inhibitors. Anautogenous mosquitoes rely on blood meals to lay eggs and are vectors of the most prevalent human diseases. Identifying the mosquito ortholog of PTP1B and determining its involvement in egg production is, therefore, important in the search for a novel and crucial target for vector control. Methodology/Principal Findings We conducted an analysis to identify the ortholog of mammalian PTP1B in the Aedes aegypti genome. We identified eight genes coding for classical PTPs. In silico structural and functional analyses of proteins coded by such genes revealed that four of these code for catalytically active enzymes. Among the four genes coding for active PTPs, AAEL001919 exhibits the greatest degree of homology with the mammalian PTP1B. Next, we evaluated the role of this enzyme in egg formation. Blood feeding largely affects AAEL001919 expression, especially in the fat body and ovaries. These tissues are critically involved in the synthesis and storage of vitellogenin, the major yolk protein. Including the classical PTP inhibitor sodium orthovanadate or the PTP substrate DiFMUP in the blood meal decreased vitellogenin synthesis and egg production. Similarly, silencing AAEL001919 using RNA interference (RNAi) assays resulted in 30% suppression of egg production. Conclusions/Significance The data reported herein implicate, for the first time, a gene that codes for a classical PTP in mosquito egg formation. These findings raise the possibility that this class of enzymes may be used as novel

  1. A putative bifunctional histidine kinase/phosphatase of the HWE family exerts positive and negative control on the Sinorhizobium meliloti general stress response.

    PubMed

    Sauviac, Laurent; Bruand, Claude

    2014-07-01

    The EcfG-type sigma factor RpoE2 is the regulator of the general stress response in Sinorhizobium meliloti. RpoE2 activity is negatively regulated by two NepR-type anti-sigma factors (RsiA1/A2), themselves under the control of two anti-anti-sigma factors (RsiB1/B2) belonging to the PhyR family of response regulators. The current model of RpoE2 activation suggests that in response to stress, RsiB1/B2 are activated by phosphorylation of an aspartate residue in their receiver domain. Once activated, RsiB1/B2 become able to interact with the anti-sigma factors and release RpoE2, which can then associate with the RNA polymerase to transcribe its target genes. The purpose of this work was to identify and characterize proteins involved in controlling the phosphorylation status of RsiB1/B2. Using in vivo approaches, we show that the putative histidine kinase encoded by the rsiC gene (SMc01507), located downstream from rpoE2, is able to both positively and negatively regulate the general stress response. In addition, our data suggest that the negative action of RsiC results from inhibition of RsiB1/B2 phosphorylation. From these observations, we propose that RsiC is a bifunctional histidine kinase/phosphatase responsible for RsiB1/B2 phosphorylation or dephosphorylation in the presence or absence of stress, respectively. Two proteins were previously proposed to control PhyR phosphorylation in Caulobacter crescentus and Sphingomonas sp. strain FR1. However, these proteins contain a Pfam:HisKA_2 domain of dimerization and histidine phosphotransfer, whereas S. meliloti RsiC harbors a Pfam:HWE_HK domain instead. Therefore, this is the first report of an HWE_HK-containing protein controlling the general stress response in Alphaproteobacteria.

  2. Phosphatidyl glycerophosphate phosphatase.

    PubMed

    Chang, Y Y; Kennedy, E P

    1967-09-01

    An enzyme (phosphatidyl glycerophosphate phosphatase) that catalyzes the formation of phosphatidyl glycerol from phosphatidyl glycerophosphate has been rendered soluble by treatment of the particulate fraction of E. coli with Triton X-100 in the presence of EDTA, and has been partially purified. The enzyme is specific for phosphatidyl glycerophosphate and does not catalyze the hydrolysis of other simple phosphomonoesters. It requires Mg(++) for activity and is inhibited by sulfhydryl agents. Some other properties of the enzyme are also described.

  3. Plant resistance against the parasitic nematode Heterodera schachtii is mediated by MPK3 and MPK6 kinases, which are controlled by the MAPK phosphatase AP2C1 in Arabidopsis.

    PubMed

    Sidonskaya, Ekaterina; Schweighofer, Alois; Shubchynskyy, Volodymyr; Kammerhofer, Nina; Hofmann, Julia; Wieczorek, Krzysztof; Meskiene, Irute

    2016-01-01

    Plant-parasitic cyst nematodes infect plants and form highly sophisticated feeding sites in roots. It is not known which plant cell signalling mechanisms trigger plant defence during the early stages of nematode parasitism. Mitogen-activated protein kinases (MAPKs) are central components of protein phosphorylation cascades transducing extracellular signals to plant defence responses. MAPK phosphatases control kinase activities and the signalling outcome. The involvement and the role of MPK3 and MPK6, as well as the MAPK phosphatase AP2C1, is demonstrated during parasitism of the beet cyst nematode Heterodera schachtii in Arabidopsis. Our data reveal notable activation patterns of plant MAPKs and the induction of AP2C1 suggesting the attenuation of defence signalling in plant cells during early nematode infection. It is demonstrated that the ap2c1 mutant that is lacking AP2C1 is more attractive but less susceptible to nematodes compared with the AP2C1-overexpressing line. This implies that the function of AP2C1 is a negative regulator of nematode-induced defence. By contrast, the enhanced susceptibility of mpk3 and mpk6 plants indicates a positive role of stress-activated MAPKs in plant immunity against nematodes. Evidence is provided that phosphatase AP2C1, as well as AP2C1-targeted MPK3 and MPK6, are important regulators of plant-nematode interaction, where the co-ordinated action of these signalling components ensures the timely activation of plant defence.

  4. Plant resistance against the parasitic nematode Heterodera schachtii is mediated by MPK3 and MPK6 kinases, which are controlled by the MAPK phosphatase AP2C1 in Arabidopsis

    PubMed Central

    Sidonskaya, Ekaterina; Schweighofer, Alois; Shubchynskyy, Volodymyr; Kammerhofer, Nina; Hofmann, Julia; Wieczorek, Krzysztof; Meskiene, Irute

    2016-01-01

    Plant-parasitic cyst nematodes infect plants and form highly sophisticated feeding sites in roots. It is not known which plant cell signalling mechanisms trigger plant defence during the early stages of nematode parasitism. Mitogen-activated protein kinases (MAPKs) are central components of protein phosphorylation cascades transducing extracellular signals to plant defence responses. MAPK phosphatases control kinase activities and the signalling outcome. The involvement and the role of MPK3 and MPK6, as well as the MAPK phosphatase AP2C1, is demonstrated during parasitism of the beet cyst nematode Heterodera schachtii in Arabidopsis. Our data reveal notable activation patterns of plant MAPKs and the induction of AP2C1 suggesting the attenuation of defence signalling in plant cells during early nematode infection. It is demonstrated that the ap2c1 mutant that is lacking AP2C1 is more attractive but less susceptible to nematodes compared with the AP2C1-overexpressing line. This implies that the function of AP2C1 is a negative regulator of nematode-induced defence. By contrast, the enhanced susceptibility of mpk3 and mpk6 plants indicates a positive role of stress-activated MAPKs in plant immunity against nematodes. Evidence is provided that phosphatase AP2C1, as well as AP2C1-targeted MPK3 and MPK6, are important regulators of plant–nematode interaction, where the co-ordinated action of these signalling components ensures the timely activation of plant defence. PMID:26438412

  5. Density-enhanced Phosphatase 1 Regulates Phosphorylation of Tight Junction Proteins and Enhances Barrier Function of Epithelial Cells*

    PubMed Central

    Sallee, Jennifer L.; Burridge, Keith

    2009-01-01

    Cell-cell adhesion is a dynamic process that can activate multiple signaling pathways. These signaling pathways can be regulated through reversible tyrosine phosphorylation events. The level of tyrosine phosphorylation of junctional proteins reflects the balance between protein-tyrosine kinase and protein-tyrosine phosphatase activity. The receptor-tyrosine phosphatase DEP-1 (CD148/PTP-η) has been implicated in cell growth and differentiation as well as in regulating phosphorylation of junctional proteins. However, the role of DEP-1 in regulating tight junction phosphorylation and the integrity of cell-cell junctions is still under investigation. In this study, we used a catalytically dead substrate-trapping mutant of DEP-1 to identify potential substrates at cell-cell junctions. We have shown that in epithelial cells the trapping mutant of DEP-1 interacts with the tight junction proteins occludin and ZO-1 in a tyrosine phosphorylation-dependent manner. In contrast, PTP-PEST, Shp2, and PTPμ did not interact with these proteins, suggesting that the interaction of DEP-1 with occludin and ZO-1 is specific. In addition, occludin and ZO-1 were dephosphorylated by DEP-1 but not these other phosphatases in vitro. Overexpression of DEP-1 increased barrier function as measured by transepithelial electrical resistance and also reduced paracellular flux of fluorescein isothiocyanate-dextran following a calcium switch. Reduced DEP-1 expression by small interfering RNA had a small but significant increase in junction permeability. These data suggest that DEP-1 can modify the phosphorylation state of tight junction proteins and play a role in regulating permeability. PMID:19332538

  6. Adamantyl-Substituted Retinoid-Derived Molecules That Interact with the Orphan Nuclear Receptor Small Heterodimer Partner: Effects of Replacing the 1-Adamantyl or Hydroxyl Group on Inhibition of Cancer Cell Growth, Induction of Cancer Cell Apoptosis, and Inhibition of Src Homology 2 Domain-Containing Protein Tyrosine Phosphatase-2 Activity

    PubMed Central

    Dawson, Marcia I.; Xia, Zebin; Jiang, Tao; Ye, Mao; Fontana, Joseph A.; Farhana, Lulu; Patel, Bhaumik; Xue, Li Ping; Bhuiyan, Mohammad; Pellicciari, Roberto; Macchiarulo, Antonio; Nuti, Roberto; Zhang, Xiao-Kun; Han, Young-Hoon; Tautz, Lutz; Hobbs, Peter D.; Jong, Ling; Waleh, Nahid; Chao, Wan-ru; Feng, Gen-Sheng; Pang, Yuhong; Su, Ying

    2014-01-01

    (E)-4-[3-(1-Adamantyl)-4′-hydroxyphenyl]-3-chlorocinnamic acid (3-Cl-AHPC) induces the cell-cycle arrest and apoptosis of leukemia and cancer cells. Studies demonstrated that 3-Cl-AHPC bound to the atypical orphan nuclear receptor small heterodimer partner (SHP). Although missing a DNA-binding domain, SHP heterodimerizes with the ligand-binding domains of other nuclear receptors to repress their abilities to induce or inhibit gene expression. 3-Cl-AHPC analogues having the 1-adamantyl and phenolic hydroxyl pharmacophoric elements replaced with isosteric groups were designed, synthesized, and evaluated for their inhibition of proliferation and induction of human cancer cell apoptosis. Structure–anticancer activity relationship studies indicated the importance of both groups to apoptotic activity. Docking of 3-Cl-AHPC and its analogues to an SHP computational model that was based on the crystal structure of ultraspiracle complexed with 1-stearoyl-2-palmitoylglycero-3-phosphoethanolamine suggested why these 3-Cl-AHPC groups could influence SHP activity. Inhibitory activity against Src homology 2 domain-containing protein tyrosine phosphatase 2 (Shp-2) was also assessed. The most active Shp-2 inhibitor was found to be the 3′-(3,3-dimethylbutynyl) analogue of 3-Cl-AHPC. PMID:18759424

  7. Violacein cytotoxicity on human blood lymphocytes and effect on phosphatases.

    PubMed

    Bromberg, N; Justo, G Z; Haun, M; Durán, N; Ferreira, C V

    2005-10-01

    Given the importance of protein phosphorylation in the context of cellular functions, abnormal protein phosphatase activity has been implicated in several diseases, including cancer. These critical roles of protein phosphatases qualify them as potential targets for the development of medicinal compounds that possess distinct modes of action such as violacein. In this work, studies with this natural indolic pigment at a concentration of 10.0 micromol L(-1) demonstrated a 20% activation of total protein phosphatase extracted from human lymphocytes. Although no alteration was observed on protein tyrosine phosphatase (CD45), 30% of inhibition was achieved in cytoplasmatic protein phosphatase activity after incubation with 10.0 micromol L(-1) violacein. Additionally, 5.0 micromol L(-1) of violacein inhibited by 50% the serum tartrate-resistant acid phosphatase activity. Violacein presented toxic effect on lymphocytes with IC50 values of 3 and 10 micromol L(-1) for protein content and protein phosphatase activity, respectively. These findings suggest an important role for protein phosphatases in the mechanisms controlling proliferation and cell death.

  8. Biogeochemical drivers of phosphatase activity in salt marsh sediments

    NASA Astrophysics Data System (ADS)

    Freitas, Joana; Duarte, Bernardo; Caçador, Isabel

    2014-10-01

    Although nitrogen has become a major concern for wetlands scientists dealing with eutrophication problems, phosphorous represents another key element, and consequently its biogeochemical cycling has a crucial role in eutrophication processes. Microbial communities are a central component in trophic dynamics and biogeochemical processes on coastal systems, since most of the processes in sediments are microbial-mediated due to enzymatic action, including the mineralization of organic phosphorus carried out by acid phosphatase activity. In the present work, the authors investigate the biogeochemical sediment drivers that control phosphatase activities. Authors also aim to assess biogeochemical factors' influence on the enzyme-mediated phosphorous cycling processes in salt marshes. Plant rhizosediments and bare sediments were collected and biogeochemical features, including phosphatase activities, inorganic and organic phosphorus contents, humic acids content and pH, were assessed. Acid phosphatase was found to give the highest contribution for total phosphatase activity among the three pH-isoforms present in salt marsh sediments, favored by acid pH in colonized sediments. Humic acids also appear to have an important role inhibiting phosphatase activity. A clear relation of phosphatase activity and inorganic phosphorous was also found. The data presented reinforces the role of phosphatase in phosphorous cycling.

  9. Phosphatase activities analyzed by in vivo expressions.

    PubMed

    Schweighofer, Alois; Ayatollahi, Zahra; Meskiene, Irute

    2009-01-01

    Protein phosphatases act to reverse phosphorylation-related modifications induced by protein kinases. Type 2C protein phosphatases (PP2C) are monomeric Ser/Thr phosphatases that require a metal for their activity and are abundant in prokaryotes and eukaryotes. In plants, such as Medicago and Arabidopsis PP2Cs control several essential processes, including ABA signaling, development, and wound-induced mitogen-activated protein kinase (MAPK) pathways. In vitro assays with recombinant proteins and yeast two-hybrid systems usually provide initial information about putative PP2C substrates; however, these observations have to be verified in vivo. Therefore, a method for transient expression in isolated Arabidopsis suspension cell protoplasts was developed to assay PP2C action in living cells. This system has proven to be very useful in producing active enzymes and their substrates and in performing enzymatic reactions in vivo. Transient gene expression in isolated cells enabled assembly of functional protein kinase cascades and the creation of phosphorylated targets for PP2Cs. The method is based on the co-transformation and transient co-expression of different PP2C proteins with MAPK. It shows that epitope-tagged PP2C and MAPK proteins exhibit high enzymatic activities and produce substantial protein amounts easily monitored by Western blot analysis. Additionally, PP2C phosphatase activities can be directly tested in protein extracts from protoplasts, suggesting a possibility for analysis of activities of new PP2C family members.

  10. [Alkaline phosphatase in Amoeba proteus].

    PubMed

    Sopina, V A

    2005-01-01

    In free-living Amoeba proteus (strain B), 3 phosphatase were found after disc-electrophoresis of 10 microg of protein in PAGE and using 1-naphthyl phosphate as a substrate a pH 9.0. These phosphatases differed in their electrophoretic mobilities - "slow" (1-3 bands), "middle" (one band) and "fast" (one band). In addition to 1-naphthyl phosphate, "slow" phosphatases were able to hydrolyse 2-naphthyl phosphate and p-nitrophenyl phosphate. They were slightly activated by Mg2+, completely inhibited by 3 chelators (EDTA, EGTA and 1,10-phenanthroline), L-cysteine, sodium dodecyl sulfate and Fe2+, Zn2+ and Mn2+ (50 mM), considerably inactivated by orthovanadate, molybdate, phosphatase inhibitor cocktail 1, p-nitrophenyl phosphate, Na2HPO4, DL-dithiothreitol and urea and partly inhibited by H2O2, DL-phenylalanine, 2-mercaptoethanol, phosphatase inhibitor cocktail 2 and Ca2+. Imidazole, L-(+)-tartrate, okadaic acid, NaF and sulfhydryl reagents -p-(hydroxy-mercuri)benzoate and N-ethylmaleimide - had no influence on the activity of "slow" phosphatases. "Middle" and "fast" phosphatases, in contrast to "slow" ones, were not inactivated by 3 chelators. The "middle" phosphatase differed from the "fast" one by smaller resistance to urea, Ca2+, Mn2+, phosphates and H2O2 and greater resistance to dithiothreitol and L-(+)-tartrate. In addition, the "fast" phosphatase was inhibited by L-cysteine but the "middle" one was activated by it. Of 5 tested ions (Mg2+, Cu2+, Mn2+, Ca2+ and Zn2+), only Zn2+ reactivated "slow" phosphatases after their inactivation by EDTA treatment. The reactivation of apoenzyme was only partial (about 35 %). Thus, among phosphatases found in amoebae at pH 9.0, only "slow" ones are Zn-metalloenzymes and may be considered as alkaline phosphatases (EC 3.1.3.1). It still remains uncertain, to which particular phosphatase class "middle" and "fast" phosphatases (pH 9.0) may belong.

  11. Structural analysis of the PP2C phosphatase tPphA from Thermosynechococcus elongatus: a flexible flap subdomain controls access to the catalytic site.

    PubMed

    Schlicker, Christine; Fokina, Oleksandra; Kloft, Nicole; Grüne, Tim; Becker, Stefan; Sheldrick, George M; Forchhammer, Karl

    2008-02-15

    The homologue of the phosphoprotein PII phosphatase PphA from Thermosynechococcus elongatus, termed tPphA, was identified and its structure was resolved in two different space groups, C222(1) and P4(1)2(1)2, at a resolution of 1.28 and 3.05 A, respectively. tPphA belongs to a large and widely distributed subfamily of Mg(2+)/Mn(2+)-dependent phosphatases of the PPM superfamily characterized by the lack of catalytic and regulatory domains. The core structure of tPphA shows a high degree of similarity to the two PPM structures identified so far. In contrast to human PP2C, but similar to Mycobacterium tuberculosis phosphatase PstP, the catalytic centre exhibits a third metal ion in addition to the dinuclear metal centre universally conserved in all PPM members. The fact that the third metal is only liganded by amino acids, which are universally conserved in all PPM members, implies that the third metal could be general for all members of this family. As a specific feature of tPphA, a flexible subdomain, previously recognized as a flap domain, could be revealed. Comparison of different structural isomers of tPphA as well as site-specific mutagenesis implied that the flap domain is involved in substrate binding and catalytic activity. The structural arrangement of the flap domain was accompanied by a large side-chain movement of an Arg residue (Arg169) at the basis of the flap. Mutation of this residue strongly impaired protein stability as well as catalytic activity, emphasizing the importance of this amino acid for the regional polysterism of the flap subdomain and confirming the assumption that flap domain flexibility is involved in catalysis.

  12. Phosphoinositide 5-phosphatases: How do they affect tumourigenesis?

    PubMed

    Miyazawa, Keiji

    2013-01-01

    The activity of biological molecules is often affected by their phosphorylation state. Regulatory phosphorylation operates as a binary switch and is usually controlled by counteracting kinases and phosphatases. However, phosphatidylinositol (PtdIns) has three phosphorylation sites on its inositol ring. The phosphorylation status of PtdIns is controlled by multiple kinases and phosphatases with distinct substrate specificities, serving as a 'lipid code' or 'phosphoinositide code'. Class I phosphoinositide 3-kinase (PI3K) converts PtdIns(4,5)P₂ to PtdIns(3,4,5)P₃, which plays a pivotal role in signals controlling glucose uptake, cytoskeletal reorganization, cell proliferation and apoptosis. PI3K is pro-oncogenic, whereas phosphoinositide phosphatases that degrade PtdIns(3,4,5)P₃ are not always anti-oncogenic. Recent studies have revealed the unique characteristics of phosphoinositide 5-phosphatases.

  13. Soybean root nodule acid phosphatase.

    PubMed Central

    Penheiter, A R; Duff, S M; Sarath, G

    1997-01-01

    Acid phosphatases are ubiquitous enzymes that exhibit activity against a variety of substrates in vitro, although little is known about their intracellular function. In this study, we report the isolation, characterization, and partial sequence of the major acid phosphatase from soybean (Glycine max L.) root nodules. The phosphatase was purified predominantly as a heterodimer with subunits of 28 and 31 kD; homodimers of both subunits were also observed and exhibited phosphatase activity. In addition to the general phosphatase substrate, p-nitrophenyl phosphate, the heterodimeric form of the enzyme readily hydrolyzed 5'-nucleotides, flavin mononucleotide, and O-phospho-L-Tyr. Low or negligible activity was observed with ATP or polyphosphate. Purified nodule acid phosphatase was stimulated by magnesium, inhibited by calcium and EDTA, and competitively inhibited by cGMP and cAMP with apparent Ki values of 7 and 12 microM, respectively. Partial N-terminal and internal sequencing of the nodule acid phosphatase revealed homology to the soybean vegetative storage proteins. There was a 17-fold increase in enzyme activity and a noticeable increase in protein levels detected by immunoblotting methods during nodule development. Both of these parameters were low in young nodules and reached a peak in mature, functional nodules, suggesting that this enzyme is important for efficient nodule metabolism. PMID:9193092

  14. CEACAM1 controls the EMT switch in murine mammary carcinoma in vitro and in vivo

    PubMed Central

    Gerstel, Daniela; von Ehrenstein, Lena; Einhoff, Julia; Schmidt, Geske; Logsdon, Matthew; Brandner, Johanna; Tiegs, Gisa; Beauchemin, Nicole; Wagener, Christoph; Deppert, Wolfgang; Horst, Andrea Kristina

    2016-01-01

    We analyzed the molecular basis for carcinoembryonic antigen-related cell adhesion molecule 1 (CEACAM1)-controlled inhibition of epithelial-mesenchymal transition (EMT) in a mouse model for mammary adenocarcinoma (WAP-T mice). We demonstrate that silencing of CEACAM1 in WAP-T tumor-derived G-2 cells induces epithelial-mesenchymal plasticity (EMP), as evidenced by typical changes of gene expression, morphology and increased invasion. In contrast, reintroduction of CEACAM1 into G-2 cells reversed up-regulation of genes imposing mesenchymal transition, as well as cellular invasion. We identified the Wnt-pathway as target for CEACAM1-mediated repression of EMT. Importantly, β-catenin phosphorylation status and transcriptional activity strongly depend on CEACAM1 expression: CEACAM1high G-2 cells displayed enhanced phosphorylation of β-catenin at S33/S37/T41 and decreased phosphorylation at Y86, thereby inhibiting canonical Wnt/β-catenin signaling. We identified Src-homology 2 domain-containing phosphatase 2 (SHP-2) as a critical binding partner of CEACAM1 that could modulate β-catenin Y86 phosphorylation. Hence, CEACAM1 serves as a scaffold that controls membrane proximal β-catenin signaling. In vivo, mammary tumors of WAP-T/CEACAM1null mice displayed increased nuclear translocation of β-catenin and a dramatically enhanced metastasis rate compared to WAP-T mice. Hence, CEACAM1 controls EMT in vitro and in vivo by site-specific regulation of β-catenin phosphorylation. Survival analyses of human mammary carcinoma patients corroborated these data, indicating that CEACAM1 is a prognostic marker for breast cancer survival. PMID:27572314

  15. CEACAM1 controls the EMT switch in murine mammary carcinoma in vitro and in vivo.

    PubMed

    Wegwitz, Florian; Lenfert, Eva; Gerstel, Daniela; von Ehrenstein, Lena; Einhoff, Julia; Schmidt, Geske; Logsdon, Matthew; Brandner, Johanna; Tiegs, Gisa; Beauchemin, Nicole; Wagener, Christoph; Deppert, Wolfgang; Horst, Andrea Kristina

    2016-09-27

    We analyzed the molecular basis for carcinoembryonic antigen-related cell adhesion molecule 1 (CEACAM1)-controlled inhibition of epithelial-mesenchymal transition (EMT) in a mouse model for mammary adenocarcinoma (WAP-T mice). We demonstrate that silencing of CEACAM1 in WAP-T tumor-derived G-2 cells induces epithelial-mesenchymal plasticity (EMP), as evidenced by typical changes of gene expression, morphology and increased invasion. In contrast, reintroduction of CEACAM1 into G-2 cells reversed up-regulation of genes imposing mesenchymal transition, as well as cellular invasion. We identified the Wnt-pathway as target for CEACAM1-mediated repression of EMT. Importantly, β-catenin phosphorylation status and transcriptional activity strongly depend on CEACAM1 expression: CEACAM1high G-2 cells displayed enhanced phosphorylation of β-catenin at S33/S37/T41 and decreased phosphorylation at Y86, thereby inhibiting canonical Wnt/β-catenin signaling. We identified Src-homology 2 domain-containing phosphatase 2 (SHP-2) as a critical binding partner of CEACAM1 that could modulate β-catenin Y86 phosphorylation. Hence, CEACAM1 serves as a scaffold that controls membrane proximal β-catenin signaling. In vivo, mammary tumors of WAP-T/CEACAM1null mice displayed increased nuclear translocation of β-catenin and a dramatically enhanced metastasis rate compared to WAP-T mice. Hence, CEACAM1 controls EMT in vitro and in vivo by site-specific regulation of β-catenin phosphorylation. Survival analyses of human mammary carcinoma patients corroborated these data, indicating that CEACAM1 is a prognostic marker for breast cancer survival.

  16. Protein Phosphatases Involved in Regulating Mitosis: Facts and Hypotheses.

    PubMed

    Kim, Hyun-Soo; Fernandes, Gary; Lee, Chang-Woo

    2016-09-01

    Almost all eukaryotic proteins are subject to post-translational modifications during mitosis and cell cycle, and in particular, reversible phosphorylation being a key event. The recent use of high-throughput experimental analyses has revealed that more than 70% of all eukaryotic proteins are regulated by phosphorylation; however, the mechanism of dephosphorylation, counteracting phosphorylation, is relatively unknown. Recent discoveries have shown that many of the protein phosphatases are involved in the temporal and spatial control of mitotic events, such as mitotic entry, mitotic spindle assembly, chromosome architecture changes and cohesion, and mitotic exit. This implies that certain phosphatases are tightly regulated for timely dephosphorylation of key mitotic phosphoproteins and are essential for control of various mitotic processes. This review describes the physiological and pathological roles of mitotic phosphatases, as well as the versatile role of various protein phosphatases in several mitotic events.

  17. Structural Genomics of Protein Phosphatases

    SciTech Connect

    Almo,S.; Bonanno, J.; Sauder, J.; Emtage, S.; Dilorenzo, T.; Malashkevich, V.; Wasserman, S.; Swaminathan, S.; Eswaramoorthy, S.; et al

    2007-01-01

    The New York SGX Research Center for Structural Genomics (NYSGXRC) of the NIGMS Protein Structure Initiative (PSI) has applied its high-throughput X-ray crystallographic structure determination platform to systematic studies of all human protein phosphatases and protein phosphatases from biomedically-relevant pathogens. To date, the NYSGXRC has determined structures of 21 distinct protein phosphatases: 14 from human, 2 from mouse, 2 from the pathogen Toxoplasma gondii, 1 from Trypanosoma brucei, the parasite responsible for African sleeping sickness, and 2 from the principal mosquito vector of malaria in Africa, Anopheles gambiae. These structures provide insights into both normal and pathophysiologic processes, including transcriptional regulation, regulation of major signaling pathways, neural development, and type 1 diabetes. In conjunction with the contributions of other international structural genomics consortia, these efforts promise to provide an unprecedented database and materials repository for structure-guided experimental and computational discovery of inhibitors for all classes of protein phosphatases.

  18. A bifunctional kinase-phosphatase in bacterial chemotaxis.

    PubMed

    Porter, Steven L; Roberts, Mark A J; Manning, Cerys S; Armitage, Judith P

    2008-11-25

    Phosphorylation-based signaling pathways employ dephosphorylation mechanisms for signal termination. Histidine to aspartate phosphosignaling in the two-component system that controls bacterial chemotaxis has been studied extensively. Rhodobacter sphaeroides has a complex chemosensory pathway with multiple homologues of the Escherichia coli chemosensory proteins, although it lacks homologues of known signal-terminating CheY-P phosphatases, such as CheZ, CheC, FliY or CheX. Here, we demonstrate that an unusual CheA homologue, CheA(3), is not only a phosphodonor for the principal CheY protein, CheY(6), but is also is a specific phosphatase for CheY(6)-P. This phosphatase activity accelerates CheY(6)-P dephosphorylation to a rate that is comparable with the measured stimulus response time of approximately 1 s. CheA(3) possesses only two of the five domains found in classical CheAs, the Hpt (P1) and regulatory (P5) domains, which are joined by a 794-amino acid sequence that is required for phosphatase activity. The P1 domain of CheA(3) is phosphorylated by CheA(4), and it subsequently acts as a phosphodonor for the response regulators. A CheA(3) mutant protein without the 794-amino acid region lacked phosphatase activity, retained phosphotransfer function, but did not support chemotaxis, suggesting that the phosphatase activity may be required for chemotaxis. Using a nested deletion approach, we showed that a 200-amino acid segment of CheA(3) is required for phosphatase activity. The phosphatase activity of previously identified nonhybrid histidine protein kinases depends on the dimerization and histidine phosphorylation (DHp) domains. However, CheA(3) lacks a DHp domain, suggesting that its phosphatase mechanism is different from that of other histidine protein kinases.

  19. Differential control of the hyperpolarization-activated current (i(f)) by cAMP gating and phosphatase inhibition in rabbit sino-atrial node myocytes.

    PubMed Central

    Accili, E A; Redaelli, G; DiFrancesco, D

    1997-01-01

    1. The actions of the phosphatase inhibitor calyculin A on the hyperpolarization-activated cardiac 'pacemaker' current (i(f)) were determined in single cells isolated from the sino-atrial (SA) node of the rabbit. 2. Cells were incubated for 8 min in Tyrode solution containing calyculin A (0.5 microM) and then superfused with normal Tyrode solution. The mean normalized i(f) measured in eight cells at mid-activation voltages during and after exposure to calyculin A increased maximally by 47% with a time constant of 466 s, a time much longer than that required for cAMP-mediated i(f) stimulation (about 8 s). 3. In two-pulse protocols, calyculin A treatment increased i(f) at full as well as at mid-activation voltages, indicating a higher i(f) conductance. 4. Measurement of the conductance-voltage (gf(V)) relation by voltage ramp protocols confirmed a conductance increase by calyculin A, with no significant change in the position of the activation curve on the voltage axis. Data pooled together from ramp and two-pulse protocols yielded a calyculin A-induced increase in fully activated i(f) conductance of 39.6 +/- 6.4% (n = 16 cells). 5. The positive and negative shift of i(f) voltage dependence in response to beta-adrenergic (1 microM isoprenaline) and muscarinic stimulation (1 microM acetylcholine), respectively, was preserved after the calyculin A-induced increase in conductance. The shift of the i(f) activation curve induced by 1 microM isoprenaline was significantly larger in calyculin A-treated cells (8.8 vs. 5.8 mV). 6. These data indicate that phosphatase inhibition increases i(f) in a manner distinct from the direct cAMP pathway and potentiates the beta-adrenergic-mediated i(f) modulation. PMID:9161982

  20. Acid phosphatase and protease activities in immobilized rat skeletal muscles

    NASA Technical Reports Server (NTRS)

    Witzmann, F. A.; Troup, J. P.; Fitts, R. H.

    1982-01-01

    The effect of hind-limb immobilization on selected Iysosomal enzyme activities was studied in rat hing-limb muscles composed primarily of type 1. 2A, or 2B fibers. Following immobilization, acid protease and acid phosphatase both exhibited signifcant increases in their activity per unit weight in all three fiber types. Acid phosphatase activity increased at day 14 of immobilization in the three muscles and returned to control levels by day 21. Acid protease activity also changed biphasically, displaying a higher and earlier rise than acid phosphatase. The pattern of change in acid protease, but not acid phosphatase, closely parallels observed muscle wasting. The present data therefore demonstrate enhanced proteolytic capacity of all three fiber types early during muscular atrophy. In addition, the data suggest a dependence of basal hydrolytic and proteolytic activities and their adaptive response to immobilization on muscle fiber composition.

  1. Acid phosphatase and protease activities in immobilized rat skeletal muscles

    NASA Technical Reports Server (NTRS)

    Witzmann, F. A.; Troup, J. P.; Fitts, R. H.

    1982-01-01

    The effect of hind-limb immobilization on selected Iysosomal enzyme activities was studied in rat hing-limb muscles composed primarily of type 1. 2A, or 2B fibers. Following immobilization, acid protease and acid phosphatase both exhibited signifcant increases in their activity per unit weight in all three fiber types. Acid phosphatase activity increased at day 14 of immobilization in the three muscles and returned to control levels by day 21. Acid protease activity also changed biphasically, displaying a higher and earlier rise than acid phosphatase. The pattern of change in acid protease, but not acid phosphatase, closely parallels observed muscle wasting. The present data therefore demonstrate enhanced proteolytic capacity of all three fiber types early during muscular atrophy. In addition, the data suggest a dependence of basal hydrolytic and proteolytic activities and their adaptive response to immobilization on muscle fiber composition.

  2. Role of Protein Tyrosine Phosphatases in Plants

    PubMed Central

    Shankar, Alka; Agrawal, Nisha; Sharma, Manisha; Pandey, Amita; Pandey, Girdhar K.

    2015-01-01

    Reversible protein phosphorylation is a crucial regulatory mechanism that controls many biological processes in eukaryotes. In plants, phosphorylation events primarily occur on serine (Ser) and threonine (Thr) residues, while in certain cases, it was also discovered on tyrosine (Tyr) residues. In contrary to plants, extensive reports on Tyr phosphorylation regulating a large numbers of biological processes exist in animals. Despite of such prodigious function in animals, Tyr phosphorylation is a least studied mechanism of protein regulation in plants. Recently, various chemical analytical procedures have strengthened the view that Tyr phosphorylation is equally prevalent in plants as in animals. However, regardless of Tyr phosphorylation events occuring in plants, no evidence could be found for the existence of gene encoding for Tyr phosphorylation i.e. the typical Tyr kinases. Various methodologies have suggested that plant responses to stress signals and developmental processes involved modifications in protein Tyr phosphorylation. Correspondingly, various reports have established the role of PTPs (Protein Tyrosine Phosphatases) in the dephosphorylation and inactivation of mitogen activated protein kinases (MAPKs) hence, in the regulation of MAPK signaling cascade. Besides this, many dual specificity protein phosphatases (DSPs) are also known to bind starch and regulate starch metabolism through reversible phosphorylation. Here, we are emphasizing the significant progress on protein Tyr phosphatases to understand the role of these enzymes in the regulation of post-translational modification in plant physiology and development. PMID:26962298

  3. Association of Protein Phosphatase PPM1G With Alcohol Use Disorder and Brain Activity During Behavioral Control in a Genome-Wide Methylation Analysis

    PubMed Central

    Ruggeri, Barbara; Nymberg, Charlotte; Vuoksimaa, Eero; Lourdusamy, Anbarasu; Wong, Cybele P.; Carvalho, Fabiana M.; Jia, Tianye; Cattrell, Anna; Macare, Christine; Banaschewski, Tobias; Barker, Gareth J.; Bokde, Arun L.W.; Bromberg, Uli; Büchel, Christian; Conrod, Patricia J.; Fauth-Bühler, Mira; Flor, Herta; Frouin, Vincent; Gallinat, Jürgen; Garavan, Hugh; Gowland, Penny; Heinz, Andreas; Ittermann, Bernd; Martinot, Jean-Luc; Nees, Frauke; Pausova, Zdenka; Paus, Tomáš; Rietschel, Marcella; Robbins, Trevor; Smolka, Michael N.; Spanagel, Rainer; Bakalkin, Georgy; Mill, Jonathan; Sommer, Wolfgang H.; Rose, Richard J.; Yan, Jia; Aliev, Fazil; Dick, Danielle; Kaprio, Jaakko; Desrivières, Sylvane; Schumann, Gunter

    2016-01-01

    Objective The genetic component of alcohol use disorder is substantial, but monozygotic twin discordance indicates a role for nonheritable differences that could be mediated by epigenetics. Despite growing evidence associating epigenetics and psychiatric disorders, it is unclear how epigenetics, particularly DNA methylation, relate to brain function and behavior, including drinking behavior. Method The authors carried out a genome-wide analysis of DNA methylation of 18 monozygotic twin pairs discordant for alcohol use disorder and validated differentially methylated regions. After validation, the authors characterized these differentially methylated regions using personality trait assessment and functional MRI in a sample of 499 adolescents. Results Hypermethylation in the 3′-protein-phosphatase-1G (PPM1G) gene locus was associated with alcohol use disorder. The authors found association of PPM1G hypermethylation with early escalation of alcohol use and increased impulsiveness. They also observed association of PPM1G hypermethylation with increased blood-oxygen-level-dependent response in the right subthalamic nucleus during an impulsiveness task. Conclusions Overall, the authors provide first evidence for an epigenetic marker associated with alcohol consumption and its underlying neurobehavioral phenotype. PMID:25982659

  4. Phosphorylation of lipin 1 and charge on the phosphatidic acid head group control its phosphatidic acid phosphatase activity and membrane association.

    PubMed

    Eaton, James M; Mullins, Garrett R; Brindley, David N; Harris, Thurl E

    2013-04-05

    The lipin gene family encodes a class of Mg(2+)-dependent phosphatidic acid phosphatases involved in the de novo synthesis of phospholipids and triglycerides. Unlike other enzymes in the Kennedy pathway, lipins are not integral membrane proteins, and they need to translocate from the cytosol to intracellular membranes to participate in glycerolipid synthesis. The movement of lipin 1 within the cell is closely associated with its phosphorylation status. Although cellular analyses have demonstrated that highly phosphorylated lipin 1 is enriched in the cytosol and dephosphorylated lipin 1 is found on membranes, the effects of phosphorylation on lipin 1 activity and binding to membranes has not been recapitulated in vitro. Herein we describe a new biochemical assay for lipin 1 using mixtures of phosphatidic acid (PA) and phosphatidylethanolamine that reflects its physiological activity and membrane interaction. This depends on our observation that lipin 1 binding to PA in membranes is highly responsive to the electrostatic charge of PA. The studies presented here demonstrate that phosphorylation regulates the ability of the polybasic domain of lipin 1 to recognize di-anionic PA and identify mTOR as a crucial upstream signaling component regulating lipin 1 phosphorylation. These results demonstrate how phosphorylation of lipin 1 together with pH and membrane phospholipid composition play important roles in the membrane association of lipin 1 and thus the regulation of its enzymatic activity.

  5. SHIP2 (SH2 Domain-containing Inositol Phosphatase 2) SH2 Domain Negatively Controls SHIP2 Monoubiquitination in Response to Epidermal Growth Factor*

    PubMed Central

    De Schutter, Julie; Guillabert, Aude; Imbault, Virginie; Degraef, Chantal; Erneux, Christophe; Communi, David; Pirson, Isabelle

    2009-01-01

    The SH2 domain containing inositol 5-phosphatase SHIP2 contains several interacting domains that are important for scaffolding properties. We and others have previously reported that SHIP2 interacts with the E3 ubiquitin ligase c-Cbl. Here, we identified human SHIP2 monoubiquitination on lysine 315. SHIP2 could also be polyubiquitinated but was not degraded by the 26 S proteasome. Furthermore, we identified a ubiquitin-interacting motif at the C-terminal end of SHIP2 that confers ubiquitin binding capacity. However, this ubiquitin-interacting motif is dispensable for its monoubiquitination. We showed that neither c-Cbl nor Nedd4-1 play the role of ubiquitin ligase for SHIP2. Strikingly, monoubiquitination of the ΔSH2-SHIP2 mutant (lacking the N-terminal SH2 domain) is strongly increased, suggesting an intrinsic inhibitory effect of the SHIP2 SH2 domain on its monoubiquitination. Moreover, SHIP2 monoubiquitination was increased upon 30 min of epidermal growth factor stimulation. This correlates with the loss of interaction between the SHIP2 SH2 domain and c-Cbl. In this model, c-Cbl could mask the monoubiquitination site and thereby prevent SHIP2 monoubiquitination. The present study thus reveals an unexpected and novel role of SHIP2 SH2 domain in the regulation of its newly identified monoubiquitination. PMID:19880507

  6. The protein tyrosine phosphatase PTPN22 controls forkhead box protein 3 T regulatory cell induction but is dispensable for T helper type 1 cell polarization

    PubMed Central

    Fousteri, G; Jofra, T; Debernardis, I; Stanford, S M; Laurenzi, A; Bottini, N; Battaglia, M

    2014-01-01

    Protein tyrosine phosphatases (PTPs) regulate T cell receptor (TCR) signalling and thus have a role in T cell differentiation. Here we tested whether the autoimmune predisposing gene PTPN22 encoding for a PTP that inhibits TCR signalling affects the generation of forkhead box protein 3 (FoxP3)+ T regulatory (Treg) cells and T helper type 1 (Th1) cells. Murine CD4+ T cells isolated from Ptpn22 knock-out (Ptpn22KO) mice cultured in Treg cell polarizing conditions showed increased sensitivity to TCR activation compared to wild-type (WT) cells, and subsequently reduced FoxP3 expression at optimal-to-high levels of activation. However, at lower levels of TCR activation, Ptpn22KO CD4+ T cells showed enhanced expression of FoxP3. Similar experiments in humans revealed that at optimal levels of TCR activation PTPN22 knock-down by specific oligonucleotides compromises the differentiation of naive CD4+ T cells into Treg cells. Notably, in vivo Treg cell conversion experiments in mice showed delayed kinetic but overall increased frequency and number of Treg cells in the absence of Ptpn22. In contrast, the in vitro and in vivo generation of Th1 cells was comparable between WT and Ptpn22KO mice, thus suggesting PTPN22 as a FoxP3-specific regulating factor. Together, these results propose PTPN22 as a key factor in setting the proper threshold for FoxP3+ Treg cell differentiation. PMID:24905474

  7. Leishmania amazonensis: characterization of an ecto-phosphatase activity.

    PubMed

    de Almeida-Amaral, Elmo Eduardo; Belmont-Firpo, Rodrigo; Vannier-Santos, Marcos André; Meyer-Fernandes, José Roberto

    2006-12-01

    We have characterized a phosphatase activity present on the external surface of Leishmania amazonensis, using intact living parasites. This enzyme hydrolyzes the substrate p-nitrophenylphosphate (p-NPP) at the rate of 25.70+/-1.17 nmol Pi x h(-1) x 10(-7)cells. The dependence on p-NPP concentration shows a normal Michaelis-Menten kinetics for this ecto-phosphatase activity present a V(max) of 31.93+/-3.04 nmol Pi x h(-1) x 10(-7)cells and apparent K(m) of 1.78+/-0.32 mM. Inorganic phosphate inhibited the ecto-phoshatase activity in a dose-dependent manner with the K(i) value of 2.60 mM. Experiments using classical inhibitor of acid phosphatase, such as ammonium molybdate, as well as inhibitors of phosphotyrosine phosphatase, such as sodium orthovanadate and [potassiumbisperoxo(1,10-phenanthroline)oxovanadate(V)] (bpV-PHEN), inhibited the ecto-phosphatase activity, with the K(i) values of 0.33 microM, 0.36 microM and 0.25 microM, respectively. Zinc chloride, another classical phosphotyrosine phosphatase inhibitor, also inhibited the ecto-phosphatase activity in a dose-dependent manner with K(i) 2.62 mM. Zinc inhibition was reversed by incubation with reduced glutathione (GSH) and cysteine, but not serine, showing that cysteine residues are important for enzymatic activity. Promastigote growth in a medium supplemented with 1mM sodium orthovanadate was completely inhibited as compared to the control medium. Taken together, these results suggest that L. amazonensis express a phosphohydrolase ectoenzyme with phosphotyrosine phosphatase activity.

  8. Atomic structure of DUSP26, a novel p53 phosphatase

    PubMed Central

    Lokareddy, Ravi Kumar; Bhardwaj, Anshul; Cingolani, Gino

    2013-01-01

    Regulation of p53 phosphorylation is critical to control its stability and biological activity. Dual Specificity Phosphatase 26 (DUSP26) is a brain phosphatase highly overexpressed in neuroblastoma, which has been implicated in dephosphorylating phospho-Ser20 and phospho-Ser37 in the p53 transactivation domain (TAD). In this paper, we report the 1.68Å crystal structure of a catalytically inactive mutant (Cys152Ser) of DUSP26 lacking the first N-terminal 60 residues (ΔN60-C/S-DUSP26). This structure reveals the architecture of a dual-specificity phosphatase domain related in structure to Vaccinia virus VH1. DUSP26 adopts a closed conformation of the protein tyrosine phosphatase (PTP)-binding loop, which results in an unusually shallow active site pocket and buried catalytic cysteine. A water molecule trapped inside the PTP-binding loop makes close contacts both with main chain and side chain atoms. The hydrodynamic radius (RH) of ΔN60-C/S-DUSP26 measured from velocity sedimentation analysis (RH ~22.7 Å) and gel filtration chromatography (RH ~21.0 Å) is consistent with a globular monomeric protein of ~18 kDa. Instead in crystal, ΔN60-C/S-DUSP26 is more elongated (RH ~37.9 Å), likely due to the extended conformation of C-terminal helix α9, which swings away from the phosphatase core to generate a highly basic surface. As in the case of the phosphatase MKP-4, we propose that a substrate-induced conformational change, possibly involving rearrangement of helix α9 with respect to the phosphatase core, allows DUSP26 to adopt a catalytically active conformation. The structural characterization of DUSP26 presented in this paper provides the first atomic insight into this disease-associated phosphatase. PMID:23298255

  9. Saccharomyces cerevisiae TORC1 Controls Histone Acetylation by Signaling Through the Sit4/PP6 Phosphatase to Regulate Sirtuin Deacetylase Nuclear Accumulation

    PubMed Central

    Workman, Jason J.; Chen, Hongfeng; Laribee, R. Nicholas

    2016-01-01

    The epigenome responds to changes in the extracellular environment, yet how this information is transmitted to the epigenetic regulatory machinery is unclear. Using a Saccharomyces cerevisiae yeast model, we demonstrate that target of rapamycin complex 1 (TORC1) signaling, which is activated by nitrogen metabolism and amino acid availability, promotes site-specific acetylation of histone H3 and H4 N-terminal tails by opposing the activity of the sirtuin deacetylases Hst3 and Hst4. TORC1 does so through suppression of the Tap42-regulated Sit4 (PP6) phosphatase complex, as sit4Δ rescues histone acetylation under TORC1-repressive conditions. We further demonstrate that TORC1 inhibition, and subsequent PP6 activation, causes a selective, rapid, nuclear accumulation of Hst4, which correlates with decreased histone acetylation. This increased Hst4 nuclear localization precedes an elevation in Hst4 protein expression, which is attributed to reduced protein turnover, suggesting that nutrient signaling through TORC1 may limit Hst4 nuclear accumulation to facilitate Hst4 degradation and maintain histone acetylation. This pathway is functionally relevant to TORC1 signaling since the stress sensitivity of a nonessential TORC1 mutant (tco89Δ) to hydroxyurea and arsenic can be reversed by combining tco89Δ with either hst3Δ, hst4Δ, or sit4Δ. Surprisingly, while hst3Δ or hst4Δ rescues the sensitivity tco89Δ has to low concentrations of the TORC1 inhibitor rapamycin, sit4Δ fails to do so. These results suggest Sit4 provides an additional function necessary for TORC1-dependent cell growth and proliferation. Collectively, this study defines a novel mechanism by which TORC1 suppresses a PP6-regulated sirtuin deacetylase pathway to couple nutrient signaling to epigenetic regulation. PMID:27343235

  10. Regulation of the Src Kinase-associated Phosphoprotein 55 Homologue by the Protein Tyrosine Phosphatase PTP-PEST in the Control of Cell Motility*

    PubMed Central

    Ayoub, Emily; Hall, Anita; Scott, Adam M.; Chagnon, Mélanie J.; Miquel, Géraldine; Hallé, Maxime; Noda, Masaharu; Bikfalvi, Andreas; Tremblay, Michel L.

    2013-01-01

    PTP-PEST is a cytosolic ubiquitous protein tyrosine phosphatase (PTP) that contains, in addition to its catalytic domain, several protein-protein interaction domains that allow it to interface with several signaling pathways. Among others, PTP-PEST is a key regulator of cellular motility and cytoskeleton dynamics. The complexity of the PTP-PEST interactome underscores the necessity to identify its interacting partners and physiological substrates in order to further understand its role in focal adhesion complex turnover and actin organization. Using a modified yeast substrate trapping two-hybrid system, we identified a cytosolic adaptor protein named Src kinase-associated phosphoprotein 55 homologue (SKAP-Hom) as a novel substrate of PTP-PEST. To confirm PTP-PEST interaction with SKAP-Hom, in vitro pull down assays were performed demonstrating that the PTP catalytic domain and Proline-rich 1 (P1) domain are respectively binding to the SKAP-Hom Y260 and Y297 residues and its SH3 domain. Subsequently, we generated and rescued SKAP-Hom-deficient mouse embryonic fibroblasts (MEFs) with WT SKAP-Hom, SKAP-Hom tyrosine mutants (Y260F, Y260F/Y297F), or SKAP-Hom SH3 domain mutant (W335K). Given the role of PTP-PEST, wound-healing and trans-well migration assays were performed using the generated lines. Indeed, SKAP-Hom-deficient MEFs showed a defect in migration compared with WT-rescued MEFs. Interestingly, the SH3 domain mutant-rescued MEFs showed an enhanced cell migration corresponding potentially with higher tyrosine phosphorylation levels of SKAP-Hom. These findings suggest a novel role of SKAP-Hom and its phosphorylation in the regulation of cellular motility. Moreover, these results open new avenues by which PTP-PEST regulates cellular migration, a hallmark of metastasis. PMID:23897807

  11. Regulation of the Src kinase-associated phosphoprotein 55 homologue by the protein tyrosine phosphatase PTP-PEST in the control of cell motility.

    PubMed

    Ayoub, Emily; Hall, Anita; Scott, Adam M; Chagnon, Mélanie J; Miquel, Géraldine; Hallé, Maxime; Noda, Masaharu; Bikfalvi, Andreas; Tremblay, Michel L

    2013-09-06

    PTP-PEST is a cytosolic ubiquitous protein tyrosine phosphatase (PTP) that contains, in addition to its catalytic domain, several protein-protein interaction domains that allow it to interface with several signaling pathways. Among others, PTP-PEST is a key regulator of cellular motility and cytoskeleton dynamics. The complexity of the PTP-PEST interactome underscores the necessity to identify its interacting partners and physiological substrates in order to further understand its role in focal adhesion complex turnover and actin organization. Using a modified yeast substrate trapping two-hybrid system, we identified a cytosolic adaptor protein named Src kinase-associated phosphoprotein 55 homologue (SKAP-Hom) as a novel substrate of PTP-PEST. To confirm PTP-PEST interaction with SKAP-Hom, in vitro pull down assays were performed demonstrating that the PTP catalytic domain and Proline-rich 1 (P1) domain are respectively binding to the SKAP-Hom Y260 and Y297 residues and its SH3 domain. Subsequently, we generated and rescued SKAP-Hom-deficient mouse embryonic fibroblasts (MEFs) with WT SKAP-Hom, SKAP-Hom tyrosine mutants (Y260F, Y260F/Y297F), or SKAP-Hom SH3 domain mutant (W335K). Given the role of PTP-PEST, wound-healing and trans-well migration assays were performed using the generated lines. Indeed, SKAP-Hom-deficient MEFs showed a defect in migration compared with WT-rescued MEFs. Interestingly, the SH3 domain mutant-rescued MEFs showed an enhanced cell migration corresponding potentially with higher tyrosine phosphorylation levels of SKAP-Hom. These findings suggest a novel role of SKAP-Hom and its phosphorylation in the regulation of cellular motility. Moreover, these results open new avenues by which PTP-PEST regulates cellular migration, a hallmark of metastasis.

  12. Gallium nitrate inhibits alkaline phosphatase activity in a differentiating mesenchymal cell culture.

    PubMed

    Boskey, A L; Ziecheck, W; Guidon, P; Doty, S B

    1993-02-01

    The effect of gallium nitrate on alkaline phosphatase activity in a differentiating chick limb-bud mesenchymal cell culture was monitored in order to gain insight into the observation that rachitic rats treated with gallium nitrate failed to show the expected increase in serum alkaline phosphatase activity. Cultures maintained in media containing 15 microM gallium nitrate showed drastically decreased alkaline phosphatase activities in the absence of significant alterations in total protein synthesis and DNA content. However, addition of 15 microM gallium nitrate to cultures 18 h before assay for alkaline phosphatase activity had little effect. At the light microscopic and electron microscopic level, gallium-treated cultures differed morphologically from gallium-free cultures: with gallium present, there were fewer hypertrophic chondrocytes and cartilage nodules were flatter and further apart. Because of altered morphology, staining with an antibody against chick cartilage alkaline phosphatase appeared less extensive; however, all nodules stained equivalently relative to gallium-free controls. Histochemical staining for alkaline phosphatase activity was negative in gallium-treated cultures, demonstrating that the alkaline phosphatase protein present was not active. The defective alkaline phosphatase activity in cultures maintained in the presence of gallium was also evidenced when cultures were supplemented with the alkaline phosphatase substrate, beta-glycerophosphate (beta GP). The data presented suggest that gallium inhibits alkaline phosphatase activity in this culture system and that gallium causes alterations in the differentiation of mesenchymal cells into hypertrophic chondrocytes.

  13. NGF-activated protein tyrosine phosphatase 1B mediates the phosphorylation and degradation of I-kappa-Balpha coupled to NF-kappa-B activation, thereby controlling dendrite morphology.

    PubMed

    Chacón, Pedro J; Arévalo, María Angeles; Tébar, Alfredo Rodríguez

    2010-04-01

    NGF diminishes dendrite complexity in cultured hippocampal neurons by decreasing the number of primary and secondary dendrites, while increasing the length of those that remain. The transduction pathway used by NGF to provoke dendrite elongation involves the activation of NF-kappa-B and the expression of the homologues of Enhancer-of-split 1 gene. Here, we define important steps that link NGF with NF-kappa-B activation, through the activity of protein tyrosine phosphatase 1B (PTP1B). Binding of NGF to p75(NTR) stimulates PTP1B activity, which can be blocked by either pharmacological inhibition of the phosphatase or by transfecting neurons with a dn PTP1B isoform, whereby NGF is no longer able to stimulate dendrite growth. Indeed, overexpressing PTP1B alone provoked dendrite growth and further studies revealed a role for the src kinase downstream of PTP1B. Again, loss of src activity largely cancelled out the capacity of NGF to promote dendrite growth, whereas overexpression of v-src in neurons was sufficient to promote dendrite growth. Finally, the NGF/p75(NTR)/PTP1B/src kinase pathway led to the tyrosine phosphorylation of I-kappa-Balpha prior to its degradation, an event that is necessary for NF-kappa-B activation. Indeed, the dendrite growth response to NGF was lost when neurons were transfected with a mutant form of I-kappa-Balpha that lacks tyr42. Thus, our data suggest that PTP1B fulfils a central role in the NGF signalling that controls dendrite patterning in hippocampal neurons.

  14. Alkaline Phosphatase in Normal Infants

    PubMed Central

    Stephen, Joan M. L.; Stephenson, Pearl

    1971-01-01

    Alkaline phosphatase was measured in plasma from children receiving vitamin D supplements in day nurseries in the London area, and from children exposed to sunlight in the West Indies. The distribution of values showed that there was no precise upper limit which could be used in the diagnosis of subclinical vitamin D deficiency. PMID:5576029

  15. New Functions of the Inositol Polyphosphate 5-Phosphatases in Cancer.

    PubMed

    Erneux, Christophe; Ghosh, Somadri; Ramos, Ana Raquel; Edimo, William's Elong

    2016-01-01

    Inositol polyphosphate 5-phosphatases act on inositol phosphates and phosphoinositides as substrates. They are 10 different isoenzymes and several splice variants in the human genome that are involved in a series of human pathologies such as the Lowe syndrome, the Joubert and MORM syndromes, breast cancer, glioblastoma, gastric cancer and several other type of cancers. Inositol 5-phosphatases can be amplified in human cancer cells, whereas the 3- and 4- phosphatase tumor suppressor PTEN and INPP4B, repectively are often repressed or deleted. The inositol 5-phosphatases are critically involved in a complex network of higly regulated phosphoinositides, affecting the lipid content of PI(3, 4, 5)P3, PI(4, 5)P2 and PI(3, 4)P2. This has an impact on the normal behavior of many intracellular target proteins e.g. protein kinase B (PKB/Akt) or actin binding proteins and final biological responses. The production of PI(3, 4P)2 by dephosphorylation of the substrate PI(3, 4, 5)P3 is particularly important as it produces a new signal messenger in the control of cell migration, invasion and endocytosis. New inhibitors/activators of inositol 5- phosphatases have recently been identified for the possible control of their activity in several human pathologies such as inflamation and cancer.

  16. Crystal structure of lipid phosphatase Escherichia coli phosphatidylglycerophosphate phosphatase B

    PubMed Central

    Fan, Junping; Jiang, Daohua; Zhao, Yan; Liu, Jianfeng; Zhang, Xuejun Cai

    2014-01-01

    Membrane-integrated type II phosphatidic acid phosphatases (PAP2s) are important for numerous bacterial to human biological processes, including glucose transport, lipid metabolism, and signaling. Escherichia coli phosphatidylglycerol-phosphate phosphatase B (ecPgpB) catalyzes removing the terminal phosphate group from a lipid carrier, undecaprenyl pyrophosphate, and is essential for transport of many hydrophilic small molecules across the membrane. We determined the crystal structure of ecPgpB at a resolution of 3.2 Å. This structure shares a similar folding topology and a nearly identical active site with soluble PAP2 enzymes. However, the substrate binding mechanism appears to be fundamentally different from that in soluble PAP2 enzymes. In ecPgpB, the potential substrate entrance to the active site is located in a cleft formed by a V-shaped transmembrane helix pair, allowing lateral movement of the lipid substrate entering the active site from the membrane lipid bilayer. Activity assays of point mutations confirmed the importance of the catalytic residues and potential residues involved in phosphate binding. The structure also suggests an induced-fit mechanism for the substrate binding. The 3D structure of ecPgpB serves as a prototype to study eukaryotic PAP2 enzymes, including human glucose-6-phosphatase, a key enzyme in the homeostatic regulation of blood glucose concentrations. PMID:24821770

  17. Crystal structure of lipid phosphatase Escherichia coli phosphatidylglycerophosphate phosphatase B.

    PubMed

    Fan, Junping; Jiang, Daohua; Zhao, Yan; Liu, Jianfeng; Zhang, Xuejun Cai

    2014-05-27

    Membrane-integrated type II phosphatidic acid phosphatases (PAP2s) are important for numerous bacterial to human biological processes, including glucose transport, lipid metabolism, and signaling. Escherichia coli phosphatidylglycerol-phosphate phosphatase B (ecPgpB) catalyzes removing the terminal phosphate group from a lipid carrier, undecaprenyl pyrophosphate, and is essential for transport of many hydrophilic small molecules across the membrane. We determined the crystal structure of ecPgpB at a resolution of 3.2 Å. This structure shares a similar folding topology and a nearly identical active site with soluble PAP2 enzymes. However, the substrate binding mechanism appears to be fundamentally different from that in soluble PAP2 enzymes. In ecPgpB, the potential substrate entrance to the active site is located in a cleft formed by a V-shaped transmembrane helix pair, allowing lateral movement of the lipid substrate entering the active site from the membrane lipid bilayer. Activity assays of point mutations confirmed the importance of the catalytic residues and potential residues involved in phosphate binding. The structure also suggests an induced-fit mechanism for the substrate binding. The 3D structure of ecPgpB serves as a prototype to study eukaryotic PAP2 enzymes, including human glucose-6-phosphatase, a key enzyme in the homeostatic regulation of blood glucose concentrations.

  18. Protein tyrosine phosphatase: enzymatic assays.

    PubMed

    Montalibet, Jacqueline; Skorey, Kathryn I; Kennedy, Brian P

    2005-01-01

    Activity assays for tyrosine phosphatases are based on the hydrolysis of a arylphosphate moiety from a synthetic substrate yielding a spectroscopically active product. Many different substrates can be used for these assays with p-nitrophenyl phosphate (pNPP), fluorescein diphosphate (FDP), and 6,8-difluoro-4-methylumbellyferyl phosphate (DiFMUP) being the most efficient and versatile. Equally, larger molecules such as phosphotyrosyl peptides can also be used to mimic more natural substrates. Activity assays include the determinations of the rate of dephosphorylation and calculations of kinetic constants such as k(cat) and K(M). These assays are useful to identify and characterize tyrosine phosphatases and are commonly used to evaluate the efficiency of inhibitors.

  19. Alkaline phosphatase of Physarum polycephalum is insoluble.

    PubMed

    Furuhashi, Kiyoshi

    2008-02-01

    The plasmodia of Physarum polycephalum grow as multinucleated cells in the presence of sufficient humidity and nutriment. Under non-illuminating conditions, stresses such as low temperature or high concentrations of salts transform the plasmodia into spherules whereas dehydration induces sclerotization. Some phosphatases including protein phosphatase and acid phosphatase have been purified from the plasmodia, but alkaline phosphatase remains to be elucidated. Phosphatase of the plasmodia, spherules and sclerotia was visualized by electrophoresis gel-staining assay using 5-bromo-4-chloro-3-indolyl phosphate. Insoluble fractions of the sclerotia were abundant in phosphatase activity. The phosphatase which was extracted by nonionic detergent was subjected to column chromatography and preparative electrophoresis. Purified phosphatase showed the highest activity at pH 8.8, indicating that this enzyme belongs to alkaline phosphatase. The apparent molecular mass from sodium dodecyl sulfate-polyacrylamide gel electrophoresis under non-reducing condition was estimated to be 100 kDa whereas that under reducing was 105 kDa. An amount of 1% sodium dodecyl sulfate or 0.5 M NaCl had no effects on the activity although the phosphatase showed heat instability, Mg(2+)-dependency and sensitivity to 2-glycerophosphate or NaF. The extracting conditions and enzymatic properties suggest that this alkaline phosphatase which is in a membrane-bound form plays important roles in phosphate metabolism.

  20. The glucose-6-phosphatase system.

    PubMed Central

    van Schaftingen, Emile; Gerin, Isabelle

    2002-01-01

    Glucose-6-phosphatase (G6Pase), an enzyme found mainly in the liver and the kidneys, plays the important role of providing glucose during starvation. Unlike most phosphatases acting on water-soluble compounds, it is a membrane-bound enzyme, being associated with the endoplasmic reticulum. In 1975, W. Arion and co-workers proposed a model according to which G6Pase was thought to be a rather unspecific phosphatase, with its catalytic site oriented towards the lumen of the endoplasmic reticulum [Arion, Wallin, Lange and Ballas (1975) Mol. Cell. Biochem. 6, 75--83]. Substrate would be provided to this enzyme by a translocase that is specific for glucose 6-phosphate, thereby accounting for the specificity of the phosphatase for glucose 6-phosphate in intact microsomes. Distinct transporters would allow inorganic phosphate and glucose to leave the vesicles. At variance with this substrate-transport model, other models propose that conformational changes play an important role in the properties of G6Pase. The last 10 years have witnessed important progress in our knowledge of the glucose 6-phosphate hydrolysis system. The genes encoding G6Pase and the glucose 6-phosphate translocase have been cloned and shown to be mutated in glycogen storage disease type Ia and type Ib respectively. The gene encoding a G6Pase-related protein, expressed specifically in pancreatic islets, has also been cloned. Specific potent inhibitors of G6Pase and of the glucose 6-phosphate translocase have been synthesized or isolated from micro-organisms. These as well as other findings support the model initially proposed by Arion. Much progress has also been made with regard to the regulation of the expression of G6Pase by insulin, glucocorticoids, cAMP and glucose. PMID:11879177

  1. Phosphatase Wip1 in Immunity: An Overview and Update

    PubMed Central

    Shen, Xiao-Fei; Zhao, Yang; Jiang, Jin-Peng; Guan, Wen-Xian; Du, Jun-Feng

    2017-01-01

    Wild-type p53-induced phosphatase 1 (Wip1) is a newly identified serine/threonine phosphatase, which belongs to the PP2C family. Due to its involvement in stress-induced networks and overexpression in human tumors, primary studies have mainly focused on the role of Wip1 in tumorigenesis. It now has also been implicated in regulating several other physiological processes such as organism aging and neurogenesis. Recent evidence highlights a new role of Wip1 in controlling immune response through regulating immune cell development and function, as well as through the interplay with inflammatory signaling pathways such NF-κB and p38 mitogen-activated protein kinase. In this short review, we will give an overview of Wip1 in immunity to better understand this important phosphatase. PMID:28144241

  2. Helicobacter pylori VacA, acting through receptor protein tyrosine phosphatase α, is crucial for CagA phosphorylation in human duodenum carcinoma cell line AZ-521

    PubMed Central

    Yahiro, Kinnosuke; Yamasaki, Eiki; Kurazono, Hisao; Akada, Junko; Yamaoka, Yoshio; Niidome, Takuro; Hatakeyama, Masanori; Suzuki, Hidekazu; Yamamoto, Taro; Moss, Joel; Isomoto, Hajime; Hirayama, Toshiya

    2016-01-01

    ABSTRACT Helicobacter pylori, a major cause of gastroduodenal diseases, produces vacuolating cytotoxin (VacA) and cytotoxin-associated gene A (CagA), which seem to be involved in virulence. VacA exhibits pleiotropic actions in gastroduodenal disorders via its specific receptors. Recently, we found that VacA induced the phosphorylation of cellular Src kinase (Src) at Tyr418 in AZ-521 cells. Silencing of receptor protein tyrosine phosphatase (RPTP)α, a VacA receptor, reduced VacA-induced Src phosphorylation. Src is responsible for tyrosine phosphorylation of CagA at its Glu-Pro-Ile-Tyr-Ala (EPIYA) variant C (EPIYA-C) motif in Helicobacter pylori-infected gastric epithelial cells, resulting in binding of CagA to SHP-2 phosphatase. Challenging AZ-521 cells with wild-type H. pylori induced phosphorylation of CagA, but this did not occur when challenged with a vacA gene-disrupted mutant strain. CagA phosphorylation was observed in cells infected with a vacA gene-disrupted mutant strain after addition of purified VacA, suggesting that VacA is required for H. pylori-induced CagA phosphorylation. Following siRNA-mediated RPTPα knockdown in AZ-521 cells, infection with wild-type H. pylori and treatment with VacA did not induce CagA phosphorylation. Taken together, these results support our conclusion that VacA mediates CagA phosphorylation through RPTPα in AZ-521 cells. These data indicate the possibility that Src phosphorylation induced by VacA is mediated through RPTPα, resulting in activation of Src, leading to CagA phosphorylation at Tyr972 in AZ-521 cells. PMID:27935824

  3. Post-Translational Regulation of the Glucose-6-Phosphatase Complex by Cyclic Adenosine Monophosphate Is a Crucial Determinant of Endogenous Glucose Production and Is Controlled by the Glucose-6-Phosphate Transporter.

    PubMed

    Soty, Maud; Chilloux, Julien; Delalande, François; Zitoun, Carine; Bertile, Fabrice; Mithieux, Gilles; Gautier-Stein, Amandine

    2016-04-01

    The excessive endogenous glucose production (EGP) induced by glucagon participates in the development of type 2 diabetes. To further understand this hormonal control, we studied the short-term regulation by cyclic adenosine monophosphate (cAMP) of the glucose-6-phosphatase (G6Pase) enzyme, which catalyzes the last reaction of EGP. In gluconeogenic cell models, a 1-h treatment by the adenylate cyclase activator forskolin increased G6Pase activity and glucose production independently of any change in enzyme protein amount or G6P content. Using specific inhibitors or protein overexpression, we showed that the stimulation of G6Pase activity involved the protein kinase A (PKA). Results of site-directed mutagenesis, mass spectrometry analyses, and in vitro phosphorylation experiments suggested that the PKA stimulation of G6Pase activity did not depend on a direct phosphorylation of the enzyme. However, the temperature-dependent induction of both G6Pase activity and glucose release suggested a membrane-based mechanism. G6Pase is composed of a G6P transporter (G6PT) and a catalytic unit (G6PC). Surprisingly, we demonstrated that the increase in G6PT activity was required for the stimulation of G6Pase activity by forskolin. Our data demonstrate the existence of a post-translational mechanism that regulates G6Pase activity and reveal the key role of G6PT in the hormonal regulation of G6Pase activity and of EGP.

  4. Inositol polyphosphate phosphatases in human disease.

    PubMed

    Hakim, Sandra; Bertucci, Micka C; Conduit, Sarah E; Vuong, David L; Mitchell, Christina A

    2012-01-01

    Phosphoinositide signalling molecules interact with a plethora of effector proteins to regulate cell proliferation and survival, vesicular trafficking, metabolism, actin dynamics and many other cellular functions. The generation of specific phosphoinositide species is achieved by the activity of phosphoinositide kinases and phosphatases, which phosphorylate and dephosphorylate, respectively, the inositol headgroup of phosphoinositide molecules. The phosphoinositide phosphatases can be classified as 3-, 4- and 5-phosphatases based on their specificity for dephosphorylating phosphates from specific positions on the inositol head group. The SAC phosphatases show less specificity for the position of the phosphate on the inositol ring. The phosphoinositide phosphatases regulate PI3K/Akt signalling, insulin signalling, endocytosis, vesicle trafficking, cell migration, proliferation and apoptosis. Mouse knockout models of several of the phosphoinositide phosphatases have revealed significant physiological roles for these enzymes, including the regulation of embryonic development, fertility, neurological function, the immune system and insulin sensitivity. Importantly, several phosphoinositide phosphatases have been directly associated with a range of human diseases. Genetic mutations in the 5-phosphatase INPP5E are causative of the ciliopathy syndromes Joubert and MORM, and mutations in the 5-phosphatase OCRL result in Lowe's syndrome and Dent 2 disease. Additionally, polymorphisms in the 5-phosphatase SHIP2 confer diabetes susceptibility in specific populations, whereas reduced protein expression of SHIP1 is reported in several human leukaemias. The 4-phosphatase, INPP4B, has recently been identified as a tumour suppressor in human breast and prostate cancer. Mutations in one SAC phosphatase, SAC3/FIG4, results in the degenerative neuropathy, Charcot-Marie-Tooth disease. Indeed, an understanding of the precise functions of phosphoinositide phosphatases is not only

  5. The DenA/DEN1 Interacting Phosphatase DipA Controls Septa Positioning and Phosphorylation-Dependent Stability of Cytoplasmatic DenA/DEN1 during Fungal Development

    PubMed Central

    Schinke, Josua; Kolog Gulko, Miriam; Christmann, Martin; Valerius, Oliver; Stumpf, Sina Kristin; Stirz, Margarita; Braus, Gerhard H.

    2016-01-01

    DenA/DEN1 and the COP9 signalosome (CSN) represent two deneddylases which remove the ubiquitin-like Nedd8 from modified target proteins and are required for distinct fungal developmental programmes. The cellular DenA/DEN1 population is divided into a nuclear and a cytoplasmatic subpopulation which is especially enriched at septa. DenA/DEN1 stability control mechanisms are different for the two cellular subpopulations and depend on different physical interacting proteins and the C-terminal DenA/DEN1 phosphorylation pattern. Nuclear DenA/DEN1 is destabilized during fungal development by five of the eight CSN subunits which target nuclear DenA/DEN1 for degradation. DenA/DEN1 becomes stabilized as a phosphoprotein at S243/S245 during vegetative growth, which is necessary to support further asexual development. After the initial phase of development, the newly identified cytoplasmatic DenA/DEN1 interacting phosphatase DipA and an additional developmental specific C-terminal phosphorylation site at serine S253 destabilize DenA/DEN1. Outside of the nucleus, DipA is co-transported with DenA/DEN1 in the cytoplasm between septa and nuclei. Deletion of dipA resulted in increased DenA/DEN1 stability in a strain which is unresponsive to illumination. The mutant strain is dysregulated in cytokinesis and impaired in asexual development. Our results suggest a dual phosphorylation-dependent DenA/DEN1 stability control with stabilizing and destabilizing modifications and physical interaction partner proteins which function as control points in the nucleus and the cytoplasm. PMID:27010942

  6. Structural Basis of Response Regulator Dephosphorylation by Rap Phosphatases

    SciTech Connect

    V Parashar; N Mirouze; D Dubnau; M Neiditch

    2011-12-31

    Bacterial Rap family proteins have been most extensively studied in Bacillus subtilis, where they regulate activities including sporulation, genetic competence, antibiotic expression, and the movement of the ICEBs1 transposon. One subset of Rap proteins consists of phosphatases that control B. subtilis and B. anthracis sporulation by dephosphorylating the response regulator Spo0F. The mechanistic basis of Rap phosphatase activity was unknown. Here we present the RapH-Spo0F X-ray crystal structure, which shows that Rap proteins consist of a 3-helix bundle and a tetratricopeptide repeat domain. Extensive biochemical and genetic functional studies reveal the importance of the observed RapH-Spo0F interactions, including the catalytic role of a glutamine in the RapH 3-helix bundle that inserts into the Spo0F active site. We show that in addition to dephosphorylating Spo0F, RapH can antagonize sporulation by sterically blocking phosphoryl transfer to and from Spo0F. Our structure-function analysis of the RapH-Spo0F interaction identified Rap protein residues critical for Spo0F phosphatase activity. This information enabled us to assign Spo0F phosphatase activity to a Rap protein based on sequence alone, which was not previously possible. Finally, as the ultimate test of our newfound understanding of the structural requirements for Rap phosphatase function, a non-phosphatase Rap protein that inhibits the binding of the response regulator ComA to DNA was rationally engineered to dephosphorylate Spo0F. In addition to revealing the mechanistic basis of response regulator dephosphorylation by Rap proteins, our studies support the previously proposed T-loop-Y allostery model of receiver domain regulation that restricts the aromatic 'switch' residue to an internal position when the {beta}4-{alpha}4 loop adopts an active-site proximal conformation.

  7. Structural Basis of Response Regulator Dephosphorylation by Rap Phosphatases

    PubMed Central

    Parashar, Vijay; Mirouze, Nicolas; Dubnau, David A.; Neiditch, Matthew B.

    2011-01-01

    Bacterial Rap family proteins have been most extensively studied in Bacillus subtilis, where they regulate activities including sporulation, genetic competence, antibiotic expression, and the movement of the ICEBs1 transposon. One subset of Rap proteins consists of phosphatases that control B. subtilis and B. anthracis sporulation by dephosphorylating the response regulator Spo0F. The mechanistic basis of Rap phosphatase activity was unknown. Here we present the RapH-Spo0F X-ray crystal structure, which shows that Rap proteins consist of a 3-helix bundle and a tetratricopeptide repeat domain. Extensive biochemical and genetic functional studies reveal the importance of the observed RapH-Spo0F interactions, including the catalytic role of a glutamine in the RapH 3-helix bundle that inserts into the Spo0F active site. We show that in addition to dephosphorylating Spo0F, RapH can antagonize sporulation by sterically blocking phosphoryl transfer to and from Spo0F. Our structure-function analysis of the RapH-Spo0F interaction identified Rap protein residues critical for Spo0F phosphatase activity. This information enabled us to assign Spo0F phosphatase activity to a Rap protein based on sequence alone, which was not previously possible. Finally, as the ultimate test of our newfound understanding of the structural requirements for Rap phosphatase function, a non-phosphatase Rap protein that inhibits the binding of the response regulator ComA to DNA was rationally engineered to dephosphorylate Spo0F. In addition to revealing the mechanistic basis of response regulator dephosphorylation by Rap proteins, our studies support the previously proposed T-loop-Y allostery model of receiver domain regulation that restricts the aromatic “switch” residue to an internal position when the β4-α4 loop adopts an active-site proximal conformation. PMID:21346797

  8. Structural basis of response regulator dephosphorylation by Rap phosphatases.

    PubMed

    Parashar, Vijay; Mirouze, Nicolas; Dubnau, David A; Neiditch, Matthew B

    2011-02-08

    Bacterial Rap family proteins have been most extensively studied in Bacillus subtilis, where they regulate activities including sporulation, genetic competence, antibiotic expression, and the movement of the ICEBs1 transposon. One subset of Rap proteins consists of phosphatases that control B. subtilis and B. anthracis sporulation by dephosphorylating the response regulator Spo0F. The mechanistic basis of Rap phosphatase activity was unknown. Here we present the RapH-Spo0F X-ray crystal structure, which shows that Rap proteins consist of a 3-helix bundle and a tetratricopeptide repeat domain. Extensive biochemical and genetic functional studies reveal the importance of the observed RapH-Spo0F interactions, including the catalytic role of a glutamine in the RapH 3-helix bundle that inserts into the Spo0F active site. We show that in addition to dephosphorylating Spo0F, RapH can antagonize sporulation by sterically blocking phosphoryl transfer to and from Spo0F. Our structure-function analysis of the RapH-Spo0F interaction identified Rap protein residues critical for Spo0F phosphatase activity. This information enabled us to assign Spo0F phosphatase activity to a Rap protein based on sequence alone, which was not previously possible. Finally, as the ultimate test of our newfound understanding of the structural requirements for Rap phosphatase function, a non-phosphatase Rap protein that inhibits the binding of the response regulator ComA to DNA was rationally engineered to dephosphorylate Spo0F. In addition to revealing the mechanistic basis of response regulator dephosphorylation by Rap proteins, our studies support the previously proposed T-loop-Y allostery model of receiver domain regulation that restricts the aromatic "switch" residue to an internal position when the β4-α4 loop adopts an active-site proximal conformation.

  9. [Protein phosphatases: structure and function].

    PubMed

    Bulanova, E G; Budagian, V M

    1994-01-01

    The process of protein and enzyme systems phosphorylation is necessary for cell growth, differentiation and preparation for division and mitosis. The conformation changes of protein as a result of phosphorylation lead to increased enzyme activity and enhanced affinity to substrates. A large group of enzymes--protein kinases--is responsible for phosphorylation process in cell, which are divided into tyrosine- and serine-threonine-kinases depending on their ability to phosphorylate appropriate amino acid residues. In this review has been considered the functional importance and structure of protein phosphatases--enzymes, which are functional antagonists of protein kinases.

  10. Phosphatidylinositolphosphate phosphatase activities and cancer

    PubMed Central

    Rudge, Simon A.; Wakelam, Michael J. O.

    2016-01-01

    Signaling through the phosphoinositide 3-kinase pathways mediates the actions of a plethora of hormones, growth factors, cytokines, and neurotransmitters upon their target cells following receptor occupation. Overactivation of these pathways has been implicated in a number of pathologies, in particular a range of malignancies. The tight regulation of signaling pathways necessitates the involvement of both stimulatory and terminating enzymes; inappropriate activation of a pathway can thus result from activation or inhibition of the two signaling arms. The focus of this review is to discuss, in detail, the activities of the identified families of phosphoinositide phosphatase expressed in humans, and how they regulate the levels of phosphoinositides implicated in promoting malignancy. PMID:26302980

  11. The TriTryp phosphatome: analysis of the protein phosphatase catalytic domains.

    PubMed

    Brenchley, Rachel; Tariq, Humera; McElhinney, Helen; Szöor, Balázs; Huxley-Jones, Julie; Stevens, Robert; Matthews, Keith; Tabernero, Lydia

    2007-11-26

    The genomes of the three parasitic protozoa Trypanosoma cruzi, Trypanosoma brucei and Leishmania major are the main subject of this study. These parasites are responsible for devastating human diseases known as Chagas disease, African sleeping sickness and cutaneous Leishmaniasis, respectively, that affect millions of people in the developing world. The prevalence of these neglected diseases results from a combination of poverty, inadequate prevention and difficult treatment. Protein phosphorylation is an important mechanism of controlling the development of these kinetoplastids. With the aim to further our knowledge of the biology of these organisms we present a characterisation of the phosphatase complement (phosphatome) of the three parasites. An ontology-based scan of the three genomes was used to identify 86 phosphatase catalytic domains in T. cruzi, 78 in T. brucei, and 88 in L. major. We found interesting differences with other eukaryotic genomes, such as the low proportion of tyrosine phosphatases and the expansion of the serine/threonine phosphatase family. Additionally, a large number of atypical protein phosphatases were identified in these species, representing more than one third of the total phosphatase complement. Most of the atypical phosphatases belong to the dual-specificity phosphatase (DSP) family and show considerable divergence from classic DSPs in both the domain organisation and sequence features. The analysis of the phosphatome of the three kinetoplastids indicates that they possess orthologues to many of the phosphatases reported in other eukaryotes, including humans. However, novel domain architectures and unusual combinations of accessory domains, suggest distinct functional roles for several of the kinetoplastid phosphatases, which await further experimental exploration. These distinct traits may be exploited in the selection of suitable new targets for drug development to prevent transmission and spread of the diseases, taking

  12. Biochemistry and structure of phosphoinositide phosphatases.

    PubMed

    Kim, Young Jun; Jahan, Nusrat; Bahk, Young Yil

    2013-01-01

    Phosphoinositides are the phosphorylated derivatives of phosphatidylinositol, and play a very significant role in a diverse range of signaling processes in eukaryotic cells. A number of phosphoinositide-metabolizing enzymes, including phosphoinositide-kinases and phosphatases are involved in the synthesis and degradation of these phospholipids. Recently, the function of various phosphatases in the phosphatidylinositol signaling pathway has been of great interest. In the present review we summarize the structural insights and biochemistry of various phosphatases in regulating phosphoinositide metabolism.

  13. Reversible Ser/Thr SHIP phosphorylation: a new paradigm in phosphoinositide signalling?: Targeting of SHIP1/2 phosphatases may be controlled by phosphorylation on Ser and Thr residues.

    PubMed

    Edimo, William's Elong; Janssens, Veerle; Waelkens, Etienne; Erneux, Christophe

    2012-08-01

    Phosphoinositide (PI) phosphatases such as the SH2 domain-containing inositol 5-phosphatases 1/2 (SHIP1 and 2) are important signalling enzymes in human physiopathology. SHIP1/2 interact with a large number of immune and growth factor receptors. Tyrosine phosphorylation of SHIP1/2 has been considered to be the determining regulatory modification. However, here we present a hypothesis, based on recent key publications, highlighting the determining role of Ser/Thr phosphorylation in regulating several key properties of SHIP1/2. Since a subunit of the Ser/Thr phosphatase PP2A has been shown to interact with SHIP2, a putative mechanism for reversing SHIP2 Ser/Thr phosphorylation can be anticipated. PI phosphatases are potential target molecules in human diseases, particularly, but not exclusively, in cancer and diabetes. Therefore, this novel regulatory mechanism deserves further attention in the hunt for discovering novel or complementary therapeutic strategies. This mechanism may be more broadly involved in regulating PI signalling in the case of synaptojanin1 or the phosphatase, tensin homolog, deleted on chromosome TEN.

  14. Insulin-receptor phosphotyrosyl-protein phosphatases.

    PubMed Central

    King, M J; Sale, G J

    1988-01-01

    Calmodulin-dependent protein phosphatase has been proposed to be an important phosphotyrosyl-protein phosphatase. The ability of the enzyme to attack autophosphorylated insulin receptor was examined and compared with the known ability of the enzyme to act on autophosphorylated epidermal-growth-factor (EGF) receptor. Purified calmodulin-dependent protein phosphatase was shown to catalyse the complete dephosphorylation of phosphotyrosyl-(insulin receptor). When compared at similar concentrations, 32P-labelled EGF receptor was dephosphorylated at greater than 3 times the rate of 32P-labelled insulin receptor; both dephosphorylations exhibited similar dependence on metal ions and calmodulin. Native phosphotyrosyl-protein phosphatases in cell extracts were also characterized. With rat liver, heart or brain, most (75%) of the native phosphatase activity against both 32P-labelled insulin and EGF receptors was recovered in the particulate fraction of the cell, with only 25% in the soluble fraction. This subcellular distribution contrasts with results of previous studies using artificial substrates, which found most of the phosphotyrosyl-protein phosphatase activity in the soluble fraction of the cell. Properties of particulate and soluble phosphatase activity against 32P-labelled insulin and EGF receptors are reported. The contribution of calmodulin-dependent protein phosphatase activity to phosphotyrosyl-protein phosphatase activity in cell fractions was determined by utilizing the unique metal-ion dependence of calmodulin-dependent protein phosphatase. Whereas Ni2+ (1 mM) markedly activated the calmodulin-dependent protein phosphatase, it was found to inhibit potently both particulate and soluble phosphotyrosyl-protein phosphatase activity. In fractions from rat liver, brain and heart, total phosphotyrosyl-protein phosphatase activity against both 32P-labelled receptors was inhibited by 99.5 +/- 6% (mean +/- S.E.M., 30 observations) by Ni2+. Results of Ni2+ inhibition

  15. Multi-stimuli responsive copper nanoclusters with bright red luminescence for quantifying acid phosphatase activity via redox-controlled luminescence switch.

    PubMed

    Zhao, Meizhi; Feng, Hui; Han, Jiaonan; Ao, Hang; Qian, Zhaosheng

    2017-09-01

    Thiolate-protected copper nanoclusers (CuNCs) are emerging as a promising class of luminescent materials since its unique optical properties such as aggregation-induced emission (AIE) and intriguing molecular-like behavior have been explored for sensing application. In this work, multi-stimuli responsive property of CuNCs was first investigated in depth and further adopted to develop a reliable and sensitive ACP assay. Penicilamine-capped CuNCs from a facile one-pot synthesis possess bright red luminescence and distinctive multi-stimuli responsive behaviors. Its sensitive and reversible response in luminescence to pH and temperature is originated from its inherent AIE property, and can be constructed as luminescent nanoswitches controlled by these external stimuli for precisely monitoring the change of environmental pH or temperature. The specific redox-responsive behavior of CuNC aggregates is found from severe luminescence quenching in the presence of a small amount of ferric or silver ions, and this sensitive response in luminescence to the preceding species is proved to be due to the conversion of Cu(II) from copper atoms with lower valence inside CuNCs. The luminescence switch of CuNC aggregates controlled by specific external potentials is further utilized to design a novel detection strategy for ACP activity. The great difference in luminescence quenching of CuNCs induced by iron(III) pyrophosphate (FePPi2) complex and free ferric ions enables us to quantitatively monitor ACP level by the luminescence change as variation of ACP activity in the assay solution. This assay is able to detect ACP level as lower as 0.8 U/L, and covers a broad linear scope of 100.0 U/L. This work reports redox-responsive property of CuNCs and its underlying nature due to the oxidation of its interior copper atoms, and provides a sensitive assay method for ACP activity which is sufficiently sensitive for practical measurement in real samples. Copyright © 2017 Elsevier B.V. All

  16. Protein phosphatases and Alzheimer's disease.

    PubMed

    Braithwaite, Steven P; Stock, Jeffry B; Lombroso, Paul J; Nairn, Angus C

    2012-01-01

    Alzheimer's Disease (AD) is characterized by progressive loss of cognitive function, linked to marked neuronal loss. Pathological hallmarks of the disease are the accumulation of the amyloid-β (Aβ) peptide in the form of amyloid plaques and the intracellular formation of neurofibrillary tangles (NFTs). Accumulating evidence supports a key role for protein phosphorylation in both the normal and pathological actions of Aβ as well as the formation of NFTs. NFTs contain hyperphosphorylated forms of the microtubule-binding protein tau, and phosphorylation of tau by several different kinases leads to its aggregation. The protein kinases involved in the generation and/or actions of tau or Aβ are viable drug targets to prevent or alleviate AD pathology. However, it has also been recognized that the protein phosphatases that reverse the actions of these protein kinases are equally important. Here, we review recent advances in our understanding of serine/threonine and tyrosine protein phosphatases in the pathology of AD. Copyright © 2012 Elsevier Inc. All rights reserved.

  17. Interdomain Communication in the Mycobacterium tuberculosis Environmental Phosphatase Rv1364c*

    PubMed Central

    Greenstein, Andrew E.; Hammel, Michal; Cavazos, Alexandra; Alber, Tom

    2009-01-01

    An “environmental phosphatase” controls bacterial transcriptional responses through alternative sigma factor subunits of RNA polymerase and a partner switching mechanism has been proposed to mediate phosphatase regulation. In many bacteria, the environmental phosphatase and multiple regulators are encoded in separate genes whose products form transient complexes. In contrast, in the Mycobacterium tuberculosis homolog, Rv1364c, the phosphatase is fused to two characteristic regulatory modules with sequence similarities to anti-sigma factor kinases and anti-anti-sigma factor proteins. Here we exploit this fusion to explore interactions between the phosphatase and the regulatory domains. We show quantitatively that the anti-sigma factor kinase domain activates the phosphatase domain, the kinase-phosphatase fusion protein autophosphorylates in Escherichia coli, and phosphorylation is antagonized by the phosphatase activity. Small angle x-ray scattering defines solution structures consistent with the interdomain communication observed biochemically. Taken together, these data indicate that Rv1364c provides a single chain framework to understand the structure, function, and regulation of environmental phosphatases throughout the bacterial kingdom. PMID:19700407

  18. The Role of Bacterial Protein Tyrosine Phosphatases in the Regulation of the Biosynthesis of Secreted Polysaccharides

    PubMed Central

    Morona, Renato

    2014-01-01

    Abstract Significance: Tyrosine phosphorylation and associated protein tyrosine phosphatases are gaining prominence as critical mechanisms in the regulation of fundamental processes in a wide variety of bacteria. In particular, these phosphatases have been associated with the control of the biosynthesis of capsular polysaccharides and extracellular polysaccharides, critically important virulence factors for bacteria. Recent Advances: Deletion and overexpression of the phosphatases result in altered polysaccharide biosynthesis in a range of bacteria. The recent structures of associated auto-phosphorylating tyrosine kinases have suggested that the phosphatases may be critical for the cycling of the kinases between monomers and higher order oligomers. Critical Issues: Additional substrates of the phosphatases apart from cognate kinases are currently being identified. These are likely to be critical to our understanding of the mechanism by which polysaccharide biosynthesis is regulated. Future Directions: Ultimately, these protein tyrosine phosphatases are an attractive target for the development of novel antimicrobials. This is particularly the case for the polymerase and histidinol phosphatase family, which is predominantly found in bacteria. Furthermore, the determination of bacterial tyrosine phosphoproteomes will likely help to uncover the fundamental roles, mechanism, and critical importance of these phosphatases in a wide range of bacteria. Antioxid. Redox Signal. 20, 2274–2289. PMID:24295407

  19. Spatial Patterns of Alkaline Phosphatase Expression within Bacterial Colonies and Biofilms in Response to Phosphate Starvation

    PubMed Central

    Huang, Ching-Tsan; Xu, Karen D.; McFeters, Gordon A.; Stewart, Philip S.

    1998-01-01

    The expression of alkaline phosphatase in response to phosphate starvation was shown to be spatially and temporally heterogeneous in bacterial biofilms and colonies. A commercial alkaline phosphatase substrate that generates a fluorescent, insoluble product was used in conjunction with frozen sectioning techniques to visualize spatial patterns of enzyme expression in both Klebsiella pneumoniae and Pseudomonas aeruginosa biofilms. Some of the expression patterns observed revealed alkaline phosphatase activity at the boundary of the biofilm opposite the place where the staining substrate was delivered, indicating that the enzyme substrate penetrated the biofilm fully. Alkaline phosphatase accumulated linearly with time in K. pneumoniae colonies transferred from high-phosphate medium to low-phosphate medium up to specific activities of 50 μmol per min per mg of protein after 24 h. In K. pneumoniae biofilms and colonies, alkaline phosphatase was initially expressed in the region of the biofilm immediately adjacent to the carbon and energy source (glucose). In time, the region of alkaline phosphatase expression expanded inward until it spanned most, but not all, of the biofilm or colony depth. In contrast, expression of alkaline phosphatase in P. aeruginosa biofilms occurred in a thin, sharply delineated band at the biofilm-bulk fluid interface. In this case, the band of activity never occupied more than approximately one-sixth of the biofilm. These results are consistent with the working hypothesis that alkaline phosphatase expression patterns are primarily controlled by the local availability of either the carbon and energy source or the electron acceptor. PMID:9546188

  20. Programmed cell death receptor ligand 1 modulates the regulatory T cells' capacity to repress shock/sepsis-induced indirect acute lung injury by recruiting phosphatase SRC homology region 2 domain-containing phosphatase 1.

    PubMed

    Tang, Lunxian; Bai, Jianwen; Chung, Chun-Shiang; Lomas-Neira, Joanne; Chen, Yaping; Huang, Xin; Ayala, Alfred

    2015-01-01

    We recently reported that adoptively transferred (AT) exogenous CD4+ CD25+ regulatory T cells (Tregs) to wild-type (WT) mice can directly act to repress shock/sepsis-induced experimental indirect acute lung injury (iALI), and this is mediated in part by programmed cell death receptor 1 (PD-1). In this study, we further determine whether recipient mouse lacking PD-L1, one of the primary ligands for PD-1, contributes to the manipulation of the Tregs' capacity to repress lung injury. To do this, Tregs isolated from the spleen of WT mice were AT into PD-L1 mice subjected to hemorrhagic shock and subsequent to cecal ligation and puncture to induce iALI. Samples were collected for analyses 24 h after cecal ligation and puncture. We found that in PD-L1-recipient mice, AT WT-Tregs lost the ability to reverse the development of iALI seen in WT recipient mice (i.e., no reduction of lung injury indices assessed by histology and vascular leakage, failure to decrease the lung neutrophil influx [myeloperoxidase activity], or the rise in lung apoptosis [caspase 3 activity]). Also, a significant increase in interleukin 1β (IL-1β) and keratinocyte-derived chemokine, but no changes in IL-6, IL-10, and IL-17A levels in lung tissues were seen in these mice compared with iALI mice without AT of Tregs. Furthermore, we noted that the lung tissue tyrosine phosphatase Src homology region 2 domain-containing phosphatase 1 (SHP-1), but not SHP-2, was activated with the AT of Tregs in PD-L1(-/-) iALI mice. Finally, through local depletion of CD4+ T cells or CD25+ (Tregs) in the lung, prior to inducing iALI, we found that SHP-1 activation was associated with the loss of Tregs' protective effects in vivo. Collectively, our data reveal that PD-L1 is a critical modulator of Tregs' ability to suppress iALI, and this appears to involve SHP-1 activation.

  1. IGF-1R modulation of acute GH-induced STAT5 signaling: role of protein tyrosine phosphatase activity.

    PubMed

    Gan, Yujun; Zhang, Yue; Buckels, Ashiya; Paterson, Andrew J; Jiang, Jing; Clemens, Thomas L; Zhang, Zhong-Yin; Du, Keyong; Chang, Yingzi; Frank, Stuart J

    2013-11-01

    GH is a potent anabolic and metabolic factor that binds its cell surface receptor (GHR), activating the GHR-associated tyrosine kinase, Janus kinase 2, which phosphorylates and activates the latent transcription factor, signal transducer and activator of transcription 5 (STAT5). Some GH actions are mediated by the elaboration of IGF-1, which exerts effects by binding and activating the heterotetrameric tyrosine kinase growth factor receptor, IGF-1R. In addition to this GH-GHR-IGF-1-IGF-1R scheme, we have demonstrated in primary osteoblasts and in islet β-cells that then deletion or silencing of IGF-1R results in diminished GH-induced STAT5 phosphorylation, suggesting that the presence of IGF-1R may facilitate GH signaling. In this study, we explore potential roles for protein tyrosine phosphatase activity in modulating GH-induced signaling, comparing conditions in which IGF-1R is present or diminished. We confirm that in mouse primary osteoblasts harboring loxP sites flanking the IGF-1R gene, infection with an adenovirus that expresses the Cre recombinase results in IGF-1R deletion and diminished acute GH-induced STAT5 phosphorylation. Furthermore, we present a new model of IGF-1R silencing, in which expression of short hairpin RNA directed at IGF-1R greatly reduces IGF-1R abundance in LNCaP human prostate cancer cells. In both models, treatment with a chemical inhibitor of protein tyrosine phosphatase-1B (PTP-1B), but not one of src homology region 2 domain-containing phosphotase-1 (SHP-1) and SHP-2, reverses the loss of GH-induced STAT5 phosphorylation in cells lacking IGF-1R but has no effect in cells with intact IGF-1R. Furthermore, expression of either a dominant-negative PTP-1B or the PTP-1B-interacting inhibitory protein, constitutive photomorphogenesis 1, also rescues acute GH-induced STAT5 signaling in IGF-1R-deficient cells but has no effect in IGF-1R replete cells. By expressing a substrate-trapping mutant PTP-1B, we demonstrate that tyrosine

  2. Pediatric reference intervals for alkaline phosphatase.

    PubMed

    Zierk, Jakob; Arzideh, Farhad; Haeckel, Rainer; Cario, Holger; Frühwald, Michael C; Groß, Hans-Jürgen; Gscheidmeier, Thomas; Hoffmann, Reinhard; Krebs, Alexander; Lichtinghagen, Ralf; Neumann, Michael; Ruf, Hans-Georg; Steigerwald, Udo; Streichert, Thomas; Rascher, Wolfgang; Metzler, Markus; Rauh, Manfred

    2017-01-01

    Interpretation of alkaline phosphatase activity in children is challenging due to extensive changes with growth and puberty leading to distinct sex- and age-specific dynamics. Continuous percentile charts from birth to adulthood allow accurate consideration of these dynamics and seem reasonable for an analyte as closely linked to growth as alkaline phosphatase. However, the ethical and practical challenges unique to pediatric reference intervals have restricted the creation of such percentile charts, resulting in limitations when clinical decisions are based on alkaline phosphatase activity. We applied an indirect method to generate percentile charts for alkaline phosphatase activity using clinical laboratory data collected during the clinical care of patients. A total of 361,405 samples from 124,440 patients from six German tertiary care centers and one German laboratory service provider measured between January 2004 and June 2015 were analyzed. Measurement of alkaline phosphatase activity was performed on Roche Cobas analyzers using the IFCC's photometric method. We created percentile charts for alkaline phosphatase activity in girls and boys from birth to 18 years which can be used as reference intervals. Additionally, data tables of age- and sex-specific percentile values allow the incorporation of these results into laboratory information systems. The percentile charts provided enable the appropriate differential diagnosis of changes in alkaline phosphatase activity due to disease and changes due to physiological development. After local validation, integration of the provided percentile charts into result reporting facilitates precise assessment of alkaline phosphatase dynamics in pediatrics.

  3. Intestinal alkaline phosphatase to treat necrotizing enterocolitis.

    PubMed

    Biesterveld, Ben E; Koehler, Shannon M; Heinzerling, Nathan P; Rentea, Rebecca M; Fredrich, Katherine; Welak, Scott R; Gourlay, David M

    2015-06-15

    Intestinal alkaline phosphatase (IAP) activity is decreased in necrotizing enterocolitis (NEC), and IAP supplementation prevents NEC development. It is not known if IAP given after NEC onset can reverse the course of the disease. We hypothesized that enteral IAP given after NEC induction would not reverse intestinal injury. NEC was induced in Sprague-Dawley pups by delivery preterm followed by formula feedings with lipopolysaccharide (LPS) and hypoxia exposure and continued up to 4 d. IAP was added to feeds on day 2 until being sacrificed on day 4. NEC severity was scored based on hematoxylin and eosin-stained terminal ileum sections, and AP activity was measured using a colorimetric assay. IAP and interleukin-6 expression were measured using real time polymerase chain reaction. NEC pups' alkaline phosphatase (AP) activity was decreased to 0.18 U/mg compared with controls of 0.57 U/mg (P < 0.01). Discontinuation of LPS and hypoxia after 2 d increased AP activity to 0.36 U/mg (P < 0.01). IAP supplementation in matched groups did not impact total AP activity or expression. Discontinuing LPS and hypoxia after NEC onset improved intestinal injury scores to 1.14 compared with continued stressors, score 2.25 (P < 0.01). IAP supplementation decreased interleukin-6 expression two-fold (P < 0.05), though did not reverse NEC intestinal damage (P = 0.5). This is the first work to demonstrate that removing the source of NEC improves intestinal damage and increases AP activity. When used as a rescue treatment, IAP decreased intestinal inflammation though did not impact injury making it likely that IAP is best used preventatively to those neonates at risk. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. HuPho: the human phosphatase portal.

    PubMed

    Liberti, Susanna; Sacco, Francesca; Calderone, Alberto; Perfetto, Livia; Iannuccelli, Marta; Panni, Simona; Santonico, Elena; Palma, Anita; Nardozza, Aurelio P; Castagnoli, Luisa; Cesareni, Gianni

    2013-01-01

    Phosphatases and kinases contribute to the regulation of protein phosphorylation homeostasis in the cell. Phosphorylation is a key post-translational modification underlying the regulation of many cellular processes. Thus, a comprehensive picture of phosphatase function and the identification of their target substrates would aid a systematic approach to a mechanistic description of cell signalling. Here we present a website designed to facilitate the retrieval of information about human protein phosphatases. To this end we developed a search engine to recover and integrate information annotated in several publicly available web resources. In addition we present a text-mining-assisted annotation effort aimed at extracting phosphatase related data reported in the scientific literature. The HuPho (human phosphatases) website can be accessed at http://hupho.uniroma2.it.

  5. Specificity of a protein phosphatase inhibitor from rabbit skeletal muscle.

    PubMed Central

    Cohen, P; Nimmo, G A; Antoniw, J F

    1977-01-01

    A hear-stable protein, which is a specific inhibitor of protein phosphatase-III, was purified 700-fold from skeletal muscle by a procedure that involved heat-treatment at 95 degrees C, chromatography on DEAE-cellulose and gel filtration on Sephadex G-100. The final step completely resolved the protein phosphatase inhibitor from the protein inhibitor of cyclic AMP-dependent protein kinase. The phosphorylase phosphatase, beta-phosphorylase kinase phosphatase, glycogen synthase phosphatase-1 and glycogen synthase phosphatase-2 activities of protein phosphatase-III [Antoniw, J. F., Nimmo, H. G., Yeaman, S. J. & Cohen, P.(1977) Biochem.J. 162, 423-433] were inhibited in a very similar manner by the protein phosphatase inhibitor and at least 95% inhibition was observed at high concentrations of inhibitor. The two forms of protein phosphatase-III, termed IIIA and IIIB, were equally susceptible to the protein phosphatase inhibitor. The protein phosphatase inhibitor was at least 200 times less effective in inhibiting the activity of protein phosphatase-I and protein phosphatase-II. The high degree of specificity of the inhibitor for protein phosphatase-III was used to show that 90% of the phosphorylase phosphatase and glycogen synthase phosphatase activities measured in muscle extracts are catalysed by protein phosphatase-III. Protein phosphatase-III was tightly associated with the protein-glycogen complex that can be isolated from skeletal muscle, whereas the protein phosphatase inhibitor and protein phosphatase-II were not. The results provide further evidence that the enzyme that catalyses the dephosphorylation of the alpha-subunit of phosphorylase kinase (protein phosphatase-II) and the enzyme that catalyses the dephosphorylation of the beta-subunit of phosphorylase kinase (protein phosphatase-III) are distinct. The results suggest that the protein phosphatase inhibitor may be a useful probe for differentiating different classes of protein phosphatases in mammalian

  6. Influence of pesticides and herbicides presence on phosphatase activity and selected bacterial microbiota of a natural lake system.

    PubMed

    López, L; Pozo, C; Rodelas, B; Calvo, C; González-López, J

    2006-07-01

    Phosphatase activities (cell-bounded phosphatases "BP" and freely dissolved phosphatases "D P") in water samples from a natural lake "Laguna Grande" (Antequera, Málaga, Spain) amended with 50 microg/ml of selected insecticides, herbicides and fungicide captan were studied under laboratory controlled conditions (temperature and agitation). Our data show that dissolved alkaline phosphatase was the enzymatic activity that contributed in higher proportion to total lake water samples phosphatase status. The presence of organochlorinated insecticides (aldrin and lindane), organophosphorous insecticides (dimetoate, methidation and methyl-parathion), herbicide atrazine and fungicide captan significantly increased phosphatase activities after 28 days of incubation. However, these activities were not affected as a consequence of the addition of the herbicide simazine to the water samples. Heterotrophic mesophilic and psychrophilic aquatic bacteria counts as well as culturable phosphate solubilizing microorganisms, increased when the pesticides were added to lake water samples with herbicide simazine exception.

  7. Multisystemic functions of alkaline phosphatases.

    PubMed

    Buchet, René; Millán, José Luis; Magne, David

    2013-01-01

    Human and mouse alkaline phosphatases (AP) are encoded by a multigene family expressed ubiquitously in multiple tissues. Gene knockout (KO) findings have helped define some of the precise exocytic functions of individual isozymes in bone, teeth, the central nervous system, and in the gut. For instance, deficiency in tissue-nonspecific alkaline phosphatase (TNAP) in mice (Alpl (-/-) mice) and humans leads to hypophosphatasia (HPP), an inborn error of metabolism characterized by epileptic seizures in the most severe cases, caused by abnormal metabolism of pyridoxal-5'-phosphate (the predominant form of vitamin B6) and by hypomineralization of the skeleton and teeth featuring rickets and early loss of teeth in children or osteomalacia and dental problems in adults caused by accumulation of inorganic pyrophosphate (PPi). Enzyme replacement therapy with mineral-targeting TNAP prevented all the manifestations of HPP in mice, and clinical trials with this protein therapeutic are showing promising results in rescuing life-threatening HPP in infants. Conversely, TNAP induction in the vasculature during generalized arterial calcification of infancy (GACI), type II diabetes, obesity, and aging can cause medial vascular calcification. TNAP inhibitors, discussed extensively in this book, are in development to prevent pathological arterial calcification. The brush border enzyme intestinal alkaline phosphatase (IAP) plays an important role in fatty acid (FA) absorption, in protecting gut barrier function, and in determining the composition of the gut microbiota via its ability to dephosphorylate lipopolysaccharide (LPS). Knockout mice (Akp3 (-/-)) deficient in duodenal-specific IAP (dIAP) become obese, and develop hyperlipidemia and hepatic steatosis when fed a high-fat diet (HFD). These changes are accompanied by upregulation in the jejunal-ileal expression of the Akp6 IAP isozyme (global IAP, or gIAP) and concomitant upregulation of FAT/CD36, a phosphorylated fatty acid

  8. Dolichyl-phosphate phosphatase and dolichyl-diphosphate phosphatase in rat-liver microsomes.

    PubMed

    Belocopitow, E; Boscoboinik, D

    1982-06-15

    Dolichyl-phosphate phosphatase and dolichyl-diphosphate phosphatase activities of a liver-cell microsomal preparation were solubilized by treatment with Triton X-100. The 100,000 X g supernatant was then passed through a column of Sepharose-4B--concanavalin A. Both enzyme activities were found in the percolate. This treatment eliminated inhibition by ATP and glucose 6-phosphate in both phosphatase activities. In each case the activities were inhibited by higher concentrations of enzyme preparation due to the presence of phospholipids. The inhibitory effects of either phosphatidylcholine or phosphatidylethanolamine were due to competition for detergent. On the other hand, the effect produced by phosphatidic acid appeared to be different, since it did not change the optimal concentration of Triton X-100 for the two enzymes. Dolichyl-phosphate phosphatase was strongly inhibited by both Pi and PPi, whereas dolichyl-diphosphate phosphatase was only slightly inhibited by Pi and not at all by PPi. Dolichyl-diphosphate phosphatase was more inhibited by divalent cations than dolichyl-phosphate phosphatase. The apparent Km of dolichyl-phosphate phosphatase for dolichyl phosphate was 0.15 mM. Dolichol also inhibited dolichyl-phosphate phosphatase, but it produced a stronger inhibition on dolichyl-diphosphate phosphatase. The inhibitory effect of dolichol was not entirely due to detergent competition.

  9. Targeting the Reversibly Oxidized Protein Tyrosine Phosphatase Superfamily

    PubMed Central

    Boivin, Benoit; Yang, Ming; Tonks, Nicholas K.

    2010-01-01

    Controlled production of reactive oxygen species leads to reversible oxidation of protein tyrosine phosphatases (PTPs) and has emerged as an important tier of regulation over phosphorylation-dependent signal transduction. We present a modified cysteinyl-labeling assay that detects reversible oxidation of members of each of the different PTP subclasses. Here, we describe the methods for enriching reversibly oxidized PTPs from complex protein extracts, illustrating the procedure in IMR90 fibroblasts. PMID:20807953

  10. Alkaline Phosphatase distribution in the inferior vagal ganglion of the cat following vagotomy: a chronological study.

    PubMed

    Glover, R A

    1976-10-07

    The object of this study was to demonstrate sites of alkaline phosphatase activity within the cellular elements of the inferior vagal (nodosal) ganglion of the cat and chronologically observe and describe alterations in enzyme activity following vagotomy. In control tissues alkaline phosphatase activity was localized to the wall of perineuronal blood vessels and the satellite cell cytoplasm which envelops the neuronal perikarya. In the experimental tissues alkaline phosphatase activity was increased in the above locations during the first 20 days following vagotomy then gradually declined to approximate control levels by 60 days post-operatively. The functional significance of changes in alkaline phosphatase activity occurring within an altered metabolic environment induced by vagotomy is discussed.

  11. Emerging issues in receptor protein tyrosine phosphatase function: lifting fog or simply shifting?

    PubMed

    Petrone, A; Sap, J

    2000-07-01

    Transmembrane (receptor) tyrosine phosphatases are intimately involved in responses to cell-cell and cell-matrix contact. Several important issues regarding the targets and regulation of this protein family are now emerging. For example, these phosphatases exhibit complex interactions with signaling pathways involving SRC family kinases, which result from their ability to control phosphorylation of both activating and inhibitory sites in these kinases and possibly also their substrates. Similarly, integrin signaling illustrates how phosphorylation of a single protein, or the activity of a pathway, can be controlled by multiple tyrosine phosphatases, attesting to the intricate integration of these enzymes in cellular regulation. Lastly, we are starting to appreciate the roles of intracellular topology, tyrosine phosphorylation and oligomerization among the many mechanisms regulating tyrosine phosphatase activity.

  12. Identification and characterization of a pyridoxal 5'-phosphate phosphatase in the silkworm (Bombyx mori).

    PubMed

    Huang, ShuoHao; Han, CaiYun; Ma, ZhenQiao; Zhou, Jie; Zhang, JianYun; Huang, LongQuan

    2017-03-01

    Vitamin B6 comprises six interconvertible pyridine compounds, among which pyridoxal 5'-phosphate (PLP) is a coenzyme for over 140 enzymes. PLP is also a very reactive aldehyde. The most well established mechanism for maintaining low levels of free PLP is its dephosphorylation by phosphatases. A human PLP-specific phosphatase has been identified and characterized. However, very little is known about the phosphatase in other living organisms. In this study, a cDNA clone of putative PLP phosphatase was identified from B. mori and characterized. The cDNA encodes a polypeptide of 343 amino acid residues, and the recombinant enzyme purified from E. coli exhibited properties similar to that of human PLP phosphatase. B. mori has a single copy of the PLPP gene, which is located on 11th chromosome, spans a 5.7kb region and contains five exons and four introns. PLP phosphatase transcript was detected in every larva tissue except hemolymph, and was most highly represented in Malpighian tube. We further down-regulated the gene expression of the PLP phosphatase in 5th instar larvae with the RNA interference. However, no significant changes in the gene expression of PLP biosynthetic enzymes and composition of B6 vitamers were detected as compared with the control. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. A macro-enzyme cause of an isolated increase of alkaline phosphatase.

    PubMed

    Cervinski, Mark A; Lee, Hong Kee; Martin, Isabella W; Gavrilov, Dimitar K

    2015-02-02

    Macroenzyme complexes of serum enzymes and antibody can increase the circulating enzymatic activity and may lead to unnecessary additional testing and procedures. Laboratory physicians and scientists need to be aware of techniques to identify macroenzyme complexes when suspected. To investigate the possibility of a macro-alkaline phosphatase in the serum of a 74 year old male with persistently increased alkaline phosphatase we coupled a protein A/G agarose affinity chromatography technique with isoenzyme electrophoresis to look for the presence of macro-alkaline phosphatase. The majority of the alkaline phosphatase activity in the patient's serum sample was bound to the column and only a minor fraction (25%) of alkaline phosphatase activity was present in the column flow-through. The alkaline phosphatase activity was also found to co-elute with the immunoglobulins in the patient sample. The alkaline phosphatase activity in a control serum sample concurrently treated in the same manner did not bind to the column and was found in the column flow-through. The use of protein A/G agarose affinity chromatography is a rapid and simple method that can be applied to the investigation of other macro-enzyme complexes. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Regulation of intestinal calcium absorption by luminal calcium content: role of intestinal alkaline phosphatase.

    PubMed

    Brun, Lucas R; Brance, María L; Lombarte, Mercedes; Lupo, Maela; Di Loreto, Verónica E; Rigalli, Alfredo

    2014-07-01

    Intestinal alkaline phosphatase is a brush border enzyme that is stimulated by calcium. Inhibition of intestinal alkaline phosphatase increases intestinal calcium absorption. We hypothesized that intestinal alkaline phosphatase acts as a minute-to-minute regulatory mechanism of calcium entry. The aim of this study was to evaluate the mechanism by which intestinal luminal calcium controls intestinal calcium absorption. We performed kinetic studies with purified intestinal alkaline phosphatase and everted duodenal sacs and showed that intestinal alkaline phosphatase modifies the luminal pH as a function of enzyme concentration and calcium luminal content. A decrease in pH occurred simultaneously with a decrease in calcium absorption. The inhibition of intestinal alkaline phosphatase by l-phenylalanine caused an increase in calcium absorption. This effect was also confirmed in calcium uptake experiments with isolated duodenal cells. Changes in luminal pH arising from intestinal alkaline phosphatase activity induced by luminal calcium concentration modulate intestinal calcium absorption. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Study protocol for a multicentre randomised controlled trial: Safety, Tolerability, efficacy and quality of life Of a human recombinant alkaline Phosphatase in patients with sepsis-associated Acute Kidney Injury (STOP-AKI)

    PubMed Central

    Peters, Esther; Mehta, Ravindra L; Murray, Patrick T; Hummel, Jürgen; Joannidis, Michael; Kellum, John A; Arend, Jacques; Pickkers, Peter

    2016-01-01

    Introduction Acute kidney injury (AKI) occurs in 55–60% of critically ill patients, and sepsis is the most common underlying cause. No pharmacological treatment options are licensed to treat sepsis-associated AKI (SA-AKI); only supportive renal replacement therapy (RRT) is available. One of the limited number of candidate compounds in clinical development to treat SA-AKI is alkaline phosphatase (AP). The renal protective effect of purified bovine intestinal AP has been demonstrated in critically ill sepsis patients. To build on these observations, a human recombinant AP (recAP) was developed, of which safety and efficacy in patients with SA-AKI will be investigated in this trial. Methods This is a randomised, double-blind, placebo-controlled, 4-arm, proof-of-concept, dose-finding adaptive phase IIa/IIb study, conducted in critically ill patients with SA-AKI. A minimum of 290 patients will be enrolled at ∼50 sites in the European Union and North America. The study involves 2 parts. Patients enrolled during Part 1 will be randomly assigned to receive either placebo (n=30) or 1 of 3 different doses of recAP (n=30 per group) once daily for 3 days (0.4, 0.8 or 1.6 mg/kg). In Part 2, patients will be randomly assigned to receive the most efficacious dose of recAP (n=85), selected during an interim analysis, or placebo (n=85). Treatment must be administered within 24 hours after SA-AKI is first diagnosed and within 96 hours from first diagnosis of sepsis. The primary end point is the area under the time-corrected endogenous creatinine clearance curve from days 1 to 7. The key secondary end point is RRT incidence during days 1–28. Ethics and dissemination This study is approved by the relevant institutional review boards/independent ethics committees and is conducted in accordance with the ethical principles of the Declaration of Helsinki, guidelines of Good Clinical Practice, Code of Federal Regulations and all other applicable regulations. Results of this

  16. Serum creatinine and alkaline phosphatase levels are associated with severe chronic periodontitis.

    PubMed

    Caúla, A L; Lira-Junior, R; Tinoco, E M B; Fischer, R G

    2015-12-01

    Periodontitis may alter systemic homeostasis and influence creatinine and alkaline phosphatase levels. Therefore, the aim of this study was to evaluate the relationship between severe chronic periodontitis and serum creatinine and alkaline phosphatase levels. One hundred patients were evaluated, 66 with severe chronic periodontitis (test group) and 34 periodontally healthy controls (control group). Medical, demographic and periodontal parameters were registered. Blood sample was collected after an overnight fast and serum creatinine and alkaline phosphatase levels were determined. There were significant differences between test and control groups in ethnicity, gender and educational level (p < 0.05). Patients with periodontitis showed a lower mean creatinine level (p < 0.05) and higher mean alkaline phosphatase level (p < 0.001) than the control group. There were significant correlations between periodontal parameters and serum creatinine and alkaline phosphatase levels. Severe chronic periodontitis was associated to lower creatinine and higher alkaline phosphatase levels. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  17. Yeast Nem1-Spo7 Protein Phosphatase Activity on Pah1 Phosphatidate Phosphatase Is Specific for the Pho85-Pho80 Protein Kinase Phosphorylation Sites*

    PubMed Central

    Su, Wen-Min; Han, Gil-Soo; Carman, George M.

    2014-01-01

    Pah1 is the phosphatidate phosphatase in the yeast Saccharomyces cerevisiae that produces diacylglycerol for triacylglycerol synthesis and concurrently controls the levels of phosphatidate used for phospholipid synthesis. Phosphorylation and dephosphorylation of Pah1 regulate its subcellular location and phosphatidate phosphatase activity. Compared with its phosphorylation by multiple protein kinases, Pah1 is dephosphorylated by a protein phosphatase complex consisting of Nem1 (catalytic subunit) and Spo7 (regulatory subunit). In this work, we characterized the Nem1-Spo7 phosphatase complex for its enzymological, kinetic, and regulatory properties with phosphorylated Pah1. The dephosphorylation of Pah1 by Nem1-Spo7 phosphatase resulted in the stimulation (6-fold) of phosphatidate phosphatase activity. For Pah1 phosphorylated by the Pho85-Pho80 kinase complex, maximum Nem1-Spo7 phosphatase activity required Mg2+ ions (8 mm) and Triton X-100 (0.25 mm) at pH 5.0. The energy of activation for the reaction was 8.4 kcal/mol, and the enzyme was thermally labile at temperatures above 40 °C. The enzyme activity was inhibited by sodium vanadate, sodium fluoride, N-ethylmaleimide, and phenylglyoxal but was not significantly affected by lipids or nucleotides. Nem1-Spo7 phosphatase activity was dependent on the concentrations of Pah1 phosphorylated by Pho85-Pho80, Cdc28-cyclin B, PKA, and PKC with kcat and Km values of 0.29 s−1 and 81 nm, 0.11 s−1 and 127 nm, 0.10 s−1 and 46 nm, and 0.02 s−1 and 38 nm, respectively. Its specificity constant (kcat/Km) for Pah1 phosphorylated by Pho85-Pho80 was 1.6-, 4-, and 6-fold higher, respectively, than that phosphorylated by PKA, Cdc28-cyclin B, and PKC. PMID:25359770

  18. Yeast Nem1-Spo7 protein phosphatase activity on Pah1 phosphatidate phosphatase is specific for the Pho85-Pho80 protein kinase phosphorylation sites.

    PubMed

    Su, Wen-Min; Han, Gil-Soo; Carman, George M

    2014-12-12

    Pah1 is the phosphatidate phosphatase in the yeast Saccharomyces cerevisiae that produces diacylglycerol for triacylglycerol synthesis and concurrently controls the levels of phosphatidate used for phospholipid synthesis. Phosphorylation and dephosphorylation of Pah1 regulate its subcellular location and phosphatidate phosphatase activity. Compared with its phosphorylation by multiple protein kinases, Pah1 is dephosphorylated by a protein phosphatase complex consisting of Nem1 (catalytic subunit) and Spo7 (regulatory subunit). In this work, we characterized the Nem1-Spo7 phosphatase complex for its enzymological, kinetic, and regulatory properties with phosphorylated Pah1. The dephosphorylation of Pah1 by Nem1-Spo7 phosphatase resulted in the stimulation (6-fold) of phosphatidate phosphatase activity. For Pah1 phosphorylated by the Pho85-Pho80 kinase complex, maximum Nem1-Spo7 phosphatase activity required Mg(2+) ions (8 mm) and Triton X-100 (0.25 mm) at pH 5.0. The energy of activation for the reaction was 8.4 kcal/mol, and the enzyme was thermally labile at temperatures above 40 °C. The enzyme activity was inhibited by sodium vanadate, sodium fluoride, N-ethylmaleimide, and phenylglyoxal but was not significantly affected by lipids or nucleotides. Nem1-Spo7 phosphatase activity was dependent on the concentrations of Pah1 phosphorylated by Pho85-Pho80, Cdc28-cyclin B, PKA, and PKC with kcat and Km values of 0.29 s(-1) and 81 nm, 0.11 s(-1) and 127 nm, 0.10 s(-1) and 46 nm, and 0.02 s(-1) and 38 nm, respectively. Its specificity constant (kcat/Km) for Pah1 phosphorylated by Pho85-Pho80 was 1.6-, 4-, and 6-fold higher, respectively, than that phosphorylated by PKA, Cdc28-cyclin B, and PKC. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  19. Direct activation of protein phosphatase-2A0 by HIV-1 encoded protein complex NCp7:vpr.

    PubMed

    Tung, H Y; De Rocquigny, H; Zhao, L J; Cayla, X; Roques, B P; Ozon, R

    1997-01-20

    The effects of HIV-1 encoded proteins NCp7, vpr and NCp7:vpr complex on the activity of protein phosphatase-2A0 have been tested. We report that NCp7 is an activator of protein phosphatase-2A0 and that vpr activated protein phosphatase-2A0 only slightly. We also report that NCp7 and vpr form a tight complex which becomes a more potent activator of protein phosphatase-2A0 than NCp7 alone. The ability of NCp7 to activate protein phosphatase-2A0 is regulated by vpr. The C-terminal portion of vpr prevents NCp7 from activating protein phosphatase-2A0 while the N-terminal portion of vpr potentiates the effect of NCp7 on the activity of protein phosphatase-2A0. Our findings indicate that vpr may be acting as a targeting subunit which directs NCp7 to activate protein phosphatase-2A0. In view of the fact that protein phosphatase-2A functions as an inhibitor of G0 to M transition of the cell cycle and is involved in other key cellular processes such as the control of RNA transcription, the results presented in this report may explain how HIV-1 causes cell cycle arrest which may lead to CD4+ T cell depletion and also how it disturbs normal cellular processes of its host cell.

  20. Protein Phosphatases Decrease Their Activity during Capacitation: A New Requirement for This Event

    PubMed Central

    Signorelli, Janetti R.; Díaz, Emilce S.; Fara, Karla; Barón, Lina; Morales, Patricio

    2013-01-01

    There are few reports on the role of protein phosphatases during capacitation. Here, we report on the role of PP2B, PP1, and PP2A during human sperm capacitation. Motile sperm were resuspended in non-capacitating medium (NCM, Tyrode's medium, albumin- and bicarbonate-free) or in reconstituted medium (RCM, NCM plus 2.6% albumin/25 mM bicarbonate). The presence of the phosphatases was evaluated by western blotting and the subcellular localization by indirect immunofluorescence. The function of these phosphatases was analyzed by incubating the sperm with specific inhibitors: okadaic acid, I2, endothall, and deltamethrin. Different aliquots were incubated in the following media: 1) NCM; 2) NCM plus inhibitors; 3) RCM; and 4) RCM plus inhibitors. The percent capacitated sperm and phosphatase activities were evaluated using the chlortetracycline assay and a phosphatase assay kit, respectively. The results confirm the presence of PP2B and PP1 in human sperm. We also report the presence of PP2A, specifically, the catalytic subunit and the regulatory subunits PR65 and B. PP2B and PP2A were present in the tail, neck, and postacrosomal region, and PP1 was present in the postacrosomal region, neck, middle, and principal piece of human sperm. Treatment with phosphatase inhibitors rapidly (≤1 min) increased the percent of sperm depicting the pattern B, reaching a maximum of ∼40% that was maintained throughout incubation; after 3 h, the percent of capacitated sperm was similar to that of the control. The enzymatic activity of the phosphatases decreased during capacitation without changes in their expression. The pattern of phosphorylation on threonine residues showed a sharp increase upon treatment with the inhibitors. In conclusion, human sperm express PP1, PP2B, and PP2A, and the activity of these phosphatases decreases during capacitation. This decline in phosphatase activities and the subsequent increase in threonine phosphorylation may be an important requirement for the

  1. Multiple Functions of the Eya Phosphotyrosine Phosphatase

    PubMed Central

    2015-01-01

    Eyes absent (Eya), a protein conserved from plants to humans and best characterized as a transcriptional coactivator, is also the prototype for a novel class of eukaryotic aspartyl protein tyrosine phosphatases. This minireview discusses recent breakthroughs in elucidating the substrates and cellular events regulated by Eya's tyrosine phosphatase function and highlights some of the complexities, new questions, and surprises that have emerged from efforts to understand how Eya's unusual multifunctionality influences developmental regulation and signaling. PMID:26667035

  2. Translating protein phosphatase research into treatments for neurodegenerative diseases.

    PubMed

    Sundaram, Jeyapriya R; Lee, Irene C J; Shenolikar, Shirish

    2017-02-08

    Many of the major neurodegenerative disorders are characterized by the accumulation of intracellular protein aggregates in neurons and other cells in brain, suggesting that errors in protein quality control mechanisms associated with the aging process play a critical role in the onset and progression of disease. The increased understanding of the unfolded protein response (UPR) signaling network and, more specifically, the structure and function of eIF2α phosphatases has enabled the development or discovery of small molecule inhibitors that show great promise in restoring protein homeostasis and ameliorating neuronal damage and death. While this review focuses attention on one or more eIF2α phosphatases, the wide range of UPR proteins that are currently being explored as potential drug targets bodes well for the successful future development of therapies to preserve neuronal function and treat neurodegenerative disease. © 2017 The Author(s); published by Portland Press Limited on behalf of the Biochemical Society.

  3. Phosphatidate phosphatase regulates membrane phospholipid synthesis via phosphatidylserine synthase.

    PubMed

    Carman, George M; Han, Gil-Soo

    2017-08-16

    The yeast Saccharomyces cerevisiae serves as a model eukaryote to elucidate the regulation of lipid metabolism. In exponentially growing yeast, a diverse set of membrane lipids are synthesized from the precursor phosphatidate via the liponucleotide intermediate CDP-diacylglycerol. As cells exhaust nutrients and progress into the stationary phase, phosphatidate is channeled via diacylglycerol to the synthesis of triacylglycerol. The CHO1-encoded phosphatidylserine synthase, which catalyzes the committed step in membrane phospholipid synthesis via CDP-diacylglycerol, and the PAH1-encoded phosphatidate phosphatase, which catalyzes the committed step in triacylglycerol synthesis are regulated throughout cell growth by genetic and biochemical mechanisms to control the balanced synthesis of membrane phospholipids and triacylglycerol. The loss of phosphatidate phosphatase activity (e.g., pah1Δ mutation) increases the level of phosphatidate and its conversion to membrane phospholipids by inducing Cho1 expression and phosphatidylserine synthase activity. The regulation of the CHO1 expression is mediated through the inositol-sensitive upstream activation sequence (UASINO), a cis-acting element for the phosphatidate-controlled Henry (Ino2-Ino4/Opi1) regulatory circuit. Consequently, phosphatidate phosphatase activity regulates phospholipid synthesis through the transcriptional regulation of the phosphatidylserine synthase enzyme. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. The role of serine/threonine protein phosphatases in exocytosis.

    PubMed Central

    Sim, Alistair T R; Baldwin, Monique L; Rostas, John A P; Holst, Jeff; Ludowyke, Russell I

    2003-01-01

    Modulation of exocytosis is integral to the regulation of cellular signalling, and a variety of disorders (such as epilepsy, hypertension, diabetes and asthma) are closely associated with pathological modulation of exocytosis. Emerging evidence points to protein phosphatases as key regulators of exocytosis in many cells and, therefore, as potential targets for the design of novel therapies to treat these diseases. Diverse yet exquisite regulatory mechanisms have evolved to direct the specificity of these enzymes in controlling particular cell processes, and functionally driven studies have demonstrated differential regulation of exocytosis by individual protein phosphatases. This Review discusses the evidence for the regulation of exocytosis by protein phosphatases in three major secretory systems, (1) mast cells, in which the regulation of exocytosis of inflammatory mediators plays a major role in the respiratory response to antigens, (2) insulin-secreting cells in which regulation of exocytosis is essential for metabolic control, and (3) neurons, in which regulation of exocytosis is perhaps the most complex and is essential for effective neurotransmission. PMID:12749763

  5. Analysis of Smad Phosphatase Activity In Vitro.

    PubMed

    Shen, Tao; Qin, Lan; Lin, Xia

    2016-01-01

    Phosphorylation of Smad1/5/8 at the C-terminal SXS motif by BMP type I receptors is one of the most critical events in BMP signaling. Conversely, protein phosphatases that dephosphorylate phospho-Smad1/5/8 can consequently prevent or terminate BMP signaling. PPM1H is an undercharacterized phosphatase in the PPM family. We recently demonstrated that PPM1H can dephosphorylate Smad1 in the cytoplasm and block BMP signaling responses in cellular assays. Here we describe in vitro method showing that PPM1H is a bona fide phosphatase for Smad1/5/8. PPM1H is produced as GST fusion protein in E. coli, and purified against glutathione sepharose beads. Bacterially purified recombinant PPM1H possesses phosphatase activity toward artificial substrate para-nitrophenyl phosphate (pNPP). Recombinant PPM1H also dephosphorylates immuno-purified phosphorylated Smad1 in test tubes. These direct in vitro phosphatase assays provide convincing evidence demonstrating the role of PPM1H as a specific phosphatase for P-Smad1.

  6. Autophagy Signaling in Prostate Cancer: Identification of a Novel Phosphatase

    DTIC Science & Technology

    2011-08-01

    polynucleotide kinase 3’-phosphatase17 71 CACGTGAACAGGGACACGCTA CACGTGTGAGACAGCCCTGAA CGGGAAGTCCACCTTTCTCAA CAAGCTGGTGATCTTCACCAA PPAP2A phosphatidic acid ...phosphatase type 2A8 97 AACCCTGTCTGTTTACTGTAA CTGACATTGCCAAGTATTCAA CATGCTGTTTGTGGCACTTTA CCGGGCAGAGACCATGTTTGA PPAP2B phosphatidic acid phosphatase...type 2B8 98 AGCGATCGTCCCGGAGAGCAA CAGCACAATTTCAGAAGAAAT CCGGATCTATTACCTGAAGAA CCGGGCACTTGCATACTCTTA PPAP2C phosphatidic acid phosphatase type 2C8 99

  7. Potential role for purple acid phosphatase in the dephosphorylation of wall proteins in tobacco cells.

    PubMed

    Kaida, Rumi; Serada, Satoshi; Norioka, Naoko; Norioka, Shigemi; Neumetzler, Lutz; Pauly, Markus; Sampedro, Javier; Zarra, Ignacio; Hayashi, Takahisa; Kaneko, Takako S

    2010-06-01

    It is not yet known whether dephosphorylation of proteins catalyzed by phosphatases occurs in the apoplastic space. In this study, we found that tobacco (Nicotiana tabacum) purple acid phosphatase could dephosphorylate the phosphoryl residues of three apoplastic proteins, two of which were identified as alpha-xylosidase and beta-glucosidase. The dephosphorylation and phosphorylation of recombinant alpha-xylosidase resulted in a decrease and an increase in its activity, respectively, when xyloglucan heptasaccharide was used as a substrate. Attempted overexpression of the tobacco purple acid phosphatase NtPAP12 in tobacco cells not only decreased the activity levels of the glycosidases but also increased levels of xyloglucan oligosaccharides and cello-oligosaccharides in the apoplast during the exponential phase. We suggest that purple acid phosphatase controls the activity of alpha-xylosidase and beta-glucosidase, which are responsible for the degradation of xyloglucan oligosaccharides and cello-oligosaccharides in the cell walls.

  8. Protein phosphatase 2A in stretch-induced endothelial cell proliferation

    NASA Technical Reports Server (NTRS)

    Murata, K.; Mills, I.; Sumpio, B. E.

    1996-01-01

    We previously proposed that activation of protein kinase C is a key mechanism for control of cell growth enhanced by cyclic strain [Rosales and Sumpio (1992): Surgery 112:459-466]. Here we examined protein phosphatase 1 and 2A activity in bovine aortic endothelial cells exposed to cyclic stain. Protein phosphatase 2A activity in the cytosol was decreased by 36.1% in response to cyclic strain for 60 min, whereas the activity in the membrane did not change. Treatment with low concentration (0.1 nM) of okadaic acid enhanced proliferation of both static and stretched endothelial cells in 10% fetal bovine serum. These data suggest that protein phosphatase 2A acts as a growth suppressor and cyclic strain may enhance cellular proliferation by inhibiting protein phosphatase 2A as well as stimulating protein kinase C.

  9. Subcellular localization of alkaline phosphatase in Bacillus licheniformis 749/C by immunoelectron microscopy with colloidal gold

    SciTech Connect

    Tinglu, G.; Ghosh, A.; Ghosh, B.K.

    1984-08-01

    Subcellular distribution of the alkaline phosphatase of Bacillus licheniformis 749/C was determined by an immunoelectron microscopy method. Anti-alkaline phosphatase antibody labeled with 15- to 18-nm colloidal gold particles (gold-immunoglobulin G (IgG) complex) were used for the study. Both the plasma membrane and cytoplasmic material were labeled with the gold-IgG particles. These particles formed clusters in association with the plasma membrane; in contrast, in the cytoplasm the particles were largely dispersed, and only a few clusters were found. The gold-IgG binding was quantitatively estimated by stereological analysis of labeled, frozen thin sections. This estimation of a variety of control samples showed that the labeling was specific for the alkaline phosphatase. Cluster formation of the gold -IgG particles in association with the plasma membrane suggests that existence of specific alkaline phosphatase binding sites (receptors) in the plasma membrane of B. licheniformis 749/C. 27 references, 6 figures, 1 table.

  10. Protein phosphatase 2A in stretch-induced endothelial cell proliferation

    NASA Technical Reports Server (NTRS)

    Murata, K.; Mills, I.; Sumpio, B. E.

    1996-01-01

    We previously proposed that activation of protein kinase C is a key mechanism for control of cell growth enhanced by cyclic strain [Rosales and Sumpio (1992): Surgery 112:459-466]. Here we examined protein phosphatase 1 and 2A activity in bovine aortic endothelial cells exposed to cyclic stain. Protein phosphatase 2A activity in the cytosol was decreased by 36.1% in response to cyclic strain for 60 min, whereas the activity in the membrane did not change. Treatment with low concentration (0.1 nM) of okadaic acid enhanced proliferation of both static and stretched endothelial cells in 10% fetal bovine serum. These data suggest that protein phosphatase 2A acts as a growth suppressor and cyclic strain may enhance cellular proliferation by inhibiting protein phosphatase 2A as well as stimulating protein kinase C.

  11. Assessing the biological activity of the glucan phosphatase laforin

    PubMed Central

    Romá-Mateo, Carlos; Raththagala, Madushi; Gentry, Mathew S.; Sanz, Pascual

    2017-01-01

    Summary Glucan phosphatases are a recently discovered family of enzymes that dephosphorylate either starch or glycogen and are essential for proper starch metabolism in plants and glycogen metabolism in humans. Mutations in the gene encoding the only human glucan phosphatase, laforin, result in the fatal, neurodegenerative, epilepsy known as Lafora disease. Here, we describe phosphatase assays to assess both generic laforin phosphatase activity and laforin’s unique glycogen phosphatase activity. PMID:27514803

  12. Proteomic analysis of protein phosphatase Z1 from Candida albicans.

    PubMed

    Márkus, Bernadett; Szabó, Krisztina; Pfliegler, Walter P; Petrényi, Katalin; Boros, Enikő; Pócsi, István; Tőzsér, József; Csősz, Éva; Dombrádi, Viktor

    2017-01-01

    Protein phosphatase Z is a "novel type" fungus specific serine/threonine protein phosphatase. Previously our research group identified the CaPPZ1 gene in the opportunistic pathogen Candida albicans and reported that the gene deletion had several important physiological consequences. In order to reveal the protein targets and the associated mechanisms behind the functions of the phosphatase a proteomic method was adopted for the comparison of the cappz1 deletion mutant and the genetically matching QMY23 control strain. Proteins extracted from the control and deletion mutant strains were separated by two-dimensional gel electrophoresis and the protein spots were stained with RuBPS and Pro-Q Diamond in order to visualize the total proteome and the phosphoproteome, respectively. The alterations in spot intensities were determined by densitometry and were analysed with the Delta2D (Decodon) software. Spots showing significantly different intensities between the mutant and control strains were excised from the gels and were digested with trypsin. The resulting peptides were identified by LC-MS/MS mass spectrometry. As many as 15 protein spots were found that exhibited significant changes in their intensity upon the deletion of the phosphatase and 20 phosphoproteins were identified in which the level of phosphorylation was modified significantly in the mutant. In agreement with previous findings we found that the affected proteins function in protein synthesis, oxidative stress response, regulation of morphology and metabolism. Among these proteins we identified two potential CaPpz1 substrates (Eft2 and Rpp0) that may regulate the elongation step of translation. RT-qPCR experiments revealed that the expression of the genes coding for the affected proteins was not altered significantly. Thus, the absence of CaPpz1 exerted its effects via protein synthesis/degradation and phosphorylation/dephosphorylation. In addition, our proteomics data strongly suggested a role for Ca

  13. Identification of the adipocyte acid phosphatase as a PAO-sensitive tyrosyl phosphatase.

    PubMed Central

    Shekels, L. L.; Smith, A. J.; Van Etten, R. L.; Bernlohr, D. A.

    1992-01-01

    We have partially purified an 18-kDa cytoplasmic protein from 3T3-L1 cells, which dephosphorylates pNPP and the phosphorylated adipocyte lipid binding protein (ALBP), and have identified it by virtue of kinetic and immunological criteria as an acid phosphatase (EC 3.1.3.2). The cytoplasmic acid phosphatase was inactivated by phenylarsine oxide (PAO) (Kinact = 10 microM), and the inactivation could be reversed by the dithiol, 2,3-dimercaptopropanol (Kreact = 23 microM), but not the monothiol, 2-mercaptoethanol. Cloning of the human adipocyte acid phosphatase revealed that two isoforms exist, termed HAAP alpha and HAAP beta (human adipocyte acid phosphatase), which are distinguished by a 34-amino acid isoform-specific domain. Sequence analysis shows HAAP alpha and HAAP beta share 74% and 90% identity with the bovine liver acid phosphatase, respectively, and 99% identity with both isoenzymes of the human red cell acid phosphatase but no sequence similarity to the protein tyrosine phosphatases (EC 3.1.3.48). HAAP beta has been cloned into Escherichia coli, expressed, and purified as a glutathione S-transferase fusion protein. Recombinant HAAP beta was shown to dephosphorylate pNPP and phosphoALBP and to be inactivated by PAO and inhibited by vanadate (Ki = 17 microM). These results describe the adipocyte acid phosphatase as a cytoplasmic enzyme containing conformationally vicinal cysteine residues with properties that suggest it may dephosphorylate tyrosyl phosphorylated cellular proteins. PMID:1304913

  14. Acid Phosphatase Development during Ripening of Avocado 1

    PubMed Central

    Sacher, Joseph A.

    1975-01-01

    The activity and subcellular distribution of acid phosphatase were assayed during ethylene-induced ripening of whole fruit or thick slices of avocado (Persea americana Mill. var. Fuerte and Hass). The activity increased up to 30-fold during ripening in both the supernatant fraction and the Triton X-100 extract of the precipitate of a 30,000g centrifugation of tissue homogenates from whole fruit or slices ripening in moist air. Enzyme activity in the residual precipitate after Triton extraction remained constant. The development of acid phosphatase in thick slices ripened in moist air was similar to that in intact fruit, except that enzyme development and ripening were accelerated about 24 hours in the slices. The increase in enzyme activity that occurs in slices ripening in moist air was inhibited when tissue sections were infiltrated with solutions, by aspiration for 2 minutes or by soaking for 2 hours, anytime 22 hours or more after addition of ethylene. This inhibition was independent of the presence or absence of cycloheximide or sucrose (0.3-0.5m). However, the large decline in enzyme activity in the presence of cycloheximide, as compared with the controls, indicated that synthesis of acid phosphatase was occurring at all stages of ripening. PMID:16659087

  15. Phosphatidate Phosphatase, a Key Regulator of Lipid Homeostasis

    PubMed Central

    Pascual, Florencia; Carman, George M.

    2012-01-01

    Yeast Pah1p phosphatidate phosphatase (PAP) catalyzes the penultimate step in the synthesis of triacylglycerol. PAP plays a crucial role in lipid homeostasis by controlling the relative proportions of its substrate phosphatidate and its product diacylglycerol. The cellular amounts of these lipid intermediates influence the synthesis of triacylglycerol and the pathways by which membrane phospholipids are synthesized. Physiological functions affected by PAP activity include phospholipid synthesis gene expression, nuclear/endoplasmic reticulum membrane growth, lipid droplet formation, and vacuole homeostasis and fusion. Yeast lacking Pah1p PAP activity are acutely sensitive to fatty acid-induced toxicity and exhibit respiratory deficiency. PAP is distinguished in its cellular location, catalytic mechanism, and physiological functions from Dpp1p and Lpp1p lipid phosphate phosphatases that utilize a variety of substrates that include phosphatidate. Phosphorylation/dephosphorylation is a major mechanism by which Pah1p PAP activity is regulated. Pah1p is phosphorylated by cytosolic-associated Pho85p-Pho80p, Cdc28p-cyclin B, and protein kinase A and is dephosphorylated by the endoplasmic reticulum-associated Nem1p-Spo7p phosphatase. The dephosphorylation of Pah1p stimulates PAP activity and facilitates the association with the membrane/phosphatidate allowing for its reaction and triacylglycerol synthesis. PMID:22910056

  16. Crosstalk between kinases, phosphatases and miRNAs in cancer.

    PubMed

    Abrantes, Júlia L F; Tornatore, Thaís F; Pelizzaro-Rocha, Karin J; de Jesus, Marcelo B; Cartaxo, Rodrigo T; Milani, Renato; Ferreira-Halder, Carmen V

    2014-12-01

    Reversible phosphorylation of proteins, performed by kinases and phosphatases, is the major post translational protein modification in eukaryotic cells. This intracellular event represents a critical regulatory mechanism of several signaling pathways and can be related to a vast array of diseases, including cancer. Cancer research has produced increasing evidence that kinase and phosphatase activity can be compromised by mutations and also by miRNA silencing, performed by small non-coding and endogenously produced RNA molecules that lead to translational repression. miRNAs are believed to target about one-third of human mRNAs while a single miRNA may target about 200 transcripts simultaneously. Regulation of the phosphorylation balance by miRNAs has been a topic of intense research over the last years, spanning topics going as far as cancer aggressiveness and chemotherapy resistance. By addressing recent studies that have shown miRNA expression patterns as phenotypic signatures of cancers and how miRNA influence cellular processes such as apoptosis, cell cycle control, angiogenesis, inflammation and DNA repair, we discuss how kinases, phosphatases and miRNAs cooperatively act in cancer biology.

  17. Alkaline phosphatase and bone calcium parameters.

    PubMed

    Fauran-Clavel, M J; Oustrin, J

    1986-01-01

    Effects of cadmium, an alkaline phosphatase inhibitor, on the calcium content of rat bone were investigated in vivo by a radioisotopic method. Disturbance of bone metabolism is observed in both the superficial (delta) and slow exchanges (Ve), which are also significantly decreased. The crystallized calcium bone compartment (E) is also strongly affected. It appears that changes in the superficial calcium exchanges cause the observed decrease in the crystallized calcium mass. The slowing of osteogenesis is confirmed by the decrease of serum alkaline phosphatase activity. A statistical examination of the correlation coefficient reveals a close link (P less than 0.01) between serum alkaline phosphatase activity and the influx of superficial calcium (Vo+) and, as a result, the crystallized bone calcium parameters. These results show that cadmium can be used to study the relationship between alkaline phosphatase and calcification. The present observations allow us to consider the possibility that alkaline phosphatase may play a role in determining the calcium content of the crystallized phases in deep bone through its action on the tissue surface.

  18. The histidine phosphatase superfamily: structure and function.

    PubMed

    Rigden, Daniel J

    2008-01-15

    The histidine phosphatase superfamily is a large functionally diverse group of proteins. They share a conserved catalytic core centred on a histidine which becomes phosphorylated during the course of the reaction. Although the superfamily is overwhelmingly composed of phosphatases, the earliest known and arguably best-studied member is dPGM (cofactor-dependent phosphoglycerate mutase). The superfamily contains two branches sharing very limited sequence similarity: the first containing dPGM, fructose-2,6-bisphosphatase, PhoE, SixA, TIGAR [TP53 (tumour protein 53)-induced glycolysis and apoptosis regulator], Sts-1 and many other activities, and the second, smaller, branch composed mainly of acid phosphatases and phytases. Human representatives of both branches are of considerable medical interest, and various parasites contain superfamily members whose inhibition might have therapeutic value. Additionally, several phosphatases, notably the phytases, have current or potential applications in agriculture. The present review aims to draw together what is known about structure and function in the superfamily. With the benefit of an expanding set of histidine phosphatase superfamily structures, a clearer picture of the conserved elements is obtained, along with, conversely, a view of the sometimes surprising variation in substrate-binding and proton donor residues across the superfamily. This analysis should contribute to correcting a history of over- and mis-annotation in the superfamily, but also suggests that structural knowledge, from models or experimental structures, in conjunction with experimental assays, will prove vital for the future description of function in the superfamily.

  19. Acid phosphatase/phosphotransferases from enteric bacteria.

    PubMed

    Mihara, Y; Utagawa, T; Yamada, H; Asano, Y

    2001-01-01

    We have investigated the enzymatic phosphorylation of nucleosides and found that Morganella morganii phoC acid phosphatase exhibits regioselective pyrophosphate (PP(i))-nucleoside phosphotransferase activity. In this study, we isolated genes encoding an acid phosphatase with regioselective phosphotransferase activity (AP/PTase) from Providencia stuartii, Enterobacter aerogenes, Escherichia blattae and Klebsiella planticola, and compared the primary structures and enzymatic characteristics of these enzymes with those of AP/PTase (PhoC acid phosphatase) from M. morganii. The enzymes were highly homologous in primary structure with M. morganii AP/PTase, and are classified as class A1 acid phosphatases. The synthesis of inosine-5'-monophosphate (5'-IMP) by E. coli overproducing each acid phosphatase was investigated. The P. stuartii enzyme, which is most closely related to the M. morganii enzyme, exhibited high 5'-IMP productivity, similar to the M. morganii enzyme. The 5'-IMP productivities of the E. aerogenes, E. blattae and K. planticola enzymes were inferior to those of the former two enzymes. This result underlines the importance of lower K(m) values for efficient nucleotide production. As these enzymes exhibited a very high degree of homology at the amino acid sequence level, it is likely that local sequence differences in the binding pocket are responsible for the differences in the nucleoside-PP(i) phosphotransferase reaction.

  20. Cloning, purification, crystallization and 1.57 Å resolution X-ray data analysis of AmsI, the tyrosine phosphatase controlling amylovoran biosynthesis in the plant pathogen Erwinia amylovora.

    PubMed

    Benini, Stefano; Caputi, Lorenzo; Cianci, Michele

    2014-12-01

    The Gram-negative bacterium Erwinia amylovora is a destructive pathogen of plants belonging to the Rosaceae family. Amongst its pathogenicity factors, E. amylovora produces the exopolysaccharide amylovoran, which contributes to the occlusion of plant vessels, causing wilting of shoots and eventually resulting in plant death. Amylovoran biosynthesis requires the presence of 12 genes (from amsA to amsL) clustered in the ams region of the E. amylovora genome. They mostly encode glycosyl transferases (AmsG, AmsB, AmsD, AmsE, AmsJ and AmsK), proteins involved in amylovoran translocation and assembly (AmsH, AmsL and AmsC), and also a tyrosine kinase (AmsA) and a tyrosine phosphatase (AmsI), which are both involved in the regulation of amylovoran biosynthesis. The low-molecular-weight protein tyrosine phosphatase AmsI was overexpressed as a His6-tagged protein in Escherichia coli, purified and crystallized. X-ray diffraction data were collected to a maximum resolution of 1.57 Å in space group P3121.

  1. Ginkgolic acids induce neuronal death and activate protein phosphatase type-2C.

    PubMed

    Ahlemeyer, B; Selke, D; Schaper, C; Klumpp, S; Krieglstein, J

    2001-10-26

    The standardized extract from Ginkgo biloba (EGb 761) is used for the treatment of dementia. Because of allergenic and genotoxic effects, ginkgolic acids are restricted in EGb 761 to 5 ppm. The question arises whether ginkgolic acids also have neurotoxic effects. In the present study, ginkgolic acids caused death of cultured chick embryonic neurons in a concentration-dependent manner, in the presence and in the absence of serum. Ginkgolic acids-induced death showed features of apoptosis as we observed chromatin condensation, shrinkage of the nucleus and reduction of the damage by the protein synthesis inhibitor cycloheximide, demonstrating an active type of cell death. However, DNA fragmentation detected by the terminal-transferase-mediated ddUTP-digoxigenin nick-end labeling (TUNEL) assay and caspase-3 activation, which are also considered as hallmarks of apoptosis, were not seen after treatment with 150 microM ginkgolic acids in serum-free medium, a dose which increased the percentage of neurons with chromatin condensation and shrunken nuclei to 88% compared with 25% in serum-deprived, vehicle-treated controls. This suggests that ginkgolic acid-induced death showed signs of apoptosis as well as of necrosis. Ginkgolic acids specifically increased the activity of protein phosphatase type-2C, whereas other protein phosphatases such as protein phosphatases 1A, 2A and 2B, tyrosine phosphatase, and unspecific acid- and alkaline phosphatases were inhibited or remained unchanged, suggesting protein phosphatase 2C to play a role in the neurotoxic effect mediated by ginkgolic acids.

  2. Modulation of serum phosphatases activity in Swiss albino mice against gamma irradiation by Mentha piperita Linn.

    PubMed

    Samarth, R M; Goyal, P K; Kumar, Ashok

    2002-09-01

    The modulatory influence of mentha oil (Mentha piperita Linn.) against a lethal dose (8.0 Gy) of gamma irradiation on the activities of serum phosphatases in Swiss albino mice was studied at various post-irradiation intervals between 6 h and 30 days. Mentha oil (40 microL/animal/day) given orally for 3 consecutive days prior to whole-body irradiation (8.0 Gy) showed a modulation of activity of serum phosphatases. The values of acid phosphatase activities were significantly higher in the irradiated groups throughout the experiment compared with the mentha treated unirradiated animals. However, the acid phosphatase activity of mentha treated irradiated animals showed a significant decline over untreated irradiated animals at all autopsy intervals, which attained the normal value on day 5. On the contrary, a marked decrease in serum alkaline phosphatase activity was noted in both irradiated groups but in the mentha treated irradiated group the values of alkaline phosphatase activity were found to be significantly higher than the respective control during the period of study being normal at day 5 post-irradiation and onwards. Copyright 2002 John Wiley & Sons, Ltd.

  3. Synthesis of repressible acid phosphatase in Saccharomyces cerevisiae under conditions of enzyme instability.

    PubMed Central

    Bostian, K A; Lemire, J M; Halvorson, H O

    1982-01-01

    The synthesis of repressible acid phosphatase in Saccharomyces cerevisiae was examined under conditions of blocked derepression as described by Toh-e et al. (Mol. Gen. Genet. 162:139-149, 1978). Based on a genetic and biochemical analysis of the phenomenon these authors proposed a new regulatory model for acid phosphatase expression involving a simultaneous interaction of regulatory factors in the control of structural gene transcription. We demonstrate here that under growth conditions that fail to produce acid phosphatase the enzyme is readily inactivated. Furthermore, we demonstrate under these conditions the production of acid phosphatase mRNA which is active both in vitro and in vivo in the synthesis of enzyme. This eliminates any step prior to translation of acid phosphatase polypeptide as an explanation for the phenomenon. We interpret our results for the block in appearance of acid phosphatase as a result of both deaccelerated growth and cellular biosynthesis during derepression, accompanied by an enhanced instability of the enzyme. Images PMID:7050664

  4. Structure-function analysis of the 3' phosphatase component of T4 polynucleotide kinase/phosphatase.

    PubMed

    Zhu, Hui; Smith, Paul; Wang, Li Kai; Shuman, Stewart

    2007-09-15

    T4 polynucleotide kinase/phosphatase (Pnkp) exemplifies a family of bifunctional enzymes with 5'-kinase and 3' phosphatase activities that function in nucleic acid repair. T4 Pnkp is a homotetramer of a 301-aa polypeptide, which consists of an N-terminal kinase domain of the P-loop phosphotransferase superfamily and a C-terminal phosphatase domain of the DxD acylphosphatase superfamily. The homotetramer is formed via pairs of phosphatase-phosphatase and kinase-kinase homodimer interfaces. Here we identify four side chains-Asp187, Ser211, Lys258, and Asp277-that are required for 3' phosphatase activity. Alanine mutations at these positions abolished phosphatase activity without affecting kinase function or tetramerization. Conservative substitutions of asparagine or glutamate for Asp187 did not revive the 3' phosphatase, nor did arginine or glutamine substitutions for Lys258. Threonine in lieu of Ser211 and glutamate in lieu of Asp277 restored full activity, whereas asparagine at position 277 had no salutary effect. We report a 3.0 A crystal structure of the Pnkp tetramer, in which a sulfate ion is coordinated between Arg246 and Arg279 in a position that we propose mimics one of the penultimate phosphodiesters (5'NpNpNp-3') of the polynucleotide 3'-PO(4) substrate. The amalgam of mutational and structural data engenders a plausible catalytic mechanism for the phosphatase that includes covalent catalysis (via Asp165), general acid-base catalysis (via Asp167), metal coordination (by Asp165, Asp277 and Asp278), and transition state stabilization (via Lys258, Ser211, backbone amides, and the divalent cation). Other critical side chains play architectural roles (Arg176, Asp187, Arg213, Asp254). To probe the role of oligomerization in phosphatase function, we introduced six double-alanine cluster mutations at the phosphatase-phosphatase domain interface, two of which (R297A-Q295A and E292A-D300A) converted Pnkp from a tetramer to a dimer and ablated phosphatase activity.

  5. Structure-Function Analysis of the 3' Phosphatase Component of T4 Polynucleotide Kinase/phosphatase

    SciTech Connect

    Zhu,H.; Smith, P.; Wang, L.; Shuman, S.

    2007-01-01

    T4 polynucleotide kinase/phosphatase (Pnkp) exemplifies a family of bifunctional enzymes with 5'-kinase and 3' phosphatase activities that function in nucleic acid repair. T4 Pnkp is a homotetramer of a 301-aa polypeptide, which consists of an N-terminal kinase domain of the P-loop phosphotransferase superfamily and a C-terminal phosphatase domain of the DxD acylphosphatase superfamily. The homotetramer is formed via pairs of phosphatase-phosphatase and kinase-kinase homodimer interfaces. Here we identify four side chains-Asp187, Ser211, Lys258, and Asp277-that are required for 3' phosphatase activity. Alanine mutations at these positions abolished phosphatase activity without affecting kinase function or tetramerization. Conservative substitutions of asparagine or glutamate for Asp187 did not revive the 3' phosphatase, nor did arginine or glutamine substitutions for Lys258. Threonine in lieu of Ser211 and glutamate in lieu of Asp277 restored full activity, whereas asparagine at position 277 had no salutary effect. We report a 3.0 A crystal structure of the Pnkp tetramer, in which a sulfate ion is coordinated between Arg246 and Arg279 in a position that we propose mimics one of the penultimate phosphodiesters (5'NpNpNp-3') of the polynucleotide 3'-PO(4) substrate. The amalgam of mutational and structural data engenders a plausible catalytic mechanism for the phosphatase that includes covalent catalysis (via Asp165), general acid-base catalysis (via Asp167), metal coordination (by Asp165, Asp277 and Asp278), and transition state stabilization (via Lys258, Ser211, backbone amides, and the divalent cation). Other critical side chains play architectural roles (Arg176, Asp187, Arg213, Asp254). To probe the role of oligomerization in phosphatase function, we introduced six double-alanine cluster mutations at the phosphatase-phosphatase domain interface, two of which (R297A-Q295A and E292A-D300A) converted Pnkp from a tetramer to a dimer and ablated phosphatase activity.

  6. AKAP phosphatase complexes in the heart.

    PubMed

    Redden, John M; Dodge-Kafka, Kimberly L

    2011-10-01

    Directed protein phosphorylation is indisputably critical for a multitude of cellular processes. A growing body of research demonstrates A kinase anchoring proteins (AKAPs) to mediate a significant number of phosphorylation events in the heart. By acting as molecular tethers for the regulatory subunit of protein kinase A, AKAPs focus kinase activity onto specific substrate. In the time since their discovery, the AKAP model has evolved in appreciation of the broader role these scaffolds play in coordinating multiple signaling enzymes to efficiently regulate dynamic cellular processes. The focus of this review is on the emerging role of AKAPs in regulating the 3 main cardiac phosphatases: Protein Phosphatase 1 by AKAP18 and Yotiao, and Protein Phosphatases 2A and 2B by muscle specific A-kinase anchoring protein.

  7. A specific sucrose phosphatase from plant tissues

    PubMed Central

    Hawker, J. S.; Hatch, M. D.

    1966-01-01

    1. A phosphatase that hydrolyses sucrose phosphate (phosphorylated at the 6-position of fructose) was isolated from sugar-cane stem and carrot roots. With partially purified preparations fructose 6-phosphate, glucose 6-phosphate, fructose 1-phosphate, glucose 1-phosphate and fructose 1,6-diphosphate are hydrolysed at between 0 and 2% of the rate for sucrose phosphate. 2. The activity of the enzyme is increased fourfold by the addition of Mg2+ ions and inhibited by EDTA, fluoride, inorganic phosphate, pyrophosphate, Ca2+ and Mn2+ ions. Sucrose (50mm) reduces activity by 60%. 3. The enzyme exhibits maximum activity between pH6·4 and 6·7. The Michaelis constant for sucrose phosphate is between 0·13 and 0·17mm. 4. At least some of the specific phosphatase is associated with particles having the sedimentation properties of mitochondria. 5. A similar phosphatase appears to be present in several other plant species. PMID:4290548

  8. CDC25 phosphatases as potential human oncogenes.

    PubMed

    Galaktionov, K; Lee, A K; Eckstein, J; Draetta, G; Meckler, J; Loda, M; Beach, D

    1995-09-15

    Cyclin-dependent kinases (CDKs) are activated by CDC25 phosphatases, which remove inhibitory phosphate from tyrosine and threonine residues. In human cells, CDC25 proteins are encoded by a multigene family, consisting of CDC25A, CDC25B, and CDC25C. In rodent cells, human CDC25A or CDC25B but not CDC25C phosphatases cooperate with either Ha-RASG12V or loss of RB1 in oncogenic focus formation. Such transformants were highly aneuploid, grew in soft agar, and formed high-grade tumors in nude mice. Overexpression of CDC25B was detected in 32 percent of human primary breast cancers tested. The CDC25 phosphatases may contribute to the development of human cancer.

  9. The Glycosylphosphatidylinositol-Anchored Phosphatase from Spirodela oligorrhiza Is a Purple Acid Phosphatase1

    PubMed Central

    Nakazato, Hiroshi; Okamoto, Takashi; Nishikoori, Miwa; Washio, Kenji; Morita, Naoki; Haraguchi, Kensaku; Thompson, Guy A.; Okuyama, Hidetoshi

    1998-01-01

    We recently presented clear evidence that the major low-phosphate-inducible phosphatase of the duckweed Spirodela oligorrhiza is a glycosylphosphatidylinositol (GPI)-anchored protein, and, to our knowledge, is the first described from higher plants (N. Morita, H. Nakazato, H. Okuyama, Y. Kim, G.A. Thompson, Jr. [1996] Biochim Biophys Acta 1290: 53–62). In this report the purified 57-kD phosphatase is shown to be a purple metalloenzyme containing Fe and Mn atoms and having an absorption maximum at 556 nm. The phosphatase activity was only slightly inhibited by tartrate, as expected for a purple acid phosphatase (PAP). Furthermore, the protein cross-reacted with an anti-Arabidopsis PAP antibody on immunoblots. The N-terminal amino acid sequence of the phosphatase was very similar to those of Arabidopsis, red kidney bean (Phaseolus vulgaris), and soybean (Glycine max) PAP. Extracts of S. oligorrhiza plants incubated with the GPI-specific precursor [3H]ethanolamine were treated with antibodies raised against the purified S. oligorrhiza phosphatase. Radioactivity from the resulting immunoprecipitates was specifically associated with a 57-kD band on sodium dodecyl sulfate-polyacrylamide gels. These results, together with previous findings, strongly indicate that the GPI-anchored phosphatase of S. oligorrhiza is a PAP. PMID:9808746

  10. PD-L1 regulates the Tregs’ capacity to repress shock/sepsis induced indirect lung injury (iALI) by recruiting phosphatase SHP-1

    PubMed Central

    Tang, Lunxian; Bai, Jianwen; Chung, Chun-Shiang; Lomas–Neira, Joanne; Chen, Yaping; Huang, Xin; Ayala, Alfred

    2014-01-01

    We recently reported that adoptively transferred (AT) exogenous CD4+CD25+ regulatory T cells (Tregs) to wild type (WT) mice can directly act to repress shock/sepsis induced experimental iALI and this is mediated in part by programmed cell death receptor 1 (PD-1). In this study, we further determine whether recipient mouse lacking PD-L1, one of the primary ligands for PD-1, contributes to the manipulation of the Tregs’ capacity to repress lung injury. To do this, Tregs isolated from the spleen of WT mice were AT into PD-L1−/− mice subjected to hemorrhagic shock [Hem] and subsequent to cecal ligation and puncture (CLP) to induce iALI. Samples were collected for analyses 24 hours after CLP. We found that in PD-L1−/− recipient mice, AT WT-Tregs lost the ability to reverse the development of iALI seen in WT recipient mice (i.e., no reduction of lung injury indices assessed by histology and vascular leakage; failure to decrease the lung neutrophil influx [MPO activity] or the rise in lung apoptosis [caspase 3 activity]). Also a significant increase of interlukin-1β (IL-1β) and keratinocyte-derived chemokine (KC), but no changes in IL-6, IL-10 and IL-17A levels in lung tissues were seen in these mice compared with iALI mice without AT of Tregs. Furthermore, we noted that the lung tissue tyrosine phosphatase Src homology region 2 domain-containing phosphatase 1 (SHP-1), but not SHP-2, was activated with the AT of Tregs in PD-L1−/− iALI mice. Finally, through local depletion of CD4+ T cells or CD25+ (Tregs) in the lung, prior to inducing iALI, we found that SHP-1 activation was associated with the loss of Tregs’ protective effects in vivo. Collectively, our data reveal that PD-L1 is a critical modulator of Treg’s ability to suppress iALI and this appears to involve SHP-1 activation. PMID:25057927

  11. Molecular Evolution of Phosphoprotein Phosphatases in Drosophila

    PubMed Central

    Miskei, Márton; Ádám, Csaba; Kovács, László; Karányi, Zsolt; Dombrádi, Viktor

    2011-01-01

    Phosphoprotein phosphatases (PPP), these ancient and important regulatory enzymes are present in all eukaryotic organisms. Based on the genome sequences of 12 Drosophila species we traced the evolution of the PPP catalytic subunits and noted a substantial expansion of the gene family. We concluded that the 18–22 PPP genes of Drosophilidae were generated from a core set of 8 indispensable phosphatases that are present in most of the insects. Retropositons followed by tandem gene duplications extended the phosphatase repertoire, and sporadic gene losses contributed to the species specific variations in the PPP complement. During the course of these studies we identified 5, up till now uncharacterized phosphatase retrogenes: PpY+, PpD5+, PpD6+, Pp4+, and Pp6+ which are found only in some ancient Drosophila. We demonstrated that all of these new PPP genes exhibit a distinct male specific expression. In addition to the changes in gene numbers, the intron-exon structure and the chromosomal localization of several PPP genes was also altered during evolution. The G−C content of the coding regions decreased when a gene moved into the heterochromatic region of chromosome Y. Thus the PPP enzymes exemplify the various types of dynamic rearrangements that accompany the molecular evolution of a gene family in Drosophilidae. PMID:21789237

  12. Phosphatase hydrolysis of organic phosphorus compounds

    USDA-ARS?s Scientific Manuscript database

    Phosphatases are diverse groups of enzymes that deserve special attention because of the significant roles they play in mineralizing organic phosphorus (P) into inorganic available form. For getting more insight on the enzymatically hydrolysis of organic P, in this work, we compared the catalytic pa...

  13. Assaying inositol and phosphoinositide phosphatase enzymes.

    PubMed

    Donahue, Janet L; Ercetin, Mustafa; Gillaspy, Glenda E

    2013-01-01

    One critical aspect of phosphoinositide signaling is the turnover of signaling molecules in the pathway. These signaling molecules include the phosphatidylinositol phosphates (PtdInsPs) and inositol phosphates (InsPs). The enzymes that catalyze the breakdown of these molecules are thus important potential regulators of signaling, and in many cases the activity of such enzymes needs to be measured and compared to other enzymes. PtdInsPs and InsPs are broken down by sequential dephosphorylation reactions which are catalyzed by a set of specific phosphatases. Many of the phosphatases can act on both PtdInsP and InsP substrates. The protocols described in this chapter detail activity assays that allow for the measurement of PtdInsP and InsP phosphatase activities in vitro starting with native or recombinant enzymes. Three different assays are described that have different equipment requirements and allow one to test a range of PtdInsP and InsP phosphatases that act on different substrates.

  14. Phosphatase activities as biosignatures of extant life

    NASA Astrophysics Data System (ADS)

    Kobayashi, K.; Itoh, Y.; Edazawa, Y.; Moroi, A.; Takano, Y.

    It has been recognized that terrestrial biosphere expands to such extreme environments as deep subsurface lithosphere high temperature hot springs and stratosphere Possible extraterrestrial biospheres in Mars Europa and Titan are being discussed Many biosignatures or biomarkers have been proposed to detect microbial activities in such extreme environments Phosphate esters are essential for the terrestrial life since they are constituents of nucleic acids and cell mebranes Thus all the terrestrial organisms have phosphatases that are enzymes catalyzing hydrolysis of phosphate esters We analyzed phosphatase activities in the samples obtained in extreme environments such as submarine hydrothermal systems and discussed whether they can be used as biosignatures for extant life Core samples and chimney samples were collected at the Suiyo Seamount Izu-Bonin Arc the Pacific Ocean in 2001 and 2002 and in South Mariana hydrothermal systems the Pacific Oceanas in 2003 both in a part of the Archaean Park Project Phosphatase activity in solid rock samples was measured spectrometrically by using 25 mM p-nitrophenyl phosphate pH 8 0 or pH 6 5 as a substrate as follows Pulverized samples were incuvated with substrate solution for an hour and then production rate of p-nitrophenol was calculated with absorbance at 410 nm Phosphatase activity in extracts was measured fluorometrically by using 4-methylumberyferryl phosphate as a substrate Concentration of amino acids and their enantiomeric ratio were determined by HPLC after HF digestion of the

  15. [Leucocyte alkaline phosphatase in normal and pathological pregnancy (author's transl)].

    PubMed

    Stark, K H; Zaki, I; Sobolewski, K

    1981-01-01

    The activities of leucocyte alkaline phosphatase were determined in 511 patients with normal and pathological pregnancy. Mean values were compared and the enzyme followed up, and the conclusion was drawn that leucocyte alkaline phosphatase was no safe indicator of foetal condition. No direct relationship were found to exist between leucocyte alkaline phosphatase, total oestrogens, HSAP, HLAP, HPL, and oxytocinase.

  16. Interplay of myosin phosphatase and protein phosphatase-2A in the regulation of endothelial nitric-oxide synthase phosphorylation and nitric oxide production

    PubMed Central

    Bátori, Róbert; Bécsi, Bálint; Nagy, Dénes; Kónya, Zoltán; Hegedűs, Csaba; Bordán, Zsuzsanna; Verin, Alexander; Lontay, Beáta; Erdődi, Ferenc

    2017-01-01

    The inhibitory phosphorylation of endothelial nitric oxide (NO) synthase (eNOS) at Thr497 (eNOSpThr497) by protein kinase C or RhoA-activated kinase is a major regulatory determinant of eNOS activity. The signalling mechanisms involved in the dephosphorylation of eNOSpThr497 have not yet been clarified. This study identifies myosin phosphatase (MP) holoenzyme consisting of protein phosphatase-1 catalytic subunit (PP1c) and MP target subunit-1 (MYPT1) as an eNOSpThr497 phosphatase. In support of this finding are: (i) eNOS and MYPT1 interacts in various endothelial cells (ECs) and in in vitro binding assays (ii) MYPT1 targets and stimulates PP1c toward eNOSpThr497 substrate (iii) phosphorylation of MYPT1 at Thr696 (MYPT1pThr696) controls the activity of MP on eNOSpThr497. Phosphatase inhibition suppresses both NO production and transendothelial resistance (TER) of ECs. In contrast, epigallocatechin-3-gallate (EGCG) signals ECs via the 67 kDa laminin-receptor (67LR) resulting in protein kinase A dependent activation of protein phosphatase-2A (PP2A). PP2A dephosphorylates MYPT1pThr696 and thereby stimulates MP activity inducing dephosphorylation of eNOSpThr497 and the 20 kDa myosin II light chains. Thus an interplay of MP and PP2A is involved in the physiological regulation of EC functions implying that an EGCG dependent activation of these phosphatases leads to enhanced NO production and EC barrier improvement. PMID:28300193

  17. Leukocidin, Tetraethylammonium Ions, and the Membrane Acyl Phosphatases in Relation to the Leukocyte Potassium Pump

    PubMed Central

    Woodin, A. M.; Wieneke, Antonnette A.

    1970-01-01

    The response of the leukocyte to leukocidin and its relevance to excitable and secreting tissues are described. New data are presented on the leukocyte membrane phosphatases and the action of tetraethylammonium ion (TEA) on the leukocyte. The leukocyte surface membrane lacks a cation-sensitive ATPase but possesses a potassium- and ouabain-sensitive p-nitrophenyl phosphatase. The p-nitrophenyl phosphatase shows peak activity at three pH values and the pH dependence and potassium sensitivity depend on the state of the membranes. In the presence of magnesium, potassium can stimulate over the range pH 6 to 8. The relation of the leukocyte p-nitrophenyl phosphatase to electrolyte control in the leukocyte and to the properties of cation-sensitive phosphatases in other cells suggests that the leukocyte enzyme is a component of an electrogenic potassium pump. Leukocidin stimulates the leukocyte p-nitrophenyl phosphatase under all the conditions studied. The effect is specific and occurs under conditions that induce cytotoxic effects in the cell. It is concluded that the potassium pump is the site of action of leukocidin. TEA prevents the effects of leukocidin by inhibiting the action of leukocidin and not the responses of the cell to injury. TEA does not inhibit the p-nitrophenyl phosphatase nor prevent its stimulation by leukocidin. The enhancement of leukocidin by diisopropylphosphofluoridate (DFP) is briefly described. It is concluded that TEA acts in the opposite way to DFP and blocks the ion pathway activated by leukocidin in the leukocyte potassium pump. PMID:4327879

  18. [ATPase and phosphatase activity of drone brood].

    PubMed

    Bodnarchuk, L I; Stakhman, O S

    2004-01-01

    Most researches on insect enzymes concern carbohydrate and nitrogenous exchange. Data on ATPase activity for larval material of drone brood are absent in the available literature. The drone brood is one of the least investigated apiproducts. Allowing for the important role of ATPase in the vital functions of the insect cells our work was aimed at the study of ATPase of the drone blood activity and that of alkaline and acid phosphatases. When studying liophylised preparations of the drone brood homogenate we have found out high activity of Mg2+, Na+, K+-, Ca2+- and Mg2+-ATPase and of alkaline and acid phosphatase, that is the possible explanation of the high-intensity power and plastic processes proceeding during growth and development of larvae.

  19. Assessment and kinetics of soil phosphatase in Brazilian Savanna systems.

    PubMed

    Ferreira, Adão S; Espíndola, Suéllen P; Campos, Maria Rita C

    2016-05-31

    The activity and kinetics of soil phosphatases are important indicators to evaluate soil quality in specific sites such as the Cerrado (Brazilian Savanna). This study aimed to determine the activity and kinetic parameters of soil phosphatase in Cerrado systems. Soil phosphatase activity was assessed in samples of native Cerrado (NC), no-tillage (NT), conventional tillage (CT) and pasture with Brachiaria brizantha (PBb) and evaluated with acetate buffer (AB), tris-HCl buffer (TB), modified universal buffer (MUB) and low MUB. The Michaelis-Menten equation and Eadie-Hofstee model were applied to obtain the kinetic parameters of soil phosphatase using different concentrations of p-nitrophenol phosphate (p-NPP). MUB showed the lowest soil phosphatase activity in all soils whereas AB in NC and NT presented the highest. Low MUB decreased interferences in the assessment of soil phosphatase activity when compared to MUB, suggesting that organic acids interfere on the soil phosphatase activity. In NC and NT, soil phosphatase activity performed with TB was similar to AB and low MUB. Km values from the Michaels-Menten equation were higher in NC than in NT, which indicate a lower affinity of phosphatase activity for the substrate in NC. Vmax values were also higher in NC than in NT. The Eadie-Hofstee model suggests that NC had more phosphatase isoforms than NT. The study showed that buffer type is of fundamental importance when assessing soil phosphatase activity in Cerrado soils.

  20. Evaluation of APHA and AOAC methods for phosphatase in cheese.

    PubMed

    Murthy, G K; Cox, S

    1988-01-01

    Varieties of market cheese were analyzed for alkaline phosphatase by the modified rapid colorimetric method of the American Public Health Association (APHA) and the official AOAC method, 16.304-16.306. In the APHA method, 5 g cheese (pH less than 7.0) is macerated with 2 mL 1:1 carbonate buffer, or 2 mL water (for cheese with pH greater than 7.0). Addition of 0.1 mL magnesium acetate (1 mg magnesium) to test portions of cheese extracts yielded reproducible and quantitative recovery of added phosphatase. In the AOAC method, macerating 0.5 g cheese with 1 mL borate buffer before adding milk phosphatase improved recovery among cheeses. Addition of magnesium ion increased phosphatase activity in some cheeses. Phosphatases in blue mold-ripened and Swiss cheeses were inactivated by heat faster than was milk phosphatase, yet milk phosphatase added to various soft cheeses was completely inactivated at 60 degrees C for 10 min. The lability of phosphatase was due to the heat-denaturing effect of NaCl present in finished cheeses. Some Mexican style soft cheeses contained both heat-labile and heat-stable phosphatases. These data suggest that the phosphatase test to differentiate milk and microbial phosphatases on the basis of repasteurization and analysis of cheese is no longer valid.

  1. Rhizobiales-like Phosphatase 2 from Arabidopsis thaliana Is a Novel Phospho-tyrosine-specific Phospho-protein Phosphatase (PPP) Family Protein Phosphatase*

    PubMed Central

    Uhrig, R. Glen; Labandera, Anne-Marie; Muhammad, Jamshed; Samuel, Marcus; Moorhead, Greg B.

    2016-01-01

    Cellular signaling through protein tyrosine phosphorylation is well established in mammalian cells. Although lacking the classic tyrosine kinases present in humans, plants have a tyrosine phospho-proteome that rivals human cells. Here we report a novel plant tyrosine phosphatase from Arabidopsis thaliana (AtRLPH2) that, surprisingly, has the sequence hallmarks of a phospho-serine/threonine phosphatase belonging to the PPP family. Rhizobiales/Rhodobacterales/Rhodospirillaceae-like phosphatases (RLPHs) are conserved in plants and several other eukaryotes, but not in animals. We demonstrate that AtRLPH2 is localized to the plant cell cytosol, is resistant to the classic serine/threonine phosphatase inhibitors okadaic acid and microcystin, but is inhibited by the tyrosine phosphatase inhibitor orthovanadate and is particularly sensitive to inhibition by the adenylates, ATP and ADP. AtRLPH2 displays remarkable selectivity toward tyrosine-phosphorylated peptides versus serine/threonine phospho-peptides and readily dephosphorylates a classic tyrosine phosphatase protein substrate, suggesting that in vivo it is a tyrosine phosphatase. To date, only one other tyrosine phosphatase is known in plants; thus AtRLPH2 represents one of the missing pieces in the plant tyrosine phosphatase repertoire and supports the concept of protein tyrosine phosphorylation as a key regulatory event in plants. PMID:26742850

  2. Bovine Intestinal Alkaline Phosphatase Reduces Inflammation After Induction of Acute Myocardial Infarction in Mice

    PubMed Central

    Fiechter, Danielle; Kats, Suzanne; Brands, Ruud; van Middelaar, Ben; Pasterkamp, Gerard; de Kleijn, Dominique; Seinen, Willem

    2011-01-01

    Background There has been increasing evidence suggesting that lipopolysaccharide or endotoxin may be an important activator of the innate immune system after acute myocardial infarction. Bovine intestinal alkaline phosphatase reduces inflammation in several endotoxin mediated diseases by dephosphorylation of the lipid A moiety of lipopolysaccharide. The aim of this study was to investigate the effect of bovine intestinal alkaline phosphatase on reducing inflammation after acute myocardial infarction. Methods Just before permanent ligation of the left anterior descending coronary (LAD) artery to induce acute myocardial infarction in Balb/c mice, bovine intestinal alkaline phosphatase (bIAP) was administrated intravenously. After 4 hours, mice were sacrificed and the inflammatory response was assessed. Acute myocardial infarction induced the production of different cytokines, which were measured in blood. Results Treatment with bovine intestinal alkaline phosphatase resulted in a significant reduction of the pro-inflammatory cytokines IL-6, IL-1β and the chymase mouse mast cell protease-1. No difference in the production of the anti-inflammatory cytokine IL-10 was observed between the control group and the bovine intestinal alkaline phosphatase treated group. Conclusion In a mouse model of permanent LAD coronary artery ligation, bIAP diminishes the pro-inflammatory responses but does not have an effect on the anti-inflammatory response in the acute phase after acute myocardial infarction.

  3. Root surface acid phosphatases and their role in phosphorus assimilation by Eriophorum vaginatum

    SciTech Connect

    Kroehler, C.J.; Linkins, A.E.

    1988-01-01

    Eriophorum vaginatum is a dominant plant in much of the arctic tundra ecosystem where phosphorus is frequently a limiting nutrient. The mineralization of this organic phosphorus was thought to be principally controlled by microbial respiration, however, more recent work shows that extracellular soil phosphatases are the principal regulators. The existence of plant root and mycorrhizal surface phosphatases which are capable of hydrolyzing organic phosphorus compounds, suggests that soil organic phosphorus may be directly utilized by plants. Since E. vaginatum is a tussock forming sedge with a very dense annually produced rooting system which can exploit most of the tussock soil volume, its surface phosphatases may play a dominant role in organic phosphorus hydrolysis into inorganic phosphorus. Of equal significance would be the potential for this activity to contribute to the phosphorus nutrition through the coupling of phosphorus hydrolysis on the root and root uptake of the resultant inorganic phosphorus. Phosphatase activity was investigated and found to be uniformly distributed along the surface of the root. Kinetic analysis of the enzyme gave estimates of 9.23 mM for the apparent Km and 1.61 * 10/sup -3/ ..mu..moles mm-2 hr/sup -1/ for the apparent Vmax. Saturation values for E. vaginatum phosphatases are about 3 times higher than average soil solution organic phosphorus concentrations. 12 refs., 4 figs.

  4. An immunochemical approach to detect oxidized protein tyrosine phosphatases using a selective C-nucleophile tag.

    PubMed

    Garcia, Francisco J; Carroll, Kate S

    2016-05-24

    Protein tyrosine phosphatases are crucial regulators of signal transduction and function as antagonists towards protein tyrosine kinases to control reversible tyrosine phosphorylation, thereby regulating fundamental physiological processes. Growing evidence has supported the notion that reversible oxidative inactivation of the catalytic cysteine residue in protein tyrosine phosphatases serves as an oxidative post-translational modification that regulates its activity to influence downstream signaling by promoting phosphorylation and induction of the signaling cascade. The oxidation of cysteine to the sulfenic acid is often transient and difficult to detect, thus making it problematic in understanding the role that this oxidative post-translational modification plays in redox-biology and pathogenesis. Several methods to detect cysteine oxidation in biological systems have been developed, though targeted approaches to directly detect oxidized phosphatases are still lacking. Herein we describe the development of a novel immunochemical approach to directly profile oxidized phosphatases. This immunochemical approach consists of an antibody designed to recognize the conserved sequence of the PTP active site (VHCDMDSAG) harboring the catalytic cysteine modified with dimedone (CDMD), a nucleophile that chemoselectively reacts with cysteine sulfenic acids to form a stable thioether adduct. Additionally, we provide biochemical and mass spectrometry workflows to be used in conjugation with this newly developed immunochemical approach to assist in the identification and quantification of basal and oxidized phosphatases.

  5. Promoting Uranium Immobilization by the Activities of Microbial Phosphatases

    SciTech Connect

    Robert J. Martinez; Melanie J. Beazley; Samuel M. Webb; Martial Taillefert; and Patricia A. Sobecky

    2007-04-19

    precipitation of U(VI) must be mediated by biological activity as less than 3% soluble U(VI) was removed either from the abiotic or the heat-killed cell controls. Interestingly, the pH has a strong effect on growth and U(VI) biomineralization rates by Rahnella. Thermodynamic modeling identifies autunite-type minerals [Ca(UO2)2(PO4)2] as the precipitate likely formed in the synthetic FRC groundwater conditions at all pH investigated. Extended X-ray absorption fine structure measurements have recently confirmed that the precipitate found in these incubations is an autunite and meta-autunite-type mineral. A kinetic model of U biomineralization at the different pH indicates that hydrolysis of organophosphate can be described using simple Monod kinetics and that uranium precipitation is accelerated when monohydrogen phosphate is the main orthophosphate species in solution. Overall, these experiments and ongoing soil slurry incubations demonstrate that the biomineralization of U(VI) through the activity of phosphatase enzymes can be expressed in a wide range of geochemical conditions pertaining to the FRC site.

  6. Leishmanial phosphatase hydrolyzes phosphoproteins and inositol phosphates

    SciTech Connect

    Saha, A.K.; Das, S.; Glew, R.H.

    1986-05-01

    An extensively purified preparation of the predominant, tartrate-resistant acid phosphatase (ACP) from the external surface of Leishmania donovani promastigotes form catalyzes the dephosphorylation of several phosphoproteins; these include: pyruvate kinase, phosphorylase kinase and histones. However, the protein phosphatase activity of ACP is very low compared with that of other protein phosphates known to be involved in regulating various metabolic pathways. /sup 32/P-labelled inositoltriphosphate (IP3), a well-established second messenger derived from phosphatidylinositol-4,5-diphosphate (PIP2), was a substrate for the leishmanial acid phosphatase; incubation of the IP3 preparation with 13.2 milliunits (1 unit equals 1 ..mu..mol 4-methylumbelliferyl phosphate (MUP) cleaved per min at pH 5.5) of ACP at pH 5.5 for 4 hr resulted in hydrolysis of 75% of the radiolabelled substrate resulting in a mixture of inositoldiphosphate and inositolmonophosphate. In addition PIP2 was hydrolyzed rapidly by ACP at pH 5.5 (V/sub max/, 71 units/mg protein; k/sub m/, 4.16 ..mu..M). In contrast, to MUP which is hydrolzyed most rapidly at pH 5.5, PIP2 hydrolysis was optimal at pH 6.8. These observations raise the possibility that ACP could play a role in the host-phagocyte interaction by degrading the precursor of the second messenger, PIP2 or the second messenger itself, IP3.

  7. Two potential fish glycerol-3-phosphate phosphatases.

    PubMed

    Raymond, James A

    2015-06-01

    Winter-acclimated rainbow smelt (Osmerus mordax Mitchill) produce high levels of glycerol as an antifreeze. A common pathway to glycerol involves the enzyme glycerol-3-phosphate phosphatase (GPP), but no GPP has yet been identified in fish or any other animal. Here, two phosphatases assembled from existing EST libraries (from winter-acclimated smelt and cold-acclimated smelt hepatocytes) were found to resemble a glycerol-associated phosphatase from a glycerol-producing alga, Dunaliella salina, and a recently discovered GPP from a bacterium, Mycobacterium tuberculosis. Recombinant proteins were generated and were found to have GPP activity on the order of a few μMol Pi/mg enzyme/min. The two enzymes have acidic pH optima (~5.5) similar to that previously determined for GPP activity in liver tissue, with about 1/3 of their peak activities at neutral pH. The two enzymes appear to account for the GPP activity of smelt liver, but due to their reduced activities at neutral pH, their contributions to glycerol production in vivo remain unclear. Similar enzymes may be active in a glycerol-producing insect, Dendroctonus ponderosae.

  8. Effect of gingival application of melatonin on alkaline and acid phosphatase, osteopontin and osteocalcin in patients with diabetes and periodontal disease

    PubMed Central

    López-Valverde, Antonio; Gómez-de-Diego, Rafel; Arias-Santiago, Salvador; de Vicente-Jiménez, Joaquín

    2013-01-01

    Objectives: To assess the effect of topical application of melatonin to the gingiva on salivary fluid concentrations of acid phosphatase, alkaline phosphatase, osteopontin, and osteocalcin. Study Design: Cross-sectional study of 30 patients with diabetes and periodontal disease and 30 healthy subjects. Diabetic patients were treated with topical application of melatonin (1% orabase cream formula) once daily for 20 days and controls with a placebo formulation. Results: Before treatment with melatonin, diabetic patients showed significantly higher mean salivary levels of alkaline and acid phosphatase, osteopontin and osteocalcin than healthy subjects (P < 0.01). After treatment with melatonin, there was a statistically significant decrease of the gingival index (15.84± 10.3 vs 5.6 ± 5.1) and pocket depth (28.3 ± 19.5 vs 11.9 ± 9.0) (P < 0.001). Also, use of melatonin was associated with a significant reduction of the four biomarkers. Changes of salivary acid phosphatase and osteopontin correlated significantly with changes in the gingival index, whereas changes of alkaline phosphatase and osteopontin correlated significantly with changes in the pocket depth. Conclusions: Treatment with topical melatonin was associated with an improvement in the gingival index and pocket depth, a reduction in salivary concentrations of acid phosphatase, alkaline phosphatase, osteopontin and osteocalcin. Key words:Melatonin, diabetes mellitus, alkaline phosphatase, acid phosphatase, osteopontin, osteocalcin. PMID:23524437

  9. Engineered proteins with sensing and activating modules for automated reprogramming of cellular functions.

    PubMed

    Sun, Jie; Lei, Lei; Tsai, Chih-Ming; Wang, Yi; Shi, Yiwen; Ouyang, Mingxing; Lu, Shaoying; Seong, Jihye; Kim, Tae-Jin; Wang, Pengzhi; Huang, Min; Xu, Xiangdong; Nizet, Victor; Chien, Shu; Wang, Yingxiao

    2017-09-07

    Protein-based biosensors or activators have been engineered to visualize molecular signals or manipulate cellular functions. Here we integrate these two functionalities into one protein molecule, an integrated sensing and activating protein (iSNAP). A prototype that can detect tyrosine phosphorylation and immediately activate auto-inhibited Shp2 phosphatase, Shp2-iSNAP, is designed through modular assembly. When Shp2-iSNAP is fused to the SIRPα receptor which typically transduces anti-phagocytic signals from the 'don't eat me' CD47 ligand through negative Shp1 signaling, the engineered macrophages not only allow visualization of SIRPα phosphorylation upon CD47 engagement but also rewire the CD47-SIRPα axis into the positive Shp2 signaling, which enhances phagocytosis of opsonized tumor cells. A second SIRPα Syk-iSNAP with redesigned sensor and activator modules can likewise rewire the CD47-SIRPα axis to the pro-phagocytic Syk kinase activation. Thus, our approach can be extended to execute a broad range of sensing and automated reprogramming actions for directed therapeutics.Protein-based biosensors have been engineered to interrogate cellular signaling and manipulate function. Here the authors demonstrate iSNAP, a tool to detect tyrosine phosphorylation and activate desired protein enzymes allowing the control of phagocytosis in macrophages.

  10. The discovery of the fat-regulating phosphatidic acid phosphatase gene

    PubMed Central

    CARMAN, George M.

    2011-01-01

    Phosphatidic acid phosphatase is a fat-regulating enzyme that plays a major role in controlling the balance of phosphatidic acid (substrate) and diacylglycerol (product), which are lipid precursors used for the synthesis of membrane phospholipids and triacylglycerol. Phosphatidic acid is also a signaling molecule that triggers phospholipid synthesis gene expression, membrane expansion, secretion, and endocytosis. While this important enzyme has been known for several decades, its gene was only identified recently from yeast. This discovery showed the importance of phosphatidic acid phosphatase in lipid metabolism in yeast as well as in higher eukaryotes including humans. PMID:21785579

  11. The discovery of the fat-regulating phosphatidic acid phosphatase gene.

    PubMed

    Carman, George M

    2011-05-01

    Phosphatidic acid phosphatase is a fat-regulating enzyme that plays a major role in controlling the balance of phosphatidic acid (substrate) and diacylglycerol (product), which are lipid precursors used for the synthesis of membrane phospholipids and triacylglycerol. Phosphatidic acid is also a signaling molecule that triggers phospholipid synthesis gene expression, membrane expansion, secretion, and endocytosis. While this important enzyme has been known for several decades, its gene was only identified recently from yeast. This discovery showed the importance of phosphatidic acid phosphatase in lipid metabolism in yeast as well as in higher eukaryotes including humans.

  12. Hexosaminidase and alkaline phosphatase activities in articular chondrocytes and relationship to cell culture conditions.

    PubMed

    Mokonjimobe, E; Hecquet, C; Robic, D; Bourbouze, R; Adolphe, M

    1992-04-15

    Hexosaminidase and alkaline phosphatase activities in rabbit articular chondrocytes have been studied under different cell culture conditions. Chondrocytes were cultured in monolayer primary culture, monolayer subcultured to the fifth passage (in vitro aging) and cultured within a collagen gel; enzymatically released cartilage cells were used as control. Under these conditions, the two enzymes behave quite differently in relationship to alteration of the chondrocyte phenotype in culture. Increased lysosomal hexosaminidase activity could be considered to be a marker of the dedifferentiated phenotype in monolayer subculture; membrane alkaline phosphatase activity could be used as a marker of non-proliferating cells.

  13. Regulation of synaptojanin 2 5′-phosphatase activity by Src

    PubMed Central

    Chuang, Yayu; Xu, Xiaonan; Kwiatkowska, Aneta; Tsapraillis, George; Hwang, Hyonson; Petritis, Konstantinos; Flynn, Dan; Symons, Marc

    2012-01-01

    Synaptojanin 2 (SYNJ2) is a phosphatidylinositol (PI) phosphatase that controls two distinct functions, clathrin-mediated endocytosis and tumor cell invadopodia formation and invasion. Here, we identify a number of novel SYNJ2 binding partners, several of which have previously been shown to be necessary for invadopodia formation or clathrin-mediated endocytosis. We focus on Src family kinases. We found that Src phosphorylates SYNJ2 on Tyr490, thereby stimulating SYNJ2 5′-phosphatase activity in vitro. We also provide evidence that Src-mediated phosphorylation of SYNJ2 contributes to invadopodia formation. PMID:23076136

  14. Protein Tyrosine Phosphatases: From Housekeeping Enzymes to Master-Regulators of Signal Transduction

    PubMed Central

    Tonks, Nicholas K.

    2013-01-01

    There are many misconceptions surrounding the roles of protein phosphatases in the regulation of signal transduction, perhaps the most damaging of which is the erroneous view that these enzymes exert their effects merely as constitutively active housekeeping enzymes. On the contrary, the phosphatases are critical, specific regulators of signaling in their own right and serve an essential function, in a coordinated manner with the kinases, to determine the response to a physiological stimulus. This review is a personal perspective on the development of our understanding of the protein tyrosine phosphatase (PTP) family of enzymes. I have discussed various aspects of the structure, regulation and function of the PTP family, which I hope will illustrate the fundamental importance of these enzymes to the control of signal transduction. PMID:23176256

  15. Multiple Phosphatases Regulate Carbon Source-Dependent Germination and Primary Metabolism in Aspergillus nidulans.

    PubMed

    de Assis, Leandro José; Ries, Laure Nicolas Annick; Savoldi, Marcela; Dinamarco, Taisa Magnani; Goldman, Gustavo Henrique; Brown, Neil Andrew

    2015-03-11

    Aspergillus nidulans is an important mold and a model system for the study of fungal cell biology. In addition, invasive A. nidulans pulmonary infections are common in humans with chronic granulomatous disease. The morphological and biochemical transition from dormant conidia into active, growing, filamentous hyphae requires the coordination of numerous biosynthetic, developmental, and metabolic processes. The present study exhibited the diversity of roles performed by seven phosphatases in regulating cell cycle, development, and metabolism in response to glucose and alternative carbon sources. The identified phosphatases highlighted the importance of several signaling pathways regulating filamentous growth, the action of the pyruvate dehydrogenase complex as a metabolic switch controlling carbon usage, and the identification of the key function performed by the α-ketoglutarate dehydrogenase during germination. These novel insights into the fundamental roles of numerous phosphatases in germination and carbon sensing have provided new avenues of research into the identification of inhibitors of fungal germination, with implications for the food, feed, and pharmaceutical industries.

  16. Dual Specificity Phosphatase 5 Is Essential for T Cell Survival

    PubMed Central

    Schauder, David M.; Cossette, Stephanie M.; Bordas, Michelle; Cui, Weiguo; Ramchandran, Ramani

    2016-01-01

    The mitogen-activated protein kinase (MAPK) pathway regulates many key cellular processes such as differentiation, apoptosis, and survival. The final proteins in this pathway, ERK1/2, are regulated by dual specificity phosphatase 5 (DUSP5). DUSP5 is a nuclear, inducible phosphatase with high affinity and fidelity for ERK1/2. By regulating the final step in the MAPK signaling cascade, DUSP5 exerts strong regulatory control over a central cellular pathway. Like other DUSPs, DUSP5 plays an important role in immune function. In this study, we have utilized new knockout mouse reagents to explore its function further. We demonstrate that global loss of DUSP5 does not result in any gross phenotypic changes. However, loss of DUSP5 affects memory/effector CD8+ T cell populations in response to acute viral infection. Specifically, Dusp5-/- mice have decreased proportions of short-lived effector cells (SLECs) and increased proportions of memory precursor effector cells (MPECs) in response to infection. Further, we show that this phenotype is T cell intrinsic; a bone marrow chimera model restricting loss of DUSP5 to the CD8+ T cell compartment displays a similar phenotype. Dusp5-/- T cells also display increased proliferation, increased apoptosis, and altered metabolic profiles, suggesting that DUSP5 is a pro-survival protein in T cells. PMID:27936095

  17. Regulation of FcεRI signaling by lipid phosphatases.

    PubMed

    Kuhny, Marcel; Zorn, Carolin N; Huber, Michael

    2014-01-01

    Mast cells (MCs) are tissue-resident sentinels of hematopoietic origin that play a prominent role in allergic diseases. They express the high-affinity receptor for IgE (FcεRI), which when cross-linked by multivalent antigens triggers the release of preformed mediators, generation of arachidonic acid metabolites, and the synthesis of cytokines and chemokines. Stimulation of the FcεRI with increasing antigen concentrations follows a characteristic bell-shaped dose-responses curve. At high antigen concentrations, the so-called supra-optimal conditions, repression of FcεRI-induced responses is facilitated by activation and incorporation of negative signaling regulators. In this context, the SH2-containing inositol-5'-phosphatase, SHIP1, has been demonstrated to be of particular importance. SHIP1 with its catalytic and multiple protein interaction sites provides several layers of control for FcεRI signaling. Regulation of SHIP1 function occurs on various levels, e.g., protein expression, receptor and membrane recruitment, competition for protein-protein interaction sites, and activating modifications enhancing the phosphatase function. Apart from FcεRI-mediated signaling, SHIP1 can be activated by diverse unrelated receptor systems indicating its involvement in the regulation of antigen-dependent cellular responses by autocrine feedback mechanisms or tissue-specific and/or (patho-) physiologically determined factors. Thus, pharmacologic engagement of SHIP1 may represent a beneficial strategy for patients suffering from acute or chronic inflammation or allergies.

  18. New functional aspects of the atypical protein tyrosine phosphatase VHZ.

    PubMed

    Kuznetsov, Vyacheslav I; Hengge, Alvan C

    2013-11-12

    LDP3 (VHZ) is the smallest classical protein tyrosine phosphatase (PTP) known to date and was originally misclassified as an atypical dual-specificity phosphatase. Kinetic isotope effects with steady-state and pre-steady-state kinetics of VHZ and mutants with p-nitrophenol phosphate have revealed several unusual properties. VHZ is significantly more active than previously reported but remains one of the least active PTPs. Highly unusual for a PTP, VHZ possesses two acidic residues (E134 and D65) in the active site. D65 occupies the position corresponding to the typical general acid in the PTP family. However, VHZ primarily utilizes E134 as the general acid, with D65 taking over this role when E134 is mutated. This unusual behavior is facilitated by two coexisting, but unequally populated, substrate binding modes. Unlike most classical PTPs, VHZ exhibits phosphotransferase activity. Despite the presence of the Q-loop that normally prevents alcoholysis of the phosphoenzyme intermediate in other classical PTPs, VHZ readily phosphorylates ethylene glycol. Although mutations of Q-loop residues affect this phosphotransferase activity, mutations on the IPD loop that contains the general acid exert more control over this process. A single P68V substitution on this loop completely abolishes phosphotransferase activity. The ability of native VHZ to catalyze transphosphorylation may lead to an imbalance of intracellular phosphorylation, which could explain the correlation of its overexpression with several types of cancer.

  19. S100 Proteins Modulate Protein Phosphatase 5 Function

    PubMed Central

    Yamaguchi, Fuminori; Umeda, Yoshinori; Shimamoto, Seiko; Tsuchiya, Mitsumasa; Tokumitsu, Hiroshi; Tokuda, Masaaki; Kobayashi, Ryoji

    2012-01-01

    PP5 is a unique member of serine/threonine phosphatases comprising a regulatory tetratricopeptide repeat (TPR) domain and functions in signaling pathways that control many cellular responses. We reported previously that Ca2+/S100 proteins directly associate with several TPR-containing proteins and lead to dissociate the interactions of TPR proteins with their client proteins. Here, we identified protein phosphatase 5 (PP5) as a novel target of S100 proteins. In vitro binding studies demonstrated that S100A1, S100A2, S100A6, and S100B proteins specifically interact with PP5-TPR and inhibited the PP5-Hsp90 interaction. In addition, the S100 proteins activate PP5 by using a synthetic phosphopeptide and a physiological protein substrate, Tau. Overexpression of S100A1 in COS-7 cells induced dephosphorylation of Tau. However, S100A1 and permanently active S100P inhibited the apoptosis signal-regulating kinase 1 (ASK1) and PP5 interaction, resulting the inhibition of dephosphorylation of phospho-ASK1 by PP5. The association of the S100 proteins with PP5 provides a Ca2+-dependent regulatory mechanism for the phosphorylation status of intracellular proteins through the regulation of PP5 enzymatic activity or PP5-client protein interaction. PMID:22399290

  20. An RNAi Screen To Identify Protein Phosphatases That Function Within the Drosophila Circadian Clock.

    PubMed

    Agrawal, Parul; Hardin, Paul E

    2016-12-07

    Circadian clocks in eukaryotes keep time via cell-autonomous transcriptional feedback loops. A well-characterized example of such a transcriptional feedback loop is in Drosophila, where CLOCK-CYCLE (CLK-CYC) complexes activate transcription of period (per) and timeless (tim) genes, rising levels of PER-TIM complexes feed-back to repress CLK-CYC activity, and degradation of PER and TIM permits the next cycle of CLK-CYC transcription. The timing of CLK-CYC activation and PER-TIM repression is regulated posttranslationally, in part through rhythmic phosphorylation of CLK, PER, and TIM. Previous behavioral screens identified several kinases that control CLK, PER, and TIM levels, subcellular localization, and/or activity, but two phosphatases that function within the clock were identified through the analysis of candidate genes from other pathways or model systems. To identify phosphatases that play a role in the clock, we screened clock cell-specific RNA interference (RNAi) knockdowns of all annotated protein phosphatases and protein phosphatase regulators in Drosophila for altered activity rhythms. This screen identified 19 protein phosphatases that lengthened or shortened the circadian period by ≥1 hr (p ≤ 0.05 compared to controls) or were arrhythmic. Additional RNAi lines, transposon inserts, overexpression, and loss-of-function mutants were tested to independently confirm these RNAi phenotypes. Based on genetic validation and molecular analysis, 15 viable protein phosphatases remain for future studies. These candidates are expected to reveal novel features of the circadian timekeeping mechanism in Drosophila that are likely to be conserved in all animals including humans.

  1. An RNAi Screen To Identify Protein Phosphatases That Function Within the Drosophila Circadian Clock

    PubMed Central

    Agrawal, Parul; Hardin, Paul E.

    2016-01-01

    Circadian clocks in eukaryotes keep time via cell-autonomous transcriptional feedback loops. A well-characterized example of such a transcriptional feedback loop is in Drosophila, where CLOCK-CYCLE (CLK-CYC) complexes activate transcription of period (per) and timeless (tim) genes, rising levels of PER-TIM complexes feed-back to repress CLK-CYC activity, and degradation of PER and TIM permits the next cycle of CLK-CYC transcription. The timing of CLK-CYC activation and PER-TIM repression is regulated posttranslationally, in part through rhythmic phosphorylation of CLK, PER, and TIM. Previous behavioral screens identified several kinases that control CLK, PER, and TIM levels, subcellular localization, and/or activity, but two phosphatases that function within the clock were identified through the analysis of candidate genes from other pathways or model systems. To identify phosphatases that play a role in the clock, we screened clock cell-specific RNA interference (RNAi) knockdowns of all annotated protein phosphatases and protein phosphatase regulators in Drosophila for altered activity rhythms. This screen identified 19 protein phosphatases that lengthened or shortened the circadian period by ≥1 hr (p ≤ 0.05 compared to controls) or were arrhythmic. Additional RNAi lines, transposon inserts, overexpression, and loss-of-function mutants were tested to independently confirm these RNAi phenotypes. Based on genetic validation and molecular analysis, 15 viable protein phosphatases remain for future studies. These candidates are expected to reveal novel features of the circadian timekeeping mechanism in Drosophila that are likely to be conserved in all animals including humans. PMID:27784754

  2. Mutated Ptpn11 alters leukemic stem cell frequency and reduces the sensitivity of acute myeloid leukemia cells to Mcl1 inhibition.

    PubMed

    Chen, L; Chen, W; Mysliwski, M; Serio, J; Ropa, J; Abulwerdi, F A; Chan, R J; Patel, J P; Tallman, M S; Paietta, E; Melnick, A; Levine, R L; Abdel-Wahab, O; Nikolovska-Coleska, Z; Muntean, A G

    2015-06-01

    PTPN11 encodes the Shp2 non-receptor protein-tyrosine phosphatase implicated in several signaling pathways. Activating mutations in Shp2 are commonly associated with juvenile myelomonocytic leukemia but are not as well defined in other neoplasms. Here we report that Shp2 mutations occur in human acute myeloid leukemia (AML) at a rate of 6.6% (6/91) in the ECOG E1900 data set. We examined the role of mutated Shp2 in leukemias harboring MLL translocations, which co-occur in human AML. The hyperactive Shp2E76K mutant, commonly observed in leukemia patients, significantly accelerated MLL-AF9-mediated leukemogenesis in vivo. Shp2E76K increased leukemic stem cell frequency and affords MLL-AF9 leukemic cells IL3 cytokine hypersensitivity. As Shp2 is reported to regulate anti-apoptotic genes, we investigated Bcl2, Bcl-xL and Mcl1 expression in MLL-AF9 leukemic cells with and without Shp2E76K. Although the Bcl2 family of genes was upregulated in Shp2E76K cells, Mcl1 showed the highest upregulation in MLL-AF9 cells in response to Shp2E76K. Indeed, expression of Mcl1 in MLL-AF9 cells phenocopies expression of Shp2E76K, suggesting Shp2 mutations cooperate through activation of anti-apoptotic genes. Finally, we show Shp2E76K mutations reduce sensitivity of AML cells to small-molecule-mediated Mcl1 inhibition, suggesting reduced efficacy of drugs targeting MCL1 in patients with hyperactive Shp2.

  3. Mutated Ptpn11 alters leukemic stem cell frequency and reduces the sensitivity of acute myeloid leukemia cells to Mcl1 inhibition

    PubMed Central

    Chen, Lili; Chen, Wei; Mysliwski, Maria; Serio, Justin; Ropa, James; Abulwerdi, Fardokht A.; Chan, Rebecca J.; Patel, Jay P.; Tallman, Martin S.; Paietta, Elisabeth; Melnick, Ari; Levine, Ross L.; Abdel-Wahab, Omar; Nikolovska-Coleska, Zaneta; Muntean, Andrew G.

    2015-01-01

    PTPN11 encodes the Shp2 non-receptor protein-tyrosine phosphatase implicated in several signaling pathways. Activating mutations in Shp2 are commonly associated with juvenile myelomonocytic leukemia (JMML) but are not as well defined in other neoplasms. Here we report that Shp2 mutations occur in human acute myeloid leukemia (AML) at a rate of 6.6% (6/91) in the ECOG E1900 dataset. We examined the role of mutated Shp2 in leukemias harboring MLL translocations which co-occur in human AML. The hyperactive Shp2E76K mutant, commonly observed in leukemia patients, significantly accelerated MLL-AF9 mediated leukemogenesis in vivo. Shp2E76K increased leukemic stem cell frequency and affords MLL-AF9 leukemic cells IL3 cytokine hypersensitivity. As Shp2 is reported to regulate anti-apoptotic genes, we investigated Bcl2, Bcl-xL and Mcl1 expression in MLL-AF9 leukemic cells with and without Shp2E76K. While the Bcl2 family of genes was upregulated in Shp2E76K cells, Mcl1 showed the highest upregulation in MLL-AF9 cells in response to Shp2E76K. Indeed, expression of Mcl1 in MLL-AF9 cells phenocopies expression of Shp2E76K suggesting Shp2 mutations cooperate through activation of anti-apoptotic genes. Finally, we show Shp2E76K mutations reduce sensitivity of AML cells to small molecule mediated Mcl1 inhibition suggesting reduced efficacy of drugs targeting MCL1 in patients with hyperactive Shp2. PMID:25650089

  4. Networks of protein kinases and phosphatases in the individual phases of contextual fear conditioning in the C57BL/6J mouse.

    PubMed

    Mucic, Goran; Sase, Sunetra; Stork, Oliver; Lubec, Gert; Li, Lin

    2015-03-01

    Although protein kinases and phosphatases have been reported to be involved in fear memory, information about these signalling molecules in the individual phases of contextual fear conditioning (cFC) is limited. C57BL/6J mice were tested in cFC, sacrificed and hippocampi were used for screening of approximately 800 protein kinases and phosphatases by protein microarrays with subsequent Western blot confirmation of threefold higher or lower hippocampal levels as compared to foot shock controls. Immunoblotting of the protein kinases and phosphatases screened out was carried out by Western blotting. A network of protein kinases and phosphatases was generated (STRING 9.1). Animals learned the task in the paradigm and protein kinase and phosphatase levels were determined in the individual phases acquisition, consolidation and retrieval and compared to foot shock controls. Protein kinases discoidin containing receptor 2 (DDR2), mitogen activated protein kinase kinase kinase 7 (TAK1), protein phosphatases dual specificity protein phosphatase (PTEN) and protein phosphatase 2a (PP2A) were modulated in the individual phases of cFC. Phosphatidyl-inositol-3,4,5-triphosphate 3-phosphatase and phosphatidylinositol-3 kinase (PI3K) that is interacting with PTEN were modulated as well. Freezing time was correlating with PP2A levels in the retrieval phase of cFC. The abovementioned protein kinases, phosphatases and inositol-signalling enzymes were not reported so far in cFC and the results are relevant for interpretation of previous and design of future studies in cFC or fear memory. Protein phosphatase PP2A was, however, the only signalling compound tested that was directly linked to retrieval in the cFC.

  5. Primary structure of rat secretory acid phosphatase and comparison to other acid phosphatases.

    PubMed

    Roiko, K; Jänne, O A; Vihko, P

    1990-05-14

    Overlapping cDNA clones encoding rat prostatic acid phosphatase (rPAP) were isolated by using two human prostatic acid phosphatase (hPAP)-encoding cDNAs to screen rat prostatic cDNA libraries. The isolated cDNAs encompassed a total of 1626 nucleotides (nt), of which 1143 nt corresponded to the protein coding sequence encoding a mature polypeptide of 350 amino acids (aa) and a 31-aa long signal peptide-like sequence. The deduced Mr of the mature rPAP was 40,599. RNA blot analysis indicated the presence of three mRNA species (4.9, 2.3 and 1.5 kb in size) in the rat prostate. The deduced aa sequences of rPAP and hPAP show 75% identity, whereas the similarity between rPAP and human lysosomal acid phosphatase (hLAP) is only 45%. Furthermore, the sequence similarity between rPAP and rat lysosomal acid phosphatase (rLAP) is 46% at the aa level. Similar to hPAP, but unlike hLAP and rLAP, the rPAP sequence lacks a membrane-anchoring domain indicating the secretory character of this phosphatase. All six cysteines present in the overlapping areas of the mature rPAP, hPAP, rLAP and hLAP proteins are positionally conserved, suggesting that these residues are important for the tertiary structure of acid phosphatases (APs). The previously reported active site residues, two arginines and one histidine, are also conserved in these APs.

  6. Carboxyarabinitol-1-P phosphatase of Phaseolus vulgaris

    SciTech Connect

    Kobza, J.; Moore, B.d.; Seemann, J.R. )

    1990-05-01

    The activity of carboxyarabinitol-1-P (CA1P) phosphatase was detected in clarified stromal extracts by the generation of {sup 14}C-carboxyarabinitol from {sup 14}C-CA1P. Carboxyribitol-1-P dependent activity was 3% of the CA1P dependent activity, indicating the enzyme was specific for CA1P. Inclusion of DTT in the assay was required for maximum velocity, but it appears that the enzyme is not regulated by thioredoxin in vivo. Activity o f the CA1P phosphatase was stimulated by RuBP, NADPH and FBP, though the latter two metabolites were required at nonphysiological concentrations in order to achieve significant stimulation. Contrary to a previous report on purified tobacco enzyme, ATP stimulated the CA1P phosphatase activity. In the presence of 1 mM RuBP or ATP, rates of 2 or 3 {mu}mol mg{sup {minus}1} Chl h{sup {minus}1}, respectively, were observed at 1 mM CA1P. These rates were 3-4 fold higher than the rate observed in the absence of effectors and are 2-4 times the in vivo rate of degradation of CA1P during dark/light transitions. The rates from bean were about 7 fold higher than rates reported for the enzyme from tobacco. Changes in the levels of ATP and RuBP associated with dark/light transitions could modulate the enzyme activity in vivo, but it remains to be established if this is the only mechanism for the required regulation of the enzyme.

  7. Lipid phosphatase SHIP2 functions as oncogene in colorectal cancer by regulating PKB activation

    PubMed Central

    Hoekstra, Elmer; Das, Asha M.; Willemsen, Marcella; Swets, Marloes; Kuppen, Peter J.K.; van der Woude, Christien J.; Bruno, Marco J.; Shah, Jigisha P.; Hagen, Timo L.M. ten; Chisholm, John D.; Kerr, William G.; Peppelenbosch, Maikel P.; Fuhler, Gwenny M.

    2016-01-01

    Colorectal cancer (CRC) is the second most common cause of cancer-related death, encouraging the search for novel therapeutic targets affecting tumor cell proliferation and migration. These cellular processes are under tight control of two opposing groups of enzymes; kinases and phosphatases. Aberrant activity of kinases is observed in many forms of cancer and as phosphatases counteract such “oncogenic” kinases, it is generally assumed that phosphatases function as tumor suppressors. However, emerging evidence suggests that the lipid phosphatase SH2-domain-containing 5 inositol phosphatase (SHIP2), encoded by the INPPL1 gene, may act as an oncogene. Just like the well-known tumor suppressor gene Phosphatase and Tensin Homolog (PTEN) it hydrolyses phosphatidylinositol (3,4,5) triphosphate (PI(3,4,5)P3). However, unlike PTEN, the reaction product is PI(3,4)P2, which is required for full activation of the downstream protein kinase B (PKB/Akt), suggesting that SHIP2, in contrast to PTEN, could have a tumor initiating role through PKB activation. In this work, we investigated the role of SHIP2 in colorectal cancer. We found that SHIP2 and INPPL1 expression is increased in colorectal cancer tissue in comparison to adjacent normal tissue, and this is correlated with decreased patient survival. Moreover, SHIP2 is more active in colorectal cancer tissue, suggesting that SHIP2 can induce oncogenesis in colonic epithelial cells. Furthermore, in vitro experiments performed on colorectal cancer cell lines shows an oncogenic role for SHIP2, by enhancing chemoresistance, cell migration, and cell invasion. Together, these data indicate that SHIP2 expression contributes to the malignant potential of colorectal cancer, providing a possible target in the fight against this devastating disease. PMID:27716613

  8. HDHD1, which is often deleted in X-linked ichthyosis, encodes a pseudouridine-5'-phosphatase.

    PubMed

    Preumont, Alice; Rzem, Rim; Vertommen, Didier; Van Schaftingen, Emile

    2010-10-15

    Pseudouridine, the fifth-most abundant nucleoside in RNA, is not metabolized in mammals, but is excreted intact in urine. The purpose of the present work was to search for an enzyme that would dephosphorylate pseudouridine 5'-phosphate, a potential intermediate in RNA degradation. We show that human erythrocytes contain a pseudouridine-5'-phosphatase displaying a Km ≤ 1 μM for its substrate. The activity of the partially purified enzyme was dependent on Mg2+, and was inhibited by Ca2+ and vanadate, suggesting that it belonged to the 'haloacid dehalogenase' family of phosphatases. Its low molecular mass (26 kDa) suggested that this phosphatase could correspond to the protein encoded by the HDHD1 (haloacid dehalogenase-like hydrolase domain-containing 1) gene, present next to the STS (steroid sulfatase) gene on human chromosome Xp22. Purified human recombinant HDHD1 dephosphorylated pseudouridine 5'-phosphate with a kcat of 1.6 s-1, a Km of 0.3 μM and a catalytic efficiency at least 1000-fold higher than that on which it acted on other phosphate esters, including 5'-UMP. The molecular identity of pseudouridine-5'-phosphatase was confirmed by the finding that its activity was negligible (<10% of controls) in extracts of B-cell lymphoblasts or erythrocytes from X-linked ichthyosis patients harbouring a combined deletion of the STS gene (the X-linked ichthyosis gene) and the HDHD1 gene. Furthermore, pseudouridine-5'-phosphatase activity was 1.5-fold higher in erythrocytes from women compared with men, in agreement with the HDHD1 gene undergoing only partial inactivation in females. In conclusion, HDHD1 is a phosphatase specifically involved in dephosphorylation of a modified nucleotide present in RNA.

  9. Crystallization of a newly discovered histidine acid phosphatase from Francisella tularensis

    SciTech Connect

    Felts, Richard L.; Reilly, Thomas J.; Calcutt, Michael J.; Tanner, John J.

    2006-01-01

    A histidine acid phosphatase from the CDC Category A pathogen F. tularensis has been crystallized in space group P4{sub 1}2{sub 1}2, with unit-cell parameters a = 61.96, c = 210.78 Å. A 1.75 Å resolution data set was collected at Advanced Light Source beamline 4.2.2. Francisella tularensis is a highly infectious bacterial pathogen that is considered by the Centers for Disease Control and Prevention to be a potential bioterrorism weapon. Here, the crystallization of a 37.2 kDa phosphatase encoded by the genome of F. tularensis subsp. holarctica live vaccine strain is reported. This enzyme shares 41% amino-acid sequence identity with Legionella pneumophila major acid phosphatase and contains the RHGXRXP motif that is characteristic of the histidine acid phosphatase family. Large diffraction-quality crystals were grown in the presence of Tacsimate, HEPES and PEG 3350. The crystals belong to space group P4{sub 1}2{sub 1}2, with unit-cell parameters a = 61.96, c = 210.78 Å. The asymmetric unit is predicted to contain one protein molecule, with a solvent content of 53%. A 1.75 Å resolution native data set was recorded at beamline 4.2.2 of the Lawrence Berkeley National Laboratory Advanced Light Source. Molecular-replacement trials using the human prostatic acid phosphatase structure as the search model (28% amino-acid sequence identity) did not produce a satisfactory solution. Therefore, the structure of F. tularensis histidine acid phosphatase will be determined by multiwavelength anomalous dispersion phasing using a selenomethionyl derivative.

  10. Protein Phosphatase 1-α Regulates AS160 Ser588 and Thr642 Dephosphorylation in Skeletal Muscle.

    PubMed

    Sharma, Pragya; Arias, Edward B; Cartee, Gregory D

    2016-09-01

    Akt substrate of 160 kDa (AS160) phosphorylation on Thr(642) and Ser(588) by Akt is essential for insulin's full effect on glucose transport. However, protein phosphorylation is determined by the balance of actions by kinases and phosphatases, and the specific phosphatase(s) controlling AS160 dephosphorylation is (are) unknown. Accordingly, we assessed roles of highly expressed skeletal muscle serine/threonine phosphatases (PP1, PP2A, PP2B, and PP2C) on AS160 dephosphorylation. Preliminary screening of candidate phosphatases used an AS160 dephosphorylation assay. Lysates from insulin-stimulated skeletal muscle were treated with pharmacological phosphatase inhibitors and assessed for AS160 Ser(588) and Thr(642) dephosphorylation. AS160 dephosphorylation on both phosphorylation sites was unaltered by PP2B or PP2C inhibitors. Okadaic acid (low dose inhibits PP2A; high dose inhibits PP1) delayed AS160 Ser(588) (both doses) and Thr(642) (high dose only) dephosphorylation concomitant with greater Akt phosphorylation (both doses). AS160 was coimmunoprecipitated with PP1-α but not with PP1-β, PP1-γ1, or PP2A. Recombinant inhibitor-2 protein (a selective PP1 inhibitor) delayed AS160 dephosphorylation on both phosphorylation sites without altering Akt phosphorylation. Furthermore, knockdown of PP1-α but not PP1-β or PP1-γ1 by small interfering RNA caused greater AS160 Ser(588) and Thr(642) phosphorylation concomitant with unaltered Akt phosphorylation. Together, these results identified PP1-α as a regulator of AS160 Thr(642) and Ser(588) dephosphorylation in skeletal muscle.

  11. Auxiliary phosphatases in two-component signal transduction.

    PubMed

    Silversmith, Ruth E

    2010-04-01

    Signal termination in two-component systems occurs by loss of the phosphoryl group from the response regulator protein. This review explores our current understanding of the structures, catalytic mechanisms and means of regulation of the known families of phosphatases that catalyze response regulator dephosphorylation. The CheZ and CheC/CheX/FliY families, despite different overall structures, employ identical catalytic strategies using an amide side chain to orient a water molecule for in-line attack of the aspartyl phosphate. Spo0E phosphatases contain sequence and structural features that suggest a strategy similar to the chemotaxis phosphatases but the mechanism used by the Rap phosphatases is not yet elucidated. Identification of features shared by phosphatase families may aid in the identification of currently unrecognized classes of response regulator phosphatases. Copyright 2010 Elsevier Ltd. All rights reserved.

  12. Effect of Bacteria and Amoebae on Rhizosphere Phosphatase Activity

    PubMed Central

    Gould, W. Douglas; Coleman, David C.; Rubink, Amy J.

    1979-01-01

    The contributions of various components of soil microflora and microfauna to rhizosphere phosphatase activity were determined with hydroponic cultures. Three treatments were employed: (i) plants alone (Bouteloua gracilis (H.B.K.) Lag. ex Steud.) (ii) plants plus bacteria (Pseudomonas sp.), and (iii) plants plus bacteria plus amoebae (Acanthamoeba sp.). No alkaline phosphatase was detected, but an appreciable amount of acid phosphatase activity (120 to 500 nmol of p-nitrophenylphosphate hydrolyzed per h per plant) was found in the root culture solutions. The presence of bacteria or bacteria and amoebae increased the amount of acid phosphatase in solution, and properties of additional activity were identical to properties of plant acid phosphatase. The presence of bacteria or bacteria and amoebae increased both solution and root phosphatase activities at most initial phosphate concentrations. PMID:16345390

  13. Desialylated alkaline phosphatase: activation by 4-nitrophenol.

    PubMed

    Nayudu, P R

    1984-01-01

    Mouse ileal alkaline phosphatase is a sialyl enzyme (12-14 moles per mole of enzyme). When partially desialylated by treatment with neuraminidase, the enzyme loses most of its activity, associated with reduced apparent Vmax and Km. Part of that loss, however, is recovered as the product 4-nitrophenol's concentration builds up in the cuvette. Experimental results are presented to demonstrate that the activation is due to the binding of 4-nitrophenol as a ligand by the partially desialylated enzyme and that both the loss of activity by sialic acid removal and activation by ligand-binding are correlated with changes in protein conformation.

  14. Phosphatase specificity and pathway insulation in signaling networks.

    PubMed

    Rowland, Michael A; Harrison, Brian; Deeds, Eric J

    2015-02-17

    Phosphatases play an important role in cellular signaling networks by regulating the phosphorylation state of proteins. Phosphatases are classically considered to be promiscuous, acting on tens to hundreds of different substrates. We recently demonstrated that a shared phosphatase can couple the responses of two proteins to incoming signals, even if those two substrates are from otherwise isolated areas of the network. This finding raises a potential paradox: if phosphatases are indeed highly promiscuous, how do cells insulate themselves against unwanted crosstalk? Here, we use mathematical models to explore three possible insulation mechanisms. One approach involves evolving phosphatase KM values that are large enough to prevent saturation by the phosphatase's substrates. Although this is an effective method for generating isolation, the phosphatase becomes a highly inefficient enzyme, which prevents the system from achieving switch-like responses and can result in slow response kinetics. We also explore the idea that substrate degradation can serve as an effective phosphatase. Assuming that degradation is unsaturatable, this mechanism could insulate substrates from crosstalk, but it would also preclude ultrasensitive responses and would require very high substrate turnover to achieve rapid dephosphorylation kinetics. Finally, we show that adaptor subunits, such as those found on phosphatases like PP2A, can provide effective insulation against phosphatase crosstalk, but only if their binding to substrates is uncoupled from their binding to the catalytic core. Analysis of the interaction network of PP2A's adaptor domains reveals that although its adaptors may isolate subsets of targets from one another, there is still a strong potential for phosphatase crosstalk within those subsets. Understanding how phosphatase crosstalk and the insulation mechanisms described here impact the function and evolution of signaling networks represents a major challenge for

  15. Inorganic Phosphate as an Important Regulator of Phosphatases

    PubMed Central

    Dick, Claudia Fernanda; Dos-Santos, André Luiz Araújo; Meyer-Fernandes, José Roberto

    2011-01-01

    Cellular metabolism depends on the appropriate concentration of intracellular inorganic phosphate (Pi). Pi starvation-responsive genes appear to be involved in multiple metabolic pathways, implying a complex Pi regulation system in microorganisms and plants. A group of enzymes is required for absorption and maintenance of adequate phosphate levels, which is released from phosphate esters and anhydrides. The phosphatase system is particularly suited for the study of regulatory mechanisms because phosphatase activity is easily measured using specific methods and the difference between the repressed and derepressed levels of phosphatase activity is easily detected. This paper analyzes the protein phosphatase system induced during phosphate starvation in different organisms. PMID:21755037

  16. Functional size of the thylakoid phosphatases determined by radiation inactivation.

    PubMed

    Hsu, L H; Tzeng, C M; Pan, R L

    1993-02-22

    Radiation inactivation technique was employed to determine the functional size of phosphatases from thylakoid membrane. The enzymatic activities of phosphatases decayed in a simple function with the increase of radiation dosage. D37 values of 18.8 +/- 2.4-14.1 +/- 1.5 Mrad were obtained, using phosphoserine, phosphothreonine, p-nitrophenol phosphate, and phospho-histone V-S, respectively, as substrates. The molecular masses of 48.2 +/- 6.3-61 +/- 5.7 kDa were yielded by target theory analysis. We thus speculate that the thylakoid alkaline phosphatase is probably a monomer while acid phosphatase is functionally a dimer in situ.

  17. Differential effect of dietary spermine on alkaline phosphatase activity in jejunum and ileum of unweaned rats.

    PubMed

    Peulen, Olivier; Gharbi, Myriam; Powroznik, Brigitte; Dandrifosse, Guy

    2004-07-01

    Spermine is a low molecular weight polyamine involved in the postnatal maturation of the gut. When it is administered orally to suckling rats it induces the maturation of their spleen, liver, pancreas, and small intestine. We showed that this polyamine modulates differently the activity of alkaline phosphatase in jejunum and ileum in suckling rat. In 14-day-old rat which had received spermine orally for 3 days, once daily, an increase of alkaline phosphatase activity in the jejunum and a decrease of this activity in the ileum was observed. Alkaline phosphatase was located at the bottom of the villus in the control jejunum and in the whole length of the villus in spermine-treated rats. On the contrary, in ileum of controls, this enzyme was present in the whole length of the villus but disappeared in the spermine-treated animals. An enzyme mass shift was observed in the small intestine after spermine administration. Spermine administration did not change the expression of genes coding for alkaline phosphatase, suggesting a post-transcriptional modification.

  18. Therapeutic strategies for anchored kinases and phosphatases: exploiting short linear motifs and intrinsic disorder

    PubMed Central

    Nygren, Patrick J.; Scott, John D.

    2015-01-01

    Phosphorylation events that occur in response to the second messenger cAMP are controlled spatially and temporally by protein kinase A (PKA) interacting with A-kinase anchoring proteins (AKAPs). Recent advances in understanding the structural basis for this interaction have reinforced the hypothesis that AKAPs create spatially constrained signaling microdomains. This has led to the realization that the PKA/AKAP interface is a potential drug target for modulating a plethora of cell-signaling events. Pharmacological disruption of kinase–AKAP interactions has previously been explored for disease treatment and remains an interesting area of research. However, disrupting or enhancing the association of phosphatases with AKAPs is a therapeutic concept of equal promise, particularly since they oppose the actions of many anchored kinases. Accordingly, numerous AKAPs bind phosphatases such as protein phosphatase 1 (PP1), calcineurin (PP2B), and PP2A. These multimodal signaling hubs are equally able to control the addition of phosphate groups onto target substrates, as well as the removal of these phosphate groups. In this review, we describe recent advances in structural analysis of kinase and phosphatase interactions with AKAPs, and suggest future possibilities for targeting these interactions for therapeutic benefit. PMID:26283967

  19. Acid phosphatase activity: a marker of androgen action in prostate explant cultures.

    PubMed

    Shao, T C; Kong, A Y; Cunningham, G R

    1987-01-01

    Acid phosphatase activity in rat ventral prostate explants has been assayed to determine if this parameter could serve as a specific and quantitative marker of androgen action in this in vitro model. Dihydrotestosterone (10 nM) caused an absolute increase in both total (42.5 +/- 2.9 vs control 27.1 +/- 4.0 nmoles p-nitrophenol generated in 30 min/micrograms DNA, P less than .01) and tartrate-resistant acid phosphatase activity (34.1 +/- 1.5 vs control 17.2 +/- 2.8 U/micrograms DNA, P less than .05), and this effect was maximal on the 4th day of culture. This was the time when explant weight and DNA content tended to fall or only to be maintained by androgen. Similar changes were observed with the potent synthetic androgen, mibolerone. The addition of either the antiandrogen cyproterone acetate or flutamide in a 100-fold excess to that of androgen caused significant inhibition in acid phosphatase activity. No significant change was observed at low concentrations of estradiol or progesterone, and only minimal and inconsistent increases in activity were noted at high concentrations. No increase was noted when cortisol, cyproterone acetate, or flutamide was added to the media. We conclude that measurement of acid phosphatase activity in cultured explants of rat ventral prostate provides a biochemical marker of androgenicity that is more specific than measurement of [3H]-thymidine incorporation.

  20. A bacterial tyrosine phosphatase inhibits plant pattern recognition receptor activation.

    PubMed

    Macho, Alberto P; Schwessinger, Benjamin; Ntoukakis, Vardis; Brutus, Alexandre; Segonzac, Cécile; Roy, Sonali; Kadota, Yasuhiro; Oh, Man-Ho; Sklenar, Jan; Derbyshire, Paul; Lozano-Durán, Rosa; Malinovsky, Frederikke Gro; Monaghan, Jacqueline; Menke, Frank L; Huber, Steven C; He, Sheng Yang; Zipfel, Cyril

    2014-03-28

    Innate immunity relies on the perception of pathogen-associated molecular patterns (PAMPs) by pattern-recognition receptors (PRRs) located on the host cell's surface. Many plant PRRs are kinases. Here, we report that the Arabidopsis receptor kinase EF-TU RECEPTOR (EFR), which perceives the elf18 peptide derived from bacterial elongation factor Tu, is activated upon ligand binding by phosphorylation on its tyrosine residues. Phosphorylation of a single tyrosine residue, Y836, is required for activation of EFR and downstream immunity to the phytopathogenic bacterium Pseudomonas syringae. A tyrosine phosphatase, HopAO1, secreted by P. syringae, reduces EFR phosphorylation and prevents subsequent immune responses. Thus, host and pathogen compete to take control of PRR tyrosine phosphorylation used to initiate antibacterial immunity.

  1. Establishing Quantitative Standards for Residual Alkaline Phosphatase in Pasteurized Milk

    PubMed Central

    Chon, Jung-Whan; Kim, Hyunsook; Kim, Kwang-Yup

    2016-01-01

    The alkaline phosphatase (ALP) assay is a rapid and convenient method for verifying milk pasteurization. Since colorimetric ALP assays rely on subjective visual assessments, their results are especially unreliable near the detection limits. In this study, we attempted to establish quantitative criteria for residual ALP in milk by using a more objective method based on spectrophotometric measurements. Raw milk was heat-treated for 0, 10, 20, 30, and 40 min and then subjected to ALP assays. The quantitative criteria for residual ALP in the milk was determined as 2 μg phenol/mL of milk, which is just above the ALP value of milk samples heat-treated for 30 min. These newly proposed methodology and criteria could facilitate the microbiological quality control of milk. PMID:27194927

  2. [Cellular components and placental alkaline phosphatase in Trypanosoma cruzi infection ].

    PubMed

    Sartori, Maria José; Mezzano, Luciana; Lin, Susana; Repossi, Gastón; Fabro, Sofía P

    2005-01-01

    Trypanosoma cruzi induces changes in the protein pattern of human placenta syncytiotrophoblast. Placental alkaline phosphatase (PLAP) is a glycoenzyme anchored to the membrane by a glycosyl-phosphatidylinositol molecule. PLAP activity and its presence was altered by the parasite in cultures of human placental villi and HEp2 cells with T.cruzi. The cells treated before the cultures with agents which affect PILAP or glycosyl-phosphatidylinositol (antibodies, PL-C, genistein, lithium) presented less parasitic invasion than the control ones. It was also observed a modification in the pattern of actine filaments of the host cells infected. We concluded that PLAP would participate in the process of T. cruzi invasion into placental syncitiotrophoblast cells, by a mechanism that involves hydrolysis of the glycosyl-phosphatidylinositol molecules, the activation of tyrosine kinase proteins, the increase of cytosolic calcium and the rearrangement of actine filaments of the host cells.

  3. Biology of tartrate-resistant acid phosphatase.

    PubMed

    Lamp, E C; Drexler, H G

    2000-11-01

    Tartrate-resistant acid phosphatase (TRAP) is a member of the ubiquitously expressed enzyme family of the acid phosphatases. Nearly 30 years ago, TRAP became known to hematologists as cytochemical marker enzyme of hairy cell leukemia. Physiologically, TRAP is primarily a cytochemical marker of macrophages, osteoclasts and dendritic cells. TRAP is localized intracellularly in the lysosomal compartment. Recent data suggest also secretion of TRAP by some cell types, in particular by osteoclasts. Human, mouse and rat TRAP are biochemically well characterized. While the complete genomic sequence of TRAP has been elucidated, only limited information on the genetic details of the gene and its regulation is available. It appears that the intracellular iron content is involved in the regulation of the enzyme. The physiological substrates for this enzyme have not been identified yet and consequently the functional role of TRAP remains completely unknown, though some hypotheses have been forwarded, e.g. involvement in bone resorption and iron homeostasis (transport, metabolism). Taken together, research on the biology of TRAP has been intensive and has led to considerable progress on a number of fronts, including the cloning of the gene. Further studies are, however, still required to determine the role of TRAP in vivo.

  4. Protein Phosphatases and Alzheimer’s Disease

    PubMed Central

    Braithwaite, Steven P.; Stock, Jeffry B.; Lombroso, Paul J.; Nairn, Angus C.

    2013-01-01

    Alzheimer’s Disease (AD) is characterized by progressive loss of cognitive function, linked to marked neuronal loss. Pathological hallmarks of the disease are the accumulation of the amyloid-β (Aβ) peptide in the form of amyloid plaques and the intracellular formation of neurofibrillary tangles (NFTs). Accumulating evidence supports a key role for protein phosphorylation in both the normal and pathological actions of Aβ as well as the formation of NFTs. NFTs contain hyperphosphorylated forms of the microtubule-binding protein tau, and phosphorylation of tau by several different kinases leads to its aggregation. The protein kinases involved in the generation and/or actions of tau or Aβ are viable drug targets to prevent or alleviate AD pathology. However, it has also been recognized that the protein phosphatases that reverse the actions of these protein kinases are equally important. Here, we review recent advances in our understanding of serine/threonine and tyrosine protein phosphatases in the pathology of AD. PMID:22340724

  5. Genetic and chemical reductions in protein phosphatase activity alter auxin transport, gravity response, and lateral root growth

    NASA Technical Reports Server (NTRS)

    Rashotte, A. M.; DeLong, A.; Muday, G. K.; Brown, C. S. (Principal Investigator)

    2001-01-01

    Auxin transport is required for important growth and developmental processes in plants, including gravity response and lateral root growth. Several lines of evidence suggest that reversible protein phosphorylation regulates auxin transport. Arabidopsis rcn1 mutant seedlings exhibit reduced protein phosphatase 2A activity and defects in differential cell elongation. Here we report that reduced phosphatase activity alters auxin transport and dependent physiological processes in the seedling root. Root basipetal transport was increased in rcn1 or phosphatase inhibitor-treated seedlings but showed normal sensitivity to the auxin transport inhibitor naphthylphthalamic acid (NPA). Phosphatase inhibition reduced root gravity response and delayed the establishment of differential auxin-induced gene expression across a gravity-stimulated root tip. An NPA treatment that reduced basipetal transport in rcn1 and cantharidin-treated wild-type plants also restored a normal gravity response and asymmetric auxin-induced gene expression, indicating that increased basipetal auxin transport impedes gravitropism. Increased auxin transport in rcn1 or phosphatase inhibitor-treated seedlings did not require the AGR1/EIR1/PIN2/WAV6 or AUX1 gene products. In contrast to basipetal transport, root acropetal transport was normal in phosphatase-inhibited seedlings in the absence of NPA, although it showed reduced NPA sensitivity. Lateral root growth also exhibited reduced NPA sensitivity in rcn1 seedlings, consistent with acropetal transport controlling lateral root growth. These results support the role of protein phosphorylation in regulating auxin transport and suggest that the acropetal and basipetal auxin transport streams are differentially regulated.

  6. Mutagenesis of putative catalytic and regulatory residues of Streptomyces chromofuscus phospholipase D differentially modifies phosphatase and phosphodiesterase activities.

    PubMed

    Zambonelli, Carlo; Casali, Monica; Roberts, Mary F

    2003-12-26

    Phospholipase D from Streptomyces chromofuscus (sc-PLD) is a member of the diverse family of metallo-phosphodiesterase/phosphatase enzymes that also includes purple acid phosphatases, protein phosphatases, and nucleotide phosphodiesterases. Whereas iron is an essential cofactor for scPLD activity, Mn2+ is also found in the enzyme. A third metal ion, Ca2+, has been shown to enhance scPLD catalytic activity although it is not an essential cofactor. Sequence alignment of scPLD with known phosphodiesterases and phosphatases requiring metal ions suggested that His-212, Glu-213, and Asp-389 could be involved in Mn2+ binding. H212A, E213A, and D389A were prepared to test this hypothesis. These three mutant enzymes and wild type scPLD show similar metal content but considerably different catalytic properties, suggesting different roles for each residue. His-212 appears involved in binding the phosphate group of substrates, whereas Glu-213 acts as a ligand for Ca2+. D389A showed a greatly reduced phosphodiesterase activity but almost unaltered ability to hydrolyze the phosphate group in p-nitrophenyl phosphate suggesting it had a critical role in aligning groups at the active site to control phosphodiesterase versus phosphatase activities. We propose a model for substrate and cofactor binding to the catalytic site of scPLD based on these results and on sequence alignment to purple acid phosphatases of known structure.

  7. Genetic and chemical reductions in protein phosphatase activity alter auxin transport, gravity response, and lateral root growth

    NASA Technical Reports Server (NTRS)

    Rashotte, A. M.; DeLong, A.; Muday, G. K.; Brown, C. S. (Principal Investigator)

    2001-01-01

    Auxin transport is required for important growth and developmental processes in plants, including gravity response and lateral root growth. Several lines of evidence suggest that reversible protein phosphorylation regulates auxin transport. Arabidopsis rcn1 mutant seedlings exhibit reduced protein phosphatase 2A activity and defects in differential cell elongation. Here we report that reduced phosphatase activity alters auxin transport and dependent physiological processes in the seedling root. Root basipetal transport was increased in rcn1 or phosphatase inhibitor-treated seedlings but showed normal sensitivity to the auxin transport inhibitor naphthylphthalamic acid (NPA). Phosphatase inhibition reduced root gravity response and delayed the establishment of differential auxin-induced gene expression across a gravity-stimulated root tip. An NPA treatment that reduced basipetal transport in rcn1 and cantharidin-treated wild-type plants also restored a normal gravity response and asymmetric auxin-induced gene expression, indicating that increased basipetal auxin transport impedes gravitropism. Increased auxin transport in rcn1 or phosphatase inhibitor-treated seedlings did not require the AGR1/EIR1/PIN2/WAV6 or AUX1 gene products. In contrast to basipetal transport, root acropetal transport was normal in phosphatase-inhibited seedlings in the absence of NPA, although it showed reduced NPA sensitivity. Lateral root growth also exhibited reduced NPA sensitivity in rcn1 seedlings, consistent with acropetal transport controlling lateral root growth. These results support the role of protein phosphorylation in regulating auxin transport and suggest that the acropetal and basipetal auxin transport streams are differentially regulated.

  8. Multiple forms of phosphatase from human brain: isolation and partial characterization of affi-gel blue nonbinding phosphatase activities.

    PubMed

    Cheng, L Y; Wang, J Z; Gong, C X; Pei, J J; Zaidi, T; Grundke-Iqbal, I; Iqbal, K

    2001-04-01

    Phosphatases extracted from a human brain were resolved into two main groups, namely affi-gel blue-binding phosphatases and affi-gel blue-nonbinding phosphatases. Affi-gel blue binding phosphatases were further separated into four different phosphatase activities, designated P1-P4, and described previously. In the present study we describe the affi-gel blue-nonbinding phosphatases which were separated into seven different phosphatase activities, designated P5-P11 by poly-(L-lysine)-agarose and aminohexyl Sepharose 4B chromatographies. These seven phosphatase activities were active toward nonprotein phosphoester. P7-P11 and to some extent P5 could also dephosphorylate a phosphoprotein. They displayed different enzyme kinetics. On the basis of activity peak, the apparent molecular mass as estimated by Sephadex G-200 column chromatography for P5 was 49 kDa; P6, 32 kDa; P7, 150 kDa; P8, 250 kDa; P9, 165 kDa; P10, 90 kDa and P11, 165 kDa. Immunoblot analysis indicated that P8-P11 may belong to PP2B family, whereas P7 may associate with PP2A. The phosphatases P7-P11 were found to be effective in the dephosphorylation of Alzheimer's disease abnormally hyperphosphorylated tau. The resulting dephosphorylated tau regained its activity in promoting the microtubule assembly, suggesting that P7-P11 might regulate the phosphorylation of tau protein in the brain.

  9. Phosphatase Specificity and Pathway Insulation in Signaling Networks

    PubMed Central

    Rowland, Michael A.; Harrison, Brian; Deeds, Eric J.

    2015-01-01

    Phosphatases play an important role in cellular signaling networks by regulating the phosphorylation state of proteins. Phosphatases are classically considered to be promiscuous, acting on tens to hundreds of different substrates. We recently demonstrated that a shared phosphatase can couple the responses of two proteins to incoming signals, even if those two substrates are from otherwise isolated areas of the network. This finding raises a potential paradox: if phosphatases are indeed highly promiscuous, how do cells insulate themselves against unwanted crosstalk? Here, we use mathematical models to explore three possible insulation mechanisms. One approach involves evolving phosphatase KM values that are large enough to prevent saturation by the phosphatase’s substrates. Although this is an effective method for generating isolation, the phosphatase becomes a highly inefficient enzyme, which prevents the system from achieving switch-like responses and can result in slow response kinetics. We also explore the idea that substrate degradation can serve as an effective phosphatase. Assuming that degradation is unsaturatable, this mechanism could insulate substrates from crosstalk, but it would also preclude ultrasensitive responses and would require very high substrate turnover to achieve rapid dephosphorylation kinetics. Finally, we show that adaptor subunits, such as those found on phosphatases like PP2A, can provide effective insulation against phosphatase crosstalk, but only if their binding to substrates is uncoupled from their binding to the catalytic core. Analysis of the interaction network of PP2A’s adaptor domains reveals that although its adaptors may isolate subsets of targets from one another, there is still a strong potential for phosphatase crosstalk within those subsets. Understanding how phosphatase crosstalk and the insulation mechanisms described here impact the function and evolution of signaling networks represents a major challenge for

  10. Phosphatidate Phosphatase Activity Plays Key Role in Protection against Fatty Acid-induced Toxicity in Yeast*

    PubMed Central

    Fakas, Stylianos; Qiu, Yixuan; Dixon, Joseph L.; Han, Gil-Soo; Ruggles, Kelly V.; Garbarino, Jeanne; Sturley, Stephen L.; Carman, George M.

    2011-01-01

    The PAH1-encoded phosphatidate (PA) phosphatase in Saccharomyces cerevisiae is a pivotal enzyme that produces diacylglycerol for the synthesis of triacylglycerol (TAG) and simultaneously controls the level of PA used for phospholipid synthesis. Quantitative lipid analysis showed that the pah1Δ mutation caused a reduction in TAG mass and an elevation in the mass of phospholipids and free fatty acids, changes that were more pronounced in the stationary phase. The levels of unsaturated fatty acids in the pah1Δ mutant were unaltered, although the ratio of palmitoleic acid to oleic acid was increased with a similar change in the fatty acid composition of phospholipids. The pah1Δ mutant exhibited classic hallmarks of apoptosis in stationary phase and a marked reduction in the quantity of cytoplasmic lipid droplets. Cells lacking PA phosphatase were sensitive to exogenous fatty acids in the order of toxicity palmitoleic acid > oleic acid > palmitic acid. In contrast, the growth of wild type cells was not inhibited by fatty acid supplementation. In addition, wild type cells supplemented with palmitoleic acid exhibited an induction in PA phosphatase activity and an increase in TAG synthesis. Deletion of the DGK1-encoded diacylglycerol kinase, which counteracts PA phosphatase in controlling PA content, suppressed the defect in lipid droplet formation in the pah1Δ mutant. However, the sensitivity of the pah1Δ mutant to palmitoleic acid was not rescued by the dgk1Δ mutation. Overall, these findings indicate a key role of PA phosphatase in TAG synthesis for protection against fatty acid-induced toxicity. PMID:21708942

  11. A novel transmembrane Ser/Thr kinase complexes with protein phosphatase-1 and inhibitor-2.

    PubMed

    Wang, Hong; Brautigan, David L

    2002-12-20

    Protein kinases and protein phosphatases exert coordinated control over many essential cellular processes. Here, we describe the cloning and characterization of a novel human transmembrane protein KPI-2 (Kinase/Phosphatase/Inhibitor-2) that was identified by yeast two-hybrid using protein phosphatase inhibitor-2 (Inh2) as bait. KPI-2 mRNA was predominantly expressed in skeletal muscle. KPI-2 is a 1503-residue protein with two predicted transmembrane helices at the N terminus, a kinase domain, followed by a C-terminal domain. The transmembrane helices were sufficient for targeting proteins to the membrane. KPI-2 kinase domain has about 60% identity with its closest relative, a tyrosine kinase. However, it only exhibited serine/threonine kinase activity in autophosphorylation reactions or with added substrates. KPI-2 kinase domain phosphorylated protein phosphatase-1 (PP1C) at Thr(320), which attenuated PP1C activity. KPI-2 C-terminal domain directly associated with PP1C, and this required a VTF motif. Inh2 associated with KPI-2 C-terminal domain with and without PP1C. Thus, KPI-2 is a kinase with sites to associate with PP1C and Inh2 to form a regulatory complex that is localized to membranes.

  12. High osmolarity glycerol response PtcB phosphatase is important for Aspergillus fumigatus virulence.

    PubMed

    Winkelströter, Lizziane K; Bom, Vinícius Leite Pedro; de Castro, Patrícia Alves; Ramalho, Leandra Naira Zambelli; Goldman, Maria Helena S; Brown, Neil Andrew; Rajendran, Ranjith; Ramage, Gordon; Bovier, Elodie; Dos Reis, Thaila Fernanda; Savoldi, Marcela; Hagiwara, Daisuke; Goldman, Gustavo H

    2015-04-01

    Aspergillus fumigatus is a fungal pathogen that is capable of adapting to different host niches and to avoid host defenses. An enhanced understanding of how, and which, A. fumigatus signal transduction pathways are engaged in the regulation of these processes is essential for the development of improved disease control strategies. Protein phosphatases are central to numerous signal transduction pathways. To comprehend the functions of protein phosphatases in A. fumigatus, 32 phosphatase catalytic subunit encoding genes were identified. We have recognized PtcB as one of the phosphatases involved in the high osmolarity glycerol response (HOG) pathway. The ΔptcB mutant has both increased phosphorylation of the p38 MAPK (SakA) and expression of osmo-dependent genes. The ΔptcB strain was more sensitive to cell wall damaging agents, had increased chitin and β-1,3-glucan, and impaired biofilm formation. The ΔptcB strain was avirulent in a murine model of invasive pulmonary aspergillosis. These results stress the importance of the HOG pathway in the regulation of pathogenicity determinants and virulence in A. fumigatus.

  13. Phosphatidate phosphatase plays role in zinc-mediated regulation of phospholipid synthesis in yeast.

    PubMed

    Soto-Cardalda, Aníbal; Fakas, Stylianos; Pascual, Florencia; Choi, Hyeon-Son; Carman, George M

    2012-01-06

    In the yeast Saccharomyces cerevisiae, the synthesis of phospholipids is coordinately regulated by mechanisms that control the homeostasis of the essential mineral zinc (Carman, G.M., and Han, G. S. (2007) Regulation of phospholipid synthesis in Saccharomyces cerevisiae by zinc depletion. Biochim. Biophys. Acta 1771, 322-330; Eide, D. J. (2009) Homeostatic and adaptive responses to zinc deficiency in Saccharomyces cerevisiae. J. Biol. Chem. 284, 18565-18569). The synthesis of phosphatidylcholine is balanced by the repression of CDP-diacylglycerol pathway enzymes and the induction of Kennedy pathway enzymes. PAH1-encoded phosphatidate phosphatase catalyzes the penultimate step in triacylglycerol synthesis, and the diacylglycerol generated in the reaction may also be used for phosphatidylcholine synthesis via the Kennedy pathway. In this work, we showed that the expression of PAH1-encoded phosphatidate phosphatase was induced by zinc deficiency through a mechanism that involved interaction of the Zap1p zinc-responsive transcription factor with putative upstream activating sequence zinc-responsive elements in the PAH1 promoter. The pah1Δ mutation resulted in the derepression of the CHO1-encoded phosphatidylserine synthase (CDP-diacylglycerol pathway enzyme) and loss of the zinc-mediated regulation of the enzyme. Loss of phosphatidate phosphatase also resulted in the derepression of the CKI1-encoded choline kinase (Kennedy pathway enzyme) but decreased the synthesis of phosphatidylcholine when cells were deficient of zinc. This result confirmed the role phosphatidate phosphatase plays in phosphatidylcholine synthesis via the Kennedy pathway.

  14. Phosphatidate Phosphatase Plays Role in Zinc-mediated Regulation of Phospholipid Synthesis in Yeast*

    PubMed Central

    Soto-Cardalda, Aníbal; Fakas, Stylianos; Pascual, Florencia; Choi, Hyeon-Son; Carman, George M.

    2012-01-01

    In the yeast Saccharomyces cerevisiae, the synthesis of phospholipids is coordinately regulated by mechanisms that control the homeostasis of the essential mineral zinc (Carman, G.M., and Han, G. S. (2007) Regulation of phospholipid synthesis in Saccharomyces cerevisiae by zinc depletion. Biochim. Biophys. Acta 1771, 322–330; Eide, D. J. (2009) Homeostatic and adaptive responses to zinc deficiency in Saccharomyces cerevisiae. J. Biol. Chem. 284, 18565–18569). The synthesis of phosphatidylcholine is balanced by the repression of CDP-diacylglycerol pathway enzymes and the induction of Kennedy pathway enzymes. PAH1-encoded phosphatidate phosphatase catalyzes the penultimate step in triacylglycerol synthesis, and the diacylglycerol generated in the reaction may also be used for phosphatidylcholine synthesis via the Kennedy pathway. In this work, we showed that the expression of PAH1-encoded phosphatidate phosphatase was induced by zinc deficiency through a mechanism that involved interaction of the Zap1p zinc-responsive transcription factor with putative upstream activating sequence zinc-responsive elements in the PAH1 promoter. The pah1Δ mutation resulted in the derepression of the CHO1-encoded phosphatidylserine synthase (CDP-diacylglycerol pathway enzyme) and loss of the zinc-mediated regulation of the enzyme. Loss of phosphatidate phosphatase also resulted in the derepression of the CKI1-encoded choline kinase (Kennedy pathway enzyme) but decreased the synthesis of phosphatidylcholine when cells were deficient of zinc. This result confirmed the role phosphatidate phosphatase plays in phosphatidylcholine synthesis via the Kennedy pathway. PMID:22128164

  15. Identification of kinases, phosphatases, and phosphorylation sites in human and porcine spermatozoa.

    PubMed

    Lackey, Brett R; Gray, Sandra L

    2015-01-01

    Multiple inter-connected signaling pathways, involving kinases and phosphatases, form a framework that controls sperm motility, function, and fertilizing ability. Methods that give a broad view of the proteomic landscape may prove valuable in uncovering new crosstalk connections, as well as in discovering new proteins within this regulatory framework. A multi-immunoblotting strategy was utilized to evaluate this concept on human and porcine spermatozoa samples. In human and porcine spermatozoa, a diversity of kinases were identified including protein kinase A (PKA), protein kinase B (PKB), isoforms of protein kinase C (PKC), calmodulin-dependent kinases (CAMK), casein kinase (CK), and isoforms of glycogen synthase kinase (GSK3). Several phosphatases, such as protein phosphatase (PP)-1, PP2A, PP2C, and mitogen activated protein kinase (MAPK) phosphatase (MKP-1), were identified in human spermatozoa. The phosphorylation epitopes recognized belonged to members of the MAPK family, in addition to α and β isoforms of GSK3 and cAMP response element binding protein (CREB). Proteomic approaches that allow a broad view may aid in understanding the crosstalk between signaling systems in spermatozoal physiology.

  16. Online assay of bone specific alkaline phosphatase with a flow injection-bead injection system.

    PubMed

    Hartwell, Supaporn Kradtap; Somprayoon, Duangporn; Kongtawelert, Prachya; Ongchai, Siriwan; Arppornchayanon, Olarn; Ganranoo, Lucksagoon; Lapanantnoppakhun, Somchai; Grudpan, Kate

    2007-09-26

    Alkaline phosphatase (ALP) has been used as one of the biomarkers for bone resorption and liver diseases. Normally, total alkaline phosphatase is quantified along with other symptoms to determine the releasing source of the alkaline phosphatase. A semi-automated flow injection-bead injection system was proposed to conveniently and selectively assay bone alkaline phosphatase (BALP) based on its specific binding to wheat germ coated beads. Amount of BALP in serum was determined from the intensity of the yellow product produced from bound BALP on the retained beads and its substrate pNPP. The used beads were discarded and the fresh ones were introduced for the next analysis. The reaction cell was designed to be opened and closed using a computer controlled solenoid valve for a precise incubation time. The performance of the proposed system was evaluated by using it to assay BALP in human serum. The results were compared to those obtained by using a commercial ELISA kit. The system is proposed to be an easy and cost effective system for quantification of BALP as an alternative to batch wise wheat germ specific binding technique.

  17. Distinct phosphatase activity profiles in two strains of Trypanosoma cruzi.

    PubMed

    Morales-Neto, R; Hulshof, L; Ferreira, C V; Gadelha, F R

    2009-12-01

    Phosphorylation of parasite proteins plays a key role in the process of cell invasion by Trypanosoma cruzi, the etiologic agent of Chagas' disease. In this sense, characterization of parasite kinases and phosphatases could open new possibilities for the rational design of chemotherapeutic agents for the treatment of Chagas' disease. In this work, we analyzed phosphatase activities in T. cruzi homogenates from 2 strains belonging to different lineages and with different resistance to oxidative stress. Tulahuen 2 cells (Lineage I) showed higher phosphatase activities and specificity constants when compared to the Y strain (Lineage II). Tulahuen 2 had an optimum phosphatase activity at pH 4.0 and the Y strain at pH 7.0. In both cases, neutral–basic, but not acid, phosphatase activities were increased in the presence of Mg2+. Although calcium had an inhibitory effect at a pH of 7.0 and 8.0 in the Y strain, this inhibition was restricted to pH 8.0 in the other strain. Different substrates and acid phosphotyrosine and alkaline phosphatase inhibitors exhibited distinct effects on the phosphatase activity of both strains. Our results provide a better understanding of T. cruzi phosphatases and reinforce the notion of heterogeneity among T. cruzi populations.

  18. A remote CheZ orthologue retains phosphatase function.

    PubMed

    Lertsethtakarn, Paphavee; Ottemann, Karen M

    2010-07-01

    Aspartyl-phosphate phosphatases underlie the rapid responses of bacterial chemotaxis. One such phosphatase, CheZ, was originally proposed to be restricted to beta and gamma proteobacter, suggesting only a small subset of microbes relied on this protein. A putative CheZ phosphatase was identified genetically in the epsilon proteobacter Helicobacter pylori (Mol Micro 61:187). H. pylori utilizes a chemotaxis system consisting of CheAY, three CheVs, CheW, CheY(HP) and the putative CheZ to colonize the host stomach. Here we investigate whether this CheZ has phosphatase activity. We phosphorylated potential targets in vitro using either a phosphodonor or the CheAY kinase and [gamma-(32)P]-ATP, and found that H. pylori CheZ (CheZ(HP)) efficiently dephosphorylates CheY(HP) and CheAY and has additional weak activity on CheV2. We detected no phosphatase activity towards CheV1 or CheV3. Mutations corresponding to Escherichia coli CheZ active site residues or deletion of the C-terminal region inactivate CheZ(HP) phosphatase activity, suggesting the two CheZs function similarly. Bioinformatics analysis suggests that CheZ phosphatases are found in all proteobacteria classes, as well as classes Aquificae, Deferribacteres, Nitrospira and Sphingobacteria, demonstrating that CheZ phosphatases are broadly distributed within Gram-negative bacteria.

  19. Characterization of DNA Substrate Binding to the Phosphatase Domain of the DNA Repair Enzyme Polynucleotide Kinase/Phosphatase.

    PubMed

    Havali-Shahriari, Zahra; Weinfeld, Michael; Glover, J N Mark

    2017-03-28

    Polynucleotide kinase/phosphatase (PNKP) is a DNA strand break repair enzyme that uses separate 5' kinase and 3' phosphatase active sites to convert damaged 5'-hydroxyl/3'-phosphate strand termini to ligatable 5'-phosphate/3'-hydroxyl ends. The phosphatase active site has received particular attention as a target of inhibition in cancer therapy development. The phosphatase domain dephosphorylates a range of single- and double-stranded substrates; however, structural studies have shown that the phosphatase catalytic cleft can bind only single-stranded substrates. Here we use a catalytically inactive but structurally intact phosphatase mutant to probe interactions between PNKP and a variety of single- and double-stranded DNA substrates using an electrophoretic mobility shift assay. This work indicates that the phosphatase domain binds 3'-phosphorylated single-stranded DNAs in a manner that is highly dependent on the presence of the 3'-phosphate. Double-stranded substrate binding, in contrast, is not as dependent on the 3'-phosphate. Experiments comparing blunt-end, 3'-overhanging, and frayed-end substrates indicate that the predicted loss of energy due to base pair disruption upon binding of the phosphatase active site is likely balanced by favorable interactions between the liberated complementary strand and PNKP. Comparison of the effects on substrate binding of mutations within the phosphatase active site cleft with mutations in surrounding positively charged surfaces suggests that the surrounding surfaces are important for binding to double-stranded substrates. We further show that while fluorescence polarization methods can detect specific binding of single-stranded DNAs with the phosphatase domain, this method does not detect specific interactions between the PNKP phosphatase and double-stranded substrates.

  20. Mutations responsible for 3-phosphoserine phosphatase deficiency.

    PubMed

    Veiga-da-Cunha, Maria; Collet, Jean-François; Prieur, Benoît; Jaeken, Jaak; Peeraer, Yves; Rabbijns, Anja; Van Schaftingen, Emile

    2004-02-01

    We report the identification of the mutations in the only known case of L-3-phosphoserine phosphatase deficiency, a recessively inherited condition. The two mutations correspond to the replacement of the semiconserved Asp32 residue by an asparagine and of the extremely conserved Met52 by a threonine. The effects of both mutations were studied on the human recombinant enzyme, expressed in Escherichia coli. Met52Thr almost abolished the enzymatic activity, whereas the Asp32Asn mutation caused a 50% decrease in Vmax. In addition, L-serine, which inhibits the conversion of [(14)C] phosphoserine to serine when catalysed by the wild-type enzyme, had a lesser inhibitory effect on the Asp32Asn mutant, indicating a reduction in the rate of phosphoenzyme hydrolysis. These modifications in the properties of the enzyme are consistent with the modification in the kinetic properties observed in fibroblasts from the patient.

  1. Inhibition of renal alkaline phosphatase by cimetidine.

    PubMed

    Minai-Tehrani, Dariush; Khodai, Somayeh; Aminnaseri, Somayeh; Minoui, Saeed; Sobhani-Damavadifar, Zahra; Alavi, Sana; Osmani, Raheleh; Ahmadi, Shiva

    2011-08-01

    Alkaline phosphatase (ALP) belongs to hydrolase group of enzymes. It is responsible for removing phosphate groups from many types of molecules, including nucleotides and proteins. Cimetidine (trade name Tagamet) is an antagonist of histamine H2-receptor that inhibits the production of gastric acid. Cimetidine is used for the treatment of gastrointestinal diseases. In this study the inhibitory effect of cimetidine on mouse renal ALP activity was investigated. Our results showed that cimetidine can inhibit ALP by uncompetitive inhibition. In the absence of inhibitor the V(max) and K(m) of the enzyme were found to be 13.7 mmol/mg prot.min and 0.25 mM, respectively. Both the Vmax and Km of the enzyme decreased with increasing cimetidine concentrations (0- 1.2 mM). The Ki and IC(50) of cimetidine were determined to be about 0.5 mM and 0.52 mM, respectively.

  2. Functional characterization of lysophosphatidic acid phosphatase from Arabidopsis thaliana.

    PubMed

    Reddy, Venky Sreedhar; Rao, D K Venkata; Rajasekharan, Ram

    2010-04-01

    Lysophosphatidic acid (LPA) acts as a signaling molecule that regulates diverse cellular processes and it can rapidly be metabolized by phosphatase and acyltransferase. LPA phosphatase gene has not been identified and characterized in plants so far. The BLAST search revealed that the At3g03520 is similar to phospholipase family, and distantly related to bacterial phosphatases. The conserved motif, (J)4XXXNXSFD, was identified in both At3g03520 like phospholipases and acid phosphatases. In silico expression analysis of At3g03520 revealed a high expression during phosphate starvation and abiotic stresses. This gene was overexpressed in Escherichia coli and shown to posses LPA specific phosphatase activity. These results suggest that this gene possibly plays a role in signal transduction and storage lipid synthesis.

  3. Phosphoglucan phosphatase function sheds light on starch degradation.

    PubMed

    Silver, Dylan M; Kötting, Oliver; Moorhead, Greg B G

    2014-07-01

    Phosphoglucan phosphatases are novel enzymes that remove phosphates from complex carbohydrates. In plants, these proteins are vital components in the remobilization of leaf starch at night. Breakdown of starch is initiated through reversible glucan phosphorylation to disrupt the semi-crystalline starch structure at the granule surface. The phosphoglucan phosphatases starch excess 4 (SEX4) and like-SEX4 2 (LSF2) dephosphorylate glucans to provide access for amylases that release maltose and glucose from starch. Another phosphatase, LSF1, is a putative inactive scaffold protein that may act as regulator of starch degradative enzymes at the granule surface. Absence of these phosphatases disrupts starch breakdown, resulting in plants accumulating excess starch. Here, we describe recent advances in understanding the biochemical and structural properties of each of these starch phosphatases.

  4. [Roles of phosphatases in pathogen infection: a review].

    PubMed

    Zhu, Pei; Li, Xinqiang; Li, Zhenlun

    2012-02-01

    Phosphatases play a key role not only in cell physiological functions of an organism, but also in host-pathogen interactions. Many studies demonstrated that some Gram-negative pathogenic bacteria could evade host immunity and promote pathogenicity by injecting phosphatases into host cells through type III secretion system. However, there were few reports about pathogenic fungi evading the immunity of hosts. Our researches indicated that the entomogenic fungus Metarhizium anisopliae could dephosphorylate the signal transduction substance of locust humoral immunity specifically in vitro by secreting extracellular protein tyrosine phosphatase, which implied that the fungus might interfere with the immune defense of locust. To provide reference for further studies of the functions of phosphatases, we reviewed the types of phosphatases and their roles in pathogen infection.

  5. Mechanism of the phosphatase component of Clostridium thermocellum polynucleotide kinase-phosphatase.

    PubMed

    Keppetipola, Niroshika; Shuman, Stewart

    2006-01-01

    Polynucleotide kinase-phosphatase (Pnkp) from Clostridium thermocellum catalyzes ATP-dependent phosphorylation of 5'-OH termini of DNA or RNA polynucleotides and Ni(2+)/Mn(2+)-dependent dephosphorylation of 2',3' cyclic phosphate, 2'-phosphate, and 3'-phosphate ribonucleotides. CthPnkp is an 870-amino-acid polypeptide composed of three domains: an N-terminal module similar to bacteriophage T4 polynucleotide kinase, a central module that resembles the dinuclear metallo-phosphoesterase superfamily, and a C-terminal ligase-like adenylyltransferase domain. Here we conducted a mutational analysis of CthPnkp that identified 11 residues required for Ni(2+)-dependent phosphatase activity with 2'-AMP and 3'-AMP. Eight of the 11 CthPnkp side chains were also required for Ni(2+)-dependent hydrolysis of p-nitrophenyl phosphate. The ensemble of essential side chains includes the conserved counterparts (Asp187, His189, Asp233, Arg237, Asn263, His264, His323, His376, and Asp392 in CthPnkp) of all of the amino acids that form the dinuclear metal-binding site and the phosphate-binding site of bacteriophage lambda phosphatase. Three residues (Asp236, His264, and Arg237) required for activity with 2'-AMP or 3'-AMP were dispensable for Ni(2+)-dependent hydrolysis of p-nitrophenyl phosphate. Our findings, together with available structural information, provide fresh insights to the metallophosphoesterase mechanism, including the roles of His264 and Asp236 in proton donation to the leaving group. Deletion analysis defined an autonomous phosphatase domain, CthPnkp-(171-424).

  6. Functional interrelationships in the alkaline phosphatase superfamily: phosphodiesterase activity of Escherichia coli alkaline phosphatase.

    PubMed

    O'Brien, P J; Herschlag, D

    2001-05-15

    Escherichia coli alkaline phosphatase (AP) is a proficient phosphomonoesterase with two Zn(2+) ions in its active site. Sequence homology suggests a distant evolutionary relationship between AP and alkaline phosphodiesterase/nucleotide pyrophosphatase, with conservation of the catalytic metal ions. Furthermore, many other phosphodiesterases, although not evolutionarily related, have a similar active site configuration of divalent metal ions in their active sites. These observations led us to test whether AP could also catalyze the hydrolysis of phosphate diesters. The results described herein demonstrate that AP does have phosphodiesterase activity: the phosphatase and phosphodiesterase activities copurify over several steps; inorganic phosphate, a strong competitive inhibitor of AP, inhibits the phosphodiesterase and phosphatase activities with the same inhibition constant; a point mutation that weakens phosphate binding to AP correspondingly weakens phosphate inhibition of the phosphodiesterase activity; and mutation of active site residues substantially reduces both the mono- and diesterase activities. AP accelerates the rate of phosphate diester hydrolysis by 10(11)-fold relative to the rate of the uncatalyzed reaction [(k(cat)/K(m))/k(w)]. Although this rate enhancement is substantial, it is at least 10(6)-fold less than the rate enhancement for AP-catalyzed phosphate monoester hydrolysis. Mutational analysis suggests that common active site features contribute to hydrolysis of both phosphate monoesters and phosphate diesters. However, mutation of the active site arginine to serine, R166S, decreases the monoesterase activity but not the diesterase activity, suggesting that the interaction of this arginine with the nonbridging oxygen(s) of the phosphate monoester substrate provides a substantial amount of the preferential hydrolysis of phosphate monoesters. The observation of phosphodiesterase activity extends the previous observation that AP has a low level of

  7. Counteracting Protein Kinase Activity in the Heart: The Multiple Roles of Protein Phosphatases

    PubMed Central

    Weber, Silvio; Meyer-Roxlau, Stefanie; Wagner, Michael; Dobrev, Dobromir; El-Armouche, Ali

    2015-01-01

    Decades of cardiovascular research have shown that variable and flexible levels of protein phosphorylation are necessary to maintain cardiac function. A delicate balance between phosphorylated and dephosphorylated states of proteins is guaranteed by a complex interplay of protein kinases (PKs) and phosphatases. Serine/threonine phosphatases, in particular members of the protein phosphatase (PP) family govern dephosphorylation of the majority of these cardiac proteins. Recent findings have however shown that PPs do not only dephosphorylate previously phosphorylated proteins as a passive control mechanism but are capable to actively control PK activity via different direct and indirect signaling pathways. These control mechanisms can take place on (epi-)genetic, (post-)transcriptional, and (post-)translational levels. In addition PPs themselves are targets of a plethora of proteinaceous interaction partner regulating their endogenous activity, thus adding another level of complexity and feedback control toward this system. Finally, novel approaches are underway to achieve spatiotemporal pharmacologic control of PPs which in turn can be used to fine-tune misleaded PK activity in heart disease. Taken together, this review comprehensively summarizes the major aspects of PP-mediated PK regulation and discusses the subsequent consequences of deregulated PP activity for cardiovascular diseases in depth. PMID:26617522

  8. Extremely high maternal alkaline phosphatase serum concentration with syncytiotrophoblastic origin

    PubMed Central

    Boronkai, A; Than, N G; Magenheim, R; Bellyei, S; Szigeti, A; Deres, P; Hargitai, B; Sumegi, B; Papp, Z; Rigo, J

    2005-01-01

    An extremely high alkaline phosphatase (AP) concentration (3609 IU/litre) was found in a 20 year old primigravida at 37 week’s gestation, prompting an examination of its histological and cellular origin. Immunohistochemistry and western blots using antibodies against AP, Ki-67, phospho-protein kinase B (Akt), phospho-p44/42 mitogen activated protein kinase/extracellular signal regulated kinase 1/2 (MAPK/Erk1/2), phospho-glycogen synthase kinase-3β (GSK-3β), phospho-stress activated protein kinase/c-Jun N-terminal kinase, total-Akt, total-GSK-3β, and phospho-p38-MAPK were carried out on index and control placental samples of the same gestational age. Compared with controls, staining of the index placenta showed minimal AP labelling of the brush border and remarkable positivity of the intervillous space. Cytotrophoblastic proliferation was 8–10% in the index placenta compared with 1–2% in controls. The index placenta also had raised concentrations of protein kinases with important roles in cell differentiation. The proliferation and differentiation rates of the cytotrophoblasts were found to be five times higher in index samples than in controls. It is hypothesised that loss of syncytial membranes in immature villi led to increased AP concentrations in the maternal circulation and decreased AP staining of the placenta. Loss of the syncytium might also stimulate increased proliferation of villous cytotrophoblasts, which would then fuse and maintain the syncytium. PMID:15623487

  9. Phosphatidylinositol anchor of HeLa cell alkaline phosphatase

    SciTech Connect

    Jemmerson, R.; Low, M.G.

    1987-09-08

    Alkaline phosphatase from cancer cells, HeLa TCRC-1, was biosynthetically labeled with either /sup 3/H-fatty acids or (/sup 3/H)ethanolamine as analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and fluorography of immunoprecipitated material. Phosphatidylinositol-specific phospholipase C (PI-PLC) released a substantial proportion of the /sup 3/H-fatty acid label from immunoaffinity-purified alkaline phosphatase but had no effect on the radioactivity of (/sup 3/H)ethanolamine-labeled material. PI-PLC also liberated catalytically active alkaline phosphatase from viable cells, and this could be selectively blocked by monoclonal antibodies to alkaline phosphatase. However, the alkaline phosphatase released from /sup 3/H-fatty acid labeled cells by PI-PLC was not radioactive. By contrast, treatment with bromelain removed both the /sup 3/H-fatty acid and the (/sup 3/H)ethanolamine label from purified alkaline phosphatase. Subtilisin was also able to remove the (/sup 3/H)ethanolamine label from the purified alkaline phosphatase. The /sup 3/H radioactivity in alkaline phosphatase purified from (/sup 3/H)ethanolamine-labeled cells comigrated with authentic (/sup 3/H)ethanolamine by anion-exchange chromatography after acid hydrolysis. The data suggest that the /sup 3/H-fatty acid and (/sup 3/H)ethanolamine are covalently attached to the carboxyl-terminal segment since bromelain and subtilisin both release alkaline phosphatase from the membrane by cleavage at that end of the polypeptide chain. The data are consistent with findings for other proteins recently shown to be anchored in the membrane through a glycosylphosphatidylinositol structure and indicate that a similar structure contributes to the membrane anchoring of alkaline phosphatase.

  10. Direct determination of phosphatase activity from physiological substrates in cells.

    PubMed

    Ren, Zhongyuan; Do, Le Duy; Bechkoff, Géraldine; Mebarek, Saida; Keloglu, Nermin; Ahamada, Saandia; Meena, Saurabh; Magne, David; Pikula, Slawomir; Wu, Yuqing; Buchet, René

    2015-01-01

    A direct and continuous approach to determine simultaneously protein and phosphate concentrations in cells and kinetics of phosphate release from physiological substrates by cells without any labeling has been developed. Among the enzymes having a phosphatase activity, tissue non-specific alkaline phosphatase (TNAP) performs indispensable, multiple functions in humans. It is expressed in numerous tissues with high levels detected in bones, liver and neurons. It is absolutely required for bone mineralization and also necessary for neurotransmitter synthesis. We provided the proof of concept that infrared spectroscopy is a reliable assay to determine a phosphatase activity in the osteoblasts. For the first time, an overall specific phosphatase activity in cells was determined in a single step by measuring simultaneously protein and substrate concentrations. We found specific activities in osteoblast like cells amounting to 116 ± 13 nmol min(-1) mg(-1) for PPi, to 56 ± 11 nmol min(-1) mg(-1) for AMP, to 79 ± 23 nmol min(-1) mg(-1) for beta-glycerophosphate and to 73 ± 15 nmol min(-1) mg(-1) for 1-alpha-D glucose phosphate. The assay was also effective to monitor phosphatase activity in primary osteoblasts and in matrix vesicles. The use of levamisole--a TNAP inhibitor--served to demonstrate that a part of the phosphatase activity originated from this enzyme. An IC50 value of 1.16 ± 0.03 mM was obtained for the inhibition of phosphatase activity of levamisole in osteoblast like cells. The infrared assay could be extended to determine any type of phosphatase activity in other cells. It may serve as a metabolomic tool to monitor an overall phosphatase activity including acid phosphatases or other related enzymes.

  11. A loss-of-function screen for phosphatases that regulate neurite outgrowth identifies PTPN12 as a negative regulator of TrkB tyrosine phosphorylation.

    PubMed

    Ambjørn, Malene; Dubreuil, Véronique; Miozzo, Federico; Nigon, Fabienne; Møller, Bente; Issazadeh-Navikas, Shohreh; Berg, Jacob; Lees, Michael; Sap, Jan

    2013-01-01

    Alterations in function of the neurotrophin BDNF are associated with neurodegeneration, cognitive decline, and psychiatric disorders. BDNF promotes axonal outgrowth and branching, regulates dendritic tree morphology and is important for axonal regeneration after injury, responses that largely result from activation of its tyrosine kinase receptor TrkB. Although intracellular neurotrophin (NT) signaling presumably reflects the combined action of kinases and phosphatases, little is known about the contributions of the latter to TrkB regulation. The issue is complicated by the fact that phosphatases belong to multiple independently evolved families, which are rarely studied together. We undertook a loss-of-function RNA-interference-based screen of virtually all known (254) human phosphatases to understand their function in BDNF/TrkB-mediated neurite outgrowth in differentiated SH-SY5Y cells. This approach identified phosphatases from diverse families, which either positively or negatively modulate BDNF-TrkB-mediated neurite outgrowth, and most of which have little or no previously established function related to NT signaling. "Classical" protein tyrosine phosphatases (PTPs) accounted for 13% of the candidate regulatory phosphatases. The top classical PTP identified as a negative regulator of BDNF-TrkB-mediated neurite outgrowth was PTPN12 (also called PTP-PEST). Validation and follow-up studies showed that endogenous PTPN12 antagonizes tyrosine phosphorylation of TrkB itself, and the downstream activation of ERK1/2. We also found PTPN12 to negatively regulate phosphorylation of p130cas and FAK, proteins with previously described functions related to cell motility and growth cone behavior. Our data provide the first comprehensive survey of phosphatase function in NT signaling and neurite outgrowth. They reveal the complexity of phosphatase control, with several evolutionarily unrelated phosphatase families cooperating to affect this biological response, and hence the

  12. A Loss-of-Function Screen for Phosphatases that Regulate Neurite Outgrowth Identifies PTPN12 as a Negative Regulator of TrkB Tyrosine Phosphorylation

    PubMed Central

    Ambjørn, Malene; Dubreuil, Véronique; Miozzo, Federico; Nigon, Fabienne; Møller, Bente; Issazadeh-Navikas, Shohreh; Berg, Jacob; Lees, Michael; Sap, Jan

    2013-01-01

    Alterations in function of the neurotrophin BDNF are associated with neurodegeneration, cognitive decline, and psychiatric disorders. BDNF promotes axonal outgrowth and branching, regulates dendritic tree morphology and is important for axonal regeneration after injury, responses that largely result from activation of its tyrosine kinase receptor TrkB. Although intracellular neurotrophin (NT) signaling presumably reflects the combined action of kinases and phosphatases, little is known about the contributions of the latter to TrkB regulation. The issue is complicated by the fact that phosphatases belong to multiple independently evolved families, which are rarely studied together. We undertook a loss-of-function RNA-interference-based screen of virtually all known (254) human phosphatases to understand their function in BDNF/TrkB-mediated neurite outgrowth in differentiated SH-SY5Y cells. This approach identified phosphatases from diverse families, which either positively or negatively modulate BDNF-TrkB-mediated neurite outgrowth, and most of which have little or no previously established function related to NT signaling. “Classical” protein tyrosine phosphatases (PTPs) accounted for 13% of the candidate regulatory phosphatases. The top classical PTP identified as a negative regulator of BDNF-TrkB-mediated neurite outgrowth was PTPN12 (also called PTP-PEST). Validation and follow-up studies showed that endogenous PTPN12 antagonizes tyrosine phosphorylation of TrkB itself, and the downstream activation of ERK1/2. We also found PTPN12 to negatively regulate phosphorylation of p130cas and FAK, proteins with previously described functions related to cell motility and growth cone behavior. Our data provide the first comprehensive survey of phosphatase function in NT signaling and neurite outgrowth. They reveal the complexity of phosphatase control, with several evolutionarily unrelated phosphatase families cooperating to affect this biological response, and hence

  13. Different designs of kinase-phosphatase interactions and phosphatase sequestration shapes the robustness and signal flow in the MAPK cascade

    PubMed Central

    2012-01-01

    Background The three layer mitogen activated protein kinase (MAPK) signaling cascade exhibits different designs of interactions between its kinases and phosphatases. While the sequential interactions between the three kinases of the cascade are tightly preserved, the phosphatases of the cascade, such as MKP3 and PP2A, exhibit relatively diverse interactions with their substrate kinases. Additionally, t